Short hairpin RNA interference therapy for ischemic heart disease.

PubMed

Huang, Mei; Chan, Denise A; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C; Chen, Xiaoyuan; Giaccia, Amato J; Wu, Joseph C

2008-09-30

During hypoxia, upregulation of hypoxia inducible factor-1 alpha transcriptional factor can activate several downstream angiogenic genes. However, hypoxia inducible factor-1 alpha is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. PHD2 was cloned from mouse embryonic stem cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter followed by a separate hypoxia response element-incorporated promoter driving a firefly luciferase reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared with the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of hypoxia inducible factor-1 alpha protein and several downstream angiogenic genes by >30% (P<0.01). Afterward, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending artery in mice. Animals were randomized into shPHD2 experimental group (n=25) versus shScramble control group (n=20). Bioluminescence imaging detected plasmid-mediated transgene expression for 4 to 5 weeks. Echocardiography showed the shPHD2 group had improved fractional shortening compared with the shScramble group at Week 4 (33.7%+/-1.9% versus 28.4%+/-2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot analysis of explanted hearts also confirmed that animals treated with shPHD2 had significantly higher levels of hypoxia inducible factor-1 alpha protein. This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by shRNA led to significant improvement in angiogenesis and contractility by in vitro and in vivo experiments. With further validation, the combination of shRNA therapy and molecular imaging can be used to track novel cardiovascular gene therapy applications in the future.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Flanagan, Sheryl A., E-mail: sflan@umich.edu; Cooper, Kristin S.; Mannava, Sudha

Purpose: To determine the effect of short hairpin ribonucleic acid (shRNA)-mediated suppression of thymidylate synthase (TS) on cytotoxicity and radiosensitization and the mechanism by which these events occur. Methods and Materials: shRNA suppression of TS was compared with 5-fluoro-2 Prime -deoxyuridine (FdUrd) inactivation of TS with or without ionizing radiation in HCT116 and HT29 colon cancer cells. Cytotoxicity and radiosensitization were measured by clonogenic assay. Cell cycle effects were measured by flow cytometry. The effects of FdUrd or shRNA suppression of TS on dNTP deoxynucleotide triphosphate imbalances and consequent nucleotide misincorporations into deoxyribonucleic acid (DNA) were analyzed by high-pressure liquidmore » chromatography and as pSP189 plasmid mutations, respectively. Results: TS shRNA produced profound ({>=}90%) and prolonged ({>=}8 days) suppression of TS in HCT116 and HT29 cells, whereas FdUrd increased TS expression. TS shRNA also produced more specific and prolonged effects on dNTPs deoxynucleotide triphosphates compared with FdUrd. TS shRNA suppression allowed accumulation of cells in S-phase, although its effects were not as long-lasting as those of FdUrd. Both treatments resulted in phosphorylation of Chk1. TS shRNA alone was less cytotoxic than FdUrd but was equally effective as FdUrd in eliciting radiosensitization (radiation enhancement ratio: TS shRNA, 1.5-1.7; FdUrd, 1.4-1.6). TS shRNA and FdUrd produced a similar increase in the number and type of pSP189 mutations. Conclusions: TS shRNA produced less cytotoxicity than FdUrd but was equally effective at radiosensitizing tumor cells. Thus, the inhibitory effect of FdUrd on TS alone is sufficient to elicit radiosensitization with FdUrd, but it only partially explains FdUrd-mediated cytotoxicity and cell cycle inhibition. The increase in DNA mismatches after TS shRNA or FdUrd supports a causal and sufficient role for the depletion of dTTP thymidine triphosphate and consequent DNA mismatches underlying radiosensitization. Importantly, shRNA suppression of TS avoids FP-mediated TS elevation and its negative prognostic role. These studies support the further exploration of TS suppression as a novel radiosensitizing strategy.« less

MISSION LentiPlex pooled shRNA library screening in mammalian cells.

PubMed

Coussens, Matthew J; Corman, Courtney; Fischer, Ashley L; Sago, Jack; Swarthout, John

2011-12-21

RNA interference (RNAi) is an intrinsic cellular mechanism for the regulation of gene expression. Harnessing the innate power of this system enables us to knockdown gene expression levels in loss of gene function studies. There are two main methods for performing RNAi. The first is the use of small interfering RNAs (siRNAs) that are chemically synthesized, and the second utilizes short-hairpin RNAs (shRNAs) encoded within plasmids. The latter can be transfected into cells directly or packaged into replication incompetent lentiviral particles. The main advantages of using lentiviral shRNAs is the ease of introduction into a wide variety of cell types, their ability to stably integrate into the genome for long term gene knockdown and selection, and their efficacy in conducting high-throughput loss of function screens. To facilitate this we have created the LentiPlex pooled shRNA library. The MISSION LentiPlex Human shRNA Pooled Library is a genome-wide lentiviral pool produced using a proprietary process. The library consists of over 75,000 shRNA constructs from the TRC collection targeting 15,000+ human genes. Each library is tested for shRNA representation before product release to ensure robust library coverage. The library is provided in a ready-to-use lentiviral format at titers of at least 5 x 10(8) TU/ml via p24 assay and is pre-divided into ten subpools of approximately 8,000 shRNA constructs each. Amplification and sequencing primers are also provided for downstream target identification. Previous studies established a synergistic antitumor activity of TRAIL when combined with Paclitaxel in A549 cells, a human lung carcinoma cell line. In this study we demonstrate the application of a pooled LentiPlex shRNA library to rapidly conduct a positive selection screen for genes involved in the cytotoxicity of A549 cells when exposed to TRAIL and Paclitaxel. One barrier often encountered with high-throughput screens is the cost and difficulty in deconvolution; we also detail a cost-effective polyclonal approach utilizing traditional sequencing.

[Inhibitory effect of migration-inducing gene-7-shRNA recombinant retrovirus combined with endostatin on growth and metastasis of hepatoma xenograft].

PubMed

Qu, B; Chen, G N; Sheng, G N; Yu, F; Lyu, Q; Gu, Y J; Guo, L; Lyu, Y

2016-09-20

Objective: To investigate the inhibitory effect of migration-inducing gene-7(Mig-7)interfered with retrovirus-mediated RNA(shRNA)combined with recombinant human endostatin(ES)on the growth and metastasis of subcutaneous xenograft of human hepatoma cells in nude mice. Methods: Two Mig-7-mRNA oligonucleotide sequences(Mig-7-shRNA-1 and Mig-7-shRNA-2)and one sequence as a negative control(Mig-7-shRNA-N)were designed. The specific Mig-7-shRNA recombinant retrovirus expression vector plasmid was constructed and used for the transfection of human hepatoma MHCC-97H cells with high expression of Mig-7. The subcutaneous xenograft tumor model of human hepatocellular carcinoma(HCC)in nude mice was established, and according to the condition of transfection and administration, the nude mice were divided into pSIREN-M1 group, pSIREN-MN group, ES group, and pSIREN-M1+ES group. The xenograft tumor volume, mass, and metastasis were compared between groups. Immunohistochemistry was used to observe the formation of vasculogenic mimicry(VM)in xenograft tumor and the difference in tumor microvascular density(MVD), and Western blot was used to measure the expression of Mig-7 and vascular endothelial growth factor(VEGF)in each group. A one-way analysis of variance was used for comparison between groups, and the Fisher's exact test was used for comparison of continuous data between groups. Results: Compared with the pSIREN-MN group, the pSIREN-M1 group had significantly lower xenograft tumor volume, mass, and metastasis rate, Mig-7 expression, and formation of VM( P < 0.05), as well as significantly higher VEGF expression and MVD( P < 0.05). Compared with the pSIREN-MN group, the ES group had significantly lower xenograft tumor volume, mass, and metastasis rate, VEGF expression, and MVD( P < 0.05), as well as significantly higher Mig-7 expression and formation of VM( P < 0.05). Compared with the pSIREN-M1 group and the ES group, the pSIREN-M1+ES group had significantly lower xenograft tumor volume, mass, and metastasis rate, Mig-7 expression, formation of VM, VEGF expression, and MVD( P < 0.05). Conclusion: Mig-7-shRNA recombinant retrovirus combined with ES has a better inhibitory effect on the growth and metastasis of HCC xenograft tumor than Mig-7-shRNA recombinant retrovirus or ES alone. The anti-tumor angiogenesis therapy alone, which targets vascular endothelial cells in vivo, has a limited effect, since it may promote the formation of VM.

[The influence with block the endotoxin signal transduction for ischemia/reperfusion injury of graft liver in rats].

PubMed

Liu, Zuo-jin; Li, Sheng-wei; Li, Xu-hong; Peng, Yong; You, Hai-bo; Li, Shou-bai; Gong, Jian-ping

2006-09-01

To explore the feasibility of interleukin 1 receptor associated kinase-4 (IRAK-4) as gene therapy target for liver ischemia/reperfusion injury (I/RI) and effective approach in vivo for short hairpin RNA (shRNA) interference used to gene therapy in liver graft hqappened. Sprague-Dawley rats were randomly divided into three groups: the control group, the in vivo transfection group (IVT) and the cold ischemia transfection group (CIT). Experiments of orthotopic liver transplantation were performed by two-cuff method. CIT were perfused with IRAK-4-shRNA plasmid (pSIIRAK-4) during cold ischemia phase, IVT received the equivalent volumes (2 mL) of pSIIRAK-4 after portal vein inosculated, and the control group leaved without any treatment. At 0 min, 60 min and 180 min after reperfusion, the expression of IRAK-4 gene and protein level were determined by RT-PCR and Western blot. The serum TNF-alpha level was detected by ELISA. Liver histopathological changes and cell apoptosis were observed by electron microscope and TUNEL. After reperfusion, the expression of IRAK-4 were largely depressed in CIT than that of IVT and the control group (P < 0.01), and furthermore, the serum TNF-alpha level, proportion of hepatocyte apoptosis and severity of hepatocyte injury were also lower than the latter. These results indicate that depression IRAK-4 expression with IRAK-4-shRNA through portal vein perfusion during cold ischemia phase could effectively blunt graft hepatic I/RI.

Silencing of p53 RNA through transarterial delivery ameliorates renal tubular injury and downregulates GSK-3β expression after ischemia-reperfusion injury.

PubMed

Fujino, Takayuki; Muhib, Sharifi; Sato, Nobuyuki; Hasebe, Naoyuki

2013-12-01

p53, a pivotal protein in the apoptotic pathway, has been identified as a mediator of transcriptional responses to ischemia-reperfusion (IR) injury. The characteristics and functional significance of the p53 response in vivo are largely unknown in IR-induced kidney injury. Therapeutic opportunities of delivering small interfering RNA (siRNA) via venous injection have gained recognition; however, systemic adverse effects of siRNA therapy should be considered. To prevent IR-induced kidney injury, we tested the efficacy of transarterial administration of siRNA targeting p53 (p53 siRNA). Female C57BL/6 mice underwent unilateral renal artery ischemia for 30 min, followed by reperfusion. siRNA experiments utilized short hairpin (sh) RNA plasmid-based approaches. Transfection of shRNA was performed using cationic polymer transfection reagent. Injection of synthetic p53 shRNA into the left renal artery just after ischemia improved tubular injury, apoptosis, and the swelling of mitochondria in cells of the thick ascending limb of Henle (mTALH) at the outer medullary regions. Staining of upregulated p53 was colocalized with the inducible expression of glycogen synthase kinase-3β (GSK-3β) at mTALH after IR injury. p53 shRNA inhibited GSK-3β expression and restored β-catenin expression at mTALH. For IR-induced kidney injury, transarterial delivery of p53 siRNA is an effective pharmacological intervention. Targeting siRNA to p53 leads to an attenuation of apoptosis and mitochondrial damage through the downregulation of GSK-3β expression and upregulation of β-catenin. Local delivery of vectors such as p53 siRNA through a transaortic catheter is clinically useful in reducing the adverse effect of siRNA-related therapy.

Comparative analysis of RNAi screening technologies at genome-scale reveals an inherent processing inefficiency of the plasmid-based shRNA hairpin.

PubMed

Bhinder, Bhavneet; Shum, David; Djaballah, Hakim

2014-02-01

RNAi screening in combination with the genome-sequencing projects would constitute the Holy Grail of modern genetics; enabling discovery and validation towards a better understanding of fundamental biology leading to novel targets to combat disease. Hit discordance at inter-screen level together with the lack of reproducibility is emerging as the technology's main pitfalls. To examine some of the underlining factors leading to such discrepancies, we reasoned that perhaps there is an inherent difference in knockdown efficiency of the various RNAi technologies. For this purpose, we utilized the two most popular ones, chemically synthesized siRNA duplex and plasmid-based shRNA hairpin, in order to perform a head to head comparison. Using a previously developed gain-of-function assay probing modulators of the miRNA biogenesis pathway, we first executed on a siRNA screen against the Silencer Select V4.0 library (AMB) nominating 1,273, followed by an shRNA screen against the TRC1 library (TRC1) nominating 497 gene candidates. We observed a poor overlap of only 29 hits given that there are 15,068 overlapping genes between the two libraries; with DROSHA as the only common hit out of the seven known core miRNA biogenesis genes. Distinct genes interacting with the same biogenesis regulators were observed in both screens, with a dismal cross-network overlap of only 3 genes (DROSHA, TGFBR1, and DIS3). Taken together, our study demonstrates differential knockdown activities between the two technologies, possibly due to the inefficient intracellular processing and potential cell-type specificity determinants in generating intended targeting sequences for the plasmid-based shRNA hairpins; and suggests this observed inefficiency as potential culprit in addressing the lack of reproducibility.

Short hairpin RNA suppression of thymidylate synthase produces DNA mismatches and results in excellent radiosensitization.

PubMed

Flanagan, Sheryl A; Cooper, Kristin S; Mannava, Sudha; Nikiforov, Mikhail A; Shewach, Donna S

2012-12-01

To determine the effect of short hairpin ribonucleic acid (shRNA)-mediated suppression of thymidylate synthase (TS) on cytotoxicity and radiosensitization and the mechanism by which these events occur. shRNA suppression of TS was compared with 5-fluoro-2'-deoxyuridine (FdUrd) inactivation of TS with or without ionizing radiation in HCT116 and HT29 colon cancer cells. Cytotoxicity and radiosensitization were measured by clonogenic assay. Cell cycle effects were measured by flow cytometry. The effects of FdUrd or shRNA suppression of TS on dNTP deoxynucleotide triphosphate imbalances and consequent nucleotide misincorporations into deoxyribonucleic acid (DNA) were analyzed by high-pressure liquid chromatography and as pSP189 plasmid mutations, respectively. TS shRNA produced profound (≥ 90%) and prolonged (≥ 8 days) suppression of TS in HCT116 and HT29 cells, whereas FdUrd increased TS expression. TS shRNA also produced more specific and prolonged effects on dNTPs deoxynucleotide triphosphates compared with FdUrd. TS shRNA suppression allowed accumulation of cells in S-phase, although its effects were not as long-lasting as those of FdUrd. Both treatments resulted in phosphorylation of Chk1. TS shRNA alone was less cytotoxic than FdUrd but was equally effective as FdUrd in eliciting radiosensitization (radiation enhancement ratio: TS shRNA, 1.5-1.7; FdUrd, 1.4-1.6). TS shRNA and FdUrd produced a similar increase in the number and type of pSP189 mutations. TS shRNA produced less cytotoxicity than FdUrd but was equally effective at radiosensitizing tumor cells. Thus, the inhibitory effect of FdUrd on TS alone is sufficient to elicit radiosensitization with FdUrd, but it only partially explains FdUrd-mediated cytotoxicity and cell cycle inhibition. The increase in DNA mismatches after TS shRNA or FdUrd supports a causal and sufficient role for the depletion of dTTP thymidine triphosphate and consequent DNA mismatches underlying radiosensitization. Importantly, shRNA suppression of TS avoids FP-mediated TS elevation and its negative prognostic role. These studies support the further exploration of TS suppression as a novel radiosensitizing strategy. Copyright © 2012 Elsevier Inc. All rights reserved.

Transfection of gene regulation nanoparticles complexed with pDNA and shRNA controls multilineage differentiation of hMSCs.

PubMed

Kim, Hye Jin; Yi, Se Won; Oh, Hyun Jyung; Lee, Jung Sun; Park, Ji Sun; Park, Keun-Hong

2018-05-29

Overexpression and knockdown of specific proteins can control stem cell differentiation for therapeutic purposes. In this study, we fabricated RUNX2, SOX9, and C/EBPα plasmid DNAs (pDNAs) and ATF4-targeting shRNA (shATF4) to induce osteogenesis, chondrogenesis, and adipogenesis of human mesenchymal stem cells (hMSCs). The pDNAs and shATF4 were complexed with TRITC-gene regulation nanoparticles (GRN). Osteogenesis-related gene expression was reduced at early (12 h) and late (36 h) time points after co-delivery of shATF4 and SOX9 or C/EBPα pDNA, respectively, and osteogenesis was inhibited in these hMSCs. By contrast, osteogenesis-related genes were highly expressed upon co-delivery of RUNX2 and ATF4 pDNAs. DEX in GRN enhanced chondrogenic differentiation. Expression of osteogenesis-, chondrogenesis-, and adipogenesis-related genes was higher in hMSCs transfected with NPs complexed with RUNX2 and ATF4 pDNAs, shATF4 and SOX9 pDNA, and shATF4 and C/EBPα pDNA for 72 h than in control hMSCs, respectively. Moreover, delivery of these NPs also increased expression of osteogenesis-, chondrogenesis-, and adipogenesis-related proteins. These alterations in expression led to morphological changes, indicating that hMSCs differentiated into osteoblasts, chondrocytes, and adipose cells. Copyright © 2018 Elsevier Ltd. All rights reserved.

Tumor-targeting magnetic lipoplex delivery of short hairpin RNA suppresses IGF-1R overexpression of lung adenocarcinoma A549 cells in vitro and in vivo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Chunmao; Ding, Chao; Kong, Minjian

2011-07-08

Highlights: {yields} We compared lipofection with magnetofection about difference of transfection efficiency on delivery a therapeutic gene in vitro and in vivo. {yields} We investigated the difference of shRNA induced by magnetofection and lipofection into A549 cell and subcutaneous tumor to knockdown IGF-1R overexpressed in A549 cell and A549 tumor. {yields} We investigated in vivo shRNA silenced IGF-1R overexpression 24, 48, and 72 h after shRNA intravenous injection into tumor-bearing mice by way of magnetofection and lipofection. {yields} Our results showed that magnetofection could achieve therapeutic gene targeted delivery into special site, which contributed to targeted gene therapy of lungmore » cancers. -- Abstract: Liposomal magnetofection potentiates gene transfection by applying a magnetic field to concentrate magnetic lipoplexes onto target cells. Magnetic lipoplexes are self-assembling ternary complexes of cationic lipids with plasmid DNA associated with superparamagnetic iron oxide nanoparticles (SPIONs). Type1insulin-like growth factor receptor (IGF-1R), an important oncogene, is frequently overexpressed in lung cancer and mediates cancer cell proliferation and tumor growth. In this study, we evaluated the transfection efficiency (percentage of transfected cells) and therapeutic potential (potency of IGF-1R knockdown) of liposomal magnetofection of plasmids expressing GFP and shRNAs targeting IGF-1R (pGFPshIGF-1Rs) in A549 cells and in tumor-bearing mice as compared to lipofection using Lipofectamine 2000. Liposomal magnetofection provided a threefold improvement in transgene expression over lipofection and transfected up to 64.1% of A549 cells in vitro. In vitro, IGF-1R specific-shRNA transfected by lipofection inhibited IGF-1R protein by 56.1 {+-} 6% and by liposomal magnetofection by 85.1 {+-} 3%. In vivo delivery efficiency of the pGFPshIGF-1R plasmid into the tumor was significantly higher in the liposomal magnetofection group than in the lipofection group. In vivo IGF-1R specific-shRNA by lipofection inhibited IGF-1R protein by an average of 43.8 {+-} 5.3%; that by liposomal magnetofection inhibited IGF-1R protein by 43.4 {+-} 5.7%, 56.3 {+-} 9.6%, and 72.2 {+-} 6.8%, at 24, 48, and 72 h, respectively, after pGFPshIGF-1R injection. Our findings indicate that liposomal magnetofection may be a promising method that allows the targeting of gene therapy to lung cancer.« less

Downregulation of CD147 expression by RNA interference inhibits HT29 cell proliferation, invasion and tumorigenicity in vitro and in vivo.

PubMed

Li, Rui; Pan, Yuqin; He, Bangshun; Xu, Yeqiong; Gao, Tianyi; Song, Guoqi; Sun, Huiling; Deng, Qiwen; Wang, Shukui

2013-12-01

We investigated the effect of CD147 silencing on HT29 cell proliferation and invasion. We constructed a novel short hairpin RNA (shRNA) expression vector pYr-mir30-shRNA. The plasmid was transferred to HT29 cells. The expression of CD147, MCT1 (lactate transporters monocarboxylate transporter 1) and MCT4 (lactate transporters monocarboxylate transporter 4) were monitored by quantitative PCR and western blotting, respectively. The MMP-2 (matrix metalloproteinase-2) and MMP-9 (matrix metalloproteinase-9) activities were determined by gelatin zymography assay, while the intracellular lactate concentration was determined by the lactic acid assay kit. WST-8 assay was used to determine the HT29 cell proliferation and the chemosensitivity. Invasion assay was used to determine the invasion of HT29 cells. In addition, we established a colorectal cancer model, and detected CD147 expression in vivo. The results showed that the expression of CD147 and MCT1 was significantly reduced at both mRNA and protein levels, and also the activity of MMP-2 and MMP-9 was reduced. The proliferation and invasion were decreased, but chemosensitivity to cisplatin was increased. In vivo, the CD147 expression was also significantly decreased, and reduced the tumor growth after CD147 gene silencing. The results demonstrated that silencing of CD147 expression inhibited the proliferation and invasion, suggesting CD147 silencing might be an adjuvant gene therapy strategy to chemotherapy.

Functional characterization of Pol III U6 promoters for gene knockdown and knockout in Plutella xylostella.

PubMed

Huang, Yuping; Wang, Yajun; Zeng, Baosheng; Liu, Zhaoxia; Xu, Xuejiao; Meng, Qian; Huang, Yongping; Yang, Guang; Vasseur, Liette; Gurr, Geoff M; You, Minsheng

2017-10-01

RNA polymerase type III (Pol-III) promoters such as U6 are commonly used to express small RNAs, including short hairpin RNAs (shRNAs) and single guide RNAs (sgRNAs). Functional U6 promoters are widely used in CRISPR systems, and their characterization can facilitate genome editing of non-model organisms. In the present study, six U6 small nuclear RNA (snRNA) promoters containing two conserved elements of a proximal sequence element (PSEA) and a TATA box, were identified and characterized in the diamondback moth (Plutella xylostella) genome. Relative efficiency of the U6 promoters to express shRNA induced EGFP knockdown was tested in a P. xylostella cell line, revealing that the PxU6:3 promoter had the strongest expression effect. Further work with the PxU6:3 promoter showed its efficacy in EGFP knockout using CRISPR/Cas9 system in the cells. The expression plasmids with versatile Pxabd-A gene specific sgRNA driven by the PxU6:3 promoter, combined with Cas9 mRNA, could induce mutagenesis at specific genomic loci in vivo. The phenotypes induced by sgRNA expression plasmids were similar to those done in vitro transcription sgRNAs. A plasmid with two tandem arranged PxU6:3:sgRNA expression cassettes targeting Pxabd-A loci was generated, which caused a 28,856 bp fragment deletion, suggesting that the multi-sgRNA expression plasmid can be used for multi-targeting. Our work indicates that U6 snRNA promoters can be used for functional studies of genes with the approach of reverse genetics in P. xylostella. These essential promoters also provide valuable potential for CRISPR-derived gene drive as a tactic for population control in this globally significant pest. Copyright © 2017 Elsevier Ltd. All rights reserved.

Tafazzin (TAZ) promotes the tumorigenicity of cervical cancer cells and inhibits apoptosis.

PubMed

Chen, Mei; Zhang, Yuan; Zheng, Peng-Sheng

2017-01-01

Tafazzin (TAZ) is often aberrantly expressed in some cancers, including rectal cancer and thyroid neoplasms. However, the function of TAZ in cervical cancer cells remains unknown. This study aims to explore the expression and function of TAZ in cervical cancer cells. Here, we determined the expression of TAZ protein in normal cervical tissue (NC, n = 27), high-grade squamous intraepithelial lesions (HSIL, n = 26) and squamous cervical carcinoma (SCC, n = 41) by immunohistochemistry, the expression of TAZ protein gradually increased from NC to HSIL to SCC. TAZ was overexpressed or down-regulated in cervical cancer cells by stably transfecting a TAZ-expressing plasmid or a shRNA plasmid targeting TAZ. In vitro, the cell growth curves and MTT assays showed that TAZ may promote the growth and viability of cervical cancer cells. In vivo, xenografts experiment showed that TAZ may increase tumor-forming ability. The percentage of apoptosis cells analyzed by FACS and TUNEL assays consistently showed that TAZ inhibits apoptosis in cervical cancer cells. Furthermore, the Cleaved Caspase 9 and Cleaved Caspase 3 were down-regulated by TAZ in cervical cancer cells. Taken together, this study demonstrated that TAZ is overexpressed in cervical cancer and may promote tumorigenicity of cervical cancer cells and inhibit apoptosis.

Tafazzin (TAZ) promotes the tumorigenicity of cervical cancer cells and inhibits apoptosis

PubMed Central

Chen, Mei; Zhang, Yuan; Zheng, Peng-Sheng

2017-01-01

Tafazzin (TAZ) is often aberrantly expressed in some cancers, including rectal cancer and thyroid neoplasms. However, the function of TAZ in cervical cancer cells remains unknown. This study aims to explore the expression and function of TAZ in cervical cancer cells. Here, we determined the expression of TAZ protein in normal cervical tissue (NC, n = 27), high-grade squamous intraepithelial lesions (HSIL, n = 26) and squamous cervical carcinoma (SCC, n = 41) by immunohistochemistry, the expression of TAZ protein gradually increased from NC to HSIL to SCC. TAZ was overexpressed or down-regulated in cervical cancer cells by stably transfecting a TAZ-expressing plasmid or a shRNA plasmid targeting TAZ. In vitro, the cell growth curves and MTT assays showed that TAZ may promote the growth and viability of cervical cancer cells. In vivo, xenografts experiment showed that TAZ may increase tumor-forming ability. The percentage of apoptosis cells analyzed by FACS and TUNEL assays consistently showed that TAZ inhibits apoptosis in cervical cancer cells. Furthermore, the Cleaved Caspase 9 and Cleaved Caspase 3 were down-regulated by TAZ in cervical cancer cells. Taken together, this study demonstrated that TAZ is overexpressed in cervical cancer and may promote tumorigenicity of cervical cancer cells and inhibit apoptosis. PMID:28489874

Involvement of Bmi-1 gene in the development of gastrointestinal stromal tumor by regulating p16Ink4A/p14ARF gene expressions: An in vivo and in vitro study.

PubMed

Wang, Jiang-Li; Wu, Jiang-Hong; Hong, Cai; Wang, Ya-Nong; Zhou, Ye; Long, Zi-Wen; Zhou, Ying; Qin, Hai-Shu

2017-12-01

This study was conducted in order to explore the role that Bmi-1 plays during the development of a gastrointestinal stromal tumor (GIST) by regulation of the p16 Ink4A and p14 ARF expressions. Eighty-six patients diagnosed with GIST were selected to take part in this experiment. The Bmi-1 protein expressions in GIST and adjacent normal tissues were detected using immunohistochemistry and further analyzed by using photodensitometry. To monitor and track the progression of the GIST, a 3-year follow-up was conducted for all affected patients. After cell transfection, the GIST cells were assigned into the control group (without transfection), the negative control (NC) group (transfected with Bmi-1-Scramble plasmid), and the Bmi-1 shRNA group (transfected with the pcDNA3.1-Bmi-1 shRNA plasmid). Protein and mRNA expressions collected from Bmi-1, p16 lnk4A , P14 ARF , cyclin D1, and CDK4 were measured using both the RT-qPCR and western blotting methods Cell senescence was assessed and obtained by using the β-Galactosidase (β-Gal) activity assay. The use of a Soft agar colony formation assay and CCK-8 assay were performed in order to detect the cell growth and subsequent proliferation. Cell invasion and migration were analyzed using the Transwell assay and scratch test. Bmi-1 in the GIST tissues was found to be significantly higher and the p16 lnk4A and P14 ARF expressions were lower than those in the adjacent normal tissues. Bmi-1 was negatively correlated with p16 lnk4A and P14 ARF expressions according to the correlation analysis. Bmi-1 expression was associated with the TNM stage, postoperative recurrence, metastasis, tumor size, and the 5-year survival rate. Area under ROC curve was calculated at 0.884, and sensitivity, specificity, and accuracy of Bmi-1 predicting the GIST were 67.44%, 97.67%, and 65.12%, respectively. Patients exhibiting a high Bmi-1 expression in the GIST tissues had lower survival rates than those with low Bmi-1 expression. In comparison with the control group, P14 ARF, and p16 lnk4A were up-regulated, while cyclinD 1 and CDK4 were down-regulated, cell senescence was promoted, and cell proliferation, invasion, and migration also showed some regression in the Bmi-1 shRNA group. These collection of data indicated that the down-regulated Bmi-1 might inhibit the proliferation, invasion, and migration of GIST cells and can be subsequently linked to the incidence and developing a prognosis of GIST. Copyright © 2017 Elsevier GmbH. All rights reserved.

Lymphoblast-derived integration-free iPSC line AD-TREM2-3 from a 74 year-old Alzheimer's disease patient expressing the TREM2 p.R47H variant.

PubMed

Martins, Soraia; Yigit, Hatice; Bohndorf, Martina; Graffmann, Nina; Fiszl, Aurelian Robert; Wruck, Wasco; Sleegers, Kristel; Van Broeckhoven, Christine; Adjaye, James

2018-06-01

Human lymphoblast cells from a male diagnosed with Alzheimer's disease (AD) expressing the TREM2 p.R47H variant were used to generate integration-free induced pluripotent stem cells (iPSCs) by over-expressing episomal-based plasmids harbouring OCT4, SOX2, KLF4, LIN28, L-MYC and p53 shRNA. The derived iPSC line - AD-TREM2-3 was defined as pluripotent based on (i) expression of pluripotency-associated markers (ii) embryoid body-based differentiation into cell types representative of the three germ layers and (iii) the similarity between the transcriptome of the iPSC line and the human embryonic stem cell line H1 with a Pearson correlation of 0.940. Copyright © 2018. Published by Elsevier B.V.

Survivin knockdown increased anti-cancer effects of (-)-epigallocatechin-3-gallate in human malignant neuroblastoma SK-N-BE2 and SH-SY5Y cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hossain, Md. Motarab; Banik, Naren L.; Ray, Swapan K., E-mail: swapan.ray@uscmed.sc.edu

Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (-)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly inmore » SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in the expression of NFP, NSE, and e-cadherin and also decreases in the expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in the expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-{kappa}B), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro network formation ability of cells was significantly inhibited by survivin silencing and completely by combination of survivin silencing and EGCG treatment. Collectively, survivin silencing potentiated anti-cancer effects of EGCG in human malignant neuroblastoma cells having survivin overexpression. -- Highlights: Black-Right-Pointing-Pointer Survivin shRNA + EGCG controlled growth of human malignant neuroblastoma cells. Black-Right-Pointing-Pointer Survivin knockdown induced neuronal differentiation in neuroblastoma cells. Black-Right-Pointing-Pointer Survivin shRNA + EGCG induced morphological and biochemical features of apoptosis. Black-Right-Pointing-Pointer Combination therapy inhibited invasion, proliferation, and angiogenesis as well. Black-Right-Pointing-Pointer So, combination therapy showed multiple anti-cancer mechanisms in neuroblastoma.« less

Fundamental study of detection of muscle hypertrophy-oriented gene doping by myostatin knock down using RNA interference.

PubMed

Takemasa, Tohru; Yakushiji, Naohisa; Kikuchi, Dale Manjiro; Deocaris, Custer; Widodo; Machida, Masanao; Kiyosawa, Hidenori

2012-01-01

To investigate the feasibility of developing a method for detection of gene doping in power-athletes, we devised an experimental model system. Myostatin is a potent negative regulator of skeletal muscle development and growth, and myostatin-knockout mice exhibit a double-muscle phenotype. To achieve knockdown, we constructed plasmids expressing short hairpin interfering RNAs (shRNAs) against myostatin. These shRNAs were transfected into C2C12 cultured cells or injected into the tibialis anterior (TA) muscle of adult mice. By performing in vitro and in vivo experiments, we found that some shRNAs effectively reduced the expression of myostatin, and that the TA muscle showed hypertrophy of up to 27.9%. Then, using real-time PCR, we tried to detect the shRNA plasmid in the serum or muscles of mice into which it had been injected. Although we were unable to detect the plasmid in serum samples, it was detectable in the treated muscle at least four weeks after induction. We were also able to detect the plasmid in muscle in the vicinity of the TA. This gene doping model system will be useful for further studies aimed at doping control. Key pointsUsing a myostatin knockdown plasmid, we have succeeded in creating a model system for gene doping using mice that resulted in muscle hypertrophy greater than that reported previously.We confirmed that there was a limit of gene doping detection using real-time PCR, either from serum or muscle smple.This model experimental system can be utilized for examining indirect methods of gene doping detection such as immune responses to gene transfer or a profiling approach using DNA microarray.

Fundamental Study of Detection of Muscle Hypertrophy-Oriented Gene Doping by Myostatin Knock Down Using RNA Interference

PubMed Central

Takemasa, Tohru; Yakushiji, Naohisa; Kikuchi, Dale Manjiro; Deocaris, Custer; Widodo; Machida, Masanao; Kiyosawa, Hidenori

2012-01-01

To investigate the feasibility of developing a method for detection of gene doping in power-athletes, we devised an experimental model system. Myostatin is a potent negative regulator of skeletal muscle development and growth, and myostatin-knockout mice exhibit a double-muscle phenotype. To achieve knockdown, we constructed plasmids expressing short hairpin interfering RNAs (shRNAs) against myostatin. These shRNAs were transfected into C2C12 cultured cells or injected into the tibialis anterior (TA) muscle of adult mice. By performing in vitro and in vivo experiments, we found that some shRNAs effectively reduced the expression of myostatin, and that the TA muscle showed hypertrophy of up to 27.9%. Then, using real-time PCR, we tried to detect the shRNA plasmid in the serum or muscles of mice into which it had been injected. Although we were unable to detect the plasmid in serum samples, it was detectable in the treated muscle at least four weeks after induction. We were also able to detect the plasmid in muscle in the vicinity of the TA. This gene doping model system will be useful for further studies aimed at doping control. Key pointsUsing a myostatin knockdown plasmid, we have succeeded in creating a model system for gene doping using mice that resulted in muscle hypertrophy greater than that reported previously.We confirmed that there was a limit of gene doping detection using real-time PCR, either from serum or muscle smple.This model experimental system can be utilized for examining indirect methods of gene doping detection such as immune responses to gene transfer or a profiling approach using DNA microarray. PMID:24149203

Systemic Delivery of Salmonella Typhimurium Transformed with IDO shRNA Enhances Intratumoral Vector Colonization and Suppresses Tumor Growth

PubMed Central

Blache, Celine A.; Manuel, Edwin R.; Kaltcheva, Teodora I.; Wong, Andrea N.; Ellenhorn, Joshua D.I.; Blazar, Bruce R.; Diamond, Don J.

2012-01-01

Generating antitumor responses through the inhibition of tumor-derived immune suppression represents a promising strategy in the development of cancer immunotherapeutics. Here we present a strategy incorporating delivery of the bacterium Salmonella typhimurium (ST), naturally tropic for the hypoxic tumor environment, transformed with an shRNA plasmid against the immunosuppressive molecule indoleamine 2,3-dioxygenase 1 (shIDO). When systemically delivered into mice, shIDO silences host IDO expression and leads to massive intratumoral cell death that is associated with significant tumor infiltration by polymorphonuclear neutrophils (PMNs). shIDO-ST treatment causes tumor cell death independently of host IDO and adaptive immunity, which may have important implications for use in immunosuppressed cancer patients. Further, shIDO-ST treatment increases reactive oxygen species (ROS) produced by infiltrating PMNs and conversely, PMN immunodepletion abrogates tumor control. Silencing of host IDO significantly enhances ST colonization, suggesting that IDO expression within the tumor controls the immune response to ST. In summary, we present a novel approach to cancer treatment that involves the specific silencing of tumor-derived IDO that allows for the recruitment of ROS-producing PMNs, which may act primarily to clear ST infection, but in the process, also induces apoptosis of surrounding tumor tissue resulting in a vigorous anti-tumor effect. PMID:23090116

Survivin knockdown increased anti-cancer effects of (−)-epigallocatechin-3-gallate in human malignant neuroblastoma SK-N- BE2 and SH-SY5Y cells

PubMed Central

Hossain, Md. Motarab; Banik, Naren L.; Ray, Swapan K.

2012-01-01

Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (−)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly in SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in expression of NFP, NSE, and e-cadherin and also decreases in expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-κB), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro network formation ability of cells was significantly inhibited by survivin silencing and completely by combination of survivin silencing and EGCG treatment. Collectively, survivin silencing potentiated anti-cancer effects of EGCG in human malignant neuroblastoma cells having survivin overexpression. PMID:22507272

Characterization of the human oncogene SCL/TAL1 interrupting locus (Stil) mediated Sonic hedgehog (Shh) signaling transduction in proliferating mammalian dopaminergic neurons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Lei; Department of Physiology, Nankai University School of Medicine, Tianjin 300071; Carr, Aprell L.

2014-07-11

Highlights: • Stil is a human oncogene that is conserved in vertebrate species. • Stil functions in the Shh pathway in mammalian cells. • The expression of Stil is required for mammalian dopaminergic cell proliferation. - Abstract: The human oncogene SCL/TAL1 interrupting locus (Stil) is highly conserved in all vertebrate species. In humans, the expression of Stil is involved in cancer cell survival, apoptosis and proliferation. In this research, we investigated the roles of Stil expression in cell proliferation of mammalian dopaminergic (DA) PC12 cells. Stil functions through the Sonic hedgehog (Shh) signal transduction pathway. Co-immunoprecipitation tests revealed that STILmore » interacts with Shh downstream components, which include SUFU and GLI1. By examining the expression of Stil, Gli1, CyclinD2 (cell-cycle marker) and PCNA (proliferating cell nuclear antigen), we found that up-regulation of Stil expression (transfection with overexpression plasmids) increased Shh signaling transduction and PC12 cell proliferation, whereas down-regulation of Stil expression (by shRNA) inhibited Shh signaling transduction, and thereby decreased PC12 cell proliferation. Transient transfection of PC12 cells with Stil knockdown or overexpression plasmids did not affect PC12 cell neural differentiation, further indicating the specific roles of Stil in cell proliferation. The results from this research suggest that Stil may serve as a bio-marker for neurological diseases involved in DA neurons, such as Parkinson’s disease.« less

Clinical significance of proliferation, apoptosis and senescence of nasopharyngeal cells by the simultaneously blocking EGF, IGF-1 receptors and Bcl-xl genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dai, Guodong; Peng, Tao; Zhou, Xuhong

2013-11-01

Highlight: •Construction of shRNA segments expression vectors is valid by the investigation of RT-PCR for IGF1R, EGFR and Bcl-xl mRNA and protein expression. •Studies have suggested that the vectors in blocking these genes of the growth factor receptors and anti- apoptosis is capable of breaking the balance of tumor growth so that tumor trend apoptosis and senescence. •Simultaneously blocking multiple genes that are abnormally expressed may be more effective in treating cancer cells than silencing a single gene. -- Abstract: Background: In previous work, we constructed short hairpin RNA (shRNA) expression plasmids that targeted human EGF and IGF-1 receptors messengermore » RNA, respectively, and demonstrated that these vectors could induce apoptosis of human nasopharyngeal cell lines (CNE2) and inhibit ligand-induced pAkt and pErk activation. Method: We have constructed multiple shRNA expression vectors of targeting EGFR, IGF1R and Bcl-xl, which were transfected to the CNE2 cells. The mRNA expression was assessed by RT-PCR. The growth of the cells, cell cycle progression, apoptosis of the cells, senescent tumor cells and the proteins of EGFR, IGF1R and Bcl-xl were analyzed by MTT, flow cytometry, cytochemical therapy or Western blot. Results: In group of simultaneously blocking EGFR, IGF1R and Bcl-xl genes, the mRNA of EGFR, IGF1R and Bcl-xl expression was decreased by (66.66 ± 3.42)%, (73.97 ± 2.83)% and (64.79 ± 2.83)%, and the protein expressions was diminished to (67.69 ± 4.02)%, (74.32 ± 2.30)%, and (60.00 ± 3.34)%, respectively. Meanwhile, the cell apoptosis increased by 65.32 ± 0.18%, 65.16 ± 0.25% and 55.47 ± 0.45%, and senescent cells increased by 1.42 ± 0.15%, 2.26 ± 0.15% and 3.22 ± 0.15% in the second, third and fourth day cultures, respectively. Conclusions: Simultaneously blocking EGFR, IGF1R and Bcl-xl genes is capable of altering the balance between proliferating versus apoptotic and senescent cells in the favor of both of apoptosis and senescence and, therefore, the tumor cells regression.« less

Constitutive Expression of Short Hairpin RNA in Vivo Triggers Buildup of Mature Hairpin Molecules

PubMed Central

Ahn, M.; Witting, S.R.; Ruiz, R.; Saxena, R.

2011-01-01

Abstract RNA interference (RNAi) has become the cornerstone technology for studying gene function in mammalian cells. In addition, it is a promising therapeutic treatment for multiple human diseases. Virus-mediated constitutive expression of short hairpin RNA (shRNA) has the potential to provide a permanent source of silencing molecules to tissues, and it is being devised as a strategy for the treatment of liver conditions such as hepatitis B and hepatitis C virus infection. Unintended interaction between silencing molecules and cellular components, leading to toxic effects, has been described in vitro. Despite the enormous interest in using the RNAi technology for in vivo applications, little is known about the safety of constitutively expressing shRNA for multiple weeks. Here we report the effects of in vivo shRNA expression, using helper-dependent adenoviral vectors. We show that gene-specific knockdown is maintained for at least 6 weeks after injection of 1 × 1011 viral particles. Nonetheless, accumulation of mature shRNA molecules was observed up to weeks 3 and 4, and then declined gradually, suggesting the buildup of mature shRNA molecules induced cell death with concomitant loss of viral DNA and shRNA expression. No evidence of well-characterized innate immunity activation (such as interferon production) or saturation of the exportin-5 pathway was observed. Overall, our data suggest constitutive expression of shRNA results in accumulation of mature shRNA molecules, inducing cellular toxicity at late time points, despite the presence of gene silencing. PMID:21780944

Bcl-2 silencing attenuates hypoxia-induced apoptosis resistance in pulmonary microvascular endothelial cells.

PubMed

Cao, Yongmei; Jiang, Zhen; Zeng, Zhen; Liu, Yujing; Gu, Yuchun; Ji, Yingying; Zhao, Yupeng; Li, Yingchuan

2016-01-01

Pulmonary arterial hypertension (PAH) is a life-threatening disorder that ultimately causes heart failure. While the underlying causes of this condition are not well understood, previous studies suggest that the anti-apoptotic nature of pulmonary microvascular endothelial cells (PMVECs) in hypoxic environments contributes to PAH pathogenesis. In this study, we focus on the contribution of Bcl-2 and hypoxia response element (HRE) to apoptosis-resistant endothelial cells and investigate the mechanism. PMVECs obtained from either normal rats or apoptosis-resistant PMVECs obtained from PAH rats were transduced with recombinant lentiviral vectors carrying either Bcl-2-shRNA or HRE combined Bcl-2-shRNA, and then cultured these cells for 24 h under hypoxic (5% O2) or normoxic (21% O2) conditions. In normal PMVECs, Bcl-2-shRNA or HRE combined with Bcl-2-shRNA transduction successfully decreased Bcl-2 expression, while increasing apoptosis as well as caspase-3 and P53 expression in a normoxic environment. In a hypoxic environment, the effects of Bcl-2-shRNA treatment on cell apoptosis, and on Bcl-2, caspase-3, P53 expression were significantly suppressed. Conversely, HRE activation combined with Bcl-2-shRNA transduction markedly enhanced cell apoptosis and upregulated caspase-3 and P53 expression, while decreasing Bcl-2 expression. Furthermore, in apoptosis-resistant PMVECs, HRE-mediated Bcl-2 silencing effectively enhanced cell apoptosis and caspase-3 activity. The apoptosis rate was significantly depressed when Lv-HRE-Bcl-2-shRNA was combined with Lv-P53-shRNA or Lv-caspase3-shRNA transduction in a hypoxic environment. These results suggest that HRE-mediated Bcl-2 inhibition can effectively attenuate hypoxia-induced apoptosis resistance in PMVECs by downregulating Bcl-2 expression and upregulating caspase-3 and P53 expression. This study therefore reveals critical insight into potential therapeutic targets for treating PAH.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liang, Wenqing, E-mail: liangwenqing_1234@126.com; Yang, Chengwei; Qian, Yu

Highlights: Black-Right-Pointing-Pointer {beta}-Catenin expression were markedly down-regulated by CTNNB1 shRNA. Black-Right-Pointing-Pointer CTNNB1 shRNA could inhibit the proliferation of RPMI8226 cells. Black-Right-Pointing-Pointer Significantly profound apoptotic cell death in CTNNB1 shRNA cells. Black-Right-Pointing-Pointer In vivo, CTNNB1 silence led to a growth inhibition of myeloma growth. Black-Right-Pointing-Pointer c-myc and {beta}-catenin in the expression cells of cleaved caspase-3 were increased. -- Abstract: Multiple myeloma (MM) is thrombogenic as a consequence of multiple hemostatic effects. Overexpression of {beta}-catenin has been observed in several types of malignant tumors, including MM. However, the relationship between {beta}-catenin expression and MM remains unclear. In the present study, RNA interferencemore » was used to inhibit {beta}-catenin expression in RPMI8226 cells. RT-PCR and Western blotting analyses showed that {beta}-catenin mRNA and protein expression were markedly down-regulated by CTNNB1 shRNA. Western blotting showed that the protein levels of cyclin D1 and glutamine synthetase were downregulated and supported the transcriptional regulatory function of {beta}-catenin. The MTT assay showed that CTNNB1 shRNA could have significant inhibitory effects on the proliferation of RPMI8226 cells. The TOPflash reporter assay demonstrated significant downregulation after CTNNB1 shRNA transfection in RPMI8226 cells. Flow cytometric analyses also showed significantly profound apoptosis in CTNNB1 shRNA cells. We found CTNNB1 silence led to growth inhibition of MM growth in vivo. Immunohistochemical analyses showed that c-myc and {beta}-catenin were reduced in CTNNB1 shRNA tumor tissues, but that expression of cleaved caspase-3 was increased. These results show that {beta}-catenin could be a new therapeutic agent that targets the biology of MM cells.« less

Short hairpin RNA interference therapy for ischemic heart disease

PubMed Central

Huang, Mei; Chan, Denise; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C.; Chen, Xiaoyuan; Giaccia, Amato; Wu, Joseph C.

2013-01-01

Background During hypoxia, upregulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. Methods and Results PHD2 was cloned from mouse embryonic stem (ES) cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared to the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of HIF-1α protein and several downstream angiogenic genes by >30% (P<0.01). Afterwards, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending (LAD) artery in mice. Animals were randomized into shPHD2 group (n=20) versus shScramble sequence as control (n=20). Bioluminescence imaging detected transgene expression for 4–5 weeks. Echocardiographic study showed the shPHD2 group had improved fractional shortening compared with the shScramble group at week 4 (33.7%±1.9% vs. 28.4%±2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot anlaysis of explanted hearts also confirm that animals treated with shPHD2 had significantly higher levels of HIF-1α protein. Conclusions This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by shRNA led to significant improvement in angiogenesis and contractility by in vitro and in vivo experiments. With further validation, the combination of shRNA therapy and molecular imaging can be used to track novel cardiovascular gene therapy applications in the future. PMID:18824759

Adenovirus vectors lacking virus-associated RNA expression enhance shRNA activity to suppress hepatitis C virus replication

NASA Astrophysics Data System (ADS)

Pei, Zheng; Shi, Guoli; Kondo, Saki; Ito, Masahiko; Maekawa, Aya; Suzuki, Mariko; Saito, Izumu; Suzuki, Tetsuro; Kanegae, Yumi

2013-12-01

First-generation adenovirus vectors (FG AdVs) expressing short-hairpin RNA (shRNA) effectively downregulate the expressions of target genes. However, this vector, in fact, expresses not only the transgene product, but also virus-associated RNAs (VA RNAs) that disturb cellular RNAi machinery. We have established a production method for VA-deleted AdVs lacking expression of VA RNAs. Here, we showed that the highest shRNA activity was obtained when the shRNA was inserted not at the popularly used E1 site, but at the E4 site. We then compared the activities of shRNAs against hepatitis C virus (HCV) expressed from VA-deleted AdVs or conventional AdVs. The VA-deleted AdVs inhibited HCV production much more efficiently. Therefore, VA-deleted AdVs were more effective than the currently used AdVs for shRNA downregulation, probably because of the lack of competition between VA RNAs and the shRNAs. These VA-deleted AdVs might enable more effective gene therapies for chronic hepatitis C.

AKI after Conditional and Kidney-Specific Knockdown of Stanniocalcin-1

PubMed Central

Huang, Luping; Belousova, Tatiana; Pan, Jenny Szu-Chin; Du, Jie; Ju, Huiming; Lu, Lianghao; Zhang, Pumin; Truong, Luan D.; Nuotio-Antar, Alli

2014-01-01

Stanniocalcin-1 is an intracrine protein; it binds to the cell surface, is internalized to the mitochondria, and diminishes superoxide generation through induction of uncoupling proteins. In vitro, stanniocalcin-1 inhibits macrophages and preserves endothelial barrier function, and transgenic overexpression of stanniocalcin-1 in mice protects against ischemia-reperfusion kidney injury. We sought to determine the kidney phenotype after kidney endothelium-specific expression of stanniocalcin-1 small hairpin RNA (shRNA). We generated transgenic mice that express stanniocalcin-1 shRNA or scrambled shRNA upon removal of a floxed reporter (phosphoglycerate kinase-driven enhanced green fluorescent protein) and used ultrasound microbubbles to deliver tyrosine kinase receptor-2 promoter-driven Cre to the kidney to permit kidney endothelium-specific shRNA expression. Stanniocalcin-1 mRNA and protein were expressed throughout the kidney in wild-type mice. Delivery of tyrosine kinase receptor-2 promoter-driven Cre to stanniocalcin-1 shRNA transgenic kidneys diminished the expression of stanniocalcin-1 mRNA and protein throughout the kidneys. Stanniocalcin-1 mRNA and protein expression did not change in similarly treated scrambled shRNA transgenic kidneys, and we observed no Cre protein expression in cultured and tyrosine kinase receptor-2 promoter-driven Cre–transfected proximal tubule cells, suggesting that knockdown of stanniocalcin-1 in epithelial cells in vivo may result from stanniocalcin-1 shRNA transfer from endothelial cells to epithelial cells. Kidney-specific knockdown of stanniocalcin-1 led to severe proximal tubule injury characterized by vacuolization, decreased uncoupling of protein-2 expression, greater generation of superoxide, activation of the unfolded protein response, initiation of autophagy, cell apoptosis, and kidney failure. Our observations suggest that stanniocalcin-1 is critical for tubular epithelial survival under physiologic conditions. PMID:24700878

Survivin knockdown increased anti-cancer effects of (-)-epigallocatechin-3-gallate in human malignant neuroblastoma SK-N-BE2 and SH-SY5Y cells.

PubMed

Hossain, Md Motarab; Banik, Naren L; Ray, Swapan K

2012-08-01

Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (-)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly in SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in the expression of NFP, NSE, and e-cadherin and also decreases in the expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in the expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-κB), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro network formation ability of cells was significantly inhibited by survivin silencing and completely by combination of survivin silencing and EGCG treatment. Collectively, survivin silencing potentiated anti-cancer effects of EGCG in human malignant neuroblastoma cells having survivin overexpression. Copyright © 2012 Elsevier Inc. All rights reserved.

Cardiac gene transfer of short hairpin RNA directed against phospholamban effectively knocks down gene expression but causes cellular toxicity in canines.

PubMed

Bish, Lawrence T; Sleeper, Meg M; Reynolds, Caryn; Gazzara, Jeffrey; Withnall, Elanor; Singletary, Gretchen E; Buchlis, George; Hui, Daniel; High, Katherine A; Gao, Guangping; Wilson, James M; Sweeney, H Lee

2011-08-01

Derangements in calcium cycling have been described in failing hearts, and preclinical studies have suggested that therapies aimed at correcting this defect can lead to improvements in cardiac function and survival. One strategy to improve calcium cycling would be to inhibit phospholamban (PLB), the negative regulator of SERCA2a that is upregulated in failing hearts. The goal of this study was to evaluate the safety and efficacy of using adeno-associated virus (AAV)-mediated cardiac gene transfer of short hairpin RNA (shRNA) to knock down expression of PLB. Six dogs were treated with self-complementary AAV serotype 6 (scAAV6) expressing shRNA against PLB. Three control dogs were treated with empty AAV6 capsid, and two control dogs were treated with scAAV6 expressing dominant negative PLB. Vector was delivered via a percutaneously inserted cardiac injection catheter. PLB mRNA and protein expression were analyzed in three of six shRNA dogs between days 16 and 26. The other three shRNA dogs and five control dogs were monitored long-term to assess cardiac safety. PLB mRNA was reduced 16-fold, and PLB protein was reduced 5-fold, with treatment. Serum troponin elevation and depressed cardiac function were observed in the shRNA group only at 4 weeks. An enzyme-linked immunospot assay failed to detect any T cells reactive to AAV6 capsid in peripheral blood mononuclear cells, heart, or spleen. Microarray analysis revealed alterations in cardiac expression of several microRNAs with shRNA treatment. AAV6-mediated cardiac gene transfer of shRNA effectively knocks down PLB expression but is associated with severe cardiac toxicity. Toxicity may result from dysregulation of endogenous microRNA pathways.

Cardiac Gene Transfer of Short Hairpin RNA Directed Against Phospholamban Effectively Knocks Down Gene Expression but Causes Cellular Toxicity in Canines

PubMed Central

Sleeper, Meg M.; Reynolds, Caryn; Gazzara, Jeffrey; Withnall, Elanor; Singletary, Gretchen E.; Buchlis, George; Hui, Daniel; High, Katherine A.; Gao, Guangping; Wilson, James M.; Sweeney, H. Lee

2011-01-01

Abstract Derangements in calcium cycling have been described in failing hearts, and preclinical studies have suggested that therapies aimed at correcting this defect can lead to improvements in cardiac function and survival. One strategy to improve calcium cycling would be to inhibit phospholamban (PLB), the negative regulator of SERCA2a that is upregulated in failing hearts. The goal of this study was to evaluate the safety and efficacy of using adeno-associated virus (AAV)-mediated cardiac gene transfer of short hairpin RNA (shRNA) to knock down expression of PLB. Six dogs were treated with self-complementary AAV serotype 6 (scAAV6) expressing shRNA against PLB. Three control dogs were treated with empty AAV6 capsid, and two control dogs were treated with scAAV6 expressing dominant negative PLB. Vector was delivered via a percutaneously inserted cardiac injection catheter. PLB mRNA and protein expression were analyzed in three of six shRNA dogs between days 16 and 26. The other three shRNA dogs and five control dogs were monitored long-term to assess cardiac safety. PLB mRNA was reduced 16-fold, and PLB protein was reduced 5-fold, with treatment. Serum troponin elevation and depressed cardiac function were observed in the shRNA group only at 4 weeks. An enzyme-linked immunospot assay failed to detect any T cells reactive to AAV6 capsid in peripheral blood mononuclear cells, heart, or spleen. Microarray analysis revealed alterations in cardiac expression of several microRNAs with shRNA treatment. AAV6-mediated cardiac gene transfer of shRNA effectively knocks down PLB expression but is associated with severe cardiac toxicity. Toxicity may result from dysregulation of endogenous microRNA pathways. PMID:21542669

Novel guanidinylated bioresponsive poly(amidoamine)s designed for short hairpin RNA delivery

PubMed Central

Yu, Jiankun; Zhang, Jinmin; Xing, Haonan; Sun, Yanping; Yang, Zhen; Yang, Tianzhi; Cai, Cuifang; Zhao, Xiaoyun; Yang, Li; Ding, Pingtian

2016-01-01

Two different disulfide (SS)-containing poly(amidoamine) (PAA) polymers were constructed using guanidino (Gua)-containing monomers (ie, arginine [Arg] and agmatine [Agm]) and N,N′-cystamine bisacrylamide (CBA) by Michael-addition polymerization. In order to characterize these two Gua-SS-PAA polymers and investigate their potentials as short hairpin RNA (shRNA)-delivery carriers, pSilencer 4.1-CMV FANCF shRNA was chosen as a model plasmid DNA to form complexes with these two polymers. The Gua-SS-PAAs and plasmid DNA complexes were determined with particle sizes less than 90 nm and positive ζ-potentials under 20 mV at nucleic acid:polymer weight ratios lower than 1:24. Bioresponsive release of plasmid DNA was observed from both newly constructed complexes. Significantly lower cytotoxicity was observed for both polymer complexes compared with polyethylenimine and Lipofectamine 2000, two widely used transfection reagents as reference carriers. Arg-CBA showed higher transfection efficiency and gene-silencing efficiency in MCF7 cells than Agm-CBA and the reference carriers. In addition, the cellular uptake of Arg-CBA in MCF7 cells was found to be higher and faster than Agm-CBA and the reference carriers. Similarly, plasmid DNA transport into the nucleus mediated by Arg-CBA was more than that by Agm-CBA and the reference carriers. The study suggested that guanidine and carboxyl introduced into Gua-SS-PAAs polymers resulted in a better nuclear localization effect, which played a key role in the observed enhancement of transfection efficiency and low cytotoxicity. Overall, two newly synthesized Gua-SS-PAAs polymers demonstrated great potential to be used as shRNA carriers for gene-therapy applications. PMID:27994462

Silencing GIRK4 expression in human atrial myocytes by adenovirus-delivered small hairpin RNA.

PubMed

Liu, Xiongtao; Yang, Jian; Shang, Fujun; Hong, Changming; Guo, Wangang; Wang, Bing; Zheng, Qiangsun

2009-07-01

GIRK4 has been shown to be a subunit of I(KACh), and the use of GIRK4 in human atrial myocytes to treat arrhythmia remains an important research pursuit. Adenovirus-delivered small hairpin RNA (shRNA) has been used to mediate gene knockdown in mouse cardiocytes, yet there is no information on the successful application of this technique in human cardiocytes. In the current study, we used a siRNA validation system to select the most efficient sequence for silencing GIRK4. To this end, adenovirus-delivered shRNA, which expresses this sequence, was used to silence GIRK4 expression in human atrial myocytes. Finally, the feasibility, challenges, and results of silencing GIRK4 expression were evaluated by RT-PCR, western blotting, and the voltage-clamp technique. The levels of mRNA and protein were depressed significantly in cells infected by adenovirus-delivered shRNA against GIRK4, approximately 86.3% and 51.1% lower than those cells infected by adenovirus-delivered nonsense shRNA, respectively. At the same time, I(KACh) densities were decreased 53% by adenovirus-delivered shRNA against GIRK4. In summary, adenovirus-delivered shRNA against GIRK4 mediated efficient GIRK4 knockdown in human atrial myocytes and decreased I(KACh) densities. As such, these data indicated that adenovirus-delivered shRNA against GIRK4 is a potential tool for treating arrhythmia.

shRNA-Mediated Silencing of Y-Box Binding Protein-1 (YB-1) Suppresses Growth of Neuroblastoma Cell SH-SY5Y In Vitro and In Vivo

PubMed Central

Wang, Hong; Sun, Ruowen; Gu, Min; Li, Shuang; Zhang, Bin; Chi, Zuofei; Hao, Liangchun

2015-01-01

Y-box binding protein-1 (YB-1), a member of cold-shock protein superfamily, has been demonstrated to be associated with tumor malignancy, and is proposed as a prognostic marker in multiple carcinomas. However, the role of YB-1 in neuroblastoma has not been well studied. To investigate the functional role of YB-1 in neuroblastoma, we established a YB-1-silenced neuroblastoma cell strain by inhibiting YB-1 expression using a shRNA knockdown approach. YB-1-silenced neuroblastoma SH-SY5Y cells exhibited a pronounced reduction in cell proliferation and an increased rate of apoptosis in vitro and in vivo xenograft tumor model. At molecular level, YB-1 silencing resulted in downregulation of Cyclin A, Cyclin D1 and Bcl-2, as well as upregulated levels of Bax, cleaved caspase-3 and cleaved PARP-1. We further demonstrated that YB-1 transcriptionally regulated Cyclin D1 expression by chromatin-immunoprecipitation and luciferase reporter assays. In addition, xenograft tumors derived from neuroblastoma SH-SY5Y cell line were treated with YB-1 shRNA plasmids by intra-tumor injection, and YB-1 targeting effectively inhibited tumor growth and induced cell death. In summary, our findings suggest that YB-1 plays a critical role in neuroblastoma development, and it may serve as a potential target for neuroblastoma therapy. PMID:25993060

Downregulation of mouse CCR3 by lentiviral shRNA inhibits proliferation and induces apoptosis of mouse eosinophils.

PubMed

Zhu, Xin-Hua; Liao, Bing; Xu, Yi; Liu, Ke; Huang, Yun; Huang, Quan-Long; Liu, Yue-Hui

2017-02-01

RNA interference has been considered as an effective gene silencing method in basic and preclinical investigations. The aims of the present study were to construct a lentiviral vector expressing a short hairpin RNA (shRNA) targeting the murine CC chemokine receptor 3 (mCCR3), and to investigate its effects on the proliferation and apoptosis of mouse eosinophils. A recombinant lentiviral vector expressing four fragments of mouse CCR3 shRNA (pLVX‑mCCR3‑1+2+3+4‑shRNA) was constructed using subcloning techniques. This novel lentivirus was then packaged into 293T cells by co‑transduction with plasmids, including Baculo p35, pCMV R8.2 and VSV. The interference effects of the vector were verified using polymerase chain reaction (PCR) and western blot analyses. The effects of the interference on the proliferation and apoptosis of mouse eosinophils were investigated using 3‑(4,5‑dimethylthiazol‑2‑yl)‑5‑(3‑carboxymethoxyphenyl)‑2‑(4‑sulfophenyl)‑2H‑tetrazolium and terminal deoxynucleotidyl transferase dUTP nick end labeling methods, respectively. The results of the PCR and western blot analyses confirmed that the novel recombinant vector, pLVX‑mCCR3‑1+2+3+4‑shRNA, had high efficiency in inhibiting the mRNA and protein expression levels of mCCR3 in mouse eosinophils. The downregulation of mCCR3 significantly inhibited proliferation of the eosinophils. Furthermore, the present study found that the downregulation of mCCR3 significantly promoted apoptosis of the eosinophils. Therefore, the downregulation of mCCR3 led to the inhibition of proliferation and induction of apoptosis in mouse eosinophils. The predominant characteristics of allergic rhinitis are eosinophil infiltration and release of inflammatory mediators, which appear in a variety of clinical manifestations. The results of the present study indicate that mCCR3 silencing may serve as a putative approach for the treatment of allergic rhinitis.

Strand antagonism in RNAi: an explanation of differences in potency between intracellularly expressed siRNA and shRNA

PubMed Central

Jin, Xin; Sun, Tingting; Zhao, Chuanke; Zheng, Yongxiang; Zhang, Yufan; Cai, Weijing; He, Qiuchen; Taira, Kaz; Zhang, Lihe; Zhou, Demin

2012-01-01

Strategies to regulate gene function frequently use small interfering RNAs (siRNAs) that can be made from their shRNA precursors via Dicer. However, when the duplex components of these siRNA effectors are expressed from their respective coding genes, the RNA interference (RNAi) activity is much reduced. Here, we explored the mechanisms of action of shRNA and siRNA and found the expressed siRNA, in contrast to short hairpin RNA (shRNA), exhibits strong strand antagonism, with the sense RNA negatively and unexpectedly regulating RNAi. Therefore, we altered the relative levels of strands of siRNA duplexes during their expression, increasing the level of the antisense component, reducing the level of the sense component, or both and, in this way we were able to enhance the potency of the siRNA. Such vector-delivered siRNA attacked its target effectively. These findings provide new insight into RNAi and, in particular, they demonstrate that strand antagonism is responsible for making siRNA far less potent than shRNA. PMID:22039150

Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis

PubMed Central

Santangeloyz, K.S.; Bertoneyz, A.L.

2011-01-01

summary Objective To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Methods Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RTPCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2−ΔΔCT) method. Results Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted in a >50% reduction (P= 0.0045) or >90% (P= 0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Conclusions Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. PMID:21945742

Prime-boost immunization by both DNA vaccine and oncolytic adenovirus expressing GM-CSF and shRNA of TGF-β2 induces anti-tumor immune activation.

PubMed

Kim, So Young; Kang, Dongxu; Choi, Hye Jin; Joo, Yeonsoo; Kim, Joo-Hang; Song, Jae J

2017-02-28

A successful DNA vaccine for the treatment of tumors should break established immune tolerance to tumor antigen. However, due to the relatively low immunogenicity of DNA vaccines, compared to other kinds of vaccines using live virus or protein, a recombinant viral vector was used to enhance humoral and cellular immunity. In the current study, we sought to develop a novel anti-cancer agent as a complex of DNA and oncolytic adenovirus for the treatment of malignant melanoma in the C57BL/6 mouse model. MART1, a human melanoma-specific tumor antigen, was used to induce an increased immune reaction, since a MART1-protective response is required to overcome immune tolerance to the melanoma antigen MelanA. Because GM-CSF is a potent inducer of anti-tumor immunity and TGF-β2 is involved in tumor survival and host immune suppression, mouse GM-CSF (mGM-CSF) and shRNA of mouse TGF-β2 (shmTGF-β2) genes were delivered together with MART1 via oncolytic adenovirus. MART1 plasmid was also used for antigen-priming. To compare the anti-tumor effect of oncolytic adenovirus expressing both mGM-CSF and shmTGF-β2 (AdGshT) with that of oncolytic adenovirus expressing mGM-CSF only (AdG), each virus was intratumorally injected into melanoma-bearing C57BL/6 mice. As a result, mice that received AdGshT showed delayed tumor growth than those that received AdG. Heterologous prime-boost immunization was combined with oncolytic AdGshT and MART1 expression to result in further delayed tumor growth. This regression is likely due to the following 4 combinations: MART1-derived mouse melanoma antigen-specific immune reaction, immune stimulation by mGM-CSF/shmTGF-β2, tumor growth inhibition by shmTGF-β2, and tumor cell-specific lysis via an oncolytic adenovirus. Immune activation was mainly induced by mature tumor-infiltrating dendritic cell (TIDC) and lowered regulatory T cells in tumor-infiltrating lymphocytes (TIL). Taken together, these findings demonstrate that human MART1 induces a mouse melanoma antigen-specific immune reaction. In addition, the results also indicate that combination therapy of MART1 plasmid, together with an oncolytic adenovirus expressing MART1, mGM-CSF, and shmTGF-β2, is a promising candidate for the treatment of malignant melanoma.

Prime-boost immunization by both DNA vaccine and oncolytic adenovirus expressing GM-CSF and shRNA of TGF-β2 induces anti-tumor immune activation

PubMed Central

Choi, Hye Jin; Joo, Yeonsoo; Kim, Joo-Hang; Song, Jae J.

2017-01-01

A successful DNA vaccine for the treatment of tumors should break established immune tolerance to tumor antigen. However, due to the relatively low immunogenicity of DNA vaccines, compared to other kinds of vaccines using live virus or protein, a recombinant viral vector was used to enhance humoral and cellular immunity. In the current study, we sought to develop a novel anti-cancer agent as a complex of DNA and oncolytic adenovirus for the treatment of malignant melanoma in the C57BL/6 mouse model. MART1, a human melanoma-specific tumor antigen, was used to induce an increased immune reaction, since a MART1-protective response is required to overcome immune tolerance to the melanoma antigen MelanA. Because GM-CSF is a potent inducer of anti-tumor immunity and TGF-β2 is involved in tumor survival and host immune suppression, mouse GM-CSF (mGM-CSF) and shRNA of mouse TGF-β2 (shmTGF-β2) genes were delivered together with MART1 via oncolytic adenovirus. MART1 plasmid was also used for antigen-priming. To compare the anti-tumor effect of oncolytic adenovirus expressing both mGM-CSF and shmTGF-β2 (AdGshT) with that of oncolytic adenovirus expressing mGM-CSF only (AdG), each virus was intratumorally injected into melanoma-bearing C57BL/6 mice. As a result, mice that received AdGshT showed delayed tumor growth than those that received AdG. Heterologous prime-boost immunization was combined with oncolytic AdGshT and MART1 expression to result in further delayed tumor growth. This regression is likely due to the following 4 combinations: MART1-derived mouse melanoma antigen-specific immune reaction, immune stimulation by mGM-CSF/shmTGF-β2, tumor growth inhibition by shmTGF-β2, and tumor cell-specific lysis via an oncolytic adenovirus. Immune activation was mainly induced by mature tumor-infiltrating dendritic cell (TIDC) and lowered regulatory T cells in tumor-infiltrating lymphocytes (TIL). Taken together, these findings demonstrate that human MART1 induces a mouse melanoma antigen-specific immune reaction. In addition, the results also indicate that combination therapy of MART1 plasmid, together with an oncolytic adenovirus expressing MART1, mGM-CSF, and shmTGF-β2, is a promising candidate for the treatment of malignant melanoma. PMID:28178658

[Expression and significance of c-fos in resistant cell line TU177/VCR of larynx squamous cell carcinoma].

PubMed

Li, G D; Hu, X L; Xing, J F; Shi, R Y; Li, X; Li, J F; Li, T L

2018-04-07

Objective: To explore the effect of c-fos on multidrug resistance of laryngeal cancer TU177 cells. Method: Increasing drug concentration gradient is adopted to establish the stability of the laryngeal cancer drug resistance in cell line; RT-PCR and Western blot were used to detect difference of the c-fos between TU177 and TU177/VCR cells; plasmids with human c-fos knockdown or over expression were transfected into TU177/VCR and TU177 cells respectively, and the effects of different treatment on cell proliferation were investigated with MTT. Results: The drug resistance of TU177/VCR cells was 26.25-fold in vincristine (VCR), 7.33-fold in Paclitaxel (TAX), 2.41 in cisplatin (DDP), and 5.50 in 5-fluorouracil (5-FU), comparing with TU177( P <0.05). The TU177/VCR cells had significantly higher c-fos expression compared to TU177 cells( P <0.05). The results showed that the IC(50) values of 5-FU for the NC group and c-fos shRNA group were (306.2±6.3)μmol/L and (81.3±3.9)μmol/L, respectively, which was decreased by 73% in the c-fos shRNA group compared to that in the NC group ( P <0.05). Similarly, the results showed that the IC(50) values for 5-FU were (55.3±9.4) μmol/L in NC group and (288.1±7.3)μmol/L in c-fos WT group, which was increased 5.21-fold in c-fos WT cells. Conclusion: C-fos plays important role in multidrug resistance of larynx cancer cell TU177/VCR, and might become a new molecular target for laryngeal cancer treatment.

Effect of small hairpin RNA targeting endothelin-converting enzyme-1 in monocrotaline-induced pulmonary hypertensive rats.

PubMed

Son, Jae Sung; Kim, Kwan Chang; Kim, Bo Kyung; Cho, Min-Sun; Hong, Young Mi

2012-12-01

The purpose of this study was to investigate the therapeutic effects of small hairpin RNA (shRNA) targeting endothelin-converting enzyme (ECE)-1 in monocrotaline (MCT)-induced pulmonary hypertensive rats. Ninty-four Sprague-Dawley rats were divided into three groups: control (n = 24), MCT (n = 35) and shRNA (n = 35). Four-week survival rate in the shRNA group was significantly increased compared to that in the MCT group. The shRNA group showed a significant improvement of right ventricular (RV) pressure compared with the MCT group. The MCT and shRNA groups also showed an increase in RV/(left ventricle + septum) ratio and lung/body weight. Plasma endothelin (ET)-1 concentrations in the shRNA group were lower than those in the MCT group. Medial wall thickness of pulmonary arterioles were increased after MCT injection and was significantly decreased in the shRNA group. The number of intra-acinar muscular pulmonary arteries was decreased in the shRNA group. The mRNA expressions of ET-1 and ET receptor A (ET(A)) were significantly decreased in the shRNA group in week 4. The protein levels of ET(A) were decreased in the shRNA group in week 2. The protein levels of tumor necrosis factor-α and vascular endothelial growth factor were decreased in the shRNA group in week 4. In conclusion, the gene silencing with lentiviral vector targeting ECE-1 could be effective against hemodynamic, histopathological and gene expression changes in pulmonary hypertension.

Creating Transgenic shRNA Mice by Recombinase-Mediated Cassette Exchange

PubMed Central

Premsrirut, Prem K.; Dow, Lukas E.; Park, Youngkyu; Hannon, Gregory J.; Lowe, Scott W.

2014-01-01

RNA interference (RNAi) enables sequence-specific, experimentally induced silencing of virtually any gene by tapping into innate regulatory mechanisms that are conserved among most eukaryotes. The principles that enable transgenic RNAi in cell lines can also be used to create transgenic animals, which express short-hairpin RNAs (shRNAs) in a regulated or tissue-specific fashion. However, RNAi in transgenic animals is somewhat more challenging than RNAi in cultured cells. The activities of promoters that are commonly used for shRNA expression in cell culture can vary enormously in different tissues, and founder lines also typically vary in transgene expression due to the effects of their single integration sites. There are many ways to produce mice carrying shRNA transgenes and the method described here uses recombinase-mediated cassette exchange (RMCE). RMCE permits insertion of the shRNA transgene into a well-characterized locus that gives reproducible and predictable expression in each founder and enhances the probability of potent expression in many cell types. This procedure is more involved and complex than simple pronuclear injection, but if even a few shRNA mice are envisioned, for example, to probe the functions of several genes, the effort of setting up the processes outlined below are well worthwhile. Note that when creating a transgenic mouse, one should take care to use the most potent shRNA possible. As a rule of thumb, the sequence chosen should provide >90% knockdown when introduced into cultured cells at single copy (e.g., on retroviral infection at a multiplicity of ≤0.3). PMID:24003198

The Toxoplasma gondii ME-49 strain upregulates levels of A20 that inhibit NF-κB activation and promotes apoptosis in human leukaemia T-cell lines.

PubMed

Chen, Qian; Pang, Min-Hui; Ye, Xiao-Hong; Yang, Guang; Lin, Chen

2018-05-18

Acute T-lymphocyte leukaemia is a form of haematological malignancy with abnormal activation of NF-κB pathway, which results in high expression of A20 and ABIN1, which constitute a negative feedback mechanism for the regulation of NF-κB activation. Clinical studies have found that acute T-lymphocyte leukaemia patients are susceptible to Toxoplasma gondii infection; however, the effect of T. gondii on the proliferation and apoptosis of human leukaemia T-cells remains unclear. Here, we used the T. gondii ME-49 strain to infect human leukaemia T-cell lines Jurkat and Molt-4, to explore the effect of T. gondii on proliferation and apoptosis, which is mediated by NF-κB in human leukaemia T-cells. The Tunel assay was used to detect cell apoptosis. Cell Counting Kit-8 was used to detect cell proliferation viability. The apoptosis level and the expression level of NF-κB related proteins in human leukaemia T-cells were detected by flow cytometry and Western blotting. Western blotting analyses revealed that the T. gondii ME-49 strain increased the expression of A20 and decreased both ABIN1 expression and NF-κB p65 phosphorylation. By constructing a lentiviral-mediated shRNA to knockdown the A20 gene in Jurkat T-cells and Molt-4 T-cells, the apoptosis levels of the two cell lines decreased after T. gondii ME-49 infection, and levels of NF-κB p65 phosphorylation and ABIN1 were higher than in the non-konckdown group. After knockingdown ABIN1 gene expression by constructing the lentiviral-mediated shRNA and transfecting the recombinant expression plasmid containing the ABIN1 gene into two cell lines, apoptosis levels and cleaved caspase-8 expression increased or decreased in response to T. gondii ME-49 infection, respectively. Our data suggest that ABIN1 protects human leukaemia T-cells by allowing them to resist the apoptosis induced by T. gondii ME-49 and that the T. gondii ME-49 strain induces the apoptosis of human leukaemia T-cells via A20-mediated downregulation of ABIN1 expression.

HIF-1α induces VE-cadherin expression and modulates vasculogenic mimicry in esophageal carcinoma cells

PubMed Central

Tang, Na-Na; Zhu, Hong; Zhang, Hong-Jie; Zhang, Wei-Feng; Jin, Hai-Lin; Wang, Lu; Wang, Pin; He, Gui-Jun; Hao, Bo; Shi, Rui-Hua

2014-01-01

AIM: To investigate whether hypoxia inducible factor (HIF)-1α modulates vasculogenic mimicry (VM) by upregulating VE-cadherin expression in esophageal squamous cell carcinoma (ESCC). METHODS: Esophageal squamous cancer cell lines Eca109 and TE13 were transfected with plasmids harboring small interfering RNAs targeting HIF-1α or VE-cadherin. The proliferation and invasion of esophageal carcinoma cells were detected by MTT and Transwell migration assays. The formation of tubular networks of cells was analyzed by 3D culture in vitro. BALB/c nude mice were used to observe xenograft tumor formation. The relationship between the expression of HIF-1α and VE-cadherin, ephrinA2 (EphA2) and laminin5γ2 (LN5γ2) was measured by Western blot and real-time polymerase chain reaction. RESULTS: Knockdown of HIF-1α inhibited cell proliferation (32.3% ± 6.1% for Eca109 cells and 38.6% ± 6.8% for TE13 cells, P < 0.05). Both Eca109 and TE13 cells formed typical tubular networks. The number of tubular networks markedly decreased when HIF-1α or VE-cadherin was knocked down. Expression of VE-cadherin, EphA2 and LN5γ2 was dramatically inhibited, but the expression of matrix metalloproteinase 2 had no obvious change in HIF-1α-silenced cells. Knockdown of VE-cadherin significantly decreased expression of both EphA2 and LN5γ2 (P < 0.05), while HIF-1α expression was unchanged. The time for xenograft tumor formation was 6 ± 1.2 d for Eca109 cells and Eca109 cells transfected with HIF-1α Neo control short hairpin RNA (shRNA) vector, and 8.4 ± 2.1 d for Eca109 cells transfected with an shRNA against HIF-1α. Knockdown of HIF-1α inhibited vasculogenic mimicry (VM) and tumorigenicity in vivo. CONCLUSION: HIF-1α may modulate VM in ESCC by regulating VE-cadherin expression, which affects VM formation through EphA2 and LN5γ2. PMID:25548487

Polyamidoamine Dendrimer Conjugates with Cyclodextrins as Novel Carriers for DNA, shRNA and siRNA

PubMed Central

Arima, Hidetoshi; Motoyama, Keiichi; Higashi, Taishi

2012-01-01

Gene, short hairpin RNA (shRNA) and small interfering RNA (siRNA) delivery can be particularly used for the treatment of diseases by the entry of genetic materials mammalian cells either to express new proteins or to suppress the expression of proteins, respectively. Polyamidoamine (PAMAM) StarburstTM dendrimers are used as non-viral vectors (carriers) for gene, shRNA and siRNA delivery. Recently, multifunctional PAMAM dendrimers can be used for the wide range of biomedical applications including intracellular delivery of genes and nucleic acid drugs. In this context, this review paper provides the recent findings on PAMAM dendrimer conjugates with cyclodextrins (CyDs) for gene, shRNA and siRNA delivery. PMID:24300184

[Inhibitory effect of Mig-7 silencing by retrovirus-mediated shRNA on vasculogenic mimicry, invasion and metastasis of human hepatocellular carcinoma cells in vitro].

PubMed

Qu, Bo; Sheng, Guan-Nan; Yu, Fei; Chen, Guan-Nan; Lv, Qi; Mao, Zhong-Peng; Guo, Long; Lv, Yi

2016-11-20

To explore the inhibitory effect of migration-inducing gene 7 (Mig-7) gene silencing induced by retroviral-mediated small hairpin RNA (shRNA) on vasculogenic mimicry (VM), invasion and metastasis of human hepatocellular carcinoma (HCC) cells in vitro. Two target sequences (Mig-7 shRNA-1 and Mig-7 shRNA-2) and one negative control sequence (Mig-7 shRNA-N) were synthesized. The recombinant retroviral vectors carrying Mig-7 shRNA were constructed, and HCC cell line MHCC-97H were transfected with Mig-7 shRNA-1, Mig-7 shRNA-2, Mig-7 shRNA-N, or the empty vector, or treated with 125 µg/mL recombinant human endostatin (ES). Mig-7 expression in the treated cells was detected using semi-quantitative PCR and Western blotting. The inhibitory effect of Mig-7 silencing on VM formation was investigated in a 3-dimensional cell culture system; the changes in cell adhesion, invasion and migration were assessed with intercellular adhesion assay, Transwell invasion assay and Transwell migration assay, respectively. The expression of Mig-7 at both mRNA and protein levels decreased significantly, VM formation, invasion and metastasis were suppressed, while intercellular adhesion increased significantly in MHCC-97H cells in Mig-7 shRNA-1 and Mig-7 shRNA-2 groups (P<0.05); such changes were not observed in cells transfected with Mig-7 shRNA-N or the empty vector, nor in cells treated with ES. Mig-7 silencing by retroviral-mediated shRNA significantly inhibits VM formation, invasion and metastasis and increases the intercellular adhesion of the HCC cells, while ES does not have such inhibitory effects.

[Knockdown of STAT3 inhibits proliferation and migration of HepG2 hepatoma cells induced by IFN1].

PubMed

Li, Xiaofang; Wang, Yuqi; Yan, Ben; Fang, Peipei; Ma, Chao; Xu, Ning; Fu, Xiaoyan; Liang, Shujuan

2018-02-01

Objective To prepare lentiviruses expressing shRNA sequences targeting human signal transducer and activator of transcription 3 (STAT3) and detect the effect of STAT3 knockdown on type I interferon (IFN1)-induced proliferation and migration in HepG2 cells. Methods Four STAT3-targeting shRNA sequences (shRNA1-shRNA4) and one control sequence (Ctrl shRNA) were selected and cloned respectively into pLKO.1-sp6-pgk-GFP to construct shRNA-expressing vectors. Along with backbone psPAX2 and pMD2.G vectors, they were separately transfected into HEK293T cells to prepare lentiviruses. HepG2 cells were infected with the lentiviruses. Cytoplastic STAT3 level was detected by Western blotting to screen effective shRNA sequence(s) targeting STAT3. Proliferation and migration of HepG2 cells were analyzed by CCK-8 assay and Transwell TM migration and scratching assay, respectively. To detect the effect of IFN1 on cell proliferation and migration of HepG2 cells, the cells were treated with 2000 U/mL IFNα2b for indicated time and the activation of IFN-triggered STAT1 signal transduction was assayed by Western blotting. Results Two most effective STAT3-targeting shRNA sequences shRNA1 and shRNA2 were selected, and the expression of both STAT3 shRNA significantly decreased proliferation and migration of HepG2 cells. When treated with IFNα2b, 2000 U/mL of IFN1 showed more competent in attenuating growth and migration of HepG2 cells. Our data further proved that knockdown of STAT3 increased the phosphorylation of STAT1, and IFNα2b further enhanced the activation of STAT1 signaling in HepG2 cells. Conclusion Knockdown of STAT3 inhibits cell migration and growth, and rescues IFN response through up-regulating STAT1 signal transduction in HepG2 hepatoma cells.

Advanced glycation end products promote the proliferation and migration of primary rat vascular smooth muscle cells via the upregulation of BAG3

PubMed Central

Li, Cunshu; Chang, Ye; Li, Yuan; Chen, Shuang; Chen, Yintao; Ye, Ning; Dai, Dongxue; Sun, Yingxian

2017-01-01

The present study was aimed to investigate the role of reactive oxygen species (ROS) on advanced glycation end product (AGE)-induced proliferation and migration of vascular smooth muscle cells (VSMCs) and whether Bcl-2-associated athanogene 3 (BAG3) is involved in the process. Primary rat VSMCs were extracted and cultured in vitro. Cell viability was detected by MTT assay and cell proliferation was detected by EdU incorporation assay. Cell migration was detected by wound healing and Transwell assays. BAG3 was detected using qPCR and western blot analysis. Transcriptional and translational inhibitors (actinomycin D and cycloheximide, respectively) were used to study the effect of AGEs on the expression of BAG3 in VSMCs. Lentiviral plasmids containing short hairpin RNA (shRNA) against rat BAG3 or control shRNA were transduced into VSMCs. Cellular ROS were detected by 2′,7′-dichlorofluorescein diacetate (DCFH-DA) staining. Mitochondrial membrane potential was detected by tetramethylrhodamine methyl ester (TMRE) staining. AGEs significantly increased the expression of BAG3 in a dose-and time-dependent manner. Furthermore, AGEs mainly increased the expression of BAG3 mRNA by increasing the RNA synthesis rather than inhibiting the RNA translation. BAG3 knockdown reduced the proliferation and migration of VSMCs induced by AGEs. BAG3 knockdown reduced the generation of ROS and sustained the mitochondrial membrane potential of VSMCs. Reduction of ROS production by N-acetylcysteine (NAC), a potent antioxidant, also reduced the proliferation and migration of VSMCs. On the whole, the present study demonstrated for the first time that AGEs could increase ROS production and promote the proliferation and migration of VSMCs by upregulating BAG3 expression. This study indicated that BAG3 should be considered as a potential target for the prevention and/or treatment of vascular complications of diabetes. PMID:28350077

Integration-free induced pluripotent stem cells derived from a patient with autosomal recessive Alport syndrome (ARAS).

PubMed

Kuebler, Bernd; Aran, Begoña; Miquel-Serra, Laia; Muñoz, Yolanda; Ars, Elisabet; Bullich, Gemma; Furlano, Monica; Torra, Roser; Marti, Merce; Veiga, Anna; Raya, Angel

2017-12-01

A skin biopsy was obtained from a 25-year-old female patient with autosomal recessive Alport syndrome (ARAS) with the homozygous COL4A3 mutation c.345delG, p.(P166Lfs*37). Dermal fibroblasts were derived and reprogrammed by nucleofection with episomal plasmids carrying OCT3/4, SOX2, KLF4 LIN28, L-MYC and p53shRNA. The generated induced Pluripotent Stem Cell (iPSC) clone AS FiPS1 Ep6F-2 was free of genomically integrated reprogramming genes, had the specific homozygous mutation, a stable karyotype, expressed pluripotency markers and generated embryoid bodies which were differentiated towards the three germ layers in vitro. This iPSC line offers a useful resource to study Alport syndrome pathomechanisms and drug testing. Copyright © 2017 The Author(s). Published by Elsevier B.V. All rights reserved.

Generation of integration-free induced pluripotent stem cell lines derived from two patients with X-linked Alport syndrome (XLAS).

PubMed

Kuebler, Bernd; Aran, Begoña; Miquel-Serra, Laia; Muñoz, Yolanda; Ars, Elisabet; Bullich, Gemma; Furlano, Monica; Torra, Roser; Marti, Merce; Veiga, Anna; Raya, Angel

2017-12-01

Skin biopsies were obtained from two male patients with X-linked Alport syndrome (XLAS) with hemizygous COL4A5 mutations in exon 41 or exon 46. Dermal fibroblasts were extracted and reprogrammed by nucleofection with episomal plasmids carrying OCT3/4, SOX2, KLF4 LIN28, L-MYC and p53 shRNA. The generated induced Pluripotent Stem Cell (iPSC) lines AS-FiPS2-Ep6F-28 and AS-FiPS3-Ep6F-9 were free of genomically integrated reprogramming genes, had the specific mutations, a stable karyotype, expressed pluripotency markers and generated embryoid bodies which were differentiated towards the three germ layers in vitro. These iPSC lines offer a useful resource to study Alport syndrome pathomechanisms and drug testing. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Derivation of an induced pluripotent stem cell line (MUSIi004-A) from dermal fibroblasts of a 48-year-old spinocerebellar ataxia type 3 patient.

PubMed

Ritthaphai, Alisa; Wattanapanitch, Methichit; Pithukpakorn, Manop; Heepchantree, Worapa; Soi-Ampornkul, Rungtip; Mahaisavariya, Panchalee; Triwongwaranat, Daranporn; Pattanapanyasat, Kovit; Vatanashevanopakorn, Chinnavuth

2018-05-21

Dermal fibroblasts were obtained from a 48-year-old female patient with spinocerebellar ataxia type 3 (SCA3). Fibroblasts were reprogrammed by nucleofection with episomal plasmids, carrying L-MYC, LIN28, OCT4, SOX2, KLF4, EBNA-1 and shRNA against p53. The SCA3 patient-specific iPSC line, MUSIi004-A, was characterized by immunofluorescence staining to verify the expression of pluripotent markers. The iPSC line exhibited an ability to differentiate into three germ layers by embryoid body (EB) formation. Karyotypic analysis of the MUSIi004-A line was normal. The mutant allele was still present in the iPSC line. This iPSC line represents a useful tool for studying neurodegeneration in SCA3. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

[Screening efficient siRNAs in vitro as the candidate genes for chicken anti-avian influenza virus H5N1 breeding].

PubMed

Zhang, P; Wang, J G; Wan, J G; Liu, W Q

2010-01-01

The frequent disease outbreaks caused by avian influenza virus not only affect the poultry industry but also pose a threat to human safety. To address the problem, RNA interference (RNAi) has recently been widely used as a potential antiviral approach. Transgenesis in combination with RNAi to specifically inhibit avian enza virus gene expression has been proposed to make chickens resistant to the infection. For the transgenic breeding, screening in vitro efficient siRNAs as the candidate genes is one of the most important tasks. Here, we combined an online search tool and a series of bioinformatics programs with a set of rules for designing siRNAs targeted towards different mRNA regions of H5N1 avian influenza virus. Five rational siRNAs were chosen by this method, five U6 promoter-driven shRNA expression plasmids containing the siRNA genes were constructed and used for producing stably transfected MDCK cells. The data obtained by virus titration, IFA, PI-stained flow cytometry, real-time quantitative RT-PCR, and DAS-ELISA analyses showed that all five stably transfected cell lines we re resistant to virusreplication when exposed to 100 CCID50 of avian influenza virus H5N1. Finally, most effective plasmids (pSi-604i and pSi-1597i) as the candidates for making the transgenic chickens were chosen. These findings provide baseline information on use of RNAi technique for breeding transgenic chickens resistant to avian influenza virus.

Effective reduction of the interleukin-1β transcript in osteoarthritis-prone guinea pig chondrocytes via short hairpin RNA mediated RNA interference influences gene expression of mediators implicated in disease pathogenesis.

PubMed

Santangelo, K S; Bertone, A L

2011-12-01

To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RT-PCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2(-ΔΔCT)) method. Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted in a >50% reduction (P=0.0045) or >90% (P=0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. Copyright © 2011 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.

Leptin produced by obese adipose stromal/stem cells enhances proliferation and metastasis of estrogen receptor positive breast cancers.

PubMed

Strong, Amy L; Ohlstein, Jason F; Biagas, Brandi A; Rhodes, Lyndsay V; Pei, Dorothy T; Tucker, H Alan; Llamas, Claire; Bowles, Annie C; Dutreil, Maria F; Zhang, Shijia; Gimble, Jeffrey M; Burow, Matthew E; Bunnell, Bruce A

2015-08-19

The steady increase in the incidence of obesity among adults has been paralleled with higher levels of obesity-associated breast cancer. While recent studies have suggested that adipose stromal/stem cells (ASCs) isolated from obese women enhance tumorigenicity, the mechanism(s) by which this occurs remains undefined. Evidence suggests that increased adiposity results in increased leptin secretion from adipose tissue, which has been shown to increased cancer cell proliferation. Previously, our group demonstrated that ASCs isolated from obese women (obASCs) also express higher levels of leptin relative to ASCs isolated from lean women (lnASCs) and that this obASC-derived leptin may account for enhanced breast cancer cell growth. The current study investigates the impact of inhibiting leptin expression in lnASCs and obASCs on breast cancer cell (BCC) growth and progression. Estrogen receptor positive (ER+) BCCs were co-cultured with leptin shRNA lnASCs or leptin shRNA obASCs and changes in the proliferation, migration, invasion, and gene expression of BCCs were investigated. To assess the direct impact of leptin inhibition in obASCs on BCC proliferation, MCF7 cells were injected alone or mixed with control shRNA obASCs or leptin shRNA obASCs into SCID/beige mice. ER+ BCCs were responsive to obASCs during direct co-culture, whereas lnASCs were unable to increase ER(+) BCC growth. shRNA silencing of leptin in obASCs negated the enhanced proliferative effects of obASC on BCCs following direct co-culture. BCCs co-cultured with obASCs demonstrated enhanced expression of epithelial-to-mesenchymal transition (EMT) and metastasis genes (SERPINE1, MMP-2, and IL-6), while BCCs co-cultured with leptin shRNA obASCs did not display similar levels of gene induction. Knockdown of leptin significantly reduced tumor volume and decreased the number of metastatic lesions to the lung and liver. These results correlated with reduced expression of both SERPINE1 and MMP-2 in tumors formed with MCF7 cells mixed with leptin shRNA obASCs, when compared to tumors formed with MCF7 cells mixed with control shRNA obASCs. This study provides mechanistic insight as to how obesity enhances the proliferation and metastasis of breast cancer cells; specifically, obASC-derived leptin contributes to the aggressiveness of breast cancer in obese women.

Effect and mechanism of PAR-2 on the proliferation of esophageal cancer cells.

PubMed

Quanjun, D; Qingyu, Z; Qiliang, Z; Liqun, X; Jinmei, C; Ziquan, L; Shike, H

2016-11-01

Esophageal Cancer (EC) is a common malignant tumor occurred in the digestive tract. In this study, we investigated the mechanism of Protease Activated Receptor 2 (PAR-2) on the proliferation of esophageal cancer cell. Transfected esophageal cancer (EC) cell (PAR-2shRNA EC109) was established with low stable PAR-2 expression. EC109 cell was treated with PAR-2 agonist, PAR-2 anti-agonist and MAPK inhibitor respectively; Untreated EC109 cell (blank control) and PAR-2shRNA EC109 cell were used for analysis also. The mRNA expressions of PAR-2, ERK1, Cyclin D1, and c-fos in each group were detected by reverse transcript and polymerase chain reaction. Western blot was used to detect the protein expressions in each group. The cell growth curves were drawn to compare the cell growth. Compared with the blank control, the mRNA and protein expressions of PAR-2, Cyclin D1, and c-fos in PAR-2 agonist group increased significantly (p < 0.05), while decreased significantly in PAR-2shRNA EC109 cell and MAPK inhibitor group (p < 0.05). The mRNA expression of ERK1 and protein expression of p-ERK1 increased in PAR-2 agonist group, decreased in PAR-2shRNA EC109 cell and MAPK inhibitor group when compared with blank control (p < 0.05). The growth of cells was upward in PAR-2 agonist group at cell growth phase when compared with blank control, while decreased in PAR-2 shRNA EC109 cell and MAPK inhibitor group with statistical difference (p < 0.05). PAR-2 regulate cell proliferation through the MAPK pathway in esophageal carcinoma cell, and Cyclin D1, c-fos are involved in this process.

Stable suppression of myostatin gene expression in goat fetal fibroblast cells by lentiviral vector-mediated RNAi.

PubMed

Patel, Utsav A; Patel, Amrutlal K; Joshi, Chaitanya G

2015-01-01

Myostatin (MSTN) is a secreted growth factor that negatively regulates skeletal muscle mass, and therefore, strategies to block myostatin-signaling pathway have been extensively pursued to increase the muscle mass in livestock. Here, we report a lentiviral vector-based delivery of shRNA to disrupt myostatin expression into goat fetal fibroblasts (GFFs) that were commonly used as karyoplast donors in somatic-cell nuclear transfer (SCNT) studies. Sh-RNA positive cells were screened by puromycin selection. Using real-time polymerase chain reaction (PCR), we demonstrated efficient knockdown of endogenous myostatin mRNA with 64% down-regulation in sh2 shRNA-treated GFF cells compared to GFF cells treated by control lentivirus without shRNA. Moreover, we have also demonstrated both the induction of interferon response and the expression of genes regulating myogenesis in GFF cells. The results indicate that myostatin-targeting siRNA produced endogenously could efficiently down-regulate myostatin expression. Therefore, targeted knockdown of the MSTN gene using lentivirus-mediated shRNA transgenics would facilitate customized cell engineering, allowing potential use in the establishment of stable cell lines to produce genetically engineered animals. © 2014 American Institute of Chemical Engineers.

Gene Electrotransfer of Plasmid with Tissue Specific Promoter Encoding shRNA against Endoglin Exerts Antitumor Efficacy against Murine TS/A Tumors by Vascular Targeted Effects.

PubMed

Stimac, Monika; Dolinsek, Tanja; Lampreht, Ursa; Cemazar, Maja; Sersa, Gregor

2015-01-01

Vascular targeted therapies, targeting specific endothelial cell markers, are promising approaches for the treatment of cancer. One of the targets is endoglin, transforming growth factor-β (TGF-β) co-receptor, which mediates proliferation, differentiation and migration of endothelial cells forming neovasculature. However, its specific, safe and long-lasting targeting remains the challenge. Therefore, in our study we evaluated the transfection efficacy, vascular targeted effects and therapeutic potential of the plasmid silencing endoglin with the tissue specific promoter, specific for endothelial cells marker endothelin-1 (ET) (TS plasmid), in comparison to the plasmid with constitutive promoter (CON plasmid), in vitro and in vivo. Tissue specificity of TS plasmid was demonstrated in vitro on several cell lines, and its antiangiogenic efficacy was demonstrated by reducing tube formation of 2H11 endothelial cells. In vivo, on a murine mammary TS/A tumor model, we demonstrated good antitumor effect of gene electrotransfer (GET) of either of both plasmids in treatment of smaller tumors still in avascular phase of growth, as well as on bigger tumors, already well vascularized. In support to the observations on predominantly vascular targeted effects of endoglin, histological analysis has demonstrated an increase in necrosis and a decrease in the number of blood vessels in therapeutic groups. A significant antitumor effect was observed in tumors in avascular and vascular phase of growth, possibly due to both, the antiangiogenic and the vascular disrupting effect. Furthermore, the study indicates on the potential use of TS plasmid in cancer gene therapy since the same efficacy as of CON plasmid was determined.

A simple and robust vector-based shRNA expression system used for RNA interference.

PubMed

Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi

2013-01-01

RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

Expression of short hairpin RNAs using the compact architecture of retroviral microRNA genes.

PubMed

Burke, James M; Kincaid, Rodney P; Aloisio, Francesca; Welch, Nicole; Sullivan, Christopher S

2017-09-29

Short hairpin RNAs (shRNAs) are effective in generating stable repression of gene expression. RNA polymerase III (RNAP III) type III promoters (U6 or H1) are typically used to drive shRNA expression. While useful for some knockdown applications, the robust expression of U6/H1-driven shRNAs can induce toxicity and generate heterogeneous small RNAs with undesirable off-target effects. Additionally, typical U6/H1 promoters encompass the majority of the ∼270 base pairs (bp) of vector space required for shRNA expression. This can limit the efficacy and/or number of delivery vector options, particularly when delivery of multiple gene/shRNA combinations is required. Here, we develop a compact shRNA (cshRNA) expression system based on retroviral microRNA (miRNA) gene architecture that uses RNAP III type II promoters. We demonstrate that cshRNAs coded from as little as 100 bps of total coding space can precisely generate small interfering RNAs (siRNAs) that are active in the RNA-induced silencing complex (RISC). We provide an algorithm with a user-friendly interface to design cshRNAs for desired target genes. This cshRNA expression system reduces the coding space required for shRNA expression by >2-fold as compared to the typical U6/H1 promoters, which may facilitate therapeutic RNAi applications where delivery vector space is limiting. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Effects of tissue factor, PAR-2 and MMP-9 expression on human breast cancer cell line MCF-7 invasion.

PubMed

Lin, Zeng-Mao; Zhao, Jian-Xin; Duan, Xue-Ning; Zhang, Lan-Bo; Ye, Jing-Ming; Xu, Ling; Liu, Yin-Hua

2014-01-01

This study aimed to explore the expression of tissue factor (TF), protease activated receptor-2 (PAR-2), and matrix metalloproteinase-9 (MMP-9) in the MCF-7 breast cancer cell line and influence on invasiveness. Stable MCF-7 cells transfected with TF cDNA and with TF ShRNA were established. TF, PAR-2, and MMP-9 protein expression was analyzed using indirect immunofluorescence and invasiveness was evaluated using a cell invasion test. Effects of an exogenous PAR-2 agonist were also examined. TF protein expression significantly differed between the TF cDNA and TF ShRNA groups. MMP-9 protein expression was significantly correlated with TF protein expression, but PAR-2 protein expression was unaffected. The PAR- 2 agonist significantly enhanced MMP-9 expression and slightly increased TF and PAR-2 expression in the TF ShRNA group, but did not significantly affect protein expression in MCF-7 cells transfected with TF cDNA. TF and MMP-9 expression was positively correlated with the invasiveness of tumor cells. TF, PAR-2, and MMP-9 affect invasiveness of MCF-7 cells. TF may increase MMP-9 expression by activating PAR-2.

Design and cloning strategies for constructing shRNA expression vectors

PubMed Central

McIntyre, Glen J; Fanning, Gregory C

2006-01-01

Background Short hairpin RNA (shRNA) encoded within an expression vector has proven an effective means of harnessing the RNA interference (RNAi) pathway in mammalian cells. A survey of the literature revealed that shRNA vector construction can be hindered by high mutation rates and the ensuing sequencing is often problematic. Current options for constructing shRNA vectors include the use of annealed complementary oligonucleotides (74 % of surveyed studies), a PCR approach using hairpin containing primers (22 %) and primer extension of hairpin templates (4 %). Results We considered primer extension the most attractive method in terms of cost. However, in initial experiments we encountered a mutation frequency of 50 % compared to a reported 20 – 40 % for other strategies. By modifying the technique to be an isothermal reaction using the DNA polymerase Phi29, we reduced the error rate to 10 %, making primer extension the most efficient and cost-effective approach tested. We also found that inclusion of a restriction site in the loop could be exploited for confirming construct integrity by automated sequencing, while maintaining intended gene suppression. Conclusion In this study we detail simple improvements for constructing and sequencing shRNA that overcome current limitations. We also compare the advantages of our solutions against proposed alternatives. Our technical modifications will be of tangible benefit to researchers looking for a more efficient and reliable shRNA construction process. PMID:16396676

Transforming Growth Factor-β Promotes Liver Tumorigenesis in Mice via Up-regulation of Snail.

PubMed

Moon, Hyuk; Ju, Hye-Lim; Chung, Sook In; Cho, Kyung Joo; Eun, Jung Woo; Nam, Suk Woo; Han, Kwang-Hyub; Calvisi, Diego F; Ro, Simon Weonsang

2017-11-01

Transforming growth factor beta (TGF-β) suppresses early stages of tumorigenesis, but also contributes to migration and metastasis of cancer cells. A large number of human tumors contain mutations that inactivate its receptors, or downstream proteins such as Smad transcription factors, indicating that the TGF-β signaling pathway prevents tumor growth. We investigated the effects of TGF-β inhibition on liver tumorigenesis in mice. C57BL/6 mice received hydrodynamic tail-vein injections of transposons encoding HRAS G12V and a short hairpin RNA (shRNA) to down-regulate p53, or those encoding HRAS G12V and MYC, or those encoding HRAS G12V and TAZ S89A , to induce liver tumor formation; mice were also given injections of transposons encoding SMAD7 or shRNA against SMAD2, SMAD3, SMAD4, or SNAI1 (Snail), with or without ectopic expression of Snail. Survival times were compared, and livers were weighted and examined for tumors. Liver tumor tissues were analyzed by quantitative reverse-transcription PCR, RNA sequencing, immunoblots, and immunohistochemistry. We analyzed gene expression levels in human hepatocellular carcinoma samples deposited in The Cancer Genome Atlas. A cell proliferation assay was performed using human liver cancer cell lines (HepG2 and Huh7) stably expressing Snail or shRNA against Snail. TGF-β inhibition via overexpression of SMAD7 (or knockdown of SMAD2, SMAD3, or SMAD4) consistently reduced formation and growth of liver tumors in mice that expressed activated RAS plus shRNA against p53, or in mice that expressed activated RAS and TAZ. TGF-β signaling activated transcription of the Snail gene in liver tumors induced by HRAS G12V and shRNA against p53, and by activated RAS and TAZ. Knockdown of Snail reduced liver tumor formation in both tumor models. Ectopic expression of Snail restored liver tumorigenesis suppressed by disruption of TGF-β signaling. In human hepatocellular carcinoma, Snail expression correlated with TGF-β activation. Ectopic expression of Snail increased cellular proliferation, whereas Snail knockdown led to reduced proliferation in human hepatocellular carcinoma cells. In analyses of transgenic mice, we found TGF-β signaling to be required for formation of liver tumors upon expression of activated RAS and shRNA down-regulating p53, and upon expression of activated RAS and TAZ. Snail is the TGF-β target that is required for hepatic tumorigenesis in these models. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

Effects of C-myc gene silencing on interleukin-1β-induced rat chondrocyte cell proliferation, apoptosis and cytokine expression.

PubMed

Zou, Jian; Li, Xiao-Lin; Shi, Zhong-Min; Xue, Jian-Feng

2018-05-01

This study explores the effects of C-myc gene silencing on cell proliferation, apoptosis and cytokine expression in interleukin (IL)-1β-induced rat chondrocytes. Primary chondrocytes were obtained from 40 Sprague-Dawley rats. For in vitro C-myc3-shRNA transfection, chondrocytes were assigned to a blank 1, model 1, IL-1β + C-myc3-shRNA, C-myc3-shRNA, (IL-1β + C-myc3-shRNA) + C-myc overexpression, C-myc3-shRNA + C-myc overexpression or IL-1β + C-myc-Con group. Western blotting and quantitative real-time polymerase chain reaction (qRT-PCR) were performed to detect C-myc, PCNA and cyclin D1 mRNA and protein expression. Cell proliferation was analyzed via CCK-8 assay and cell cycle while apoptosis was measured through flow cytometry. ELISA was utilized to assess the levels of metallopeptidase 13 (MMP-13), IL-6 and tumor necrosis factor-α (TNF-α). Both the qRT-PCR and Western blotting results demonstrated that C-myc3-shRNA transfection inhibits C-myc expression and promotes PCNA and cyclin D1 expression. In comparison to the model 1 group, all groups except the (IL-1β + C-myc3-shRNA) + C-myc overexpression and IL-1β + C-myc-Con groups showed increases in cell proliferation and S phase cell count and decreases in G 0 /G 1 phase cell count, cell apoptosis and MMP-13, IL-6 and TNF-α levels. The model 1, C-myc3-shRNA and C-myc3-shRNA + C-myc overexpression groups displayed higher cell proliferation and S phase cell count and reduced G 0 /G 1 phase cell count, cell apoptosis and MMP-13, IL-6 and TNF-α levels than the IL-1β + C-myc3-shRNA group. In comparison to the model 1 and C-myc3-shRNA + C-myc overexpression groups, the C-myc3-shRNA group promoted cell proliferation and S phase cell counts but suppressed G 0 /G 1 phase cell count, cell apoptosis and MMP-13, IL-6 and TNF-α levels. In conclusion, the study demonstrates that C-myc gene silencing can promote cell proliferation and inhibit cell apoptosis and cytokine expression in IL-1β-induced rat chondrocytes.

Ribonucleic acid interference knockdown of interleukin 6 attenuates cold-induced hypertension.

PubMed

Crosswhite, Patrick; Sun, Zhongjie

2010-06-01

The purpose of this study was to determine the role of the proinflammatory cytokine interleukin (IL) 6 in cold-induced hypertension. Four groups of male Sprague-Dawley rats were used (6 rats per group). After blood pressure was stabilized, 3 groups received intravenous delivery of adenoassociated virus carrying IL-6 small hairpin RNA (shRNA), adenoassociated virus carrying scrambled shRNA, and PBS, respectively, before exposure to a cold environment (5 degrees C). The last group received PBS and was kept at room temperature (25 degrees C, warm) as a control. Adenoassociated virus delivery of IL-6 shRNA significantly attenuated cold-induced elevation of systolic blood pressure and kept it at the control level for < or =7 weeks (length of the study). Chronic exposure to cold upregulated IL-6 expression in aorta, heart, and kidneys and increased macrophage and T-cell infiltration in kidneys, suggesting that cold exposure increases inflammation. IL-6 shRNA delivery abolished the cold-induced upregulation of IL-6, indicating effective silence of IL-6. Interestingly, RNA interference knockdown of IL-6 prevented cold-induced inflammation, as evidenced by a complete inhibition of tumor necrosis factor-alpha expression and leukocyte infiltration by IL-6 shRNA. RNA interference knockdown of IL-6 significantly decreased the cold-induced increase in vascular superoxide production. It is noted that IL-6 shRNA abolished the cold-induced increase in collagen deposition in the heart, suggesting that inflammation is involved in cold-induced cardiac remodeling. Cold exposure caused glomerular collapses, which could be prevented by knockdown of IL-6, suggesting an important role of inflammation in cold-induced renal damage. In conclusion, cold exposure increased IL-6 expression and inflammation, which play critical roles in the pathogenesis of cold-induced hypertension and cardiac and renal damage.

N-Myc knockdown and apigenin treatment controlled growth of malignant neuroblastoma cells having N-Myc amplification

PubMed Central

Hossain, Md. Motarab; Banik, Naren L.; Ray, Swapan K.

2013-01-01

Malignant neuroblastomas mostly occur in children and are frequently associated with N-Myc amplification. Oncogene amplification, which is selective increase in copy number of the oncogene, provides survival advantages in solid tumors including malignant neuroblastoma. We have decreased expression of N-Myc oncogene using short hairpin RNA (shRNA) plasmid to increase anti-tumor efficacy of the isoflavonoid apigenin (APG) in human malignant neuroblastoma SK-N-DZ and SK-N-BE2 cell lines that harbor N-Myc amplification. N-Myc knockdown induced morphological and biochemical features of neuronal differentiation. Combination of N-Myc knockdown and APG most effectively induced morphological and biochemical features of apoptotic death. This combination therapy also prevented cell migration and decreased N-Myc driven survival, angiogenic, and invasive factors. Collectively, N-Myc knockdown and APG treatment is a promising strategy for controlling the growth of human malignant neuroblastoma cell lines that harbor N-Myc amplification. PMID:23941992

N-Myc knockdown and apigenin treatment controlled growth of malignant neuroblastoma cells having N-Myc amplification.

PubMed

Hossain, Md Motarab; Banik, Naren L; Ray, Swapan K

2013-10-15

Malignant neuroblastomas mostly occur in children and are frequently associated with N-Myc amplification. Oncogene amplification, which is selective increase in copy number of the oncogene, provides survival advantages in solid tumors including malignant neuroblastoma. We have decreased expression of N-Myc oncogene using short hairpin RNA (shRNA) plasmid to increase anti-tumor efficacy of the isoflavonoid apigenin (APG) in human malignant neuroblastoma SK-N-DZ and SK-N-BE2 cell lines that harbor N-Myc amplification. N-Myc knockdown induced morphological and biochemical features of neuronal differentiation. Combination of N-Myc knockdown and APG most effectively induced morphological and biochemical features of apoptotic death. This combination therapy also prevented cell migration and decreased N-Myc driven survival, angiogenic, and invasive factors. Collectively, N-Myc knockdown and APG treatment is a promising strategy for controlling the growth of human malignant neuroblastoma cell lines that harbor N-Myc amplification. © 2013 Elsevier B.V. All rights reserved.

[Lentiviral vector-mediated short hairpin RNA targeting survivin inhibits abdominal growth of human endometrium xenograft in nude mice].

PubMed

Peng, Dongxian; He, Yuanli

2015-02-01

To investigate the inhibitory effect of lentiviral vector-mediated short hairpin RNA targeting survivin (LV-survivin shRNA) on the growth of human endometrium xenograft in the abdominal cavity of nude mice. The endometrium xenografts from 8 women with endometriosis were injected into the peritoneal cavities of 45 nude mice. The mice were then randomly assigned to receive intraperitoneal injection of LV-survivin shRNA, pGCL-NC-GFP (negative control) or PBS (blank control). Two weeks later, the number and morphometry of endometriotic lesions were quantified and the expression of survivin protein were detected by immunohistochemistry. The formation of endometriotic lesions was significantly suppressed in mice receiving LV-survivin shRNA injection as compared with those in the two control groups (P/0.001). The mice in LV-survivin-shRNA group showed significantly down-regulated expression levels of survivin protein compared with those in the negative and blank control groups, presenting also necrosis in the endometriosis-like lesions in microscopic observation. Lentiviral vector-mediated shRNA can effectively inhibit the expression of survivin in human endometrium xengrafts and suppress the formation and growth of endometriotic lesions in the abdominal cavities of nude mice.

Modulation of ColE1-like Plasmid Replication for Recombinant Gene Expression

PubMed Central

Camps, Manel

2010-01-01

ColE1-like plasmids constitute the most popular vectors for recombinant protein expression. ColE1 plasmid replication is tightly controlled by an antisense RNA mechanism that is highly dynamic, tuning plasmid metabolic burden to the physiological state of the host. Plasmid homeostasis is upset upon induction of recombinant protein expression because of non-physiological levels of expression and because of the frequently biased amino acid composition of recombinant proteins. Disregulation of plasmid replication is the main cause of collapse of plasmid-based expression systems because of a simultaneous increase in the metabolic burden (due to increased average copy number) and in the probability of generation of plasmid-free cells (due to increased copy number variation). Interference between regulatory elements of co-resident plasmids causes comparable effects on plasmid stability (plasmid incompatibility). Modulating plasmid copy number for recombinant gene expression aims at achieving a high gene dosage while preserving the stability of the expression system. Here I present strategies targeting plasmid replication for optimizing recombinant gene expression. Specifically, I review approaches aimed at modulating the antisense regulatory system (as well as their implications for plasmid incompatibility) and innovative strategies involving modulation of host factors, of R-loop formation, and of the timing of recombinant gene expression. PMID:20218961

The Role of Lymphangiogenesis in Orthotopic Prostatic Tumor-Environment on Regional and Systemic Metastasis

DTIC Science & Technology

2008-01-01

expressing Renilla luciferase and VEGF-C shRNA or irrelevant firefly luciferase shRNA (Ctrl) were implanted orthotopically as before. To determine the...on metastasis in Pten knockout model (Month 10-24): a) Generate Ubc/sVEGFR-3 and Ubc/ Renilla luciferase (RL) lentiviral vectors by subcloning...progression (month 10-12) c) Monitor efficiency of Ubc/lentiviral transduction and expression in Pten (-/-) prostate using optical imaging of Renilla

[Effect of DOT1L gene silence on proliferation of acute monocytic leukemia cell line THP-1].

PubMed

Zhang, Yu-Juan; Li, Hua-Wen; Chang, Guo-Qiang; Zhang, Hong-Ju; Wang, Jian; Lin, Ya-Ni; Zhou, Jia-Xi; Li, Qing-Hua; Pang, Tian-Xiang

2013-08-01

This study was aimed to investigate the influence of short hairpin RNA (shRNA) on proliferation of human leukemia cell line THP-1. The shRNA targeting the site 732-752 of DOT1L mRNA was designed and chemically synthesized, then a single-vector lentiviral, tet-inducible shRNA-DOT1L system (Plko-Tet-On) was generated. Thereafter, the THP-1 cells with lentivirus were infected to create stable cell line with regulatable shRNA expression. The expression of DOT1L in the THP-1 cell line was assayed by RT-PCR. Effect of shRNA-DOT1L on the proliferation of THP-1 cells was detected with MTT method,and the change of colony forming potential of THP-1 cells was analyzed by colony forming unit test. Cell cycle distribution was tested by flow cytometry. The results indicated that the expression of DOT1L was statistically lower than that in the control groups. The proliferation and colony forming capacity of THP-1 cells were significantly inhibited. The percentage of cells at G0/G1 phase increased in THP-1/shRNA cells treated with Dox while the percentage of cells at S phase significantly decreased as compared with that in the control group. It is concluded that the shRNA targeting DOT1L can effectively inhibit the proliferation of acute monocytic leukemia cell line THP-1.

Large-pore mesoporous silica nanospheres as vehicles for delivering TRAF3-shRNA plasmids to Kupffer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Junyong, E-mail: zhangmachine@hotmail.com; Guo, Shipeng, E-mail: guoshipeng2008@126.com; Zhang, Wenfeng, E-mail: Sadengren8881@163.com

The currently available techniques for transferring exogenous genes into macrophages, especially the targeted import of exogenous genes into Kupffer cells (KCs) in vivo, are inefficient and achieve only low targeting. Novel Large-Pore Mesoporous Silica Nanospheres (LPMSNs) may be a promising gene transfection agent for KCs because of their superior biodegradation and hypotoxic characteristics, as well as their ability to retain the biological function of KCs and the high loading-rate of exogenous plasmid. LPMSNs were able to completely adsorb shRNA-TRAF3 (tumor necrosis factor receptor-associated factor-3) plasmid at a mass ratio as low as 30:1, and exhibited a low cytotoxicity for KCs. LPMSNsmore » were detected in KC cytoplasm in vitro, and transmission electron microscopy (TEM) revealed that they were present only in KCs in liver tissue in vivo. The max KC transfection efficiency with LPMSNs was 34.8± 0.07%, as evaluated using flow cytometry, and the protein and mRNA levels of TRAF3 were significantly inhibited (P < 0.05) by shRNA-TRAF3 plasmid transfection after 24 h in vitro and 48 h in vivo. In conclusion, KC targeted transfection was achieved successfully by LPMSNs carrying shRNA-TRAF3 plasmids in vitro and vivo. The protein and mRNA levels of TRAF3 were suppressed significantly. These results suggest that LPMSNs are a promising vehicle for delivering exogenous genes into KCs in vitro and vivo. - Highlights: • We constructed Large-Pore Mesoporous Silica Nanospheres (LPMSNs). • LPMSNs adsorbed high quantity of plasmid. • Low cytotoxicity of LPMSNs to Kupffer cells. • LPMSNs delivered plasmid into Kupffer cells.« less

Short Hairpin Ribonucleic Acid Constructs Targeting Insulin-like Growth Factor Binding Protein-3 Reversed Decreased Testosterone Concentrations in Diabetic Rats

PubMed Central

Zhou, Zhang-Yan; Fei-Li; Cheng, Shao-Ping; Huang, Hui; Peng, Bi-Wen; Wang, Jing; Liu, Chang-Mao; Xing, Cheng; Sun, Ya-Ling; Bsoul, Najeeb; Pan, Hui; Yi, Cun-Jian; Liu, Rong-Hua; Zhong, Guang-Jun

2015-01-01

Background The aim of this study was to determine if shRNA constructs targeting insulin-like growth factor binding protein-3 can rehabilitate decreased serum testosterone concentrations in streptozotocin-induced diabetic rats. Material/Methods After 12 weeks of intracavernous administration of IGFBP-3 shRNA, intracavernous pressure responses to electrical stimulation of cavernous nerves were evaluated. The expression of IGFBP-3 at mRNA and protein levels was detected by quantitative real-time PCR analysis and Western blot, respectively. The concentrations of serum testosterone and cavernous cyclic guanosine monophosphate were detected by enzyme-linked immunosorbent assay. Results After 12 weeks of intracavernous administration of IGFBP-3 shRNA, the cavernosal pressure was significantly increased in response to the cavernous nerves stimulation compared to the diabetic control group (p<0.01). Cavernous IGFBP-3 expression at both mRNA and protein levels was significantly inhibited. Both serum testosterone and cavernous cyclic guanosine monophosphate concentrations were significantly increased in the IGFBP-3 shRNA treatment group compared to the diabetic control group (p<0.01). Conclusions These results suggest that IGFBP-3 shRNA may rehabilitate erectile function via increases of concentrations of serum testosterone and cavernous cyclic guanosine monophosphate in streptozotocin-induced diabetic rats. PMID:25582342

In vivo Postnatal Electroporation and Time-lapse Imaging of Neuroblast Migration in Mouse Acute Brain Slices

PubMed Central

Oudin, Madeleine Julie; Doherty, Patrick; Lalli, Giovanna

2013-01-01

The subventricular zone (SVZ) is one of the main neurogenic niches in the postnatal brain. Here, neural progenitors proliferate and give rise to neuroblasts able to move along the rostral migratory stream (RMS) towards the olfactory bulb (OB). This long-distance migration is required for the subsequent maturation of newborn neurons in the OB, but the molecular mechanisms regulating this process are still unclear. Investigating the signaling pathways controlling neuroblast motility may not only help understand a fundamental step in neurogenesis, but also have therapeutic regenerative potential, given the ability of these neuroblasts to target brain sites affected by injury, stroke, or degeneration. In this manuscript we describe a detailed protocol for in vivo postnatal electroporation and subsequent time-lapse imaging of neuroblast migration in the mouse RMS. Postnatal electroporation can efficiently transfect SVZ progenitor cells, which in turn generate neuroblasts migrating along the RMS. Using confocal spinning disk time-lapse microscopy on acute brain slice cultures, neuroblast migration can be monitored in an environment closely resembling the in vivo condition. Moreover, neuroblast motility can be tracked and quantitatively analyzed. As an example, we describe how to use in vivo postnatal electroporation of a GFP-expressing plasmid to label and visualize neuroblasts migrating along the RMS. Electroporation of shRNA or CRE recombinase-expressing plasmids in conditional knockout mice employing the LoxP system can also be used to target genes of interest. Pharmacological manipulation of acute brain slice cultures can be performed to investigate the role of different signaling molecules in neuroblast migration. By coupling in vivo electroporation with time-lapse imaging, we hope to understand the molecular mechanisms controlling neuroblast motility and contribute to the development of novel approaches to promote brain repair. PMID:24326479

P2Y12 shRNA treatment decreases SGC activation to relieve diabetic neuropathic pain in type 2 diabetes mellitus rats.

PubMed

Wang, Shouyu; Wang, Zilin; Li, Lin; Zou, Lifang; Gong, Yingxin; Jia, Tianyu; Zhao, Shanhong; Yuan, Huilong; Shi, Liran; Liu, Shuangmei; Wu, Bing; Yi, Zhihua; Liu, Hui; Gao, Yun; Li, Guilin; Deussing, Jan M; Li, Man; Zhang, Chunping; Liang, Shangdong

2018-06-26

Diabetic neuropathic pain is a common complication of type 2 diabetes mellitus (DM). Activation of satellite glial cells (SGCs) in the dorsal root ganglia (DRG) plays a crucial role in neuropathic pain through the release of proinflammatory cytokines. The P2Y12 receptor is expressed in SGCs of the DRG. In this study, our aim was to investigate the role of the P2Y12 receptor on the pathological changes in diabetic neuropathic pain. The present study showed that diabetic neuropathic pain increased mechanical and thermal hyperalgesia in type 2 DM model rats. The results showed that the expression levels of P2Y12 messenger RNA (mRNA) and protein in DRG SGCs were increased in DM model rats compared with control rats. Glial fibrillary acidic protein (GFAP) and interleukin-1β (IL-1β) expression levels in the DRG were increased in DM rats. Upregulation of GFAP is a marker of SGC activation. Targeting the P2Y12 receptor by short hairpin RNA (shRNA) decreased the upregulated expression of P2Y12 mRNA and protein, coexpression of P2Y12 and GFAP, the expression of GFAP, IL-1β, and tumor necrosis factor-receptor 1 in the DRG of DM rats, and relieved mechanical and thermal hyperalgesia in DM rats. After treatment with the P2Y12 receptor shRNA, the enhancing integrated OPTICAL density (IOD) ratios of p-P38 MAPK to P38 mitogen activated protein kinase (MAPK) in the DM rats treated with P2Y12 shRNA were significantly lower than that in the untreated DM rats. Therefore, P2Y12 shRNA treatment decreased SGC activation to relieve mechanical and thermal hyperalgesia in DM rats. © 2018 Wiley Periodicals, Inc.

[Lentivirus-mediated shRNA silencing of LAMP2A inhibits the proliferation of multiple myeloma cells].

PubMed

Li, Lixuan; Li, Jia

2015-05-01

To study the effects of lentivirus-mediated short hairpin RNA (shRNA) silencing of lysosome-associated membrane protein type 2A (LAMP2A) expression on the proliferation of multiple myeloma cells. The constructed shRNA lentiviral vector was applied to infect human multiple myeloma cell line MM.1S, and stable expression cell line was obtained by puromycin screening. Western blotting was used to verify the inhibitory effect on LAMP2A protein expression. MTT assay was conducted to detect the effect of knocked-down LAMP2A on MM.1S cell proliferation, and the anti-tumor potency of suberoylanilide hydroxamic acid (SAHA) against the obtained MM.1S LAMP2A(shRNA) stable cell line. Lactate assay was performed to observe the impact of low LAMP2A expression on cell glycolysis. The stable cell line with low LAMP2A expression were obtained with the constructed human LAMP2A-shRNA lentiviral vector. Down-regulation of LAMP2A expression significantly inhibited MM.1S cell proliferation and enhanced the anti-tumor activity of SAHA. Interestingly, decreased LAMP2A expression also inhibited MM.1S cell lactic acid secretion. Down-regulation of LAMP2A expression could inhibit cell proliferation in multiple myeloma cells.

Alteration of a recombinant protein N-glycan structure in silkworms by partial suppression of N-acetylglucosaminidase gene expression.

PubMed

Kato, Tatsuya; Kikuta, Kotaro; Kanematsu, Ayumi; Kondo, Sachiko; Yagi, Hirokazu; Kato, Koichi; Park, Enoch Y

2017-09-01

To synthesize complex type N-glycans in silkworms, shRNAs against the fused lobe from Bombyx mori (BmFDL), which codes N-acetylglucosaminidase (GlcNAcase) in the Golgi, was expressed by recombinant B. mori nucleopolyhedrovirus (BmNPV) in silkworm larvae. Expression was under the control of the actin promoter of B. mori or the U6-2 and i.e.-2 promoters from Orgyia pseudotsugata multiple nucleopolyhedrovirus (OpMNPV). The reduction of specific GlcNAcase activity was observed in Bm5 cells and silkworm larvae using the U6-2 promoter. In silkworm larvae, the partial suppression of BmFDL gene expression was observed. When shRNA against BmFDL was expressed under the control of U6-2 promoter, the Man 3 GlcNAc(Fuc)GlcNAc structure appeared in a main N-glycans of recombinant human IgG. These results suggested that the control of BmFDL expression by its shRNA in silkworms caused the modification of its N-glycan synthetic pathway, which may lead to the alteration of N-glycans in the expressed recombinant proteins. Suppression of BmFDL gene expression by shRNA is not sufficient to synthesize complex N-glycans in silkworm larvae but can modify the N-glycan synthetic pathway.

[Knock-down of ZEB1 inhibits the proliferation, invasion and migration of gastric cancer cells].

PubMed

Chen, Dengyu; Chu, Yifan; Zheng, Qingwei; Xu, Zhiben; Zhou, Ping; Li, Sheng

2017-08-01

Objective To down-regulate the expression of zinc-finger E-box binding homeobox 1 (ZEB1) gene by shRNA, and investigate its effect on invasion, migration and proliferation, as well as the related gene expressions of lncRNA HOTAIR and E-cadherin in human gastric cancer BGC823 cells. Methods RNA interfering (RNAi) was used to knock down ZEB1 in gastric cancer BGC823 cells. The recombinant plasmid shZEB1 was constructed and transfected into the gastric cancer BGC823 cells by Lipofectamine TM 2000, and the stably transfected cells were isolated by G418 selection and limited dilution. The expression of ZEB1 mRNA and protein was detected by real-time quantitative PCR and Western blot analysis. Cell proliferation was determined by MTT assay, and the invasion and migration abilities of BGC823 cells were monitored by Transwell TM invasion assay and wound healing assay, respectively. The expressions of lncRNA HOTAIR and E-cadherin mRNA were detected by real-time quantitative PCR. Results After ZEB1 expression was successfully down-regulated in BGC823 cells by siRNA, the proliferation, invasion and migration rates in shZEB1 transfection group were significantly lower than those in control group; meanwhile, the expression of lncRNA HOTAIR was reduced and E-cadherin expression was enhanced. Conclusion Knock-down of ZEB1 expression by RNA interference can decease lncRNA HOTAIR expression and restrain cell proliferation, invasion and migration in gastric cancer BGC823 cells.

Plasmid expression and maintenance during long-term starvation-survival of bacteria in well water.

PubMed Central

Caldwell, B A; Ye, C; Griffiths, R P; Moyer, C L; Morita, R Y

1989-01-01

Strains of enteric bacteria and pseudomonads containing plasmid R388::Tnl721 (Tpr, Tcr) or pRO101 (Hgr, Tcr) were starved for over 250 days in sterile well water to evaluate effects of starvation-survival on plasmid expression and maintenance. Viable populations dropped to between approximately 0.1 and 1% of the initial populations. Escherichia coli(pRO101) and Pseudomonas cepacia(pRO101) lost both viability and plasmid expression at a lower rate than strains containing R388::Tnl721. Three patterns of host-plasmid interaction were detected: (i) no apparent loss of plasmid expression, (ii) loss of plasmid expression on initial recovery with subsequent expression upon resuscitation, and (iii) loss of capability to produce functional plasmid resistance. PMID:2782868

Hypoxia-inducible bidirectional shRNA expression vector delivery using PEI/chitosan-TBA copolymers for colorectal Cancer gene therapy.

PubMed

Javan, Bita; Atyabi, Fatemeh; Shahbazi, Majid

2018-06-01

This investigation was conducted to construct a hypoxia/colorectal dual-specific bidirectional short hairpin RNA (shRNA) expression vector and to transfect it into the colon cancer cell line HT-29 with PEI/chitosan-TBA nanoparticles for the simultaneous knock down of β-catenin and Bcl-2 under hypoxia. To construct a pRNA-bipHRE-CEA vector, the carcinoma embryonic antigen (CEA) promoter designed in two directions and the vascular endothelial growth factor (VEGF) enhancer were inserted between two promoters for hypoxic cancer specific gene expression. To confirm the therapeutic effect of the dual-specific vector, β-catenin and Bcl-2 shRNAs were inserted downstream of each promoter. The physicochemical properties, the cytotoxicity, and the transfection efficiency of these PEI/chitosan-TBA nanoparticles were investigated. In addition, the antitumor effects of the designed vector on the expression of β-catenin and Bcl-2, cell cycle distribution, and apoptosis were investigated in vitro. The silencing effect of the hypoxia-response shRNA expression vector was relatively low (18%-25%) under normoxia, whereas it was significantly increased to approximately 50%-60% in the HT-29 cell line. Moreover, the cancer cells showed significant G0/G1 arrest and increased apoptosis due to gene silencing under hypoxia. Furthermore, MTS assay, fluorescence microscopy images, and flow cytometry analyses confirmed that the PEI/chitosan-TBA blend system provided effective transfection with low cytotoxicity. This novel hypoxia-responsive shRNA expression vector may be useful for RNA interference (RNAi)-based cancer gene therapy in hypoxic colorectal tumors. Moreover, the PEI/chitosan-TBA copolymer might be a promising gene carrier for use in gene transfer in vivo. Copyright © 2018. Published by Elsevier Inc.

Caspase-3 short hairpin RNAs: a potential therapeutic agent in neurodegeneration of aluminum-exposed animal model.

PubMed

Zhang, Qinli; Li, Na; Jiao, Xia; Qin, Xiujun; Kaur, Ramanjit; Lu, Xiaoting; Song, Jing; Wang, Linping; Wang, Junming; Niu, Qiao

2014-01-01

There is abundant evidence supporting the role of caspases in the development of neurodegenerative disease, including Alzheimer's disease (AD). Therefore, regulating the activity of caspases has been considered as a therapeutic target. However, all the efforts on AD therapy using pan-caspase inhibitors have failed because of uncontrolled adverse effects. Alternatively, the specific knockdown of caspase-3 gene through RNA interference (RNAi) could serve as a future potential therapeutic strategy. The aim of the present study is to down-regulate the expression of caspase-3 gene using lentiviral vector-mediated caspase-3 short hairpin RNA (LV-Caspase-3 shRNA). The effect of LV-Caspase-3 shRNA on apoptosis induced by aluminum (Al) was investigated in primary cultured cortical neurons and validated in C57BL/6J mice. The results indicated an increase in apoptosis and caspase-3 expression in primary cultured neurons and the cortex ofmice exposed to Al, which could be down-regulated by LV-Caspase-3 shRNA. Furthermore, LV-Caspase-3 shRNA reduced neural cell death and improved learning and memory in C57BL/6J mice treated with Al. Our results suggest that LV-caspase-3 shRNA is a potential therapeutic agent to prevent neurodegeneration and cognitive dysfunction in aluminum- exposed animal models. The findings provide a rational gene therapy strategy for AD.

Natural Killer Cell Cytotoxicity Against SKOV3 after HLA-G Downregulation by shRNA.

PubMed

Nazari, Nazanin; Farjadian, Shirin

2016-09-01

HLA-G is a nonclassical HLA class I molecule which, when elevated in tumor cells, is one of the main factors involved in tumor evasion of immune responses including NK and T cells. To evaluate the effect of HLA-G downregulation on NK cell cytotoxicity in tumor cell lines. The expression level of HLA-G was measured by real-time PCR and flowcytometry after transfection of SKOV3 by shRNA.1, which targets specific sequences in exon 4, or shRNA.2, which targets both exons 4 and 6. NK-92MI cell cytotoxicity against transfected or untransfected target cell lines was measured with the lactate dehydrogenase (LDH) release assay. The Jeg-3 cell line was used as a positive control. Membrane-bound HLA-G expression levels decreased significantly in both cell lines after transfection with both shRNAs compared to their corresponding untransfected cells (p<0.05). Jeg-3 cells were better lysed than SKOV3 cells by NK cells during the first 48 h after transfection with both shRNAs. Compared to untransfected cells, shRNA.1-transfected SKOV3 cells were significantly more lysed by NK cells 24 h post-transfection (p=0.043). As a clinical approach, HLA-G downregulation with shRNA may be effective in cancer therapy by improving immune cell activation.

Doxycycline modulates VEGF-A expression: Failure of doxycycline-inducible lentivirus shRNA vector to knockdown VEGF-A expression in transgenic mice.

PubMed

Merentie, Mari; Rissanen, Riina; Lottonen-Raikaslehto, Line; Huusko, Jenni; Gurzeler, Erika; Turunen, Mikko P; Holappa, Lari; Mäkinen, Petri; Ylä-Herttuala, Seppo

2018-01-01

Vascular endothelial growth factor-A (VEGF-A) is the master regulator of angiogenesis, vascular permeability and growth. However, its role in mature blood vessels is still not well understood. To better understand the role of VEGF-A in the adult vasculature, we generated a VEGF-A knockdown mouse model carrying a doxycycline (dox)-regulatable short hairpin RNA (shRNA) transgene, which silences VEGF-A. The aim was to find the critical level of VEGF-A reduction for vascular well-being in vivo. In vitro, the dox-inducible lentiviral shRNA vector decreased VEGF-A expression efficiently and dose-dependently in mouse endothelial cells and cardiomyocytes. In the generated transgenic mice plasma VEGF-A levels decreased shortly after the dox treatment but returned back to normal after two weeks. VEGF-A expression decreased shortly after the dox treatment only in some tissues. Surprisingly, increasing the dox exposure time and dose led to elevated VEGF-A expression in some tissues of both wildtype and knockdown mice, suggesting that dox itself has an effect on VEGF-A expression. When the effect of dox on VEGF-A levels was further tested in naïve/non-transduced cells, the dox administration led to a decreased VEGF-A expression in endothelial cells but to an increased expression in cardiomyocytes. In conclusion, the VEGF-A knockdown was achieved in a dox-regulatable fashion with a VEGF-A shRNA vector in vitro, but not in the knockdown mouse model in vivo. Dox itself was found to regulate VEGF-A expression explaining the unexpected results in mice. The effect of dox on VEGF-A levels might at least partly explain its previously reported beneficial effects on myocardial and brain ischemia. Also, this effect on VEGF-A should be taken into account in all studies using dox-regulated vectors.

[Construction, identification and expression of three kinds of shuttle plasmids of adenovirus expression vector of hepatitis C virus structure gene].

PubMed

Cao, Yi-zhan; Hao, Chun-qiu; Feng, Zhi-hua; Zhou, Yong-xing; Li, Jin-ge; Jia, Zhan-sheng; Wang, Ping-zhong

2003-02-01

To construct three recombinant shuttle plasmids of adenovirus expression vector which can express hepatitis C virus(HCV) different structure genes(C, C+E1, C+E1+E2) in order to pack adenovirus expression vectors which can express HCV different structure gene effectively. The different HCV structure genes derived from the plasmid pBRTM/HCV1-3011 by using polymerase chain reaction (PCR) were inserted into the backward position of cytomegalovirus(CMV) immediate early promotor element of shuttle plasmid(pAd.CMV-Link.1) of adenovirus expression vector respectively, then the three recombinant plasmids (pAd.HCV-C, pAd.HCV-CE1, pAd.HCV-S) were obtained. The recombinant plasmids were identified by endonuclease, PCR and sequencing. HCV structure genes were expressed transiently with Lipofectamine 2000 coated in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. Insert DNAs of the three recombinant plasmids' were confirmed to be HCV different structure genes by endonuclease, PCR and sequencing. The three recombinant plasmids can express HCV structure gene (C, C+E1, C+E1+E2) transiently in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. The three recombinant shuttle plasmids of adenovirus expression vector can express HCV structure gene(C, C+E1, C+E1+E2) transiently. This should be useful to pack adenovirus expression vector which can express HCV structure genes.

Efficient delivery of connective tissue growth factor shRNA using PAMAM nanoparticles.

PubMed

Huang, Z J; Yi, B; Yuan, H; Yang, G P

2014-08-28

The aim of this study was to detect the anti-fibrosis activity of connective tissue growth factor (CTGF) small hairpin RNA (shRNA) mediated by polyamidoamine dendrimer nanoparticles in rat myocardial cell lines and myocardium. CTGF shRNAs were constructed from inverted oligonucleotides and a polyamidoamine nanoparticle vector was used to transfer shRNA into H9c2 myocardial cells and spontaneously hypertensive rats. The expression of CTGF, transforming growth factor-b1, and laminin were measured by semi-quantitative reverse transcription-polymerase chain reaction, Western blotting, and immunohistochemistry. pCTGF-shRNA significantly reduced CTGF upregulation induced by angiotensin II in H9c2 myocardial cells. The mRNA and protein expression of CTGF and laminin in pCTGF-shRNA-transferred spontaneously hypertensive rats decreased significantly compared to the control group and pHK-shRNA group (P < 0.05). The expression of transforming growth factor-b1 showed no significant difference among the 3 groups (P > 0.05). pCTGF-shRNA mediated by polyamidoamine can be used to successfully reduce myocardial CTGF and laminin expression, suggesting that this system can be used to improve myocardial fibrosis therapy.

RNA interference mediated in human primary cells via recombinant baculoviral vectors.

PubMed

Nicholson, Linda J; Philippe, Marie; Paine, Alan J; Mann, Derek A; Dolphin, Colin T

2005-04-01

The success of RNA interference (RNAi) in mammalian cells, mediated by siRNAs or shRNA-generating plasmids, is dependent, to an extent, upon transfection efficiency. This is a particular problem with primary cells, which are often difficult to transfect using cationic lipid vehicles. Effective RNAi in primary cells is thus best achieved with viral vectors, and retro-, adeno-, and lentivirus RNAi systems have been described. However, the use of such human viral vectors is inherently problematic, e.g., Class 2 status and requirement of secondary helper functions. Although insect cells are their natural host, baculoviruses also transduce a range of vertebrate cell lines and primary cells with high efficiency. The inability of baculoviral vectors to replicate in mammalian cells, their Class 1 status, and the simplicity of their construction make baculovirus an attractive alternative gene delivery vector. We have developed a baculoviral-based RNAi system designed to express shRNAs and GFP from U6 and CMV promoters, respectively. Transduction of Saos2, HepG2, Huh7, and primary human hepatic stellate cells with a baculoviral construct expressing shRNAs targeting lamin A/C resulted in effective knockdown of the corresponding mRNA and protein. Development of this baculoviral-based system provides an additional shRNA delivery option for RNAi-based investigations in mammalian cells.

Embedding siRNA sequences targeting Apolipoprotein B100 in shRNA and miRNA scaffolds results in differential processing and in vivo efficacy

PubMed Central

Maczuga, Piotr; Lubelski, Jacek; van Logtenstein, Richard; Borel, Florie; Blits, Bas; Fakkert, Erwin; Costessi, Adalberto; Butler, Derek; van Deventer, Sander; Petry, Harald; Koornneef, Annemart; Konstantinova, Pavlina

2013-01-01

Overexpression of short hairpin RNA (shRNA) often causes cytotoxicity and using microRNA (miRNA) scaffolds can circumvent this problem. In this study, identically predicted small interfering RNA (siRNA) sequences targeting apolipoprotein B100 (siApoB) were embedded in shRNA (shApoB) or miRNA (miApoB) scaffolds and a direct comparison of the processing and long-term in vivo efficacy was performed. Next generation sequencing of small RNAs originating from shApoB- or miApoB-transfected cells revealed substantial differences in processing, resulting in different siApoB length, 5′ and 3′ cleavage sites and abundance of the guide or passenger strands. Murine liver transduction with adeno-associated virus (AAV) vectors expressing shApoB or miApoB resulted in high levels of siApoB expression associated with strong decrease of plasma ApoB protein and cholesterol. Expression of miApoB from the liver-specific LP1 promoter was restricted to the liver, while the H1 promoter-expressed shApoB was ectopically present. Delivery of 1 × 1011 genome copies AAV-shApoB or AAV-miApoB led to a gradual loss of ApoB and plasma cholesterol inhibition, which was circumvented by delivering a 20-fold lower vector dose. In conclusion, incorporating identical siRNA sequences in shRNA or miRNA scaffolds results in differential processing patterns and in vivo efficacy that may have serious consequences for future RNAi-based therapeutics. PMID:23089734

Tumor targeting of gene expression through metal-coordinated conjugation with dextran.

PubMed

Hosseinkhani, Hossein; Aoyama, Teruyoshi; Ogawa, Osamu; Tabata, Yasuhiko

2003-03-07

Tumor targeting of plasmid DNA was achieved through the conjugation of dextran derivatives with chelate residues based on metal coordination. Diethylenetriamine pentaacetic acid (DTPA), spermidine (Sd), and spermine (Sm) were chemically introduced to the hydroxyl groups of dextran to obtain dextran-DTPA, dextran-Sd and dextran-Sm derivatives. Conjugation of the dextran derivative by Zn(2+) coordination decreased the apparent size of the plasmid DNA, depending on the derivative type. The negative zeta potential of plasmid DNA became almost 0 mV after Zn(2+)-coordinated conjugation with dextran-Sm. When the dextran derivative-plasmid DNA conjugates with Zn(2+) coordination were intravenously injected subcutaneously into mice bearing Meth-AR-1 fibrosarcoma, the dextran-Sm-plasmid DNA conjugate significantly enhanced the level of gene expression in the tumor, in contrast to the conjugate of other dextran derivatives and free plasmid DNA. The enhanced gene expression produced by the Zn(2+)-coordinated dextran-Sm-plasmid DNA conjugate was specific to the tumor, whereas a simple mixture of dextran-Sm and plasmid DNA was not effective. The level of gene expression depended on the percentage of chelate residues introduced, the mixing weight ratio of the plasmid DNA/Sm residue used for conjugate preparation, and the plasmid DNA dose. A fluorescent microscopic study revealed that localization of plasmid DNA in the tumor tissue was observed only after injection of the dextran-Sm-plasmid DNA conjugate with Zn(2+) coordination. In addition, the gene expression induced by the conjugate lasted for more than 10 days after the injection. We conclude that Zn(2+)-coordinated dextran-Sm conjugation is a promising way to enable plasmid DNA to target the tumor in gene expression as well as to prolong the duration of gene expression.

Genetic control of ColE1 plasmid stability that is independent of plasmid copy number regulation.

PubMed

Standley, Melissa S; Million-Weaver, Samuel; Alexander, David L; Hu, Shuai; Camps, Manel

2018-06-16

ColE1-like plasmid vectors are widely used for expression of recombinant genes in E. coli. For these vectors, segregation of individual plasmids into daughter cells during cell division appears to be random, making them susceptible to loss over time when no mechanisms ensuring their maintenance are present. Here we use the plasmid pGFPuv in a recA relA strain as a sensitized model to study factors affecting plasmid stability in the context of recombinant gene expression. We find that in this model, plasmid stability can be restored by two types of genetic modifications to the plasmid origin of replication (ori) sequence: point mutations and a novel 269 nt duplication at the 5' end of the plasmid ori, which we named DAS (duplicated anti-sense) ori. Combinations of these modifications produce a range of copy numbers and of levels of recombinant expression. In direct contradiction with the classic random distribution model, we find no correlation between increased plasmid copy number and increased plasmid stability. Increased stability cannot be explained by reduced levels of recombinant gene expression either. Our observations would be more compatible with a hybrid clustered and free-distribution model, which has been recently proposed based on detection of individual plasmids in vivo using super-resolution fluorescence microscopy. This work suggests a role for the plasmid ori in the control of segregation of ColE1 plasmids that is distinct from replication initiation, opening the door for the genetic regulation of plasmid stability as a strategy aimed at enhancing large-scale recombinant gene expression or bioremediation.

Type 3 Fimbriae Encoded on Plasmids Are Expressed from a Unique Promoter without Affecting Host Motility, Facilitating an Exceptional Phenotype That Enhances Conjugal Plasmid Transfer

PubMed Central

Madsen, Jonas Stenløkke; Riber, Leise; Kot, Witold; Basfeld, Alrun; Burmølle, Mette; Hansen, Lars Hestbjerg; Sørensen, Søren Johannes

2016-01-01

Horizontal gene transfer (HGT), the transmission of genetic material to a recipient that is not the progeny of the donor, is fundamental in bacterial evolution. HGT is often mediated by mobile genetic elements such as conjugative plasmids, which may be in conflict with the chromosomal elements of the genome because they are independent replicons that may petition their own evolutionary strategy. Here we study differences between type 3 fimbriae encoded on wild type plasmids and in chromosomes. Using known and newly characterized plasmids we show that the expression of type 3 fimbriae encoded on plasmids is systematically different, as MrkH, a c-di-GMP dependent transcriptional activator is not needed for strong expression of the fimbriae. MrkH is required for expression of type 3 fimbriae of the Klebsiella pneumoniae chromosome, wherefrom the fimbriae operon (mrkABCDF) of plasmids is believed to have originated. We find that mrkABCDFs of plasmids are highly expressed via a unique promoter that differs from the original Klebsiella promoter resulting in fundamental behavioral consequences. Plasmid associated mrkABCDFs did not influence the swimming behavior of the host, that hereby acquired an exceptional phenotype being able to both actively swim (planktonic behavior) and express biofilm associated fimbriae (sessile behavior). We show that this exceptional phenotype enhances the conjugal transfer of the plasmid. PMID:27627107

Quantitative Evaluation of Myostatin Gene in Stably Transfected Caprine Fibroblast Cells by Anti-Myostatin shRNA.

PubMed

Jain, Sudhir Kumar; Jain, Hemlata; Kumar, Dharmendra; Bedekar, Megha Kadam; Pandey, Akhilesh Kumar; Sarkhel, Bikash Chandra

2015-09-01

Skeletal muscle is the major component of lean tissue that is used for consumption, and myostatin is a negative regulator of skeletal muscle growth. Downregulation of this gene therefore offers a strategy for developing superior animals with enhanced muscle growth. Knockdown of myostatin was achieved by RNA interference technology. The anti-myostatin shRNA were designed and stably transfected in caprine fibroblast cells. The reduced expression of target gene was achieved and measured in clonal fibroblast cells by real-time PCR. Two single-cell clones induced significant decrease of myostatin gene expression by 73.96 and 72.66 %, respectively (P < 0.05). To ensure the appropriate growth of transfected cell, seven media were tested. The best suited media was used for transfected fibroblast cell proliferation. The findings suggest that shRNA provides a novel potential tool for gene knockdown and these stably transfected cells can be used as the donor cells for animal cloning.

Genetic and small molecule inhibition of arylamine N-acetyltransferase 1 reduces anchorage-independent growth in human breast cancer cell line MDA-MB-231.

PubMed

Stepp, Marcus W; Doll, Mark A; Carlisle, Samantha M; States, J Christopher; Hein, David W

2018-04-01

Arylamine N-acetyltransferase 1 (NAT1) expression is reported to affect proliferation, invasiveness, and growth of cancer cells. MDA-MB-231 breast cancer cells were engineered such that NAT1 expression was elevated or suppressed, or treated with a small molecule inhibitor of NAT1. The MDA-MB-231 human breast cancer cell lines were engineered with a scrambled shRNA, a NAT1 specific shRNA or a NAT1 overexpression cassette stably integrated into a single flippase recognition target (FRT) site facilitating incorporation of these different genetic elements into the same genomic location. NAT1-specific shRNA reduced NAT1 activity in vitro by 39%, increased endogenous acetyl coenzyme A levels by 35%, and reduced anchorage-independent growth (sevenfold) without significant effects on cell morphology, growth rates, anchorage-dependent colony formation, or invasiveness compared to the scrambled shRNA cell line. Despite 12-fold overexpression of NAT1 activity in the NAT1 overexpression cassette transfected MDA-MB-231 cell line, doubling time, anchorage-dependent cell growth, anchorage-independent cell growth, and relative invasiveness were not changed significantly when compared to the scrambled shRNA cell line. A small molecule (5E)-[5-(4-hydroxy-3,5-diiodobenzylidene)-2-thioxo-1,3-thiazolidin-4-one (5-HDST) was 25-fold more selective towards the inhibition of recombinant human NAT1 than N-acetyltransferase 2. Incubation of MDA-MB-231 cell line with 5-HDST resulted in 60% reduction in NAT1 activity and significant decreases in cell growth, anchorage-dependent growth, and anchorage-independent growth. In summary, inhibition of NAT1 activity by either shRNA or 5-HDST reduced anchorage-independent growth in the MDA-MB-231 human breast cancer cell line. These findings suggest that human NAT1 could serve as a target for the prevention and/or treatment of breast cancer. © 2018 Wiley Periodicals, Inc.

In vivo induction of interferon gamma expression in grey horses with metastatic melanoma resulting from direct injection of plasmid DNA coding for equine interleukin 12.

PubMed

Müller, J-M V; Wissemann, J; Meli, M L; Dasen, G; Lutz, H; Heinzerling, L; Feige, K

2011-11-01

Whole blood pharmacokinetics of intratumourally injected naked plasmid DNA coding for equine Interleukin 12 (IL-12) was assessed as a means of in vivo gene transfer in the treatment of melanoma in grey horses. The expression of induced interferon gamma (IFN-g) was evaluated in order to determine the pharmacodynamic properties of in vivo gene transduction. Seven grey horses bearing melanoma were injected intratumourally with 250 µg naked plasmid DNA coding for IL-12. Peripheral blood and biopsies from the injection site were taken at 13 time points until day 14 post injection (p.i.). Samples were analysed using quantitative real-time PCR. Plasmid DNA was quantified in blood samples and mRNA expression for IFN-g in tissue samples. Plasmid DNA showed fast elimination kinetics with more than 99 % of the plasmid disappearing within 36 hours. IFN-g expression increased quickly after IL-12 plasmid injection, but varied between individual horses. Intratumoural injection of plasmid DNA is a feasible method for inducing transgene expression in vivo. Biological activity of the transgene IL-12 was confirmed by measuring expression of IFN-g.

Combined antitumor gene therapy with herpes simplex virus-thymidine kinase and short hairpin RNA specific for mammalian target of rapamycin.

PubMed

Woo, Ha-Na; Lee, Won Il; Kim, Ji Hyun; Ahn, Jeonghyun; Han, Jeong Hee; Lim, Sue Yeon; Lee, Won Woo; Lee, Heuiran

2015-12-01

A proof-of-concept study is presented using dual gene therapy that employed a small hairpin RNA (shRNA) specific for mammalian target of rapamycin (mTOR) and a herpes simplex virus-thymidine kinase (HSV-TK) gene to inhibit the growth of tumors. Recombinant adeno-associated virus (rAAV) vectors containing a mutant TK gene (sc39TK) were transduced into HeLa cells, and the prodrug ganciclovir (GCV) was administered to establish a suicide gene-therapy strategy. Additionally, rAAV vectors expressing an mTOR-targeted shRNA were employed to suppress mTOR-dependent tumor growth. GCV selectively induced death in tumor cells expressing TK, and the mTOR-targeted shRNA altered the cell cycle to impair tumor growth. Combining the TK-GCV system with mTOR inhibition suppressed tumor growth to a greater extent than that achieved with either treatment alone. Furthermore, HSV-TK expression and mTOR inhibition did not mutually interfere with each other. In conclusion, gene therapy that combines the TK-GCV system and mTOR inhibition shows promise as a novel strategy for cancer therapy.

Knockdown of Pokemon protein expression inhibits hepatocellular carcinoma cell proliferation by suppression of AKT activity.

PubMed

Zhu, Xiaosan; Dai, Yichen; Chen, Zhangxin; Xie, Junpei; Zeng, Wei; Lin, Yuanyuan

2013-01-01

Overexpression of Pokemon, which is an erythroid myeloid ontogenic factor protein, occurs in different cancers, including hepatocellular carcinoma (HCC). Pokemon is also reported to have an oncogenic activity in various human cancers. This study investigated the effect of Pokemon knockdown on the regulation of HCC growth. POK shRNA suppressed the expression of Pokemon protein in HepG2 cells compared to the negative control vector-transfected HCC cells. Pokemon knockdown also reduced HCC cell viability and enhanced cisplatin-induced apoptosis in HCC cells. AKT activation and the expression of various cell cycle-related genes were inhibited following Pokemon knockdown. These data demonstrate that Pokemon may play a role in HCC progression, suggesting that inhibition of Pokemon expression using Pokemon shRNA should be further evaluated as a novel target for the control of HCC.

Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia.

PubMed

Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W

2010-08-01

The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

Knockdown of MAGEA6 Activates AMP-Activated Protein Kinase (AMPK) Signaling to Inhibit Human Renal Cell Carcinoma Cells.

PubMed

Ye, Xueting; Xie, Jing; Huang, Hang; Deng, Zhexian

2018-01-01

Melanoma antigen A6 (MAGEA6) is a cancer-specific ubiquitin ligase of AMP-activated protein kinase (AMPK). The current study tested MAGEA6 expression and potential function in renal cell carcinoma (RCC). MAGEA6 and AMPK expression in human RCC tissues and RCC cells were tested by Western blotting assay and qRT-PCR assay. shRNA method was applied to knockdown MAGEA6 in human RCC cells. Cell survival and proliferation were tested by MTT assay and BrdU ELISA assay, respectively. Cell apoptosis was tested by the TUNEL assay and single strand DNA ELISA assay. The 786-O xenograft in nude mouse model was established to test RCC cell growth in vivo. MAGEA6 is specifically expressed in RCC tissues as well as in the established (786-O and A498) and primary human RCC cells. MAGEA6 expression is correlated with AMPKα1 downregulation in RCC tissues and cells. It is not detected in normal renal tissues nor in the HK-2 renal epithelial cells. MAGEA6 knockdown by targeted-shRNA induced AMPK stabilization and activation, which led to mTOR complex 1 (mTORC1) in-activation and RCC cell death/apoptosis. AMPK inhibition, by AMPKα1 shRNA or the dominant negative AMPKα1 (T172A), almost reversed MAGEA6 knockdown-induced RCC cell apoptosis. Conversely, expression of the constitutive-active AMPKα1 (T172D) mimicked the actions by MAGEA6 shRNA. In vivo, MAGEA6 shRNA-bearing 786-O tumors grew significantly slower in nude mice than the control tumors. AMPKα1 stabilization and activation as well as mTORC1 in-activation were detected in MAGEA6 shRNA tumor tissues. MAGEA6 knockdown inhibits human RCC cells via activating AMPK signaling. © 2018 The Author(s). Published by S. Karger AG, Basel.

Development of a baculovirus vector carrying a small hairpin RNA for suppression of sf-caspase-1 expression and improvement of recombinant protein production.

PubMed

Zhang, Xiaoyue; Xu, Keyan; Ou, Yanmei; Xu, Xiaodong; Chen, Hongying

2018-05-02

The Baculovirus expression vector system (BEVS) is a transient expression platform for recombinant protein production in insect cells. Baculovirus infection of insect cells will shutoff host translation and induce apoptosis and lead to the termination of protein expression. Previous reports have demonstrated the enhancement of protein yield in BEVS using stable insect cell lines expressing interference RNA to suppress the expression of caspase-1. In this study, short-hairpin RNA (shRNA) expression cassettes targeting Spodoptera frugiperda caspase-1 (Sf-caspase-1) were constructed and inserted into an Autographa californica multiple nucleopolyhedrovirus (AcMNPV) vector. Using the recombinant baculovirus vectors, we detected the suppression of Sf-caspase-1 expression and cell apoptosis. Green fluorescent protein (GFP), Discosoma sp. Red (DsRed) and firefly luciferase were then expressed as reporter proteins. The results showed that suppression of apoptosis enhanced the accumulation of exogenous proteins at 2 and 3 days post infection. After 4 days post infection, the activity of the reporter proteins remained higher in BEVS using the baculovirus carrying shRNA in comparison with the control without shRNA, but the accumulated protein levels showed no obvious difference between them, suggesting that apoptosis suppression resulted in improved protein folding rather than translation efficiency at the very late stage of baculovirus infection. The baculovirus vector developed in this study would be a useful tool for the production of active proteins suitable for structural and functional studies or pharmaceutical applications in Sf9 cells, and it also has the potential to be adapted for the improvement of protein expression in different insect cell lines that can be infected by AcMNPV.

Cloning of the citrate permease gene of Lactococcus lactis subsp. lactis biovar diacetylactis and expression in Escherichia coli.

PubMed Central

Sesma, F; Gardiol, D; de Ruiz Holgado, A P; de Mendoza, D

1990-01-01

The citrate plasmid (Cit+ plasmid) from Lactococcus lactis subsp. lactis biovar diacetylactis was cloned into the EcoRI site of plasmid pUC18. This recombinant plasmid enabled Escherichia coli K-12 to transport and utilize citrate as a source of energy, indicating expression of the citrate permease from L. lactis biovar diacetylactis. The citrate permease was under the control of the lac promoter of pUC18. Genetic expression of the Cit+ plasmid in maxicells revealed that the plasmid encoded two polypeptides of 47 and 32 kilodaltons, determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Images PMID:2117878

The critical role of myostatin in differentiation of sheep myoblasts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Chenxi; Xinjiang Laboratory of Animal Biotechnology, Urumqi; Li, Wenrong

Highlights: Black-Right-Pointing-Pointer Identification of the effective and specific shRNA to knockdown MSTN. Black-Right-Pointing-Pointer Overexpression of MSTN reversibly suppressed myogenic differentiation. Black-Right-Pointing-Pointer shRNA knockdown of endogenous MSTN promoted ovine myoblast differentiation. Black-Right-Pointing-Pointer MSTN inhibits myogenic differentiation through down-regulation of MyoD and Myogenin and up-regulation of Smad3. Black-Right-Pointing-Pointer Provides a promise for the generation of transgenic sheep to improve meat productivity. -- Abstract: Myostatin [MSTN, also known as growth differentiation factor 8 (GDF8)], is an inhibitor of skeletal muscle growth. Blockade of MSTN function has been reported to result in increased muscle mass in mice. However, its role in myoblast differentiation inmore » farm animals has not been determined. In the present study, we sought to determine the role of MSTN in the differentiation of primary sheep myoblasts. We found that ectopic overexpression of MSTN resulted in lower fusion index in sheep myoblasts, which indicated the repression of myoblast differentiation. This phenotypic change was reversed by shRNA knockdown of the ectopically expressed MSTN in the cells. In contrast, shRNA knockdown of the endogenous MSTN resulted in induction of myogenic differentiation. Additional studies revealed that the induction of differentiation by knocking down the ectopically or endogenously expressed MSTN was accompanied by up-regulation of MyoD and myogenin, and down-regulation of Smad3. Our results demonstrate that MSTN plays critical role in myoblast differentiation in sheep, analogous to that in mice. This study also suggests that shRNA knockdown of MSTN could be a potentially promising approach to improve sheep muscle growth, so as to increase meat productivity.« less

HPV16 E6 regulates annexin 1 (ANXA1) protein expression in cervical carcinoma cell lines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Calmon, Marilia Freitas; Sichero, Laura; Boccardo, Enrique

Annexin 1 (ANXA1) is a substrate for E6AP mediated ubiquitylation. It has been hypothesized that HPV 16 E6 protein redirects E6AP away from ANXA1, increasing its stability and possibly contributing to viral pathogenesis. We analyzed ANXA1 expression in HPV-positive and negative cervical carcinoma-derived cells, in cells expressing HPV-16 oncogenes and in cells transduced with shRNA targeting E6AP. We observed that ANXA1 protein expression increased in HPV-16-positive tumor cells, in keratinocytes expressing HPV-16 E6wt (wild-type) or E6/E7 and C33 cells expressing HPV-16 E6wt. ANXA1 protein expression decreased in cells transfected with E6 Dicer-substrate RNAs (DsiRNA) and C33 cells cotransduced with HPV-16more » E6wt and E6AP shRNA. Moreover, colony number and proliferation rate decreased in HPV16-positive cells transduced with ANXA1 shRNA. We observed that in cells infected with HPV16, the E6 binds to E6AP to degrade p53 and upregulate ANXA1. We suggest that ANXA1 may play a role in HPV-mediated carcinogenesis. - Highlights: • ANXA1 upregulation requires the presence of E6 and E6AP and is dependent on E6 integrity. • E6 binds to E6AP to degrade p53 and upregulate ANXA1 in cells infected with HPV16. • ANXA1 plays a role in cell proliferation in HPV-positive cervical cells.« less

The novel functional nucleic acid iRed effectively regulates target genes following cytoplasmic delivery by faint electric treatment

NASA Astrophysics Data System (ADS)

Hasan, Mahadi; Tarashima, Noriko; Fujikawa, Koki; Ohgita, Takashi; Hama, Susumu; Tanaka, Tamotsu; Saito, Hiroyuki; Minakawa, Noriaki; Kogure, Kentaro

2016-01-01

An intelligent shRNA expression device (iRed) contains the minimum essential components needed for shRNA production in cells, and could be a novel tool to regulate target genes. However, general delivery carriers consisting of cationic polymers/lipids could impede function of a newly generated shRNA via electrostatic interaction in the cytoplasm. Recently, we found that faint electric treatment (fET) of cells enhanced delivery of siRNA and functional nucleic acids into the cytoplasm in the absence of delivery carriers. Here, we examined fET of cells stably expressing luciferase in the presence of iRed encoding anti-luciferase shRNA. Transfection of lipofectamine 2000 (LFN)/iRed lipoplexes showed an RNAi effect, but fET-mediated iRed transfection did not, likely because of the endosomal localization of iRed after delivery. However, fET in the presence of lysosomotropic agent chloroquine significantly improved the RNAi effect of iRed/fET to levels that were higher than those for the LFN/iRed lipoplexes. Furthermore, the amount of lipid droplets in adipocytes significantly decreased following fET with iRed against resistin in the presence of chloroquine. Thus, iRed could be a useful tool to regulate target genes following fET-mediated cytoplasmic delivery with endosomal escape devices.

Cloning of a Recombinant Plasmid Encoding Thiol-Specific Antioxidant Antigen (TSA) Gene of Leishmania majorand Expression in the Chinese Hamster Ovary Cell Line.

PubMed

Fatemeh, Ghaffarifar; Fatemeh, Tabatabaie; Zohreh, Sharifi; Abdolhosein, Dalimiasl; Mohammad Zahir, Hassan; Mehdi, Mahdavi

2012-01-01

TSA (thiol-specific antioxidant antigen) is the immune-dominant antigen of Leishmania major and is considered to be the most promising candidate molecule for a recombinant or DNA vaccine against leishmaniasis. The aim of the present work was to express a plasmid containing the TSA gene in eukaryotic cells. Genomic DNA was extracted, and the TSA gene was amplified by polymerase chain reaction (PCR). The PCR product was cloned into the pTZ57R/T vector, followed by subcloning into the eukaryotic expression vector pcDNA3 (EcoRI and HindIII sites). The recombinant plasmid was characterised by restriction digest and PCR. Eukaryotic Chinese hamster ovary cells were transfected with the plasmid containing the TSA gene. Expression of the L. major TSA gene was confirmed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blotting. The plasmid containing the TSA gene was successfully expressed, as demonstrated by a band of 22.1 kDa on Western blots. The plasmid containing the TSA gene can be expressed in a eukaryotic cell line. Thus, the recombinant plasmid may potentially be used as a DNA vaccine in animal models.

Inhibition of STAT-3 Results in Radiosensitization of Human Squamous Cell Carcinoma

PubMed Central

Bonner, James A.; Trummell, Hoa Q.; Willey, Christopher D.; Plants, Brian A.; Raisch, Kevin P.

2009-01-01

Background Signal Transducer and Activator of Transcription – 3 (STAT-3) is a downstream component of the Epidermal Growth Factor Receptor (EGFr) signaling process that may facilitate the resistance of tumor cells to conventional cancer treatments. Studies were performed to determine if inhibition of this downstream protein may produce radiosensitization. Methods/Results A431 cells (human squamous cell carcinoma cells with EGFr overexpression) were found to be sensitized to radiation after treatment with STAT-3 small interfering RNA (siRNA). Therefore, a short hairpin RNA (shRNA) against STAT-3 was designed and cloned into a pBABE vector system modified for shRNA expression. Following transfection, clone 2.1 was selected for further study as it showed a dramatic reduction of STAT-3 protein (and mRNA) when compared to A431 parental cells or a negative control shRNA cell line (transfected with STAT-3 shRNA with 2 base pairs mutated). A431 2.1 showed doubling times of 25-31 h as compared to 18-24 h for the parental cell line. The A431 shRNA knockdown STAT-3 cells A431 were more sensitive to radiation than A431 parental or negative STAT-3 control cells. Conclusion A431 cells stably transfected with shRNA against STAT-3 resulted in enhanced radiosensitivity. Further work will be necessary to determine whether inhibition of STAT-3 phosphorylation is a necessary step for the radiosensitization that is induced by inhibition of EGFr. PMID:19616333

PSI:Biology-Materials Repository: A Biologist’s Resource for Protein Expression Plasmids

PubMed Central

Cormier, Catherine Y.; Park, Jin G.; Fiacco, Michael; Steel, Jason; Hunter, Preston; Kramer, Jason; Singla, Rajeev; LaBaer, Joshua

2011-01-01

The Protein Structure Initiative:Biology-Materials Repository (PSI:Biology-MR; MR; http://psimr.asu.edu) sequence-verifies, annotates, stores, and distributes the protein expression plasmids and vectors created by the Protein Structure Initiative (PSI). The MR has developed an informatics and sample processing pipeline that manages this process for thousands of samples per month from nearly a dozen PSI centers. DNASU (http://dnasu.asu.edu), a freely searchable database, stores the plasmid annotations, which include the full-length sequence, vector information, and associated publications for over 130,000 plasmids created by our laboratory, by the PSI and other consortia, and by individual laboratories for distribution to researchers worldwide. Each plasmid links to external resources, including the PSI Structural Biology Knowledgebase (http://sbkb.org), which facilitates cross-referencing of a particular plasmid to additional protein annotations and experimental data. To expedite and simplify plasmid requests, the MR uses an expedited material transfer agreement (EP-MTA) network, where researchers from network institutions can order and receive PSI plasmids without institutional delays. Currently over 39,000 protein expression plasmids and 78 empty vectors from the PSI are available upon request from DNASU. Overall, the MR’s repository of expression-ready plasmids, its automated pipeline, and the rapid process for receiving and distributing these plasmids more effectively allows the research community to dissect the biological function of proteins whose structures have been studied by the PSI. PMID:21360289

[Construction of plant expression plasmid of chimera SBR-CT delta A1].

PubMed

Mai, Sui; Ling, Junqi

2003-08-01

The purpose of this study is to construct plant expression plasmid containing the gene encoding chimera SBR-CT delta A1. The target gene fragment P2, including the gene-encoded chimera SBR-CT delta A1 (3,498-5,378 bp), was obtained by standard PCR amplification. The PCR products were ligated with pGEM-easy vector through TA clone to form plasmid pTSC. The plasmid pTSC and plasmid pPOKII were digested by restricted endonuclease BamHI and KpnI, and the digested products were extracted and purified for recombination. Then the purified P2 and plasmid pPOKII were recombined by T4 DNA ligase to form recombinant plasmid pROSC; inserting bar gene into the plasmid and form pROSB plasmid. The recombined plasmids were isolated and identified by restricted endonuclease cutting and Sanger dideoxy DNA sequencing. P2 gene was linked to pPOKII plasmid and formed recombinant plasmid pROSC. The DNA sequence and orientation were corrected. And bar gene was inserted into pPOSC and form recombinant plasmid pROSB. Plant expression vector pROSC and pROSB containing the gene encoding chimera SBR-CT delta A1, which may provide useful experiment foundation for further study on edible vaccine against caries have been successfully constructed.

Reversal of multidrug resistance by magnetic Fe3O4 nanoparticle copolymerizating daunorubicin and MDR1 shRNA expression vector in leukemia cells.

PubMed

Chen, Bao-an; Mao, Pei-pei; Cheng, Jian; Gao, Feng; Xia, Guo-hua; Xu, Wen-lin; Shen, Hui-lin; Ding, Jia-hua; Gao, Chong; Sun, Qian; Chen, Wen-ji; Chen, Ning-na; Liu, Li-jie; Li, Xiao-mao; Wang, Xue-mei

2010-08-09

In many instances, multidrug resistance (MDR) is mediated by increasing the expression at the cell surface of the MDR1 gene product, P-glycoprotein (P-gp), a 170-kD energy-dependent efflux pump. The aim of this study was to investigate the potential benefit of combination therapy with magnetic Fe(3)O(4) nanoparticle [MNP (Fe(3)O(4))] and MDR1 shRNA expression vector in K562/A02 cells. For stable reversal of "classical" MDR by short hairpin RNA (shRNA) aiming directly at the target sequence (3491-3509, 1539-1557, and 3103-3121 nucleotide) of MDR1 mRNA. PGC silencer-U6-neo-GFP-shRNA/MDR1 called PGY1-1, PGY1-2, and PGY1-3 were constructed and transfected into K562/A02 cells by lipofectamine 2000. After transfected and incubated with or without MNP (Fe(3)O(4)) for 48 hours, the transcription of MDR1 mRNA and the expression of P-gp were detected by quantitative real-time PCR and Western-blot assay respectively. Meanwhile intracellular concentration of DNR in K562/A02 cells was detected by flow cytometry (FCM). PGC silencer-U6-neo-GFP-shRNA/MDR1 was successfully constructed, which was confirmed by sequencing and PGY1-2 had the greatest MDR1 gene inhibitory ratio. Analysis of the reversal ratio of MDR, the concentration of daunorubicin (DNR) and the transcription of MDR1 gene and expression of P-gp in K562/A02 showed that combination of DNR with either MNP (Fe(3)O(4)) or PGY1-2 exerted a potent cytotoxic effect on K562/A02 cells, while combination of MNP (Fe(3)O(4)) and PGY1-2 could synergistically reverse multidrug resistance. Thus our in vitro data strongly suggested that a combination of MNP (Fe(3)O(4)) and shRNA expression vector might be a more sufficient and less toxic anti-MDR method on leukemia.

Expression Levels of ALA Dehydratase as a Marker of ALA-PDT Efficacy

NASA Astrophysics Data System (ADS)

Avital, Schauder; Tamar, Feuerstein; Zvi, Malik

2010-05-01

Accelerated synthesis of protoporphyrinIX (PpIX) following ALA pre-treatment followed by light irradiation is the principle of ALA-PDT. Several limiting enzymes were suggested to control PpIX accumulation and PDT efficacy, among them porphobilinogen deaminase (PBGD) and ferrochelatase. Here we reveal the centrality of ALA dehydratase (ALAD) activity in predicting ALA-PDT efficacy. Silencing of ALAD expression and activity was carried out in leukemic cells using shRNA plasmid transfection or Pb2+ intoxication. ALAD activity, porphyrin synthesis and mitochondrial activity were determined versus PDT efficacy. In K562 ALAD-silenced cells, ALAD activity and expression were reduced and as a result, PpIX synthesis was almost abolished. Following ALA treatment and irradiation, ALAD-silenced cells depicted normal mitochondrial activity, in contrast to control and non-silencing transfected cells where accumulated PpIX and irradiation caused ROS formation and mitochondrial damage. Morphological analysis by scanning electron microscopy (SEM) of ALA-PDT treated cells showed no morphological changes in ALAD-silenced cells, while controls exhibited cell deformations and lysis. Annexin V-FITC/PI staining as well as LDH-L leakage testing showed that membrane integrity was undamaged following ALA-PDT in ALAD silenced cells. Pb2+ treatment in MEL cells impaired ALAD activity and reduced PpIX synthesis but to a lesser extent. In conclusion, we show that a dramatic reduction in PpIX accumulation following down regulation of ALAD expression prevents an efficient PDT. Thus, ALAD has a major role in regulating PpIX synthesis and ALA-PDT therapeutic outcome. Monitoring ALAD expression or activity in various tumors may be useful as prognostic tool to predict PDT efficacy.

Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.

PubMed

Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu

2014-02-04

TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.

Ultrasound enhances in vivo tumor expression of plasmid DNA by PEG-introduced cationized dextran.

PubMed

Hosseinkhani, Hossein; Tabata, Yasuhiko

2005-11-28

This study is an investigation to experimentally confirm whether or not ultrasound (US) irradiation is effective in enhancing the in vivo gene expression of plasmid DNA in tumor. Dextran was cationized by introducing spermine to the hydroxyl groups to allow to polyionically complex with a plasmid DNA. The cationized dextran prepared was additionally modified with poly(ethylene glycol) (PEG) molecules which have an active ester and methoxy groups at each terminal, to obtain cationized dextran with different percentages of PEG introduced. Various cationized dextrans with or without PEG introduction were mixed with a plasmid DNA of LacZ to form cationized dextran-plasmid DNA complexes. Electrophoretical examination revealed that the plasmid DNA was complexed both with the cationized dextran and PEG-introduced cationized dextran, irrespective of the PEG introduction percentage, although the higher N/P ratio was needed for plasmid DNA complexation with the latter. By complexation with the cationized dextran, the zeta potential of plasmid DNA was changed to be positive. The charge of PEG-introduced cationized dextran-plasmid DNA complexes became close to 0 mV as their percentage of PEG introduced increased, although the molecular size was about 250 nm, irrespective of the PEG introduction. When cationized dextran-plasmid DNA complexes with or without PEG introduction were intravenously injected to mice carrying a subcutaneous Meth-AR-1 fibrosarcoma mass and the subsequent US irradiation to the tumor mass percutaneously, the PEG-introduced cationized dextran-plasmid DNA complex plus US irradiation enhanced the tumor level of gene expression to a significantly high extent compared with the cationized dextran-plasmid DNA complex and free plasmid DNA with or without US irradiation. The enhanced level depended on the time period and timing of US irradiation. Fluorescent microscopic studies revealed that the localization of plasmid DNA and the gene expression were observed in the tumor tissue injected with the PEG-introduced cationized dextran-plasmid DNA complex plus the subsequent US irradiation. We conclude that complexation with the PEG-introduced cationized dextran combined with US irradiation is a promising way to target the plasmid DNA to the tumor for gene expression.

Permanent, lowered HLA class I expression using lentivirus vectors with shRNA constructs: Averting cytotoxicity by alloreactive T lymphocytes.

PubMed

Haga, K; Lemp, N A; Logg, C R; Nagashima, J; Faure-Kumar, E; Gomez, G G; Kruse, C A; Mendez, R; Stripecke, R; Kasahara, N; Kasahara, N A; Cicciarelli, J C

2006-12-01

Transplantation of many tissues requires histocompatibility matching of human leukocyte antigens (HLA) to prevent graft rejection, to reduce the level of immunosuppression needed to maintain graft survival, and to minimize the risk of graft-versus-host disease, particularly in the case of bone marrow transplantation. However, recent advances in fields of gene delivery and genetic regulation technologies have opened the possibility of engineering grafts that display reduced levels of HLA expression. Suppression of HLA expression could help to overcome the limitations imposed by extensive HLA polymorphisms that restrict the availability of suitable donors, necessitate the maintenance of large donor registries, and complicate the logistics of procuring and delivering matched tissues and organs to the recipient. Accordingly, we investigated whether knockdown of HLA by RNA interference (RNAi), a ubiquitous regulatory system that can efficiently and selectively inhibit the expression of specific gene products, would enable allogeneic cells to evade immune recognition. For efficient and stable delivery of short hairpin-type RNAi constructs (shRNA), we employed lentivirus-based gene transfer vectors, which provide a delivery system that can achieve integration into genomic DNA, thereby permanently modifying transduced graft cells. Our results show that lentivirus-mediated delivery of shRNA targeting pan-Class I and allele-specific HLA can achieve efficient and dose-dependent reduction in surface expression of HLA in human cells, associated with enhanced resistance to alloreactive T lymphocyte-mediated cytotoxicity, while avoiding MHC-non-restricted killing. We hypothesize that RNAi-induced silencing of HLA expression has the potential to create histocompatibility-enhanced, and, eventually, perhaps "universally" compatible cellular grafts.

AAV Gene Therapy for Alcoholism: Inhibition of Mitochondrial Aldehyde Dehydrogenase Enzyme Expression in Hepatoma Cells.

PubMed

Sanchez, Anamaria C; Li, Chengwen; Andrews, Barbara; Asenjo, Juan A; Samulski, R Jude

2017-09-01

Most ethanol is broken down in the liver in two steps by alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH2) enzymes, which metabolize down ethanol into acetaldehyde and then acetate. Some individuals from the Asian population who carry a mutation in the aldehyde dehydrogenase gene (ALDH2*2) cannot metabolize acetaldehyde as efficiently, producing strong effects, including facial flushing, dizziness, hypotension, and palpitations. This results in an aversion to alcohol intake and protection against alcoholism. The large prevalence of this mutation in the human population strongly suggests that modulation of ALDH2 expression by genetic technologies could result in a similar phenotype. scAAV2 vectors encoding ALDH2 small hairpin RNA (shRNA) were utilized to validate this hypothesis by silencing ALDH2 gene expression in human cell lines. Human cell lines HEK-293 and HepG2 were transduced with scAAV2/shRNA, showing a reduction in ALDH2 RNA and protein expression with the two viral concentration assayed (1 × 10 4 and 1 × 10 5 vg/cell) at two different time points. In both cell lines, ALDH2 RNA levels were reduced by 90% and protein expression was inhibited by 90% and 52%, respectively, 5 days post infection. Transduced HepG2 VL17A cells (ADH+) exposed to ethanol resulted in a 50% increase in acetaldehyde levels. These results suggest that gene therapy could be a useful tool for the treatment of alcoholism by knocking down ALDH2 expression using shRNA technology delivered by AAV vectors.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Doi, Nobutaka; New Products Research & Development, Gene Engineering Division, NIPPON GENE Co., Ltd.; Ogawa, Ryohei, E-mail: ogawa@med.u-toyama.ac.jp

The cancer cells residing in the hypoxic layer are resistant to radiation and these are ones responsible for cancer recurrence after radiation therapy. One of the reasons why hypoxic cancer cells acquire radioresistance may be attributable to changes in the gene expression profile by the activation of hypoxia inducible factors (HIFs). However, the details underlying this process remain unknown. In this study, we investigated the effects of knockdown of HIF subunit genes to elucidate how HIF subunit genes may be involved in the radioresistance acquired by HeLa cells following exposure to a hypoxia mimic. Interestingly, HIF-1α and HIF-2α seemed mutuallymore » complementary for each other when either of them was suppressed. We thus suppressed the expression of both genes simultaneously. To do this, we developed a short hairpin RNA (shRNA) targeting a high homology region between HIF-1α and HIF-2α. It was shown that the expression of the shRNA effectively suppressed the acquisition of radioresistance following the hypoxia mimic. Moreover, it was confirmed that suppression of both subunits resulted in the downregulation of stem cell markers and the suppression of spheroid formation during the hypoxia mimicking-conditions. This shRNA-mediated knockdown method targeting a common region shared by a family of genes may offer a new candidate cancer treatment. - Highlights: • Incubation with CoCl{sub 2} confers radioresistance to HeLa cells. • Both HIF-1α and HIF-2α are involved in the acquisition of radioresistance. • An shRNA to a homology region of HIF-1α and HIF-2α suppressed the radioresistance. • The shRNA decreased cells with stem cell markers and a stem cell phenotype.« less

[Construction and expression analysis of the zebrafish heart-specific transgenetic vector based on Tol2 transposable element].

PubMed

Chen, Tingfang; Luo, Na; Xie, Huaping; Wu, Xiushan; Deng, Yun

2010-02-01

In an effort to generate a desired expression construct for making heart-specific expression transgenic zebrafish, a Tol2 plasmid, which can drive EGFP reporter gene specifically expressed in the heart, was modified using subcloning technology. An IRES fragment bearing multiple cloning site (MCS) was amplified directly from pIRES2-EGFP plasmid and was inserted between the CMLC2 promoter and EGFP fragment of the pDestTol2CG vector. This recombinant expression plasmid pTol2-CMLC2-IRES-EGFP can drive any interested gene specifically expressed in the zebrafish heart along with EGFP reporter gene. To test the effectiveness of this new expression plasmid, we constructed pTol2-CMLC2-RED-IRES-EGFP plasmid by inserting another reporter gene DsRed-Monome into MCS downstream of the CMLC2 promoter and injected this transgenic recombinant plasmid into one-cell stage embryos of zebrafish. Under fluorescence microscope, both the red fluorescence and the green fluorescence produced by pTol2-CMLC2-RED-IRES-EGFP were detected specifically in the heart tissue in the same expression pattern. This novel expression construct pTol2-CMLC2-IRES-EGFP will become an important tool for our research on identifying heart development candidate genes' function using zebrafish as a model.

Expression Plasmids for Use in Candida glabrata

PubMed Central

Zordan, Rebecca E.; Ren, Yuxia; Pan, Shih-Jung; Rotondo, Giuseppe; Peñas, Alejandro De Las; Iluore, Joseph; Cormack, Brendan P.

2013-01-01

We describe a series of CEN/ARS episomal plasmids containing different Candida glabrata promoters, allowing for a range of constitutive or regulated expression of proteins in C. glabrata. The set of promoters includes three constitutive promoters (EGD2pr, HHT2pr, PDC1pr), two macrophage/phagocytosis-induced promoters (ACO2pr, LYS21pr), and one nutritionally regulated promoter (MET3pr). Each promoter was cloned into two plasmid backbones that differ in their selectable marker, URA3, or the dominant-selectable NAT1 gene, which confers resistance to the drug nourseothricin. Expression from the 12 resulting plasmids was assessed using GFP as a reporter and flow cytometry or quantitative reverse-transcription polymerase chain reaction to assess expression levels. Together this set of plasmids expands the toolkit of expression vectors available for use with C. glabrata. PMID:23934995

Genetic transformation of a clinical (genital tract), plasmid-free isolate of Chlamydia trachomatis: engineering the plasmid as a cloning vector.

PubMed

Wang, Yibing; Kahane, Simona; Cutcliffe, Lesley T; Skilton, Rachel J; Lambden, Paul R; Persson, Kenneth; Bjartling, Carina; Clarke, Ian N

2013-01-01

Our study had three objectives: to extend the plasmid-based transformation protocol to a clinical isolate of C. trachomatis belonging to the trachoma biovar, to provide "proof of principle" that it is possible to "knock out" selected plasmid genes (retaining a replication competent plasmid) and to investigate the plasticity of the plasmid. A recently developed, plasmid-based transformation protocol for LGV isolates of C. trachomatis was modified and a plasmid-free, genital tract C. trachomatis isolate from Sweden (SWFP-) was genetically transformed. Transformation of this non-LGV C. trachomatis host required a centrifugation step, but the absence of the natural plasmid removed the need for plaque purification of transformants. Transformants expressed GFP, were penicillin resistant and iodine stain positive for accumulated glycogen. The transforming plasmid did not recombine with the host chromosome. A derivative of pGFP::SW2 carrying a deletion of the plasmid CDS5 gene was engineered. CDS5 encodes pgp3, a protein secreted from the inclusion into the cell cytoplasm. This plasmid (pCDS5KO) was used to transform C. trachomatis SWFP-, and established that pgp3 is dispensable for plasmid function. The work shows it is possible to selectively delete segments of the chlamydial plasmid, and this is the first step towards a detailed molecular dissection of the role of the plasmid. The 3.6 kb β-galactosidase cassette was inserted into the deletion site of CDS5 to produce plasmid placZ-CDS5KO. Transformants were penicillin resistant, expressed GFP and stained for glycogen. In addition, they expressed β-galactosidase showing that the lacZ cassette was functional in C. trachomatis. An assay was developed that allowed the visualisation of individual inclusions by X-gal staining. The ability to express active β-galactosidase within chlamydial inclusions is an important advance as it allows simple, rapid assays to measure directly chlamydial infectivity without the need for plaquing, fluorescence or antibody staining.

Plasmids for variable expression of proteins targeted to the mitochondrial matrix or intermembrane space.

PubMed

Newman, Laura E; Schiavon, Cara; Kahn, Richard A

2016-01-01

We describe the construction and uses of a series of plasmids for directing expression to varied levels of exogenous proteins targeted to the mitochondrial matrix or intermembrane space. We found that the level of protein expression achieved, the kinetics of expression and mitochondrial import, and half-life after import can each vary with the protein examined. These factors should be considered when directing localization of an exogenous protein to mitochondria for rescue, proteomics, or other approaches. We describe the construction of a collection of plasmids for varied expression of proteins targeted to the mitochondrial matrix or intermembrane space, using previously defined targeting sequences and strength CMV promoters. The limited size of these compartments makes them particularly vulnerable to artifacts from over-expression. We found that different proteins display different kinetics of expression and import that should be considered when analyzing results from this approach. Finally, this collection of plasmids has been deposited in the Addgene plasmid repository to facilitate the ready access and use of these tools.

Reduced N-Type Ca2+ Channels in Atrioventricular Ganglion Neurons Are Involved in Ventricular Arrhythmogenesis.

PubMed

Zhang, Dongze; Tu, Huiyin; Cao, Liang; Zheng, Hong; Muelleman, Robert L; Wadman, Michael C; Li, Yu-Long

2018-01-15

Attenuated cardiac vagal activity is associated with ventricular arrhythmogenesis and related mortality in patients with chronic heart failure. Our recent study has shown that expression of N-type Ca 2+ channel α-subunits (Ca v 2.2-α) and N-type Ca 2+ currents are reduced in intracardiac ganglion neurons from rats with chronic heart failure. Rat intracardiac ganglia are divided into the atrioventricular ganglion (AVG) and sinoatrial ganglion. Ventricular myocardium receives projection of neuronal terminals only from the AVG. In this study we tested whether a decrease in N-type Ca 2+ channels in AVG neurons contributes to ventricular arrhythmogenesis. Lentiviral Ca v 2.2-α shRNA (2 μL, 2×10 7  pfu/mL) or scrambled shRNA was in vivo transfected into rat AVG neurons. Nontransfected sham rats served as controls. Using real-time single-cell polymerase chain reaction and reverse-phase protein array, we found that in vivo transfection of Ca v 2.2-α shRNA decreased expression of Ca v 2.2-α mRNA and protein in rat AVG neurons. Whole-cell patch-clamp data showed that Ca v 2.2-α shRNA reduced N-type Ca 2+ currents and cell excitability in AVG neurons. The data from telemetry electrocardiographic recording demonstrated that 83% (5 out of 6) of conscious rats with Ca v 2.2-α shRNA transfection had premature ventricular contractions ( P <0.05 versus 0% of nontransfected sham rats or scrambled shRNA-transfected rats). Additionally, an index of susceptibility to ventricular arrhythmias, inducibility of ventricular arrhythmias evoked by programmed electrical stimulation, was higher in rats with Ca v 2.2-α shRNA transfection compared with nontransfected sham rats and scrambled shRNA-transfected rats. A decrease in N-type Ca 2+ channels in AVG neurons attenuates vagal control of ventricular myocardium, thereby initiating ventricular arrhythmias. © 2018 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley.

Structural and physiological studies of the Escherichia coli histidine operon inserted into plasmid vectors.

PubMed Central

Bruni, C B; Musti, A M; Frunzio, R; Blasi, F

1980-01-01

A fragment of deoxyribonucleic acid 5,300 base paris long and containing the promoter-proximal portion of the histidine operon of Escherichia coli K-12, has been cloned in plasmid pBR313 (plasmids pCB2 and pCB3). Restriction mapping, partial nucleotide sequencing, and studies on functional expression in vivo and on protein synthesis in minicells have shown that the fragment contains the regulatory region of the operon, the hisG, hisD genes, and part of the hisC gene. Another plasmid (pCB5) contained the hisG gene and part of the hisD gene. Expression of the hisG gene in the latter plasmid was under control of the tetracycline promoter of the pBR313 plasmid. The in vivo expression of the two groups of plasmids described above, as well as their effect on the expression of the histidine genes not carried by the plasmids but present on the host chromosome, has been studied. The presence of multiple copies of pCB2 or pCB3, but not of pCB5, prevented derepression of the chromosomal histidine operon. Possible interpretations of this phenomenon are discussed. Images PMID:6246067

Using the CRISPR/Cas9 system to eliminate native plasmids of Zymomonas mobilis ZM4.

PubMed

Cao, Qing-Hua; Shao, Huan-Huan; Qiu, Hui; Li, Tao; Zhang, Yi-Zheng; Tan, Xue-Mei

2017-03-01

The CRISPR/Cas system can be used to simply and efficiently edit the genomes of various species, including animals, plants, and microbes. Zymomonas mobilis ZM4 is a highly efficient, ethanol-producing bacterium that contains five native plasmids. Here, we constructed the pSUZM2a-Cas9 plasmid and a single-guide RNA expression plasmid. The pSUZM2a-Cas9 plasmid was used to express the Cas9 gene cloned from Streptococcus pyogenes CICC 10464. The single-guide RNA expression plasmid pUC-T7sgRNA, with a T7 promoter, can be used for the in vitro synthesis of single-guide RNAs. This system was successfully employed to knockout the upp gene of Escherichia coli and the replicase genes of native Z. mobilis plasmids. This is the first study to apply the CRISPR/Cas9 system of S. pyogenes to eliminate native plasmids in Z. mobilis. It provides a new method for plasmid curing and paves the way for the genomic engineering of Z. mobilis.

Reprint of "versatile and stable vectors for efficient gene expression in Ralstonia eutropha H16".

PubMed

Gruber, Steffen; Hagen, Jeremias; Schwab, Helmut; Koefinger, Petra

2014-12-20

The Gram-negative β-proteobacterium Ralstonia eutropha H16 is primarily known for polyhydroxybutyrate (PHB) production and its ability to grow chemolithoautotrophically by using CO2 and H2 as sole carbon and energy sources. The majority of metabolic engineering and heterologous expression studies conducted so far rely on a small number of suitable expression systems. Particularly the plasmid based expression systems already developed for the use in R. eutropha H16 suffer from high segregational instability and plasmid loss after a short time of fermentation. In order to develop efficient and highly stable plasmid expression vectors for the use in R. eutropha H16, a new plasmid design was created including the RP4 partitioning system, as well as various promoters and origins of replication. The application of minireplicons derived from broad-host-range plasmids RSF1010, pBBR1, RP4 and pSa for the construction of expression vectors and the use of numerous, versatile promoters extend the range of feasible expression levels considerably. In particular, the use of promoters derived from the bacteriophage T5 was described for the first time in this work, characterizing the j5 promoter as the strongest promoter yet to be applied in R. eutropha H16. Moreover, the implementation of the RP4 partition sequence in plasmid design increased plasmid stability significantly and enables fermentations with marginal plasmid loss of recombinant R. eutropha H16 for at least 96h. The utility of the new vector family in R. eutropha H16 is demonstrated by providing expression data with different model proteins and consequently further raises the value of this organism as cell factory for biotechnological applications including protein and metabolite production. Copyright © 2014 Elsevier B.V. All rights reserved.

Versatile and stable vectors for efficient gene expression in Ralstonia eutropha H16.

PubMed

Gruber, Steffen; Hagen, Jeremias; Schwab, Helmut; Koefinger, Petra

2014-09-30

The Gram-negative β-proteobacterium Ralstonia eutropha H16 is primarily known for polyhydroxybutyrate (PHB) production and its ability to grow chemolithoautotrophically by using CO2 and H2 as sole carbon and energy sources. The majority of metabolic engineering and heterologous expression studies conducted so far rely on a small number of suitable expression systems. Particularly the plasmid based expression systems already developed for the use in R. eutropha H16 suffer from high segregational instability and plasmid loss after a short time of fermentation. In order to develop efficient and highly stable plasmid expression vectors for the use in R. eutropha H16, a new plasmid design was created including the RP4 partitioning system, as well as various promoters and origins of replication. The application of minireplicons derived from broad-host-range plasmids RSF1010, pBBR1, RP4 and pSa for the construction of expression vectors and the use of numerous, versatile promoters extend the range of feasible expression levels considerably. In particular, the use of promoters derived from the bacteriophage T5 was described for the first time in this work, characterizing the j5 promoter as the strongest promoter yet to be applied in R. eutropha H16. Moreover, the implementation of the RP4 partition sequence in plasmid design increased plasmid stability significantly and enables fermentations with marginal plasmid loss of recombinant R. eutropha H16 for at least 96 h. The utility of the new vector family in R. eutropha H16 is demonstrated by providing expression data with different model proteins and consequently further raises the value of this organism as cell factory for biotechnological applications including protein and metabolite production. Copyright © 2014 Elsevier B.V. All rights reserved.

Critical design criteria for minimal antibiotic-free plasmid vectors necessary to combine robust RNA Pol II and Pol III-mediated eukaryotic expression with high bacterial production yields

PubMed Central

Carnes, Aaron E.; Luke, Jeremy M.; Vincent, Justin M.; Anderson, Sheryl; Schukar, Angela; Hodgson, Clague P.; Williams, James A.

2010-01-01

Background For safety considerations, regulatory agencies recommend elimination of antibiotic resistance markers and nonessential sequences from plasmid DNA-based gene medicines. In the present study we analyzed antibiotic-free (AF) vector design criteria impacting bacterial production and mammalian transgene expression. Methods Both CMV-HTLV-I R RNA Pol II promoter (protein transgene) and murine U6 RNA Pol III promoter (RNA transgene) vector designs were studied. Plasmid production yield was assessed through inducible fed-batch fermentation. RNA Pol II-directed EGFP and RNA Pol III-directed RNA expression were quantified by fluorometry and quantitative real-time polymerase chain reaction (RT-PCR), respectively, after transfection of human HEK293 cells. Results Sucrose-selectable minimalized protein and therapeutic RNA expression vector designs that combined an RNA-based AF selection with highly productive fermentation manufacturing (>1,000 mg/L plasmid DNA) and high level in vivo expression of encoded products were identified. The AF selectable marker was also successfully applied to convert existing kanamycin-resistant DNA vaccine plasmids gWIZ and pVAX1 into AF vectors, demonstrating a general utility for retrofitting existing vectors. A minimum vector size for high yield plasmid fermentation was identified. A strategy for stable fermentation of plasmid dimers with improved vector potency and fermentation yields up to 1,740 mg/L was developed. Conclusions We report the development of potent high yield AF gene medicine expression vectors for protein or RNA (e.g. short hairpin RNA or microRNA) products. These AF expression vectors were optimized to exceed a newly identified size threshold for high copy plasmid replication and direct higher transgene expression levels than alternative vectors. PMID:20806425

The Hippo Signaling Pathway Regulates Ovarian Function via the Proliferation of Ovarian Germline Stem Cells.

PubMed

Ye, Haifeng; Li, Xiaoyan; Zheng, Tuochen; Hu, Chuan; Pan, Zezheng; Huang, Jian; Li, Jia; Li, Wei; Zheng, Yuehui

2017-01-01

To improve the separation, identification and cultivation of ovarian germline stem cells (OGSCs), to clarify the relationship between the Hippo signaling pathway effector YAP1 and the proliferation and differentiation of OGSCs in vitro and to identify the major contribution of Hippo signaling to ovarian function. Two-step enzymatic separation processes and magnetic separation were used to isolate and identify OGSCs by determining the expression of Mvh, Oct4, Nanog, Fragilis and Stella markers. Then, YAP1, as the main effector molecule in the Hippo signaling pathway, was chosen as the target gene of the study. Lentivirus containing overexpressed YAP1 or a YAP1-targeted shRNA was transduced into OGSCs. The effects of modulating the Hippo signaling pathway on the proliferation, differentiation, reproduction and endocrine function of ovaries were observed by microinjecting the lentiviral vectors with overexpressed YAP1 or YAP1 shRNA into infertile mouse models or natural mice of reproductive age. (1) The specific expression of Mvh, Oct4, Nanog, Fragilis and Stella markers was observed in isolated stem cells. Thus, the isolated cells were preliminarily identified as OGSCs. (2) The co-expression of LATS2, MST1, YAP1 and MVH was observed in isolated OGSCs. Mvh and Oct4 expression levels were significantly increased in OGSCs overexpressing YAP1 compared to GFP controls. Consistently, Mvh and Oct4 levels were significantly decreased in cells expressing YAP1-targeted shRNA. (3) After 14-75 days of YAP1 overexpression in infertile mouse models, we detected follicle regeneration in ovaries, the activation of primordial follicles and increased birth rate, accompanied by increasing levels of E2 and FSH. (4) However, we detected decreasing follicles in ovaries, lower birth rate, and decreasing E2 and FSH in serum from healthy mice of reproductive age following YAP1 shRNA expression. Methods for the isolation, identification and culture of OGSCs were successfully established. Further results indicate that isolated OGSCs can specifically recognize Hippo signaling molecules and that manipulation of YAP1 expression can be used to regulate the proliferation and differentiation of OGSCs, as well as ovarian function in mice. This study suggests that the Hippo signaling pathway may represent a new molecular target for the regulation of mouse ovarian functional remodeling. © 2017 The Author(s)Published by S. Karger AG, Basel.

RNAi screening of subtracted transcriptomes reveals tumor suppression by taurine-activated GABAA receptors involved in volume regulation

PubMed Central

van Nierop, Pim; Vormer, Tinke L.; Foijer, Floris; Verheij, Joanne; Lodder, Johannes C.; Andersen, Jesper B.; Mansvelder, Huibert D.; te Riele, Hein

2018-01-01

To identify coding and non-coding suppressor genes of anchorage-independent proliferation by efficient loss-of-function screening, we have developed a method for enzymatic production of low complexity shRNA libraries from subtracted transcriptomes. We produced and screened two LEGO (Low-complexity by Enrichment for Genes shut Off) shRNA libraries that were enriched for shRNA vectors targeting coding and non-coding polyadenylated transcripts that were reduced in transformed Mouse Embryonic Fibroblasts (MEFs). The LEGO shRNA libraries included ~25 shRNA vectors per transcript which limited off-target artifacts. Our method identified 79 coding and non-coding suppressor transcripts. We found that taurine-responsive GABAA receptor subunits, including GABRA5 and GABRB3, were induced during the arrest of non-transformed anchor-deprived MEFs and prevented anchorless proliferation. We show that taurine activates chloride currents through GABAA receptors on MEFs, causing seclusion of cell volume in large membrane protrusions. Volume seclusion from cells by taurine correlated with reduced proliferation and, conversely, suppression of this pathway allowed anchorage-independent proliferation. In human cholangiocarcinomas, we found that several proteins involved in taurine signaling via GABAA receptors were repressed. Low GABRA5 expression typified hyperproliferative tumors, and loss of taurine signaling correlated with reduced patient survival, suggesting this tumor suppressive mechanism operates in vivo. PMID:29787571

Generation of an induced pluripotent stem cell line from a patient with non-syndromic CLN3-associated retinal degeneration and a coisogenic control line.

PubMed

Zhang, Xiao; Zhang, Dan; Chen, Shang-Chih; Lamey, Tina; Thompson, Jennifer A; McLaren, Terri; De Roach, John N; Chen, Fred K; McLenachan, Samuel

2018-05-01

We report the generation of the human iPSC line LEIi004-A from a patient with late-onset non-syndromic retinitis pigmentosa caused by compound heterozygous mutations in the CLN3 gene. Reprogramming of primary dermal fibroblasts was performed using episomal plasmids containing OCT4, SOX2, KLF4, L-MYC, LIN28, shRNA for p53 and mir302/367 microRNA. To create a coisogenic control line, one CLN3 variant was corrected in the patient-iPSC using CRISPR/Cas9 gene editing to generate the iPSC line LEIi004-A-1. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Recombinant cell lines expressing shRNA targeting herpes simplex virus 2 VP16 inhibit virus replication.

PubMed

Zhang, Rui; Wang, Yan; Song, Bo; Han, Zhi Qiang; Xu, Yu Ming

2012-01-01

To establish HSV2 VP16 targeting shRNA-expressing cell lines and investigate the antiviral effect of shRNA targeting HSV2 VP16. The cell lines Vero-shRNAs and negative-control Vero-shCON were established. Their inhibition effects on VP16 mRNA expression were tested by real-time fluorescent quantitative polymerase chain reaction (PCR) and their antiviral effects were evaluated by yield reduction assay. The influence of passage numbers on the inhibition ability of cell lines was researched. Vero-shRNA24 targeting the upper stream, Vero-shRNA642 targeting the lower stream and Vero-shCON were established. Vero-shRNA24, Vero-shRNA642 and Vero-shRNA24 + 642 could reduce the VP16 mRNA significantly. Vero-shRNA24 was the most efficient. The HSV2 titers in Vero and Vero-shCON were the highest at 72 h after infection, and started decreasing thereafter. The viral titers of the Vero-shRNA groups reached a peak after 84 h and the highest titers were lower than in the Vero group. The inhibiting effect on VP16 mRNA expression and viral replication of Vero-shRNA24 cell lines of passages 10 and 20 were not significantly different from the primary cell line. Although of no statistical significance, the passage 50 cell line showed decreased inhibiting ability. Recombinant cell lines expressing shRNA targeting HSV2 VP16 were established. They can stably inhibit HSV2 VP16 mRNA expression and viral replication within passage 50. Copyright © 2012 S. Karger AG, Basel.

Spermine oxidase is a regulator of macrophage host response to Helicobacter pylori: enhancement of antimicrobial nitric oxide generation by depletion of spermine.

PubMed

Chaturvedi, Rupesh; Asim, Mohammad; Barry, Daniel P; Frye, Jeanetta W; Casero, Robert A; Wilson, Keith T

2014-03-01

The gastric pathogen Helicobacter pylori causes peptic ulcer disease and gastric cancer. We have reported that in H. pylori-activated macrophages, nitric oxide (NO) derived from inducible NO synthase (iNOS) can kill the bacterium, iNOS protein expression is dependent on uptake of its substrate L-arginine (L-Arg), the polyamine spermine can inhibit iNOS translation by inhibiting L-Arg uptake, and inhibition of polyamine synthesis enhances NO-mediated bacterial killing. Because spermine oxidase (SMO), which back-converts spermine to spermidine, is induced in macrophages by H. pylori, we determined its role in iNOS-dependent host defense. SMO shRNA knockdown in RAW 264.7 murine macrophages resulted in a marked decrease in H. pylori-stimulated iNOS protein, but not mRNA expression, and a 90% reduction in NO levels; NO production was also inhibited in primary murine peritoneal macrophages with SMO knockdown. There was an increase in spermine levels after H. pylori stimulation that rapidly decreased, while SMO knockdown caused a greater increase in spermine that was sustained. With SMO knockdown, L-Arg uptake and killing of H. pylori by macrophages was prevented. The overexpression of SMO by transfection of an expression plasmid prevented the H. pylori-stimulated increase in spermine levels, and led to increased L-Arg uptake, iNOS protein expression and NO production, and H. pylori killing. In two human monocytic cell lines, U937 and THP-1, overexpression of SMO caused a significant enhancement of NO production with H. pylori stimulation. By depleting spermine, SMO can abrogate the inhibitory effect of polyamines on innate immune responses to H. pylori by enhancing antimicrobial NO production.

Multivalent Chromosomal Expression of the Clostridium botulinum Serotype A Neurotoxin Heavy-Chain Antigen and the Bacillus anthracis Protective Antigen in Lactobacillus acidophilus.

PubMed

O'Flaherty, Sarah; Klaenhammer, Todd R

2016-10-15

Clostridium botulinum and Bacillus anthracis produce potent toxins that cause severe disease in humans. New and improved vaccines are needed for both of these pathogens. For mucosal vaccine delivery using lactic acid bacteria, chromosomal expression of antigens is preferred over plasmid-based expression systems, as chromosomal expression circumvents plasmid instability and the need for antibiotic pressure. In this study, we constructed three strains of Lactobacillus acidophilus NCFM expressing from the chromosome (i) the nontoxic host receptor-binding domain of the heavy chain of Clostridium botulinum serotype A neurotoxin (BoNT/A-Hc), (ii) the anthrax protective antigen (PA), and (iii) both the BoNT/A-Hc and the PA. The BoNT/A-Hc vaccine cassette was engineered to contain the signal peptide from the S-layer protein A from L. acidophilus and a dendritic-cell-targeting peptide. A chromosomal region downstream of lba0889 carrying a highly expressed enolase gene was selected for insertion of the vaccine cassettes. Western blot analysis confirmed the heterologous expression of the two antigens from plasmid and chromosome locations. Stability assays demonstrated loss of the vaccine cassettes from expression plasmids without antibiotic maintenance. RNA sequencing showed high expression of each antigen and that insertion of the vaccine cassettes had little to no effect on the transcription of other genes in the chromosome. This study demonstrated that chromosomal integrative recombinant strains are promising vaccine delivery vehicles when targeted into high-expression chromosomal regions. Levels of expression match high-copy-number plasmids and eliminate the requirement for antibiotic selective maintenance of recombinant plasmids. Clostridium botulinum and Bacillus anthracis produce potent neurotoxins that pose a biochemical warfare concern; therefore, effective vaccines against these bacteria are required. Chromosomal expression of antigens is preferred over plasmid-based expression systems since expressing antigens from a chromosomal location confers an advantage to the vaccine strains by eliminating the antibiotic maintenance required for plasmids and negates issues with plasmid instability that would result in loss of the antigen. Lactic acid bacteria, including Lactobacillus acidophilus, have shown potential for mucosal vaccine delivery, as L. acidophilus is bile and acid tolerant, allowing transit through the gastrointestinal tract where cells interact with host epithelial and immune cells, including dendritic cells. In this study, we successfully expressed C. botulinum and B. anthracis antigens in the probiotic L. acidophilus strain NCFM. Both antigens were highly expressed individually or in tandem from the chromosome of L. acidophilus. Copyright © 2016 O'Flaherty and Klaenhammer.

Multivalent Chromosomal Expression of the Clostridium botulinum Serotype A Neurotoxin Heavy-Chain Antigen and the Bacillus anthracis Protective Antigen in Lactobacillus acidophilus

PubMed Central

Klaenhammer, Todd R.

2016-01-01

ABSTRACT Clostridium botulinum and Bacillus anthracis produce potent toxins that cause severe disease in humans. New and improved vaccines are needed for both of these pathogens. For mucosal vaccine delivery using lactic acid bacteria, chromosomal expression of antigens is preferred over plasmid-based expression systems, as chromosomal expression circumvents plasmid instability and the need for antibiotic pressure. In this study, we constructed three strains of Lactobacillus acidophilus NCFM expressing from the chromosome (i) the nontoxic host receptor-binding domain of the heavy chain of Clostridium botulinum serotype A neurotoxin (BoNT/A-Hc), (ii) the anthrax protective antigen (PA), and (iii) both the BoNT/A-Hc and the PA. The BoNT/A-Hc vaccine cassette was engineered to contain the signal peptide from the S-layer protein A from L. acidophilus and a dendritic-cell-targeting peptide. A chromosomal region downstream of lba0889 carrying a highly expressed enolase gene was selected for insertion of the vaccine cassettes. Western blot analysis confirmed the heterologous expression of the two antigens from plasmid and chromosome locations. Stability assays demonstrated loss of the vaccine cassettes from expression plasmids without antibiotic maintenance. RNA sequencing showed high expression of each antigen and that insertion of the vaccine cassettes had little to no effect on the transcription of other genes in the chromosome. This study demonstrated that chromosomal integrative recombinant strains are promising vaccine delivery vehicles when targeted into high-expression chromosomal regions. Levels of expression match high-copy-number plasmids and eliminate the requirement for antibiotic selective maintenance of recombinant plasmids. IMPORTANCE Clostridium botulinum and Bacillus anthracis produce potent neurotoxins that pose a biochemical warfare concern; therefore, effective vaccines against these bacteria are required. Chromosomal expression of antigens is preferred over plasmid-based expression systems since expressing antigens from a chromosomal location confers an advantage to the vaccine strains by eliminating the antibiotic maintenance required for plasmids and negates issues with plasmid instability that would result in loss of the antigen. Lactic acid bacteria, including Lactobacillus acidophilus, have shown potential for mucosal vaccine delivery, as L. acidophilus is bile and acid tolerant, allowing transit through the gastrointestinal tract where cells interact with host epithelial and immune cells, including dendritic cells. In this study, we successfully expressed C. botulinum and B. anthracis antigens in the probiotic L. acidophilus strain NCFM. Both antigens were highly expressed individually or in tandem from the chromosome of L. acidophilus. PMID:27496774

Development of Novel Peptide Inhibitors of the Estrogen Receptor

DTIC Science & Technology

1997-10-01

plasmids used for the transfection experiments described below included pERE-TK- CAT , an estrogen responsive chloramphenicol acetylase reporter plasmid...The inhibitory potential of expressed fragments of ER were assessed by measuring the activity of chloramphenicol acetyltransferase ( CAT ) enzyme...with an ER expression plasmid (pCMV-ER) and an estrogen-responsive reporter plasmid (pERE-TK- CAT ) in order to look for inhibition of an ER mediated

Tailor-made fibroblast-specific and antibiotic-free interleukin 12 plasmid for gene electrotransfer-mediated cancer immunotherapy.

PubMed

Kamensek, Urska; Tesic, Natasa; Sersa, Gregor; Kos, Spela; Cemazar, Maja

2017-01-01

Electrotransfer mediated delivery of interleukin-12 (IL-12) gene, encoded on a plasmid vector, has already been demonstrated to have a potent antitumor efficacy and great potential for clinical application. In the present study, our aim was to construct an optimized IL-12-encoding plasmid that is safe from the regulatory point of view. In light of previous studies demonstrating that IL-12 should be released in a tumor localized manner for optimal efficacy, the strong ubiquitous promoter was replaced with a weak endogenous promoter of the collagen 2 gene, which is specific for fibroblasts. Next, to comply with increasing regulatory demands for clinically used plasmids, the expression cassette was cloned in a plasmid lacking the antibiotic resistance gene. The constructed fibroblast-specific and antibiotic-free IL-12 plasmid was demonstrated to support low IL-12 expression after gene electrotransfer in selected cell lines. Furthermore, the removal of antibiotic resistance did not affect the plasmid expression profile and lowered its cytotoxicity. With optimal IL-12 expression and minimal transgene non-specific effects, i.e., low cytotoxicity, the constructed plasmid could be especially valuable for different modern immunological approaches to achieve localized boosting of the host's immune system. Copyright © 2016 Elsevier Inc. All rights reserved.

Preclinical Biodistribution and Safety Evaluation of a pbi-shRNA STMN1 Lipoplex after Subcutaneous Delivery.

PubMed

Wang, Zhaohui; Jay, Christopher M; Evans, Courtney; Kumar, Padmasini; Phalon, Connor; Rao, Donald D; Senzer, Neil; Nemunaitis, John

2017-02-01

Stathmin-1 (STMN1) is a microtubule-destabilizing protein which is overexpressed in cancer. Its overexpression is associated with poor prognosis and also serves as a predictive marker to taxane therapy. We have developed a proprietary bi-functional shRNA (bi-shRNA) platform to execute RNA interference (RNAi)-mediated gene silencing and a liposome-carrier complex to systemically deliver the pbi-shRNA plasmids. In vitro and in vivo testing demonstrated efficacy and specificity of pbi-shRNA plasmid in targeting STMN1 (Phadke, A. P., Jay, C. M., Wang, Z., Chen, S., Liu, S., Haddock, C., Kumar, P., Pappen, B. O., Rao, D. D., Templeton, N. S., et al. (2011). In vivo safety and antitumor efficacy of bifunctional small hairpin RNAs specific for the human Stathmin 1 oncoprotein. DNA Cell Biol. 30, 715-726.). Biodistribution and toxicology studies in bio-relevant Sprague Dawley rats with pbi-shRNA STMN1 lipoplex revealed that the plasmid DNA was delivered to a broad distribution of organs after a single subcutaneous injection. Specifically, plasmid was detected within the first week using QPCR (threshold 50 copies plasmid/1 µg genomic DNA) at the injection site, lung, spleen, blood, skin, ovary (limited), lymph nodes, and liver. It was not detected in the heart, testis or bone marrow. No plasmid was detected from any organ 30 days after injection. Treatment was well tolerated. Minimal inflammation/erythema was observed at the injection site. Circulating cytokine response was also examined by ELISA. The IL-6 levels were induced within 6 h then declined to the vehicle control level 72 h after the injection. TNFα induction was transiently observed 4 days after the DNA lipoplex treatment. In summary, the pbi-shRNA STMN1 lipoplex was well tolerated and displayed broad distribution after a single subcutaneous injection. The pre-clinical data has been filed to FDA and the pbi-shRNA STMN1 lipoplex is being investigated in a phase I clinical study. © The Author 2016. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

A 5′ Noncoding Exon Containing Engineered Intron Enhances Transgene Expression from Recombinant AAV Vectors in vivo

PubMed Central

Lu, Jiamiao; Williams, James A.; Luke, Jeremy; Zhang, Feijie; Chu, Kirk; Kay, Mark A.

2017-01-01

We previously developed a mini-intronic plasmid (MIP) expression system in which the essential bacterial elements for plasmid replication and selection are placed within an engineered intron contained within a universal 5′ UTR noncoding exon. Like minicircle DNA plasmids (devoid of bacterial backbone sequences), MIP plasmids overcome transcriptional silencing of the transgene. However, in addition MIP plasmids increase transgene expression by 2 and often >10 times higher than minicircle vectors in vivo and in vitro. Based on these findings, we examined the effects of the MIP intronic sequences in a recombinant adeno-associated virus (AAV) vector system. Recombinant AAV vectors containing an intron with a bacterial replication origin and bacterial selectable marker increased transgene expression by 40 to 100 times in vivo when compared with conventional AAV vectors. Therefore, inclusion of this noncoding exon/intron sequence upstream of the coding region can substantially enhance AAV-mediated gene expression in vivo. PMID:27903072

Functional Geno,ic Analysis of Breast Cancer Cell Tumorigenicity Using a Noval Gene Silencing Resource

DTIC Science & Technology

2006-04-01

Fig. 2B). In addition, luciferase assay on cells co-transfected with constructs expressing firefly and renilla luciferase genes showed a significant...positive cells. (C) BT474 cells were co-transfected with pGL3 plasmid expressing firefly luciferase, pRL plasmid expressing renilla luciferase, and...genes Per1 (A) and Bmal1 (B). BT474 cells were transfected with Per1 (A) and Bmal1 (B) firefly luciferase reporters, pRL plasmid expressing renilla

Inducible expression of photoacoustic reporter gene tyrosinase in cells using a single plasmid

NASA Astrophysics Data System (ADS)

Paproski, Robert J.; Zemp, Roger J.

2012-02-01

We have previously demonstrated that tyrosinase is a reporter gene for photoacoustic imaging since tyrosinase is the rate-limiting step in the synthesis of melanin, a pigment capable of producing strong photoacoustic signals. We previously created a cell line capable of inducible tyrosinase expression (important due to toxicity of melanin) by stably transfecting tyrosinase in MCF-7 Tet-OnR cell line (Clontech) which expresses a doxycycline-controlled transactivator. Unfortunately, Clontech provides few Tet-On Advanced cell lines making it difficult to have inducible tyrosinase expression in cell lines not provided by Clontech. In order to simplify the creation of cell lines with inducible expression of tyrosinase, we created a single plasmid that encodes both the transactivator as well as tyrosinase. PCR was used to amplify both the transactivator and tyrosinase from the Tet-OnR Advanced and pTRE-Tight-TYR plasmids, respectively. Both PCR products were cloned into the pEGFP-N1 plasmid and the newly created plasmid was transfected into ZR-75-1, MCF-7, and MIA PaCa-1 cells using lipofectamine. After several days, brown melanin was only observed in cells incubated with doxycycline, suggesting that the newly created single plasmid allowed inducible tyrosinase expression in many different cells lines.

[Application of dhfr gene negative Chinese hamster ovary cell line to express hepatitis B virus surface antigen].

PubMed

Yi, Y; Zhang, M; Liu, C

2001-06-01

To set up an efficient expressing system for recombinant hepatitis B virus surface antigen (HBsAg) in dhfr gene negative CHO cell line. HBsAg gene expressing plasmid pCI-dhfr-S was constructed by integrating HBsAg gene into plasmid pCI which carries dhfr gene. The HBsAg expressing cell line was set up by transfection of plasmid pCI-dhfr-S into dhfr gene negative CHO cell line in the way of lipofectin. Under the selective pressure of MTX, 18 of 28 clonized cell lines expressed HBsAg, 4 of them reached a high titer of 1:32 and protein content 1-3 micrograms/ml. In this study, the high level expression of HBsAg demonstrated that the dhfr negative mammalian cell line when recombined with plasmid harboring the corresponding deleted gene can efficiently express the foreign gene. The further steps toward building optimum conditions of the expressing system and the increase of expressed product are under study.

Targeted gene delivery to the synovial pannus in antigen-induced arthritis by ultrasound-targeted microbubble destruction in vivo.

PubMed

Xiang, Xi; Tang, Yuanjiao; Leng, Qianying; Zhang, Lingyan; Qiu, Li

2016-02-01

The purpose of this study was to optimize an ultrasound-targeted microbubble destruction (UTMD) technique to improve the in vivo transfection efficiency of the gene encoding enhanced green fluorescent protein (EGFP) in the synovial pannus in an antigen-induced arthritis rabbit model. A mixture of microbubbles and plasmids was locally injected into the knee joints of an antigen-induced arthritis (AIA) rabbits. The plasmid concentrations and ultrasound conditions were varied in the experiments. We also tested local articular and intravenous injections. The rabbits were divided into five groups: (1) ultrasound+microbubbles+plasmid; (2) ultrasound+plasmid; (3) microbubble+plasmid; (4) plasmid only; (5) untreated controls. EGFP expression was observed by fluorescent microscope and immunohistochemical staining in the synovial pannus of each group. The optimal plasmid dosage and ultrasound parameter were determined based on the results of EGFP expression and the present and absent of tissue damage under light microscopy. The irradiation procedure was performed to observe the duration of the EGFP expression in the synovial pannus and other tissues and organs, as well as the damage to the normal cells. The optimal condition was determined to be a 1-MHz ultrasound pulse applied for 5 min with a power output of 2 W/cm(2) and a 20% duty cycle along with 300 μg of plasmid. Under these conditions, the synovial pannus showed significant EGFP expression without significant damage to the surrounding normal tissue. The EGFP expression induced by the local intra-articular injection was significantly more increased than that induced by the intravenous injection. The EGFP expression in the synovial pannus of the ultrasound+microbubbles+plasmid group was significantly higher than that of the other four groups (P<0.05). The expression peaked on day 5, remained detectable on day 40 and disappeared on day 60. No EGFP expression was detected in the other tissues and organs. The UTMD technique can significantly enhance the in vivo gene transfection efficiency without significant tissue damage in the synovial pannus of an AIA model. Thus, this could become a safe and effective non-viral gene transfection procedure for arthritis therapy. Copyright © 2015 Elsevier B.V. All rights reserved.

Aberrant levels of histone H3 acetylation induce spermatid anomaly in mouse testis.

PubMed

Dai, Lei; Endo, Daisuke; Akiyama, Naotaro; Yamamoto-Fukuda, Tomomi; Koji, Takehiko

2015-02-01

Histone acetylation is involved in the regulation of chromatin structure and gene function. We reported previously that histone H3 acetylation pattern is subject to dynamic changes and limited to certain stages of germ cell differentiation during murine spermatogenesis, suggesting a crucial role for acetylation in the process. In the present study, we investigated the effects of hyper- and hypo-acetylation on spermatogenesis. Changes in acetylation level were induced by either in vivo administration of sodium phenylbutyrate, a histone deacetylase inhibitor, or by knockdown of histone acetyltransferases using short hairpin RNA plasmids transfection. Administration of sodium phenylbutyrate induced accumulation of acetylated histone H3 at lysine 9 and lysine 18 in round spermatids, together with spermatid morphological abnormalities and induction of apoptosis through a Bax-related pathway. Knockdown of steroid receptor coactivator 1, a member of histone acetyltransferases, but not general control of amino acid synthesis 5 nor elongator protein 3 by in vivo electroporation of shRNA plasmids, reduced acetylated histone H3 at lysine 9 in round spermatids, and induced morphological abnormalities. We concluded that the proper regulation of histone H3 acetylation levels is important for spermatid differentiation and complex chromatin remodeling during spermiogenesis.

Role of the 85-Kilobase Plasmid and Plasmid-Encoded Virulence-Associated Protein A in Intracellular Survival and Virulence of Rhodococcus equi

PubMed Central

Giguère, Steeve; Hondalus, Mary K.; Yager, Julie A.; Darrah, Patricia; Mosser, David M.; Prescott, John F.

1999-01-01

Rhodococcus equi is a facultative intracellular pathogen of macrophages and a cause of pneumonia in young horses (foals) and immunocompromised people. Isolates of R. equi from pneumonic foals typically contain large, 85- or 90-kb plasmids encoding a highly immunogenic virulence-associated protein (VapA). The objective of this study was to determine the role of the 85-kb plasmid and VapA in the intracellular survival and virulence of R. equi. Clinical isolates containing the plasmid and expressing VapA efficiently replicated within mouse macrophages in vitro, while plasmid-cured derivatives of these organisms did not multiply intracellularly. An isolate harboring the large plasmid also replicated in the tissues of experimentally infected mice, whereas its plasmid-cured derivative was rapidly cleared. All foals experimentally infected with a plasmid-containing clinical isolate developed severe bronchopneumonia, whereas the foals infected with its plasmid-cured derivative remained asymptomatic and free of visible lung lesions. By day 14 postinfection, lung bacterial burdens had increased considerably in foals challenged with the plasmid-containing clinical isolate. In contrast, bacteria could no longer be cultured from the lungs of foals challenged with the isogenic plasmid-cured derivative. A recombinant, plasmid-cured derivative expressing wild-type levels of VapA failed to replicate in macrophages and remained avirulent for both mice and foals. These results show that the 85-kb plasmid of R. equi is essential for intracellular replication within macrophages and for development of disease in the native host, the foal. However, expression of VapA alone is not sufficient to restore the virulence phenotype. PMID:10377138

Phenotypic Screening for Friedreich Ataxia Using Random shRNA Selection.

PubMed

Cotticelli, M Grazia; Acquaviva, Fabio; Xia, Shujuan; Kaur, Avinash; Wang, Yongping; Wilson, Robert B

2015-10-01

Friedreich ataxia (FRDA) is an autosomal recessive neuro- and cardio-degenerative disorder for which there are no proven effective treatments. FRDA is caused by decreased expression and/or function of the protein frataxin. Frataxin chaperones iron in the mitochondrial matrix and regulates the iron-sulfur cluster (ISC) assembly complex. ISCs are prosthetic groups critical for the function of the Krebs cycle and the mitochondrial electron transport chain. Decreased expression of frataxin is associated with decreased ISC assembly, mitochondrial iron accumulation, and increased oxidative stress, all of which contribute to mitochondrial dysfunction. In media with beta-hydroxybutyrate (BHB) as carbon source, primary FRDA fibroblasts grow poorly and/or lose viability over several days. We screened a random, short-hairpin-RNA (shRNA)-expressing library in primary FRDA fibroblasts and identified two shRNAs that reverse the growth/viability defect in BHB media. One of these two clones increases frataxin expression in primary FRDA fibroblasts, either as a vector-expressed shRNA or as a transfected short-interfering RNA (siRNA). © 2015 Society for Laboratory Automation and Screening.

Tumor-specific expression of shVEGF and suicide gene as a novel strategy for esophageal cancer therapy.

PubMed

Liu, Ting; Wu, Hai-Jun; Liang, Yu; Liang, Xu-Jun; Huang, Hui-Chao; Zhao, Yan-Zhong; Liao, Qing-Chuan; Chen, Ya-Qi; Leng, Ai-Min; Yuan, Wei-Jian; Zhang, Gui-Ying; Peng, Jie; Chen, Yong-Heng

2016-06-21

To develop a potent and safe gene therapy for esophageal cancer. An expression vector carrying fusion suicide gene (yCDglyTK) and shRNA against vascular endothelial growth factor (VEGF) was constructed and delivered into EC9706 esophageal cancer cells by calcium phosphate nanoparticles (CPNP). To achieve tumor selectivity, expression of the fusion suicide gene was driven by a tumor-specific human telomerase reverse transcriptase (hTERT) promoter. The biologic properties and therapeutic efficiency of the vector, in the presence of prodrug 5-fluorocytosine (5-FC), were evaluated in vitro and in vivo. Both in vitro and in vivo testing showed that the expression vector was efficiently introduced by CPNP into tumor cells, leading to cellular expression of yCDglyTK and decreased VEGF level. With exposure to 5-FC, it exhibited strong anti-tumor effects against esophageal cancer. Combination of VEGF shRNA with the fusion suicide gene demonstrated strong anti-tumor activity. The shVEGF-hTERT-yCDglyTK/5-FC system provided a novel approach for esophageal cancer-targeted gene therapy.

Down-regulation of human endogenous retrovirus type K (HERV-K) viral env RNA in pancreatic cancer cells decreases cell proliferation and tumor growth

PubMed Central

Li, Ming; Radvanyi, Laszlo; Yin, Bingnan; Li, Jia; Chivukula, Raghavender; Lin, Kevin; Lu, Yue; Shen, JianJun; Chang, David Z.; Li, Donghui; Johanning, Gary L.; Wang-Johanning, Feng

2017-01-01

Purpose We investigated the role of the human endogenous retrovirus type K (HERV-K) envelope (env) gene in pancreatic cancer (PC). Experimental Design shRNA was employed to knockdown (KD) the expression of HERV-K in PC cells. Results HERV-K env expression was detected in seven PC cell lines and in 80% of PC patient biopsies, but not in two normal pancreatic cell lines or uninvolved normal tissues. A new HERV-K splice variant was discovered in several PC cell lines. RT activity and virus-like particles were observed in culture media supernatant obtained from Panc-1 and Panc-2 cells. HERV-K viral RNA levels and anti-HERV-K antibody titers were significantly higher in PC patient sera (N=106) than in normal donor sera (N=40). Importantly, the in vitro and in vivo growth rates of three PC cell lines were significantly reduced after HERV-K KD by shRNA targeting HERV-K env, and there was reduced metastasis to lung after treatment. RNA-seq results revealed changes in gene expression after HERV-K env KD, including RAS and TP53. Furthermore, downregulation of HERV-K Env protein expression by shRNA also resulted in decreased expression of RAS, p-ERK, p-RSK, and p-AKT in several PC cells or tumors. Conclusion These results demonstrate that HERV-K influences signal transduction via the RAS-ERK-RSK pathway in PC. Our data highlight the potentially important role of HERV-K in tumorigenesis and progression of PC, and indicate that HERV-K viral proteins may be attractive biomarkers and/or tumor-associated antigens, as well as potentially useful targets for detection, diagnosis and immunotherapy of PC. PMID:28679769

PSMB5 plays a dual role in cancer development and immunosuppression

PubMed Central

Wang, Chih-Yang; Li, Chung-Yen; Hsu, Hui-Ping; Cho, Chien-Yu; Yen, Meng-Chi; Weng, Tzu-Yang; Chen, Wei-Ching; Hung, Yu-Hsuan; Lee, Kuo-Ting; Hung, Jui-Hsiang; Chen, Yi-Ling; Lai, Ming-Derg

2017-01-01

Tumor progression and metastasis are dependent on the intrinsic properties of tumor cells and the influence of microenvironment including the immune system. It would be important to identify target drug that can inhibit cancer cell and activate immune cells. Proteasome β subunits (PSMB) family, one component of the ubiquitin-proteasome system, has been demonstrated to play an important role in tumor cells and immune cells. Therefore, we used a bioinformatics approach to examine the potential role of PSMB family. Analysis of breast TCGA and METABRIC database revealed that high expression of PSMB5 was observed in breast cancer tissue and that high expression of PSMB5 predicted worse survival. In addition, high expression of PSMB5 was observed in M2 macrophages. Based on our bioinformatics analysis, we hypothesized that PSMB5 contained immunosuppressive and oncogenic characteristics. To study the effects of PSMB5 on the cancer cell and macrophage in vitro, we silenced PSMB5 expression with shRNA in THP-1 monocytes and MDA-MB-231 cells respectively. Knockdown of PSMB5 promoted human THP-1 monocyte differentiation into M1 macrophage. On the other hand, knockdown PSMB5 gene expression inhibited MDA-MB-231 cell growth and migration by colony formation assay and boyden chamber. Collectively, our data demonstrated that delivery of PSMB5 shRNA suppressed cell growth and activated defensive M1 macrophages in vitro. Furthermore, lentiviral delivery of PSMB5 shRNA significantly decreased tumor growth in a subcutaneous mouse model. In conclusion, our bioinformatics study and functional experiments revealed that PSMB5 served as novel cancer therapeutic targets. These results also demonstrated a novel translational approach to improve cancer immunotherapy. PMID:29218236

Silencing of Urothelial Carcinoma Associated 1 Inhibits the Proliferation and Migration of Medulloblastoma Cells.

PubMed

Zhengyuan, Xie; Hu, Xiao; Qiang, Wang; Nanxiang, Li; Junbin, Cai; Wangming, Zhang

2017-09-16

BACKGROUND UCA1 is a long non-coding RNA that has been found to be aberrantly upregulated in various cancers. The aim of this study was to determine the expression level and function of UCA1 in medulloblastoma, the most common malignant brain tumor during childhood. MATERIAL AND METHODS Real-time PCR was used to detect the expression of UCA1 in medulloblastoma specimens and cell lines. Lentiviral-mediated expression of a short hairpin RNA (shRNA) targeting UCA1 or a negative control shRNA was also achieved with the medulloblastoma cell line, Daoy. Cell proliferation and cell cycle progression were subsequently characterized with cell counting kit (CCK)-8 and flow cytometry. Cell migration was examined in wound healing and Transwell migration assays. RESULTS Levels of UCA1 mRNA were higher in the medulloblastoma specimens (p<0.05) and cell lines (p<0.05) compared to the corresponding nontumor adjacent tissue specimens and a glioblastoma cell line, respectively. For the Daoy cells with silenced UCA1, their proliferation was reduced by 30% compared to the Daoy cells expressing a negative control shRNA (p=0.017). Cell cycle arrest in the G0/G1 phase, resulting in a decreased number of cells in the S phase, as well as reduced cell migration in both wound scratch healing (p=0.001) and Transwell migration assays (p=0.021) were also observed for the Daoy cells with silenced UCA1. CONCLUSIONS UCA1 was highly expressed in part of medulloblastoma specimens and cell lines examined. In addition, knockdown of UCA1 significantly inhibited the proliferation and migration of medulloblastoma cells in vitro.

Pleckstrin homology domain-interacting protein (PHIP) as a marker and mediator of melanoma metastasis

PubMed Central

De Semir, David; Nosrati, Mehdi; Bezrookove, Vladimir; Dar, Altaf A.; Federman, Scot; Bienvenu, Geraldine; Venna, Suraj; Rangel, Javier; Climent, Joan; Meyer Tamgüney, Tanja M.; Thummala, Suresh; Tong, Schuyler; Leong, Stanley P. L.; Haqq, Chris; Billings, Paul; Miller, James R.; Sagebiel, Richard W.; Debs, Robert; Kashani-Sabet, Mohammed

2012-01-01

Although melanomas with mutant v-Raf murine sarcoma viral oncogene homolog B1 (BRAF) can now be effectively targeted, there is no molecular target for most melanomas expressing wild-type BRAF. Here, we show that the activation of Pleckstrin homology domain-interacting protein (PHIP), promotes melanoma metastasis, can be used to classify a subset of primary melanomas, and is a prognostic biomarker for melanoma. Systemic, plasmid-based shRNA targeting of Phip inhibited the metastatic progression of melanoma, whereas stable suppression of Phip in melanoma cell lines suppressed metastatic potential and prolonged the survival of tumor-bearing mice. The human PHIP gene resides on 6q14.1, and although 6q loss has been observed in melanoma, the PHIP locus was preserved in melanoma cell lines and patient samples, and its overexpression was an independent adverse predictor of survival in melanoma patients. In addition, a high proportion of PHIP-overexpressing melanomas harbored increased PHIP copy number. PHIP-overexpressing melanomas include tumors with wild-type BRAF, neuroblastoma RAS viral (v-ras) oncogene homolog, and phosphatase and tensin homolog, demonstrating PHIP activation in triple-negative melanoma. These results describe previously unreported roles for PHIP in predicting and promoting melanoma metastasis, and in the molecular classification of melanoma. PMID:22511720

Decreasing CNPY2 Expression Diminishes Colorectal Tumor Growth and Development through Activation of p53 Pathway.

PubMed

Yan, Ping; Gong, Hui; Zhai, Xiaoyan; Feng, Yi; Wu, Jun; He, Sheng; Guo, Jian; Wang, Xiaoxia; Guo, Rui; Xie, Jun; Li, Ren-Ke

2016-04-01

Neovascularization drives tumor development, and angiogenic factors are important neovascularization initiators. We recently identified the secreted angiogenic factor CNPY2, but its involvement in cancer has not been explored. Herein, we investigate CNPY2's role in human colorectal cancer (CRC) development. Tumor samples were obtained from CRC patients undergoing surgery. Canopy 2 (CNPY2) expression was analyzed in tumor and adjacent normal tissue. Stable lines of human HCT116 cells expressing CNPY2 shRNA or control shRNA were established. To determine CNPY2's effects on tumor xenografts in vivo, human CNPY2 shRNA HCT116 cells and controls were injected into nude mice, separately. Cellular apoptosis, growth, and angiogenesis in the xenografts were evaluated. CNPY2 expression was significantly higher in CRC tissues. CNPY2 knockdown in HCT116 cells inhibited growth and migration and promoted apoptosis. In xenografts, CNPY2 knockdown prevented tumor growth and angiogenesis and promoted apoptosis. Knockdown of CNPY2 in the HCT116 CRC cell line reversibly increased p53 activity. The p53 activation increased cyclin-dependent kinase inhibitor p21 and decreased cyclin-dependent kinase 2, thereby inhibiting tumor cell growth, inducing cell apoptosis, and reducing angiogenesis both in vitro and in vivo. CNPY2 may play a critical role in CRC development by enhancing cell proliferation, migration, and angiogenesis and by inhibiting apoptosis through negative regulation of the p53 pathway. Therefore, CNPY2 may represent a novel CRC therapeutic target and prognostic indicator. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

Regulation of Metastatic Breast Cancer Dormancy

DTIC Science & Technology

2015-09-01

individual cell motility to disseminate and eventually extravasate into common metastatic niches such as the brain, bone and liver. Once attaining the...Engineer tagged MCF7 cells with shRNA against E-cadherin and engineer tagged MDA-MB-361 and MDA- MB-231 cells to express or prevent expression of E

Bacterial delivery of RNAi effectors: transkingdom RNAi.

PubMed

Lage, Hermann; Krühn, Andrea

2010-08-18

RNA interference (RNAi) represents a high effective mechanism for specific inhibition of mRNA expression. Besides its potential as a powerful laboratory tool, the RNAi pathway appears to be promising for therapeutic utilization. For development of RNA interference (RNAi)-based therapies, delivery of RNAi-mediating agents to target cells is one of the major obstacles. A novel strategy to overcome this hurdle is transkingdom RNAi (tkRNAi). This technology uses non-pathogenic bacteria, e.g. Escherichia coli, to produce and deliver therapeutic short hairpin RNA (shRNA) into target cells to induce RNAi. A first-generation tkRNAi-mediating vector, TRIP, contains the bacteriophage T7 promoter for expression regulation of a therapeutic shRNA of interest. Furthermore, TRIP has the Inv locus from Yersinia pseudotuberculosis that encodes invasin, which permits natural noninvasive bacteria to enter beta1-integrin-positive mammalian cells and the HlyA gene from Listeria monocytogenes, which produces listeriolysin O. This enzyme allows the therapeutic shRNA to escape from entry vesicles within the cytoplasm of the target cell. TRIP constructs are introduced into a competent non-pathogenic Escherichia coli strain, which encodes T7 RNA polymerase necessary for the T7 promoter-driven synthesis of shRNAs. A well-characterized cancer-associated target molecule for different RNAi strategies is ABCB1 (MDR1/P-glycoprotein, MDR1/P-gp). This ABC-transporter acts as a drug extrusion pump and mediates the "classical" ABCB1-mediated multidrug resistance (MDR) phenotype of human cancer cells which is characterized by a specific cross resistance pattern. Different ABCB1-expressing MDR cancer cells were treated with anti-ABCB1 shRNA expression vector bearing E. coli. This procedure resulted in activation of the RNAi pathways within the cancer cells and a considerable down regulation of the ABCB1 encoding mRNA as well as the corresponding drug extrusion pump. Accordingly, drug accumulation was enhanced in the pristine drug-resistant cancer cells and the MDR phenotype was reversed. By means of this model the data provide the proof-of-concept that tkRNAi is suitable for modulation of cancer-associated factors, e.g. ABCB1, in human cancer cells.

Electrotransfer of Plasmid Vector DNA into Muscle

NASA Astrophysics Data System (ADS)

Miyazaki, Satsuki; Miyazaki, Jun-Ichi

Wolff et al. (1990) first reported that plasmid DNA injected into skeletal muscle is taken up by muscle cells and the genes in the plasmid are expressed for more than two months thereafter, although the transfected DNA does not usually undergo chromosomal integration (Wolff et al., 1991, 1992). However, the relatively low expression levels attained by this method have hampered its applications for uses other than as a DNA vaccine (Davis et al., 1995). There are a number of reports analyzing the conditions that affect the efficiency of gene transfer by intramuscular DNA injection and assessing the fine structures of expression plasmid vectors that may affect expression levels (Davis et al., 1993; Liang et al., 1996; Norman et al., 1997). Furthermore, various attempts were done to improve the efficiency of gene transfer by intramus cular DNA injection. Consequently, regenerating muscle was shown to produce 80-fold or more protein than did normal muscle, following injection of an expression plas-mid. Muscle regeneration was induced by treatment with cardiotoxin or bupivacaine (Wells, 1993; Vitadello et al., 1994). We previously demonstrated that by combining a strong promoter and bupivacaine pretreatment intramuscular injection of an IL-5 expression plasmid results in IL-5 production in muscle at a level sufficient to induce marked proliferation of eosinophils in the bone marrow and eosinophil infiltration of various organs (Tokui et al., 1997). It was also reported that a single intramuscular injection of an erythropoietin expression plasmid produced physiologically significant elevations in serum erythropoietin levels and increased hematocrits in adult mice (Tripathy et al., 1996). Hematocrits in these animals remained elevated at >60% for at least 90 days after a single injection. However, improvements to this method have not been sufficient to extend its applications including clinical use.

Back to basics: pBR322 and protein expression systems in E. coli.

PubMed

Balbás, Paulina; Bolívar, Francisco

2004-01-01

The extensive variety of plasmid-based expression systems in E. coli resulted from the fact that there is no single strategy for achieving maximal expression of every cloned gene. Although a number of strategies have been implemented to deal with problems associated to gene transcription and translation, protein folding, secretion, location, posttranslational modifications, particularities of different strains, and the like and more integrated processes have been developed, the basic plasmid-borne elements and their interaction with the particular host strain will influence the overall expression system and final productivity. Plasmid vector pBR322 is a well-established multipurpose cloning vector in laboratories worldwide, and a large number of derivatives have been created for specific applications and research purposes, including gene expression in its natural host, E. coli, and few other bacteria. The early characterization of the molecule, including its nucleotide sequence, replication and maintenance mechanisms, and determination of its coding regions, accounted for its success, not only as a universal cloning vector, but also as a provider of genes and an origin of replication for other intraspecies vectors. Since the publication of the aforementioned reviews, novel discoveries pertaining to these issues have appeared in the literature that deepen the understanding of the plasmid's features, behavior, and impact in gene expression systems, as well as some important strain characteristics that affect plasmid replication and stability. The objectives of this review include updating and discussing the new information about (1) the replication and maintenance of pBR322; (2) the host-related modulation mechanisms of plasmid replication; (3) the effects of growth rate on replication control, stability, and recombinant gene expression; (4) ways for plasmid amplification and elimination. Finally, (5) a summary of novel ancillary studies about pBR322 is presented.

Genetic Stability of Streptomyces Lividans pIJ702 in Response to Spaceflight

NASA Astrophysics Data System (ADS)

Lim, K. S.; Goins, T. L.; Voeikova, T. A.; Pyle, B. H.

2008-06-01

Streptomyces lividans carrying plasmid pIJ702 encoding genes for thiostrepton resistance (tsr-) and melanin production (mel+) was plated on agar and flown on the Russian satellite Foton-M3 for 16 days. The percentage loss of plasmid expression in flight samples was lower than that in ground samples when both samples were grown in enriched (ISP) media. Differences in media content also affect plasmid expression rate; ISP media have a higher loss of plasmid expression than samples in minimum media when both were grown on ground conditions. Results suggest that stress resulted in the increased expression of plasmid pIJ702 by S. lividans. Screening of thiostrepton resistant white (tsr+ mel-) mutants showed similar proportions of variants in ground samples and flight samples. To determine if there are mutations in the mel gene, DNA extracted from flight and control white mutants was amplified and gel electrophoresis of amplified products show no major mutation in the products. Sequencing of amplified products is required to identify mutations resulting in loss of pigmentation.

Development of inducer-free expression plasmids based on IPTG-inducible promoters for Bacillus subtilis.

PubMed

Tran, Dinh Thi Minh; Phan, Trang Thi Phuong; Huynh, Thanh Kieu; Dang, Ngan Thi Kim; Huynh, Phuong Thi Kim; Nguyen, Tri Minh; Truong, Tuom Thi Tinh; Tran, Thuoc Linh; Schumann, Wolfgang; Nguyen, Hoang Duc

2017-07-25

Besides Escherichia coli, Bacillus subtilis is an important bacterial species for the production of recombinant proteins. Recombinant genes are inserted into shuttle expression vectors which replicate in both E. coli and in B. subtilis. The ligation products are first transformed into E. coli cells, analyzed for correct insertions, and the correct recombinant plasmids are then transformed into B. subtilis. A major problem using E. coli cells can be the strong basal level of expression of the recombinant protein which may interfere with the stability of the cells. To minimize this problem, we developed strong expression vectors being repressed in E. coli and inducer-free in B. subtilis. In general, induction of IPTG-inducible expression vectors is determined by the regulatory lacI gene encoding the LacI repressor in combination with the lacO operator on the promoter. To investigate the inducer-free properties of the vectors, we constructed inducer-free expression plasmids by removing the lacI gene and characterized their properties. First, we examined the ability to repress a reporter gene in E. coli, which is a prominent property facilitating the construction of the expression vectors carrying a target gene. The β-galactosidase (bgaB gene) basal levels expressed from Pgrac01-bgaB could be repressed at least twice in the E. coli cloning strain. Second, the inducer-free production of BgaB from four different plasmids with the Pgrac01 promoter in B. subtilis was investigated. As expected, BgaB expression levels of inducer-free constructs are at least 37 times higher than that of the inducible constructs in the absence of IPTG, and comparable to those in the presence of the inducer. Third, using efficient IPTG-inducible expression vectors containing the strong promoter Pgrac100, we could convert them into inducer-free expression plasmids. The BgaB production levels from the inducer-free plasmid in the absence of the inducer were at least 4.5 times higher than that of the inducible vector using the same promoter. Finally, we used gfp as a reporter gene in combination with the two promoters Pgrac01 and Pgrac100 to test the new vector types. The GFP expression levels could be repressed at least 1.5 times for the Pgrac01-gfp+ inducer-free construct in E. coli. The inducer-free constructs Pgrac01-gfp+ and Pgrac100-gfp+ allowed GFP expression at high levels from 23 × 10 4 to 32 × 10 4 RFU units and 9-13% of total intracellular proteins. We could reconfirm the two major advantages of the new inducer-free expression plasmids: (1) Strong repression of the target gene expression in the E. coli cloning strain, and (2) production of the target protein at high levels in B. subtilis in the absence of the inducer. We propose a general strategy to generate inducer-free expression vector by using IPTG-inducible vectors, and more specifically we developed inducer-free expression plasmids using IPTG-inducible promoters in the absence of the LacI repressor. These plasmids could be an excellent choice for high-level production of recombinant proteins in B. subtilis without the addition of inducer and at the same time maintaining a low basal level of the recombinant proteins in E. coli. The repression of the recombinant gene expression would facilitate cloning of genes that potentially inhibit the growth of E. coli cloning strains. The inducer-free expression plasmids will be extended versions of the current available IPTG-inducible expression vectors for B. subtilis, in which all these vectors use the same cognate promoters. These inducer-free and previously developed IPTG-inducible expression plasmids will be a useful cassette to study gene expression at a small scale up to a larger scale up for the production of recombinant proteins.

A microRNA embedded AAV alpha-synuclein gene silencing vector for dopaminergic neurons

PubMed Central

Han, Ye; Khodr, Christina E.; Sapru, Mohan K.; Pedapati, Jyothi; Bohn, Martha C.

2011-01-01

Alpha-synuclein (SNCA), an abundantly expressed presynaptic protein, is implicated in Parkinson disease (PD). Since over-expression of human SNCA (hSNCA) leads to death of dopaminergic (DA) neurons in human, rodent and fly brain, hSNCA gene silencing may reduce levels of toxic forms of SNCA and ameliorate degeneration of DA neurons in PD. To begin to develop a gene therapy for PD based on hSNCA gene silencing, two AAV gene silencing vectors were designed, and tested for efficiency and specificity of silencing, as well as toxicity in vitro. The same hSNCA silencing sequence (shRNA) was used in both vectors, but in one vector, the shRNA was embedded in a microRNA backbone and driven by a pol II promoter, and in the other the shRNA was not embedded in a microRNA and was driven by a pol III promoter. Both vectors silenced hSNCA to the same extent in 293T cells transfected with hSNCA. In DA PC12 cells, neither vector decreased expression of rat SNCA, tyrosine hydroxylase (TH), dopamine transporter (DAT) or the vesicular monoamine transporter (VMAT). However, the mir30 embedded vector was significantly less toxic to both PC12 and SH-SY5Y cells. Our in vitro data suggest that this miRNA-embedded silencing vector may be ideal for chronic in vivo SNCA gene silencing in DA neurons. PMID:21338582

Duck Enteritis Virus Glycoprotein D and B DNA Vaccines Induce Immune Responses and Immunoprotection in Pekin Ducks

PubMed Central

Zhao, Yan; Cao, Yongsheng; Cui, Lihong; Ma, Bo; Mu, Xiaoyu; Li, Yanwei; Zhang, Zhihui; Li, Dan; Wei, Wei; Gao, Mingchun; Wang, Junwei

2014-01-01

DNA vaccine is a promising strategy for protection against virus infection. However, little is known on the efficacy of vaccination with two plasmids for expressing the glycoprotein D (gD) and glycoprotein B (gB) of duck enteritis virus (DEV) in inducing immune response and immunoprotection against virulent virus infection in Pekin ducks. In this study, two eukaryotic expressing plasmids of pcDNA3.1-gB and pcDNA3.1-gD were constructed. Following transfection, the gB and gD expressions in DF1 cells were detected. Groups of ducks were vaccinated with pcDNA3.1-gB and/or pcDNA3.1-gD, and boosted with the same vaccine on day 14 post primary vaccination. We found that intramuscular vaccinations with pcDNA3.1-gB and/or pcDNA3.1-gD, but not control plasmid, stimulated a high frequency of CD4+ and CD8+ T cells in Pekin ducks, particularly with both plasmids. Similarly, vaccination with these plasmids, particularly with both plasmids, promoted higher levels of neutralization antibodies against DEV in Pekin ducks. More importantly, vaccination with both plasmids significantly reduced the virulent DEV-induced mortality in Pekin ducks. Our data indicated that vaccination with plasmids for expressing both gB and gD induced potent cellular and humoral immunity against DEV in Pekin ducks. Therefore, this vaccination strategy may be used for the prevention of DEV infection in Pekin ducks. PMID:24736466

Duck enteritis virus glycoprotein D and B DNA vaccines induce immune responses and immunoprotection in Pekin ducks.

PubMed

Zhao, Yan; Cao, Yongsheng; Cui, Lihong; Ma, Bo; Mu, Xiaoyu; Li, Yanwei; Zhang, Zhihui; Li, Dan; Wei, Wei; Gao, Mingchun; Wang, Junwei

2014-01-01

DNA vaccine is a promising strategy for protection against virus infection. However, little is known on the efficacy of vaccination with two plasmids for expressing the glycoprotein D (gD) and glycoprotein B (gB) of duck enteritis virus (DEV) in inducing immune response and immunoprotection against virulent virus infection in Pekin ducks. In this study, two eukaryotic expressing plasmids of pcDNA3.1-gB and pcDNA3.1-gD were constructed. Following transfection, the gB and gD expressions in DF1 cells were detected. Groups of ducks were vaccinated with pcDNA3.1-gB and/or pcDNA3.1-gD, and boosted with the same vaccine on day 14 post primary vaccination. We found that intramuscular vaccinations with pcDNA3.1-gB and/or pcDNA3.1-gD, but not control plasmid, stimulated a high frequency of CD4+ and CD8+ T cells in Pekin ducks, particularly with both plasmids. Similarly, vaccination with these plasmids, particularly with both plasmids, promoted higher levels of neutralization antibodies against DEV in Pekin ducks. More importantly, vaccination with both plasmids significantly reduced the virulent DEV-induced mortality in Pekin ducks. Our data indicated that vaccination with plasmids for expressing both gB and gD induced potent cellular and humoral immunity against DEV in Pekin ducks. Therefore, this vaccination strategy may be used for the prevention of DEV infection in Pekin ducks.

Manipulation of VviAGL11 expression changes the seed content in grapevine (Vitis vinifera L.).

PubMed

Malabarba, Jaiana; Buffon, Vanessa; Mariath, Jorge E A; Maraschin, Felipe S; Margis-Pinheiro, Márcia; Pasquali, Giancarlo; Revers, Luís F

2018-04-01

Seedlessness in grapes is a desirable trait, especially for in natura consumption. Previously, we showed that VviAGL11 is the main responsible gene for seed morphogenesis in grapevine. Here we tested the function of this gene in grapevine with the use of plant plasmids. VviAGL11 was cloned into silencing and overexpression versions of p28iIR plasmid. Reproductive grapevine bunches from different seeded and seedless cultivars were separately treated with VviAGL11-harboring plasmids, along with controls. Plasmids were detected in leaves after a month of treatment, and berries, leaves, stems and seeds were analyzed for ectopic gene expression by RT-qPCR after 90 days of plasmid injection. Fruits from the seedless 'Linda' treated with the VviAGL11-overexpression plasmid showed high expression levels of VviAGL11 and exhibited small seeds that were not found in the untreated control samples. Mature grapes from seeded 'Italia' and 'Ruby' bunches treated with the VviAGL11-silencing plasmid showed decreased VviAGL11 expression, reduced number of seeds and increased number of seed traces. The present study confirms that VviAGL11 is a key master regulator of seed morphogenesis in grapevine and corroborates with the applicability of plant plasmids as promising biotechnological tools to functionally test genes in perennial plants in a rapid and confident way. Copyright © 2018 Elsevier B.V. All rights reserved.

Reporter gene expression in dendritic cells after gene gun administration of plasmid DNA.

PubMed

Watkins, Craig; Hopkins, John; Harkiss, Gordon

2005-07-21

Dendritic cells (DC) play an integral role in plasmid DNA vaccination. However, the interaction between plasmid DNA and DC in vivo is incompletely understood. In this report, we utilise the sheep pseudoafferent cannulation model to examine the interaction between plasmid DNA encoding enhanced green fluorescent protein (pEGFP) and afferent lymph DC (ALDC) following gene gun administration. The results show that peaks of fluorescent ALDC tended to appear around days 1-4 and 9-13, then erratically thereafter for up to 2 months. Phenotypic analysis showed that EGFP+ ALDC expressed MHC class II, WC6, CD1b, and SIRPalpha markers. Plasmid, detected by PCR, was found in lymph cells and cell-free plasma on a daily basis, and was present variably for up to 2 months. Plasmid was also detected in purified CD1b+ ALDC, but the presence of plasmid did not correlate with EGFP expression by ALDC. Free EGFP in afferent lymph plasma was detectable by luminometry only after three administrations of the plasmid. The results show that gene gun administered pEGFP persisted for extended periods after a single administration, leeching out of skin on a daily basis. The plasmid was associated with both the cellular and fluid components of afferent lymph. EGFP protein appeared in afferent lymph in a pulsatile manner, but associated only with ALDC.

Construction of pTM series plasmids for gene expression in Brucella species.

PubMed

Tian, Mingxing; Qu, Jing; Bao, Yanqing; Gao, Jianpeng; Liu, Jiameng; Wang, Shaohui; Sun, Yingjie; Ding, Chan; Yu, Shengqing

2016-04-01

Brucellosis, the most common widespread zoonotic disease, is caused by Brucella spp., which are facultative, intracellular, Gram-negative bacteria. With the development of molecular biology techniques, more and more virulence-associated factors have been identified in Brucella spp. A suitable plasmid system is an important tool to study virulence genes in Brucella. In this study, we constructed three constitutive replication plasmids (pTM1-Cm, pTM2-Amp, and pTM3-Km) using the replication origin (rep) region derived from the pBBR1-MCS vector. Also, a DNA fragment containing multiple cloning sites (MCSs) and a terminator sequence derived from the pCold vector were produced for complementation of the deleted genes. Besides pGH-6×His, a plasmid containing the groE promoter of Brucella spp. was constructed to express exogenous proteins in Brucella with high efficiency. Furthermore, we constructed the inducible expression plasmid pZT-6×His, containing the tetracycline-inducible promoter pzt1, which can induce expression by the addition of tetracycline in the Brucella culture medium. The constructed pTM series plasmids will play an important role in the functional investigation of Brucella spp. Copyright © 2016 Elsevier B.V. All rights reserved.

[Knockdown of indoleamine 2, 3-dioxygenase 2 (IDO2)gene inhibits tumor growth and enhances immune function in mice bearing melanoma].

PubMed

Liu, Yanling; Liu, Huan; Xiang, Yingqing; Chen, Xiaoyan; Xu, Ping; Min, Weiping

2017-12-01

Objective To study the role of indoleamine 2, 3-dioxygenase 2 (IDO2) in anti-tumor therapy and its effect on the immune response when using IDO2 as therapeutic target. Methods B16-BL6 cells were used to construct mouse xenografted melanoma model. IDO2-shRNA that contained IDO2-siRNA or control shRNA (scrambled-shRNA) was injected hydrodynamically via the tail vein to treat melanoma. The tumor size was measured by vernier caliper. Flow cytometry was performed to analyze the percentage of regulatory T cells (Tregs), T cell apoptosis rate in draining lymph nodes and the expressions of co-stimulatory molecules on splenic dendritic cells (DCs) from different treatment groups. The lactate dehydrogenase (LDH) assay was used to determine the CD8 + cytotoxic T lymphocyte (CTL) activity. The serum levels of tumor necrosis factor α (TNF-α) and interferon γ (IFN-γ) were detected by ELISA. Results In the IDO2-shRNA treated group, the tumor formation time was delayed, tumor grew slowly, and excised tumor mass was significantly reduced. IDO2-shRNA treatment also decreased the percentage of Tregs and T cell apoptosis in draining lymph nodes and increased the expressions of co-stimulatory molecules CD80 and CD86 on splenic DCs. The capacity of CD8 + T cells to kill B16-BL6 cells was enhanced and the serum levels of TNF-α and IFN-γ were upregulated. Conclusion Silencing IDO2 can effectively inhibit the growth of melanoma and improve the anti-tumor immune response in vivo.

Lentiviral vectors encoding shRNAs efficiently transduce and knockdown LINGO-1 but induce an interferon response and cytotoxicity in CNS neurons

PubMed Central

Hutson, Thomas H.; Foster, Edmund; Dawes, John M.; Hindges, Robert; Yáñez-Muñoz, Rafael J.; Moon, Lawrence D.F.

2017-01-01

Background Knocking down neuronal LINGO-1 using short hairpin RNAs (shRNAs) might enhance axon regeneration in the CNS. Integration-deficient lentiviral vectors have great potential as a therapeutic delivery system for CNS injuries. However, recent studies have revealed that shRNAs can induce an interferon response resulting in off-target effects and cytotoxicity. Methods CNS neurons were transduced with integration-deficient lentiviral vectors in vitro. The transcriptional effect of shRNA expression was analysed using qRT-PCR and northern blots were used to assess shRNA production. Results Integration-deficient lentiviral vectors efficiently transduced CNS neurons and knocked down LINGO-1 mRNA in vitro. However, an increase in cell death was observed when lentiviral vectors encoding an shRNA were applied or when high vector concentrations were used. We demonstrate that high doses of vector or the use of vectors encoding shRNAs can induce an up-regulation of interferon stimulated genes (OAS1 and PKR) and a down-regulation of off- target genes (including p75NTR and NgR1). Furthermore, the northern blot demonstrated that these negative consequences occur even when lentiviral vectors express low levels of shRNAs. Together, these results may explain why neurite outgrowth was not enhanced on an inhibitory substrate after transduction with lentiviral vectors encoding an shRNA targeting LINGO-1. Conclusions These findings highlight the importance of including appropriate controls to verify silencing specificity and the requirement to check for an interferon response when conducting RNA interference experiments. However, the potential benefits that RNA interference and viral vectors offer to gene-based therapies to CNS injuries cannot be overlooked and demand further investigation. PMID:22499506

Dextransucrase Expression Is Concomitant with that of Replication and Maintenance Functions of the pMN1 Plasmid in Lactobacillus sakei MN1

PubMed Central

Nácher-Vázquez, Montserrat; Ruiz-Masó, José A.; Mohedano, María L.; del Solar, Gloria; Aznar, Rosa; López, Paloma

2017-01-01

The exopolysaccharide synthesized by Lactobacillus sakei MN1 is a dextran with antiviral and immunomodulatory properties of potential utility in aquaculture. In this work we have investigated the genetic basis of dextran production by this bacterium. Southern blot hybridization experiments demonstrated the plasmidic location of the dsrLS gene, which encodes the dextransucrase involved in dextran synthesis. DNA sequencing of the 11,126 kbp plasmid (pMN1) revealed that it belongs to a family which replicates by the theta mechanism, whose prototype is pUCL287. The plasmid comprises the origin of replication, repA, repB, and dsrLS genes, as well as seven open reading frames of uncharacterized function. Lb. sakei MN1 produces dextran when sucrose, but not glucose, is present in the growth medium. Therefore, plasmid copy number and stability, as well as dsrLS expression, were investigated in cultures grown in the presence of either sucrose or glucose. The results revealed that pMN1 is a stable low-copy-number plasmid in both conditions. Gene expression studies showed that dsrLS is constitutively expressed, irrespective of the carbon source present in the medium. Moreover, dsrLS is expressed from a monocistronic transcript as well as from a polycistronic repA-repB-orf1-dsrLS mRNA. To our knowledge, this is the first report of a plasmid-borne dextransucrase-encoding gene, as well as the first time that co-transcription of genes involved in plasmid maintenance and replication with a gene encoding an enzyme has been established. PMID:29209293

Expression of hygromycin B resistance in oyster culinary-medicinal mushroom, Pleurotus ostreatus (Jacq.:Fr.)P. Kumm. (higher Basidiomycetes) using three gene expression systems.

PubMed

Dong, Xiaoya; Zhang, Ke; Gao, Yuqian; Qi, Yuancheng; Shen, Jinwen; Qiu, Liyou

2012-01-01

Three hygromycin B phosphotransferase (hph) gene expression systems for culinary-medicinal Oyster mushroom, Pleurotus ostreatus, plasmid pSHC, pAN7-1, and pBHt1 were evaluated through PEG/CaCl(2)-mediated protoplast transformation. Plasmid pSHC is a newly constructed hph gene expression system, composed of Escherichia coli hph gene, the P. ostreatus sdi promoter, and the CaMV35S terminator. The vector pAN7-1 was commonly used for integrative transformation in filamentous fungi. Plasmid pBHtl is a T-DNA binary vector, usually introduced into fungi by Agrobacterium-mediated transformation. The results showed that plasmids pSHC, pAN7-1, and pBHt1 were all integrated into the host chromosomes and expressed hygromycin B resistance in P. ostreatus. pAN7-1 had the highest transformation efficiency and hph gene expression level, pSHC the second, and pBHt1 the lowest. Growth rates of the transformants on plates containing hygromycin B were in correspondence with their hph gene expression levels. To our knowledge, this is the first report on integrated transformation of plasmid pAN7-1 and pBHt1 in P. ostreatus.

A Significant Increase of RNAi Efficiency in Human Cells by the CMV Enhancer with a tRNAlys Promoter

PubMed Central

Weiwei, Ma; Zhenhua, Xie; Feng, Liu; Hang, Ning; Yuyang, Jiang

2009-01-01

RNA interference (RNAi) is the process of mRNA degradation induced by double-stranded RNA in a sequence-specific manner. Different types of promoters, such as U6, H1, tRNA, and CMV, have been used to control the inhibitory effect of RNAi expression vectors. In the present study, we constructed two shRNA expression vectors, respectively, controlled by tRNAlys and CMV enhancer-tRNAlys promoters. Compared to the vectors with tRNAlys or U6 promoter, the vector with a CMV enhancer-tRNAlys promoter silenced pokemon more efficiently on both the mRNA and the protein levels. Meanwhile, the silencing of pokemon inhibited the proliferation of MCF7 cells, but the induction of apoptosis of MCF7 cells was not observed. We conclude that the CMV enhancer-tRNAlys promoter may be a powerful tool in driving intracellular expression of shRNA which can efficiently silence targeted gene. PMID:19859553

p62 as a therapeutic target for inhibition of autophagy in prostate cancer.

PubMed

Wang, Lei; Kim, Donghern; Wise, James T F; Shi, Xianglin; Zhang, Zhuo; DiPaola, Robert S

2018-04-01

To test the hypothesis that p62 is an optimal target for autophagy inhibition and Verteporfin, a clinically available drug approved by FDA to treat macular degeneration that inhibits autophagy by targeting p62 protein, can be developed clinically to improve therapy for advanced prostate cancer. Forced expression of p62 in PC-3 cells and normal prostate epithelial cells, RWPE-1 and PZ-HPV7, were carried out by transfection of these cells with pcDNA3.1/p62 or p62 shRNA plasmid. Autophagosomes and autophagic flux were measured by transfection of tandem fluorescence protein mCherry-GFP-LC3 construct. Apoptosis was measured by Annexin V/PI staining. Tumorigenesis was measured by a xenograft tumor growth model. Verteporfin inhibited cell growth and colony formation in PC-3 cells. Verteporfin generated crosslinked p62 oligomers, resulting in inhibition of autophagy and constitutive activation of Nrf2 as well as its target genes, Bcl-2 and TNF-α. In normal prostate epithelial cells, forced expression of p62 caused constitutive Nrf2 activation, development of apoptosis resistance, and Verteporfin treatment exhibited inhibitory effects. Verteporfin treatment also inhibited starvation-induced autophagic flux of these cells. Verteporfin inhibited tumorigenesis of both normal prostate epithelial cells with p62 expression and prostate cancer cells and decreased p62, constitutive Nrf2, and Bcl-xL in xenograft tumor tissues, indicating that p62 can be developed as a drug target against prostate cancer. p62 has a high potential to be developed as a therapeutic target. Verteporfin represents a prototypical agent with therapeutic potential against prostate cancer through inhibition of autophagy by a novel mechanism of p62 inhibition. © 2018 Wiley Periodicals, Inc.

[Abnormal expression of insulin-like growth factor-I receptor and inhibitory effect of its transcription intervention on nude mice xenograft tumor].

PubMed

Yao, M; Yan, X D; Cai, Y; Gu, J J; Yang, X L; Pan, L H; Wang, L; Yao, D F

2016-11-20

Objective: To investigate the expression of insulin-like growth factor-I receptor (IGF-IR) in liver cancer and the inhibitory effect of its transcription intervention on nude mice xenograft tumor. Methods: A total of 40 patients with primary liver cancer were enrolled, and 40 samples of cancer lesions, peri-cancerous tissues (with a distance of 2 cm to the margin of cancer lesion), or distal liver tissues (with a distance of 5 cm to the margin of cancer lesion), with a weight of 200 mg, were collected after surgery. Some of these samples were used for pathological examination, and the rest were stored at -85°C. A total of 18 BALB/c nude mice aged 4-6 weeks with a body weight of 18-20 g (9 male and 9 female mice) were randomly divided into control group, negative control group, and co-intervention group, with 6 mice in each group, and fed under specific pathogen-free conditions. The cell line was cultured in the dimethyl sulfoxide complete medium containing 10% fetal bovine serum in a CO 2 incubator at 37°C. When the cell confluence reached 90% after cell inoculation, shRNA was divided into co-intervention group, negative control group, and untreated control group and were transfected to hepatoma cells using PolyJetTM transfection reagent. Stable cell clones obtained by G418 screening and used for the in vivo study. Immunohistochemistry, Western blotting, and quantitative real-time PCR were used to analyze the expression of IGF-IR in the human hepatoma tissue and cell line. The IGF-IR shRNA eukaryotic expression plasmids were established and screened for the most effective sequence; they were transfected to PLC/PRF/5 hepatoma cells, and the CCK-8 assay was used to analyze the changes in cell proliferation. The stable cell line screened out by G418 was inoculated to establish the subcutaneous xenograft tumor in nude mice. The tumor growth curve was plotted and histological examination was performed. Graphpad Prism 5.0 and SPSS 18.0 were used for plotting and data analysis; the variance test and Q test were used for comparison of means between multiple samples, the t-test was used for comparison of means between any two samples, the chi-square test or Fisher's exact test was used for comparison of rates between samples, and a rank correlation analysis was performed for expression intensity. Results: The liver cancer group had a significantly higher positive rate of IGF-IR than the peri-cancerous group and distal tissue group (82.5% vs 42.5%/10%, χ 2 = 13.653 and 42.29, both P < 0.01), as well as significantly higher expression intensity than these two groups ( Z = 4.771 and 6.579, both P < 0.01). IGF-IR was not significantly expressed in the L02 cell line and was strongly expressed in the PLC/PRF/5 hepatoma cells, and the expression intensity of IGF-IR in the PLC/PRF/5 hepatoma cells was 4 and 5 times that in Bel-7404 cells and HepG2 cells, respectively. After the PLC/PRF/5 hepatoma cells were transfected with shRNA4 with the best co-intervention effect, the mean inhibition rate of tumor cell growth reached 63.9% at 72 hours, and the mean inhibition rate of IGF-IR transcription reached 59.6%. Tumor cells were arrested in G1 phase, and there was a significant increase in apoptosis rate. As for the subcutaneous hepatoma xenograft in nude mice, the intervention group had significantly slower tumor growth than the blank control group and negative control group (143±24 mm3 vs 372±46 mm3/350±50 mm3, t = 10.776 and 9.142, both P < 0.01); the intervention group had significantly downregulated IGF-IR expression, which was significantly lower than that in the blank control group and negative control group ( t = 11.184 and 9.450, both P < 0.01). Conclusion: Intervention of IGF-IR transcription can effectively inhibit the growth of xenograft tumor in nude mice, suggesting that IGF-IR gene might become a new potential target for the treatment of liver cancer.

PEGylation enhances tumor targeting of plasmid DNA by an artificial cationized protein with repeated RGD sequences, Pronectin.

PubMed

Hosseinkhani, Hossein; Tabata, Yasuhiko

2004-05-31

The objective of this study is to investigate feasibility of a non-viral gene carrier with repeated RGD sequences (Pronectin F+) in tumor targeting for gene expression. The Pronectin F+ was cationized by introducing spermine (Sm) to the hydroxyl groups to allow to polyionically complex with plasmid DNA. The cationized Pronectin F+ prepared was additionally modified with poly(ethylene glycol) (PEG) molecules which have active ester and methoxy groups at the terminal, to form various PEG-introduced cationized Pronectin F+. The cationized Pronectin F+ with or without PEGylation at different extents was mixed with a plasmid DNA of LacZ to form respective cationized Pronectin F+-plasmid DNA complexes. The plasmid DNA was electrophoretically complexed with cationized Pronectin F+ and PEG-introduced cationized Pronectin F+, irrespective of the PEGylation extent, although the higher N/P ratio of complexes was needed for complexation with the latter Pronectin F+. The molecular size and zeta potential measurements revealed that the plasmid DNA was reduced in size to about 250 nm and the charge was changed to be positive by the complexation with cationized Pronectin F+. For the complexation with PEG-introduced cationized Pronectin F+, the charge of complex became neutral being almost 0 mV with the increasing PEGylation extents, while the molecular size was similar to that of cationized Pronectin F+. When cationized Pronectin F+-plasmid DNA complexes with or without PEGylation were intravenously injected to mice carrying a subcutaneous Meth-AR-1 fibrosarcoma mass, the PEG-introduced cationized Pronectin F+-plasmid DNA complex specifically enhanced the level of gene expression in the tumor, to a significantly high extent compared with the cationized Pronectin F+-plasmid DNA complexes and free plasmid DNA. The enhanced level of gene expression depended on the percentage of PEG introduced, the N/P ratio, and the plasmid DNA dose. A fluorescent microscopic study revealed that the localization of plasmid DNA in the tumor tissue was observed only for the PEG-introduced cationized Pronectin F+-plasmid DNA complex injected. We conclude that the PEGylation of cationized Pronectin F+ is a promising way to enable the plasmid DNA to target to the tumor for gene expression. Coyright 2004 Elsevier B.V.

Effect of ITGA5 down-regulation on the migration capacity of human dental pulp stem cells

PubMed Central

Xu, Shuaimei; Cui, Li; Ma, Dandan; Sun, Wenjuan; Wu, Buling

2015-01-01

Background: The purpose of this study was to evaluate the role of integrin-α5 (ITGA5) in regulating the migration capacity of human dental pulp stem cells (hDPSCs), which might provide new evidence for understanding the repair and regeneration mechanisms of dental pulp tissues. Materials and methods: The enzyme digestion method was employed to isolate the hDPSCs from dental pulp tissues. The cell surface markers of hDPSCs were detected using flow cytometry analysis. Then the colony forming and multi-differentiation capacity of hDPSCs were evaluated. The lentivirus vector that carried the ITGA5 shRNA was constructed and real-time PCR was used to examine the effectiveness of ITGA5 shRNA lentivirus. Then transwell assay was performed to evaluate the impact of ITGA5 inhibition on the migration capability of hDPSCs. Results: Our results showed that the cells we isolated from the dental pulps were positive for mesenchymal stem cells biomarkers. In addition, the cells possessed both colony forming capacity and multi-differentiation potential. ITGA5 shRNA lentivirus could not only infect hDPSCs with high efficiency, but also down-regulate the expression level of ITGA5 mRNA significantly (P<0.01). The transwell assay revealed the number of cells that migrated to the lower chamber was significantly less in the ITGA5 shRNA group compared with that in the scrambled shRNA group (P=0.016). Conclusion: ITGA5 plays an important role in maintaining and regulating the normal migration capacity of hDPSCs. PMID:26823759

Expression of RNA interference triggers from an oncolytic herpes simplex virus results in specific silencing in tumour cells in vitro and tumours in vivo

PubMed Central

2010-01-01

Background Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEXGM-CSF, we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. Methods To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Results Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. Conclusions This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials. PMID:20836854

TRB3 reverses chemotherapy resistance and mediates crosstalk between endoplasmic reticulum stress and AKT signaling pathways in MHCC97H human hepatocellular carcinoma cells.

PubMed

Li, Yang; Zhu, Danxi; Hou, Lidan; Hu, Bin; Xu, Min; Meng, Xiangjun

2018-01-01

Tribbles homolog 3 (TRB3), a type of pseudokinase that contains a consensus serine/threonine kinase catalytic core structure, is upregulated in hepatocellular carcinoma. However, the effect of TRB3 expression in hepatocellular carcinoma and the molecular mechanisms underlying TRB3-mediated effects on tumorigenesis in hepatocellular carcinoma have not been fully elucidated. The present study focused on the effect of TRB3 expression in MHCC97H hepatocellular carcinoma cells and investigated the underlying molecular mechanisms in MHCC97H cells. In the present study, it was revealed that TRB3 was significantly overexpressed in the MHCC97H hepatocellular carcinoma cell compared with L-02 normal hepatic cells. Under endoplasmic reticulum (ER) stress induced by thapsigargin and tunicamycin, the levels of TRB3, CCAAT/enhancer binding protein homologous protein (CHOP), protein kinase B (AKT) and phosphorylated (p)AKT expression were upregulated. Furthermore, when the expression of TRB3 was silenced by short hairpin (sh)RNA, the survival of MHCC97H hepatocellular carcinoma cells was increased. Notably, following transduction with lentiviral containing TRB3-shRNA, cell survival also increased after treatment with chemotherapy drug cisplatin. The present study demonstrated that knockdown of CHOP by shRNA was able to reduce TRB3 expression, and the knockdown of TRB3 markedly increased the level of pAKT. TRB3 was overexpressed in MHCC97H hepatocellular carcinoma cells, particularly under endoplasmic reticulum stress. Knockdown of TRB3 was able to increase cell survival. Therefore, TRB3 expression may induce apoptosis and reverse resistance to chemotherapy in MHCC97H hepatic carcinoma cells. The present study suggests that TRB3 is a key molecule that mediates the crosstalk between ER stress and AKT signal pathways. Furthermore, the present study may provide further insight into the cancer biology of hepatocellular carcinoma and the development of anticancer drugs targeting the ER stress and AKT signaling pathways.

Complete genome sequence and the expression pattern of plasmids of the model ethanologen Zymomonas mobilis ZM4 and its xylose-utilizing derivatives 8b and 2032.

PubMed

Yang, Shihui; Vera, Jessica M; Grass, Jeff; Savvakis, Giannis; Moskvin, Oleg V; Yang, Yongfu; McIlwain, Sean J; Lyu, Yucai; Zinonos, Irene; Hebert, Alexander S; Coon, Joshua J; Bates, Donna M; Sato, Trey K; Brown, Steven D; Himmel, Michael E; Zhang, Min; Landick, Robert; Pappas, Katherine M; Zhang, Yaoping

2018-01-01

Zymomonas mobilis is a natural ethanologen being developed and deployed as an industrial biofuel producer. To date, eight Z. mobilis strains have been completely sequenced and found to contain 2-8 native plasmids. However, systematic verification of predicted Z. mobilis plasmid genes and their contribution to cell fitness has not been hitherto addressed. Moreover, the precise number and identities of plasmids in Z. mobilis model strain ZM4 have been unclear. The lack of functional information about plasmid genes in ZM4 impedes ongoing studies for this model biofuel-producing strain. In this study, we determined the complete chromosome and plasmid sequences of ZM4 and its engineered xylose-utilizing derivatives 2032 and 8b. Compared to previously published and revised ZM4 chromosome sequences, the ZM4 chromosome sequence reported here contains 65 nucleotide sequence variations as well as a 2400-bp insertion. Four plasmids were identified in all three strains, with 150 plasmid genes predicted in strain ZM4 and 2032, and 153 plasmid genes predicted in strain 8b due to the insertion of heterologous DNA for expanded substrate utilization. Plasmid genes were then annotated using Blast2GO, InterProScan, and systems biology data analyses, and most genes were found to have apparent orthologs in other organisms or identifiable conserved domains. To verify plasmid gene prediction, RNA-Seq was used to map transcripts and also compare relative gene expression under various growth conditions, including anaerobic and aerobic conditions, or growth in different concentrations of biomass hydrolysates. Overall, plasmid genes were more responsive to varying hydrolysate concentrations than to oxygen availability. Additionally, our results indicated that although all plasmids were present in low copy number (about 1-2 per cell), the copy number of some plasmids varied under specific growth conditions or due to heterologous gene insertion. The complete genome of ZM4 and two xylose-utilizing derivatives is reported in this study, with an emphasis on identifying and characterizing plasmid genes. Plasmid gene annotation, validation, expression levels at growth conditions of interest, and contribution to host fitness are reported for the first time.

Expression of Heterogenous Arsenic Resistance Genes in the Obligately Autotrophic Biomining Bacterium Thiobacillus ferrooxidans.

PubMed

Peng, J B; Yan, W M; Bao, X Z

1994-07-01

Two arsenic-resistant plasmids were constructed and introduced into Thiobacillus ferrooxidans strains by conjugation. The plasmids with the replicon of wide-host-range plasmid RSF1010 were stable in T. ferrooxidans. The arsenic resistance genes originating from the heterotroph were expressed in this obligately autotrophic bacterium, but the promoter derived from T. ferrooxidans showed no special function in its original host.

Next-generation libraries for robust RNA interference-based genome-wide screens

PubMed Central

Kampmann, Martin; Horlbeck, Max A.; Chen, Yuwen; Tsai, Jordan C.; Bassik, Michael C.; Gilbert, Luke A.; Villalta, Jacqueline E.; Kwon, S. Chul; Chang, Hyeshik; Kim, V. Narry; Weissman, Jonathan S.

2015-01-01

Genetic screening based on loss-of-function phenotypes is a powerful discovery tool in biology. Although the recent development of clustered regularly interspaced short palindromic repeats (CRISPR)-based screening approaches in mammalian cell culture has enormous potential, RNA interference (RNAi)-based screening remains the method of choice in several biological contexts. We previously demonstrated that ultracomplex pooled short-hairpin RNA (shRNA) libraries can largely overcome the problem of RNAi off-target effects in genome-wide screens. Here, we systematically optimize several aspects of our shRNA library, including the promoter and microRNA context for shRNA expression, selection of guide strands, and features relevant for postscreen sample preparation for deep sequencing. We present next-generation high-complexity libraries targeting human and mouse protein-coding genes, which we grouped into 12 sublibraries based on biological function. A pilot screen suggests that our next-generation RNAi library performs comparably to current CRISPR interference (CRISPRi)-based approaches and can yield complementary results with high sensitivity and high specificity. PMID:26080438

Injectable supramolecular hydrogel formed from α-cyclodextrin and PEGylated arginine-functionalized poly(l-lysine) dendron for sustained MMP-9 shRNA plasmid delivery.

PubMed

Lin, Qianming; Yang, Yumeng; Hu, Qian; Guo, Zhong; Liu, Tao; Xu, Jiake; Wu, Jianping; Kirk, Thomas Brett; Ma, Dong; Xue, Wei

2017-02-01

Hydrogels have attracted much attention in cancer therapy and tissue engineering due to their sustained gene delivery ability. To obtain an injectable and high-efficiency gene delivery hydrogel, methoxypolyethylene glycol (MPEG) was used to conjugate with the arginine-functionalized poly(l-lysine) dendron (PLLD-Arg) by click reaction, and then the synthesized MPEG-PLLD-Arg interacted with α-cyclodextrin (α-CD) to form the supramolecular hydrogel by the host-guest interaction. The gelation dynamics, hydrogel strength and shear viscosity could be modulated by α-CD content in the hydrogel. MPEG-PLLD-Arg was confirmed to bind and deliver gene effectively, and its gene transfection efficiency was significantly higher than PEI-25k under its optimized condition. After gelation, MMP-9 shRNA plasmid (pMMP-9) could be encapsulated into the hydrogel matrix in situ and be released from the hydrogels sustainedly, as the release rate was dependent on α-CD content. The released MPEG-PLLD-Arg/pMMP-9 complex still showed better transfection efficiency than PEI-25k and induced sustained tumor cell apoptosis. Also, in vivo assays indicated that this pMMP-9-loaded supramolecular hydrogel could result in the sustained tumor growth inhibition meanwhile showed good biocompatibility. As an injectable, sustained and high-efficiency gene delivery system, this supramolecular hydrogel is a promising candidate for long-term gene therapy. To realize the sustained gene delivery for gene therapy, a supramolecular hydrogel with high-efficiency gene delivery ability was prepared through the host-guest interaction between α-cyclodextrin and PEGylated arginine-functionalized poly(l-lysine) dendron. The obtained hydrogel was injectable and biocompatible with adjustable physicochemical property. More importantly, the hydrogel showed the high-efficiency and sustained gene transfection to our used cells, better than PEI-25k. The supramolecular hydrogel resulted in the sustained tumor growth inhibition meanwhile keep good biocompatibility. As an injectable, sustained and high-efficiency gene delivery system, this supramolecular hydrogel is a promising candidate in long-term gene therapy and tissue engineering. Copyright © 2016 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Plasmid-Encoded Tetracycline Efflux Pump Protein Alters Bacterial Stress Responses and Ecological Fitness of Acinetobacter oleivorans

PubMed Central

Hong, Hyerim; Jung, Jaejoon; Park, Woojun

2014-01-01

Acquisition of the extracellular tetracycline (TC) resistance plasmid pAST2 affected host gene expression and phenotype in the oil-degrading soil bacterium, Acinetobacter oleivorans DR1. Whole-transcriptome profiling of DR1 cells harboring pAST2 revealed that all the plasmid genes were highly expressed under TC conditions, and the expression levels of many host chromosomal genes were modulated by the presence of pAST2. The host energy burden imposed by replication of pAST2 led to (i) lowered ATP concentrations, (ii) downregulated expression of many genes involved in cellular growth, and (iii) reduced growth rate. Interestingly, some phenotypes were restored by deleting the plasmid-encoded efflux pump gene tetH, suggesting that the membrane integrity changes resulting from the incorporation of efflux pump proteins also resulted in altered host response under the tested conditions. Alteration of membrane integrity by tetH deletion was shown by measuring permeability of fluorescent probe and membrane hydrophobicity. The presence of the plasmid conferred peroxide and superoxide resistance to cells, but only peroxide resistance was diminished by tetH gene deletion, suggesting that the plasmid-encoded membrane-bound efflux pump protein provided peroxide resistance. The downregulation of fimbriae-related genes presumably led to reduced swimming motility, but this phenotype was recovered by tetH gene deletion. Our data suggest that not only the plasmid replication burden, but also its encoded efflux pump protein altered host chromosomal gene expression and phenotype, which also alters the ecological fitness of the host in the environment. PMID:25229538

Plasmid-encoded tetracycline efflux pump protein alters bacterial stress responses and ecological fitness of Acinetobacter oleivorans.

PubMed

Hong, Hyerim; Jung, Jaejoon; Park, Woojun

2014-01-01

Acquisition of the extracellular tetracycline (TC) resistance plasmid pAST2 affected host gene expression and phenotype in the oil-degrading soil bacterium, Acinetobacter oleivorans DR1. Whole-transcriptome profiling of DR1 cells harboring pAST2 revealed that all the plasmid genes were highly expressed under TC conditions, and the expression levels of many host chromosomal genes were modulated by the presence of pAST2. The host energy burden imposed by replication of pAST2 led to (i) lowered ATP concentrations, (ii) downregulated expression of many genes involved in cellular growth, and (iii) reduced growth rate. Interestingly, some phenotypes were restored by deleting the plasmid-encoded efflux pump gene tetH, suggesting that the membrane integrity changes resulting from the incorporation of efflux pump proteins also resulted in altered host response under the tested conditions. Alteration of membrane integrity by tetH deletion was shown by measuring permeability of fluorescent probe and membrane hydrophobicity. The presence of the plasmid conferred peroxide and superoxide resistance to cells, but only peroxide resistance was diminished by tetH gene deletion, suggesting that the plasmid-encoded membrane-bound efflux pump protein provided peroxide resistance. The downregulation of fimbriae-related genes presumably led to reduced swimming motility, but this phenotype was recovered by tetH gene deletion. Our data suggest that not only the plasmid replication burden, but also its encoded efflux pump protein altered host chromosomal gene expression and phenotype, which also alters the ecological fitness of the host in the environment.

Zinc finger protein 598 inhibits cell survival by promoting UV-induced apoptosis.

PubMed

Yang, Qiaohong; Gupta, Romi

2018-01-19

UV is one of the major causes of DNA damage induced apoptosis. However, cancer cells adopt alternative mechanisms to evade UV-induced apoptosis. To identify factors that protect cancer cells from UV-induced apoptosis, we performed a genome wide short-hairpin RNA (shRNA) screen, which identified Zinc finger protein 598 (ZNF598) as a key regulator of UV-induced apoptosis. Here, we show that UV irradiation transcriptionally upregulates ZNF598 expression. Additionally, ZNF598 knockdown in cancer cells inhibited UV-induced apoptosis. In our study, we observe that ELK1 mRNA level as well as phosphorylated ELK1 levels was up regulated upon UV irradiation, which was necessary for UV irradiation induced upregulation of ZNF598. Cells expressing ELK1 shRNA were also resistant to UV-induced apoptosis, and phenocopy ZNF598 knockdown. Upon further investigation, we found that ZNF598 knockdown inhibits UV-induced apoptotic gene expression, which matches with decrease in percentage of annexin V positive cell. Similarly, ectopic expression of ZNF598 promoted apoptotic gene expression and also increased annexin V positive cells. Collectively, these results demonstrate that ZNF598 is a UV irradiation regulated gene and its loss results in resistance to UV-induced apoptosis.

A role for GPx3 in activity of normal and leukemia stem cells

PubMed Central

Herault, Olivier; Hope, Kristin J.; Deneault, Eric; Mayotte, Nadine; Chagraoui, Jalila; Wilhelm, Brian T.; Cellot, Sonia; Sauvageau, Martin; Andrade-Navarro, Miguel A.; Hébert, Josée

2012-01-01

The determinants of normal and leukemic stem cell self-renewal remain poorly characterized. We report that expression of the reactive oxygen species (ROS) scavenger glutathione peroxidase 3 (GPx3) positively correlates with the frequency of leukemia stem cells (LSCs) in Hoxa9+Meis1-induced leukemias. Compared with a leukemia with a low frequency of LSCs, a leukemia with a high frequency of LSCs showed hypomethylation of the Gpx3 promoter region, and expressed high levels of Gpx3 and low levels of ROS. LSCs and normal hematopoietic stem cells (HSCs) engineered to express Gpx3 short hairpin RNA (shRNA) were much less competitive in vivo than control cells. However, progenitor cell proliferation and differentiation was not affected by Gpx3 shRNA. Consistent with this, HSCs overexpressing Gpx3 were significantly more competitive than control cells in long-term repopulation experiments, and overexpression of the self-renewal genes Prdm16 or Hoxb4 boosted Gpx3 expression. In human primary acute myeloid leukemia samples, GPX3 expression level directly correlated with adverse prognostic outcome, revealing a potential novel target for the eradication of LSCs. PMID:22508837

Elimination of the cryptic plasmid in Leuconostoc citreum by CRISPR/Cas9 system.

PubMed

Jang, Ye-Ji; Seo, Seung-Oh; Kim, Seul-Ah; Li, Ling; Kim, Tae-Jip; Kim, Sun Chang; Jin, Yong-Su; Han, Nam Soo

2017-06-10

Leuconostoc spp. are important lactic acid bacteria for the fermentation of foods. In particular, L. citreum strains isolated from various foods have been used as host strains for genetic and metabolic engineering studies. In order to develop a food-grade genetic engineering system, L. citreum CB2567 was isolated from Kimchi. However, the isolated bacterium contained a cryptic plasmid which was difficult to eliminate. As the existence of the plasmid might hinder strain engineering, we eliminated the plasmid using an RNA-guided DNA endonuclease CRISPR/Cas9 system. We demonstrated that a plasmid-free L. citreum CB2567 host strain could be efficiently constructed through a two-step procedure: 1) transformation of the "killer" plasmid expressing Cas9 endonuclease and a guide RNA (gRNA) targeting for a specific sequence in the cryptic plasmid, and 2) serial subculture without antibiotics for curing the killer plasmid. When the crude extract of L. citreum expressing Cas9 and the guide RNA was incubated with a PCR fragment containing the specific sequence recognized by the guide RNA, the PCR fragment was cleaved. Also, the cryptic plasmid pCB42 was successfully eliminated from the host strain after transforming the plasmid harboring Cas9 and the guide RNA. The Cas9 and gRNA expression plasmid used in this study can be applied for genome engineering purposes by additionally introducing an editing DNA template to repair the double strand DNA breakage caused by Cas9 in the genome of L. citreum. This study demonstrates the feasibility of developing CRISPR/Cas9-based genetic engineering tools to develop a safe host strain and construct food-grade lactic acid bacteria without residual antibiotic markers. Copyright © 2017 Elsevier B.V. All rights reserved.

Luminescent/magnetic PLGA-based hybrid nanocomposites: a smart nanocarrier system for targeted codelivery and dual-modality imaging in cancer theranostics.

PubMed

Shen, Xue; Li, Tingting; Chen, Zhongyuan; Geng, Yue; Xie, Xiaoxue; Li, Shun; Yang, Hong; Wu, Chunhui; Liu, Yiyao

2017-01-01

Cancer diagnosis and treatment represent an urgent medical need given the rising cancer incidence over the past few decades. Cancer theranostics, namely, the combination of diagnostics and therapeutics within a single agent, are being developed using various anticancer drug-, siRNA-, or inorganic materials-loaded nanocarriers. Herein, we demonstrate a strategy of encapsulating quantum dots, superparamagnetic Fe 3 O 4 nanocrystals, and doxorubicin (DOX) into biodegradable poly(d,l-lactic- co -glycolic acid) (PLGA) polymeric nanocomposites using the double emulsion solvent evaporation method, followed by coupling to the amine group of polyethyleneimine premodified with polyethylene glycol-folic acid (PEI-PEG-FA [PPF]) segments and adsorption of vascular endothelial growth factor (VEGF)-targeted small hairpin RNA (shRNA). VEGF is important for tumor growth, progression, and metastasis. These drug-loaded luminescent/magnetic PLGA-based hybrid nanocomposites (LDM-PLGA/PPF/VEGF shRNA) were fabricated for tumor-specific targeting, drug/gene delivery, and cancer imaging. The data showed that LDM-PLGA/PPF/VEGF shRNA nanocomposites can codeliver DOX and VEGF shRNA into tumor cells and effectively suppress VEGF expression, exhibiting remarkable synergistic antitumor effects both in vitro and in vivo. The cell viability waŝ14% when treated with LDM-PLGA/PPF/VEGF shRNA nanocomposites ([DOX] =25 μg/mL), and in vivo tumor growth data showed that the tumor volume decreased by 81% compared with the saline group at 21 days postinjection. Magnetic resonance and fluorescence imaging data revealed that the luminescent/magnetic hybrid nanocomposites may also be used as an efficient nanoprobe for enhanced T 2 -weighted magnetic resonance and fluorescence imaging in vitro and in vivo. The present work validates the great potential of the developed multifunctional LDM-PLGA/PPF/VEGF shRNA nanocomposites as effective theranostic agents through the codelivery of drugs/genes and dual-modality imaging in cancer treatment.

Luminescent/magnetic PLGA-based hybrid nanocomposites: a smart nanocarrier system for targeted codelivery and dual-modality imaging in cancer theranostics

PubMed Central

Shen, Xue; Li, Tingting; Chen, Zhongyuan; Geng, Yue; Xie, Xiaoxue; Li, Shun; Yang, Hong; Wu, Chunhui; Liu, Yiyao

2017-01-01

Cancer diagnosis and treatment represent an urgent medical need given the rising cancer incidence over the past few decades. Cancer theranostics, namely, the combination of diagnostics and therapeutics within a single agent, are being developed using various anticancer drug-, siRNA-, or inorganic materials-loaded nanocarriers. Herein, we demonstrate a strategy of encapsulating quantum dots, superparamagnetic Fe3O4 nanocrystals, and doxorubicin (DOX) into biodegradable poly(d,l-lactic-co-glycolic acid) (PLGA) polymeric nanocomposites using the double emulsion solvent evaporation method, followed by coupling to the amine group of polyethyleneimine premodified with polyethylene glycol-folic acid (PEI-PEG-FA [PPF]) segments and adsorption of vascular endothelial growth factor (VEGF)-targeted small hairpin RNA (shRNA). VEGF is important for tumor growth, progression, and metastasis. These drug-loaded luminescent/magnetic PLGA-based hybrid nanocomposites (LDM-PLGA/PPF/VEGF shRNA) were fabricated for tumor-specific targeting, drug/gene delivery, and cancer imaging. The data showed that LDM-PLGA/PPF/VEGF shRNA nanocomposites can codeliver DOX and VEGF shRNA into tumor cells and effectively suppress VEGF expression, exhibiting remarkable synergistic antitumor effects both in vitro and in vivo. The cell viability waŝ14% when treated with LDM-PLGA/PPF/VEGF shRNA nanocomposites ([DOX] =25 μg/mL), and in vivo tumor growth data showed that the tumor volume decreased by 81% compared with the saline group at 21 days postinjection. Magnetic resonance and fluorescence imaging data revealed that the luminescent/magnetic hybrid nanocomposites may also be used as an efficient nanoprobe for enhanced T2-weighted magnetic resonance and fluorescence imaging in vitro and in vivo. The present work validates the great potential of the developed multifunctional LDM-PLGA/PPF/VEGF shRNA nanocomposites as effective theranostic agents through the codelivery of drugs/genes and dual-modality imaging in cancer treatment. PMID:28652734

A plasmid-based reverse genetics system for influenza A virus.

PubMed Central

Pleschka, S; Jaskunas, R; Engelhardt, O G; Zürcher, T; Palese, P; García-Sastre, A

1996-01-01

A reverse genetics system for negative-strand RNA viruses was first successfully developed for influenza viruses. This technology involved the transfection of in vitro-reconstituted ribonucleoprotein (RNP) complexes into influenza virus-infected cells. We have now developed a method that allows intracellular reconstitution of RNP complexes from plasmid-based expression vectors. Expression of a viral RNA-like transcript is achieved from a plasmid containing a truncated human polymerase I (polI) promoter and a ribozyme sequence that generates the desired 3' end by autocatalytic cleavage. The polI-driven plasmid is cotransfected into human 293 cells with polII-responsive plasmids that express the viral PB1, PB2, PA, and NP proteins. This exclusively plasmid-driven system results in the efficient transcription and replication of the viral RNA-like reporter and allows the study of cis- and trans-acting signals involved in the transcription and replication of influenza virus RNAs. Using this system, we have also been able to rescue a synthetic neuraminidase gene into a recombinant influenza virus. This method represents a convenient alternative to the previously established RNP transfection system. PMID:8648766

Seeing red; the development of pON.mCherry, a broad-host range constitutive expression plasmid for Gram-negative bacteria.

PubMed

Gebhardt, Michael J; Jacobson, Rachael K; Shuman, Howard A

2017-01-01

The development of plasmid-mediated gene expression control in bacteria revolutionized the field of bacteriology. Many of these expression control systems rely on the addition of small molecules, generally metabolites or non-metabolized analogs thereof, to the growth medium to induce expression of the genes of interest. The paradigmatic example of an expression control system is the lac system from Escherichia coli, which typically relies on the Ptac promoter and the Lac repressor, LacI. In many cases, however, constitutive gene expression is desired, and other experimental approaches require the coordinated control of multiple genes. While multiple systems have been developed for use in E. coli and its close relatives, the utility and/or functionality of these tools does not always translate to other species. For example, for the Gram-negative pathogen, Legionella pneumophila, a causative agent of Legionnaires' Disease, the aforementioned Ptac system represents the only well-established expression control system. In order to enhance the tools available to study bacterial gene expression in L. pneumophila, we developed a plasmid, pON.mCherry, which confers constitutive gene expression from a mutagenized LacI binding site. We demonstrate that pON.mCherry neither interferes with other plasmids harboring an intact LacI-Ptac expression system nor alters the growth of Legionella species during intracellular growth. Furthermore, the broad-host range plasmid backbone of pON.mCherry allows constitutive gene expression in a wide variety of Gram-negative bacterial species, making pON.mCherry a useful tool for the greater research community.

Expression of Heterogenous Arsenic Resistance Genes in the Obligately Autotrophic Biomining Bacterium Thiobacillus ferrooxidans

PubMed Central

Peng, Ji-Bin; Yan, Wang-Ming; Bao, Xue-Zhen

1994-01-01

Two arsenic-resistant plasmids were constructed and introduced into Thiobacillus ferrooxidans strains by conjugation. The plasmids with the replicon of wide-host-range plasmid RSF1010 were stable in T. ferrooxidans. The arsenic resistance genes originating from the heterotroph were expressed in this obligately autotrophic bacterium, but the promoter derived from T. ferrooxidans showed no special function in its original host. PMID:16349341

Claudin 4 Is Differentially Expressed between Ovarian Cancer Subtypes and Plays a Role in Spheroid Formation

PubMed Central

Boylan, Kristin L. M.; Misemer, Benjamin; DeRycke, Melissa S.; Andersen, John D.; Harrington, Katherine M.; Kalloger, Steve E.; Gilks, C. Blake; Pambuccian, Stefan E.; Skubitz, Amy P. N.

2011-01-01

Claudin 4 is a cellular adhesion molecule that is frequently overexpressed in ovarian cancer and other epithelial cancers. In this study, we sought to determine whether the expression of claudin 4 is associated with outcome in ovarian cancer patients and may be involved in tumor progression. We examined claudin 4 expression in ovarian cancer tissues and cell lines, as well as by immunohistochemical staining of tissue microarrays (TMAs; n = 500), spheroids present in patients’ ascites, and spheroids formed in vitro. Claudin 4 was expressed in nearly 70% of the ovarian cancer tissues examined and was differentially expressed across ovarian cancer subtypes, with the lowest expression in clear cell subtype. No association was found between claudin 4 expression and disease-specific survival in any subtype. Claudin 4 expression was also observed in multicellular spheroids obtained from patients’ ascites. Using an in vitro spheroid formation assay, we found that NIH:OVCAR5 cells treated with shRNA against claudin 4 required a longer time to form compact spheroids compared to control NIH:OVCAR5 cells that expressed high levels of claudin 4. The inability of the NIH:OVCAR5 cells treated with claudin 4 shRNA to form compact spheroids was verified by FITC-dextran exclusion. These results demonstrate a role for claudin 4 and tight junctions in spheroid formation and integrity. PMID:21541062

The reversed terminator of octopine synthase gene on the Agrobacterium Ti plasmid has a weak promoter activity in prokaryotes.

PubMed

Shao, Jun-Li; Long, Yue-Sheng; Chen, Gu; Xie, Jun; Xu, Zeng-Fu

2010-06-01

Agrobacterium tumefaciens transfers DNA from its Ti plasmid to plant host cells. The genes located within the transferred DNA of Ti plasmid including the octopine synthase gene (OCS) are expressed in plant host cells. The 3'-flanking region of OCS gene, known as OCS terminator, is widely used as a transcriptional terminator of the transgenes in plant expression vectors. In this study, we found the reversed OCS terminator (3'-OCS-r) could drive expression of hygromycin phosphotransferase II gene (hpt II) and beta-glucuronidase gene in Escherichia coli, and expression of hpt II in A. tumefaciens. Furthermore, reverse transcription-polymerase chain reaction analysis revealed that an open reading frame (ORF12) that is located downstream to the 3'-OCS-r was transcribed in A. tumefaciens, which overlaps in reverse with the coding region of the OCS gene in octopine Ti plasmid.

Expression of recombinant myostatin propeptide pPIC9K-Msp plasmid in Pichia pastoris.

PubMed

Du, W; Xia, J; Zhang, Y; Liu, M J; Li, H B; Yan, X M; Zhang, J S; Li, N; Zhou, Z Y; Xie, W Z

2015-12-28

Myostatin propeptide can inhibit the biological activity of myostatin protein and promote muscle growth. To express myostatin propeptide in vitro with a higher biological activity, we performed codon optimization on the sheep myostatin propeptide gene sequence, and mutated aspartic acid-76 to alanine based on the codon usage bias of Pichia pastoris and the enhanced biological activity of myostatin propeptide mutant. Modified myostatin propeptide gene was cloned into the pPIC9K plasmid to form the recombinant plasmid pPIC9K-Msp. Recombinant plasmid pPIC9K-Msp was transformed into Pichia pastoris GS115 by electrotransformation. Transformed cells were screened, and methanol was used to induce expression. SDS-PAGE and western blotting were used to verify the successful expression of myostatin propeptide with biological activity in Pichia pastoris, providing the basis for characterization of this protein.

Vectors for co-expression of an unrestricted number of proteins

PubMed Central

Scheich, Christoph; Kümmel, Daniel; Soumailakakis, Dimitri; Heinemann, Udo; Büssow, Konrad

2007-01-01

A vector system is presented that allows generation of E. coli co-expression clones by a standardized, robust cloning procedure. The number of co-expressed proteins is not limited. Five ‘pQLink’ vectors for expression of His-tag and GST-tag fusion proteins as well as untagged proteins and for cloning by restriction enzymes or Gateway cloning were generated. The vectors allow proteins to be expressed individually; to achieve co-expression, two pQLink plasmids are combined by ligation-independent cloning. pQLink co-expression plasmids can accept an unrestricted number of genes. As an example, the co-expression of a heterotetrameric human transport protein particle (TRAPP) complex from a single plasmid, its isolation and analysis of its stoichiometry are shown. pQLink clones can be used directly for pull-down experiments if the proteins are expressed with different tags. We demonstrate pull-down experiments of human valosin-containing protein (VCP) with fragments of the autocrine motility factor receptor (AMFR). The cloning method avoids PCR or gel isolation of restriction fragments, and a single resistance marker and origin of replication are used, allowing over-expression of rare tRNAs from a second plasmid. It is expected that applications are not restricted to bacteria, but could include co-expression in other hosts such as Bacluovirus/insect cells. PMID:17311810

Increased cFLIP expression in thymic epithelial tumors blocks autophagy via NF-κB signalling.

PubMed

Belharazem, Djeda; Grass, Albert; Paul, Cornelia; Vitacolonna, Mario; Schalke, Berthold; Rieker, Ralf J; Körner, Daniel; Jungebluth, Philipp; Simon-Keller, Katja; Hohenberger, Peter; Roessner, Eric M; Wiebe, Karsten; Gräter, Thomas; Kyriss, Thomas; Ott, German; Geserick, Peter; Leverkus, Martin; Ströbel, Philipp; Marx, Alexander

2017-10-27

The anti-apoptotic cellular FLICE-like inhibitory protein cFLIP plays a pivotal role in normal tissues homoeostasis and the development of many tumors, but its role in normal thymus (NT), thymomas and thymic carcinomas (TC) is largely unknown. Expression, regulation and function of cFLIP were analyzed in biopsies of NT, thymomas, thymic squamous cell carcinomas (TSCC), thymic epithelial cells (TECs) derived thereof and in the TC line 1889c by qRT-PCR, western blot, shRNA techniques, and functional assays addressing survival, senescence and autophagy. More than 90% of thymomas and TSCCs showed increased cFLIP expression compared to NT. cFLIP expression declined with age in NTs but not in thymomas. During short term culture cFLIP expression levels declined significantly slower in neoplastic than non-neoplastic primary TECs. Down-regulation of cFLIP by shRNA or NF-κB inhibition accelerated senescence and induced autophagy and cell death in neoplastic TECs. The results suggest a role of cFLIP in the involution of normal thymus and the development of thymomas and TSCC. Since increased expression of cFLIP is a known tumor escape mechanism, it may serve as tissue-based biomarker in future clinical trials, including immune checkpoint inhibitor trials in the commonly PD-L1 high thymomas and TCs.

Effects of an intravitreal injection of interleukin-35-expressing plasmid on pro-inflammatory and anti-inflammatory cytokines.

PubMed

Hou, Chao; Wu, Qianni; Ouyang, Chen; Huang, Ting

2016-09-01

In order to explore the potential effects of interleukin (IL)-35 on IL-10, transforming growth factor-β (TGF-β), interferon-γ (INF)-γ, IL-12 and IL-17, a pcDNA3.1‑IL-35 plasmid was injected into the vitreous cavity of BALB/c mice. Enzyme-linked immunosorbent assay, western blot analysis and quantitative PCR analysis were performed to confirm the successful expression of IL-35. Slit-lamp biomicroscopy, hematoxylin and eosin staining and immunofluorescence were employed to detect the status of eyes, and western blot analysis was performed to examine the expression of corneal graft rejection-related cytokines. There were no abnormalities in the eyes pre-mydriasis or post-mydriasis and no injuries to the cornea or retina following the injection of IL-35-expressing plasmid. An immunofluorescence assay detected the positive expression of IL-35 in corneal epithelial cells from IL-35‑injected mice and negative staining in the control group. Further study revealed that IL-35 enhanced the expression of IL-10 and TGF-β which reached their highest levels at 1 and 2 weeks after injection, respectively (p<0.01). Moreover, the expression of INF-γ and IL-12 was decreased significantly at 2 weeks after the injection of IL-35-expressing plasmid (p<0.05), and the expression of IL-17 was suppressed notably at 4 weeks after the injection (p<0.05). The intravitreal injection of IL-35-expressing plasmid in mice downregulates the expression of pro-inflammatory cytokines and upregulates the expression of anti-inflammatory cytokines. Thus, IL-35 may further be assessed as a potential target for the treatment of corneal graft rejection.

Protein Structure Initiative Material Repository: an open shared public resource of structural genomics plasmids for the biological community

PubMed Central

Cormier, Catherine Y.; Mohr, Stephanie E.; Zuo, Dongmei; Hu, Yanhui; Rolfs, Andreas; Kramer, Jason; Taycher, Elena; Kelley, Fontina; Fiacco, Michael; Turnbull, Greggory; LaBaer, Joshua

2010-01-01

The Protein Structure Initiative Material Repository (PSI-MR; http://psimr.asu.edu) provides centralized storage and distribution for the protein expression plasmids created by PSI researchers. These plasmids are a resource that allows the research community to dissect the biological function of proteins whose structures have been identified by the PSI. The plasmid annotation, which includes the full length sequence, vector information and associated publications, is stored in a freely available, searchable database called DNASU (http://dnasu.asu.edu). Each PSI plasmid is also linked to a variety of additional resources, which facilitates cross-referencing of a particular plasmid to protein annotations and experimental data. Plasmid samples can be requested directly through the website. We have also developed a novel strategy to avoid the most common concern encountered when distributing plasmids namely, the complexity of material transfer agreement (MTA) processing and the resulting delays this causes. The Expedited Process MTA, in which we created a network of institutions that agree to the terms of transfer in advance of a material request, eliminates these delays. Our hope is that by creating a repository of expression-ready plasmids and expediting the process for receiving these plasmids, we will help accelerate the accessibility and pace of scientific discovery. PMID:19906724

Plasmids of corynebacteria.

PubMed

Deb, J K; Nath, N

1999-06-01

Corynebacteria are pleomorphic, asporogenous, Gram-positive bacteria. Included in this group are nonpathogenic soil corynebacteria, which are widely used for the industrial production of amino acids and detergents, and in biotransformation of steroids. Other members of this group are plant and animal pathogens. This review summarizes the current information available about the plasmids of corynebacteria. The emphasis is mainly on the small plasmids, which have been used for construction of vectors for expression of genes in these bacteria. Moreover, considerable information is now available on their nucleotide sequence, gene organization and modes of replication, which would make it possible to further manipulate these plasmids. Other plasmid properties, such as incompatibility and host range, are also discussed. Finally, use of these plasmids as cloning vectors for the expression of heterologous proteins using corynebacteria as hosts is also summarized to highlight the potential of these bacteria as hosts for recombinant DNA.

Live, attenuated Salmonella typhimurium vectoring Campylobacter antigens.

PubMed

Sizemore, Donata R; Warner, Beth; Lawrence, Julie; Jones, Amy; Killeen, Kevin P

2006-05-01

We describe the evaluation of three live, attenuated deltaphoP/Q Salmonella enteric serovar Typhimurium strains expressing PEB1 minus its signal sequence (PEB1-ss) from three different plasmids: a pBR-based asd plasmid, an arabinose-based runaway plasmid, which each expressed PEB1-ss in the bacterial cytosol, and a PEB1::HlyA fusion plasmid that directs secretion of PEB1-ss into the extracellular milieu. Serum IgG responses specific for PEB1-ss were induced by pBR-derived and runaway plasmids, with 100 and 90% seroconversion, respectively, at a 1:500 dilution of anti-sera as measured by Western blot analysis, while the PEB1-ss::HlyA fusion plasmid induced serum IgG in only 20% of the mice. Although significant levels of anti-PEB serum IgG were induced, no protection against oral Campylobacter jejuni challenge was observed.

Imipenem-resistance in Serratia marcescens is mediated by plasmid expression of KPC-2.

PubMed

Su, W-Q; Zhu, Y-Q; Deng, N-M; Li, L

2017-04-01

Imipenem is a broad-spectrum carbapenem antibiotic with applications against severe bacterial infections. Here, we describe the identification of imipenem-resistant Serratia marcescens in our hospital and the role of plasmid-mediated KPC-2 expression in imipenem resistance. We used the modified Hodge test to detect carbapenemase produced in imipenem-resistant strains. His resistance can be transferred to E. coli in co-culture tests, which implicates the plasmid in imipenem resistance. PCR amplification from the plasmid identified two products consistent with KPC-2 of 583 and 1050 bp that were also present in E. coli after co-culture. The restriction pattern for both plasmids was identical, supporting the transfer from the S. marcescens isolate to E. coli. Finally, gene sequencing confirmed KPC-2 in the plasmid. Due to the presence of KPC-2 in the imipenem-resistant S. marcescens, we propose that KPC-2 mediates antibiotic resistance in the S. marcescens isolate.

Development of a plasmid-based expression system in Clostridium thermocellum and its use to screen heterologous expression of bifunctional alcohol dehydrogenases (adhEs)

DOE PAGES

Hon, Shuen; Lanahan, Anthony; Tian, Liang; ...

2016-04-22

Clostridium thermocellum is a promising candidate for ethanol production from cellulosic biomass, but requires metabolic engineering to improve ethanol yield. A key gene in the ethanol production pathway is the bifunctional aldehyde and alcohol dehydrogenase, adhE. To explore the effects of overexpressing wild-type, mutant, and exogenous adhEs, we developed a new expression plasmid, pDGO144, that exhibited improved transformation efficiency and better gene expression than its predecessor, pDGO-66. This new expression plasmid will allow for many other metabolic engineering and basic research efforts in C. thermocellum. As proof of concept, we used this plasmid to express 12 different adhE genes (bothmore » wild type and mutant) from several organisms. Ethanol production varied between clones immediately after transformation, but tended to converge to a single value after several rounds of serial transfer. The previously described mutant C. thermocellum D494G adhE gave the best ethanol production, which is consistent with previously published results.« less

Development of a plasmid-based expression system in Clostridium thermocellum and its use to screen heterologous expression of bifunctional alcohol dehydrogenases (adhEs)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hon, Shuen; Lanahan, Anthony; Tian, Liang

Clostridium thermocellum is a promising candidate for ethanol production from cellulosic biomass, but requires metabolic engineering to improve ethanol yield. A key gene in the ethanol production pathway is the bifunctional aldehyde and alcohol dehydrogenase, adhE. To explore the effects of overexpressing wild-type, mutant, and exogenous adhEs, we developed a new expression plasmid, pDGO144, that exhibited improved transformation efficiency and better gene expression than its predecessor, pDGO-66. This new expression plasmid will allow for many other metabolic engineering and basic research efforts in C. thermocellum. As proof of concept, we used this plasmid to express 12 different adhE genes (bothmore » wild type and mutant) from several organisms. Ethanol production varied between clones immediately after transformation, but tended to converge to a single value after several rounds of serial transfer. The previously described mutant C. thermocellum D494G adhE gave the best ethanol production, which is consistent with previously published results.« less

Development of a plasmid-based expression system in Clostridium thermocellum and its use to screen heterologous expression of bifunctional alcohol dehydrogenases (adhEs).

PubMed

Hon, Shuen; Lanahan, Anthony A; Tian, Liang; Giannone, Richard J; Hettich, Robert L; Olson, Daniel G; Lynd, Lee R

2016-12-01

Clostridium thermocellum is a promising candidate for ethanol production from cellulosic biomass, but requires metabolic engineering to improve ethanol yield. A key gene in the ethanol production pathway is the bifunctional aldehyde and alcohol dehydrogenase, adhE . To explore the effects of overexpressing wild-type, mutant, and exogenous adhE s, we developed a new expression plasmid, pDGO144, that exhibited improved transformation efficiency and better gene expression than its predecessor, pDGO-66. This new expression plasmid will allow for many other metabolic engineering and basic research efforts in C. thermocellum . As proof of concept, we used this plasmid to express 12 different adhE genes (both wild type and mutant) from several organisms. Ethanol production varied between clones immediately after transformation, but tended to converge to a single value after several rounds of serial transfer. The previously described mutant C. thermocellum D494G adhE gave the best ethanol production, which is consistent with previously published results.

Liposomal lipid and plasmid DNA delivery to B16/BL6 tumors after intraperitoneal administration of cationic liposome DNA aggregates.

PubMed

Reimer, D L; Kong, S; Monck, M; Wyles, J; Tam, P; Wasan, E K; Bally, M B

1999-05-01

The transfer of plasmid expression vectors to cells is essential for transfection after administration of lipid-based DNA formulations (lipoplexes). A murine i.p. B16/BL6 tumor model was used to characterize DNA delivery, liposomal lipid delivery, and gene transfer after regional (i.p.) administration of free plasmid DNA and DNA lipoplexes. DNA lipoplexes were prepared using cationic dioleoyldimethylammonium chloride/dioleoylphosphatidylethanolamine (50:50 mol ratio) liposomes mixed with plasmid DNA (1 microgram DNA/10 nmol lipid). The plasmid used contained the chloramphenicol acetyltransferase gene and chloramphenicol acetyltransferase expression (mU/g tumor) was measured to estimate transfection efficiency. Tumor-associated DNA and liposomal lipid levels were measured to estimate the efficiency of lipid-mediated DNA delivery to tumors. Plasmid DNA delivery was estimated using [3H]-labeled plasmid as a tracer, dot blot analysis, and/or Southern analysis. Liposomal lipid delivery was estimated using [14C]-dioleoylphosphatidylethanolamine as a liposomal lipid marker. Gene expression in the B16/BL6 tumors was highly variable, with values ranging from greater than 2,000 mU/g tumor to less than 100 mU/g tumor. There was a tendency to observe enhanced transfection in small (<250 mg) tumors. Approximately 18% of the injected dose of DNA was associated with these small tumors 2 h after i.p. administration. Southern analysis of extracted tumor DNA indicated that plasmid DNA associated with tumors was intact 24 h after administration. DNA and associated liposomal lipid are efficiently bound to tumors after regional administration; however, it is unclear whether delivery is sufficient to abet internalization and appropriate subcellular localization of the expression vector.

[Adenoviral short hairpin RNA targeting phosphodiesterase 5 attenuates cardiac remodeling and cardiac dysfunction following myocardial infarction in mice].

PubMed

Zhang, Jian; Jin, Zhe; Li, Longhu; Gang, Li; Yu, Qin; Wang, Meilan; Song, Ailin; Hong, Bingzhe

2014-04-01

To observe the impact of PDE5shRNA on cardiac remodeling and heart function following myocardial infarction in mice. Myocardial infarction (MI) was induced in mice by left coronary artery ligation. Mice were randomly assigned to sham group (n = 6), PDE5shRNA group (n = 12), common adenovirus group (n = 15) and DMEM group (n = 8). Four weeks post-MI, the survival rate was evaluated. Cardiac function was examined by echocardiography. HE staining and Masson staining were used to evaluate the myocardial infarction size and fibrosis. The number of blood vessels was evaluated by immunohistochemistry, PDE5 protein expression in the left ventricular was detected using Western blot, level of cGMP or PKG activity in the left ventricle was evaluated with ELISA. Four weeks post-MI, all mice survived in the sham group, 3(37%) mice died in the DMEM group, 1 (8%) died in the PDE5shRNA group and 5 died in the common adenovirus group (33%). Infarct size was significantly reduced in PDE5shRNA group compared with the common adenovirus group and DMEM group [(25.4 ± 2.9)% vs. (42.0 ± 3.2)% and (43.4 ± 2.6) %, P < 0.05]. Cardiac function was significantly improved in PDE5shRNA group compared to common adenovirus group and DMEM group[LVFS: (21.1 ± 3.7)% vs. (14.2 ± 2.9)% and (14.22 ± 2.91)%, all P < 0.05; LVEF: (48.2 ± 7.1)% vs. (34.6 ± 6.2)% and (38.1 ± 2.8)%, all P < 0.05; LVESD: (3.87 ± 0.45) mm vs.(4.91 ± 0.62) mm and (4.63 ± 0.37) mm, all P < 0.05]. The blood vessel density was also higher in PDE5shRNA group compared with common adenovirus group (infarct area:14.3 ± 2.0 vs. 6.6 ± 1.2, P < 0.05; periinfarct area: 23.6 ± 2.1 vs. 13.7 ± 2.4, P < 0.05). Compared with common adenovirus group, level of PDE5 was significantly downregulated and level of cGMP or PKG was significantly upregulated in PDE5shRNA group (all P < 0.05). Present study suggests PDE5shRNA improves cardiac function and attenuates cardiac remodeling through reducing infarction size and cardiac fibrosis and these beneficial effects are possibly mediated by activating cGMP/PKG signaling pathway.

Selective gene silencing by viral delivery of short hairpin RNA

PubMed Central

2010-01-01

RNA interference (RNAi) technology has not only become a powerful tool for functional genomics, but also allows rapid drug target discovery and in vitro validation of these targets in cell culture. Furthermore, RNAi represents a promising novel therapeutic option for treating human diseases, in particular cancer. Selective gene silencing by RNAi can be achieved essentially by two nucleic acid based methods: i) cytoplasmic delivery of short double-stranded (ds) interfering RNA oligonucleotides (siRNA), where the gene silencing effect is only transient in nature, and possibly not suitable for all applications; or ii) nuclear delivery of gene expression cassettes that express short hairpin RNA (shRNA), which are processed like endogenous interfering RNA and lead to stable gene down-regulation. Both processes involve the use of nucleic acid based drugs, which are highly charged and do not cross cell membranes by free diffusion. Therefore, in vivo delivery of RNAi therapeutics must use technology that enables the RNAi therapeutic to traverse biological membrane barriers in vivo. Viruses and the vectors derived from them carry out precisely this task and have become a major delivery system for shRNA. Here, we summarize and compare different currently used viral delivery systems, give examples of in vivo applications, and indicate trends for new developments, such as replicating viruses for shRNA delivery to cancer cells. PMID:20858246

The sodium-bicarbonate cotransporter NBCe2 (slc4a5) expressed in human renal proximal tubules shows increased apical expression under high-salt conditions.

PubMed

Gildea, John J; Xu, Peng; Carlson, Julia M; Gaglione, Robert T; Bigler Wang, Dora; Kemp, Brandon A; Reyes, Camellia M; McGrath, Helen E; Carey, Robert M; Jose, Pedro A; Felder, Robin A

2015-12-01

The electrogenic sodium bicarbonate cotransporter (NBCe2) is encoded by SLC4A5, variants of which have been associated with salt sensitivity of blood pressure, which affects 25% of the adult population. NBCe2 is thought to mediate sodium bicarbonate cotransport primarily in the renal collecting duct, but NBCe2 mRNA is also found in the rodent renal proximal tubule (RPT). The protein expression or function of NBCe2 has not been demonstrated in the human RPT. We validated an NBCe2 antibody by shRNA and Western blot analysis, as well as overexpression of an epitope-tagged NBCe2 construct in both RPT cells (RPTCs) and human embryonic kidney 293 (HEK293) cells. Using this validated NBCe2 antibody, we found NBCe2 protein expression in the RPT of fresh and frozen human kidney slices, RPTCs isolated from human urine, and isolated RPTC apical membrane. Under basal conditions, NBCe2 was primarily found in the Golgi, while NBCe1 was primarily found at the basolateral membrane. Following an acute short-term increase in intracellular sodium, NBCe2 expression was increased at the apical membrane in cultured slices of human kidney and polarized, immortalized RPTCs. Sodium bicarbonate transport was increased by monensin and overexpression of NBCe2, decreased by NBCe2 shRNA, but not by NBCe1 shRNA, and blocked by 2,2'-(1,2-ethenediyl)bis[5-isothiocyanato-benzenesulfonic acid]. NBCe2 could be important in apical sodium and bicarbonate cotransport under high-salt conditions; the implication of the ex vivo studies to the in vivo situation when salt intake is increased remains unclear. Therefore, future studies will examine the role of NBCe2 in mediating increased renal sodium transport in humans whose blood pressures are elevated by an increase in sodium intake. Copyright © 2015 the American Physiological Society.

Silencing Nrf2 impairs glioma cell proliferation via AMPK-activated mTOR inhibition

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jia, Yue; Wang, Handong, E-mail: njhdwang@hotmail.com; Wang, Qiang

Gliomas are the leading cause of death among adults with primary brain malignancies. Treatment for malignant gliomas remains limited, and targeted therapies have been incompletely explored. Nuclear factor erythroid 2-related factor 2 (Nrf2), a key transcription regulator for antioxidant and detoxification enzymes, is abundantly expressed in cancer cells. In this study, the role and mechanism of Nrf2 in cancer cell proliferation was investigated in multiple glioma cell lines. We first evaluated the expression patterns of Nrf2 in four glioma cell lines and found all four cell lines expressed Nrf2, but the highest level was observed in U251 cells. We further evaluatedmore » the biological functions of Nrf2 in U251 glioma cell proliferation by specific inhibition of Nrf2 using short hairpin RNA (shRNA). We found that Nrf2 depletion inhibited glioma cell proliferation. Nrf2 depletion also decreased colony formation in U251 cells stably expressing Nrf2 shRNA compared to scrambled control shRNA. Moreover, suppression of Nrf2 expression could lead to ATP depletion (with concomitant rise in AMP/ATP ratio) and consequently to AMPK-activated mTOR inhibition. Finally, activation of adenosine monophosphate–activated protein kinase (AMPK) by treated with phenformin, an AMPK agonist, can mimic the inhibitory effect of Nrf2 knockdown in U251 cells. In conclusion, our findings will shed light to the role and mechanism of Nrf2 in regulating glioma proliferation via ATP-depletion-induced AMPK activation and consequent mTOR inhibition, a novel insight into our understanding the role and mechanism of Nrf2 in glioma pathoetiology. To our knowledge, this is also the first report to provide a rationale for the implication of cross-linking between Nrf2 and mTOR signaling.« less

Complete genome sequence and the expression pattern of plasmids of the model ethanologen Zymomonas mobilis ZM4 and its xylose-utilizing derivatives 8b and 2032

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Shihui; Vera, Jessica M.; Grass, Jeff

Zymomonas mobilis is a natural ethanologen being developed and deployed as an industrial biofuel producer. To date, eight Z. mobilis strains have been completely sequenced and found to contain 2-8 native plasmids. However, systematic verification of predicted Z. mobilis plasmid genes and their contribution to cell fitness has not been hitherto addressed. Moreover, the precise number and identities of plasmids in Z. mobilis model strain ZM4 have been unclear. The lack of functional information about plasmid genes in ZM4 impedes ongoing studies for this model biofuel-producing strain. In this study, we determined the complete chromosome and plasmid sequences of ZM4more » and its engineered xylose-utilizing derivatives 2032 and 8b. Compared to previously published and revised ZM4 chromosome sequences, the ZM4 chromosome sequence reported here contains 65 nucleotide sequence variations as well as a 2400-bp insertion. Four plasmids were identified in all three strains, with 150 plasmid genes predicted in strain ZM4 and 2032, and 153 plasmid genes predicted in strain 8b due to the insertion of heterologous DNA for expanded substrate utilization. Plasmid genes were then annotated using Blast2GO, InterProScan, and systems biology data analyses, and most genes were found to have apparent orthologs in other organisms or identifiable conserved domains. To verify plasmid gene prediction, RNA-Seq was used to map transcripts and also compare relative gene expression under various growth conditions, including anaerobic and aerobic conditions, or growth in different concentrations of biomass hydrolysates. Overall, plasmid genes were more responsive to varying hydrolysate concentrations than to oxygen availability. Additionally, our results indicated that although all plasmids were present in low copy number (about 1-2 per cell), the copy number of some plasmids varied under specific growth conditions or due to heterologous gene insertion. The complete genome of ZM4 and two xylose-utilizing derivatives is reported in this study, with an emphasis on identifying and characterizing plasmid genes. Furthermore, plasmid gene annotation, validation, expression levels at growth conditions of interest, and contribution to host fitness are reported for the first time.« less

Complete genome sequence and the expression pattern of plasmids of the model ethanologen Zymomonas mobilis ZM4 and its xylose-utilizing derivatives 8b and 2032

DOE PAGES

Yang, Shihui; Vera, Jessica M.; Grass, Jeff; ...

2018-05-02

Zymomonas mobilis is a natural ethanologen being developed and deployed as an industrial biofuel producer. To date, eight Z. mobilis strains have been completely sequenced and found to contain 2-8 native plasmids. However, systematic verification of predicted Z. mobilis plasmid genes and their contribution to cell fitness has not been hitherto addressed. Moreover, the precise number and identities of plasmids in Z. mobilis model strain ZM4 have been unclear. The lack of functional information about plasmid genes in ZM4 impedes ongoing studies for this model biofuel-producing strain. In this study, we determined the complete chromosome and plasmid sequences of ZM4more » and its engineered xylose-utilizing derivatives 2032 and 8b. Compared to previously published and revised ZM4 chromosome sequences, the ZM4 chromosome sequence reported here contains 65 nucleotide sequence variations as well as a 2400-bp insertion. Four plasmids were identified in all three strains, with 150 plasmid genes predicted in strain ZM4 and 2032, and 153 plasmid genes predicted in strain 8b due to the insertion of heterologous DNA for expanded substrate utilization. Plasmid genes were then annotated using Blast2GO, InterProScan, and systems biology data analyses, and most genes were found to have apparent orthologs in other organisms or identifiable conserved domains. To verify plasmid gene prediction, RNA-Seq was used to map transcripts and also compare relative gene expression under various growth conditions, including anaerobic and aerobic conditions, or growth in different concentrations of biomass hydrolysates. Overall, plasmid genes were more responsive to varying hydrolysate concentrations than to oxygen availability. Additionally, our results indicated that although all plasmids were present in low copy number (about 1-2 per cell), the copy number of some plasmids varied under specific growth conditions or due to heterologous gene insertion. The complete genome of ZM4 and two xylose-utilizing derivatives is reported in this study, with an emphasis on identifying and characterizing plasmid genes. Furthermore, plasmid gene annotation, validation, expression levels at growth conditions of interest, and contribution to host fitness are reported for the first time.« less

Role of FAT/CD36 in fatty acid sensing, energy, and glucose homeostasis regulation in DIO and DR rats.

PubMed

Le Foll, Christelle; Dunn-Meynell, Ambrose A; Levin, Barry E

2015-02-01

Hypothalamic fatty acid (FA) sensing neurons alter their activity utilizing the FA translocator/receptor, FAT/CD36. Depletion of ventromedial hypothalamus (VMH) CD36 with adeno-associated viral vector expressing CD36 shRNA (AAV CD36 shRNA) leads to redistribution of adipose stores and insulin resistance in outbred rats. This study assessed the requirement of VMH CD36-mediated FA sensing for the regulation of energy and glucose homeostasis in postnatal day 5 (P5) and P21 selectively bred diet-induced obese (DIO) and diet-resistant (DR) rats using VMH AAV CD36 shRNA injections. P5 CD36 depletion altered VMH neuronal FA sensing predominantly in DIO rats. After 10 wk on a 45% fat diet, DIO rats injected with VMH AAV CD36 shRNA at P21 ate more and gained more weight than DIO AAV controls, while DR AAV CD36 shRNA-injected rats gained less weight than DR AAV controls. VMH CD36 depletion increased inguinal fat pad weights and leptin levels in DIO and DR rats. Although DR AAV CD36 shRNA-injected rats became as obese as DIO AAV controls, only DIO control and CD36 depleted rats became insulin-resistant on a 45% fat diet. VMH CD36 depletion stunted linear growth in DIO and DR rats. DIO rats injected with AAV CD36 shRNA at P5 had increased fat mass, mostly due to a 45% increase in subcutaneous fat. They were also insulin-resistant with an associated 71% increase of liver triglycerides. These results demonstrate that VMH CD36-mediated FA sensing is a critical factor in the regulation of energy and glucose homeostasis and fat deposition in DIO and DR rats.

Polyetherimide-grafted Fe3O4@SiO2 nanoparticles as theranostic agents for simultaneous VEGF siRNA delivery and magnetic resonance cell imaging

PubMed Central

Li, Tingting; Shen, Xue; Chen, Yin; Zhang, Chengchen; Yan, Jie; Yang, Hong; Wu, Chunhui; Zeng, Hongjun; Liu, Yiyao

2015-01-01

Engineering a safe and high-efficiency delivery system for efficient RNA interference is critical for successful gene therapy. In this study, we designed a novel nanocarrier system of polyethyleneimine (PEI)-modified Fe3O4@SiO2, which allows high efficient loading of VEGF small hairpin (sh)RNA to form Fe3O4@SiO2/PEI/VEGF shRNA nanocomposites for VEGF gene silencing as well as magnetic resonance (MR) imaging. The size, morphology, particle stability, magnetic properties, and gene-binding capacity and protection were determined. Low cytotoxicity and hemolyticity against human red blood cells showed the excellent biocompatibility of the multifunctional nanocomposites, and also no significant coagulation was observed. The nanocomposites maintain their superparamagnetic property at room temperature and no appreciable change in magnetism, even after PEI modification. The qualitative and quantitative analysis of cellular internalization into MCF-7 human breast cancer cells by Prussian blue staining and inductively coupled plasma atomic emission spectroscopy analysis, respectively, demonstrated that the Fe3O4@SiO2/PEI/VEGF shRNA nanocomposites could be easily internalized by MCF-7 cells, and they exhibited significant inhibition of VEGF gene expression. Furthermore, the MR cellular images showed that the superparamagnetic iron oxide core of our Fe3O4@SiO2/PEI/VEGF shRNA nanocomposites could also act as a T2-weighted contrast agent for cancer MR imaging. Our data highlight multifunctional Fe3O4@SiO2/PEI/VEGF shRNA nanocomposites as a potential platform for simultaneous gene delivery and MR cell imaging, which are promising as theranostic agents for cancer treatment and diagnosis in the future. PMID:26170664

Argonaute proteins are key determinants of RNAi efficacy, toxicity, and persistence in the adult mouse liver.

PubMed

Grimm, Dirk; Wang, Lora; Lee, Joyce S; Schürmann, Nina; Gu, Shuo; Börner, Kathleen; Storm, Theresa A; Kay, Mark A

2010-09-01

shRNA overexpression from viral gene therapy vectors can trigger cytotoxicity leading to organ failure and lethality in mice and rats. This process likely involves saturation of endogenous cellular RNAi factors including exportin-5 (Xpo-5). Here, we have shown that Xpo-5 overexpression enhanced shRNA efficiency in the liver of adult mice but increased hepatotoxicity. We identified the 4 members of the human Argonaute (Ago) protein family as downstream factors involved in saturation of endogenous cellular RNAi, all of which were able to interact with shRNAs in cells and mice. In Ago/shRNA coexpression studies, Ago-2 (Slicer) was the primary rate-limiting determinant of both in vitro and in vivo RNAi efficacy, toxicity, and persistence. In adult mice, vector-based Ago-2/Xpo-5 coexpression enhanced U6-driven shRNA silencing of exogenous and endogenous hepatic targets, reduced hepatotoxicity, and extended RNAi stability by more than 3 months. Use of weaker RNA polymerase III promoters to minimize shRNA expression likewise alleviated in vivo toxicity and permitted greater than 95% persistent knockdown of hepatitis B virus and other transgenes in mouse liver for more than 1 year. Our studies substantiate that abundant small RNAs can overload the endogenous RNAi pathway and reveal possible strategies for reducing hepatotoxicity of short- and long-term clinical gene silencing in humans.

Exploiting translational coupling for the selection of cells producing toxic recombinant proteins from expression vectors.

PubMed

Tagliavia, Marcello; Cuttitta, Angela

2016-01-01

High rates of plasmid instability are associated with the use of some expression vectors in Escherichia coli, resulting in the loss of recombinant protein expression. This is due to sequence alterations in vector promoter elements caused by the background expression of the cloned gene, which leads to the selection of fast-growing, plasmid-containing cells that do not express the target protein. This phenomenon, which is worsened when expressing toxic proteins, results in preparations containing very little or no recombinant protein, or even in clone loss; however, no methods to prevent loss of recombinant protein expression are currently available. We have exploited the phenomenon of translational coupling, a mechanism of prokaryotic gene expression regulation, in order to select cells containing plasmids still able to express recombinant proteins. Here we designed an expression vector in which the cloned gene and selection marker are co-expressed. Our approach allowed for the selection of the recombinant protein-expressing cells and proved effective even for clones encoding toxic proteins.

A Simple And Rapid Minicircle DNA Vector Manufacturing System

PubMed Central

Kay, Mark A; He, Cheng-Yi; Chen, Zhi-Ying

2010-01-01

Minicircle DNA vectors consisting of a circular expression cassette devoid of the bacterial plasmid DNA backbone provides several advantages including sustained transgene expression in quiescent cells/tissues. Their use has been limited by labor-intensive production. We report on a strategy for making multiple genetic modifications in E.coli to construct a producer strain that stably expresses a set of inducible minicircle-assembly enzymes, the øC31-integrase and I-SceI homing-endonuclease. This bacterial strain is capable of producing highly purified minicircle yields in the same time frame as routine plasmid DNA. It is now feasible for minicircle DNA vectors to replace routine plasmids in mammalian transgene expression studies. PMID:21102455

[The induction of neovascularization in chorioallantoic membrane of chicken embryos transfected by a recombinant plasmid containing human angiogenin gene].

PubMed

Avdeeva, S V; Khaĭdarova, N V; Logunov, D Iu; Neugodova, G L; Sevast'ianova, G A; Tarantul, V Z; Naroditskiĭ, B S

2003-01-01

A method was elaborated to evaluate the biological activity of expression products of gene in the plasmid vectors, which are crucial for the synthesis of growth factor of blood vessels. It was proven as possible that the chrioallantonic membrane (CAM) of chicken's embryos could be transfected by recombinant plasmids containing both the reporter and target genes. The efficiency of CAM transfection was assessed by a plasmid carrying the reporter gene of green fluorescent protein (GFP). Finally, it was demonstrated that, at an infiltration of the recombinant plasmid containing the human angiogenine gene, its expression products induce the neovascularization in the CAM cells of chicken's embryos and stimulate an accretion in vessels of the 1st, 2nd and 3d orders.

Expression of membrane targeted aequorin in Xenopus laevis oocytes.

PubMed

Daguzan, C; Nicolas, M T; Mazars, C; Leclerc, C; Moreau, M

1995-08-01

We described here a system for high level of expression of the calcium activated photoprotein aequorin. This protein has been targeted to the plasma membrane of Xenopus oocyte by nuclear microinjection of a plasmid containing a construction of a chimeric cDNA encoding a fusion protein composed of the photoprotein aequorin and the 5-HT1A receptor. The expression of this fusion protein is placed under the control of RSV promoter. Functional photoprotein was reconstituted in the oocyte by incubation with coelenterazine. The amount of photoprotein 24 h after nuclear microinjection of the plasmid was sufficient to trigger a detectable light emission following calcium entry. The efficiency of the expression is correlated with the dose of plasmid injected. Intracytoplasmic injection of the plasmid always failed in photoprotein expression. Targeting of the apoprotein was demonstrated by immunolocalization under confocal microscopy. In our experimental conditions, the apoprotein was always localized at the animal pole above the nucleus. We never observed expression and targeting to the plasma membrane of the vegetal pole. WE suggest that such expression might be of great interest for the study of numerous problems of developmental biology, in which calcium-dependent pathways are involved.

Loss of Selenium-Binding Protein 1 Decreases Sensitivity to Clastogens and Intracellular Selenium Content in HeLa Cells.

PubMed

Zhao, Changhui; Zeng, Huawei; Wu, Ryan T Y; Cheng, Wen-Hsing

2016-01-01

Selenium-binding protein 1 (SBP1) is not a selenoprotein but structurally binds selenium. Loss of SBP1 during carcinogenesis usually predicts poor prognosis. Because genome instability is a hallmark of cancer, we hypothesize that SBP1 sequesters cellular selenium and sensitizes cancer cells to DNA-damaging agents. To test this hypothesis, we knocked down SBP1 expression in HeLa cervical cancer cells by employing a short hairpin RNA (shRNA) approach. Reduced sensitivity to hydrogen peroxide, paraquat and camptothecin, reactive oxygen species content, and intracellular retention of selenium after selenomethionine treatment were observed in SBP1 shRNA HeLa cells. Results from Western analyses showed that treatment of HeLa cells with selenomethionine resulted in increased SBP1 protein expression in a dose-dependent manner. Knockdown of SBP1 rendered HeLa cells increased expression of glutathione peroxidase-1 but not glutathione peroxidase-4 protein levels and accelerated migration from a wound. Altogether, SBP1 retains supplemental selenium and sensitizes HeLa cancer cells to clastogens, suggesting a new cancer treatment strategy by sequestering selenium through SBP1.

Development of an expression plasmid and its use in genetic manipulation of Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (higher Basidiomycetes).

PubMed

Yu, Xuya; Ji, Sen-Lin; He, Yi-Long; Ren, Meng-Fei; Xu, Jun-Wei

2014-01-01

We report the construction of a plasmid, pJW-EXP, designed for the expression of homologous and heterologous genes in Ganoderma lucidum. pJW-EXP was generated from the plasmid pMD19-T by inserting the G. lucidum glyceraldehyde-3-phosphate dehydrogenase gene promoter, the G. lucidum iron-sulfur protein subunit of succinate dehydrogenase gene terminator and the homologous carboxin-resistance gene as selection marker. This expression plasmid can be efficiently transformed into Ganoderma through polyethylene glycol-mediated protoplast transformation. Southern blot analysis showed that most of the integrated DNA appeared as multiple copies in the genome. The applicability of the constructed plasmid was tested by expression of the truncated G. lucidum 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) gene that encodes the catalytic domain of HMGR. Overexpression of the truncated HMGR gene, which is a key gene in the biosynthetic pathway of the antitumor compounds, ganoderic acids, increased the transcription of the HMGR gene and enhanced ganoderic acid accumulation. pJW-EXP can serve as a useful tool in the genetic improvement and metabolic engineering of Ganoderma.

Multifunctional PLGA Nanobubbles as Theranostic Agents: Combining Doxorubicin and P-gp siRNA Co-Delivery Into Human Breast Cancer Cells and Ultrasound Cellular Imaging.

PubMed

Yang, Hong; Deng, Liwei; Li, Tingting; Shen, Xue; Yan, Jie; Zuo, Liangming; Wu, Chunhui; Liu, Yiyao

2015-12-01

Multidrug resistance (MDR) is a major impediment to the success of cancer chemotherapy. One of the effective approaches to overcome MDR is to use nanoparticle-mediated the gene silence of chemotherapeutic export proteins by RNA interference to increase drug accumulation in drug resistant cancer cells. In this work, a new co-delivery system, DOX-PLGA/PEI/P-gp shRNA nanobubbles (NBs) around 327 nm, to overcome doxorubicin (DOX) resistance in MCF-7 human breast cancer was designed and developed. Positively charged polyethylenimine (PEI) were modified onto the surface of DOX-PLGA NBs through DCC/NHS crosslinking, and could efficiently condense P-gp shRNA into DOX-PLGA/PEI NBs at vector/shRNA weight ratios of 70:1 and above. An in vitro release profile demonstrated an efficient DOX release (more than 80%) from DOX-PLGA/PEI NBs at pH 4.4, suggesting a pH-responsive drug release for the multifunctionalized NBs. Cellular experimental results further showed that DOX-PLGA/PEI/P-gp shRNA NBs could facilitate cellular uptake of DOX into cells and increase the cell proliferation suppression effect of DOX against MCF-7/ADR cells (a DOX-resistant and P-glycoprotein (P-gp) over-expression cancer cell line). The IC50 of DOX-PLGA NBs against MCF-7/ADR cells was 2-fold lower than that of free DOX. The increased cellular uptake and nuclear accumulation of DOX delivered by DOX-PLGA/PEI/P-gp shRNA NBs in MCF-7/ADR cells was confirmed by fluorescence microscopy and fluorescence spectrophotometry, and might be owning to the down-regulation of P-gp and reduced the efflux of DOX. The cellular uptake mechanism of DOX-PLGA/PEI/P-gp shRNA NBs indicated that the macropinocytosis was one of the pathways for the uptake of NBs by MCF-7/ADR cells, which was also an energy-dependent process. Furthermore, the in vitro cellular ultrasound imaging suggested that the employment of the DOX-PLGA/PEI/P-gp shRNA NBs could efficiently enhance ultrasound imaging of cancer cells. These results demonstrated that the developed DOX-PLGA/PEI/P-gp shRNA NBs is a potential, safe and efficient theranotic agent for cancer therapy and diagnostics.

[In vitro study of joint intervention of E-cad and Bmi-1 mediated by transcription activator-like effector nuclease in nasopharyngeal carcinoma].

PubMed

Luo, Tingting; Yan, Aifen; Liu, Lian; Jiang, Hong; Feng, Cuilan; Liu, Guannan; Liu, Fang; Tang, Dongsheng; Zhou, Tianhong

2018-03-28

To explore the effect of intervention of E-cadherin (E-cad) and B-lymphoma Moloney murine leukemia virus insertion region-1 (Bmi-1) mediated by transcription activator-like effector nuclease (TALEN) on the biological behaviors of nasopharyngeal carcinoma cells.
 Methods: Multi-locus gene targeting vectors pUC-DS1-CMV-E-cad-2A-Neo-DS2 and pUC-DS1-Bmi-1 shRNA-Zeo-DS2 were constructed, and the E-cad and Bmi-1 targeting vectors were transferred with TALEN plasmids to CNE-2 cells individually or simultaneously. The integration of target genes were detected by PCR, the expressions of E-cad and Bmi-1 were detected by Western blot. The changes of cell proliferation were detected by cell counting kit-8 (CCK-8) assay. The cell cycle and apoptosis were detected by flow cytometry. The cell migration and invasion were detected by Transwell assay.
 Results: The E-cad and Bmi-1 shRNA expression elements were successfully integrated into the genome of CNE-2 cells, the protein expression level of E-cad was up-regulated, and the protein expression level of Bmi-1 was down-regulated. The intervention of E-cad and Bmi-1 didn't affect the proliferation, cell cycle and apoptosis of CNE-2 cells, but it significantly inhibited the migration and invasion ability of CNE-2 cells. Furthermore, the intervention of E-cad and Bmi-1 together significantly inhibited the migration ability of nasopharyngeal carcinoma cells compared with the intervention of E-cad or Bmi-1 alone (all P<0.01).
 Conclusion: The joint intervention of E-cad and Bmi-1 mediated by TALEN can effectively inhibit the migration and invasion of nasopharyngeal carcinoma cells in vitro, which may lay the preliminary experimental basis for gene therapy of human cancer.

Advanced glycation end products promote the proliferation and migration of primary rat vascular smooth muscle cells via the upregulation of BAG3.

PubMed

Li, Cunshu; Chang, Ye; Li, Yuan; Chen, Shuang; Chen, Yintao; Ye, Ning; Dai, Dongxue; Sun, Yingxian

2017-05-01

The present study was aimed to investigate the role of reactive oxygen species (ROS) on advanced glycation end product (AGE)-induced proliferation and migration of vascular smooth muscle cells (VSMCs) and whether Bcl-2‑associated athanogene 3 (BAG3) is involved in the process. Primary rat VSMCs were extracted and cultured in vitro. Cell viability was detected by MTT assay and cell proliferation was detected by EdU incorporation assay. Cell migration was detected by wound healing and Transwell assays. BAG3 was detected using qPCR and western blot analysis. Transcriptional and translational inhibitors (actinomycin D and cycloheximide, respectively) were used to study the effect of AGEs on the expression of BAG3 in VSMCs. Lentiviral plasmids containing short hairpin RNA (shRNA) against rat BAG3 or control shRNA were transduced into VSMCs. Cellular ROS were detected by 2',7'-dichlorofluorescein diacetate (DCFH-DA) staining. Mitochondrial membrane potential was detected by tetramethylrhodamine methyl ester (TMRE) staining. AGEs significantly increased the expression of BAG3 in a dose-and time-dependent manner. Furthermore, AGEs mainly increased the expression of BAG3 mRNA by increasing the RNA synthesis rather than inhibiting the RNA translation. BAG3 knockdown reduced the proliferation and migration of VSMCs induced by AGEs. BAG3 knockdown reduced the generation of ROS and sustained the mitochondrial membrane potential of VSMCs. Reduction of ROS production by N-acetylcysteine (NAC), a potent antioxidant, also reduced the proliferation and migration of VSMCs. On the whole, the present study demonstrated for the first time that AGEs could increase ROS production and promote the proliferation and migration of VSMCs by upregulating BAG3 expression. This study indicated that BAG3 should be considered as a potential target for the prevention and/or treatment of vascular complications of diabetes.

MSH3-deficiency initiates EMAST without oncogenic transformation of human colon epithelial cells.

PubMed

Campregher, Christoph; Schmid, Gerald; Ferk, Franziska; Knasmüller, Siegfried; Khare, Vineeta; Kortüm, Benedikt; Dammann, Kyle; Lang, Michaela; Scharl, Theresa; Spittler, Andreas; Roig, Andres I; Shay, Jerry W; Gerner, Christopher; Gasche, Christoph

2012-01-01

Elevated microsatellite instability at selected tetranucleotide repeats (EMAST) is a genetic signature in certain cases of sporadic colorectal cancer and has been linked to MSH3-deficiency. It is currently controversial whether EMAST is associated with oncogenic properties in humans, specifically as cancer development in Msh3-deficient mice is not enhanced. However, a mutator phenotype is different between species as the genetic positions of repetitive sequences are not conserved. Here we studied the molecular effects of human MSH3-deficiency. HCT116 and HCT116+chr3 (both MSH3-deficient) and primary human colon epithelial cells (HCEC, MSH3-wildtype) were stably transfected with an EGFP-based reporter plasmid for the detection of frameshift mutations within an [AAAG]17 repeat. MSH3 was silenced by shRNA and changes in protein expression were analyzed by shotgun proteomics. Colony forming assay was used to determine oncogenic transformation and double strand breaks (DSBs) were assessed by Comet assay. Despite differential MLH1 expression, both HCT116 and HCT116+chr3 cells displayed comparable high mutation rates (about 4×10(-4)) at [AAAG]17 repeats. Silencing of MSH3 in HCECs leads to a remarkable increased frameshift mutations in [AAAG]17 repeats whereas [CA]13 repeats were less affected. Upon MSH3-silencing, significant changes in the expression of 202 proteins were detected. Pathway analysis revealed overexpression of proteins involved in double strand break repair (MRE11 and RAD50), apoptosis, L1 recycling, and repression of proteins involved in metabolism, tRNA aminoacylation, and gene expression. MSH3-silencing did not induce oncogenic transformation and DSBs increased 2-fold. MSH3-deficiency in human colon epithelial cells results in EMAST, formation of DSBs and significant changes of the proteome but lacks oncogenic transformation. Thus, MSH3-deficiency alone is unlikely to drive human colon carcinogenesis.

MSH3-Deficiency Initiates EMAST without Oncogenic Transformation of Human Colon Epithelial Cells

PubMed Central

Campregher, Christoph; Schmid, Gerald; Ferk, Franziska; Knasmüller, Siegfried; Khare, Vineeta; Kortüm, Benedikt; Dammann, Kyle; Lang, Michaela; Scharl, Theresa; Spittler, Andreas; Roig, Andres I.; Shay, Jerry W.; Gerner, Christopher; Gasche, Christoph

2012-01-01

Background/Aim Elevated microsatellite instability at selected tetranucleotide repeats (EMAST) is a genetic signature in certain cases of sporadic colorectal cancer and has been linked to MSH3-deficiency. It is currently controversial whether EMAST is associated with oncogenic properties in humans, specifically as cancer development in Msh3-deficient mice is not enhanced. However, a mutator phenotype is different between species as the genetic positions of repetitive sequences are not conserved. Here we studied the molecular effects of human MSH3-deficiency. Methods HCT116 and HCT116+chr3 (both MSH3-deficient) and primary human colon epithelial cells (HCEC, MSH3-wildtype) were stably transfected with an EGFP-based reporter plasmid for the detection of frameshift mutations within an [AAAG]17 repeat. MSH3 was silenced by shRNA and changes in protein expression were analyzed by shotgun proteomics. Colony forming assay was used to determine oncogenic transformation and double strand breaks (DSBs) were assessed by Comet assay. Results Despite differential MLH1 expression, both HCT116 and HCT116+chr3 cells displayed comparable high mutation rates (about 4×10−4) at [AAAG]17 repeats. Silencing of MSH3 in HCECs leads to a remarkable increased frameshift mutations in [AAAG]17 repeats whereas [CA]13 repeats were less affected. Upon MSH3-silencing, significant changes in the expression of 202 proteins were detected. Pathway analysis revealed overexpression of proteins involved in double strand break repair (MRE11 and RAD50), apoptosis, L1 recycling, and repression of proteins involved in metabolism, tRNA aminoacylation, and gene expression. MSH3-silencing did not induce oncogenic transformation and DSBs increased 2-fold. Conclusions MSH3-deficiency in human colon epithelial cells results in EMAST, formation of DSBs and significant changes of the proteome but lacks oncogenic transformation. Thus, MSH3-deficiency alone is unlikely to drive human colon carcinogenesis. PMID:23209772

Systematic Analysis of the Functional Relevance of Nuclear Structure and Mechanics in Breast Cancer Progression

DTIC Science & Technology

2013-07-01

epithelial cells; MDA-MB-231 metastatic breast cancer cells) with systematic alterations in the expression of lamins A, B1, B2, C, and lamin B receptor...LBR). We then evaluated the effect of altered lamin expression on nuclear stiffness in these cell lines. While increased expression of lamin A...caused stiffer, less deformable nuclei, reduction of lamins A/C expression by shRNA reduced nuclear stiffness. The effect of alterations in other lamins

The 987P fimbrial gene cluster of enterotoxigenic Escherichia coli is plasmid encoded.

PubMed Central

Schifferli, D M; Beachey, E H; Taylor, R K

1990-01-01

A clone containing the 987P fimbrial gene cluster was selected from a cosmid library of total DNA of the prototype Escherichia coli strain 987 by using 987P-specific antiserum. A subclone of 12 kilobases containing all of the genes required for fimbrial expression on a nonfimbriated K-12 strain of E. coli and a DNA fragment internal to the fimbrial subunit gene were used to probe the prototype strain and various isolates of 987P-fimbriated enterotoxigenic E. coli. All strains had several plasmids, as shown by agarose gel electrophoresis, and each of five strains which expressed 987P fimbriae showed a plasmid of 35 to 40 megadaltons (MDa) hybridizing to both 987P-specific probes. Hybridization to restricted DNA of strain 987 supported a plasmid origin for the cloned 987P gene cluster. Moreover, an isogenic strain which had lost its 35-MDa plasmid was no longer capable of synthesizing fimbrial subunits, but regained fimbrial expression after reintroduction of the TnphoA (Tn5 IS50L::phoA)-tagged 35-MDa plasmid. Absence of fimbrial subunit synthesis in K-12 strains transformed with the 35-MDa plasmid alone suggested the requirement of regulatory elements existing in strain 987 but missing in K-12 strains. A probe for the heat-stable enterotoxin STIa hybridized in each of the 987P-fimbriated strains to the plasmid containing the 987P genes and in most of these strains to an additional plasmid which contained the gene for the heat-stable enterotoxin STII. Occurrence of the 987P and STIa genes on the same replicon correlates with epidemiological observations, STIa being the most prevalent toxin produced by 987P-fimbriated E. coli. Images PMID:1967167

Food-grade host/vector expression system for Lactobacillus casei based on complementation of plasmid-associated phospho-beta-galactosidase gene lacG.

PubMed

Takala, T M; Saris, P E J; Tynkkynen, S S H

2003-01-01

A new food-grade host/vector system for Lactobacillus casei based on lactose selection was constructed. The wild-type non-starter host Lb. casei strain E utilizes lactose via a plasmid-encoded phosphotransferase system. For food-grade cloning, a stable lactose-deficient mutant was constructed by deleting a 141-bp fragment from the phospho-beta-galactosidase gene lacG via gene replacement. The deletion resulted in an inactive phospho-beta-galactosidase enzyme with an internal in-frame deletion of 47 amino acids. A complementation plasmid was constructed containing a replicon from Lactococcus lactis, the lacG gene from Lb. casei, and the constitutive promoter of pepR for lacG expression from Lb. rhamnosus. The expression of the lacG gene from the resulting food-grade plasmid pLEB600 restored the ability of the lactose-negative mutant strain to grow on lactose to the wild-type level. The vector pLEB600 was used for expression of the proline iminopeptidase gene pepI from Lb. helveticus in Lb. casei. The results show that the food-grade expression system reported in this paper can be used for expression of foreign genes in Lb. casei.

A freeze-thaw method for disintegration of Escherichia coli cells producing T7 lysozyme used in pBAD expression systems.

PubMed

Wanarska, Marta; Hildebrandt, Piotr; Kur, Józef

2007-01-01

The pLysN plasmid containing the T7 lysozyme gene under control of the lac promoter was constructed to facilitate cell disintegration after expression of recombinant proteins in arabinose-induced expression systems. The usefulness of this plasmid was tested in Escherichia coli TOP10 and E. coli LMG194 cells carrying pBADMHADgeSSB plasmid containing Deinococcus geothermalis SSB protein gene under control of the araBAD promoter. The results showed that low-level expression of T7 lysozyme did not interfere with the target SSB protein production, and that the freezing-thawing treatment was sufficient for disruption of the E. coli cells producing low amounts of T7 lysozyme.

Exploring the Role of Ubiquitination in Progesterone Receptor Transcriptional Activation and Turnover in Breast Cancer Cells

DTIC Science & Technology

2006-06-01

factors. T47DY cells were cotransfected with a PR construct, a PRE- luciferase plasmid and a renilla plasmid, for transfection control. The cells...PR-B or S294A PR-B, PRE-luciferase reporter constructs and a Renilla control plasmid. Cells were treated for 24hrs with or without R5020 (10nM...plasmid and a plasmid constitutively expressing renilla luciferase for transfection control. Cell were starved for one day and treated with or without

MACF1 Overexpression by Transfecting the 21 kbp Large Plasmid PEGFP-C1A-ACF7 Promotes Osteoblast Differentiation and Bone Formation.

PubMed

Zhang, Yan; Yin, Chong; Hu, Lifang; Chen, Zhihao; Zhao, Fan; Li, Dijie; Ma, Jianhua; Ma, Xiaoli; Su, Peihong; Qiu, Wuxia; Yang, Chaofei; Wang, Pai; Li, Siyu; Zhang, Ge; Wang, Liping; Qian, Airong; Xian, Cory J

2018-02-01

Microtubule actin crosslinking factor 1 (MACF1) is a large spectraplakin protein known to have crucial roles in regulating cytoskeletal dynamics, cell migration, growth, and differentiation. However, its role and action mechanism in bone remain unclear. The present study investigated optimal conditions for effective transfection of the large plasmid PEGFP-C1A-ACF7 (∼21 kbp) containing full-length human MACF1 cDNA, as well as the potential role of MACF1 in bone formation. To enhance MACF1 expression, the plasmid was transfected into osteogenic cells by electroporation in vitro and into mouse calvaria with nanoparticles. Then, transfection efficiency, osteogenic marker expression, calvarial thickness, and bone formation were analyzed. Notably, MACF1 overexpression triggered a drastic increase in osteogenic gene expression, alkaline phosphatase activity, and matrix mineralization in vitro. Mouse calvarial thickness, mineral apposition rate, and osteogenic marker protein expression were significantly enhanced by local transfection. In addition, MACF1 overexpression promoted β-catenin expression and signaling. In conclusion, MACF1 overexpression by transfecting the large plasmid containing full-length MACF1 cDNA promotes osteoblast differentiation and bone formation via β-catenin signaling. Current data will provide useful experimental parameters for the transfection of large plasmids and a novel strategy based on promoting bone formation for prevention and therapy of bone disorders.

Autophagy influences the low-dose hyper-radiosensitivity of human lung adenocarcinoma cells by regulating MLH1.

PubMed

Wang, Qiong; Xiao, Zhuya; Lin, Zhenyu; Zhou, Jie; Chen, Weihong; Jie, Wuyun; Cao, Xing; Yin, Zhongyuan; Cheng, Jing

2017-06-01

To investigate the impact of autophagy on the low-dose hyper-radiosensitivity (HRS) of human lung adenocarcinoma cells via MLH1 regulation. Immunofluorescent staining, Western blotting, and electron microscopy were utilized to detect autophagy in A549 and H460 cells. shRNA was used to silence MLH1 expression. The levels of MLH1, mTOR, p-mTOR, BNIP3, and Beclin-1 were measured by real-time polymerase chain reaction (PCR) and Western blotting. A549 cells, which have low levels of MLH1 expression, displayed HRS/induced radioresistance (IRR). Conversely, the radiosensitivity of H460 cells, which express high levels of MLH1, conformed to the linear-quadratic (LQ) model. After down-regulating MLH1 expression, A549 cells showed increased HRS and inhibition of autophagy, whereas H460 cells exhibited HRS/IRR. The levels of mTOR, p-mTOR, and BNIP3 were reduced in cells harboring MLH1 shRNA, and the changes in the mTOR/p-mTOR ratio mirrored those in MLH1 expression. Low MLH1-expressing A549 cells may exhibit HRS. Both the mTOR/p-mTOR and BNIP3/Beclin-1 signaling pathways were found to be related to HRS, but only mTOR/p-mTOR is involved in the regulation of HRS via MLH1 and autophagy.

Increased cFLIP expression in thymic epithelial tumors blocks autophagy via NF-κB signalling

PubMed Central

Belharazem, Djeda; Grass, Albert; Paul, Cornelia; Vitacolonna, Mario; Schalke, Berthold; Rieker, Ralf J.; Körner, Daniel; Jungebluth, Philipp; Simon-Keller, Katja; Hohenberger, Peter; Roessner, Eric M.; Wiebe, Karsten; Gräter, Thomas; Kyriss, Thomas; Ott, German; Geserick, Peter; Ströbel, Philipp; Marx, Alexander

2017-01-01

The anti-apoptotic cellular FLICE-like inhibitory protein cFLIP plays a pivotal role in normal tissues homoeostasis and the development of many tumors, but its role in normal thymus (NT), thymomas and thymic carcinomas (TC) is largely unknown. Expression, regulation and function of cFLIP were analyzed in biopsies of NT, thymomas, thymic squamous cell carcinomas (TSCC), thymic epithelial cells (TECs) derived thereof and in the TC line 1889c by qRT-PCR, western blot, shRNA techniques, and functional assays addressing survival, senescence and autophagy. More than 90% of thymomas and TSCCs showed increased cFLIP expression compared to NT. cFLIP expression declined with age in NTs but not in thymomas. During short term culture cFLIP expression levels declined significantly slower in neoplastic than non-neoplastic primary TECs. Down-regulation of cFLIP by shRNA or NF-κB inhibition accelerated senescence and induced autophagy and cell death in neoplastic TECs. The results suggest a role of cFLIP in the involution of normal thymus and the development of thymomas and TSCC. Since increased expression of cFLIP is a known tumor escape mechanism, it may serve as tissue-based biomarker in future clinical trials, including immune checkpoint inhibitor trials in the commonly PD-L1high thymomas and TCs. PMID:29163772

[Expression of the fusion protein CFP10-ESAT6 of Mycobacterium tuberculosis and the study of its immunogenicity].

PubMed

Wang, Xiao-ying; Bao, Lang; Zhao, Ming-cai; Zhang, Hui-dong; Long, Yang

2006-05-01

To express a recombinant fusion protein CFP10-ESAT6 of Mycobacterium tuberculosis, and obtain the polyclonal antibodies of this fusion protein by immune rabbit. The 630 bp cfpl0-esat6 fusion gene fragments were amplified from the genomic DNA of a Mycobacterium tuberculosis reference strain H37Rv and inserted into the expression plasmid pET32a (+) to generate the recombinant plasmid pET-cfp10-esat6. The recombinat expression plasmid was transformed into E. coli BL21 (DE3). The fused protein CFP10-ESAT6 with His-tag was expressed after inducing with IPTG and purified with affinity chromatography. This protein was used to immune the rabbit to obtained the polyclonal antibodies, and been analyzed with Western-blot and ELISA. The recombinant plasmid pET-cfp10-esat6 was success fully constructed, the recombinant fusion protein CFP10-ESAT6 could be expressed at relatively high levels, and the polyclonal antibodies of fusion protein were obtained. The successful construction and expression of the recombinant fusion protein CFP10-ESAT6 and the obtained polyclonal antibodies will be very helpful for the development of new anti-tuberculosis vaccine and the clinical serologic diagnosis.

[Clone, construct, expression and verification of lactoferricin B gene and several sequence mutations in yeast].

PubMed

Feng, Yong-qian; Zha, Xiao-jun; Zhai, Chao-yang

2007-07-01

To construct the eucaryotic recombinant plasmid of pYES2/LactoferricinB expressing in yeast of S. cerevisiae, of which the expressed protein antibacterial activity was verified in preliminary. By self-template PCR method, the gene of Lactoferricin B and its several sequence mutations were amplified with the parts of the pre-synthesized single chains. And then Lactoferricin B gene and its mutants were cloned into the vector of pYES2 to construct the recombined expression plasmid pYES2/Lactoferricin B etc. extracted and used to transform the yeast S. cerevisiae. The expressions of proteins were determined after induced by galactose. The expression proteins were collected and purified by hydronium-exchange column, and the bacterial inhibited test was applied to identify the protein antibacterial activities. The PCR amplifying and DNA sequencing tests indicated that the purpose plasmid contained the Lactoferricin B gene and several mutations. The induced target proteins were confirmed by SDS-PAGE electrophoresis and mass spectrum test. The protein antibacterial activities of mutations were verified in preliminary. The recombined plasmid pYES2/Lactoferricin B etc. are successfully constructed and induced to express in yeast cell of S. cerevisiae; the obtained recombined protein of Lactoferricin B provides a basis for further research work on the biological function and antibacterial activity.

Immune Responses Induced by Gene Gun or Intramuscular Injection of DNA Vaccines That Express Immunogenic Regions of the Serine Repeat Antigen from Plasmodium falciparum

PubMed Central

Belperron, Alexia A.; Feltquate, David; Fox, Barbara A.; Horii, Toshihiro; Bzik, David J.

1999-01-01

The liver- and blood-stage-expressed serine repeat antigen (SERA) of Plasmodium falciparum is a candidate protein for a human malaria vaccine. We compared the immune responses induced in mice immunized with SERA-expressing plasmid DNA vaccines delivered by intramuscular (i.m.) injection or delivered intradermally by Gene Gun immunization. Mice were immunized with a pcdna3 plasmid encoding the entire 47-kDa domain of SERA (amino acids 17 to 382) or the N-terminal domain (amino acids 17 to 110) of SERA. Minimal antibody responses were detected following DNA vaccination with the N-terminal domain of SERA, suggesting that the N-terminal domain alone is not highly immunogenic by this route of vaccine delivery. Immunization of mice by Gene Gun delivery of the 47-kDa domain of SERA elicited a significantly higher serum antibody titer to the antigen than immunization of mice by i.m. injection with the same plasmid did. The predominant isotype subclass of the antibodies elicited to the SERA protein following i.m. and Gene Gun immunizations with SERA plasmid DNA was immunoglobulin G1. Coimmunization of mice with SERA plasmid DNA and a plasmid expressing the hepatitis B surface antigen (pCMV-s) by the i.m. route resulted in higher anti-SERA titers than those generated in mice immunized with the SERA DNA plasmid alone. Vaccination with DNA may provide a viable alternative or may be used in conjunction with protein-based subunit vaccines to maximize the efficacy of a human malaria vaccine that includes immunogenic regions of the SERA protein. PMID:10496891

Effects of different cytokines on immune responses of rainbow trout in a virus DNA vaccination model

PubMed Central

Cao, Yongsheng; Zhang, Qiya; Xu, Liming; Li, Shaowu; Wang, Di; Zhao, Jingzhuang; Liu, Hongbai; Feng, Jian; Lu, Tongyan

2017-01-01

Seven rainbow trout cytokine genes (interleukin (IL)-2, IL-8, IL-15, IL-17, IL-1β, intracellular interferon (iIFN) 1a, and IFN-γ2) were evaluated for their adjuvant effects on a DNA vaccine, called pG, containing the glycoprotein gene of infectious hematopoietic necrosis virus (IHNV). Distinct DNA constructs in expression plasmid pcDNA3.1 encoding a cytokine gene were generated. Immunofluorescence assays in rainbow trout gonadal cells demonstrated successful protein expression from all these constructs. Subsequently, fish were immunized with pG alone or together with a cytokine expression plasmid. Results showed that each cytokine plasmids at an appropriate dose showed notable effects on immune gene expression. IL-17 and IFN-γ2 can enhance early specific IgM response. All cytokines, except IL-8, can benefit initial neutralizing antibody (NAb) titers. At 35 days post immunization (dpi), NAb titers of fish immunized with pG and IL-2, iIFN1a, or IFN-γ2 plasmids remained at high levels (1:160). NAb titers of fish immunized with pG alone decreased to 1:40. IL-8 or IL-1β can enhance antigen-specific proliferative T-cell responses at 14 dpi. At 28 dpi, coinjection of pG with IL-2, IL-8, IL-15, or IL-17 plasmids induced considerably stronger lymphocyte proliferation than that with injection of pG alone. All cytokine plasmids delivered with pG plasmid enhanced protection of trout against IHNV-mediated mortality. These results indicate that the type and dose of trout cytokine genes injected into fish affect quality of immune response to DNA vaccination. PMID:29348820

Silencing Genes in the Heart.

PubMed

Fechner, Henry; Vetter, Roland; Kurreck, Jens; Poller, Wolfgang

2017-01-01

Silencing of cardiac genes by RNA interference (RNAi) has developed into a powerful new method to treat cardiac diseases. Small interfering (si)RNAs are the inducers of RNAi, but cultured primary cardiomyocytes and heart are highly resistant to siRNA transfection. This can be overcome by delivery of small hairpin (sh)RNAs or artificial microRNA (amiRNAs) by cardiotropic adeno-associated virus (AAV) vectors. Here we describe as example of the silencing of a cardiac gene, the generation and cloning of shRNA, and amiRNAs directed against the cardiac protein phospholamban. We further describe the generation of AAV shuttle plasmids with self complementary vector genomes, the production of AAV vectors in roller bottles, and their purification via iodixanol gradient centrifugation and concentration with filter systems. Finally we describe the preparation of primary neonatal rat cardiomyocytes (PNRC), the transduction of PNRC with AAV vectors, and the maintenance of the transduced cell culture.

Copy number variability of expression plasmids determined by cell sorting and Droplet Digital PCR.

PubMed

Jahn, Michael; Vorpahl, Carsten; Hübschmann, Thomas; Harms, Hauke; Müller, Susann

2016-12-19

Plasmids are widely used for molecular cloning or production of proteins in laboratory and industrial settings. Constant modification has brought forth countless plasmid vectors whose characteristics in terms of average plasmid copy number (PCN) and stability are rarely known. The crucial factor determining the PCN is the replication system; most replication systems in use today belong to a small number of different classes and are available through repositories like the Standard European Vector Architecture (SEVA). In this study, the PCN was determined in a set of seven SEVA-based expression plasmids only differing in the replication system. The average PCN for all constructs was determined by Droplet Digital PCR and ranged between 2 and 40 per chromosome in the host organism Escherichia coli. Furthermore, a plasmid-encoded EGFP reporter protein served as a means to assess variability in reporter gene expression on the single cell level. Only cells with one type of plasmid (RSF1010 replication system) showed a high degree of heterogeneity with a clear bimodal distribution of EGFP intensity while the others showed a normal distribution. The heterogeneous RSF1010-carrying cell population and one normally distributed population (ColE1 replication system) were further analyzed by sorting cells of sub-populations selected according to EGFP intensity. For both plasmids, low and highly fluorescent sub-populations showed a remarkable difference in PCN, ranging from 9.2 to 123.4 for ColE1 and from 0.5 to 11.8 for RSF1010, respectively. The average PCN determined here for a set of standardized plasmids was generally at the lower end of previously reported ranges and not related to the degree of heterogeneity. Further characterization of a heterogeneous and a homogeneous population demonstrated considerable differences in the PCN of sub-populations. We therefore present direct molecular evidence that the average PCN does not represent the true number of plasmid molecules in individual cells.

The effect of mutation on Rhodococcus equi virulence plasmid gene expression and mouse virulence.

PubMed

Ren, Jun; Prescott, John F

2004-11-15

An 81 kb virulence plasmid containing a pathogenicity island (PI) plays a crucial role in the pathogenesis of Rhodococcus equi pneumonia in foals but its specific function in virulence and regulation of plasmid-encoded virulence genes is unclear. Using a LacZ selection marker developed for R. equi in this study, in combination with an apramycin resistance gene, an efficient two-stage homologous recombination targeted gene mutation procedure was used to mutate three virulence plasmid genes, a LysR regulatory gene homologue (ORF4), a ResD-like two-component response regulator homologue (ORF8), and a gene (ORF10) of unknown function that is highly expressed by R. equi inside macrophages, as well as the chromosomal gene operon, phoPR. Virulence testing by liver clearance after intravenous injection in mice showed that the ORF4 and ORF8 mutants were fully attenuated, that the phoPR mutant was hypervirulent, and that virulence of the ORF10 mutant remained unchanged. A virulence plasmid DNA microarray was used to compare the plasmid gene expression profile of each of the four gene-targeted mutants against the parental R. equi strain. Changes were limited to PI genes and gene induction was observed for all mutants, suggesting that expression of virulence plasmid genes is dominated by a negative regulatory network. The finding of attenuation of ORF4 and ORF8 mutants despite enhanced transcription of vapA suggests that factors other than VapA are important for full expression of virulence. ORF1, a putative Lsr antigen gene, was strongly and similarly induced in all mutants, implying a common regulatory pathway affecting this gene for all four mutated genes. ORF8 is apparently the centre of this common pathway. Two distinct highly correlated gene induction patterns were observed, that of the ORF4 and ORF8 mutants, and that of the ORF10 and phoPR mutants. The gene induction pattern distinguishing these two groups paralleled their virulence in mice.

Preclinical development of BCG.HIVA2auxo.int, harboring an integrative expression vector, for a HIV-TB Pediatric vaccine. Enhancement of stability and specific HIV-1 T-cell immunity.

PubMed

Mahant, Aakash; Saubi, Narcís; Eto, Yoshiki; Guitart, Núria; Gatell, Josep Ma; Hanke, Tomáš; Joseph, Joan

2017-08-03

One of the critical issues that should be addressed in the development of a BCG-based HIV vaccine is genetic plasmid stability. Therefore, to address this issue we have considered using integrative vectors and the auxotrophic mutant of BCG complemented with a plasmid carrying a wild-type complementing gene. In this study, we have constructed an integrative E. coli-mycobacterial shuttle plasmid, p2auxo.HIVA int , expressing the HIV-1 clade A immunogen HIVA. This shuttle vector uses an antibiotic resistance-free mechanism for plasmid selection and maintenance. It was first transformed into a glycine auxotrophic E. coli strain and subsequently transformed into a lysine auxotrophic Mycobacterium bovis BCG strain to generate the vaccine BCG.HIVA 2auxo.int . Presence of the HIVA gene sequence and protein expression was confirmed. We demonstrated that the in vitro stability of the integrative plasmid p2auxo.HIVA int was increased 4-fold, as compared with the BCG strain harboring the episomal plasmid, and was genetically and phenotypically characterized. The BCG.HIVA 2auxo.int vaccine in combination with modified vaccinia virus Ankara (MVA).HIVA was found to be safe and induced HIV-1 and Mycobacterium tuberculosis-specific interferon-γ-producing T-cell responses in adult BALB/c mice. We have engineered a more stable and immunogenic BCG-vectored vaccine using the prototype immunogen HIVA. Thus, the use of integrative expression vectors and the antibiotic-free plasmid selection system based on "double" auxotrophic complementation are likely to improve the mycobacterial vaccine stability in vivo and immunogenicity to develop not only recombinant BCG-based vaccines expressing second generation of HIV-1 immunogens but also other major pediatric pathogens to prime protective responses shortly following birth.

ANG II receptor subtype 1a gene knockdown in the subfornical organ prevents increased drinking behavior in bile duct-ligated rats.

PubMed

Walch, Joseph D; Nedungadi, T Prashant; Cunningham, J Thomas

2014-09-15

Bile duct ligation (BDL) causes congestive liver failure that initiates hemodynamic changes, resulting in dilutional hyponatremia due to increased water intake and vasopressin release. This project tested the hypothesis that angiotensin signaling at the subfornical organ (SFO) augments drinking behavior in BDL rats. A genetically modified adeno-associated virus containing short hairpin RNA (shRNA) for ANG II receptor subtype 1a (AT1aR) gene was microinjected into the SFO of rats to knock down expression. Two weeks later, BDL or sham surgery was performed. Rats were housed in metabolic chambers for measurement of fluid and food intake and urine output. The rats were euthanized 28 days after BDL surgery for analysis. A group of rats was perfused for immunohistochemistry, and a second group was used for laser-capture microdissection for analysis of SFO AT1aR gene expression. BDL rats showed increased water intake that was attenuated in rats that received SFO microinjection of AT1aR shRNA. Among BDL rats treated with scrambled (control) and AT1aR shRNA, we observed an increased number of vasopressin-positive cells in the supraoptic nucleus that colocalized with ΔFosB staining, suggesting increased vasopressin release in both groups. These results indicate that angiotensin signaling through the SFO contributes to increased water intake, but not dilutional hyponatremia, during congestive liver failure. Copyright © 2014 the American Physiological Society.

Tongue Epithelium Cells from shRNA Mediated Transgenic Goat Show High Resistance to Foot and Mouth Disease Virus

PubMed Central

Li, Wenting; Wang, Kejun; Kang, Shimeng; Deng, Shoulong; Han, Hongbing; Lian, Ling; Lian, Zhengxing

2015-01-01

Foot and mouth disease induced by foot and mouth disease virus (FMDV) is severe threat to cloven-hoofed domestic animals. The gene 3Dpol in FMDV genome encodes the viral RNA polymerase, a vital element for FMDV replication. In this study, a conserved 3D-7414shRNA targeting FMDV-3Dpol gene was designed and injected into pronuclear embryos to produce the transgenic goats. Sixty-one goats were produced, of which, seven goats positively integrated 3D-7414shRNA. Loss of function assay demonstrated that siRNA effectively knockdown 3Dpol gene in skin epithelium cells of transgenic goats. Subsequently, the tongue epithelium cells from transgenic and non-transgenic goats were infected with FMDV O/YS/CHA/05 strain. A significant decrease of virus titres and virus copy number was observed in cells of transgenic goats compared with that of non-transgenic goats, which indicated that 3D-7414siRNA inhibited FMDV replication by interfering FMDV-3Dpol gene. Furthermore, we found that expression of TLR7, RIG-I and TRAF6 was lower in FMDV infected cells from transgenic goats compared to that from non-transgenic goats, which might result from lower virus copy number in transgenic goats’ cells. In conclusion, we successfully produced transgenic goats highly expressing 3D-7414siRNA targeting 3Dpol gene, and the tongue epithelium cells from the transgenic goats showed effective resistance to FMDV. PMID:26671568

Plasmid-Mediated Bioaugmentation for the Bioremediation of Contaminated Soils

PubMed Central

Garbisu, Carlos; Garaiyurrebaso, Olatz; Epelde, Lur; Grohmann, Elisabeth; Alkorta, Itziar

2017-01-01

Bioaugmentation, or the inoculation of microorganisms (e.g., bacteria harboring the required catabolic genes) into soil to enhance the rate of contaminant degradation, has great potential for the bioremediation of soils contaminated with organic compounds. Regrettably, cell bioaugmentation frequently turns into an unsuccessful initiative, owing to the rapid decrease of bacterial viability and abundance after inoculation, as well as the limited dispersal of the inoculated bacteria in the soil matrix. Genes that encode the degradation of organic compounds are often located on plasmids and, consequently, they can be spread by horizontal gene transfer into well-established, ecologically competitive, indigenous bacterial populations. Plasmid-mediated bioaugmentation aims to stimulate the spread of contaminant degradation genes among indigenous soil bacteria by the introduction of plasmids, located in donor cells, harboring such genes. But the acquisition of plasmids by recipient cells can affect the host’s fitness, a crucial aspect for the success of plasmid-mediated bioaugmentation. Besides, environmental factors (e.g., soil moisture, temperature, organic matter content) can play important roles for the transfer efficiency of catabolic plasmids, the expression of horizontally acquired genes and, finally, the contaminant degradation activity. For plasmid-mediated bioaugmentation to be reproducible, much more research is needed for a better selection of donor bacterial strains and accompanying plasmids, together with an in-depth understanding of indigenous soil bacterial populations and the environmental conditions that affect plasmid acquisition and the expression and functioning of the catabolic genes of interest. PMID:29062312

11β-Hydroxysteroid dehydrogenase type 1 shRNA ameliorates glucocorticoid-induced insulin resistance and lipolysis in mouse abdominal adipose tissue.

PubMed

Wang, Ying; Yan, Chaoying; Liu, Limei; Wang, Wei; Du, Hanze; Fan, Winnie; Lutfy, Kabirullah; Jiang, Meisheng; Friedman, Theodore C; Liu, Yanjun

2015-01-01

Long-term glucocorticoid exposure increases the risk for developing type 2 diabetes. Prereceptor activation of glucocorticoid availability in target tissue by 11β-hydroxysteroid dehydrogenase type 1 (11β-HSD1) coupled with hexose-6-phosphate dehydrogenase (H6PDH) is an important mediator of the metabolic syndrome. We explored whether the tissue-specific modulation of 11β-HSD1 and H6PDH in adipose tissue mediates glucocorticoid-induced insulin resistance and lipolysis and analyzed the effects of 11β-HSD1 inhibition on the key lipid metabolism genes and insulin-signaling cascade. We observed that corticosterone (CORT) treatment increased expression of 11β-HSD1 and H6PDH and induced lipase HSL and ATGL with suppression of p-Thr(172) AMPK in adipose tissue of C57BL/6J mice. In contrast, CORT induced adipose insulin resistance, as reflected by a marked decrease in IR and IRS-1 gene expression with a reduction in p-Thr(308) Akt/PKB. Furthermore, 11β-HSD1 shRNA attenuated CORT-induced 11β-HSD1 and lipase expression and improved insulin sensitivity with a concomitant stimulation of pThr(308) Akt/PKB and p-Thr(172) AMPK within adipose tissue. Addition of CORT to 3T3-L1 adipocytes enhanced 11β-HSD1 and H6PDH and impaired p-Thr(308) Akt/PKB, leading to lipolysis. Knockdown of 11β-HSD1 by shRNA attenuated CORT-induced lipolysis and reversed CORT-mediated inhibition of pThr(172) AMPK, which was accompanied by a parallel improvement of insulin signaling response in these cells. These findings suggest that elevated adipose 11β-HSD1 expression may contribute to glucocorticoid-induced insulin resistance and adipolysis. Copyright © 2015 the American Physiological Society.

Anti-melanoma vaccines engineered to simultaneously modulate cytokine priming and silence PD-L1 characterized using ex vivo myeloid-derived suppressor cells as a readout of therapeutic efficacy.

PubMed

Liechtenstein, Therese; Perez-Janices, Noemi; Blanco-Luquin, Idoia; Goyvaerts, Cleo; Schwarze, Julia; Dufait, Ines; Lanna, Alessio; Ridder, Mark De; Guerrero-Setas, David; Breckpot, Karine; Escors, David

Efficacious antitumor vaccines strongly stimulate cancer-specific effector T cells and counteract the activity of tumor-infiltrating immunosuppressive cells. We hypothesised that combining cytokine expression with silencing programmed cell death ligand 1 (PD-L1) could potentiate anticancer immune responses of lentivector vaccines. Thus, we engineered a collection of lentivectors that simultaneously co-expressed an antigen, a PD-L1-silencing shRNA, and various T cell-polarising cytokines, including interferon γ (IFNγ), transforming growth factor β (TGFβ) or interleukins (IL12, IL15, IL23, IL17A, IL6, IL10, IL4). In a syngeneic B16F0 melanoma model and using tyrosinase related protein 1 (TRP1) as a vaccine antigen, we found that simultaneous delivery of IL12 and a PD-L1-silencing shRNA was the only combination that exhibited therapeutically relevant anti-melanoma activities. Mechanistically, we found that delivery of the PD-L1 silencing construct boosted T cell numbers, inhibited in vivo tumor growth and strongly cooperated with IL12 cytokine priming and antitumor activities. Finally, we tested the capacities of our vaccines to counteract tumor-infiltrating myeloid-derived suppressor cell (MDSC) activities ex vivo . Interestingly, the lentivector co-expressing IL12 and the PD-L1 silencing shRNA was the only one that counteracted MDSC suppressive activities, potentially underlying the observed anti-melanoma therapeutic benefit. We conclude that (1) evaluation of vaccines in healthy mice has no significant predictive value for the selection of anticancer treatments; (2) B16 cells expressing xenoantigens as a tumor model are of limited value; and (3) vaccines which inhibit the suppressive effect of MDSC on T cells in our ex vivo assay show promising and relevant antitumor activities.

Anti-melanoma vaccines engineered to simultaneously modulate cytokine priming and silence PD-L1 characterized using ex vivo myeloid-derived suppressor cells as a readout of therapeutic efficacy

PubMed Central

Liechtenstein, Therese; Perez-Janices, Noemi; Blanco-Luquin, Idoia; Goyvaerts, Cleo; Schwarze, Julia; Dufait, Ines; Lanna, Alessio; Ridder, Mark De; Guerrero-Setas, David; Breckpot, Karine; Escors, David

2014-01-01

Efficacious antitumor vaccines strongly stimulate cancer-specific effector T cells and counteract the activity of tumor-infiltrating immunosuppressive cells. We hypothesised that combining cytokine expression with silencing programmed cell death ligand 1 (PD-L1) could potentiate anticancer immune responses of lentivector vaccines. Thus, we engineered a collection of lentivectors that simultaneously co-expressed an antigen, a PD-L1-silencing shRNA, and various T cell-polarising cytokines, including interferon γ (IFNγ), transforming growth factor β (TGFβ) or interleukins (IL12, IL15, IL23, IL17A, IL6, IL10, IL4). In a syngeneic B16F0 melanoma model and using tyrosinase related protein 1 (TRP1) as a vaccine antigen, we found that simultaneous delivery of IL12 and a PD-L1-silencing shRNA was the only combination that exhibited therapeutically relevant anti-melanoma activities. Mechanistically, we found that delivery of the PD-L1 silencing construct boosted T cell numbers, inhibited in vivo tumor growth and strongly cooperated with IL12 cytokine priming and antitumor activities. Finally, we tested the capacities of our vaccines to counteract tumor-infiltrating myeloid-derived suppressor cell (MDSC) activities ex vivo. Interestingly, the lentivector co-expressing IL12 and the PD-L1 silencing shRNA was the only one that counteracted MDSC suppressive activities, potentially underlying the observed anti-melanoma therapeutic benefit. We conclude that (1) evaluation of vaccines in healthy mice has no significant predictive value for the selection of anticancer treatments; (2) B16 cells expressing xenoantigens as a tumor model are of limited value; and (3) vaccines which inhibit the suppressive effect of MDSC on T cells in our ex vivo assay show promising and relevant antitumor activities. PMID:25954597

Dynamics in copy numbers of five plasmids of a dairy Lactococcus lactis in dairy-related conditions including near-zero growth rates.

PubMed

van Mastrigt, Oscar; Lommers, Marcel M A N; de Vries, Yorick C; Abee, Tjakko; Smid, Eddy J

2018-03-23

Lactic acid bacteria can carry multiple plasmids affecting their performance in dairy fermentations. The expression of plasmid-encoded genes and the activity of the corresponding proteins is severely affected by changes in the number of plasmid copies. We studied the impact of growth rate on dynamics of plasmid copy numbers at high growth rates in chemostat cultures and down to near-zero growth rates in retentostat cultures. Five plasmids of the dairy strain Lactococcus lactis FM03-V1 were selected which varied in size (3 to 39 kb), in replication mechanism (theta or rolling-circle) and in putative (dairy-associated) functions. Copy numbers ranged from 1.5 to 40.5 and the copy number of theta-type replicating plasmids were negatively correlated to the plasmid size. Despite the extremely wide range of growth rates (0.0003 h -1 to 0.6 h -1 ), copy numbers of the five plasmids were stable and only slightly increased at near-zero growth rates showing that the plasmid replication rate was strictly controlled. One low-copy number plasmid, carrying a large exopolysaccharide gene cluster, was segregationally unstable during retentostat cultivations reflected in complete loss of the plasmid in one of the retentostat cultures. The copy number of the five plasmids was also hardly affected by varying the pH value, nutrient limitation or presence of citrate (maximum 2.2-fold) signifying the stability in copy number of the plasmids. Importance Lactococcus lactis is extensively used in starter cultures for dairy fermentations. Important traits for growth and survival of L. lactis in dairy fermentations are encoded by genes located on plasmids, such as genes involved in lactose and citrate metabolism, protein degradation and oligopeptide uptake and bacteriophage resistance. Because the number of plasmid copies could affect the expression of plasmid-encoded genes, it is important to know the factors that influence the plasmid copy numbers. We monitored plasmid copy numbers of L. lactis at near-zero growth rates, characteristic for cheese ripening. Moreover, we analysed the effect of pH, nutrient limitation and presence of citrate. This showed that plasmid copy numbers were stable giving insight into plasmid copy number dynamics in dairy fermentations. Copyright © 2018 American Society for Microbiology.

Fast and efficient three-step target-specific curing of a virulence plasmid in Salmonella enterica.

PubMed

de Moraes, Marcos H; Teplitski, Max

2015-12-01

Virulence plasmids borne by serovars of Salmonella enterica carry genes involved in its pathogenicity, as well as other functions. Characterization of phenotypes associated with virulence plasmids requires a system for efficiently curing strains of their virulence plasmids. Here, we developed a 3-step protocol for targeted curing of virulence plasmids. The protocol involves insertion of an I-SecI restriction site linked to an antibiotic resistance gene into the target plasmid using λ-Red mutagenesis, followed by the transformation with a temperature-sensitive auxiliary plasmid which carries I-SecI nuclease expressed from a tetracycline-inducible promoter. Finally, the auxiliary plasmid is removed by incubation at 42 °C and the plasmid-less strains are verified on antibiotic-containing media. This method is fast and very efficient: over 90 % of recovered colonies lacked their virulence plasmid.

Enhanced synergistic anti-Lewis lung carcinoma effect of a DNA vaccine harboring a MUC1-VEGFR2 fusion gene used with GM-CSF as an adjuvant.

PubMed

Ruan, Junzhong; Duan, Yong; Li, Fugen; Wang, Zitong

2017-01-01

In order to achieve a synergistic effect on anti-tumour and anti-angiogenesis activity, we designed and constructed a DNA vaccine that expresses MUC1and VEGFR2 in the same reading frame. The aim of this study was to investigate the anti-tumour activity of this DNA vaccine. Furthermore, we also investigated the enhanced synergistic anti-Lewis lung carcinoma effect of this DNA vaccine by using GM-CSF as an adjuvant. A series of DNA plasmids encoding MUC1, VEGFR2, GM-CSF, and their conjugates were constructed and injected into mice intramuscularly (i.m.) followed by an electric pulse. The humoral and cellular immune responses after immunization were detected by enzyme-linked immunosorbent assay (ELISA) and enzyme-linked immunospot (ELISPOT), respectively. To evaluate the anti-tumour efficacy of these plasmids, murine models with MUC1-expressing tumours were generated. After injection into the tumour-bearing mouse model, the plasmid carrying the fusion gene of MUC1 and VEGFR2 showed stronger inhibition of tumour growth than the plasmid expressing MUC1 or VEGFR2 alone, which indicated that MUC1 and VEGFR2 could exert a synergistic anti-tumour effect. Furthermore, mice vaccinated with the combination of the GM-CSF expressing plasmid and the plasmid carrying the fusion gene of MUC1 and VEGFR2 showed an increased inhibition in the growth of MUC1-expressing tumours and prolonged mouse survival. These observations emphasize the potential of the synergistic anti-tumour and anti-angiogenesis strategy used in DNA vaccines, and the potential of the GM-CSF gene as an adjuvant for DNA vaccines, which could represent a promising approach for tumour immunotherapy. © 2016 John Wiley & Sons Australia, Ltd.

ELF5 in epithelial ovarian carcinoma tissues and biological behavior in ovarian carcinoma cells.

PubMed

Yan, Hongchao; Qiu, Linglin; Xie, Xiaolei; Yang, He; Liu, Yongli; Lin, Xiaoman; Huang, Hongxiang

2017-03-01

The expression of E74-like factor 5 (ELF5) in epithelial ovarian carcinoma tissues and its effects on biological behavior in ovarian carcinoma cells were assessed in search for a new approach for gene treatment of epithelial ovarian carcinoma. RT-PCR technology was applied to detect the expression of ELF5 mRNA in epithelial ovarian carcinoma (n=49), borderline ovarian epithelial tumor (n=19), benign ovarian epithelial tumor (n=31) and normal ovarian tissues (n=40). Then, we transfected recombinant plasmid pcDNA3.1‑ELF5+EGFP into human ovarian carcinoma SKOV3 cells (recombinant plasmid group) in vitro and screened out stably transfected cells to conduct multiplication culture. Western blot analysis was performed to detect the expression of ELF5 protein in the different groups. Flow cytometry was employed to detect cell apoptosis and cycles. ELF5 mRNA in epithelial ovarian carcinoma and borderline ovarian epithelial tumor tissues were significantly lower (P<0.05) than those in benign ovarian epithelial tumor and normal ovarian tissues. ELF5 protein expression in the cells of recombinant plasmid group was significantly higher compared with empty plasmid and blank control groups. The capacity of cell reproductive recombinant plasmid group at each time point decreased (P<0.05). Flow cytometry detection showed that 67.03% of cells in recombinant plasmid group was blocked in G0/G1 phase (P<0.05), compared with empty plasmid group (37.17%) and blank control group (38.24%). Apoptotic rate of recombinant plasmid group was significantly lower (31.4±1.9%; P<0.05), compared with that of empty plasmid group (9.1±2.2%) and blank control group (8.7±1.5%), and the differences were statistically significant. In conclusion, ELF5 interfered with cell cycle of human ovarian carcinoma SKOV3 cells and promoted apoptosis of human ovarian carcinoma SKOV3 cells inhibiting their growth and invasive capacity; and thus providing a new approach to gene treatment of ovarian carcinoma.

Generation and periodontal differentiation of human gingival fibroblasts-derived integration-free induced pluripotent stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yin, Xiaohui; Peking University Stem Cell Research Center and Department of Cell Biology, School of Basic Medical Sciences, Peking University, 38 Xueyuan Road, Beijing 100191; Li, Yang

Induced pluripotent stem cells (iPSCs) have been recognized as a promising cell source for periodontal tissue regeneration. However, the conventional virus-based reprogramming approach is associated with a high risk of genetic mutation and limits their therapeutic utility. Here, we successfully generated iPSCs from readily accessible human gingival fibroblasts (hGFs) through an integration-free and feeder-free approach via delivery of reprogramming factors of Oct4, Sox2, Klf4, L-myc, Lin28 and TP53 shRNA with episomal plasmid vectors. The iPSCs presented similar morphology and proliferation characteristics as embryonic stem cells (ESCs), and expressed pluripotent markers including Oct4, Tra181, Nanog and SSEA-4. Additionally, these cells maintainedmore » a normal karyotype and showed decreased CpG methylation ratio in the promoter regions of Oct4 and Nanog. In vivo teratoma formation assay revealed the development of tissues representative of three germ layers, confirming the acquisition of pluripotency. Furthermore, treatment of the iPSCs in vitro with enamel matrix derivative (EMD) or growth/differentiation factor-5 (GDF-5) significantly up-regulated the expression of periodontal tissue markers associated with bone, periodontal ligament and cementum respectively. Taken together, our data demonstrate that hGFs are a valuable cell source for generating integration-free iPSCs, which could be sequentially induced toward periodontal cells under the treatment of EMD and GDF-5. - Highlights: • Integration-free iPSCs are successfully generated from hGFs via an episomal approach. • EMD promotes differentiation of the hGFs-derived iPSCs toward periodontal cells. • GDF-5 promotes differentiation of the hGFs-derived iPSCs toward periodontal cells. • hGFs-derived iPSCs could be a promising cell source for periodontal regeneration.« less

Analyzing Pseudophosphatase Function.

PubMed

Hinton, Shantá D

2016-01-01

Pseudophosphatases regulate signal transduction cascades, but their mechanisms of action remain enigmatic. Reflecting this mystery, the prototypical pseudophosphatase STYX (phospho-serine-threonine/tyrosine-binding protein) was named with allusion to the river of the dead in Greek mythology to emphasize that these molecules are "dead" phosphatases. Although proteins with STYX domains do not catalyze dephosphorylation, this in no way precludes their having other functions as integral elements of signaling networks. Thus, understanding their roles in signaling pathways may mark them as potential novel drug targets. This chapter outlines common strategies used to characterize the functions of pseudophosphatases, using as an example MK-STYX [mitogen-activated protein kinase (MAPK) phospho-serine-threonine/tyrosine binding], which has been linked to tumorigenesis, apoptosis, and neuronal differentiation. We start with the importance of "restoring" (when possible) phosphatase activity in a pseudophosphatase so that the active mutant may be used as a comparison control throughout immunoprecipitation and mass spectrometry analyses. To this end, we provide protocols for site-directed mutagenesis, mammalian cell transfection, co-immunoprecipitation, phosphatase activity assays, and immunoblotting that we have used to investigate MK-STYX and the active mutant MK-STYXactive. We also highlight the importance of utilizing RNA interference (RNAi) "knockdown" technology to determine a cellular phenotype in various cell lines. Therefore, we outline our protocols for introducing short hairpin RNA (shRNA) expression plasmids into mammalians cells and quantifying knockdown of gene expression with real-time quantitative PCR (qPCR). A combination of cellular, molecular, biochemical, and proteomic techniques has served as powerful tools in identifying novel functions of the pseudophosphatase MK-STYX. Likewise, the information provided here should be a helpful guide to elucidating the function of other pseudophosphatases.

Engineered Saccharomyces cerevisiae strain for improved xylose utilization with a three-plasmid SUMO yeast expression system

USDA-ARS?s Scientific Manuscript database

A three-plasmid yeast expression system utilizing the portable small ubiquitin-like modifier (SUMO) vector set combined with the efficient endogenous yeast protease Ulp1 was developed for production of large amounts of soluble functional protein in Saccharomyces cerevisiae. Each vector has a differ...

Genetic engineering of Lactobacillus diolivorans.

PubMed

Pflügl, Stefan; Marx, Hans; Mattanovich, Diethard; Sauer, Michael

2013-07-01

In this study, we developed a toolbox for genetic manipulation of Lactobacillus diolivorans, a promising production organism for 1,3-propanediol from glycerol. Two major findings play a key role for successful transformation of this organism: (1) the absence of a native plasmid, because a native plasmid is a major obstacle for transformation of L. diolivorans, and (2) the absence of DNA methylation. A suitable expression plasmid, pSHM, for homologous and heterologous protein expression in L. diolivorans was constructed. This plasmid is based on the replication origin repA of L. diolivorans. The native glyceraldehyde-3-phosphate dehydrogenase promoter is used for constitutive expression of the genes of interest. Functional expression of genes in L. diolivorans was shown with two examples: production of green fluorescent protein resulted in a 40- to 60-fold higher fluorescence of the obtained clones compared with the wild-type strain. Finally, the homologous overexpression of a putatively NADPH-dependent 1,3-propanediol oxidoreductase improved 1,3-propanediol production by 20% in batch cultures. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Construction of armored RNA containing long-size chimeric RNA by increasing the number and affinity of the pac site in exogenous rna and sequence coding coat protein of the MS2 bacteriophage.

PubMed

Wei, Baojun; Wei, Yuxiang; Zhang, Kuo; Yang, Changmei; Wang, Jing; Xu, Ruihuan; Zhan, Sien; Lin, Guigao; Wang, Wei; Liu, Min; Wang, Lunan; Zhang, Rui; Li, Jinming

2008-01-01

To construct a one-plasmid expression system of the armored RNA containing long chimeric RNA by increasing the number and affinity of the pac site. The plasmid pET-MS2-pac was constructed with one C-variant pac site, and then the plasmid pM-CR-2C containing 1,891-bp chimeric sequences and two C-variant pac sites was produced. Meanwhile, three plasmids (pM-CR-C, pM-CR-2W and pM-CR-W) were obtained as parallel controls with a different number and affinity of the pac site. Finally, the armored RNA was expressed and purified. The armored RNA with 1,891 bases target RNA was expressed successfully by the one-plasmid expression system with two C-variant pac sites, while for one pac site, no matter whether the affinity was changed or not, only the 1,200 bases target RNA was packaged. It was also found that the C-variant pac site could increase the expression efficiency of the armored RNA. The armored RNA with 1,891-bp exogenous RNA in our study showed the characterization of ribonuclease resistance and stability at different time points and temperature conditions. The armored RNA with 1,891 bases exogenous RNA was constructed and the expression system can be used as a platform for preparation of the armored RNA containing long RNA sequences. Copyright 2008 S. Karger AG, Basel.

Evaluation of the reversal of multidrug resistance by MDR1 ribonucleic acid interference in a human colon cancer model using a Renilla luciferase reporter gene and coelenterazine.

PubMed

Jeon, Yong Hyun; Bae, Seon-ae; Lee, Yong Jin; Lee, You La; Lee, Sang-Woo; Yoon, Ghil-Suk; Ahn, Byeong-Cheol; Ha, Jeoung-Hee; Lee, Jaetae

2010-12-01

The reversal effect of multidrug resistance (MDR1) gene expression by adenoviral vector-mediated MDR1 ribonucleic acid interference was assessed in a human colon cancer animal model using bioluminescent imaging with Renilla luciferase (Rluc) gene and coelenterazine, a substrate for Rluc or MDR1 gene expression. A fluorescent microscopic examination demonstrated an increased green fluorescent protein signal in Ad-shMDR1- (recombinant adenovirus that coexpressed MDR1 small hairpin ribonucleic acid [shRNA] and green fluorescent protein) infected HCT-15/Rluc cells in a virus dose-dependent manner. Concurrently, with an increasing administered virus dose (0, 15, 30, 60, and 120 multiplicity of infection), Rluc activity was significantly increased in Ad-shMDR1-infected HCT-15/Rluc cells in a virus dose-dependent manner. In vivo bioluminescent imaging showed about 7.5-fold higher signal intensity in Ad-shMDR1-infected tumors than in control tumors (p < .05). Immunohistologic analysis demonstrated marked reduction of P-glycoprotein expression in infected tumor but not in control tumor. In conclusion, the reversal of MDR1 gene expression by MDR1 shRNA was successfully evaluated by bioluminescence imaging with Rluc activity using an in vivo animal model with a multidrug resistance cancer xenograft.

GROWTH OF HUMAN PANCREATIC CANCER IS INHIBITED BY DOWN-REGULATION OF GASTRIN GENE EXPRESSION

PubMed Central

Matters, Gail L.; Harms, John F.; McGovern, Christopher O.; Jayakumar, Calpurnia; Crepin, Keisha; Smith, Zachary P.; Nelson, Melissa C.; Stock, Heather; Fenn, Craig W.; Kaiser, James; Kester, Mark; Smith, Jill P.

2009-01-01

Objectives This study evaluated the effects of gastrin mRNA down-regulation on growth of human pancreatic cancer. Methods Gastrin expression was examined in human pancreatic cancer cell lines by RT-PCR and peptide expression was assessed by immunocytochemistry. Gastrin was down-regulated using either stable transfection of an antisense gastrin cDNA or one of three shRNA (short hairpin RNA) constructs. Tumor formation was evaluated following either subcutaneous or orthotopic injections into nude mice. The effect of nanoliposomes loaded with gastrin siRNA was tested in mice bearing pancreatic tumors. Results Stable transfection of gastrin antisense or shRNAs into BxPC-3 cells resulted in clones with >90% reduction in gastrin mRNA. Tumor growth rate and incidence of metastases in both wild type and transfected pancreatic cancer cells was directly proportional to the degrees of gastrin mRNA expression. Immunofluoresence analysis confirmed that gastrin peptide levels were decreased in antisense and shRNA tumors. Gastrin knockdown clones had lower Ki-67 and increased cleaved caspase-3 staining, consistent with known effects of gastrin on proliferation and apoptosis. Tumors in mice treated with gastrin siRNA were smaller than controls. Conclusions These results suggest that RNAi targeting of gastrin could serve as an effective treatment for pancreatic cancer. PMID:19465883

Targeted Elimination of PCDH-PC Expressing Prostate Cancer Cells for Control of Hormone-Resistant Prostate Cancer

DTIC Science & Technology

2009-11-01

expression knockout by shRNAs or antisense oligonucleotides ( ASOs ) might be useful in preventing the development of castration-recurrent prostate...cancer in prostate cancer patients. To this end, we have created functional shRNA vectors and ASOs capable of suppressing PCDH-PC expression and we have...containing PCDH-PC cDNA. Cell extracts were prepared 48 hrs after co-transfection and were electrophoresed on an SDS-PAGE gel and blotted onto a

Effects of Gene Orientation and Use of Multiple Promoters on the Expression of XYL1 and XYL2 in Saccharomyces cerevisiae

NASA Astrophysics Data System (ADS)

Bae, Ju Yun; Laplaza, José; Jeffries, Thomas W.

Orientation of adjacent genes has been reported to affect their expression in eukaryotic systems, and metabolic engineering also often makes repeated use of a few promoters to obtain high expression. To improve transcriptional control in heterologous expression, we examined how these factors affect gene expression and enzymatic activity in Saccharomyces cerevisiae. We assembled d-xylose reductase (XYL1) and d-xylitol dehydrogenase (XYL2) in four ways. Each pair of genes was placed in two different tandem (l→2→ or √1√2), convergent (1→√2), and divergent (√1 2→) orientations in autonomous plasmids. The TEF1 promoter was used to drive XYL1 and the TDH3 promoter to drive XYL2 in each of the constructs. The effects of gene orientation on growth, transcription, and enzyme activity were analyzed. The transcription level as measured by quantitative PCR (q-PCR) correlated with enzyme activities, but our data did not show a significant effect of gene orientation. To test the possible dilution of promoter strength due to multiple use of the same promoter, we examined the level of expression of XYL1 driven by either the TEF1 or TDH3 promoter when carried on a single copy plasmid. We then coexpressed XYL2 from either a single or multicopy plasmid, which was also driven by the same promoter. XYL2 transcript and enzyme expression increased with plasmid copy number, while the expression of XYLl was constant regardless of the number of other TEF1 or TDH3 promoters present in the cell. According to our data, there is no significant effect of gene orientation or multiple promoter use on gene transcription and translation when genes are expressed from plasmids; however, other factors could affect expression of adjacent genes in chromosomes.

[Construction of a plant effective expression vector containing the gene of hepatitis B virus surface antigen].

PubMed

Lin, Bing-Ying; Jin, Zhi-Qiang; Li, Mei

2006-11-01

To construct a plant effective expression vector driven by a fruit specific promoter for the expression of hepatitis B virus surface antigen (HBsAg), to further improve the expression of exogenous gene in plant, and to prepare for the development of an effective anti-hepatitis vaccine. Tomato fruit-specific promoters' gene 2A12 and E8 were respectively introduced to pBPFOmega7 to form pB2A12 and pBE8. The DNA fragment containing HBsAg-s gene from plasmid YEP-HBs was inserted respectively into pB2A12 and pBE8 to form pB2A12-HBs and pBE8-HBs. The fragment containing "p35S+2A12+Omega+HBsAg-s+Tnos" of the pB2A12-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the reconstructed plant binary expression plasmid pCAM2A12-HBs, and the fragment containing "p35S+E8+Omega+HBsAg-s+Tnos" of the pBE8-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the plasmid pCAME8-HBs. The inserted gene HBsAg and fruit-specific promoters in the reconstructed plant binary expression vectors were confirmed by sequencing. Then, pCAM2A12-HBs and pCAME8-HBs were directly introduced into Agrobacterium tumefaciens strain EHA105. Digestion with restriction enzymes proved that all recombinant vectors had the inserts with expected length of the target fragments, and the sequencing results were confirmed correct. In this study, plant expression vector containing HBsAg gene driven by fruit specific promoter and CaMV35s promoter was successfully constructed.

Identification of Essential Genetic Baculoviral Elements for Recombinant Protein Expression by Transactivation in Sf21 Insect Cells.

PubMed

Bleckmann, Maren; Schürig, Margitta; Chen, Fang-Fang; Yen, Zen-Zen; Lindemann, Nils; Meyer, Steffen; Spehr, Johannes; van den Heuvel, Joop

2016-01-01

The Baculovirus Expression Vector System (BEVS) is widely used to produce high amounts of recombinant proteins. Nevertheless, generating recombinant baculovirus in high quality is rather time-consuming and labor-intensive. Alternatively, virus-free expression in insect cells did not achieve similar expression levels for most proteins so far. The transactivation method is a promising approach for protein expression in Sf21 cells. It combines advantages of BEVS and plasmid-based expression by activating strong virus-dependent promoters on a transfected plasmid by baculoviral coinfection. Here, we identified expression elements required for transactivation. Therefore, we designed several vectors comprising different viral promoters or promoter combinations and tested them for eGFP expression using the automated BioLector microcultivation system. Remarkably, only the combination of the very late promoter p10 together with the homologous region 5 (hr5) could boost expression during transactivation. Other elements, like p10 alone or the late viral promoter polH, did not respond to transactivation. A new combination of hr5 and p10 with the strongest immediate early OpMNPV viral promoter OpIE2 improved the yield of eGFP by ~25% in comparison to the previous applied hr5-IE1-p10 expression cassette. Furthermore, we observed a strong influence of the transcription termination sequence and vector backbone on the level of expression. Finally, the expression levels for transactivation, BEVS and solely plasmid-based expression were compared for the marker protein eGFP, underlining the potential of transactivation for fast recombinant protein expression in Sf21 cells. In conclusion, essential elements for transactivation could be identified. The optimal elements were applied to generate an improved vector applicable in virus-free plasmid-based expression, transactivation and BEVS.

E6 and E7 gene silencing results in decreased methylation of tumor suppressor genes and induces phenotype transformation of human cervical carcinoma cell lines

PubMed Central

Long, Jia; Shen, Danbei; Zhou, Wuqing; Zhou, Qiyan; Yang, Jia; Jiang, Mingjun

2015-01-01

In SiHa and CaSki cells, E6 and E7-targeting shRNA specifically and effectively knocked down human papillomavirus (HPV) 16 E6 and E7 at the transcriptional level, reduced the E6 and E7 mRNA levels by more than 80% compared with control cells that expressed a scrambled-sequence shRNA. E6 and E7 repression resulted in down-regulation of DNA methyltransferase mRNA and protein expression, decreased DNA methylation and increased mRNA expression levels of tumor suppressor genes, induced a certain apoptosis and inhibited proliferation in E6 and E7 shRNA-infected SiHa and CaSki cells compared with the uninfected cells. Repression of E6 and E7 oncogenes resulted in restoration of DNA methyltransferase suppressor pathways and induced apoptosis in HPV16-positive cervical carcinoma cell lines. Our findings suggest that the potential carcinogenic mechanism of HPV16 through influencing DNA methylation pathway to activate the development of cervical cancer exist, and maybe as a candidate therapeutic strategy for cervical and other HPV-associated cancers. PMID:26329329

Cationic microparticle [poly(D,L-lactide-co-glycolide)]-coated DNA vaccination induces a long-term immune response against foot and mouth disease in guinea pigs.

PubMed

Reddy, Kotla S; Rashmi, Brabhi R; Dechamma, Hosur J; Gopalakrishna, Susarla; Banumathi, N; Suryanarayana, Veluvarthy V S; Reddy, Golla R

2012-05-01

Foot and mouth disease (FMD) can be controlled by regular vaccination and restriction of the movement of infected animals in the endemic countries. Although presently used, tissue culture inactivated vaccine gives protection, it has several limitations, including a short duration of immunity. DNA vaccine delivered through microparticles could comprise an alternative approach to conventional vaccine when aiming to circumvent these limitations. We constructed the expression plasmid (pVAC-1D) containing 1D gene FMD virus serotype Asia 1. Poly(D,L-lactide-co-glycolide) (PLG) microparticles were prepared and coated with the pVAC-1D plasmid. Guinea pigs were vaccinated with PLG-coated and naked DNA vaccine constructs intramuscularly. The humoral response was measured by an enzyme-linked immunosorbent assay (ELISA) and the serum neutralization test (SNT). Analysis of the persistence and the expression of pVAC-1D plasmid construct was carried out by quantitative polymerase chain reaction (qPCR). The humoral response lasted for 1 year, as measured by ELISA and SNT. Analysis of the persistence and the expression of pVAC-1D plasmid construct by qPCR has shown that pVAC-1D expression was seen for a longer duration compared to the naked DNA vaccine. Microparticles coated plasmid DNA-injected guinea pigs were protected when challenged with FMD virus. The present study has shown that the delivery of plasmid coated on cationic PLG microparticles enhance the duration of immunity of the DNA vaccine constructs. Copyright © 2012 John Wiley & Sons, Ltd.

Incorporation of aptamers in the terminal loop of shRNAs yields an effective and novel combinatorial targeting strategy.

PubMed

Pang, Ka Ming; Castanotto, Daniela; Li, Haitang; Scherer, Lisa; Rossi, John J

2018-01-09

Gene therapy by engineering patient's own blood cells to confer HIV resistance can potentially lead to a functional cure for AIDS. Toward this goal, we have previously developed an anti-HIV lentivirus vector that deploys a combination of shRNA, ribozyme and RNA decoy. To further improve this therapeutic vector against viral escape, we sought an additional reagent to target HIV integrase. Here, we report the development of a new strategy for selection and expression of aptamer for gene therapy. We developed a SELEX protocol (multi-tag SELEX) for selecting RNA aptamers against proteins with low solubility or stability, such as integrase. More importantly, we expressed these aptamers in vivo by incorporating them in the terminal loop of shRNAs. This novel strategy allowed efficient expression of the shRNA-aptamer fusions that targeted RNAs and proteins simultaneously. Expressed shRNA-aptamer fusions targeting HIV integrase or reverse transcriptase inhibited HIV replication in cell cultures. Viral inhibition was further enhanced by combining an anti-integrase aptamer with an anti-HIV Tat-Rev shRNA. This construct exhibited efficacy comparable to that of integrase inhibitor Raltegravir. Our strategy for the selection and expression of RNA aptamers can potentially extend to other gene therapy applications. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

SHRNA SILENCING OF AS3MT EXPRESSION MINIMIZES ARSENIC METHYLATION CAPACITY OF HEPG2 CELLS

EPA Science Inventory

Several methyltransferases have been shown to catalyze the oxidative methylation of inorganic arsenic (iAs) in mammalian species. However, the relative contributions of these enzymes to the overall capacity of cells to methylate iAs have not been characterized. Arsenic (+3 oxidat...

An essential role of Nrf2 in American ginseng-mediated anti-oxidative actions in cardiomyocytes.

PubMed

Li, Jinqing; Ichikawa, Tomonaga; Jin, Yu; Hofseth, Lorne J; Nagarkatti, Prakash; Nagarkatti, Mitzi; Windust, Anthony; Cui, Taixing

2010-07-20

Ginseng has been used as a folk medicine for thousands of years in Asia, and has become a popular herbal medicine world-wide. Recent studies have revealed that ginseng, including American ginseng, exerts antioxidant effects in the cardiovascular system; however, the underlying mechanisms are not fully understood. Thus, we investigated role of Nrf2, a master transcription factor of endogenous anti-oxidative defense systems, in the regulation of American ginseng-mediated anti-oxidative actions in cardiomyocytes. A standardized crude extract of American ginseng was supplied by the National Research Council of Canada, Institute for National Measurement Standards. H9C2 cells, a rat cardiomyocyte cell line, were exposed to angiotensin II (Ang II) or tumor necrosis factor alpha (TNFalpha) to induce oxidative stress that was examined by measuring formation of reactive oxygen and nitrogen species. Oxidative stress-induced cell death was induced by exogenous addition of hydrogen peroxide (H(2)O(2)). Proteins were measured by Western blot and mRNA expression was determined by quantitative real time PCR. Nrf2-driven transcriptional activity was assessed by antioxidant response element (ARE)-luciferase reporter assay. Direct Nrf2 binding to its target gene promoters was determined by chromatin immunoprecipitation assay. Adenoviral over-expression of Nrf2 shRNA was utilized to knock down Nrf2 in H9C2 cells. Immunochemical staining was applied for Nrf2 expression in the heart. American ginseng induced dramatic increases in Nrf2 protein expression, Nrf2 nuclear translocation, Nrf2 transcriptional activity, direct Nrf2 binding to its target gene promoters, and expression of a group of anti-oxidative genes driven by Nrf2 in H9C2 cells. In addition, American ginseng inhibited Ang II- or TNFalpha-induced free radical formation and H(2)O(2)-induced cell death in H9C2 cells over-expressed with control shRNA but not in the cells over-expressed with Nrf2 shRNA. Finally, oral administration of American ginseng markedly increased Nrf2 activity in murine hearts. These results demonstrate that American ginseng suppresses oxidative stress and oxidative stress-induced cell death in cardiomyocytes through activating the Nrf2 pathway, thereby providing cardioprotection against pathological cardiac remodeling. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

Expression of Duplicate msa Genes in the Salmonid Pathogen Renibacterium salmoninarum

PubMed Central

Rhodes, Linda D.; Coady, Alison M.; Strom, Mark S.

2002-01-01

Renibacterium salmoninarum is a gram-positive bacterium responsible for bacterial kidney disease of salmon and trout. R. salmoninarum has two identical copies of the gene encoding major soluble antigen (MSA), an immunodominant, extracellular protein. To determine whether one or both copies of msa are expressed, reporter plasmids encoding a fusion of MSA and green fluorescent protein controlled by 0.6 kb of promoter region from msa1 or msa2 were constructed and introduced into R. salmoninarum. Single copies of the reporter plasmids integrated into the chromosome by homologous recombination. Expression of mRNA and protein from the integrated plasmids was detected, and transformed cells were fluorescent, demonstrating that both msa1 and msa2 are expressed under in vitro conditions. This is the first report of successful transformation and homologous recombination in R. salmoninarum. PMID:12406741

Biological effects of RNAi targeted inhibiting Tiam1 gene expression on cholangiocarcinoma cells.

PubMed

Cheng, Wei; Liu, Yaling; Zuo, Zhi; Yin, Xinmin; Jiang, Bo; Chen, Daojin; Peng, Chuang; Yang, Jianhui

2015-01-01

To investigate the characteristics of Tiam1 gene expression in human cholangiocarcinoma tissues and benign bile duct tissues, and to analyze the correlations between Tiam1 gene expression and the degree of tumor differentiation, invasive and metastatic abilities. To explore the effect of targeted inhibiting Tiam1 gene expression on proliferation and migration activity of human cholangiocarcinoma cells. Expression of Tiam1 in 83 cases of cholangiocarcinoma tissues and 25 cases of benign bile tissues was detected using immunohistochemistry. The clinical data of patients with cholangiocarcinoma were collected. The correlations between Tiam1 gene expression and the clinicopathologic features in patients with cholangiocarcinoma were analyzed. The human cholangiocarcinoma RBE cells were divided into 3 groups. Cells in experimental group and control group were respectively transfected with Tiam1 shRNA lentiviral vectors and negative shRNA lentiviral control vectors. Cells in blank group received no treatment. Real-time PCR endogenesis was used to verify Tiam1 gene expression. Cell cycle experiments and MTT assay were used to measure cell proliferation activity. Transwell test was used to detect cell migration activity. The negative rate Tiam1 protein expression in cholangiocarcinoma tissues was significantly higher than that in benign bile tissues (P<0.001). Tiam1 protein expression in cholangiocarcinoma tissues had correlations with cholangiocarcinoma differentiation degree, TNM stage and lymph node metastasis (P<0.05), and had no significant correlations with gender, age and distant metastasis (P>0.05). Real-time PCR detection indicated that Tiam1 expression of experimental group was significantly lower than that in control group and blank group (P<0.05), demonstrating that Tiam1 shRNA was effective on Tiam1 gene silencing in RBE cells. Cell cycle experiment showed that the percentage of S phase in cell cycle in experimental group was lower than that in control group and blank group (P<0.05), demonstrating that after the down-regulation of Tiam1 gene expression, the speed of cell proliferation was inhibited. MTT assay results showed that the total growth speed in experimental group was significantly lower than that in control group and blank group (P<0.05), indicating that the proliferation activity of cholangiocarcinoma cells was inhibited after targeted inhibition of Tiam1 gene expression. Transwell detection results showed that the metastasis rate in experimental group was significantly lower than that in control group and blank group (P<0.05), demonstrating that targeted inhibition of Tiam1 gene expression could significantly inhibit migration ability of RBE cells. Tiam1 expression significantly increased in cholangiocarcinoma tissues, and increased along with the degree of malignancy of cholangiocarcinoma. Targeted silencing Tiam1 expression could inhibit proliferation and migration activity of cholangiocarcinoma cells.

Biological effects of RNAi targeted inhibiting Tiam1 gene expression on cholangiocarcinoma cells

PubMed Central

Cheng, Wei; Liu, Yaling; Zuo, Zhi; Yin, Xinmin; Jiang, Bo; Chen, Daojin; Peng, Chuang; Yang, Jianhui

2015-01-01

Objective: To investigate the characteristics of Tiam1 gene expression in human cholangiocarcinoma tissues and benign bile duct tissues, and to analyze the correlations between Tiam1 gene expression and the degree of tumor differentiation, invasive and metastatic abilities. To explore the effect of targeted inhibiting Tiam1 gene expression on proliferation and migration activity of human cholangiocarcinoma cells. Methods: Expression of Tiam1 in 83 cases of cholangiocarcinoma tissues and 25 cases of benign bile tissues was detected using immunohistochemistry. The clinical data of patients with cholangiocarcinoma were collected. The correlations between Tiam1 gene expression and the clinicopathologic features in patients with cholangiocarcinoma were analyzed. The human cholangiocarcinoma RBE cells were divided into 3 groups. Cells in experimental group and control group were respectively transfected with Tiam1 shRNA lentiviral vectors and negative shRNA lentiviral control vectors. Cells in blank group received no treatment. Real-time PCR endogenesis was used to verify Tiam1 gene expression. Cell cycle experiments and MTT assay were used to measure cell proliferation activity. Transwell test was used to detect cell migration activity. Results: The negative rate Tiam1 protein expression in cholangiocarcinoma tissues was significantly higher than that in benign bile tissues (P<0.001). Tiam1 protein expression in cholangiocarcinoma tissues had correlations with cholangiocarcinoma differentiation degree, TNM stage and lymph node metastasis (P<0.05), and had no significant correlations with gender, age and distant metastasis (P>0.05). Real-time PCR detection indicated that Tiam1 expression of experimental group was significantly lower than that in control group and blank group (P<0.05), demonstrating that Tiam1 shRNA was effective on Tiam1 gene silencing in RBE cells. Cell cycle experiment showed that the percentage of S phase in cell cycle in experimental group was lower than that in control group and blank group (P<0.05), demonstrating that after the down-regulation of Tiam1 gene expression, the speed of cell proliferation was inhibited. MTT assay results showed that the total growth speed in experimental group was significantly lower than that in control group and blank group (P<0.05), indicating that the proliferation activity of cholangiocarcinoma cells was inhibited after targeted inhibition of Tiam1 gene expression. Transwell detection results showed that the metastasis rate in experimental group was significantly lower than that in control group and blank group (P<0.05), demonstrating that targeted inhibition of Tiam1 gene expression could significantly inhibit migration ability of RBE cells. Conclusion: Tiam1 expression significantly increased in cholangiocarcinoma tissues, and increased along with the degree of malignancy of cholangiocarcinoma. Targeted silencing Tiam1 expression could inhibit proliferation and migration activity of cholangiocarcinoma cells. PMID:26884821

A novel immunization method to induce cytotoxic T-lymphocyte responses (CTL) against plasmid-encoded herpes simplex virus type-1 glycoprotein D.

PubMed

Cruz, P E; Khalil, P L; Dryden, T D; Chiou, H C; Fink, P S; Berberich, S J; Bigley, N J

1999-03-05

DNA molecules complexed with an asialoglycoprotein-polycation conjugate, consisting of asialoorosomucoid (ASOR) coupled to poly-L-lysine, can enter hepatocytes which bear receptors for ASOR. We used this receptor-mediated DNA delivery system to deliver plasmid DNA encoding glycoprotein D (gD) of herpes simplex virus type 1 to ASOR-positive cells. Maximum expression of gD protein was seen at 3 days after injection of this preparation in approximately 13% of cells from BALB/c mice [hepatocytes from mice injected intravenously (i.v.) or peritoneal exudate cells from mice injected intraperitoneally (i.p.)]. In comparison with mice injected with either the plasmid vector alone or the gD-containing plasmid uncomplexed to ASOR, mice immunized with gD-containing plasmid complexed with ASOR-poly-L-lysine induced marked antigen-specific CTL responses. BALB/c mice immunized with gD-DNA developed a T-cell-mediated CTL response against target cells expressing gD and MHC class II glycoproteins, but not against cells expressing only gD and MHC class I molecules. In C3H mice, gD-DNA induced a T-cell-mediated CTL response against target cells expressing gD and class I MHC molecules. Serum anti-gD antibody in low titers were produced in both strains of mice. DNA complexed with ASOR-poly-L-lysine induced CTL responses in mice.

Directly transforming PCR-amplified DNA fragments into plant cells is a versatile system that facilitates the transient expression assay.

PubMed

Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan

2013-01-01

A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.

Directly Transforming PCR-Amplified DNA Fragments into Plant Cells Is a Versatile System That Facilitates the Transient Expression Assay

PubMed Central

Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan

2013-01-01

A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926

Intracellular integration of synthetic nanostructures with viable cells for controlled biochemical manipulation

NASA Astrophysics Data System (ADS)

McKnight, Timothy E.; Melechko, Anatoli V.; Griffin, Guy D.; Guillorn, Michael A.; Merkulov, Vladimir I.; Serna, Francisco; Hensley, Dale K.; Doktycz, Mitchel J.; Lowndes, Douglas H.; Simpson, Michael L.

2003-05-01

We demonstrate the integration of vertically aligned carbon nanofibre (VACNF) elements with the intracellular domains of viable cells for controlled biochemical manipulation. Deterministically synthesized VACNFs were modified with either adsorbed or covalently-linked plasmid DNA and were subsequently inserted into cells. Post insertion viability of the cells was demonstrated by continued proliferation of the interfaced cells and long-term (> 22 day) expression of the introduced plasmid. Adsorbed plasmids were typically desorbed in the intracellular domain and segregated to progeny cells. Covalently bound plasmids remained tethered to nanofibres and were expressed in interfaced cells but were not partitioned into progeny, and gene expression ceased when the nanofibre was no longer retained. This provides a method for achieving a genetic modification that is non-inheritable and whose extent in time can be directly and precisely controlled. These results demonstrate the potential of VACNF arrays as an intracellular interface for monitoring and controlling subcellular and molecular phenomena within viable cells for applications including biosensors, in vivo diagnostics, and in vivo logic devices.

Expression of human growth hormone by the eukaryotic alga, Chlorella.

PubMed

Hawkins, R L; Nakamura, M

1999-06-01

A method to use Chlorella to express a recombinant heterologous protein that can be recovered from the extracellular medium has been developed. Plasmids are constructed with an extracellular secretion signal sequence inserted between a promoter region and a gene for human growth hormone (hGH). The plasmids also contain a Kanr region which confers resistance to the antibiotic G418. Protoplasts are prepared by enzymatic treatment, and the plasmid is introduced by incubation of the protoplasts with polyethylene glycol and dimethyl sulfoxide. Cells are then grown in the presence of G418, and the medium is collected from 6 days after transfection. hGH is measured by immunoassay, and values for expressed hGH of about 200-600 ng/ml are obtained.

Caffeine and rolipram affect Smad signalling and TGF-β1 stimulated CTGF and transgelin expression in lung epithelial cells.

PubMed

Fehrholz, Markus; Speer, Christian P; Kunzmann, Steffen

2014-01-01

Caffeine administration is an important part of the therapeutic treatment of bronchopulmonary dysplasia (BPD) in preterm infants. However, caffeine mediated effects on airway remodelling are still undefined. The TGF-β/Smad signalling pathway is one of the key pathways involved in airway remodelling. Connective tissue growth factor (CTGF), a downstream mediator of TGF-β, and transgelin, a binding and stabilising protein of the cytoskeleton, are both regulated by TGF-β1 and play an important role in airway remodelling. Both have also been implicated in the pathogenesis of BPD. The aim of the present study was to clarify whether caffeine, an unspecific phosphodiesterase (PDE) inhibitor, and rolipram, a prototypical PDE-4 selective inhibitor, were both able to affect TGF-β1-induced Smad signalling and CTGF/transgelin expression in lung epithelial cells. Furthermore, the effect of transgelin knock-down on Smad signalling was studied. The pharmacological effect of caffeine and rolipram on Smad signalling was investigated by means of a luciferase assay via transfection of a TGF-β1-inducible reporter plasmid in A549 cells. The regulation of CTGF and transgelin expression by caffeine and rolipram were studied by promoter analysis, real-time PCR and Western blot. Endogenous transgelin expression was down-regulated by lentiviral transduction mediating transgelin-specific shRNA expression. The addition of caffeine and rolipram inhibited TGF-β1 induced reporter gene activity in a concentration-related manner. They also antagonized the TGF-β1 induced up-regulation of CTGF and transgelin on the promoter-, the mRNA-, and the protein-level. Functional analysis showed that transgelin silencing reduced TGF-β1 induced Smad-signalling and CTGF induction in lung epithelial cells. The present study highlights possible new molecular mechanisms of caffeine and rolipram including an inhibition of Smad signalling and of TGF-β1 regulated genes involved in airway remodelling. An understanding of these mechanisms might help to explain the protective effects of caffeine in prevention of BPD and suggests rolipram to be a potent replacement for caffeine.

Plasmid analyses in clinical isolates of Bacteroides fragilis and other Bacteroides species.

PubMed Central

Wallace, B L; Bradley, J E; Rogolsky, M

1981-01-01

Plasmid analyses were performed on Bacteroides strains isolated from clinical specimens. Of 32 Bacteroides strains, 8 were found to contain plasmids. Seven of these eight strains were B. fragilis, and the other one was B. distasonis. Three of these eight strains harbored only a 3.0-megadalton plasmid. Two strains had only a 2.0-megadalton plasmid, and one had 2.0-, 3.0-megadalton plasmid. Of the remaining two strains, one had 2.0-, 3.0-, and 5.0-megadalton plasmids, and the other had 3.0- and 5.0-megadalton plasmids. Beta-Lactamase was produced by 93% of the clinical isolates. Seven of the eight plasmid-carrying strains were cadmium resistant, five were zinc resistant, four were mercury resistant, and two expressed a brick-red fluorescence under ultraviolet light. None of these traits could be associated with a plasmid after performing either curing experiments or genetic transfer experiments by cell-to-cell contact. Images PMID:6974737

Transfected Cell Microarrays for the Expression of Membrane-Displayed Single-Chain Antibodies

DTIC Science & Technology

2011-01-01

v) yeast extract, 0.005% (w/v) NaCl, and 50 μg/ml kanamycin. The broth was stored at 4◦C for up to 3 months. 4. QIAGEN Plasmid Midi kit (Qiagen) or...ampi- cillin. The broth was stored at 4◦C for up to 3 months. 16. QIAprep spin miniprep kit and QIAGEN Plasmid Midi kit (Qiagen) or PureYield Plasmid...was stored at 4◦C for up to 3 months. 8. QIAGEN Plasmid Midi kit (Qiagen) or PureYield Plasmid Midiprep System (Promega Corp.) was stored at room tem

Interleukin-6-driven progranulin expression increases cholangiocarcinoma growth by an Akt-dependent mechanism.

PubMed

Frampton, Gabriel; Invernizzi, Pietro; Bernuzzi, Francesca; Pae, Hae Yong; Quinn, Matthew; Horvat, Darijana; Galindo, Cheryl; Huang, Li; McMillin, Matthew; Cooper, Brandon; Rimassa, Lorenza; DeMorrow, Sharon

2012-02-01

Cholangiocarcinoma is a devastating cancer of biliary origin with limited treatment options. The growth factor, progranulin, is overexpressed in a number of tumours. The study aims were to assess the expression of progranulin in cholangiocarcinoma and to determine its effects on tumour growth. The expression and secretion of progranulin were evaluated in multiple cholangiocarcinoma cell lines and in clinical samples from patients with cholangiocarcinoma. The role of interleukin 6 (IL-6)-mediated signalling in the expression of progranulin was assessed using a combination of specific inhibitors and shRNA knockdown techniques. The effect of progranulin on proliferation and Akt activation and subsequent effects of FOXO1 phosphorylation were assessed in vitro. Progranulin knockdown cell lines were established, and the effects on cholangiocarcinoma growth were determined. Progranulin expression and secretion were upregulated in cholangiocarcinoma cell lines and tissue, which were in part via IL-6-mediated activation of the ERK1/2/RSK1/C/EBPβ pathway. Blocking any of these signalling molecules, by either pharmacological inhibitors or shRNA, prevented the IL-6-dependent activation of progranulin expression. Treatment of cholangiocarcinoma cells with recombinant progranulin increased cell proliferation in vitro by a mechanism involving Akt phosphorylation leading to phosphorylation and nuclear extrusion of FOXO1. Knockdown of progranulin expression in cholangiocarcinoma cells decreased the expression of proliferating cellular nuclear antigen, a marker of proliferative capacity, and slowed tumour growth in vivo. Evidence is presented for a role for progranulin as a novel growth factor regulating cholangiocarcinoma growth. Specific targeting of progranulin may represent an alternative for the development of therapeutic strategies.

[Knockdown of dopamine receptor D2 upregulates the expression of adiogenic genes in mouse primary mesencephalic neurons].

PubMed

Ding, Jiaqi; Chen, Xiaoli; Lin, Jiaji; Zhu, Junling; Li, Zhuyi

2018-01-01

Objective To study the effects of dopamine receptor D2 (DRD2) on the adipogenesis genes in mouse primary mesencephalic neurons. Methods The lentiviral vectors which expressed specific shRNA targeting DRD2 were constructed to decrease DRD2 expression in mouse primary mesencephalic neurons. High throughput sequencing (HTS) analysis was used to investigate gene expression changes between the DRD2 knock-down group and the negative control group. Real-time quantitative PCR (qRT-PCR) and Western blot analysis were applied to verify the differently expressed genes. Fatty acids were measured by fatty acid detection kit. Results DRD2 expression was effectively down-regulated in mouse primary mesencephalic neurons by lentiviral vectors. HTS revealed adipogenesis genes were significantly up-regulated after DRD2 down-regulation, mainly including delta(14)-sterol reductase, acetyl-coenzyme A synthetase, insulin-induced gene 1 protein and especially stearoyl-coenzyme A desaturase 1 (SCD1, 4-fold upregulated). The qRT-PCR and Western blot analysis verified that SCD1 was upregulated 2.6 folds and 2 folds respectively by lentiviral DRD2-shRNA vectors. Moreover, the SCD1-related free fatty acids were significantly more increased than the negative control group. Conclusion DRD2 in primary mesencephalic neurons had a significant regulative effect on the adipogenesis genes. The up-regulation of SCD1 can accelerate the conversion of saturated fatty acids to monounsaturated fatty acids and prevent the damage of lipid toxicity to cells.

Effects of RNAi-mediated MUC4 gene silencing on the proliferation and migration of human pancreatic carcinoma BxPC-3 cells.

PubMed

Li, Yong; Wu, Changqiang; Chen, Tianwu; Zhang, Juanjuan; Liu, Gang; Pu, Yu; Zhu, Jiang; Shen, Chengyi; Zhang, Yang; Zeng, Nanlin; Zhang, Xiaoming

2016-12-01

It was previously demonstrated that mucin 4 (MUC4) is not expressed in normal pancreatic tissues or in chronic pancreatitis tissue but is highly expressed in pancreatic cancer (PC) tissue. Effective MUC4 gene knockdown in PC may contribute to the elucidation of pancreatic tumor development and metastasis, and may be valuable in new therapeutic approaches. Thus to confirm this, in the present study, the BxPC-3 cell line was transfected with eight pairs of shRNA lentiviral vectors for MUC4. The qPCR results showed that expression of MUC4 mRNA in the BxPC-3 cells was significantly decreased at 96 h after transfection. One of these shRNA lentiviral vectors (shRNA‑A141) had showed the strongest suppressive effect on MUC4 mRNA expression and was used for MUC4 knockdown in BxPC-3 cells. After stable transfection, BxPC-3 cells showed a significantly lower expression of MUC4 mRNA and MUC4 protein, and were suppressed on cell growth and migration. In vivo, lower tumor growth rates and tumor volume were observed in the tumors derived from the MUC4-knockdown cells, whereas the transplanted tumors derived from the control group cells, grew rapidly. Thus, inhibition of MUC4 expression may be an effective means for mitigating metastasis and invasion of PC.

Knockdown of RhoA expression alters ovarian cancer biological behavior in vitro and in nude mice.

PubMed

Wang, Xiaoxia; Jiang, Wenyan; Kang, Jiali; Liu, Qicai; Nie, Miaoling

2015-08-01

RhoA regulates cell proliferation, migration, angiogenesis and gene expression. Altered RhoA activity contributes to cancer progression. The present study investigated the effects of RhoA knockdown on the regulation of ovarian cancer biological behavior in vitro and in nude mice. The expression of RhoA was knocked down using a lentivirus carrying RhoA short hairpin RNA (shRNA) in ovarian cancer cells and was confirmed by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blot analysis. The altered ovarian cancer biological behaviors were assayed by cell viability, terminal deoxynucleotidyltransferase-mediated dUTP nick end-labeling (TUNEL), migration, invasion, and nude mice tumorigenicity assays, while the altered gene expression was detected by RT-qPCR and western blot analysis. The results showed that lentivirus-carrying RhoA shRNA significantly suppressed RhoA expression in ovarian cancer cells, which suppressed tumor cell viability, migration, invasion and adhesion in vitro. RhoA silencing also inhibited the tumorigenicity of ovarian cancer cells in nude mice, which was characterized by the suppression of tumor xenograft formation and growth and induction of tumor cell apoptosis. The results of the present study demonstrated that knockdown of RhoA expression had a significant antitumor effect on ovarian cancer cells in vitro and in nude mice, suggesting that RhoA may be a target for the development of a novel therapeutic strategy in the control of ovarian cancer.

Enhanced expression of cro-beta-galactosidase fusion proteins under the control of the PR promoter of bacteriophage lambda.

PubMed Central

Zabeau, M; Stanley, K K

1982-01-01

Hybrid plasmids carrying cro-lacZ gene fusions have been constructed by joining DNA segments carrying the PR promoter and the start of the cro gene of bacteriophage lambda to the lacZ gene fragment carried by plasmid pLG400 . Plasmids in which the translational reading frames of the cro and lacZ genes are joined in-register (type I) direct the synthesis of elevated levels of cro-beta-galactosidase fusion protein amounting to 30% of the total cellular protein, while plasmids in which the genes are fused out-of-register (type II) produce a low level of beta-galactosidase protein. Sequence rearrangements downstream of the cro initiator AUG were found to influence the efficiency of translation, and have been correlated with alterations in the RNA secondary structure of the ribosome-binding site. Plasmids which direct the synthesis of high levels of beta-galactosidase are conditionally lethal and can only be propagated when the PR promoter is repressed. Deletion of sequences downstream of the lacZ gene restored viability, indicating that this region of the plasmid encodes a function which inhibits the growth of the cells. The different applications of these plasmids for expression of cloned genes are discussed. Images Fig. 6. PMID:6327257

Blood-brain barrier transport of non-viral gene and RNAi therapeutics.

PubMed

Boado, Ruben J

2007-09-01

The development of gene- and RNA interference (RNAi)-based therapeutics represents a challenge for the drug delivery field. The global brain distribution of DNA genes, as well as the targeting of specific regions of the brain, is even more complicated because conventional delivery systems, i.e. viruses, have poor diffusion in brain when injected in situ and do not cross the blood-brain barrier (BBB), which is only permeable to lipophilic molecules of less than 400 Da. Recent advances in the "Trojan Horse Liposome" (THL) technology applied to the transvascular non-viral gene therapy of brain disorders presents a promising solution to the DNA/RNAi delivery obstacle. The THL is comprised of immunoliposomes carrying either a gene for protein replacement or small hairpin RNA (shRNA) expression plasmids for RNAi effect, respectively. The THL is engineered with known lipids containing polyethyleneglycol (PEG), which stabilizes its structure in vivo in circulation. The tissue target specificity of THL is given by conjugation of approximately 1% of the PEG residues to peptidomimetic monoclonal antibodies (MAb) that bind to specific endogenous receptors (i.e. insulin and transferrin receptors) located on both the BBB and the brain cellular membranes, respectively. These MAbs mediate (a) receptor-mediated transcytosis of the THL complex through the BBB, (b) endocytosis into brain cells and (c) transport to the brain cell nuclear compartment. The present review presents an overview of the THL technology and its current application to gene therapy and RNAi, including experimental models of Parkinson's disease and brain tumors.

Plasmid DNA production combining antibiotic-free selection, inducible high yield fermentation, and novel autolytic purification.

PubMed

Carnes, Aaron E; Hodgson, Clague P; Luke, Jeremy M; Vincent, Justin M; Williams, James A

2009-10-15

DNA vaccines and gene medicines, derived from bacterial plasmids, are emerging as an important new class of pharmaceuticals. However, the challenges of performing cell lysis processes for plasmid DNA purification at an industrial scale are well known. To address downstream purification challenges, we have developed autolytic Escherichia coli host strains that express endolysin (phage lambdaR) in the cytoplasm. Expression of the endolysin is induced during fermentation by a heat inducible promoter. The endolysin remains in the cytoplasm, where it is separated from its peptidoglycan substrate in the cell wall; hence the cells remain alive and intact and can be harvested by the usual methods. The plasmid DNA is then recovered by autolytic extraction under slightly acidic, low salt buffer conditions and treatment with a low concentration of non-ionic detergent. Under these conditions the E. coli genomic DNA remains associated with the insoluble cell debris and is removed by a solid-liquid separation. Here, we report fermentation, lysis methods, and plasmid purification using autolytic hosts.

In vitro transfection of plasmid DNA by amine derivatives of gelatin accompanied with ultrasound irradiation.

PubMed

Hosseinkhani, Hossein; Aoyama, Ternyoshi; Yamamoto, Shingo; Ogawa, Osamu; Tabata, Yasuhiko

2002-10-01

The purpose of this study is to examine the ultrasound (US)-enhanced gene expression by the complexes of a plasmid DNA with gelatin derivatives of aminization. Gelatin derivatives with different introduced extents of ethylenediamine (Ed), spermidine (Sd), and spermine (Sm) were prepared with a water-soluble carbodiimide. The molecular size and zeta potential of the gelatin derivatives before and after complexation with the plasmid DNA were examined. After incubation with the complexes with or without US exposure, the DNA expression of rat gastric mucosal cells was measured to evaluate the effect of the type of gelatin derivatives on their gene expression. The cell uptake of the complexes, the cell viability, and the buffering effect of gelatin derivatives were examined. The apparent molecular size and zeta potential of gelatin derivatives became larger as their aminization extent increased although the Sm gelatin derivative of higher aminization showed a larger value than other corresponding derivatives. Irrespective of the type of gelatin derivatives, the apparent molecular size of plasmid DNA was reduced by increasing the gelatin-DNA mixing ratio to attain a saturated value of about 150 nm. The condensed gelatin-DNA complexes showed the zeta potential of 10-15 mV. The cells incubated with the complex exhibited significantly stronger luciferase activities than free plasmid DNA, and the activity was further enhanced by US irradiation. The enhancement was significant for the Sm derivative compared with the corresponding Ed and Sd derivatives. The amount of plasmid DNA internalized into the cells was significantly increased by the complexation with every gelatin derivative, whereas US irradiation did not significantly increase the DNA internalization. US irradiation had no effect on the viability of cells incubated with every gelatin derivative-plasmid DNA complex, although the viability was decreased by the complex incubation. The buffering capacity of Sm derivative was higher than that of Ed and Sd derivatives and comparable with that of polyethylene amine. Among amine derivatives of gelatin, the Sm derivative enabled the plasmid DNA to induce the US-enhanced gene expression of cells in vitro most effectively because of the superior buffering effect.

Influence of silencing soluble epoxide hydrolase with RNA interference on cardiomyocytes apoptosis induced by doxorubicin.

PubMed

Du, Guangsheng; Lv, Jiagao; He, Li; Ma, Yexin

2011-06-01

In order to investigate the influence of silencing soluble epoxide hydrolase (sEH) with double-stranded small interfering RNA (siRNA) on cardiomyocytes apoptosis induced by doxorubicin (DOX), two plasmids containing siRNA sequences specific to sEH were constructed and transfected into the primary cultured cardiomyocytes by using FuGENE HD transfection agents. The mRNA and protein expression levels of sEH were detected by semiquantitative RT-PCR and Western blotting respectively, and the plasmids that silenced sEH most significantly were selected, and renamed EH-R. The plasmids carrying a nonspecific siRNA coding sequence (PCN) served as the negative control. Cardiomyocytes were divided into four groups: control group, DOX group, PCN+DOX group, and EH-R+DOX group. Apoptosis of cardiomyocytes was induced by DOX at a concentration of 1 μmol/L. Apoptosis rate of cardiomyocytes was determined by flow cytometery. The protein expression levels of Bcl-2 and Bax were detected by Western blotting. The results showed that the expression of sEH was down-regulated by EH-R plasmid. The expression levels of sEH mRNA and protein in the EH-R+DOX group were significantly decreased as compared with other groups (P<0.01). As compared with the control group, the apoptosis rate of cardiomyocytes in three DOX-treated groups was obviously increased, the expression levels of Bax increased, and those of Bcl-2 decreased (P<0.01). However, the expression levels of Bax were decreased, those of Bcl-2 increased and the apoptosis rate of cardiomyocytes obviously decreased in EH-R+DOX group when compared with those in the DOX group and the PCN+DOX group (P<0.01 for each). It was concluded that the recombinant plasmids could be successfully constructed, and transfected into the primary cultured cardiomyocytes. They could ameliorate the DOX-induced cardiomyocytes apoptosis by selectively inhibiting the expression of sEH with RNAi and increasing the expression of Bcl-2.

[Development of a mouse cell line containing stably integrated copies of pMCLacI/Neo plasmid: a model for studying mutations in vitro].

PubMed

Lu, Y; Li, H; Fu, J

2000-04-01

To establish a suitable model for studying the different mechanisms of mutation between expressed and non-expressed genes in mammalian cells. The NIH3T3 cells were transfected with the linearized pMCLacI/Neo DNAs by liposome-mediated transfection, and grew in the presence of G418. One drug resistant cell clone was selected to proliferate and to be analyzed with Southern blot and RT-PCR analyses on its genomic DNAs. (1) Multiple copies of pMCLacI/Neo plasmid DNA were intactly integrated in the genomic DNAs of the cell clone. (2) One of lac I target genes in the integrated plasmid could be transcribed in the NIH3T3 cells while the other could not. (3) The pMCLacI/Neo plasmid DNA could be efficiently rescued from the genomic DNAs of the cell clone with the average rescue efficiency of 410 cfu/microg DNA. The NIH3T3 cell line containing copies of a stably integrated pMCLacI/Neo has been established. The two lacI target genes in the cell line could imitate the functional states of expressed and non-expressed genes in mammalian cells respectively. The cell line will be a useful model for studying the different mechanisms of mutation between expressed and non-expressed genes in mammalian cells.

One pyrimidine dimer inactivates expression of a transfected gene in xeroderma pigmentosum cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Protic-Sabljic, M.; Kraemer, K.H.

1985-10-01

The authors have developed a host cell reactivation assay of DNA repair utilizing UV-treated plasmid vectors. The assay primarily reflects cellular repair of transcriptional activity of damaged DNA measured indirectly as enzyme activity of the transfected genes. They studied three plasmids (pSV2cat, 5020 base pairs; pSV2catSVgpt, 7268 base pairs; and pRSVcat, 5027 base pairs) with different sizes and promoters carrying the bacterial cat gene (CAT, chloramphenicol acetyltransferase) in a construction that permits cat expression in human cells. All human simian virus 40-transformed cells studied expressed high levels of the transfected cat gene. UV treatment of the plasmids prior to transfectionmore » resulted in differential decrease in CAT activity in different cell lines. With pSV2catSVgpt, UV inactivation of CAT expression was greater in the xeroderma pigmentosum group A and D lines than in the other human cell lines tested. The D0 of the CAT inactivation curve was 50 J X m-2 for pSV2cat and for pRSVcat in the xeroderma pigmentosum group A cells. The similarity of the D0 data in the xeroderma pigmentosum group A cells for three plasmids of different size and promoters implies they all have similar UV-inactivation target size. UV-induced pyrimidine dimer formation in the plasmids was quantified by assay of the number of UV-induced T4 endonuclease V-sensitive sites. In the most sensitive xeroderma pigmentosum cells, with all three plasmids, one UV-induced pyrimidine dimer inactivates a target of about 2 kilobases, close to the size of the putative CAT mRNA.« less

Gene Amplification by PCR and Subcloning into a GFP-Fusion Plasmid Expression Vector as a Molecular Biology Laboratory Course

ERIC Educational Resources Information Center

Bornhorst, Joshua A.; Deibel, Michael A.; Mulnix, Amy B.

2004-01-01

A novel experimental sequence for the advanced undergraduate laboratory course has been developed at Earlham College. Utilizing recent improvements in molecular techniques for a time-sensitive environment, undergraduates were able to create a chimera of a selected gene and green fluorescent protein (GFP) in a bacterial expression plasmid over the…

Distribution and expression in vitro and in vivo of DNA vaccine against lymphocystis disease virus in Japanese flounder ( Paralichthys olivaceus)

NASA Astrophysics Data System (ADS)

Zheng, Fengrong; Sun, Xiuqin; Liu, Hongzhan; Wu, Xingan; Zhong, Nan; Wang, Bo; Zhou, Guodong

2010-01-01

Lymphocystis disease, caused by the lymphocystis disease virus (LCDV), is a significant worldwide problem in fish industry causing substantial economic losses. In this study, we aimed to develop the DNA vaccine against LCDV, using DNA vaccination technology. We evaluated plasmid pEGFP-N2-LCDV1.3 kb as a DNA vaccine candidate. The plasmid DNA was transiently expressed after liposome transfection into the eukaryotic COS 7 cell line. The distribution and expression of the DNA vaccine (pEGFP-N2-LCDV1.3kb) were also analyzed in tissues of the vaccinated Japanese flounder by PCR, RT-PCR and fluorescent microscopy. Results from PCR analysis indicated that the vaccine-containing plasmids were distributed in injected muscle, the muscle opposite the injection site, the hind intestine, gill, spleen, head, kidney and liver, 6 and 25 days after vaccination. The vaccine plasmids disappeared 100 d post-vaccination. Fluorescent microscopy revealed green fluorescence in the injected muscle, the muscle opposite the injection site, the hind intestine, gill, spleen, head, kidney and liver of fish 48 h post-vaccination, green fluorescence did not appear in the control treated tissue. Green fluorescence became weak at 60 days post-vaccination. RT-PCR analysis indicated that the mcp gene was expressed in all tested tissues of vaccinated fish 6-50 days post-vaccination. These results demonstrate that the antigen encoded by the DNA vaccine is distributed and expressed in all of the tissues analyzed in the vaccinated fish. The antigen would therefore potentially initiate a specific immune response. the plasmid DNA was injected into Japanese flounder ( Paralichthys olivaceus) intramuscularly and antibodies against LCDV were evaluated. The results indicate that the plasmid encoded DNA vaccine could induce an immune response to LCDV and would therefore offer immune protection against LCD. Further studies are required for the development and application of this promising DNA vaccine.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hervey, IV, William Judson; Khalsa-Moyers, Gurusahai K; Lankford, Patricia K

Protein enrichments of engineered, affinity-tagged (or bait ) fusion proteins with interaction partners are often laden with background, non-specific proteins, due to interactions that occur in vitro as an artifact of the technique. Furthermore, the in vivo expression of the bait protein may itself affect physiology or metabolism. In this study, intrinsic affinity purification challenges were investigated in a model protein complex, DNA-dependent RNA polymerase (RNAP), encompassing chromosome- and plasmid-encoding strategies for bait proteins in two different microbial species: Escherichia coli and Rhodopseudomonas palustris. Isotope ratio measurements of bait protein expression strains relative to native, wild-type strains were performed bymore » liquid chromatography tandem mass spectrometry (LC-MS-MS) to assess bait protein expression strategies in each species. Authentic interacting proteins of RNAP were successfully discerned from artifactual co-isolating proteins by the isotopic differentiation of interactions as random or targeted (I-DIRT) method (A. J. Tackett et al. J. Proteome Res. 2005, 4 (5), 1752-1756). To investigate broader effects of bait protein production in the bacteria, we compared proteomes from strains harboring a plasmid that encodes an affinity-tagged subunit (RpoA) of the RNAP complex with the corresponding wild-type strains using stable isotope metabolic labeling. The ratio of RpoA abundance in plasmid strains versus wild type was 0.8 for R. palustris and 1.7 for E. coli. While most other proteins showed no appreciable difference, proteins significantly increased in abundance in plasmid-encoded bait-expressing strains of both species included the plasmid encoded antibiotic resistance protein, GenR and proteins involved in amino acid biosynthesis. Together, these local, complex-specific and more global, whole proteome isotopic abundance ratio measurements provided a tool for evaluating both in vivo and in vitro effects of plasmid-encoding strategies for bait protein expression. This approach has the potential for enabling discovery of protein-protein interactions among the growing number of sequenced microbial species without the need for development of chromosomal insertion systems.« less

SHRNA-MEDIATED SILENCING OF AS3MT EXPRESSION MODULATES THE CAPACITY OF HEPG2 CELLS TO METHYLATE INORGANIC ARSENIC

EPA Science Inventory

Several methyltransferases have been linked to the oxidative methylation of inorganic arsenic (iAs) in mammalian cells. However, the relative contributions of these enzymes to the overall capacity of cells to methylate iAs have not been characterized. Arsenic (+3 oxidation state)...

Silence of synaptotagmin I in INS-1 cells inhibits fast exocytosis and fast endocytosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xiong Xiong; Zhou Keming; Wu Zhengxing

Synaptotagmin I (Syt I) is a Ca{sup 2+} sensor for triggering fast synchronized release of neurotransmitters. However, controversy remains whether Syt I is also obligatory for the exocytosis and endocytosis of larger dense core vesicles (LDCVs) in endocrine cells. In this study, we used a short hairpin RNA (shRNA) to silence the expression of Syt I and investigated the roles of Syt I on exocytosis and endocytosis in INS-1 cells. Our results demonstrated that expression of Syt I is remarkably reduced by the Syt I gene targeting shRNA. Using high-time resolution capacitance measurement, we found that the silence of Sytmore » I decreased the calcium sensitivity of fusion of insulin granules and therefore reduced the exocytotic burst triggered by step-like [Ca{sup 2+}] {sub i} elevation. In addition, the occurrence frequency and amplitude of fast endocytosis were remarkably reduced in the silenced cells. We conclude that Syt I not only participates in the Ca{sup 2+}-sensing of LDCV fusion with plasmalemma, but also plays a crucial role in fast endocytosis in INS-1 cells.« less

Transgene expression and local tissue distribution of naked and polymer-condensed plasmid DNA after intradermal administration in mice

PubMed Central

Palumbo, R. Noelle; Zhong, Xiao; Panus, David; Han, Wenqing; Ji, Weihang; Wang, Chun

2012-01-01

DNA vaccination using cationic polymers as carriers has the potential to be a very powerful method of immunotherapy, but typical immune responses generated have been less than robust. To better understand the details of DNA vaccine delivery in vivo, we prepared polymer/DNA complexes using three structurally distinct cationic polymers and fluorescently labeled plasmid DNA and injected them intradermally into mice. We analyzed transgene expression (luciferase) and the local tissue distribution of the labeled plasmid at the injection site at various time points (from hours to days). Comparable numbers of luciferase expressing cells were observed in the skin of mice receiving naked plasmid or polyplexes one day after transfection. At day 4, however, the polyplexes appeared to result in more transfected skin cells than naked plasmid. Live animal imaging revealed that naked plasmid dispersed quickly in the skin of mice after injection and had a wider distribution than any of the three types of polyplexes. However, naked plasmid level dropped to below detection limit after 24 h, whereas polyplexes persisted for up to 2 weeks. The PEGylated polyplexes had a significantly wider distribution in the tissue than the nonPEGylated polyplexes. PEGylated polyplexes also distributed more broadly among dermal fibroblasts and allowed greater interaction with antigen-presenting cells (APCs) (dendritic cells and macrophages) starting at around 24 h post-injection. By day 4, co-localization of polyplexes with APCs was observed at the injection site regardless of polymer structure, whereas small amounts of polyplexes were found in the draining lymph nodes. These in vivo findings demonstrate the superior stability of PEGylated polyplexes in physiological milieu and provide important insight on how cationic polymers could be optimized for DNA vaccine delivery. PMID:22300619

[Comparative study of aromatic ring meta-cleavage enzymes in Pseudomonas strains with plasmid and chromosomal genetic control of the catabolism of biphenyl and m-toluate].

PubMed

Selifonov, S A; Starozoĭtov, I I

1990-12-01

It was shown that two different enzymes of aromatic ring oxidative meta-cleavage (2,3-dihydroxybiphenyl-1,2-dioxygenase), DBO and catechol-2,3-dioxygenase, C230) function in Pseudomonas strains with a plasmid and chromosomal genetic control of biphenyl and toluate catabolism. A comparative analysis of DBO's and C230's expressed by the pBS241 biphenyl degradative plasmid in P. putida BS893, pBS311 in P. putida U83, chromosomal genes in P. putida BF and C230 from P. putida PaW160 (pWWO) was carried out. It was found that the DBO's of all strains under study are highly specialized enzymes in respect of 2,3-dihydroxybiphenyl cleavage and are also able to cleave 3-methyl-catechol and catechol (but not 4-methylcatechol) at low rates. In contrast with DBO's, in Pseudomonas strains the substrate specificities of all C230's are variable. The C230's expressed by the D-plasmids pBS241 and pBC311 have a moderate affinity for catechol, 3-methyl- and 4-methylcatechol, but are unable to cleave 2,3-dihydroxybiphenyl. The C230 which is encoded by the chromosomal structure gene from P. putida BF is very similar to C230 which codes for the TOL-plasmid pWWO. These plasmid differ from C230's expressed by biphenyl D-plasmids due to their capability to cleave 2,3-dihydroxybiphenyl in addition to catechol cleavage. All DBO's and C230's under study possess a number of properties that are typical for the enzymes having an oxidative meta-cleaving effect. The different roles of these enzymes in biphenyl and toluate catabolism in Pseudomonas strains are discussed.

Isl-1 down-regulates DRG cell proliferation during chicken embryo development.

PubMed

Chen, Dawei; Wang, Guoxin; Luo, Haoshu; Liu, Jiali; Cui, Sheng

2010-01-01

Protein Isl-1 RNA interference and over expression in early chicken embryo dorsal root ganglia (DRG) were used to investigate the function of Isl-1 in DRG cell proliferation. Isl-1 targeted shRNA expression vector and Isl-1 over-expression vector were transfected into chicken embryo DRG by in ovo electroporation. Then, the DRG proliferation rate was detected by BrdU immunohistochemistry. The rate of DRG cell proliferation increased after Isl-1 knock-down and decreased after Isl-1 over-expression. In this study, we found that Isl-1 negatively modulates DRG cell proliferation.

Signaling Pathways in Pathogenesis of Diamond Blackfan Anemia

DTIC Science & Technology

2013-10-01

hematopoietic stem cells with RPS19 shRNA lentiviral constructs and examine levels of miR34a and target genes c-Myb, c- Myc, Sirt1 , and Notch1 at...leads to decreased expression of the miR34a targets c-myb and c-myc. Sirt1 and Notch1 expression remains unchanged in RPS19 deficient cells...b. Study miR34a target gene expression (c-Myb, c-Myc, Sirt1 , and Notch1) in lymphoblastoid cell lines (LCL) and CD34+ bone marrow progenitor cells

Protection of the liver against CCl4-induced injury by intramuscular electrotransfer of a kallistatin-encoding plasmid.

PubMed

Diao, Yong; Zhao, Xiao-Feng; Lin, Jun-Sheng; Wang, Qi-Zhao; Xu, Rui-An

2011-01-07

To investigate the effect of transgenic expression of kallistatin (Kal) on carbon tetrachloride (CCl(4))-induced liver injury by intramuscular (im) electrotransfer of a Kal-encoding plasmid formulated with poly-L-glutamate (PLG). The pKal plasmid encoding Kal gene was formulated with PLG and electrotransferred into mice skeletal muscle before the administration of CCl4. The expression level of Kal was measured. The serum biomarker levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), malonyldialdehyde (MDA), and tumor necrosis factor (TNF)-α were monitored. The extent of CCl4-induced liver injury was analyzed histopathologically. The transgene of Kal was sufficiently expressed after an im injection of plasmid formulated with PLG followed by electroporation. In the Kal gene-transferred mice, protection against CCl4-induced liver injury was reflected by significantly decreased serum ALT, AST, MDA and TNF-α levels compared to those in control mice (P<0.01 to 0.05 in a dose-dependent manner). Histological observations also revealed that hepatocyte necrosis, hemorrhage, vacuolar change and hydropic degeneration were apparent in mice after CCl4 administration. In contrast, the damage was markedly attenuated in the Kal gene-transferred mice. The expression of hepatic fibrogenesis marker transforming growth factor-β1 was also reduced in the pKal transferred mice. Intramuscular electrotransfer of plasmid pKal which was formulated with PLG significantly alleviated the CCl4-induced oxidative stress and inflammatory response, and reduced the liver damage in a mouse model.

Construction of Stable Fluorescent Reporter Plasmids for Use in Staphylococcus aureus

PubMed Central

Rodriguez, Michelle D.; Paul, Zubin; Wood, Charles E.; Rice, Kelly C.; Triplett, Eric W.

2017-01-01

Here, the genes encoding three different fluorescent proteins were cloned into the stably maintained Staphylococcus aureus shuttle vector pKK30. The resulting plasmids were transformed into two S. aureus strains; SH1000 and RN4220. Stability assays illustrated that the three recombinant plasmids retained near 100% maintenance in vitro for 160 generations. S. aureus strain SH1000 expressing green fluorescent protein was then inoculated in an ovine model and in vivo stability for 6 days was demonstrated. In essence, these reporter plasmids represent a useful set of tools for dynamic imaging studies in S. aureus. These three reporter plasmids are available through BEI Resources. PMID:29312199

Construction of Stable Fluorescent Reporter Plasmids for Use in Staphylococcus aureus.

PubMed

Rodriguez, Michelle D; Paul, Zubin; Wood, Charles E; Rice, Kelly C; Triplett, Eric W

2017-01-01

Here, the genes encoding three different fluorescent proteins were cloned into the stably maintained Staphylococcus aureus shuttle vector pKK30. The resulting plasmids were transformed into two S. aureus strains; SH1000 and RN4220. Stability assays illustrated that the three recombinant plasmids retained near 100% maintenance in vitro for 160 generations. S. aureus strain SH1000 expressing green fluorescent protein was then inoculated in an ovine model and in vivo stability for 6 days was demonstrated. In essence, these reporter plasmids represent a useful set of tools for dynamic imaging studies in S. aureus . These three reporter plasmids are available through BEI Resources.

Gab3 is required for human colorectal cancer cell proliferation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xiang, Shihao; Wang, Na; Hui, Pingping

Here, we focused on the potential function of Gab3, an uncommon Gab family protein, in human colorectal cancer (CRC) cells. We found that Gab3 was only expressed in human colon cancer tissues as well as in established (HCT-116 and HT-29 lines) and primary human CRC cells. It was however absent in normal human colon cancer tissues and in FHC colon epithelial cells. Knockdown of Gab3 by targeted-shRNAs inhibited proliferation of the CRC cells. Reversely, exogenous over-expression of Gab3 promoted CRC cell proliferation. At the signaling level, Gab3 co-precipitated with p85 and SHP2 in CRC cells, which was required for subsequentmore » Akt and Erk activation. Gab3 shRNA knockdown inhibited Akt and Erk activation, yet Gab3 over-expression augmented it. In vivo, HCT-116 xenograft tumor growth in severe combined immune deficient (SCID) mice was suppressed following expressing Gab3 shRNAs. Meanwhile, Akt and Erk activation in Gab3 shRNA-expressing tumors was also largely inhibited. Together, our results suggest that Gab3 expression in CRC cells is important for Akt-Erk activation and cell proliferation. - Highlights: • Gab3 is only expressed in colorectal cancer (CRC) cells, but not in colon epithelial cells. • Gab3 shRNA knockdown inhibits CRC cell proliferation. • Exogenous over-expression of Gab3 promotes HCT-116 cell proliferation. • Gab3 co-precipitates with p85 and SHP2 to mediate Akt and Erk activation in CRC cells. • HCT-116 tumor growth in SCID mice is suppressed with expression of Gab3 shRNAs.« less

Upregulation of EMMPRIN (OX47) in Rat Dorsal Root Ganglion Contributes to the Development of Mechanical Allodynia after Nerve Injury.

PubMed

Wang, Qun; Sun, Yanyuan; Ren, Yingna; Gao, Yandong; Tian, Li; Liu, Yang; Pu, Yanan; Gou, Xingchun; Chen, Yanke; Lu, Yan

2015-01-01

Matrix metalloproteinases (MMPs) are widely implicated in inflammation and tissue remodeling associated with various neurodegenerative diseases and play an important role in nociception and allodynia. Extracellular Matrix Metalloproteinase Inducer (EMMPRIN) plays a key regulatory role for MMP activities. However, the role of EMMPRIN in the development of neuropathic pain is not clear. Western blotting, real-time quantitative RT-PCR (qRT-PCR), and immunofluorescence were performed to determine the changes of messenger RNA and protein of EMMPRIN/OX47 and their cellular localization in the rat dorsal root ganglion (DRG) after nerve injury. Paw withdrawal threshold test was examined to evaluate the pain behavior in spinal nerve ligation (SNL) model. The lentivirus containing OX47 shRNA was injected into the DRG one day before SNL. The expression level of both mRNA and protein of OX47 was markedly upregulated in ipsilateral DRG after SNL. OX47 was mainly expressed in the extracellular matrix of DRG. Administration of shRNA targeted against OX47 in vivo remarkably attenuated mechanical allodynia induced by SNL. In conclusion, peripheral nerve injury induced upregulation of OX47 in the extracellular matrix of DRG. RNA interference against OX47 significantly suppressed the expression of OX47 mRNA and the development of mechanical allodynia. The altered expression of OX47 may contribute to the development of neuropathic pain after nerve injury.

Advanced glycation end product-induced astrocytic differentiation of cultured neurospheres through inhibition of Notch-Hes1 pathway-mediated neurogenesis.

PubMed

Guo, Yijing; Wang, Pin; Sun, Haixia; Cai, Rongrong; Xia, Wenqing; Wang, Shaohua

2013-12-23

This study aims to investigate the roles of the Notch-Hes1 pathway in the advanced glycation end product (AGE)-mediated differentiation of neural stem cells (NSCs). We prepared pLentiLox3.7 lentiviral vectors that express short hairpin RNA (shRNA) against Notch1 and transfected it into NSCs. Cell differentiation was analyzed under confocal laser-scanning microscopy. The percentage of neurons and astrocytes was quantified by normalizing the total number of TUJ1+ (Neuron-specific class III β-tubulin) and GFAP+ (Glial fibrillary acidic protein) cells to the total number of Hoechst 33342-labeled cell nuclei. The protein and gene expression of Notch-Hes1 pathway components was examined via western blot analysis and real-time PCR. After 1 week of incubation, we found that AGE-bovine serum albumin (BSA) (400 μg/mL) induced the astrocytic differentiation of cultured neurospheres and inhibited neuronal formation. The expression of Notch-Hes1 pathway components was upregulated in the cells in the AGE-BSA culture medium. Immunoblot analysis indicated that shRNA silencing of Notch1 expression in NSCs significantly increases neurogenesis and suppresses astrocytic differentiation in NSCs incubated with AGE-BSA. AGEs promote the astrocytic differentiation of cultured neurospheres by inhibiting neurogenesis through the Notch-Hes1 pathway, providing a potential therapeutic target for hyperglycemia-related cognitive deficits.

Transcriptomic analysis of genetically defined autism candidate genes reveals common mechanisms of action

PubMed Central

2013-01-01

Background Austism spectrum disorder (ASD) is a heterogeneous behavioral disorder or condition characterized by severe impairment of social engagement and the presence of repetitive activities. The molecular etiology of ASD is still largely unknown despite a strong genetic component. Part of the difficulty in turning genetics into disease mechanisms and potentially new therapeutics is the sheer number and diversity of the genes that have been associated with ASD and ASD symptoms. The goal of this work is to use shRNA-generated models of genetic defects proposed as causative for ASD to identify the common pathways that might explain how they produce a core clinical disability. Methods Transcript levels of Mecp2, Mef2a, Mef2d, Fmr1, Nlgn1, Nlgn3, Pten, and Shank3 were knocked-down in mouse primary neuron cultures using shRNA constructs. Whole genome expression analysis was conducted for each of the knockdown cultures as well as a mock-transduced culture and a culture exposed to a lentivirus expressing an anti-luciferase shRNA. Gene set enrichment and a causal reasoning engine was employed to identify pathway level perturbations generated by the transcript knockdown. Results Quantification of the shRNA targets confirmed the successful knockdown at the transcript and protein levels of at least 75% for each of the genes. After subtracting out potential artifacts caused by viral infection, gene set enrichment and causal reasoning engine analysis showed that a significant number of gene expression changes mapped to pathways associated with neurogenesis, long-term potentiation, and synaptic activity. Conclusions This work demonstrates that despite the complex genetic nature of ASD, there are common molecular mechanisms that connect many of the best established autism candidate genes. By identifying the key regulatory checkpoints in the interlinking transcriptional networks underlying autism, we are better able to discover the ideal points of intervention that provide the broadest efficacy across the diverse population of autism patients. PMID:24238429

Transcriptomic analysis of genetically defined autism candidate genes reveals common mechanisms of action.

PubMed

Lanz, Thomas A; Guilmette, Edward; Gosink, Mark M; Fischer, James E; Fitzgerald, Lawrence W; Stephenson, Diane T; Pletcher, Mathew T

2013-11-15

Austism spectrum disorder (ASD) is a heterogeneous behavioral disorder or condition characterized by severe impairment of social engagement and the presence of repetitive activities. The molecular etiology of ASD is still largely unknown despite a strong genetic component. Part of the difficulty in turning genetics into disease mechanisms and potentially new therapeutics is the sheer number and diversity of the genes that have been associated with ASD and ASD symptoms. The goal of this work is to use shRNA-generated models of genetic defects proposed as causative for ASD to identify the common pathways that might explain how they produce a core clinical disability. Transcript levels of Mecp2, Mef2a, Mef2d, Fmr1, Nlgn1, Nlgn3, Pten, and Shank3 were knocked-down in mouse primary neuron cultures using shRNA constructs. Whole genome expression analysis was conducted for each of the knockdown cultures as well as a mock-transduced culture and a culture exposed to a lentivirus expressing an anti-luciferase shRNA. Gene set enrichment and a causal reasoning engine was employed to identify pathway level perturbations generated by the transcript knockdown. Quantification of the shRNA targets confirmed the successful knockdown at the transcript and protein levels of at least 75% for each of the genes. After subtracting out potential artifacts caused by viral infection, gene set enrichment and causal reasoning engine analysis showed that a significant number of gene expression changes mapped to pathways associated with neurogenesis, long-term potentiation, and synaptic activity. This work demonstrates that despite the complex genetic nature of ASD, there are common molecular mechanisms that connect many of the best established autism candidate genes. By identifying the key regulatory checkpoints in the interlinking transcriptional networks underlying autism, we are better able to discover the ideal points of intervention that provide the broadest efficacy across the diverse population of autism patients.

Inhibition of GLO1 in Glioblastoma Multiforme Increases DNA-AGEs, Stimulates RAGE Expression, and Inhibits Brain Tumor Growth in Orthotopic Mouse Models.

PubMed

Jandial, Rahul; Neman, Josh; Lim, Punnajit P; Tamae, Daniel; Kowolik, Claudia M; Wuenschell, Gerald E; Shuck, Sarah C; Ciminera, Alexandra K; De Jesus, Luis R; Ouyang, Ching; Chen, Mike Y; Termini, John

2018-01-30

Cancers that exhibit the Warburg effect may elevate expression of glyoxylase 1 (GLO1) to detoxify the toxic glycolytic byproduct methylglyoxal (MG) and inhibit the formation of pro-apoptotic advanced glycation endproducts (AGEs). Inhibition of GLO1 in cancers that up-regulate glycolysis has been proposed as a therapeutic targeting strategy, but this approach has not been evaluated for glioblastoma multiforme (GBM), the most aggressive and difficult to treat malignancy of the brain. Elevated GLO1 expression in GBM was established in patient tumors and cell lines using bioinformatics tools and biochemical approaches. GLO1 inhibition in GBM cell lines and in an orthotopic xenograft GBM mouse model was examined using both small molecule and short hairpin RNA (shRNA) approaches. Inhibition of GLO1 with S -( p -bromobenzyl) glutathione dicyclopentyl ester ( p- BrBzGSH(Cp)₂) increased levels of the DNA-AGE N ²-1-(carboxyethyl)-2'-deoxyguanosine (CEdG), a surrogate biomarker for nuclear MG exposure; substantially elevated expression of the immunoglobulin-like receptor for AGEs (RAGE); and induced apoptosis in GBM cell lines. Targeting GLO1 with shRNA similarly increased CEdG levels and RAGE expression, and was cytotoxic to glioma cells. Mice bearing orthotopic GBM xenografts treated systemically with p -BrBzGSH(Cp)₂ exhibited tumor regression without significant off-target effects suggesting that GLO1 inhibition may have value in the therapeutic management of these drug-resistant tumors.

Inhibition of GLO1 in Glioblastoma Multiforme Increases DNA-AGEs, Stimulates RAGE Expression, and Inhibits Brain Tumor Growth in Orthotopic Mouse Models

PubMed Central

Jandial, Rahul; Neman, Josh; Tamae, Daniel; Kowolik, Claudia M.; Wuenschell, Gerald E.; Ciminera, Alexandra K.; De Jesus, Luis R.; Ouyang, Ching; Chen, Mike Y.

2018-01-01

Cancers that exhibit the Warburg effect may elevate expression of glyoxylase 1 (GLO1) to detoxify the toxic glycolytic byproduct methylglyoxal (MG) and inhibit the formation of pro-apoptotic advanced glycation endproducts (AGEs). Inhibition of GLO1 in cancers that up-regulate glycolysis has been proposed as a therapeutic targeting strategy, but this approach has not been evaluated for glioblastoma multiforme (GBM), the most aggressive and difficult to treat malignancy of the brain. Elevated GLO1 expression in GBM was established in patient tumors and cell lines using bioinformatics tools and biochemical approaches. GLO1 inhibition in GBM cell lines and in an orthotopic xenograft GBM mouse model was examined using both small molecule and short hairpin RNA (shRNA) approaches. Inhibition of GLO1 with S-(p-bromobenzyl) glutathione dicyclopentyl ester (p-BrBzGSH(Cp)2) increased levels of the DNA-AGE N2-1-(carboxyethyl)-2′-deoxyguanosine (CEdG), a surrogate biomarker for nuclear MG exposure; substantially elevated expression of the immunoglobulin-like receptor for AGEs (RAGE); and induced apoptosis in GBM cell lines. Targeting GLO1 with shRNA similarly increased CEdG levels and RAGE expression, and was cytotoxic to glioma cells. Mice bearing orthotopic GBM xenografts treated systemically with p-BrBzGSH(Cp)2 exhibited tumor regression without significant off-target effects suggesting that GLO1 inhibition may have value in the therapeutic management of these drug-resistant tumors. PMID:29385725

Down-regulation of CD19 expression inhibits proliferation, adhesion, migration and invasion and promotes apoptosis and the efficacy of chemotherapeutic agents and imatinib in SUP-B15 cells.

PubMed

Wu, Junqing; Liang, Bin; Qian, Yan; Tang, Liyuan; Xing, Chongyun; Zhuang, Qiang; Shen, Zhijian; Jiang, Songfu; Yu, Kang; Feng, Jianhua

2018-05-29

The survival rate of childhood acute lymphoblastic leukemia (ALL) has increased while that of Philadelphia-positive (Ph+) ALL remains low. CD19 is a B-cell specific molecule related to the survival and proliferation of normal B cells. However, there is little information available on the effects of CD19 on the biological behavior of Ph+ ALL cells. In this study, we explored a lentiviral vector-mediated short hairpin RNA (shRNA) expression vector to stably reduce CD19 expression in Ph+ ALL cell line SUP-B15 cells and investigated the effects of CD19 downregulation on cell proliferation, apoptosis, drug sensitivity, cell adhesion, cell migration and cell invasion in vitro. CD19 mRNA and protein expression levels were inhibited significantly by CD19 shRNA. Down-regulation of CD19 could inhibit cell proliferation, adhesion, migration and invasion, and increase cell apoptosis and the efficacy of chemotherapeutic agents and imatinib in SUP-B15 cells. Moreover, we found that down-regulation of CD19 expression inhibits cell proliferation and induces apoptosis in SUP-B15 cells in a p53-dependent manner. Taken together, our results suggest that lentiviral vector-mediated RNA interference of CD19 gene may be a promising strategy in the treatment of Ph+ ALL. This article is protected by copyright. All rights reserved.

Characterization of protein-protein interaction domains within the baculovirus Autographa californica multiple nucleopolyhedrovirus late expression factor LEF-3.

PubMed

Downie, Kelsey; Adetola, Gbolagade; Carstens, Eric B

2013-11-01

Autographa californica nucleopolyhedrovirus late expression factor 3 (LEF-3) is required for late viral gene expression probably through its numerous functions related to DNA replication, including nuclear localization of the virus helicase P143 and binding to ssDNA. LEF-3 appears to interact with itself as a homo-oligomer, although the details of this oligomeric structure are not yet known. To examine LEF-3-LEF-3 interactions, a bimolecular fluorescent protein complementation assay was used. Pairs of recombinant plasmids expressing full-length LEF-3 fused to one of two complementary fragments (V1 or V2) of a variant of yellow fluorescent protein named 'Venus' were constructed. Plasmids expressing fusions with complementary fragments of Venus were co-transfected into Sf21 cells and analysed by fluorescence microscopy. Co-transfected plasmids expressing full-length V1-LEF-3 and V2-LEF-3 showed positive fluorescence, confirming the formation of homo-oligomers. A series of truncated V1/V2-LEF-3 fusions was constructed and used to investigate interactions with one another as well as with full-length LEF-3.

A double-pulse approach for electrotransfection.

PubMed

Pasquet, L; Bellard, E; Golzio, M; Rols, M P; Teissie, J

2014-12-01

Gene transfer and expression can be obtained by delivering calibrated electric pulses on cells in the presence of plasmids coding for the activity of interest. The electric treatment affects the plasma membrane and induces the formation of a transient complex between nucleic acids and the plasma membrane. It results in a delivery of the plasmid in the cytoplasm. Expression is only obtained if the plasmid is translocated inside the nucleus. This is a key limit in the process. We previously showed that delivery of a high-field short-duration electric pulse was inducing a structural alteration of the nuclear envelope. This study investigates if the double-pulse approach (first pulse to transfer the plasmid to the cytoplasm, and second pulse to induce the structural alteration of the envelope) was a way to enhance the protein expression using the green fluorescent protein as a reporter. We observed that not only the double-pulse approach induced the transfection of a lower number of cells but moreover, these transfected cells were less fluorescent than the cells treated only with the first pulse.

Characterization of a TOL-like plasmid from Alcaligenes eutrophus that controls expression of a chromosomally encoded p-cresol pathway.

PubMed Central

Hughes, E J; Bayly, R C; Skurray, R A

1984-01-01

Alcaligenes eutrophus wild-type strain 345 metabolizes m- and p-toluate via a catechol meta-cleavage pathway. DNA analysis, curing studies, and transfer of this phenotype by conjugation and transformation showed that the degradative genes are encoded on a self-transmissible 85-kilobase plasmid, pRA1000. HindIII and XhoI restriction endonuclease analysis of pRA1000 showed it to be similar to the archetypal TOL plasmid, pWWO, differing in the case of HindIII only by the absence of fragments B and D present in pWWO. In strain 345, the presence of pRA1000 prevented the expression of chromosomally encoded enzymes required for the degradation of p-cresol, whereas these enzymes were expressed in strains cured of pRA1000. On the basis of studies with an R68.45-pRA1000 cointegrate plasmid, pRA1001, we conclude that the gene(s) responsible for the effect of p-cresol degradation resides within or near the m- and p-toluate degradative region on pRA1000. Images PMID:6325399

FOXA1 promotes tumor cell proliferation through AR involving the Notch pathway in endometrial cancer

PubMed Central

2014-01-01

Background Increasing evidence suggests that forkhead box A1 (FOXA1) is frequently dysregulated in many types of human cancers. However, the exact function and mechanism of FOXA1 in human endometrial cancer (EC) remains unclear. Methods FOXA1 expression, androgen receptor (AR) expression, and the relationships of these two markers with clinicopathological factors were determined by immunohistochemistry analysis. FOXA1 and AR were up-regulated by transient transfection with plasmids, and were down-regulated by transfection with siRNA or short hairpin RNA (shRNA). The effects of FOXA1 depletion and FOXA1 overexpression on AR-mediated transcription as well as Notch pathway and their impact on EC cell proliferation were examined by qRT-PCR, western blotting, co-immunoprecipitation, ChIP-PCR, MTT, colony-formation, and xenograft tumor–formation assays. Results We found that the expression of FOXA1 and AR in ECs was significantly higher than that in a typical hyperplasia and normal tissues. FOXA1 expression was significantly correlated with AR expression in clinical tissues. High FOXA1 levels positively correlated with pathological grade and depth of myometrial invasion in EC. High AR levels also positively correlated with pathological grade in EC. Moreover, the expression of XBP1, MYC, ZBTB16, and UHRF1, which are downstream targets of AR, was promoted by FOXA1 up-regulation or inhibited by FOXA1 down-regulation. Co-immunoprecipitation showed that FOXA1 interacted with AR in EC cells. ChIP-PCR assays showed that FOXA1 and AR could directly bind to the promoter and enhancer regions upstream of MYC. Mechanistic investigation revealed that over-expression of Notch1 and Hes1 proteins by FOXA1 could be reversed by AR depletion. In addition, we showed that down-regulation of AR attenuated FOXA1-up-regulated cell proliferation. However, AR didn’t influence the promotion effect of FOXA1 on cell migration and invasion. In vivo xenograft model, FOXA1 knockdown reduced the rate of tumor growth. Conclusions These results suggest that FOXA1 promotes cell proliferation by AR and activates Notch pathway. It indicated that FOXA1 and AR may serve as potential gene therapy in EC. PMID:24512546

Single inverted terminal repeats of the Junonia coenia Densovirus promotes somatic chromosomal integration of vector plasmids in insect cells and supports high efficiency expression

USDA-ARS?s Scientific Manuscript database

Plasmids that contain a disrupted genome of the Junonia coenia densovirus (JcDNV) integrate into the chromosomes of the somatic cells of insects. When subcloned individually, both the P9 inverted terminal repeat (P9-ITR) and the P93-ITR promote the chromosomal integration of vector plasmids in insec...

Expression of recombinant organophosphorus hydrolase in the original producer of the enzyme, Sphingobium fuliginis ATCC 27551.

PubMed

Nakayama, Kosuke; Ohmori, Takeshi; Ishikawa, Satoshi; Iwata, Natsumi; Seto, Yasuo; Kawahara, Kazuyoshi

2016-05-01

The plasmid encoding His-tagged organophosphorus hydrolase (OPH) cloned from Sphingobium fuliginis was modified to be transferred back to this bacterium. The replication function of S. amiense plasmid was inserted at downstream of OPH gene, and S. fuliginis was transformed with this plasmid. The transformant produced larger amount of active OPH with His-tag than E. coli.

Laminin-5γ-2 (LAMC2) Is Highly Expressed in Anaplastic Thyroid Carcinoma and Is Associated With Tumor Progression, Migration, and Invasion by Modulating Signaling of EGFR

PubMed Central

Kanojia, Deepika; Okamoto, Ryoko; Jain, Saket; Madan, Vikas; Chien, Wenwen; Sampath, Abhishek; Ding, Ling-Wen; Xuan, Meng; Said, Jonathan W.; Doan, Ngan B.; Liu, Li-Zhen; Yang, Henry; Gery, Sigal; Braunstein, Glenn D.; Koeffler, H. Phillip

2014-01-01

Context: Anaplastic thyroid carcinoma (ATC) is an aggressive malignancy having no effective treatment. Laminin subunit-γ-2 (LAMC2) is an epithelial basement membrane protein involved in cell migration and tumor invasion and might represent an ideal target for the development of novel therapeutic approaches for ATC. Objective: The objective of the investigation was to study the role of LAMC2 in ATC tumorigenesis. Design: LAMC2 expression was evaluated by RT-PCR, Western blotting, and immunohistochemistry in tumor specimens, adjacent noncancerous tissues, and cell lines. The short hairpin RNA (shRNA) approach was used to investigate the effect of LAMC2 knockdown on the tumorigenesis of ATC. Results: LAMC2 was highly expressed in ATC samples and cell lines compared with normal thyroid tissues. Silencing LAMC2 by shRNA in ATC cells moderately inhibited cell growth in liquid culture and dramatically decreased growth in soft agar and in xenografts growing in immunodeficient mice. Silencing LAMC2 caused cell cycle arrest and significantly suppressed the migration, invasion, and wound healing of ATC cells. Rescue experiments by overexpressing LAMC2 in LAMC2 knockdown cells reversed the inhibitory effects as shown by increased cell proliferation and colony formation. Microarray data demonstrated that LAMC2 shRNA significantly altered the expression of genes associated with migration, invasion, proliferation, and survival. Immunoprecipitation studies showed that LAMC2 bound to epidermal growth factor receptor (EGFR) in the ATC cells. Silencing LAMC2 partially blocked epidermal growth factor-mediated activation of EGFR and its downstream pathway. Interestingly, cetuximab (an EGFR blocking antibody) or EGFR small interfering RNA additively enhanced the antiproliferative activity of the LAMC2 knockdown ATC cells compared with the control cells. Conclusions: To our knowledge, this is the first report investigating the effect of LAMC2 on cell growth, cell cycle, migration, invasion, and EGFR signaling in ATC cells, suggesting that LAMC2 may be a potential therapeutic target for the treatment of ATC. PMID:24170107

Regulation of DNA repair mechanism in human glioma xenograft cells both in vitro and in vivo in nude mice.

PubMed

Ponnala, Shivani; Veeravalli, Krishna Kumar; Chetty, Chandramu; Dinh, Dzung H; Rao, Jasti S

2011-01-01

Glioblastoma Multiforme (GBM) is the most lethal form of brain tumor. Efficient DNA repair and anti-apoptotic mechanisms are making glioma treatment difficult. Proteases such as MMP9, cathepsin B and urokinase plasminogen activator receptor (uPAR) are over expressed in gliomas and contribute to enhanced cancer cell proliferation. Non-homologous end joining (NHEJ) repair mechanism plays a major role in double strand break (DSB) repair in mammalian cells. Here we show that silencing MMP9 in combination with uPAR/cathepsin B effects NHEJ repair machinery. Expression of DNA PKcs and Ku70/80 at both mRNA and protein levels in MMP9-uPAR (pMU) and MMP9-cathepsin B (pMC) shRNA-treated glioma xenograft cells were reduced. FACS analysis showed an increase in apoptotic peak and proliferation assays revealed a significant reduction in the cell population in pMU- and pMC-treated cells compared to untreated cells. We hypothesized that reduced NHEJ repair led to DSBs accumulation in pMU- and pMC-treated cells, thereby initiating cell death. This hypothesis was confirmed by reduced Ku70/Ku80 protein binding to DSB, increased comet tail length and elevated γH2AX expression in treated cells compared to control. Immunoprecipitation analysis showed that EGFR-mediated lowered DNA PK activity in treated cells compared to controls. Treatment with pMU and pMC shRNA reduced the expression of DNA PKcs and ATM, and elevated γH2AX levels in xenograft implanted nude mice. Glioma cells exposed to hypoxia and irradiation showed DSB accumulation and apoptosis after pMU and pMC treatments compared to respective controls. Our results suggest that pMU and pMC shRNA reduce glioma proliferation by DSB accumulation and increase apoptosis under normoxia, hypoxia and in combination with irradiation. Considering the radio- and chemo-resistant cancers favored by hypoxia, our study provides important therapeutic potential of MMP9, uPAR and cathepsin B shRNA in the treatment of glioma from clinical stand point.

Regulation of DNA Repair Mechanism in Human Glioma Xenograft Cells both In Vitro and In Vivo in Nude Mice

PubMed Central

Ponnala, Shivani; Veeravalli, Krishna Kumar; Chetty, Chandramu; Dinh, Dzung H.; Rao, Jasti S.

2011-01-01

Background Glioblastoma Multiforme (GBM) is the most lethal form of brain tumor. Efficient DNA repair and anti-apoptotic mechanisms are making glioma treatment difficult. Proteases such as MMP9, cathepsin B and urokinase plasminogen activator receptor (uPAR) are over expressed in gliomas and contribute to enhanced cancer cell proliferation. Non-homologous end joining (NHEJ) repair mechanism plays a major role in double strand break (DSB) repair in mammalian cells. Methodology/Principal Findings Here we show that silencing MMP9 in combination with uPAR/cathepsin B effects NHEJ repair machinery. Expression of DNA PKcs and Ku70/80 at both mRNA and protein levels in MMP9-uPAR (pMU) and MMP9-cathepsin B (pMC) shRNA-treated glioma xenograft cells were reduced. FACS analysis showed an increase in apoptotic peak and proliferation assays revealed a significant reduction in the cell population in pMU- and pMC-treated cells compared to untreated cells. We hypothesized that reduced NHEJ repair led to DSBs accumulation in pMU- and pMC-treated cells, thereby initiating cell death. This hypothesis was confirmed by reduced Ku70/Ku80 protein binding to DSB, increased comet tail length and elevated γH2AX expression in treated cells compared to control. Immunoprecipitation analysis showed that EGFR-mediated lowered DNA PK activity in treated cells compared to controls. Treatment with pMU and pMC shRNA reduced the expression of DNA PKcs and ATM, and elevated γH2AX levels in xenograft implanted nude mice. Glioma cells exposed to hypoxia and irradiation showed DSB accumulation and apoptosis after pMU and pMC treatments compared to respective controls. Conclusion/Significance Our results suggest that pMU and pMC shRNA reduce glioma proliferation by DSB accumulation and increase apoptosis under normoxia, hypoxia and in combination with irradiation. Considering the radio- and chemo-resistant cancers favored by hypoxia, our study provides important therapeutic potential of MMP9, uPAR and cathepsin B shRNA in the treatment of glioma from clinical stand point. PMID:22022560

Effects of SASH1 on lung cancer cell proliferation, apoptosis, and invasion in vitro.

PubMed

Chen, En-guo; Chen, Yanfan; Dong, Liang-liang; Zhang, Ji-song

2012-10-01

The purposes of this study were to investigate the effects of the SASH1 gene on the growth, proliferation, apoptosis, invasiveness, and metastatic potential of lung cancer cells and explore the potential use of SASH1 for the treatment of human lung cancer. The SASH1 gene was cloned into the pcDNA3.1 eukaryotic expression vector, and SASH1 shRNA were designed and constructed. The resulting constructs were transfected into A549 human lung cancer cells, and the changes in the relevant biological characteristics of the cells overexpressing SASH1 and cells with downregulated expression of SASH1 were analyzed using the MTT assay, transwell invasion assay, and flow cytometry. The effects of the SASH1 gene on the expression of cyclin D1, Bcl-2, and MMP-2/9 were also concurrently examined. In the A549 cells from the pcDNA3.1-SASH1 transfected group, cell viability, proliferation, and migration were significantly reduced compared to the control cells (p = 0.039, p = 0.013), and a cell cycle arrest in G1 was observed. The A549 cells transfected with the SASH1 shRNA demonstrated significantly higher cell viabilities, proliferation, and migration compared to the control cells (p = 0.012, p = 0.045). Additionally, the percentage of A549 cells undergoing apoptosis was significantly higher in the pcDNA3.1-SASH1 transfected cells and significantly lower in the SASH1 shRNA transfected cells compared to the control cells (p = 0.010, p = 0.000). The cyclin D1, Bcl-2, and MMP-9/2 protein expression levels were significantly lower in the pcDNA3.1-SASH1-transfected cells and were significantly higher in the SASH1 shRNA-transfected cells than that in the control cells. The SASH1 gene may inhibit A549 cell growth and proliferation as well as promote cellular apoptosis. The overexpression of the SASH1 gene may also be related to the decreased migration of A549 human lung cancer cells.

Evidence for the involvement of NOD2 in regulating colonic epithelial cell growth and survival.

PubMed

Cruickshank, Sheena-M; Wakenshaw, Louise; Cardone, John; Howdle, Peter-D; Murray, Peter-J; Carding, Simon-R

2008-10-14

To investigate the function of NOD2 in colonic epithelial cells (CEC). A combination of in vivo and in vitro analyses of epithelial cell turnover in the presence and absence of a functional NOD2 protein and, in response to enteric Salmonella typhimurium infection, were used. shRNA interference was also used to investigate the consequences of knocking down NOD2 gene expression on the growth and survival of colorectal carcinoma cell lines. In the colonic mucosa the highest levels of NOD2 expression were in proliferating crypt epithelial cells. Muramyl dipeptide (MDP), that is recognized by NOD2, promoted CEC growth in vitro. By contrast, the growth of NOD2-deficient CECs was impaired. In vivo CEC proliferation was also reduced and apoptosis increased in Nod2(-/-) mice, which were also evident following enteric Salmonella infection. Furthermore, neutralization of NOD2 mRNA expression in human colonic carcinoma cells by shRNA interference resulted in decreased survival due to increased levels of apoptosis. These findings are consistent with the involvement of NOD2 protein in promoting CEC growth and survival. Defects in proliferation by CECs in cases of CD may contribute to the underlying pathology of disrupted intestinal homeostasis and excessive inflammation.

Evidence for the involvement of NOD2 in regulating colonic epithelial cell growth and survival

PubMed Central

Cruickshank, Sheena M; Wakenshaw, Louise; Cardone, John; Howdle, Peter D; Murray, Peter J; Carding, Simon R

2008-01-01

AIM: To investigate the function of NOD2 in colonic epithelial cells (CEC). METHODS: A combination of in vivo and in vitro analyses of epithelial cell turnover in the presence and absence of a functional NOD2 protein and, in response to enteric Salmonella typhimurium infection, were used. shRNA interference was also used to investigate the consequences of knocking down NOD2 gene expression on the growth and survival of colorectal carcinoma cell lines. RESULTS: In the colonic mucosa the highest levels of NOD2 expression were in proliferating crypt epithelial cells. Muramyl dipeptide (MDP), that is recognized by NOD2, promoted CEC growth in vitro. By contrast, the growth of NOD2-deficient CECs was impaired. In vivo CEC proliferation was also reduced and apoptosis increased in Nod2-/- mice, which were also evident following enteric Salmonella infection. Furthermore, neutralization of NOD2 mRNA expression in human colonic carcinoma cells by shRNA interference resulted in decreased survival due to increased levels of apoptosis. CONCLUSION: These findings are consistent with the involvement of NOD2 protein in promoting CEC growth and survival. Defects in proliferation by CECs in cases of CD may contribute to the underlying pathology of disrupted intestinal homeostasis and excessive inflammation. PMID:18855982

Anti-cancer effect of oncolytic adenovirus-armed shRNA targeting MYCN gene on doxorubicin-resistant neuroblastoma cells.

PubMed

Li, Yuan; Zhuo, Baobiao; Yin, Yiyu; Han, Tao; Li, Shixian; Li, Zhengwei; Wang, Jian

2017-09-09

Chemotherapy is one of the few effective choices for patients with neuroblastoma. However, the development of muti-drug resistance (MDR) to chemotherapy is a major obstacle to the effective treatment of advanced or recurrent neuroblastoma. The muti-drug resistance-associated protein (MRP), which encodes a transmembrane glycoprotein, is a key regulator of MDR. The expression of MRP is a close correlation with MYCN oncogene in neuroblastoma. We have recently shown ZD55-shMYCN (oncolytic virus armed with shRNA against MYCN) can down-regulate MYCN to inhibit tumor cells proliferation and induce apoptosis in neuroblastoma. Here we further report ZD55-shMYCN re-sensitized doxorubicin-resistant cells to doxorubicin (as shown by reduced proliferation, increased apoptosis, and inhibited cell migration), and reduced the in vivo growth rate of neuroblastoma xenografts by down-regulation of MRP expression. Sequential therapy with doxorubicin did not affect the replication of ZD55-shMYCN in doxorubicin-resistant neuroblastoma cells, but decreased the expression of Bcl-2, Bcl-X L , MMP-1. Thus, this synergistic effect of ZD55-shMYCN in combination with doxorubicin provides a novel therapy strategy for doxorubicin-resistant neuroblastoma, and is a promising approach for further clinical development. Copyright © 2017 Elsevier Inc. All rights reserved.

RNAi knockdown of oxytocin receptor in the nucleus accumbens inhibits social attachment and parental care in monogamous female prairie voles

PubMed Central

Keebaugh, Alaine C.; Barrett, Catherine E.; LaPrairie, Jamie L.; Jenkins, Jasmine J.; Young, Larry J.

2015-01-01

Oxytocin modulates many aspects of social cognition and behaviors, including maternal nurturing, social recognition and bonding. Natural variation in oxytocin receptor (OXTR) density in the nucleus accumbens (NAcc) is associated with variation in alloparental behavior, and artificially enhancing OXTR expression in the NAcc enhances alloparental behavior and pair bonding in socially monogamous prairie voles. Furthermore, infusion of an OXTR antagonist into the nucleus accumbens (NAcc) inhibits alloparental behavior and partner preference formation. However, antagonists can promiscuously interact with other neuropeptide receptors. To directly examine the role of OXTR signaling in social bonding, we used RNA interference to selectively knockdown, but not eliminate, OXTR in the NAcc of female prairie voles and examined the impact on social behaviors. Using an adeno-associated viral vector expressing a short hairpin RNA (shRNA) targeting Oxtr mRNA, we reduced accumbal OXTR density in female prairie voles from juvenile age through adulthood. Females receiving the shRNA vector displayed a significant reduction in alloparental behavior and disrupted partner preference formation. These are the first direct demonstrations that OXTR plays a critical role in alloparental behavior and adult social attachment, and suggest that natural variation in OXTR expression in this region alone can create variation in social behavior. PMID:25874849

The Renilla luciferase gene as a reference gene for normalization of gene expression in transiently transfected cells.

PubMed

Jiwaji, Meesbah; Daly, Rónán; Pansare, Kshama; McLean, Pauline; Yang, Jingli; Kolch, Walter; Pitt, Andrew R

2010-12-31

The importance of appropriate normalization controls in quantitative real-time polymerase chain reaction (qPCR) experiments has become more apparent as the number of biological studies using this methodology has increased. In developing a system to study gene expression from transiently transfected plasmids, it became clear that normalization using chromosomally encoded genes is not ideal, at it does not take into account the transfection efficiency and the significantly lower expression levels of the plasmids. We have developed and validated a normalization method for qPCR using a co-transfected plasmid. The best chromosomal gene for normalization in the presence of the transcriptional activators used in this study, cadmium, dexamethasone, forskolin and phorbol-12-myristate 13-acetate was first identified. qPCR data was analyzed using geNorm, Normfinder and BestKeeper. Each software application was found to rank the normalization controls differently with no clear correlation. Including a co-transfected plasmid encoding the Renilla luciferase gene (Rluc) in this analysis showed that its calculated stability was not as good as the optimised chromosomal genes, most likely as a result of the lower expression levels and transfection variability. Finally, we validated these analyses by testing two chromosomal genes (B2M and ActB) and a co-transfected gene (Rluc) under biological conditions. When analyzing co-transfected plasmids, Rluc normalization gave the smallest errors compared to the chromosomal reference genes. Our data demonstrates that transfected Rluc is the most appropriate normalization reference gene for transient transfection qPCR analysis; it significantly reduces the standard deviation within biological experiments as it takes into account the transfection efficiencies and has easily controllable expression levels. This improves reproducibility, data validity and most importantly, enables accurate interpretation of qPCR data.

The effect of eukaryotic expression vectors and adjuvants on DNA vaccines in chickens using an avian influenza model.

PubMed

Suarez, D L; Schultz-Cherry, S

2000-01-01

Vaccination of poultry with naked plasmid DNA has been successfully demonstrated with several different poultry pathogens, but the technology needs to be further developed before it can be practically implemented. Many different methods can conceivably enhance the efficacy of DNA vaccines, and this report examines the use of different eukaryotic expression vectors with different promoters and different adjuvants to express the influenza hemagglutinin protein. Four different promoters in five different plasmids were used to express the hemagglutinin protein of an H5 avian influenza virus, including two different immediate early cytomegaloviruses (CMVs), Rous sarcoma virus, chicken actin, and simian virus 40 promoters. All five constructs expressed detectable hemagglutinin protein in cell culture, but the pCI-neo HA plasmid with the CMV promoter provided the best response in chickens when vaccinated intramuscularly at 1 day of age on the basis of antibody titer and survivability after challenge with a highly pathogenic avian influenza virus at 6 wk postinoculation. A beneficial response was observed in birds boostered at 3 wk of age, in birds given larger amounts of DNA, and with the use of multiple injection sites to administer the vaccine. With the use of the pCI-neo construct, the effects of different adjuvants designed to increase the uptake of plasmid DNA, including 25% sucrose, diethylaminoethyl dextran, calcium phosphate, polybrene, and two different cationic liposomes, were examined. Both liposomes tested enhanced antibody titers as compared with the positive controls, but the other chemical adjuvants decreased the antibody response as compared with the control chickens that received just the plasmid alone. The results observed are promising for continued studies, but continued improvements in vaccine response and reduced costs are necessary before the technology can be commercially developed.

Rational Development of A Polycistronic Plasmid with A CpG-Free Bacterial Backbone as A Potential Tool for Direct Reprogramming.

PubMed

Dormiani, Kianoush; Mir Mohammad Sadeghi, Hamid; Sadeghi-Aliabadi, Hojjat; Forouzanfar, Mahboobeh; Baharvand, Hossein; Ghaedi, Kamran; Nasr-Esfahani, Mohammad Hossein

2017-01-01

Induced pluripotent stem cells are generated from somatic cells by direct reprogramming. These reprogrammed pluripotent cells have different applications in biomedical fields such as regenerative medicine. Although viral vectors are widely used for efficient reprogramming, they have limited applications in the clinic due to the risk for immunogenicity and insertional mutagenesis. Accordingly, we designed and developed a small, non-integrating plasmid named pLENSO/Zeo as a 2A-mediated polycistronic expression vector. In this experimental study, we developed a single plasmid which includes a single expression cassette containing open reading frames of human LIN28, NANOG, SOX2 and OCT4 along with an EGFP reporter gene. Each reprogramming factor is separated by an intervening sequence that encodes a 2A self-processing peptide. The reprogramming cassette is located downstream of a CMV promoter. The vector is easily propagated in the E. coli GT115 strain through a CpG-depleted vector backbone. We evaluated the stability of the constructed vector bioinformatically, and its ability to stoichiometric expression of the reprogramming factors using quantitative molecular methods analysis after transient transfection into HEK293 cells. In the present study, we developed a nonviral episomal vector named pLENSO/ Zeo. Our results demonstrated the general structural stability of the plasmid DNA. This relatively small vector showed concomitant, high-level expression of the four reprogramming factors with similar titers, which are considered as the critical parameters for efficient and consistent reprogramming. According to our experimental results, this stable extrachromosomal plasmid expresses reliable amounts of four reprogramming factors simultaneously. Consequently, these promising results encouraged us to evaluate the capability of pLENSO/Zeo as a simple and feasible tool for generation of induced pluripotent stem cells from primary cells in the future.

Interference with endogenous EZH2 reverses the chemotherapy drug resistance in cervical cancer cells partly by up-regulating Dicer expression.

PubMed

Cai, Liqiong; Wang, Zehua; Liu, Denghua

2016-05-01

Cervical cancer is one of the most common female malignancies in the world, and chemotherapeutic drug resistance is a major obstacle to cancer therapy. Enhancer of zeste homolog 2 (EZH2) is an enzymatic subunit of polycomb repressive complex 2 (PRC2) and catalyzes the repressive histone H3 lysine 27 trimethylation (H3K27me3). However, the role of EZH2 on the chemotherapy drug resistance in cervical cancers remains unclear. In the present study, the cervical carcinoma specimens and paired normal tissue specimens were obtained and the expression of EZH2 was detected by western blotting. The results showed that high levels of EZH2 were detected in cervical carcinoma tissues, compared with paired control tissues (**p < 0.01). Next, three pairs of shRNA specific to EZH2 were designed and used to interfere with endogenous EZH2 expression. Cell viability was assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assays following treatment with various concentrations of cisplatin in HeLa and HeLa/DDP cells. The MTT assay results showed that knockdown of EZH2 in HeLa/DDP cells caused a 2.29- or 1.83-fold decrease in the cisplatin IC50 values (for shRNA1-EZH2, 34.88 vs. 15.21 μg/mL; p < 0.01; for shRNA3-EZH2, 34.88 vs. 19.09 μg/mL; p < 0.01). The EZH2 activity was also suppressed by 3-deazaneplanocin A (DZNep), EZH2 inhibitor, and the results demonstrated that, meanwhile, DZNep potently inhibited cell viability of HeLa/DDP cells, partly by suppression the levels of EZH2 and H3K27me3, but not H3K27me2, which was detected by western blotting analysis. Moreover, cell migration assay results showed that knockdown of EZH2 decreased cell metastasis of cervical cancer cells. Furthermore, cell cycle was detected by fluorescence-activated cell sorting (FACS) assay and the results demonstrated that interference with EZH2 expression increased the percentage of cells at G0/G1 phase and the HeLa/DDP cells were blocked at G0/G1 phase. Interestingly, western blotting results revealed that higher expression of EZH2 was related with lower level of Dicer in HeLa/DDP cells. Finally, in vivo tumorigenicity experiments results demonstrated that interference with endogenous EZH2 by shRNA specific to EZH2 or inhibition EZH2 by DZNep could significantly increase antitumor effects in nude mice. Thus, inhibiting the levels of endogenous EZH2 effectively reversed the cisplatin resistance and increased the cisplatin sensitivity in cisplatin-resistant HeLa/DDP cells. EZH2 might be a potential target for treating chemotherapeutic drug-resistant cervical cancers.

Region of Herpes Simplex Virus Type 1 Latency-Associated Transcript Sufficient for Wild-Type Spontaneous Reactivation Promotes Cell Survival in Tissue Culture

PubMed Central

Inman, Melissa; Perng, Guey-Chuen; Henderson, Gail; Ghiasi, Homayon; Nesburn, Anthony B.; Wechsler, Steven L.; Jones, Clinton

2001-01-01

The latency-associated transcript (LAT) is the only abundant herpes simplex virus type 1 (HSV-1) transcript expressed during latency. In the rabbit eye model, LAT null mutants do not reactivate efficiently from latency. We recently demonstrated that the LAT null mutant dLAT2903 induces increased levels of apoptosis in trigeminal ganglia of infected rabbits compared to LAT+ strains (G.-C. Perng, C. Jones, J. Ciacci-Zarella, M. Stone, G. Henderson, A. Yokht, S. M. Slanina, F. M. Hoffman, H. Ghiasi, A. B. Nesburn, and C. S. Wechsler, Science 287:1500–1503, 2000).The same study also demonstrated that a plasmid expressing LAT nucleotides 301 to 2659 enhanced cell survival of transfected cells after induction of apoptosis. Consequently, we hypothesized that LAT enhances spontaneous reactivation in part, because it promotes survival of infected neurons. Here we report on the ability of plasmids expressing different portions of the 5′ end of LAT to promote cell survival after induction of apoptosis. A plasmid expressing the first 1.5 kb of LAT (LAT nucleotides 1 to 1499) promoted cell survival in neuro-2A (mouse neuronal) and CV-1 (monkey fibroblast) cells. A plasmid expressing just the first 811 nucleotides of LAT promoted cell survival less efficiently. Plasmids expressing the first 661 nucleotides or less of LAT did not promote cell survival. We previously showed that a mutant expressing just the first 1.5 kb of LAT has wild-type spontaneous reactivation in rabbits, and a mutant expressing just the first 811 nucleotides of LAT has a reactivation frequency higher than that of dLAT2903 but lower than that of wild-type virus. In addition, mutants reported here for the first time, expressing just the first 661 or 76 nucleotides of LAT, had spontaneous reactivation indistinguishable from that of the LAT null mutant dLAT2903. In summary, these studies provide evidence that there is a functional relationship between the ability of LAT to promote cell survival and its ability to enhance spontaneous reactivation. PMID:11264353

Xin, an actin binding protein, is expressed within muscle satellite cells and newly regenerated skeletal muscle fibers.

PubMed

Hawke, Thomas J; Atkinson, Daniel J; Kanatous, Shane B; Van der Ven, Peter F M; Goetsch, Sean C; Garry, Daniel J

2007-11-01

Xin is a muscle-specific actin binding protein of which its role and regulation within skeletal muscle is not well understood. Here we demonstrate that Xin mRNA is robustly upregulated (>16-fold) within 12 h of skeletal muscle injury and is localized to the muscle satellite cell population. RT-PCR confirmed the expression pattern of Xin during regeneration, as well as within primary muscle myoblast cultures, but not other known stem cell populations. Immunohistochemical staining of single myofibers demonstrate Xin expression colocalized with the satellite cell marker Syndecan-4 further supporting the mRNA expression of Xin in satellite cells. In situ hybridization of regenerating muscle 5-7 days postinjury illustrates Xin expression within newly regenerated myofibers. Promoter-reporter assays demonstrate that known myogenic transcription factors [myocyte enhancer factor-2 (MEF2), myogenic differentiation-1 (MyoD), and myogenic factor-5 (Myf-5)] transactivate Xin promoter constructs supporting the muscle-specific expression of Xin. To determine the role of Xin within muscle precursor cells, proliferation, migration, and differentiation analysis using Xin, short hairpin RNA (shRNA) were undertaken in C2C12 myoblasts. Reducing endogenous Xin expression resulted in a 26% increase (P < 0.05) in cell proliferation and a 20% increase (P < 0.05) in myoblast migratory capacity. Skeletal muscle myosin heavy chain protein levels were increased (P < 0.05) with Xin shRNA administration; however, this was not accompanied by changes in myoglobin protein (another marker of differentiation) nor overt morphological differences relative to differentiating control cells. Taken together, the present findings support the hypothesis that Xin is expressed within muscle satellite cells during skeletal muscle regeneration and is involved in the regulation of myoblast function.

Interleukin-6-driven progranulin expression increases cholangiocarcinoma growth by an Akt-dependent mechanism

PubMed Central

Frampton, Gabriel; Invernizzi, Pietro; Bernuzzi, Francesca; Pae, Hae Yong; Quinn, Matthew; Horvat, Darijana; Galindo, Cheryl; Huang, Li; McMillin, Matthew; Cooper, Brandon; Rimassa, Lorenza; DeMorrow, Sharon

2015-01-01

Background and objectives Cholangiocarcinoma is a devastating cancer of biliary origin with limited treatment options. The growth factor, progranulin, is overexpressed in a number of tumours. The study aims were to assess the expression of progranulin in cholangiocarcinoma and to determine its effects on tumour growth. Methods The expression and secretion of progranulin were evaluated in multiple cholangiocarcinoma cell lines and in clinical samples from patients with cholangiocarcinoma. The role of interleukin 6 (IL-6)-mediated signalling in the expression of progranulin was assessed using a combination of specific inhibitors and shRNA knockdown techniques. The effect of progranulin on proliferation and Akt activation and subsequent effects of FOXO1 phosphorylation were assessed in vitro. Progranulin knockdown cell lines were established, and the effects on cholangiocarcinoma growth were determined. Results Progranulin expression and secretion were upregulated in cholangiocarcinoma cell lines and tissue, which were in part via IL-6-mediated activation of the ERK1/2/RSK1/C/EBPβ pathway. Blocking any of these signalling molecules, by either pharmacological inhibitors or shRNA, prevented the IL-6-dependent activation of progranulin expression. Treatment of cholangiocarcinoma cells with recombinant progranulin increased cell proliferation in vitro by a mechanism involving Akt phosphorylation leading to phosphorylation and nuclear extrusion of FOXO1. Knockdown of progranulin expression in cholangiocarcinoma cells decreased the expression of proliferating cellular nuclear antigen, a marker of proliferative capacity, and slowed tumour growth in vivo. Conclusions Evidence is presented for a role for progranulin as a novel growth factor regulating cholangiocarcinoma growth. Specific targeting of progranulin may represent an alternative for the development of therapeutic strategies. PMID:22068162

Three-Dimensional Imaging of the Intracellular Fate of Plasmid DNA and Transgene Expression: ZsGreen1 and Tissue Clearing Method CUBIC Are an Optimal Combination for Multicolor Deep Imaging in Murine Tissues.

PubMed

Fumoto, Shintaro; Nishimura, Koyo; Nishida, Koyo; Kawakami, Shigeru

2016-01-01

Evaluation methods for determining the distribution of transgene expression in the body and the in vivo fate of viral and non-viral vectors are necessary for successful development of in vivo gene delivery systems. Here, we evaluated the spatial distribution of transgene expression using tissue clearing methods. After hydrodynamic injection of plasmid DNA into mice, whole tissues were subjected to tissue clearing. Tissue clearing followed by confocal laser scanning microscopy enabled evaluation of the three-dimensional distribution of transgene expression without preparation of tissue sections. Among the tested clearing methods (ClearT2, SeeDB, and CUBIC), CUBIC was the most suitable method for determining the spatial distribution of transgene expression in not only the liver but also other tissues such as the kidney and lung. In terms of the type of fluorescent protein, the observable depth for green fluorescent protein ZsGreen1 was slightly greater than that for red fluorescent protein tdTomato. We observed a depth of ~1.5 mm for the liver and 500 μm for other tissues without preparation of tissue sections. Furthermore, we succeeded in multicolor deep imaging of the intracellular fate of plasmid DNA in the murine liver. Thus, tissue clearing would be a powerful approach for determining the spatial distribution of plasmid DNA and transgene expression in various murine tissues.

An efficient procedure for the expression and purification of HIV-1 protease from inclusion bodies.

PubMed

Nguyen, Hong-Loan Thi; Nguyen, Thuy Thi; Vu, Quy Thi; Le, Hang Thi; Pham, Yen; Trinh, Phuong Le; Bui, Thuan Phuong; Phan, Tuan-Nghia

2015-12-01

Several studies have focused on HIV-1 protease for developing drugs for treating AIDS. Recombinant HIV-1 protease is used to screen new drugs from synthetic compounds or natural substances. However, large-scale expression and purification of this enzyme is difficult mainly because of its low expression and solubility. In this study, we constructed 9 recombinant plasmids containing a sequence encoding HIV-1 protease along with different fusion tags and examined the expression of the enzyme from these plasmids. Of the 9 plasmids, pET32a(+) plasmid containing the HIV-1 protease-encoding sequence along with sequences encoding an autocleavage site GTVSFNF at the N-terminus and TEV plus 6× His tag at the C-terminus showed the highest expression of the enzyme and was selected for further analysis. The recombinant protein was isolated from inclusion bodies by using 2 tandem Q- and Ni-Sepharose columns. SDS-PAGE of the obtained HIV-1 protease produced a single band of approximately 13 kDa. The enzyme was recovered efficiently (4 mg protein/L of cell culture) and had high specific activity of 1190 nmol min(-1) mg(-1) at an optimal pH of 4.7 and optimal temperature of 37 °C. This procedure for expressing and purifying HIV-1 protease is now being scaled up to produce the enzyme on a large scale for its application. Copyright © 2015 Elsevier Inc. All rights reserved.

Immune Efficacy of a Genetically Engineered Vaccine against Lymphocystis Disease Virus: Analysis of Different Immunization Strategies

PubMed Central

Zheng, Fengrong; Sun, Xiuqin; Wu, Xing'an; Liu, Hongzhan; Li, Jiye; Wu, Suqi; Zhang, Jinxing

2011-01-01

Here, we report the construction of a vaccine against lymphocystis disease virus (LCDV) using nucleic acid vaccination technology. A fragment of the major capsid protein encoding gene from an LCDV isolated from China (LCDV-cn) was cloned into an eukaryotic expression vector pEGFP-N2, yielding a recombinant plasmid pEGFP-N2-LCDV-cn0.6 kb. This plasmid was immediately expressed after liposomal transfer into the Japanese flounder embryo cell line. The recombinant plasmid was inoculated into Japanese flounder via two routes (intramuscular injection and hypodermic injection) at three doses (0.1, 5, and 15 μg), and then T-lymphopoiesis in different tissues and antibodies raised against LCDV were evaluated. The results indicated that this recombinant plasmid induced unique humoral or cell-mediated immune responses depending on the inoculation route and conferred immune protection. Furthermore, the humoral immune responses and protective effects were significantly increased at higher vaccine doses via the two injection routes. Plasmid pEGFP-N2-LCDV0.6 kb is therefore a promising vaccine candidate against LCDV in Japanese flounder. PMID:21789044

Towards the construction of high-quality mutagenesis libraries.

PubMed

Li, Heng; Li, Jing; Jin, Ruinan; Chen, Wei; Liang, Chaoning; Wu, Jieyuan; Jin, Jian-Ming; Tang, Shuang-Yan

2018-07-01

To improve the quality of mutagenesis libraries in directed evolution strategy. In the process of library transformation, transformants which have been shown to take up more than one plasmid might constitute more than 20% of the constructed library, thereby extensively impairing the quality of the library. We propose a practical transformation method to prevent the occurrence of multiple-plasmid transformants while maintaining high transformation efficiency. A visual library model containing plasmids expressing different fluorescent proteins was used. Multiple-plasmid transformants can be reduced through optimizing plasmid DNA amount used for transformation based on the positive correlation between the occurrence frequency of multiple-plasmid transformants and the logarithmic ratio of plasmid molecules to competent cells. This method provides a simple solution for a seemingly common but often neglected problem, and should be valuable for improving the quality of mutagenesis libraries to enhance the efficiency of directed evolution strategies.

Lentivirus-mediated shRNA interference of ghrelin receptor blocks proliferation in the colorectal cancer cells.

PubMed

Liu, An; Huang, Chenggang; Xu, Jia; Cai, Xuehong

2016-09-01

Ghrelin, an orexigenic peptide, acts via the growth hormone secretagogue receptor (GHSR) to stimulate the release of growth hormone. Moreover, it has a range of biological actions, including the stimulation of food intake, modulation of insulin signaling and cardiovascular effects. Recently, it has been demonstrated that ghrelin has a proliferative and antiapoptotic effects in cancers, suggesting a potential role in promoting tumor growth. However, it remains unknown whether GHSR contributes to colorectal cancer proliferation. In this study, the therapeutic effect of lentivirus-mediated short hairpin RNA (shRNA) targeting ghrelin receptor 1a (GHSR1a) was analyzed in colorectal cancer cell line SW480 both in vitro and in vivo. Our study demonstrated that ghrelin and GHSR1a are significantly upregulated in cancerous colorectal tissue samples and cell lines. In vitro, human colorectal cancer cell line SW480 with downregulation of GHSR1a by shRNA showed significant inhibition of cell viability compared with blank control (BC) or scrambled control (SC) regardless of the application of exogenous ghrelin. Furthermore, GHSR1a silencing by target specific shRNA was shown capable of increasing PTEN, inhibiting AKT phosphorylation and promoting the release of p53 in SW480 cells. In addition, the effects of GHSR1a knockdown were further explored in vivo using colorectal tumor xenograft mouse model. The tumor weights were decreased markedly in GHSR1α knockdown SW480 mouse xenograft tumors compared with blank control or negative control tumors. Our results suggested that the expression of GHSR1a is significantly correlated with the growth of colorectal cancer cells, and the GHSR1a knockdown approach may be a potential therapy for the treatment of colorectal cancer. © 2016 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

Prostate-targeted biodegradable nanoparticles loaded with androgen receptor silencing constructs eradicate xenograft tumors in mice

PubMed Central

Yang, Jun; Xie, Sheng-Xue; Huang, Yiling; Ling, Min; Liu, Jihong; Ran, Yali; Wang, Yanlin; Thrasher, J Brantley; Berkland, Cory; Li, Benyi

2012-01-01

Background Prostate cancer is the major cause of cancer death in men and the androgen receptor (AR) has been shown to play a critical role in the progression of the disease. Our previous reports showed that knocking down the expression of the AR gene using a siRNA-based approach in prostate cancer cells led to apoptotic cell death and xenograft tumor eradication. In this study, we utilized a biodegradable nanoparticle to deliver the therapeutic AR shRNA construct specifically to prostate cancer cells. Materials & methods The biodegradable nanoparticles were fabricated using a poly(dl-lactic-co-glycolic acid) polymer and the AR shRNA constructs were loaded inside the particles. The surface of the nanoparticles were then conjugated with prostate-specific membrane antigen aptamer A10 for prostate cancer cell-specific targeting. Results A10-conjugation largely enhanced cellular uptake of nanoparticles in both cell culture- and xenograft-based models. The efficacy of AR shRNA encapsulated in nanoparticles on AR gene silencing was confirmed in PC-3/AR-derived xenografts in nude mice. The therapeutic property of A10-conjugated AR shRNA-loaded nanoparticles was evaluated in xenograft models with different prostate cancer cell lines: 22RV1, LAPC-4 and LNCaP. Upon two injections of the AR shRNA-loaded nanoparticles, rapid tumor regression was observed over 2 weeks. Consistent with previous reports, A10 aptamer conjugation significantly enhanced xenograft tumor regression compared with nonconjugated nanoparticles. Discussion These data demonstrated that tissue-specific delivery of AR shRNA using a biodegradable nanoparticle approach represents a novel therapy for life-threatening prostate cancers. PMID:22583574

Combination therapy utilizing shRNA knockdown and an optimized resistant transgene for rescue of diseases caused by misfolded proteins.

PubMed

Li, Chengwen; Xiao, Pingjie; Gray, Steven James; Weinberg, Marc Scott; Samulski, R Jude

2011-08-23

Molecular knockdown of disease proteins and restoration of wild-type activity represent a promising but challenging strategy for the treatment of diseases that result from the accumulation of misfolded proteins (i.e., Huntington disease, amyotrophic lateral sclerosis, and α-1 antitrypsin deficiency). In this study we used alpha-1 antitrypsin (AAT) deficiency with the piZZ mutant phenotype as a model system to evaluate the efficiency of gene-delivery approaches that both silence the piZZ transcript (e.g., shRNA) and restore circulating wild-type AAT expression from resistant codon-optimized AAT (AAT-opt) transgene cassette using adeno-associated virus (AAV) vector delivery. After systemic injection of a self-complimentary AAV serotype 8 (scAAV8) vector encoding shRNA in piZZ transgenic mice, both mutant AAT mRNA in the liver and defected serum protein level were inhibited by 95%, whereas liver pathology, as monitored by dPAS and fibrosis staining, reversed. To restore blood AAT levels in AAV8/shRNA-treated mice, several strategies to restore functional AAT levels were tested, including using AAV AAT-opt transgene cassettes targeted to muscle and liver, or combination vectors carrying piZZ shRNA and AAT-opt transgenes separately, or a single bicistronic AAV vector. With these molecular approaches, we observed over 90% knockdown of mutant AAT with a 13- to 30-fold increase of circulating wild-type AAT protein from the shRNA-resistant AAT-opt cassette. The molecular approaches applied in this study can simultaneously prevent liver pathology and restore blood AAT concentration in AAT deficiencies. Based on these observations, similar gene-therapy strategies could be considered for any diseases caused by accumulation of misfolded proteins.

A pro-invasive role for the Ca2+-activated K+ channel KCa3.1 in malignant glioma

PubMed Central

Turner, Kathryn L.; Honasoge, Avinash; Robert, Stephanie M.; McFerrin, Michael M.; Sontheimer, Harald

2014-01-01

Glioblastoma multiforme (GBM) are highly motile primary brain tumors. Diffuse tissue invasion hampers surgical resection leading to poor patient prognosis. Recent studies suggest that intracellular Ca2+ acts as a master regulator for cell motility and engages a number of downstream signals including Ca2+-activated ion channels. Querying the REepository of Molecular BRAin Neoplasia DaTa (REMBRANDT), an annotated patient gene database maintained by the National Cancer Institute, we identified the intermediate conductance Ca2+-activated K+ channels, KCa3.1, being overexpressed in 32% of glioma patients where protein expression significantly correlated with poor patient survival. To mechanistically link KCa3.1 expression to glioma invasion, we selected patient gliomas that, when propagated as xenolines in vivo, present with either high or low KCa3.1 expression. In addition we generated U251 glioma cells that stably express an inducible knockdown shRNA to experimentally eliminate KCa3.1 expression. Subjecting these cells to a combination of in vitro and in situ invasion assays, we demonstrate that KCa3.1 expression significantly enhances glioma invasion and that either specific pharmacological inhibition with TRAM-34 or elimination of the channel impairs invasion. Importantly, after intracranial implantation into SCID mice, ablation of KCa3.1 with inducible shRNA resulted in a significant reduction in tumor invasion into surrounding brain in vivo. These results show that KCa3.1 confers an invasive phenotype that significantly worsens a patient’s outlook, and suggests that KCa3.1 represents a viable therapeutic target to reduce glioma invasion. PMID:24585442

Effects of legumain as a potential prognostic factor on gastric cancers.

PubMed

Li, Na; Liu, Qiaoling; Su, Qi; Wei, Chongyang; Lan, Bin; Wang, Jianyong; Bao, Guoqing; Yan, Fei; Yu, Ying; Peng, Baowei; Qiu, Ju; Yan, Xiangming; Zhang, Sheng; Guo, Fang

2013-01-01

Although legumain has been found to be a prognostic factor in both breast cancer and colorectal cancer, its effects on gastric cancer are unknown. In this study, we investigated effects of legumain on gastric cancer and the correlation between legumain expression and prognosis of gastric cancer patients. SGC7901 cells were transduced with legumain cDNA (SGC7901-hLeg) for overexpression of legumain or with legumain shRNA to knock down legumain. In vitro tumor migration was examined by wound healing assay. Furthermore, a tumorigenicity and metastasis mouse model was used to examine legumain function in vivo; asparaginyl endopeptidase inhibitor (AEPI, an inhibitor of legumain) was injected to the mice (i.p.) to evaluate its therapeutic effect. Tissue microarray analysis from 112 gastric cancer patients was performed to evaluate the association between legumain expression and the cumulative survival time. Legumain was highly expressed in gastric cancer patients and some gastric cancer cell lines. Legumain promoted gastric cell migration in vitro and promoted gastric tumor growth and metastasis in vivo, and these effects were reversed by knockdown of legumain with shRNA or treated with AEPI. In gastric cancer clinical samples, legumain expression in tumor was significantly higher than in non-tumor and was negatively associated with the cumulative survival rate. In conclusion, legumain was highly expressed in gastric adenocarcinoma; legumain promoted gastric cancer tumorigenesis and metastasis in vitro and in vivo. Legumain expression in tumor was a poor prognostic factor for gastric cancer patients, and legumain could be a potential target molecule for gastric cancer therapy in clinic.

The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells.

PubMed

Suriguga; Li, Xiao-Fei; Li, Yang; Yu, Chun-Hong; Li, Yi-Ran; Yi, Zong-Chun

2013-12-15

Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependent increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. © 2013.

Engineering new mycobacterial vaccine design for HIV–TB pediatric vaccine vectored by lysine auxotroph of BCG

PubMed Central

Saubi, Narcís; Gea-Mallorquí, Ester; Ferrer, Pau; Hurtado, Carmen; Sánchez-Úbeda, Sara; Eto, Yoshiki; Gatell, Josep M; Hanke, Tomáš; Joseph, Joan

2014-01-01

In this study, we have engineered a new mycobacterial vaccine design by using an antibiotic-free plasmid selection system. We assembled a novel Escherichia coli (E. coli)–mycobacterial shuttle plasmid p2auxo.HIVA, expressing the HIV-1 clade A immunogen HIVA. This shuttle vector employs an antibiotic resistance-free mechanism for plasmid selection and maintenance based on glycine complementation in E. coli and lysine complementation in mycobacteria. This plasmid was first transformed into glycine auxotroph of E. coli strain and subsequently transformed into lysine auxotroph of Mycobacterium bovis BCG strain to generate vaccine BCG.HIVA2auxo. We demonstrated that the episomal plasmid p2auxo.HIVA was stable in vivo over a 7-week period and genetically and phenotypically characterized the BCG.HIVA2auxo vaccine strain. The BCG.HIVA2auxo vaccine in combination with modified vaccinia virus Ankara (MVA). HIVA was safe and induced HIV-1 and Mycobacterium tuberculosis-specific interferon-γ-producing T-cell responses in adult BALB/c mice. Polyfunctional HIV-1-specific CD8+ T cells, which produce interferon-γ and tumor necrosis factor-α and express the degranulation marker CD107a, were induced. Thus, we engineered a novel, safer, good laboratory practice–compatible BCG-vectored vaccine using prototype immunogen HIVA. This antibiotic-free plasmid selection system based on “double” auxotrophic complementation might be a new mycobacterial vaccine platform to develop not only recombinant BCG-based vaccines expressing second generation of HIV-1 immunogens but also other major pediatric pathogens to prime protective response soon after birth. PMID:26015961

Long-term and stable correction of uremic anemia by intramuscular injection of plasmids containing hypoxia-regulated system of erythropoietin expression

PubMed Central

Wang, Yarong; Du, Dewei; Li, Zhanting; Wei, Junxia; Yang, Angang

2012-01-01

Relative deficiency in production of glycoprotein hormone erythropoietin (Epo) is a major cause of renal anemia. This study planned to investigate whether the hypoxia-regulated system of Epo expression, constructed by fusing Epo gene to the chimeric phosphoglycerate kinase (PGK) hypoxia response elements (HRE) in combination with cytomegalovirus immediate-early (CMV IE) basal gene promoter and delivered by plasmid intramuscular injection, might provide a long-term physiologically regulated Epo secretion expression to correct the anemia in adenine-induced uremic rats. Plasmid vectors (pHRE-Epo) were synthesized by fusing human Epo cDNA to the HRE/CMV promoter. Hypoxia-inducible activity of this promoter was evaluated first in vitro and then in vivo in healthy and uremic rats (n = 30 per group). The vectors (pCMV-Epo) in which Epo expression was directed by a constitutive CMV gene promoter served as control. ANOVA and Student's t-test were used to analyze between-group differences. A high-level expression of Epo was induced by hypoxia in vitro and in vivo. Though both pHRE-Epo and pCMV-Epo corrected anemia, the hematocrit of the pCMV-Epo-treated rats exceeded the normal (P < 0.05), but that of the pHRE-Epo-treated rats didn't. Hypoxia-regulated system of Epo gene expression constructed by fusing Epo to the HRE/CMV promoter and delivered by plasmid intramuscular injection may provide a long-term and stable Epo expression and secretion in vivo to correct the anemia in adenine-induced uremic rats. PMID:22990115

Co-transplantation of plasmid-transfected myoblasts and myotubes into rat brains enables high levels of gene expression long-term

NASA Technical Reports Server (NTRS)

Jiao, S.; Williams, P.; Safda, N.; Schultz, E.; Wolff, J. A.

1993-01-01

We have previously proposed the use of primary muscle cells as a "platform," or "vehicle" for intracerebral transgene expression. Brain grafts of minced muscle, or cultured muscle cells persisted in rat brains for at least 6 mo without any decrease in graft size, or tumor formation. Stable, but moderate levels of intracerebral transgene expression were obtained by transplanting plasmid-transfected myotubes in culture. In the present study, high and stable levels of intracerebral transgene expression were achieved by the co-transplantation of plasmid-transfected myoblasts and myotubes in culture. Approximately 5 X 10(5) myoblasts and myotubes were transfected with 10 micrograms pRSVL plasmid DNA, and 30 micrograms Lipofectin (BRL), respectively. They were mixed together (total cell number was 1 million), and stereotactically injected into the caudate nucleus of an adult rat brain. The activity of luciferase, the product of transgene expression, was stable for at least 4 mo, and much higher than the levels in myotube grafts, or co-grafts of myoblasts and minced muscle. Presumably, the myotubes served as a framework on which the myoblasts can form myotubes. The sections of brains transplanted with co-graft of myoblasts, and myotubes transfected with pRSVLac-Z were stained immunofluorescently for beta-galactosidase activity. The muscle grafts contained beta-galactosidase positive myofibers 4 mo after transplantation. Such high and stable levels of in vivo expression after postnatal gene transfer have rarely been achieved. Primary muscle cells are useful vehicle for transgene expression in brains, and potentially valuable for gene therapy of degenerative neurological disorders.

Effects of exogenous IL-37 on the biological characteristics of human lung adenocarcinoma A549 cells and the chemotaxis of regulatory T cells.

PubMed

Chen, Yu-Hua; Zhou, Bi-Yun; Wu, Guo-Cai; Liao, De-Quan; Li, Jing; Liang, Si-Si; Wu, Xian-Jin; Xu, Jun-Fa; Chen, Yong-Hua; Di, Xiao-Qing; Lin, Qiong-Yan

2018-02-14

This study aims to investigate the effects of exogenous interleukin (IL)-37 on the biological characteristics of human lung adenocarcinoma A549 cells and the chemotaxis of regulatory T (Treg) cells. After isolating the CD4+ CD25+ Treg cells from the peripheral blood, flow cytometry was used to detect the purity of the Treg cells. A549 cells were divided into blank (no transfection), empty plasmid (transfection with pIRES2-EGFP empty plasmid) or IL-37 group (transfection with pIRES2-EGFP-IL-37 plasmid). RT-PCR was used to detect mRNA expression of IL-37 and ELISA to determine IL-37 and MMP-9 expressions. Western blotting was applied to detect the protein expressions of PCNA, Ki-67, Cyclin D1, CDK4, cleaved caspase-3 and cleaved caspase-9. MTT assay, flow cytometry, scratch test and transwell assay were performed to detect cell proliferation, cycle, apoptosis, migration and invasion. Effect of exogenous IL-37 on the chemotaxis of Treg cells was measured through transwell assay. Xenograft models in nude mice were eastablished to detect the impact of IL-37 on A549 cells. The IL-37 group had a higher IL-37 expression, cell apoptosis in the early stage and percentage of cells in the G0/G1 phase than the blank and empty plasmid groups. The IL-37 group had a lower MMP-9 expression, optical density (OD), percentage of cells in the S and G2/M phases, migration, invasion and chemotaxis of CD4+CD25+ Foxp3+ Treg cells. The xenograft volume and weight of nude mice in the IL-37 group were lower than those in the blank and empty plasmid groups. Compared with the blank and empty plasmid groups, the IL-37 group had significantly reduced expression of PCNA, Ki-67, Cyclin D1 and CDK4 but elevated expression of cleaved caspase-3 and cleaved caspase-9. Therefore, exogenous IL-37 inhibits the proliferation, migration and invasion of human lung adenocarcinoma A549 cells as well as the chemotaxis of Treg cells while promoting the apoptosis of A549 cells.

Virulence plasmid (pYV)-associated expression of phenotypic virulent determinants in pathogenic Yersinia species: a convenient method for monitoring the presence of pYV under culture conditions and its application for...food

USDA-ARS?s Scientific Manuscript database

In Yersinia pestis, Y. pseudotuberculosis, and Y, enterocolitica, phenotypic expression of virulence plasmid (pYV: 70-kb)-associated genetic determinants may include low calcium response (Lcr, pin point colony, size = 0.36 mm), colony morphology (size = 1.13 mm), crystal violet (CV) binding (dark-v...

Virulence plasmid (pYV)-associated expression of phenotypic virulent determinants in pathogenic Yersinia species: a convenient method for monitoring the presence of pYV under culture conditions and its application for....food

USDA-ARS?s Scientific Manuscript database

In Yersinia pestis, Y. pseudotuberculosis, and Y, enterocolitica, phenotypic expression of several virulence plasmid (pYV: 70-kb)-associated genetic determinants may include low calcium response (Lcr, pin point colony, size = 0.36 mm), colony morphology (size = 1.13 mm), crystal violet (CV) binding...

Down-Regulation of Protein Kinase C-ε by Prolonged Incubation with PMA Inhibits the Proliferation of Vascular Smooth Muscle Cells.

PubMed

Zhou, Huixuan; Wang, Yan; Zhou, Quanhong; Wu, Bin; Wang, Aizhong; Jiang, Wei; Wang, Li

2016-01-01

Phorbol myristate acetate (PMA) exerts a pleiotropic effect on the growth and differentiation of various cells. Protein kinase Cs (PKCs) plays a central role in mediating the effects of PMA on cells. The present study investigated whether the down-regulation of protein kinase C-ε (PKC-ε) is involved in the inhibition of vascular smooth muscle cell (VSMC) proliferation caused by prolonged PMA incubation. Using cell counting, Cell Counting Kit-8 (CCK-8) and EdU incorporation assay on VSMCs, we evaluated the inhibitory effects of prolonged incubation of PMA, of lentiviruses carrying the short-hairpin RNAs (shRNA) of PKC-ε and of the PKC-ε inhibitor peptide on the proliferation and viability of cells. The effect of PKC-ε down-regulation on growth of rat breast cancer SHZ-88 cells was also measured. The prolonged incubation of VSMCs with PMA for up to 72 hours resulted in attenuated cell growth rates in a time-dependent manner. The expression of PKC-ε, as assessed by Western blotting, was also decreased accordingly. Notably, the number of EdU-positive cells and the cell viability of VSMCs were decreased by shRNA of PKC-ε and the PKC-ε inhibitor peptide, respectively. The proliferation of rat breast cancer SHZ-88 cells was also attenuated by lentivirus-induced shRNA silencing of PKC-ε. Prolonged incubation of PMA can inhibit the expression of PKC-ε. The effect results in the inhibition of VSMC proliferation. PKC-ε silencing can also attenuate breast cancer cell growth, suggesting that PKC-ε may be a potential target for anti-cancer drugs. © 2016 The Author(s) Published by S. Karger AG, Basel.

New technology and resources for cryptococcal research

PubMed Central

Zhang, Nannan; Park, Yoon-Dong; Williamson, Peter R.

2014-01-01

Rapid advances in molecular biology and genome sequencing have enabled the generation of new technology and resources for cryptococcal research. RNAi-mediated specific gene knock down has become routine and more efficient by utilizing modified shRNA plasmids and convergent promoter RNAi constructs. This system was recently applied in a high-throughput screen to identify genes involved in host-pathogen interactions. Gene deletion efficiencies have also been improved by increasing rates of homologous recombination through a number of approaches, including a combination of double-joint PCR with split-marker transformation, the use of dominant selectable markers and the introduction of Cre-Loxp systems into Cryptococcus. Moreover, visualization of cryptococcal proteins has become more facile using fusions with codon-optimized fluorescent tags, such as green or red fluorescent proteins or, mCherry. Using recent genome-wide analytical tools, new transcriptional factors and regulatory proteins have been identified in novel virulence-related signaling pathways by employing microarray analysis, RNA-sequencing and proteomic analysis. PMID:25460849

RNA interference against stromal interacting molecule-1 (STIM1) ameliorates ethanol-induced hepatotoxicity.

PubMed

Cui, Ruibing; Li, Rong; Guo, Xiaolan; Jia, Xiaoqing; Yan, Ming

2018-06-01

Previously we have demonstrated that stromal interacting molecule-1 (STIM1) was involved in ethanol induced liver injury. However, the exact pathogenic mechanism of STIM1 in alcoholic liver disease (ALD) is still unknown. We constructed plasmid vectors encoding short-hairpin RNA against STIM1 to investigate its role in ALD in the rat liver cell line BRL and in Sprague-Dawley rats. The results showed that STIM1 targeted sh-RNA (Sh-STIM1) significantly ameliorated ethanol-induced BRL cells injury and liver injury in rats with 20 weeks-induced alcoholic liver disease. Inhibition of STIM1 also reduced intracellular calcium ion concentration, reactive oxygen species (ROS) production, lipid peroxidation, NF-kappa B activation and TNF-α production under ethanol exposure. STIM1 may play an important role in the pathogenesis of alcoholic liver disease. Silencing STIM1 may be effective in preventing alcoholic liver disease. Copyright © 2018 Elsevier B.V. All rights reserved.

Degradation of Substituted Phenylurea Herbicides by Arthrobacter globiformis Strain D47 and Characterization of a Plasmid-Associated Hydrolase Gene, puhA

PubMed Central

Turnbull, Gillian A.; Ousley, Margaret; Walker, Allan; Shaw, Eve; Morgan, J. Alun W.

2001-01-01

Arthrobacter globiformis D47 was shown to degrade a range of substituted phenylurea herbicides in soil. This strain contained two plasmids of approximately 47 kb (pHRIM620) and 34 kb (pHRIM621). Plasmid-curing experiments produced plasmid-free strains as well as strains containing either the 47- or the 34-kb plasmid. The strains were tested for their ability to degrade diuron, which demonstrated that the degradative genes were located on the 47-kb plasmid. Studies on the growth of these strains indicated that the ability to degrade diuron did not offer a selective advantage to A. globiformis D47 on minimal medium designed to contain the herbicide as a sole carbon source. The location of the genes on a plasmid and a lack of selection would explain why the degradative phenotype, as with many other pesticide-degrading bacteria, can be lost on subculture. A 22-kb EcoRI fragment of plasmid pHRIM620 was expressed in Escherichia coli and enabled cells to degrade diuron. Transposon mutagenesis of this fragment identified one open reading frame that was essential for enzyme activity. A smaller subclone of this gene (2.5 kb) expressed in E. coli coded for the protein that degraded diuron. This gene and its predicted protein sequence showed only a low level of protein identity (25% over ca. 440 amino acids) to other database sequences and was named after the enzyme it encoded, phenylurea hydrolase (puhA gene). PMID:11319111

Targeted Elimination of PCDH-PC Expressing Prostate Cancer Cells for Control of Hormone-Resistant Prostate Cancer

DTIC Science & Technology

2008-11-01

or antisense oligonucleotides ( ASOs ) might be useful in preventing the development of castration- recurrent prostate cancer in prostate cancer...patients. To this end, we have created functional shRNA vectors and ASOs capable of suppressing PCDH-PC expression and we have also created a monoclonal...electrophoresed on an SDS-PAGE gel and blotted onto a filter. The filter was probed with an anti-myc antibody. The levels of myc-tagged PCDH-PC protein

A series of vectors to construct lacZ fusions for the study of gene expression in Schizosaccharomyces pombe.

PubMed

Lafuente, M J; Petit, T; Gancedo, C

1997-12-22

We have constructed a series of plasmids to facilitate the fusion of promoters with or without coding regions of genes of Schizosaccharomyces pombe to the lacZ gene of Escherichia coli. These vectors carry a multiple cloning region in which fission yeast DNA may be inserted in three different reading frames with respect to the coding region of lacZ. The plasmids were constructed with the ura4+ or the his3+ marker of S. pombe. Functionality of the plasmids was tested measuring in parallel the expression of fructose 1,6-bisphosphatase and beta-galactosidase under the control of the fbp1+ promoter in different conditions.

A Modified Shuttle Plasmid Facilitates Expression of a Flavin Mononucleotide-Based Fluorescent Protein in Treponema denticola ATCC 35405

PubMed Central

Godovikova, Valentina; Goetting-Minesky, M. Paula; Shin, Jae M.; Kapila, Yvonne L.; Rickard, Alexander H.

2015-01-01

Oral pathogens, including Treponema denticola, initiate the dysregulation of tissue homeostasis that characterizes periodontitis. However, progress of research on the roles of T. denticola in microbe-host interactions and signaling, microbial communities, microbial physiology, and molecular evolution has been hampered by limitations in genetic methodologies. This is typified by an extremely low transformation efficiency and inability to transform the most widely studied T. denticola strain with shuttle plasmids. Previous studies have suggested that robust restriction-modification (R-M) systems in T. denticola contributed to these problems. To facilitate further molecular genetic analysis of T. denticola behavior, we optimized existing protocols such that shuttle plasmid transformation efficiency was increased by >100-fold over prior reports. Here, we report routine transformation of T. denticola ATCC 35405 with shuttle plasmids, independently of both plasmid methylation status and activity of the type II restriction endonuclease encoded by TDE0911. To validate the utility of this methodological advance, we demonstrated expression and activity in T. denticola of a flavin mononucleotide-based fluorescent protein (FbFP) that is active under anoxic conditions. Addition of routine plasmid-based fluorescence labeling to the Treponema toolset will enable more-rigorous and -detailed studies of the behavior of this organism. PMID:26162875

Stable long-term indigo production by overexpression of dioxygenase genes using a chromosomal integrated cascade expression circuit.

PubMed

Royo, Jose Luis; Moreno-Ruiz, Emilia; Cebolla, Angel; Santero, Eduardo

2005-03-16

In our laboratory we have analyzed different factors to maximize the yield in heterologous protein expression for long-term cultivation, by combination of an efficient cascade expression system and stable integration in the bacterial chromosome. In this work, we have explored this system for the production of indigo dye as a model for biotechnological production, by expressing in Escherichia coli the thnA1A2A3A4 genes from Sphingomonas macrogolitabida strain TFA, which encode the components of a tetralin dioxygenase activity. We compared Ptac, and the Pm-based cascade expression circuit in a multicopy plasmid and stably integrated into the bacterial chromosome. Plasmid-based expression systems resulted in instability of indigo production when serially diluted batch experiments were performed without a selective pressure. This problem was solved by integrating the expression module in the chromosome. Despite the gene dosage reduction, the synergic effect of the cascade expression system produced comparable expression to the dioxygenase activity in the plasmid configuration but could be stably maintained for at least 5 days. Here, we show that the cascade amplification circuit integrated in the chromosome could be an excellent system for tight control and stable production of recombinant products.

An electrospun scaffold integrating nucleic acid delivery for treatment of full thickness wounds

PubMed Central

Kobsa, Serge; Kristofik, Nina J.; Sawyer, Andrew J.; Bothwell, Alfred L.M.; Kyriakides, Themis R.; Saltzman, W. Mark

2013-01-01

We developed a multi-functional construct capable of controlled delivery of bioactive substances that can improve wound repair by supporting the intrinsic ability of the skin to heal. We synthesized electrospun scaffolds—composed of a blend of the degradable polymers poly(L-lactide) (PLA) or polycaprolactone (PCL)—that produce highly efficient non-viral in vivo gene delivery to cells in the wound bed, provide a protective barrier during early wound healing, and support cell migration and growth. This multi-functional material was tested for its influence on wound healing: scaffolds were loaded with plasmids encoding keratinocyte growth factor (KGF) and applied to full thickness wounds in mice. Compared to scaffolds with control plasmids, animals receiving the KGF plasmid-loaded scaffold produced significant enhancements in wound healing, which was quantified by improvements in the rate of wound re-epithelialization, keratinocyte proliferation, and granulation response. Further, we quantified the expression level of endogenous and plasmid-derived KGF in wound samples: qRT-PCR on wound sections revealed a correlation between the levels of plasmid-derived protein expression and histological analysis of wound healing, revealing an inverse relationship between the expression level of exogenous KGF and the size of the unhealed epithelial layer in wounds. Our findings suggest that engineered nanofiber PLA/PCL scaffolds are capable of highly efficient controlled DNA delivery and are promising materials for treatment of cutaneous wounds. PMID:23453058

Activation of cellular immunity and marked inhibition of liver cancer in a mouse model following gene therapy and tumor expression of GM-SCF, IL-21, and Rae-1.

PubMed

Cheng, Mingrong; Zhi, Kangkang; Gao, Xiaoyan; He, Bing; Li, Yingchun; Han, Jiang; Zhang, Zhiping; Wu, Yan

2013-12-18

Cancer is both a systemic and a genetic disease. The pathogenesis of cancer might be related to dampened immunity. Host immunity recognizes nascent malignant cells - a process referred to as immune surveillance. Augmenting immune surveillance and suppressing immune escape are crucial in tumor immunotherapy. A recombinant plasmid capable of co-expressing granulocyte-macrophage colony- stimulating factor (GM-SCF), interleukin-21 (IL-21), and retinoic acid early transcription factor-1 (Rae-1) was constructed, and its effects determined in a mouse model of subcutaneous liver cancer. Serum specimens were assayed for IL-2 and INF-γ by ELISA. Liver cancer specimens were isolated for Rae-1 expression by RT-PCR and Western blot, and splenocytes were analyzed by flow cytometry. The recombinant plasmid inhibited the growth of liver cancer and prolonged survival of tumor-loaded mice. Activation of host immunity might have contributed to this effect by promoting increased numbers and cytotoxicity of natural killer (NK) cells and cytotoxic T lymphocytes (CTL) following expression of GM-SCF, IL-21, and Rae-1. By contrast, the frequency of regulatory T cells was decreased, Consequently, activated CTL and NK cells enhanced their secretion of INF-γ, which promoted cytotoxicity of NK cells and CTL. Moreover, active CTL showed dramatic secretion of IL-2, which stimulates CTL. The recombinant expression plasmid also augmented Rae-1 expression by liver cancer cells. Rae-1 receptor expressing CTL and NK cells removed liver cancer. The recombinant expression plasmid inhibited liver cancer by a mechanism that involved activation of cell-mediated immunity and Rae-1 in liver cancer.

High-throughput plasmid construction using homologous recombination in yeast: its mechanisms and application to protein production for X-ray crystallography.

PubMed

Mizutani, Kimihiko

2015-01-01

Homologous recombination is a system for repairing the broken genomes of living organisms by connecting two DNA strands at their homologous sequences. Today, homologous recombination in yeast is used for plasmid construction as a substitute for traditional methods using restriction enzymes and ligases. This method has various advantages over the traditional method, including flexibility in the position of DNA insertion and ease of manipulation. Recently, the author of this review reported the construction of plasmids by homologous recombination in the methanol-utilizing yeast Pichia pastoris, which is known to be an excellent expression host for secretory proteins and membrane proteins. The method enabled high-throughput construction of expression systems of proteins using P. pastoris; the constructed expression systems were used to investigate the expression conditions of membrane proteins and to perform X-ray crystallography of secretory proteins. This review discusses the mechanisms and applications of homologous recombination, including the production of proteins for X-ray crystallography.

Intranasal Delivery of pGDNF Nanoparticles for Parkinson's Disease

NASA Astrophysics Data System (ADS)

Harmon, Brendan Trevor

Parkinson's disease (PD) is a progressive neurodegenerative disorder that primarily affects the dopaminergic A9 nigrostriatal tract. For dopamine neurons specifically, glial cell-derived neurotrophic factor (GDNF) has been shown to promote their survival and proliferation both in culture and in vivo. GDNF has also proven to be neuroprotective and restorative in various animal models of PD and some human clinical trials. However, its delivery to the brain has required invasive surgical routes which are not clinically practical for many patients. The main objective of this project was to test intranasal delivery to the brain of a nanoparticle vector incorporating an expression plasmid for GDNF (pGDNF). The intranasal route circumvents the blood-brain barrier, allowing larger sized vectors into the central nervous system while avoiding peripheral distribution. This approach would provide a renewable source of GDNF within the target areas of the brain, the striatum and the substantia nigra (SN) without the need for surgical injections or frequent re-dosing. A PEGylated polylysine compacted plasmid nanoparticle vector (PEG-CK30), developed by Copernicus Therapeutics, Inc., has been shown to transfect neurons and glial cells in vivo while lacking the safety issues present with other vectors. The first goal of this work was to determine if these PEG-CK30 compacted plasmid nanoparticles can successfully transfect cells and express the reporter protein, enhanced green fluorescent protein (eGFP) in the rat brain after intranasal administration. Initial in vivo experiments utilized the expression plasmid pCG, expressing eGFP under the fast-acting cytomegalovirus (CMV) promoter. Intranasal administration of pCG nanoparticles resulted in evidence of transfection of brain cells, as shown both qualitatively, by GFP-immunohistochemistry, and quantitatively, by GFP-ELISA. Expression was detected throughout the rat brain two days post-administration. Following the proof-of-principle study with pCG, a new plasmid was created by Copernicus Therapeutics, Inc. to better mimic their long-lasting pGDNF plasmid while providing both GDNF as well as the reporter function of eGFP. This eGFP-GDNF plasmid was used to monitor expression and cell-types transfected. This expression plasmid, called pUGG, was first characterized in vitro to verify protein expression. Transfection experiments in SHEP-1 neuroblastoma cells, ventral midbrain cultures, and N27 dopaminergic cells all demonstrated that pUGG expressed bioactive eGFP and GDNF. However, cleavage of the two proteins did not occur and the expressed protein emerged as a fusion construct which was not detectable by GDNF-ELISA, although it was detected by GFP-ELISA. The next goal was to determine if pUGG was able to transfect cells in vivo in rat brain. Direct striatal injection of pUGG nanoparticles showed significant eGFP expression at the site of injection both 7 and 14 days post-administration with no difference in eGFP expression between the two time-points. GFP-immunohistochemistry at the striatal injection site revealed expression of eGFP-positive cells as well as evidence of GDNF's bioactivity as indicated by neurite outgrowth. Moving forward, we administered pUGG nanoparticles intranasally to rats and found significant expression seven days later throughout the brain, with highest levels in the forebrain areas (olfactory bulb and frontal cortex). Significant expression was also seen along the rostral-caudal axis of the brain compared with naked pUGG plasmid. The final goal of this work was to examine whether intranasal pGDNF pre-treatment could generate sufficient GDNF to protect SN dopamine neurons after a unilateral 6-hydroxydopmaine (6-OHDA) lesion, a common animal model for PD. Copernicus' pGDNF plasmid was utilized for the neuroprotection experiments to avoid possible confounds due to the GFP fusion produced by pUGG. Tyrosine hydroxylase-immunostaining density was used as a marker for dopamine neurons in the SN and their nerve terminals in the striatum. Dopamine cell counts were also performed in the SN. Intranasal delivery of pGDNF significantly protected dopamine neurons in the rat 6-OHDA model of PD. This was revealed in three ways. First, pGDNF treatments reduced amphetamine-induced circling behavior, suggesting a prevention of dopamine loss on the 6-OHDA-lesioned side. Second, pGDNF increased TH staining density and dopamine cell counts in the SN on the 6-OHDA-lesioned side. This result was direct evidence of neuroprotection of dopamine cell bodies. Third, pGDNF increased TH staining density in the striatum on the 6-OHDA-lesioned side. This result was direct evidence of protection of dopaminergic nerve terminals. Intranasal pGDNF nanoparticles provided greater neuroprotection than naked pGDNF for all measures. This result was consistent with our previous findings that pGDNF nanoparticles produce more GDNF in brain than the naked plasmid. Collectively, these results demonstrate that intranasal delivery of Copernicus' pGDNF nanoparticles has great clinical potential as a new, non-invasive and non-viral gene therapy approach for early stage Parkinson's disease. By promoting recovery of damaged neurons and preventing further cell loss, symptoms may be reversed and disease progression may be stopped.

Stable transformation of Pleurotus ostreatus to hygromycin B resistance using Lentinus edodes GPD expression signals.

PubMed

Irie, T; Honda, Y; Hirano, T; Sato, T; Enei, H; Watanabe, T; Kuwahara, M

2001-09-01

It was reported that Pleurotus ostreatus was transformed unstably using recombinant plasmids containing a hygromycin B phosphotransferase gene (hph) under the control of Aspergillus nidulans expression signals, and that the plasmids were maintained extrachromosomally in the transformants. Here we report a stable and integrative transformation of the fungus to hygromycin B resistance, using a recombinant hph fused with Lentinus edodes glyceraldehyde-3-phosphate dehydrogenase expression signals. Restriction-enzyme-mediated integration (REMI) was also tried and increased the transformation efficiency about ten-fold.

Relevance of miR-21 in regulation of tumor suppressor gene PTEN in human cervical cancer cells.

PubMed

Peralta-Zaragoza, Oscar; Deas, Jessica; Meneses-Acosta, Angélica; De la O-Gómez, Faustino; Fernández-Tilapa, Gloria; Gómez-Cerón, Claudia; Benítez-Boijseauneau, Odelia; Burguete-García, Ana; Torres-Poveda, Kirvis; Bermúdez-Morales, Victor Hugo; Madrid-Marina, Vicente; Rodríguez-Dorantes, Mauricio; Hidalgo-Miranda, Alfredo; Pérez-Plasencia, Carlos

2016-03-14

Expression of the microRNA miR-21 has been found to be altered in almost all types of cancers and it has been classified as an oncogenic microRNA or oncomir. Due to the critical functions of its target proteins in various signaling pathways, miR-21 is an attractive target for genetic and pharmacological modulation in various cancers. Cervical cancer is the second most common cause of death from cancer in women worldwide and persistent HPV infection is the main etiologic agent. This malignancy merits special attention for the development of new treatment strategies. In the present study we analyze the role of miR-21 in cervical cancer cells. To identify the downstream cellular target genes of upstream miR-21, we silenced endogenous miR-21 expression in a cervical intraepithelial neoplasia-derived cell lines using siRNAs. The effect of miR-21 on gene expression was assessed in cervical cancer cells transfected with the siRNA expression plasmid pSIMIR21. We identified the tumor suppressor gene PTEN as a target of miR-21 and determined the mechanism of its regulation throughout reporter construct plasmids. Using this model, we analyzed the expression of miR-21 and PTEN as well as functional effects such as autophagy and apoptosis induction. In SiHa cells, there was an inverse correlation between miR-21 expression and PTEN mRNA level as well as PTEN protein expression in cervical cancer cells. Transfection with the pSIMIR21 plasmid increased luciferase reporter activity in construct plasmids containing the PTEN-3'-UTR microRNA response elements MRE21-1 and MRE21-2. The role of miR-21 in cell proliferation was also analyzed in SiHa and HeLa cells transfected with the pSIMIR21 plasmid, and tumor cells exhibited markedly reduced cell proliferation along with autophagy and apoptosis induction. We conclude that miR-21 post-transcriptionally down-regulates the expression of PTEN to promote cell proliferation and cervical cancer cell survival. Therefore, it may be a potential therapeutic target in gene therapy for cervical cancer.

Factors modulating expression of Renilla luciferase from control plasmids used in luciferase reporter gene assays1

PubMed Central

Shifera, Amde Selassie; Hardin, John A.

2009-01-01

The Renilla luciferase gene is commonly used as an internal control in luciferase-based reporter gene assays to normalize the values of the experimental reporter gene for variations that could be caused by transfection efficiency and sample handling. Various plasmids encoding Renilla luciferase under different promoter constructs are commercially available. The validity of the use of Renilla luciferase as an internal control is based on the assumption that it is constitutively expressed in transfected cells and that its constitutive expression is not modulated by experimental factors that could result in either the upregulation or the downregulation of the amounts of the enzyme produced. During the past ten years, a number of reports have appeared that identified a variety of conditions that could alter the basal constitutive expression of Renilla luciferase. The use of Renilla luciferase in those circumstances would not be valid and an alternative way of normalization would be necessary. This review covers the factors that have been reported thus far as modulating the expression of Renilla luciferase from plasmid constructs. PMID:19788887

Development of an antibiotic marker-free platform for heterologous protein production in Streptomyces.

PubMed

Sevillano, Laura; Díaz, Margarita; Santamaría, Ramón I

2017-09-26

The industrial use of enzymes produced by microorganisms is continuously growing due to the need for sustainable solutions. Nevertheless, many of the plasmids used for recombinant production of proteins in bacteria are based on the use of antibiotic resistance genes as selection markers. The safety concerns and legal requirements surrounding the increased use of antibiotic resistance genes have made the development of new antibiotic-free approaches essential. In this work, a system completely free of antibiotic resistance genes and useful for the production of high yields of proteins in Streptomyces is described. This system is based on the separation of the two components of the yefM/yoeBsl (antitoxin/toxin) operon; the toxin (yoeBsl) gene, responsible for host death, is integrated into the genome and the antitoxin gene (yefMsl), which inactivates the toxin, is located in the expression plasmid. To develop this system, the toxin gene was integrated into the genome of a strain lacking the complete operon, and the antibiotic resistance gene integrated along with the toxin was eliminated by Cre recombinase to generate a final host strain free of any antibiotic resistance marker. In the same way, the antibiotic resistance gene from the final expression plasmid was removed by Dre recombinase. The usefulness of this system was analysed by checking the production of two hydrolases from different Streptomyces. Production of both proteins, with potential industrial use, was high and stable over time after strain storage and after serial subcultures. These results support the robustness and stability of the positive selection system developed. The total absence of antibiotic resistance genes makes this system a powerful tool for using Streptomyces as a host to produce proteins at the industrial level. This work is the first Streptomyces antibiotic marker-free system to be described. Graphical abstract Antibiotic marker-free platform for protein expression in Streptomyces. The antitoxin gene present in the expression plasmid counteracts the effect of the toxin gene in the genome. In absence of the expression plasmid, the toxin causes cell death ensuring that only plasmid-containing cells persist.

Knock down of the myostatin gene by RNA interference increased body weight in chicken.

PubMed

Bhattacharya, T K; Shukla, R; Chatterjee, R N; Dushyanth, K

2017-01-10

Myostatin is a negative regulator of muscular growth in poultry and other animals. Of several approaches, knocking down the negative regulator is an important aspect to augment muscular growth in chicken. Knock down of myostatin gene has been performed by shRNA acting against the expression of gene in animals. Two methods of knock down of gene in chicken such as embryo manipulation and sperm mediated method have been performed. The hatching percentage in embryo manipulation and sperm mediated method of knock down was 58.0 and 41.5%, respectively. The shRNA in knock down chicken enhanced body weight at 6 weeks by 26.9%. The dressing percentage and serum biochemical parameters such as SGPT and alkaline phosphatase differed significantly (P<0.05) between knock down and control birds. It is concluded that knocking down the myostatin gene successfully augmented growth in chicken. Copyright © 2016 Elsevier B.V. All rights reserved.

Analysis of protein function in clinical C. albicans isolates

PubMed Central

Gerami-Nejad, Maryam; Forche, Anja; McClellan, Mark; Berman, Judith

2012-01-01

Clinical isolates are prototrophic and hence are not amenable to genetic manipulation using nutritional markers. Here we describe a new set of plasmids carrying the NAT1 (nourseothricin) drug resistance marker (Shen et al., 2005) that can be used both in clinical isolates and in laboratory strains. We constructed novel plasmids containing HA-NAT1 or MYC-NAT1 cassettes to facilitate PCR-mediated construction of strains with C-terminal epitope-tagged proteins and a NAT1-pMet3-GFP plasmid to enable conditional expression of proteins with or without the green fluorescent protein fused at the N-terminus. Furthermore, for proteins that require both the endogenous N- and C-termini for function, we have constructed a GF-NAT1-FP cassette carrying truncated alleles that facilitate insertion of an intact, single copy of GFP internal to the coding sequence. In addition, GFP-NAT1, RFP-NAT1, and M-Cherry-NAT1 plasmids were constructed expressing two differently labeled gene products for the study of protein co-expression and co-localization in vivo. Together, these vectors provide a useful set of genetic tools for studying diverse aspects of gene function in C. albicans clinical as well as laboratory strains. PMID:22777821

Combined prime-boost vaccination against tick-borne encephalitis (TBE) using a recombinant vaccinia virus and a bacterial plasmid both expressing TBE virus non-structural NS1 protein

PubMed Central

Aleshin, SE; Timofeev, AV; Khoretonenko, MV; Zakharova, LG; Pashvykina, GV; Stephenson, JR; Shneider, AM; Altstein, AD

2005-01-01

Background Heterologous prime-boost immunization protocols using different gene expression systems have proven to be successful tools in protecting against various diseases in experimental animal models. The main reason for using this approach is to exploit the ability of expression cassettes to prime or boost the immune system in different ways during vaccination procedures. The purpose of the project was to study the ability of recombinant vaccinia virus (VV) and bacterial plasmid, both carrying the NS1 gene from tick-borne encephalitis (TBE) virus under the control of different promoters, to protect mice against lethal challenge using a heterologous prime-boost vaccination protocol. Results The heterologous prime-boost vaccination protocol, using a VV recombinant and bacterial plasmid, both containing the NS1 TBE virus protein gene under the control of different promoters, achieved a high level of protection in mice against lethal challenge with a highly pathogenic TBE virus strain. No signs of pronounced TBE infection were detected in the surviving animals. Conclusion Heterologous prime-boost vaccination protocols using recombinant VV and bacterial plasmids could be used for the development of flavivirus vaccines. PMID:16076390

Hydrodynamic delivery of plasmid DNA encoding human FcγR-Ig dimers blocks immune-complex mediated inflammation in mice.

PubMed

Shashidharamurthy, R; Machiah, D; Bozeman, E N; Srivatsan, S; Patel, J; Cho, A; Jacob, J; Selvaraj, P

2012-09-01

Therapeutic use and function of recombinant molecules can be studied by the expression of foreign genes in mice. In this study, we have expressed human Fcγ receptor-Ig fusion molecules (FcγR-Igs) in mice by administering FcγR-Ig plasmid DNAs hydrodynamically and compared their effectiveness with purified molecules in blocking immune-complex (IC)-mediated inflammation in mice. The concentration of hydrodynamically expressed FcγR-Igs (CD16A(F)-Ig, CD32A(R)-Ig and CD32A(H)-Ig) reached a maximum of 130 μg ml(-1) of blood within 24 h after plasmid DNA administration. The in vivo half-life of FcγR-Igs was found to be 9-16 days and western blot analysis showed that the FcγR-Igs were expressed as a homodimer. The hydrodynamically expressed FcγR-Igs blocked 50-80% of IC-mediated inflammation up to 3 days in a reverse passive Arthus reaction model. Comparative analysis with purified molecules showed that hydrodynamically expressed FcγR-Igs are more efficient than purified molecules in blocking IC-mediated inflammation and had a higher half-life. In summary, these results suggest that the administration of a plasmid vector with the FcγR-Ig gene can be used to study the consequences of blocking IC binding to FcγRs during the development of inflammatory diseases. This approach may have potential therapeutic value in treating IC-mediated inflammatory autoimmune diseases such as lupus, arthritis and autoimmune vasculitis.

In vivo transcription of R-plasmid deoxyribonucleic acid in Escherichia coli strains with altered antibiotic resistance levels and/or conjugal proficiency.

PubMed Central

Davis, R; Vapnek, D

1976-01-01

The amounts of plasmid deoxyribonucleic acid (DNA) and the levels of the in vivo transcription of the Escherichia coli plasmids R538-1 (repressed for conjugal transfer) and R538-1drd (derepressed for transfer) were determined by DNA-DNA hybridization and DNA-ribonucleic acid hybridization, respectively. The results demonstrate that the level of plasmid transcription is increased by two-fold in the strain carrying the derepressed plasmid, compared to an isogenic strain carrying the repressed plasmid, whereas the amount of plasmid DNA is approximately the same, suggesting that the transfer genes are under transcriptional control. Levels of plasmid DNA, plasmid DNA transcription, and chloramphenicol acetyltransferase activity were also compared in a mutant strain that carried the R538-1drd plasmid and was resistant to high levels of antibiotics. This strain produces about 13 copies of plasmid DNA per chromosome compared to five copies for the parent strain. The level of transcription of plasmid DNA was found to be twofold higher in the high-level resistant strain, whereas the level of chloramphenition, acetyltransferase activity was increased by 10-fold. In addition the levels of plasmid DNA transcription and chloramphenicol acetyltransferase activity in the high-level resistant strain were found to be further increased by the presence of high levels of chloramphenicol in the growth medium. The amount of plasmid DNA remained constant under these conditions, indicating that high levels of chloramphenicol can stimulate the expression of plasmid genes at the level of transcription in this strain. PMID:767321

[Analysis of nuclear localization and signal function of MITF protein predisposing to Warrdenburg syndrome].

PubMed

Zhang, Hua; Feng, Juan; Chen, Hongsheng; Li, Jiada; Luo, Hunjin; Feng, Yong

2015-12-01

To study the role of dysfunction of nuclear localization signals (NLS) of MITF protein in the pathogenesis of Waardenburg syndrome. Eukaryotic expression plasmid pCMV-MITF-Flag was used as a template to generate mutant plasmid pCMV-MITF△NLS-Flag by molecular cloning technique in order to design the mutagenic primers. The UACC903 cells were transfected transiently with MITF and MITF△NLS plasmids, and the luciferase activity assays were performed to determine their impact on the transcriptional activities of target gene tyrosinase (TYR). The oligonucleotide 5'-GAACGAAGAAGAAGATTT-3' was subcloned into pEGFP-N1 to generate recombinant eukaryotic expression plasmid pEGFP-N1-MITF-NLS. The NIH3T3 cells were transfected separately with MITF, MITF△NLS, pEGFP-N1 and pEGFP-N1-NLS plasmids, and their subcellular distribution was observed by immunoflorescence assays. Expression plasmids for the mutant MITF△NLS with loss of core NLS sequence and pEGFP-N1-NLS coupled with MITF△NLS were successfully generated. Compared with the wild-type MITF, MITF△NLS was not able to transactivate the transcriptional activities of promoter TYR and did not affect the normal function of MITF. MITF△NLS was only localized in the cytoplasm and pEGFP-N1 was found in both the cytoplasm and nucleus, whereas pEGFP-N1-NLS was mainly located in the nucleus. This study has confirmed the localization function of NLS sequence 213ERRRRF218 within the MITF protein. Mutant MITF with loss of NLS has failed to transactivate the transcriptional activities of target gene TYR, which can result in melanocyte defects and cause WS.

Vaccination of plasmid DNA encoding ORF81 gene of CJ strains of KHV provides protection to immunized carp.

PubMed

Zhou, Jingxiang; Xue, Jiangdong; Wang, Qiuju; Zhu, Xia; Li, Xingwei; Lv, Wenliang; Zhang, Dongming

2014-06-01

In order to construct the recombinant plasmid of pIRES-ORF81, the nucleic acid isolated from Koi herpes virus-CJ (KHV-CJ) strains was used as a template to insert the ORF81 gene fragments amplified by PCR into the pIRES-neo, a kind of eukaryotic expression vector. Using Western blotting analysis, it was verified that ORF81 gene protein can be expressed correctly by pIRES-ORF81, after MFC cells were transfected. The recombinant plasmid pIRES-ORF81 was set into three immunization dose gradients: 1, 10, and 50 μg/carp. Empty plasmid group, PBS group, and blank control group were set simultaneously. Giving intramuscular injections to healthy carps with an average body mass of 246 ± 20 g, indirect ELISA was used to regularly determine antibody levels after three times immunization injection. Neutralizing antibodies were detected by neutralization assay. The results of inoculation tests showed that the pIRES-ORF81 recombinant plasmid can induce the production of carp-specific antibodies. The differences of immune effect between the three different doses of immune gradients were not significant (P > 0.05), but they can induce the production of neutralizing antibodies. After 25 d of inoculation, carp mortality of pIRES-neo empty vector treatment groups was 85%, while the carp mortality of eukaryotic expression recombinant plasmid pIRES-ORF81 injected with three different doses of immune gradients was 20, 17.5, and 12.5%, respectively. Differences in comparison to the control group were highly significant (P < 0.01). However, histopathological section of immunohistochemistry organization revealed no significant changes. It demonstrated that the DNA vaccine pIRES-ORF81 constructed in the experiment displayed a good protective effect against KHV, which had the potential to industrial applications.

A method to facilitate and monitor expression of exogenous genes in the rat kidney using plasmid and viral vectors

PubMed Central

Corridon, Peter R.; Rhodes, George J.; Leonard, Ellen C.; Basile, David P.; Gattone, Vincent H.; Bacallao, Robert L.

2013-01-01

Gene therapy has been proposed as a novel alternative to treat kidney disease. This goal has been hindered by the inability to reliably deliver transgenes to target cells throughout the kidney, while minimizing injury. Since hydrodynamic forces have previously shown promising results, we optimized this approach and designed a method that utilizes retrograde renal vein injections to facilitate transgene expression in rat kidneys. We show, using intravital fluorescence two-photon microscopy, that fluorescent albumin and dextrans injected into the renal vein under defined conditions of hydrodynamic pressure distribute broadly throughout the kidney in live animals. We found injection parameters that result in no kidney injury as determined by intravital microscopy, histology, and serum creatinine measurements. Plasmids, baculovirus, and adenovirus vectors, designed to express EGFP, EGFP-actin, EGFP-occludin, EGFP-tubulin, tdTomato-H2B, or RFP-actin fusion proteins, were introduced into live kidneys in a similar fashion. Gene expression was then observed in live and ex vivo kidneys using two-photon imaging and confocal laser scanning microscopy. We recorded widespread fluorescent protein expression lasting more than 1 mo after introduction of transgenes. Plasmid and adenovirus vectors provided gene transfer efficiencies ranging from 50 to 90%, compared with 10–50% using baculovirus. Using plasmids and adenovirus, fluorescent protein expression was observed 1) in proximal and distal tubule epithelial cells; 2) within glomeruli; and 3) within the peritubular interstitium. In isolated kidneys, fluorescent protein expression was observed from the cortex to the papilla. These results provide a robust approach for gene delivery and the study of protein function in live mammal kidneys. PMID:23467422

Genomic Analysis and Isolation of RNA Polymerase II Dependent Promoters from Spodoptera frugiperda.

PubMed

Bleckmann, Maren; Fritz, Markus H-Y; Bhuju, Sabin; Jarek, Michael; Schürig, Margitta; Geffers, Robert; Benes, Vladimir; Besir, Hüseyin; van den Heuvel, Joop

2015-01-01

The Baculoviral Expression Vector System (BEVS) is the most commonly used method for high expression of recombinant protein in insect cells. Nevertheless, expression of some target proteins--especially those entering the secretory pathway--provides a severe challenge for the baculovirus infected insect cells, due to the reorganisation of intracellular compounds upon viral infection. Therefore, alternative strategies for recombinant protein production in insect cells like transient plasmid-based expression or stable expression cell lines are becoming more popular. However, the major bottleneck of these systems is the lack of strong endogenous polymerase II dependent promoters, as the strong baculoviral p10 and polH promoters used in BEVS are only functional in presence of the viral transcription machinery during the late phase of infection. In this work we present a draft genome and a transcriptome analysis of Sf21 cells for the identification of the first known endogenous Spodoptera frugiperda promoters. Therefore, putative promoter sequences were identified and selected because of high mRNA level or in analogy to other strong promoters in other eukaryotic organism. The chosen endogenous Sf21 promoters were compared to early viral promoters for their efficiency to trigger eGFP expression using transient plasmid based transfection in a BioLector Microfermentation system. Furthermore, promoter activity was not only shown in Sf21 cells but also in Hi5 cells. The novel endogenous Sf21 promoters were ranked according to their activity and expand the small pool of available promoters for stable insect cell line development and transient plasmid expression in insect cells. The best promoter was used to improve plasmid based transient transfection in insect cells substantially.

Inhibition of TRPC3 downregulates airway hyperresponsiveness, remodeling of OVA-sensitized mouse.

PubMed

Wang, Lingwei; Li, Jie; Zhang, Jian; He, Qi; Weng, Xuanwen; Huang, Yanmei; Guan, Minjie; Qiu, Chen

2017-02-26

Airway hyperresponsiveness (AHR), airway remodeling and inflammation are the fundamental pathological alterations that occur in asthma. Transient receptor potential canonical 3 (TRPC3) has been implicated in diverse functions of airway smooth muscle cells (ASMCs) in asthma. However, the underlying mechanisms remain incompletely understood. We investigated the mRNA and protein expression of TRPC3 in ASMCs from normal and OVA-sensitized mouse. And the effects of inhibition or knockdown of TRPC3 with Ethyl-1- (4- (2,3,3-trichloroacrylamide) phenyl) -5 - (trifluoromethyl) -1H -pyrazole -4-carboxylate (Pyr3) and lentiviral shRNA on OVA-sensitized mouse AHR, airway remodeling, circulating inflammatory cytokines, cell proliferation and migration. We found that TRPC3 mRNA and protein expression levels were significantly increased in ASMCs from OVA-sensitized mouse. Inhibiting TRPC3 with continuous subcutaneous administration of Pyr3 decreased enhanced pause (Penh) of OVA-sensitized mouse. Meanwhile, both Pyr3 and lentiviral shRNA treatment of ASMCs in OVA-sensitized mouse significantly decreased their proliferation and migration. These results suggest that TRPC3 plays a critical role in asthma and represents a promising new target for asthma treatment. Copyright © 2016 Elsevier Inc. All rights reserved.

Lactoferrin promote primary rat osteoblast proliferation and differentiation via up-regulation of insulin-like growth factor-1 expression.

PubMed

Hou, Jian-ming; Wu, Man; Lin, Qing-ming; Lin, Fan; Xue, Ying; Lan, Xu-hua; Chen, En-yu; Wang, Mei-li; Yang, Hai-yan; Wang, Feng-xiong

2014-08-01

The aim of this study was to explore the effect of lactoferrin (LF) in primary fetal rat osteoblasts proliferation and differentiation and investigate the underlying molecular mechanisms. Primary rat osteoblasts were obtained from the calvarias of neonatal rats. Osteoblasts were treated with LF (0.1-1000 μg/mL), or OSI-906 [a selective inhibitor of insulin-like growth factor 1 (IGF-1) receptor and insulin receptor]. The IGF-1 was then knocked down by small hairpin RNA (shRNA) technology and then was treated with recombinant human IGF-1 or LF. Cell proliferation and differentiation were measured by MTT assay and alkaline phosphatase (ALP) assay, respectively. The expression of IGF-1 and IGF binding protein 2 (IGFBP2) mRNA were analyzed using real-time PCR. LF promotes the proliferation and differentiation of osteoblasts in a certain range (1-100 μg/mL) in time- and dose-dependent manner. The mRNA level of IGF-1 was significantly increased, while the expression of IGFBP2 was suppressed by LF treatment. Knockdown of IGF-1 by shRNA in primary rat osteoblast dramatically decreased the abilities of proliferation and differentiation of osteoblasts and blocked the proliferation and differentiation effect of LF in osteoblasts. OSI906 (5 μM) blocked the mitogenic and differentiation of LF in osteoblasts. Proliferation and differentiation of primary rat osteoblasts in response to LF are mediated in part by stimulating of IGF-1 gene expression and alterations in the gene expression of IGFBP2.

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Imipenem represses CRISPR-Cas interference of DNA acquisition through H-NS stimulation in Klebsiella pneumoniae.

PubMed

Lin, Tzu-Lung; Pan, Yi-Jiun; Hsieh, Pei-Fang; Hsu, Chun-Ru; Wu, Meng-Chuan; Wang, Jin-Town

2016-08-17

Analysis of the genome of Klebsiella pneumoniae NTUH-K2044 strain revealed the presence of two clustered regularly interspaced short palindromic repeats (CRISPR) arrays separated with CRISPR-associated (cas) genes. Carbapenem-resistant K. pneumoniae isolates were observed to be less likely to have CRISPR-Cas than sensitive strains (5/85 vs. 22/132). Removal of the transcriptional repressor, H-NS, was shown to prevent the transformation of plasmids carrying a spacer and putative proto-spacer adjacent motif (PAM). The CRISPR-Cas system also decreased pUC-4K plasmid stability, resulting in plasmid loss from the bacteria with acquisition of new spacers. Analysis of the acquired proto-spacers in pUC-4K indicated that 5'-TTN-3' was the preferred PAM in K. pneumoniae. Treatment of cells by imipenem induced hns expression, thereby decreasing cas3 expression and consequently repressed CRISPR-Cas activity resulted in increase of plasmid stability. In conclusion, NTUH-K2044 CRISPR-Cas contributes to decrease of plasmid transformation and stability. Through repression of CRISPR-Cas activity by induced H-NS, bacteria might be more able to acquire DNA to confront the challenge of imipenem.

Study of the Efficiency of the Hydroporation for Delivery of Plasmid DNA to the Cells on the Model of Toxic Neuropathy.

PubMed

Yudin, M A; Bykov, V N; Nikiforov, A S; Al-Shekhadat, R I; Ivanov, I M; Ustinova, T M

2018-04-01

We compared the efficiency of delivery of plasmid DNA (active ingredient concentration 1 mg/kg) that provides production of nerve growth factor (NGF) after intravenous administration to rats and after administration by hydroporation. The method of hydroporation ensured plasmid penetration into the liver tissue and lengthened the time of its detection in the organ. DNA concentration in 1 h after its introduction by hydroporation or intravenous route was 0.7 and 0.05 ng/mg tissue, respectively. The use of this transfection method ensured preservation of NGF DNA in the liver tissue at a level of 0.24 ng/mg of tissue 1 day after administration of the plasmid construct, while after intravenous administration, expression of the analyzed DNA was not detected in blood and liver samples. After hydroporation, the maximum of relative normalized expression of cDNA (270 rel. units) was observed after 4 h, and after 1 day, this parameter decreased to 35 rel. units. Introduction of plasmid DNA of NGF by hydroporation prevented the development of disorders of neuromuscular conduction in a rats model of toxic neuropathy induced by subacute administration of malathion in a dose of 0.5 LD 50 .

Imipenem represses CRISPR-Cas interference of DNA acquisition through H-NS stimulation in Klebsiella pneumoniae

PubMed Central

Lin, Tzu-Lung; Pan, Yi-Jiun; Hsieh, Pei-Fang; Hsu, Chun-Ru; Wu, Meng-Chuan; Wang, Jin-Town

2016-01-01

Analysis of the genome of Klebsiella pneumoniae NTUH-K2044 strain revealed the presence of two clustered regularly interspaced short palindromic repeats (CRISPR) arrays separated with CRISPR-associated (cas) genes. Carbapenem-resistant K. pneumoniae isolates were observed to be less likely to have CRISPR-Cas than sensitive strains (5/85 vs. 22/132). Removal of the transcriptional repressor, H-NS, was shown to prevent the transformation of plasmids carrying a spacer and putative proto-spacer adjacent motif (PAM). The CRISPR-Cas system also decreased pUC-4K plasmid stability, resulting in plasmid loss from the bacteria with acquisition of new spacers. Analysis of the acquired proto-spacers in pUC-4K indicated that 5′-TTN-3′ was the preferred PAM in K. pneumoniae. Treatment of cells by imipenem induced hns expression, thereby decreasing cas3 expression and consequently repressed CRISPR-Cas activity resulted in increase of plasmid stability. In conclusion, NTUH-K2044 CRISPR-Cas contributes to decrease of plasmid transformation and stability. Through repression of CRISPR-Cas activity by induced H-NS, bacteria might be more able to acquire DNA to confront the challenge of imipenem. PMID:27531594

Epstein-Barr virus origin of lytic replication mediates association of replicating episomes with promyelocytic leukaemia protein nuclear bodies and replication compartments.

PubMed

Amon, Wolfgang; White, Robert E; Farrell, Paul J

2006-05-01

Epstein-Barr virus (EBV) establishes a latent persistence from which it can be reactivated to undergo lytic replication. Late lytic-cycle gene expression is linked to lytic DNA replication, as it is sensitive to the same inhibitors that block lytic replication, and it has recently been shown that the viral origin of lytic replication (ori lyt) is required in cis for late-gene expression. During the lytic cycle, the viral genome forms replication compartments, which are usually adjacent to promyelocytic leukaemia protein (PML) nuclear bodies. A tetracycline repressor DNA-binding domain-enhanced green fluorescent protein fusion was used to visualize replicating plasmids carrying a tetracycline operator sequence array. ori lyt mediated the production of plasmid replication compartments that were associated with PML nuclear bodies. Plasmids carrying ori lyt and EBV itself were visualized in the same cells and replicated in similar regions of the nucleus, further supporting the validity of the plasmids for studying late-gene regulation.

Minichromosome assembly of non-integrated plasmid DNA transfected into mammalian cells.

PubMed Central

Reeves, R; Gorman, C M; Howard, B

1985-01-01

The nucleoprotein structures formed on various plasmid expression vectors transfected into mammalian cells by both the calcium phosphate and DEAE-dextran methods have been studied. We demonstrate by a variety of means that mammalian cells are capable of rapidly assembling non-integrated circular plasmids (both replicating and non-replicating) into typical "minichromosomes" containing nucleosomes with a 190 bp repetitive spacing. Treatment of recipient cells with sodium butyrate for a short period of time (12-16 h) immediately following transfection markedly increased the DNase I digestion sensitivity of the newly assembled plasmid chromatin. Furthermore, minichromosomes isolated from such butyrate-treated cells are depleted in histone H1 and contain highly acetylated forms of histone H4. These findings are entirely consistent with our earlier speculation (Gorman et al., Nucleic Acids Res. 11, 1044; 1983) that appropriate butyrate treatment might stimulate transient expression of newly transfected genes by facilitating their assembly into an "active" type of chromatin structure. Images PMID:3859838

Design and construction of a first-generation high-throughput integrated robotic molecular biology platform for bioenergy applications.

PubMed

Hughes, Stephen R; Butt, Tauseef R; Bartolett, Scott; Riedmuller, Steven B; Farrelly, Philip

2011-08-01

The molecular biological techniques for plasmid-based assembly and cloning of gene open reading frames are essential for elucidating the function of the proteins encoded by the genes. High-throughput integrated robotic molecular biology platforms that have the capacity to rapidly clone and express heterologous gene open reading frames in bacteria and yeast and to screen large numbers of expressed proteins for optimized function are an important technology for improving microbial strains for biofuel production. The process involves the production of full-length complementary DNA libraries as a source of plasmid-based clones to express the desired proteins in active form for determination of their functions. Proteins that were identified by high-throughput screening as having desired characteristics are overexpressed in microbes to enable them to perform functions that will allow more cost-effective and sustainable production of biofuels. Because the plasmid libraries are composed of several thousand unique genes, automation of the process is essential. This review describes the design and implementation of an automated integrated programmable robotic workcell capable of producing complementary DNA libraries, colony picking, isolating plasmid DNA, transforming yeast and bacteria, expressing protein, and performing appropriate functional assays. These operations will allow tailoring microbial strains to use renewable feedstocks for production of biofuels, bioderived chemicals, fertilizers, and other coproducts for profitable and sustainable biorefineries. Published by Elsevier Inc.

Immune responses of mice immunized by DNA plasmids encoding PCV2 ORF 2 gene, porcine IL-15 or the both.

PubMed

Dong, Bo; Feng, Jing; Lin, Hai; Li, Lanxiang; Su, Dingding; Tu, Di; Zhu, Weijuan; Yang, Qing; Ren, Xiaofeng

2013-11-19

Porcine circovirus type 2 (PCV2) is associated with many kinds of diseases including postweaning multisystemic wasting syndrome (PMWS). It affects the immune system of swine and causes huge epidemic losses every year. In our previous study, we provided evidence that DNA plasmid bearing porcine IL-15 (pVAX-pIL-15) might serve as an immune enhancer for DNA plasmid encoding porcine reproductive and respiratory syndrome virus GP5 gene. In this study, PCV2 open reading frame (ORF)2 gene was cloned into the eukaryotic expression vector pVAX, resulting in the plasmid pVAX-PCV2-ORF2. Transient expression of the plasmid in BHK-21 cells could be detected using immunofluorescence assay. Experimental mice were divided into 5 groups and immunized with PBS, pVAX, pVAX-pIL-15, pVAX-PCV2-ORF2 or pVAX-pIL-15 plus pVAX-PCV2-ORF2. The results showed that the mice co-inoculated with pVAX-PCV2-ORF2 plus pVAX-pIL-15 had higher humoral and cellular immune responses than the others. In addition, DNA plasmid bearing PCV2 ORF2 gene had a protective effect against challenge with PCV2 in mice which could be promoted with the utilization of pIL-15. Copyright © 2013 Elsevier Ltd. All rights reserved.

Characterization of Endogenous Plasmids from Lactobacillus salivarius UCC118▿ †

PubMed Central

Fang, Fang; Flynn, Sarah; Li, Yin; Claesson, Marcus J.; van Pijkeren, Jan-Peter; Collins, J. Kevin; van Sinderen, Douwe; O'Toole, Paul W.

2008-01-01

The genome of Lactobacillus salivarius UCC118 comprises a 1.83-Mb chromosome, a 242-kb megaplasmid (pMP118), and two smaller plasmids of 20 kb (pSF118-20) and 44 kb (pSF118-44). Annotation and bioinformatic analyses suggest that both of the smaller plasmids replicate by a theta replication mechanism. Furthermore, it appears that they are transmissible, although neither possesses a complete set of conjugation genes. Plasmid pSF118-20 encodes a toxin-antitoxin system composed of pemI and pemK homologs, and this plasmid could be cured when PemI was produced in trans. The minimal replicon of pSF118-20 was determined by deletion analysis. Shuttle vector derivatives of pSF118-20 were generated that included the replication region (pLS203) and the replication region plus mobilization genes (pLS208). The plasmid pLS203 was stably maintained without selection in Lactobacillus plantarum, Lactobacillus fermentum, and the pSF118-20-cured derivative strain of L. salivarius UCC118 (strain LS201). Cloning in pLS203 of genes encoding luciferase and green fluorescent protein, and expression from a constitutive L. salivarius promoter, demonstrated the utility of this vector for the expression of heterologous genes in Lactobacillus. This study thus expands the knowledge base and vector repertoire of probiotic lactobacilli. PMID:18390685

Microneedle-mediated transcutaneous immunization with plasmid DNA coated on cationic PLGA nanoparticles

PubMed Central

Kumar, Amit; Wonganan, Piyanuch; Sandoval, Michael A.; Li, Xinran; Zhu, Saijie; Cui, Zhengrong

2012-01-01

Previously, it was shown that microneedle-mediated transcutaneous immunization with plasmid DNA can potentially induce a stronger immune response than intramuscular injection of the same plasmid DNA. In the present study, we showed that the immune responses induced by transcutaneous immunization by applying plasmid DNA onto a skin area pretreated with solid microneedles were significantly enhanced by coating the plasmid DNA on the surface of cationic nanoparticles. In addition, the net surface charge of the DNA-coated nanoparticles significantly affected their in vitro skin permeation and their ability to induce immune responses in vivo. Transcutaneous immunization with plasmid DNA-coated net positively charged anoparticles elicited a stronger immune response than with plasmid DNA-coated net negatively charged nanoparticles or by intramuscular immunization with plasmid DNA alone. Transcutaneous immunization with plasmid DNA-coated net positively charged nanoparticles induced comparable immune responses as intramuscular injection of them, but transcutaneous immunization was able to induce specific mucosal immunity and a more balanced T helper type 1 and type 2 response. The ability of the net positively charged DNA-coated nanoparticles to induce a strong immune response through microneedle-mediated transcutaneous immunization may be attributed to their ability to increase the expression of the antigen gene encoded by the plasmid and to more effectively stimulate the maturation of antigen-presenting cells. PMID:22921518

The 2-micron plasmid as a nonselectable, stable, high copy number yeast vector

NASA Technical Reports Server (NTRS)

Ludwig, D. L.; Bruschi, C. V.

1991-01-01

The endogenous 2-microns plasmid of Saccharomyces cerevisiae has been used extensively for the construction of yeast cloning and expression plasmids because it is a native yeast plasmid that is able to be maintained stably in cells at high copy number. Almost invariably, these plasmid constructs, containing some or all 2-microns sequences, exhibit copy number levels lower than 2-microns and are maintained stably only under selective conditions. We were interested in determining if there was a means by which 2-microns could be utilized for vector construction, without forfeiting either copy number or nonselective stability. We identified sites in the 2-microns plasmid that could be used for the insertion of genetic sequences without disrupting 2-microns coding elements and then assessed subsequent plasmid constructs for stability and copy number in vivo. We demonstrate the utility of a previously described 2-microns recombination chimera, pBH-2L, for the manipulation and transformation of 2-microns as a pure yeast plasmid vector. We show that the HpaI site near the STB element in the 2-microns plasmid can be utilized to clone yeast DNA of at least 3.9 kb with no loss of plasmid stability. Additionally, the copy number of these constructs is as high as levels reported for the endogenous 2-microns.

The Salmonella dublin virulence plasmid mediates systemic but not enteric phases of salmonellosis in cattle.

PubMed Central

Wallis, T S; Paulin, S M; Plested, J S; Watson, P R; Jones, P W

1995-01-01

Plasmid-bearing and plasmid-free isolates and a plasmid-cured strain of Salmonella dublin were compared for virulence in calves. The plasmid-bearing strains were highly virulent, causing severe enteric and systemic disease with high mortality. In contrast, the plasmid-free strains caused diarrhea but only low mortality. The infection kinetics of a wild-type and a derivative plasmid-cured strain were compared. Both strains were isolated in high numbers from intestinal sites at 3 and 6 days after oral challenge and were isolated at comparable frequencies from systemic sites at 3 days, but not at 6 days, when the wild-type strain was predominant. The strains were equally invasive in intestinal epithelia with and without Peyer's patch and elicited comparable secretory and inflammatory responses and intestinal pathology in ligated ileal loops. The effect of the virulence plasmid on growth kinetics and on the outer membrane protein profile was assessed in an in vivo growth chamber. The virulence plasmid did not influence either extracellular growth or the expression of major outer membrane proteins. These observations demonstrate that the virulence plasmid is not involved in either the enteric phase of infection or the systemic dissemination of S. dublin but probably mediates the persistence of S. dublin at systemic sites. PMID:7790094

STAT3 Knockdown Reduces Pancreatic Cancer Cell Invasiveness and Matrix Metalloproteinase-7 Expression in Nude Mice

PubMed Central

Huang, Ke jian; Wu, Wei dong; Jiang, Tao; Cao, Jun; Feng, Zhen zhong; Qiu, Zheng jun

2011-01-01

Aims Transducer and activator of transcription-3 (STAT3) plays an important role in tumor cell invasion and metastasis. The aim of the present study was to investigate the effects of STAT3 knockdown in nude mouse xenografts of pancreatic cancer cells and underlying gene expression. Methods A STAT3 shRNA lentiviral vector was constructed and infected into SW1990 cells. qRT-PCR and western immunoblot were performed to detect gene expression. Nude mouse xenograft assays were used to assess changes in phenotypes of these stable cells in vivo. HE staining was utilized to evaluate tumor cell invasion and immunohistochemistry was performed to analyze gene expression. Results STAT3 shRNA successfully silenced expression of STAT3 mRNA and protein in SW1990 cells compared to control cells. Growth rate of the STAT3-silenced tumor cells in nude mice was significantly reduced compared to in the control vector tumors and parental cells-generated tumors. Tumor invasion into the vessel and muscle were also suppressed in the STAT3-silenced tumors compared to controls. Collagen IV expression was complete and continuous surrounding the tumors of STAT3-silenced SW1990 cells, whereas collagen IV expression was incomplete and discontinuous surrounding the control tumors. Moreover, microvessel density was significantly lower in STAT3-silenced tumors than parental or control tumors of SW1990 cells. In addition, MMP-7 expression was reduced in STAT3-silenced tumors compared to parental SW1990 xenografts and controls. In contrast, expression of IL-1β and IgT7α was not altered. Conclusion These data clearly demonstrate that STAT3 plays an important role in regulation of tumor growth, invasion, and angiogenesis, which could be act by reducing MMP-7 expression in pancreatic cancer cells. PMID:21991388

The role of catechol-O-methyltransferase in catechol-enhanced erythroid differentiation of K562 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Suriguga,; Li, Xiao-Fei; Li, Yang

2013-12-15

Catechol is widely used in pharmaceutical and chemical industries. Catechol is also one of phenolic metabolites of benzene in vivo. Our previous study showed that catechol improved erythroid differentiation potency of K562 cells, which was associated with decreased DNA methylation in erythroid specific genes. Catechol is a substrate for the catechol-O-methyltransferase (COMT)-mediated methylation. In the present study, the role of COMT in catechol-enhanced erythroid differentiation of K562 cells was investigated. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation and induced mRNA expression of erythroid specific genes in K562 cells. Treatment with catechol caused a time- and concentration-dependentmore » increase in guaiacol concentration in the medium of cultured K562 cells. When COMT expression was knocked down by COMT shRNA expression in K562 cells, the production of guaiacol significantly reduced, and the sensitivity of K562 cells to cytotoxicity of catechol significantly increased. Knockdown of COMT expression by COMT shRNA expression also eliminated catechol-enhanced erythroid differentiation of K562 cells. In addition, the pre-treatment with methyl donor S-adenosyl-L-methionine or its demethylated product S-adenosyl-L-homocysteine induced a significant increase in hemin-induced Hb synthesis in K562 cells and the mRNA expression of erythroid specific genes. These findings indicated that O-methylation catalyzed by COMT acted as detoxication of catechol and involved in catechol-enhanced erythroid differentiation of K562 cells, and the production of S-adenosyl-L-homocysteine partly explained catechol-enhanced erythroid differentiation. - Highlights: • Catechol enhanced hemin-induced hemoglobin accumulation. • COMT-catalyzed methylation acted as detoxication of catechol. • COMT involved in catechol-enhanced erythroid differentiation.« less

The tunable pReX expression vector enables optimizing the T7-based production of membrane and secretory proteins in E. coli.

PubMed

Kuipers, Grietje; Karyolaimos, Alexandros; Zhang, Zhe; Ismail, Nurzian; Trinco, Gianluca; Vikström, David; Slotboom, Dirk Jan; de Gier, Jan-Willem

2017-12-16

To optimize the production of membrane and secretory proteins in Escherichia coli, it is critical to harmonize the expression rates of the genes encoding these proteins with the capacity of their biogenesis machineries. Therefore, we engineered the Lemo21(DE3) strain, which is derived from the T7 RNA polymerase-based BL21(DE3) protein production strain. In Lemo21(DE3), the T7 RNA polymerase activity can be modulated by the controlled co-production of its natural inhibitor T7 lysozyme. This setup enables to precisely tune target gene expression rates in Lemo21(DE3). The t7lys gene is expressed from the pLemo plasmid using the titratable rhamnose promoter. A disadvantage of the Lemo21(DE3) setup is that the system is based on two plasmids, a T7 expression vector and pLemo. The aim of this study was to simplify the Lemo21(DE3) setup by incorporating the key elements of pLemo in a standard T7-based expression vector. By incorporating the gene encoding the T7 lysozyme under control of the rhamnose promoter in a standard T7-based expression vector, pReX was created (ReX stands for Regulated gene eXpression). For two model membrane proteins and a model secretory protein we show that the optimized production yields obtained with the pReX expression vector in BL21(DE3) are similar to the ones obtained with Lemo21(DE3) using a standard T7 expression vector. For another secretory protein, a c-type cytochrome, we show that pReX, in contrast to Lemo21(DE3), enables the use of a helper plasmid that is required for the maturation and hence the production of this heme c protein. Here, we created pReX, a T7-based expression vector that contains the gene encoding the T7 lysozyme under control of the rhamnose promoter. pReX enables regulated T7-based target gene expression using only one plasmid. We show that with pReX the production of membrane and secretory proteins can be readily optimized. Importantly, pReX facilitates the use of helper plasmids. Furthermore, the use of pReX is not restricted to BL21(DE3), but it can in principle be used in any T7 RNAP-based strain. Thus, pReX is a versatile alternative to Lemo21(DE3).

A large shRNA library approach identifies lncRNA Ntep as an essential regulator of cell proliferation

PubMed Central

Beermann, Julia; Kirste, Dominique; Iwanov, Katharina; Lu, Dongchao; Kleemiß, Felix; Kumarswamy, Regalla; Schimmel, Katharina; Bär, Christian; Thum, Thomas

2018-01-01

The mammalian cell cycle is a complex and tightly controlled event. Myriads of different control mechanisms are involved in its regulation. Long non-coding RNAs (lncRNA) have emerged as important regulators of many cellular processes including cellular proliferation. However, a more global and unbiased approach to identify lncRNAs with importance for cell proliferation is missing. Here, we present a lentiviral shRNA library-based approach for functional lncRNA profiling. We validated our library approach in NIH3T3 (3T3) fibroblasts by identifying lncRNAs critically involved in cell proliferation. Using stringent selection criteria we identified lncRNA NR_015491.1 out of 3842 different RNA targets represented in our library. We termed this transcript Ntep (non-coding transcript essential for proliferation), as a bona fide lncRNA essential for cell cycle progression. Inhibition of Ntep in 3T3 and primary fibroblasts prevented normal cell growth and expression of key fibroblast markers. Mechanistically, we discovered that Ntep is important to activate P53 concomitant with increased apoptosis and cell cycle blockade in late G2/M. Our findings suggest Ntep to serve as an important regulator of fibroblast proliferation and function. In summary, our study demonstrates the applicability of an innovative shRNA library approach to identify long non-coding RNA functions in a massive parallel approach. PMID:29099486

Novel high throughput pooled shRNA screening identifies NQO1 as a potential drug target for host directed therapy for tuberculosis

PubMed Central

Li, Qing; Karim, Ahmad F.; Ding, Xuedong; Das, Biswajit; Dobrowolski, Curtis; Gibson, Richard M.; Quiñones-Mateu, Miguel E.; Karn, Jonathan; Rojas, Roxana E.

2016-01-01

Chemical regulation of macrophage function is one key strategy for developing host-directed adjuvant therapies for tuberculosis (TB). A critical step to develop these therapies is the identification and characterization of specific macrophage molecules and pathways with a high potential to serve as drug targets. Using a barcoded lentivirus-based pooled short-hairpin RNA (shRNA) library combined with next generation sequencing, we identified 205 silenced host genes highly enriched in mycobacteria-resistant macrophages. Twenty-one of these “hits” belonged to the oxidoreductase functional category. NAD(P)H:quinone oxidoreductase 1 (NQO1) was the top oxidoreductase “hit”. NQO1 expression was increased after mycobacterial infection, and NQO1 knockdown increased macrophage differentiation, NF-κB activation, and the secretion of pro-inflammatory cytokines TNF-α and IL-1β in response to infection. This suggests that mycobacteria hijacks NQO1 to down-regulate pro-inflammatory and anti-bacterial functions. The competitive inhibitor of NQO1 dicoumarol synergized with rifampin to promote intracellular killing of mycobacteria. Thus, NQO1 is a new host target in mycobacterial infection that could potentially be exploited to increase antibiotic efficacy in vivo. Our findings also suggest that pooled shRNA libraries could be valuable tools for genome-wide screening in the search for novel druggable host targets for adjunctive TB therapies. PMID:27297123

Role of IncP-1β Plasmids pWDL7::rfp and pNB8c in Chloroaniline Catabolism as Determined by Genomic and Functional Analyses

PubMed Central

Król, J. E.; Penrod, J. T.; McCaslin, H.; Rogers, L. M.; Yano, H.; Stancik, A. D.; Dejonghe, W.; Brown, C. J.; Parales, R. E.; Wuertz, S.

2012-01-01

Broad-host-range catabolic plasmids play an important role in bacterial degradation of man-made compounds. To gain insight into the role of these plasmids in chloroaniline degradation, we determined the first complete nucleotide sequences of an IncP-1 chloroaniline degradation plasmid, pWDL7::rfp and its close relative pNB8c, as well as the expression pattern, function, and bioaugmentation potential of the putative 3-chloroaniline (3-CA) oxidation genes. Based on phylogenetic analysis of backbone proteins, both plasmids are members of a distinct clade within the IncP-1β subgroup. The plasmids are almost identical, but whereas pWDL7::rfp carries a duplicate inverted catabolic transposon, Tn6063, containing a putative 3-CA oxidation gene cluster, dcaQTA1A2BR, pNB8c contains only a single copy of the transposon. No genes for an aromatic ring cleavage pathway were detected on either plasmid, suggesting that only the upper 3-CA degradation pathway was present. The dcaA1A2B gene products expressed from a high-copy-number vector were shown to convert 3-CA to 4-chlorocatechol in Escherichia coli. Slight differences in the dca promoter region between the plasmids and lack of induction of transcription of the pNB8c dca genes by 3-CA may explain previous findings that pNB8C does not confer 3-CA transformation. Bioaugmentation of activated sludge with pWDL7::rfp accelerated removal of 3-CA, but only in the presence of an additional carbon source. Successful bioaugmentation requires complementation of the upper pathway genes with chlorocatechol cleavage genes in indigenous bacteria. The genome sequences of these plasmids thus help explain the molecular basis of their catabolic activities. PMID:22101050

Hydrophobic and electrostatic interactions between cell penetrating peptides and plasmid DNA are important for stable non-covalent complexation and intracellular delivery.

PubMed

Upadhya, Archana; Sangave, Preeti C

2016-10-01

Cell penetrating peptides are useful tools for intracellular delivery of nucleic acids. Delivery of plasmid DNA, a large nucleic acid, poses a challenge for peptide mediated transport. The paper investigates and compares efficacy of five novel peptide designs for complexation of plasmid DNA and subsequent delivery into cells. The peptides were designed to contain reported DNA condensing agents and basic cell penetrating sequences, octa-arginine (R 8 ) and CHK 6 HC coupled to cell penetration accelerating peptides such as Bax inhibitory mutant peptide (KLPVM) and a peptide derived from the Kaposi fibroblast growth factor (kFGF) membrane translocating sequence. A tryptophan rich peptide, an analogue of Pep-3, flanked with CH 3 on either ends was also a part of the study. The peptides were analysed for plasmid DNA complexation, protection of peptide-plasmid DNA complexes against DNase I, serum components and competitive ligands by simple agarose gel electrophoresis techniques. Hemolysis of rat red blood corpuscles (RBCs) in the presence of the peptides was used as a measure of peptide cytotoxicity. Plasmid DNA delivery through the designed peptides was evaluated in two cell lines, human cervical cancer cell line (HeLa) and (NIH/3 T3) mouse embryonic fibroblasts via expression of the secreted alkaline phosphatase (SEAP) reporter gene. The importance of hydrophobic sequences in addition to cationic sequences in peptides for non-covalent plasmid DNA complexation and delivery has been illustrated. An alternative to the employment of fatty acid moieties for enhanced gene transfer has been proposed. Comparison of peptides for plasmid DNA complexation and delivery of peptide-plasmid DNA complexes to cells estimated by expression of a reporter gene, SEAP. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd.

Treatment with Cefotaxime Affects Expression of Conjugation Associated Proteins and Conjugation Transfer Frequency of an IncI1 Plasmid in Escherichia coli

PubMed Central

Møller, Thea S. B.; Liu, Gang; Boysen, Anders; Thomsen, Line E.; Lüthje, Freja L.; Mortensen, Sisse; Møller-Jensen, Jakob; Olsen, John E.

2017-01-01

Horizontal gene transfer (HGT) is the major mechanism responsible for spread of antibiotic resistance. Antibiotic treatment has been suggested to promote HGT, either by directly affecting the conjugation process itself or by selecting for conjugations subsequent to DNA transfer. However, recent research suggests that the effect of antibiotic treatment on plasmid conjugation frequencies, and hence the spread of resistance plasmids, may have been overestimated. We addressed the question by quantifying transfer proteins and conjugation frequencies of a blaCTX−M−1 encoding IncI1 resistance plasmid in Escherichia coli MG1655 in the presence and absence of therapeutically relevant concentrations of cefotaxime (CTX). Analysis of the proteome by iTRAQ labeling and liquid chromatography tandem mass spectrometry revealed that Tra proteins were significantly up-regulated in the presence of CTX. The up-regulation of the transfer machinery was confirmed at the transcriptional level for five selected genes. The CTX treatment did not cause induction of the SOS-response as revealed by absence of significantly regulated SOS associated proteins in the proteome and no significant up-regulation of recA and sfiA genes. The frequency of plasmid conjugation, measured in an antibiotic free environment, increased significantly when the donor was pre-grown in broth containing CTX compared to growth without this drug, regardless of whether blaCTX-M-1 was located on the plasmid or in trans on the chromosome. The results shows that antibiotic treatment can affect expression of a plasmid conjugation machinery and subsequent DNA transfer. PMID:29238335

Novel Minicircle Vector for Gene Therapy in Murine Myocardial Infarction

PubMed Central

Huang, Mei; Chen, ZhiYing; Hu, Shijun; Jia, Fangjun; Li, Zongjin; Hoyt, Grant; Robbins, Robert C.; Kay, Mark A.; Wu, Joseph C.

2011-01-01

Background Conventional plasmids for gene therapy produce low-level and short-term gene expression. In this study, we develop a novel non-viral vector which robustly and persistently expresses the hypoxia inducible factor-1 alpha (HIF-1α) therapeutic gene in the heart, leading to functional benefits following myocardial infarction (MI). Methods and Results We first created minicircles carrying double fusion (MC-DF) reporter gene consisting of firefly luciferase and enhanced green fluorescent protein (Fluc-eGFP) for noninvasive measurement of transfection efficiency. Mouse C2C12 myoblasts and normal FVB mice were used for in vitro and in vivo confirmation, respectively. Bioluminescence imaging (BLI) showed stable minicircle gene expression in the heart for >12 weeks and the activity level was 5.6±1.2 fold stronger than regular plasmid at day 4 (P<0.01). Next, we created minicircles carrying hypoxia inducible factor-1 alpha (MC-HIF-1α) therapeutic gene for treatment of MI. Adult FVB mice underwent LAD ligation and were injected intramyocardially with (1) MC-HIF-1α, (2) regular plasmid carrying HIF-1α (PL-HIF-1α) as positive control, and (3) PBS as negative control (n=10/group). Echocardiographic study showed a significantly greater improvement of left ventricular ejection fraction (LVEF) in the minicircle group (51.3%±3.6%) compared to regular plasmid group (42.3%±4.1%) and saline group (30.5%±2.8%) at week 4 (P<0.05 for both). Histology demonstrated increased neoangiogenesis in both treatment groups. Finally, Western blot showed minicircles express >50% higher HIF-1α level than regular plasmid. Conclusion Taken together, this is the first study to demonstrate that minicircles can significantly improve transfection efficiency, duration of transgene expression, and cardiac contractility. Given the serious drawbacks associated with most viral vectors, we believe this novel non-viral vector can be of great value for cardiac gene therapy protocols. PMID:19752373

Plasmids containing the gene for DNA polymerase I from Streptococcus pneumoniae

DOEpatents

Lacks, S.A.; Martinez, S.; Lopez, P.; Espinosa, M.

1991-03-26

A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of Streptococcus pneumoniae. Plasmid pSM22, the vector containing the pneumocccal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme. 1 figure.

Effects of APC De-targeting and GAr modification on the duration of luciferase expression from plasmid DNA delivered to skeletal muscle.

PubMed

Subang, Maria C; Fatah, Rewas; Wu, Ying; Hannaman, Drew; Rice, Jason; Evans, Claire F; Chernajovsky, Yuti; Gould, David

2015-01-01

Immune responses to expressed foreign transgenes continue to hamper progress of gene therapy development. Translated foreign proteins with intracellular location are generally less accessible to the immune system, nevertheless they can be presented to the immune system through both MHC Class I and Class II pathways. When the foreign protein luciferase was expressed following intramuscular delivery of plasmid DNA in outbred mice, expression rapidly declined over 4 weeks. Through modifications to the expression plasmid and the luciferase transgene we examined the effect of detargeting expression away from antigen-presenting cells (APCs), targeting expression to skeletal muscle and fusion with glycine-alanine repeats (GAr) that block MHC-Class I presentation on the duration of luciferase expression. De-targeting expression from APCs with miR142-3p target sequences incorporated into the luciferase 3'UTR reduced the humoral immune response to both native and luciferase modified with a short GAr sequence but did not prolong the duration of expression. When a skeletal muscle specific promoter was combined with the miR target sequences the humoral immune response was dampened and luciferase expression persisted at higher levels for longer. Interestingly, fusion of luciferase with a longer GAr sequence promoted the decline in luciferase expression and increased the humoral immune response to luciferase. These studies demonstrate that expression elements and transgene modifications can alter the duration of transgene expression but other factors will need to overcome before foreign transgenes expressed in skeletal muscle are immunologically silent.

[Establishment and identification of mouse lymphoma cell line EL4 expressing red fluorescent protein].

PubMed

Li, Yan-Jie; Cao, Jiang; Chen, Chong; Wang, Dong-Yang; Zeng, Ling-Yu; Pan, Xiu-Ying; Xu, Kai-Lin

2010-02-01

This study was purposed to construct a lentiviral vector encoding red fluorescent protein (DsRed) and transfect DsRed into EL4 cells for establishing mouse leukemia/lymphoma model expressing DsRed. The bicistronic SIN lentiviral transfer plasmid containing the genes encoding neo and internal ribosomal entry site-red fluorescent protein (IRES-DsRed) was constructed. Human embryonic kidney 293FT cells were co-transfected with the three plasmids by liposome method. The viral particles were collected and used to transfect EL4 cells, then the cells were selected by G418. The results showed that the plasmid pXZ208-neo-IRES-DsRed was constructed successfully, and the viral titer reached to 10(6) U/ml. EL4 cells were transfected by the viral solution efficiently. The transfected EL4 cells expressing DsRed survived in the final concentration 600 microg/ml of G418. The expression of DsRed in the transfected EL4 cells was demonstrated by fluorescence microscopy and flow cytometry. In conclusion, the EL4/DsRed cell line was established successfully.

Human Immunodeficiency Virus Tat-Activated Expression of Poliovirus Protein 2A Inhibits mRNA Translation

NASA Astrophysics Data System (ADS)

Sun, Xiao-Hong; Baltimore, David

1989-04-01

To study the effect of poliovirus protein 2A on cellular RNA translation, the tat control system of human immunodeficiency virus (HIV) was used. Protein 2A was expressed from a plasmid construct (pHIV/2A) incorporating the HIV long terminal repeat. Protein synthesis was measured by using chloramphenicol acetyltransferase as a reporter gene driven by the Rous sarcoma virus long terminal repeat. When HIV/2A was contransfected with the reporter, addition of a tat-producing plasmid caused at least a 50-fold drop in chloramphenicol acetyltransferase synthesis. A HeLa cell line carrying HIV/2A was established. In it, tat expression caused more than a 10-fold drop in chloramphenicol acetyltransferase synthesis from the reporter plasmid. Furthermore, 2A induction by tat caused cleavage of the cellular translation factor P220, a part of eukaryotic translation initiation factor 4F. Thus protein 2A can, by itself, carry out the inhibition of cellular protein synthesis characteristic of a poliovirus infection. Also, the HIV tat activation provides a very effective method to control gene expression in mammalian cells.

Analysis of Microbe-Associated Molecular Pattern-Responsive Synthetic Promoters with the Parsley Protoplast System.

PubMed

Kanofsky, Konstantin; Lehmeyer, Mona; Schulze, Jutta; Hehl, Reinhard

2016-01-01

Plants recognize pathogens by microbe-associated molecular patterns (MAMPs) and subsequently induce an immune response. The regulation of gene expression during the immune response depends largely on cis-sequences conserved in promoters of MAMP-responsive genes. These cis-sequences can be analyzed by constructing synthetic promoters linked to a reporter gene and by testing these constructs in transient expression systems. Here, the use of the parsley (Petroselinum crispum) protoplast system for analyzing MAMP-responsive synthetic promoters is described. The synthetic promoter consists of four copies of a potential MAMP-responsive cis-sequence cloned upstream of a minimal promoter and the uidA reporter gene. The reporter plasmid contains a second reporter gene, which is constitutively expressed and hence eliminates the requirement of a second plasmid used as a transformation control. The reporter plasmid is transformed into parsley protoplasts that are elicited by the MAMP Pep25. The MAMP responsiveness is validated by comparing the reporter gene activity from MAMP-treated and untreated cells and by normalizing reporter gene activity using the constitutively expressed reporter gene.

GFP as a marker for transient gene transfer and expression in Mycoplasma hyorhinis.

PubMed

Ishag, Hassan Z A; Liu, Maojun; Yang, Ruosong; Xiong, Qiyan; Feng, Zhixin; Shao, Guoqing

2016-01-01

Mycoplasma hyorhinis (M. hyorhinis) is an opportunistic pathogen of pigs and has been shown to transform cell cultures, which has increased the interest of researchers. The green florescence proteins (GFP) gene of Aquorea victoria, proved to be a vital marker to identify transformed cells in mixed populations. Use of GFP to observe gene transfer and expression in M. hyorhinis (strain HUB-1) has not been described. We have constructed a pMD18-O/MHRgfp plasmid containing the p97 gene promoter, origin of replication, tetracycline resistance marker and GFP gene controlled by the p97 gene promoter. The plasmid transformed into M. hyorhinis with a frequency of ~4 × 10(-3) cfu/µg plasmid DNA and could be detected by PCR amplification of the GFP gene from the total DNA of the transformant mycoplasmas. Analysis of a single clone grown on KM2-Agar containing tetracycline, showed a green fluorescence color. Conclusively, this report suggests the usefulness of GFP to monitor transient gene transfer and expression in M. hyorhinis, eventually minimizing screening procedures for gene transfer and expression.

Persistent interferon transgene expression by RNA interference-mediated silencing of interferon receptors.

PubMed

Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu

2010-09-01

The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.

[Prokaryotic expression and histological localization of the Taenia solium CDC37 gene].

PubMed

Huang, Jiang; Li, Bo; Dai, Jia-Lin; Zhang, Ai-Hua

2013-02-01

To express Taenia solium gene encoding cell division cycle 37 protein (TsCDC37) and investigate its antigenicity and localization in adults of Taenia solium. The complete coding sequence of TsCDC37 was amplified by PCR based on the recombinant plasmid clone from the cDNA library of adult Taenia solium. The PCR product was cloned into a prokaryotic expression vector pET-28a (+). The recombinant expression plasmid was identified by PCR, double endonuclease digestion and sequencing. The recombinant plasmid was transformed into E. coli BL21/DE3 and followed by expression of the protein induced by IPTG. The mice were immunized subcutaneously with purified recombinant TsCDC37 formulated in Freund's adjuvant. The antigenicity of the recombinant protein was examined by Western blotting. The localization of TsCDC37 in adult worms was demonstrated by immunofluorescent technique. The recombinant expression vector was constructed successfully. The recombinant protein was about M(r) 52 000, it was then purified and specifically recognized by immuno sera of SD rats and sera from patients infected with Taenia solium, Taenia saginata or Taenia asiatica. The immunofluorescence assay revealed that TsCDC37 located at the tegument of T. solium adult and the eggs. TsCDC37 gene has been expressed with immunoreactivity. The recombinant protein is mainly expressed in tegument and egg, and is a common antigen of the three human taenia cestodes.

Systemic delivery of shRNA by AAV9 provides highly efficient knockdown of ubiquitously expressed GFP in mouse heart, but not liver.

PubMed

Piras, Bryan A; O'Connor, Daniel M; French, Brent A

2013-01-01

AAV9 is a powerful gene delivery vehicle capable of providing long-term gene expression in a variety of cell types, particularly cardiomyocytes. The use of AAV-delivery for RNA interference is an intense area of research, but a comprehensive analysis of knockdown in cardiac and liver tissues after systemic delivery of AAV9 has yet to be reported. We sought to address this question by using AAV9 to deliver a short-hairpin RNA targeting the enhanced green fluorescent protein (GFP) in transgenic mice that constitutively overexpress GFP in all tissues. The expression cassette was initially tested in vitro and we demonstrated a 61% reduction in mRNA and a 90% reduction in GFP protein in dual-transfected 293 cells. Next, the expression cassette was packaged as single-stranded genomes in AAV9 capsids to test cardiac GFP knockdown with several doses ranging from 1.8×10(10) to 1.8×10(11) viral genomes per mouse and a dose-dependent response was obtained. We then analyzed GFP expression in both heart and liver after delivery of 4.4×10(11) viral genomes per mouse. We found that while cardiac knockdown was highly efficient, with a 77% reduction in GFP mRNA and a 71% reduction in protein versus control-treated mice, there was no change in liver expression. This was despite a 4.5-fold greater number of viral genomes in the liver than in the heart. This study demonstrates that single-stranded AAV9 vectors expressing shRNA can be used to achieve highly efficient cardiac-selective knockdown of GFP expression that is sustained for at least 7 weeks after the systemic injection of 8 day old mice, with no change in liver expression and no evidence of liver damage despite high viral genome presence in the liver.

A Bivalent Typhoid Live Vector Vaccine Expressing both Chromosome- and Plasmid-Encoded Yersinia pestis Antigens Fully Protects against Murine Lethal Pulmonary Plague Infection

PubMed Central

Wang, Jin Yuan; Carrasco, Jose A.; Lloyd, Scott A.; Mellado-Sanchez, Gabriela; Diaz-McNair, Jovita; Franco, Olga; Buskirk, Amanda D.; Nataro, James P.; Pasetti, Marcela F.

2014-01-01

Live attenuated bacteria hold great promise as multivalent mucosal vaccines against a variety of pathogens. A major challenge of this approach has been the successful delivery of sufficient amounts of vaccine antigens to adequately prime the immune system without overattenuating the live vaccine. Here we used a live attenuated Salmonella enterica serovar Typhi strain to create a bivalent mucosal plague vaccine that produces both the protective F1 capsular antigen of Yersinia pestis and the LcrV protein required for secretion of virulence effector proteins. To reduce the metabolic burden associated with the coexpression of F1 and LcrV within the live vector, we balanced expression of both antigens by combining plasmid-based expression of F1 with chromosomal expression of LcrV from three independent loci. The immunogenicity and protective efficacy of this novel vaccine were assessed in mice by using a heterologous prime-boost immunization strategy and compared to those of a conventional strain in which F1 and LcrV were expressed from a single low-copy-number plasmid. The serum antibody responses to lipopolysaccharide (LPS) induced by the optimized bivalent vaccine were indistinguishable from those elicited by the parent strain, suggesting an adequate immunogenic capacity maintained through preservation of bacterial fitness; in contrast, LPS titers were 10-fold lower in mice immunized with the conventional vaccine strain. Importantly, mice receiving the optimized bivalent vaccine were fully protected against lethal pulmonary challenge. These results demonstrate the feasibility of distributing foreign antigen expression across both chromosomal and plasmid locations within a single vaccine organism for induction of protective immunity. PMID:25332120

Genetic manipulation of Treponema denticola.

PubMed

Kuramitsu, Howard K; Chi, Bo; Ikegami, Akihiko

2005-07-01

The oral anaerobic spirochete, Treponema denticola, has been implicated in the etiology of human periodontal diseases; however, the molecular basis for the virulence of these organisms is still unclear. Potential pathogenic factors expressed by T. denticola have recently begun to be identified through the development of gene transfer approaches in this organism following electroporetic transformation. Several antibiotic resistance markers have been developed for use in the construction of monospecific mutants in these organisms. In addition, these antibiotic resistance cassettes have been more recently utilized to construct shuttle plasmids for complementation analysis of the mutants. These plasmids were also used to express heterologous spirochete genes in T. denticola. The transformation of other spirochetes such as T. phagedenis with these plasmids further suggests that it should be possible to develop similar gene transfer systems in other cultivable treponemes.

Plasmids containing the gene for DNA polymerase I from Streptococcus pneumoniae

DOEpatents

Lacks, S.A.; Martinez, S.; Lopez, P.; Espinosa, M.

1987-08-28

A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of /und Streptococcus/ /und pneumoniae/. Plasmid pSM22, the vector containing the pneumococcal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme. 1 fig., 1 tab.

Role of plasmids in Lactobacillus brevis BSO 464 hop tolerance and beer spoilage.

PubMed

Bergsveinson, Jordyn; Baecker, Nina; Pittet, Vanessa; Ziola, Barry

2015-02-01

Specific isolates of lactic acid bacteria (LAB) can grow in the harsh beer environment, thus posing a threat to brew quality and the economic success of breweries worldwide. Plasmid-localized genes, such as horA, horC, and hitA, have been suggested to confer hop tolerance, a trait required for LAB survival in beer. The presence and expression of these genes among LAB, however, do not universally correlate with the ability to grow in beer. Genome sequencing of the virulent beer spoilage organism Lactobacillus brevis BSO 464 revealed the presence of eight plasmids, with plasmids 1, 2, and 3 containing horA, horC, and hitA, respectively. To investigate the roles that these and the other five plasmids play in L. brevis BSO 464 growth in beer, plasmid curing with novobiocin was used to derive 10 plasmid variants. Multiplex PCRs were utilized to determine the presence or absence of each plasmid, and how plasmid loss affected hop tolerance and growth in degassed (noncarbonated) beer was assessed. Loss of three of the eight plasmids was found to affect hop tolerance and growth in beer. Loss of plasmid 2 (horC and 28 other genes) had the most dramatic effect, with loss of plasmid 4 (120 genes) and plasmid 8 (47 genes) having significant, but smaller, impacts. These results support the contention that genes on mobile genetic elements are essential for bacterial growth in beer and that beer spoilage ability is not dependent solely on the three previously described hop tolerance genes or on the chromosome of a beer spoilage LAB isolate.

Role of Plasmids in Lactobacillus brevis BSO 464 Hop Tolerance and Beer Spoilage

PubMed Central

Bergsveinson, Jordyn; Baecker, Nina; Pittet, Vanessa

2014-01-01

Specific isolates of lactic acid bacteria (LAB) can grow in the harsh beer environment, thus posing a threat to brew quality and the economic success of breweries worldwide. Plasmid-localized genes, such as horA, horC, and hitA, have been suggested to confer hop tolerance, a trait required for LAB survival in beer. The presence and expression of these genes among LAB, however, do not universally correlate with the ability to grow in beer. Genome sequencing of the virulent beer spoilage organism Lactobacillus brevis BSO 464 revealed the presence of eight plasmids, with plasmids 1, 2, and 3 containing horA, horC, and hitA, respectively. To investigate the roles that these and the other five plasmids play in L. brevis BSO 464 growth in beer, plasmid curing with novobiocin was used to derive 10 plasmid variants. Multiplex PCRs were utilized to determine the presence or absence of each plasmid, and how plasmid loss affected hop tolerance and growth in degassed (noncarbonated) beer was assessed. Loss of three of the eight plasmids was found to affect hop tolerance and growth in beer. Loss of plasmid 2 (horC and 28 other genes) had the most dramatic effect, with loss of plasmid 4 (120 genes) and plasmid 8 (47 genes) having significant, but smaller, impacts. These results support the contention that genes on mobile genetic elements are essential for bacterial growth in beer and that beer spoilage ability is not dependent solely on the three previously described hop tolerance genes or on the chromosome of a beer spoilage LAB isolate. PMID:25501474

The mechanism of opiorphin-induced experimental priapism in rats involves activation of the polyamine synthetic pathway.

PubMed

Kanika, Nirmala Devi; Tar, Moses; Tong, Yuehong; Kuppam, Dwaraka Srinivasa Rao; Melman, Arnold; Davies, Kelvin Paul

2009-10-01

Intracorporal injection of plasmids encoding opiorphins into retired breeder rats can result in animals developing a priapic-like condition. Microarray analysis demonstrated that following intracorporal gene transfer of plasmids expressing opiorphins the most significantly upregulated gene in corporal tissue was the ornithine decarboxylase gene (ODC). Quantitative RT-PCR confirmed the upregulation of ODC, as well as other genes involved in polyamine synthesis, such as arginase-I and -II, polyamine oxidase, spermidine synthase, spermidine acetyltransferase (SAT), and S-adenosylmethionine decarboxylase. Western blot analysis demonstrated upregulation of arginase-I and -II, ODC, and SAT at the protein level. Levels of the polyamine putrescine were upregulated in animals treated with opiorphin-expressing plasmids compared with controls. A direct role for the upregulation of polyamine synthesis in the development of the priapic-like condition was supported by the observation that the ODC inhibitor 1,3-diaminopropane, when added to the drinking water of animals treated with plasmids expressing opiorphins, prevented experimental priapism. We also demonstrate that in sickle cell mice, another model of priapism, there is increased expression of the mouse opiorphin homologue in corporal tissue compared with the background strain at a life stage prior to evidence of priapism. At a life stage when there is onset of priapism, there is increased expression of the enzymes involved in polyamine synthesis (ODC and arginase-I and -II). Our results suggest that the upregulation of enzymes involved in the polyamine synthetic pathway may play a role in the development of experimental priapism and represent a target for the prevention of priapism.

The mechanism of opiorphin-induced experimental priapism in rats involves activation of the polyamine synthetic pathway

PubMed Central

Kanika, Nirmala Devi; Tar, Moses; Tong, Yuehong; Kuppam, Dwaraka Srinivasa Rao; Melman, Arnold

2009-01-01

Intracorporal injection of plasmids encoding opiorphins into retired breeder rats can result in animals developing a priapic-like condition. Microarray analysis demonstrated that following intracorporal gene transfer of plasmids expressing opiorphins the most significantly upregulated gene in corporal tissue was the ornithine decarboxylase gene (ODC). Quantitative RT-PCR confirmed the upregulation of ODC, as well as other genes involved in polyamine synthesis, such as arginase-I and -II, polyamine oxidase, spermidine synthase, spermidine acetyltransferase (SAT), and S-adenosylmethionine decarboxylase. Western blot analysis demonstrated upregulation of arginase-I and -II, ODC, and SAT at the protein level. Levels of the polyamine putrescine were upregulated in animals treated with opiorphin-expressing plasmids compared with controls. A direct role for the upregulation of polyamine synthesis in the development of the priapic-like condition was supported by the observation that the ODC inhibitor 1,3-diaminopropane, when added to the drinking water of animals treated with plasmids expressing opiorphins, prevented experimental priapism. We also demonstrate that in sickle cell mice, another model of priapism, there is increased expression of the mouse opiorphin homologue in corporal tissue compared with the background strain at a life stage prior to evidence of priapism. At a life stage when there is onset of priapism, there is increased expression of the enzymes involved in polyamine synthesis (ODC and arginase-I and -II). Our results suggest that the upregulation of enzymes involved in the polyamine synthetic pathway may play a role in the development of experimental priapism and represent a target for the prevention of priapism. PMID:19657052

ERK1/2/COX-2/PGE2 signaling pathway mediates GPR91-dependent VEGF release in streptozotocin-induced diabetes

PubMed Central

Li, Tingting; Hu, Jianyan; Du, Shanshan; Chen, Yongdong; Wang, Shuai

2014-01-01

Purpose Retinal vascular dysfunction caused by vascular endothelial growth factor (VEGF) is the major pathological change that occurs in diabetic retinopathy (DR). It has recently been demonstrated that G protein-coupled receptor 91 (GPR91) plays a major role in both vasculature development and retinal angiogenesis. In this study, we examined the signaling pathways involved in GPR91-dependent VEGF release during the early stages of retinal vascular change in streptozotocin-induced diabetes. Methods Diabetic rats were assigned randomly to receive intravitreal injections of shRNA lentiviral particles targeting GPR91 (LV.shGPR91) or control particles (LV.shScrambled). Accumulation of succinate was assessed by gas chromatography-mass spectrometry (GC-MS). At 14 weeks, the ultrastructure and function of the retinal vessels of diabetic retinas with or without shRNA treatment were assessed using hematoxylin and eosin (HE) staining, transmission electron microscopy (TEM), and Evans blue dye permeability. The expression of GPR91, extracellular signal-regulated kinases 1 and 2 (ERK1/2) and cyclooxygenase-2 (COX-2) were measured using immunofluorescence and western blotting. COX-2 and VEGF mRNA were determined by quantitative RT–PCR. Prostaglandin E2 (PGE2) and VEGF secretion were detected using an enzyme-linked immunosorbent assay. Results Succinate exhibited abundant accumulation in diabetic rat retinas. The retinal telangiectatic vessels, basement membrane thickness, and Evans blue dye permeability were attenuated by treatment with GPR91 shRNA. In diabetic rats, knockdown of GPR91 inhibited the activities of ERK1/2 and COX-2 as well as the expression of PGE2 and VEGF. Meanwhile, COX-2, PGE2, and VEGF expression was inhibited by ERK1/2 inhibitor U0126 and COX-2 inhibitor NS-398. Conclusions Our data suggest that hyperglycemia causes succinate accumulation and GPR91 activity in retinal ganglion cells, which mediate VEGF-induced retinal vascular change via the ERK1/2/COX-2/PGE2 pathway. This study highlights the signaling pathway as a potential target for intervention in DR. PMID:25324681

Oral immunization using HgbA in a recombinant chancroid vaccine delivered by attenuated Salmonella typhimurium SL3261 in the temperature-dependent rabbit model.

PubMed

Breau, Cathy; Cameron, D William; Desjardins, Marc; Lee, B Craig

2012-01-31

Chancroid, a sexually transmitted genital ulcer disease caused by the Gram-negative bacterium Haemophilus ducreyi, facilitates the acquisition and transmission of HIV. An effective vaccine against chancroid has not been developed. In this preliminary study, the gene encoding the H. ducreyi outer membrane hemoglobin receptor HgbA was cloned into the plasmid pTETnir15. The recombinant construct was introduced into the attenuated Salmonella typhimurium SL3261 strain and stable expression was induced in vitro under anaerobic conditions. The vaccine strain was delivered into the temperature-dependent rabbit model of chancroid by intragastric immunization as a single dose, or as three doses administered at two-weekly intervals. No specific antibody to HgbA was elicited after either dose schedule. Although the plasmid vector survived in vivo passage for up to 15 days following single oral challenge, HgbA expression was restricted to plasmid isolates recovered one day after immunization. Rabbits inoculated with the 3-dose booster regimen achieved no protective immunity from homologous challenge. These results emphasize that refinements in plasmid design to enhance a durable heterologous protein expression are necessary for the development of a live oral vaccine against chancroid. Copyright © 2011 Elsevier B.V. All rights reserved.

Integrating T7 RNA Polymerase and Its Cognate Transcriptional Units for a Host-Independent and Stable Expression System in Single Plasmid.

PubMed

Liang, Xiao; Li, Chenmeng; Wang, Wenya; Li, Qiang

2018-05-18

Metabolic engineering and synthetic biology usually require universal expression systems for stable and efficient gene expression in various organisms. In this study, a host-independent and stable T7 expression system had been developed by integrating T7 RNA polymerase and its cognate transcriptional units in single plasmid. The expression of T7 RNA polymerase was restricted below its lethal threshold using a T7 RNA polymerase antisense gene cassette, which allowed long periods of cultivation and protein production. In addition, by designing ribosome binding sites, we further tuned the expression capacity of this novel T7 system within a wide range. This host-independent expression system efficiently expressed genes in five different Gram-negative strains and one Gram-positive strain and was also shown to be applicable in a real industrial d- p-hydroxyphenylglycine production system.

The partitioning and copy number control systems of the selfish yeast plasmid: an optimized molecular design for stable persistence in host cells

PubMed Central

Yen-Ting-Liu; Sau, Saumitra; Ma, Chien-Hui; Kachroo, Aashiq H; Rowley, Paul A; Chang, Keng-Ming; Fan, Hsiu-Fang; Jayaram, Makkuni

2014-01-01

Summary The multi-copy 2 micron plasmid of Saccharomyces cerevisiae, a resident of the nucleus, is remarkable for its high chromosome-like stability. The plasmid does not appear to contribute to the fitness of the host, nor does it impose a significant metabolic burden on the host at its steady state copy number. The plasmid may be viewed as a highly optimized selfish DNA element whose genome design is devoted entirely towards efficient replication, equal segregation and copy number maintenance. A partitioning system comprised of two plasmid coded proteins, Rep1 and Rep2, and a partitioning locus STB is responsible for equal or nearly equal segregation of plasmid molecules to mother and daughter cells. Current evidence supports a model in which the Rep-STB system promotes the physical association of the plasmid with chromosomes and thus plasmid segregation by a hitchhiking mechanism. The Flp site-specific recombination system housed by the plasmid plays a critical role in maintaining steady state plasmid copy number. A decrease in plasmid population due to rare missegregation events is rectified by plasmid amplification via a recombination induced rolling circle replication mechanism. Appropriate plasmid amplification, without runaway increase in copy number, is ensured by positive and negative regulation of FLP gene expression by plasmid coded proteins and by the control of Flp level/activity through host mediated post-translational modification(s) of Flp. The Flp system has been successfully utilized to understand mechanisms of site-specific recombination, to bring about directed genetic alterations for addressing fundamental problems in biology, and as a tool in biotechnological applications. PMID:25541598

The partitioning and copy number control systems of the selfish yeast plasmid: an optimized molecular design for stable persistence in host cells.

PubMed

Yen-Ting-Liu; Sau, Saumitra; Ma, Chien-Hui; Kachroo, Aashiq H; Rowley, Paul A; Chang, Keng-Ming; Fan, Hsiu-Fang; Jayaram, Makkuni

2014-10-01

The multi-copy 2 micron plasmid of Saccharomyces cerevisiae, a resident of the nucleus, is remarkable for its high chromosome-like stability. The plasmid does not appear to contribute to the fitness of the host, nor does it impose a significant metabolic burden on the host at its steady state copy number. The plasmid may be viewed as a highly optimized selfish DNA element whose genome design is devoted entirely towards efficient replication, equal segregation and copy number maintenance. A partitioning system comprised of two plasmid coded proteins, Rep1 and Rep2, and a partitioning locus STB is responsible for equal or nearly equal segregation of plasmid molecules to mother and daughter cells. Current evidence supports a model in which the Rep-STB system promotes the physical association of the plasmid with chromosomes and thus plasmid segregation by a hitchhiking mechanism. The Flp site-specific recombination system housed by the plasmid plays a critical role in maintaining steady state plasmid copy number. A decrease in plasmid population due to rare missegregation events is rectified by plasmid amplification via a recombination induced rolling circle replication mechanism. Appropriate plasmid amplification, without runaway increase in copy number, is ensured by positive and negative regulation of FLP gene expression by plasmid coded proteins and by the control of Flp level/activity through host mediated post-translational modification(s) of Flp. The Flp system has been successfully utilized to understand mechanisms of site-specific recombination, to bring about directed genetic alterations for addressing fundamental problems in biology, and as a tool in biotechnological applications.

In vitro expression of erythropoietin by transfected human mesenchymal stromal cells.

PubMed

Mok, P-L; Cheong, S-K; Leong, C-F; Othman, A

2008-01-01

Mesenchymal stromal cells (MSC) are pluripotent progenitor cells that can be found in human bone marrow (BM). These cells have low immunogenicity and could suppress alloreactive T-cell responses. In the current study, MSC were tested for their capacity to carry and deliver the erythropoietin (EPO) gene in vitro. Expanded BM MSC was transfected with EPO-encoded plasmid pMCV1.2 and EPO-encoded MIDGE (minimalistic immunologically defined gene expression) vector by electroporation. The expressed EPO was used to induce hematopoietic stem cells (HSC) into erythroid colonies. The results showed that the MIDGE vector was more effective and stable than the plasmid (pMCV1.2) in delivering EPO gene into MSC. The supernatants containing EPO obtained from the transfected cell culture were able to induce the differentiation of HSC into erythroid colonies. MSC hold promise as a cell factory for the production of biologic molecules, and MIDGE vector is more effective and stable than the plasmid in nucleofection involving the EPO gene.

Sequence determination and analysis of three plasmids of Pseudomonas sp. GLE121, a psychrophile isolated from surface ice of Ecology Glacier (Antarctica).

PubMed

Dziewit, Lukasz; Grzesiak, Jakub; Ciok, Anna; Nieckarz, Marta; Zdanowski, Marek K; Bartosik, Dariusz

2013-09-01

Pseudomonas sp. GLE121 (a psychrophilic Antarctic strain) carries three plasmids: pGLE121P1 (6899 bp), pGLE121P2 (8330 bp) and pGLE121P3 (39,583 bp). Plasmids pGLE121P1 and pGLE121P2 show significant sequence similarity to members of the IncP-9 and IncP-7 incompatibility groups, respectively, while the largest replicon, pGLE121P3, is highly related to plasmid pNCPPB880-40 of Pseudomonas syringae pathovar tomato NCPPB880. All three plasmids have a narrow host range, limited to members of the genus Pseudomonas. Plasmid pGLE121P3 encodes a conjugal transfer system, while pGLE121P1 carries only a putative MOB module, conserved in many mobilizable plasmids. Plasmid pGLE121P3 contains an additional load of genetic information, including a pair of genes with homology to the rulAB operon, responsible for ultraviolet radiation (UVR) tolerance. Given the increasing UV exposure in Antarctic regions, the expression of these genes is likely to be an important adaptive response. Copyright © 2013 Elsevier Inc. All rights reserved.

Quorum-quenching limits quorum-sensing exploitation by signal-negative invaders

NASA Astrophysics Data System (ADS)

Tannières, Mélanie; Lang, Julien; Barnier, Claudie; Shykoff, Jacqui A.; Faure, Denis

2017-01-01

Some bacteria produce and perceive quorum-sensing (QS) signals that coordinate several behaviours, including the costly processes that are exoenzyme production and plasmid transfer. In the case of plasmid transfer, the emergence of QS signal-altered invaders and their policing are poorly documented. In Agrobacterium tumefaciens, the virulence Ti-plasmid encodes both synthesis and sensing of QS-signals, which promote its transfer from a donor to a recipient cell. Here, we reported that QS-altered A. tumefaciens mutants arose during experimental evolution. All showed improved growth compared to their ancestor. Genome sequencing revealed that, though some had lost the Ti-plasmid, most were defective for QS-signal synthesis and Ti-plasmid conjugation (traR mutations) and one exhibited a QS-signal exploitation behaviour, using signal produced by other cells to enhance its own Ti-plasmid transfer. We explored mechanisms that can limit this QS-hijacking. We showed that the A. tumefaciens capacity to inactivate QS-signals by expressing QS-degrading enzyme could attenuate dissemination of the QS signal-negative Ti-plasmids. This work shows that enzymatic QS-disruption whether encoded by the QS-producing Ti-plasmid itself, by a companion plasmid in the same donor cells, or by one in the recipient cells, in all cases can serve as a mechanism for controlling QS exploitation by QS signal-negative mutants.

Plasmids encoding PKI(1-31), a specific inhibitor of cAMP-stimulated gene expression, inhibit the basal transcriptional activity of some but not all cAMP-regulated DNA response elements in JEG-3 cells.

PubMed

Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J

1989-11-25

Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids encoding PKI(1-31) inhibit the expression that is stimulated by the addition of cAMP analogs in both cell lines; basal expression, however, is inhibited by PKI(1-31) only in the JEG-3 cell line and not in the CV-1 cells. These observations indicate that, in JEG-3 cells, PKI(1-31) is a specific inhibitor of kinase A-mediated gene transcription, but it does not modify kinase C-directed transcription.(ABSTRACT TRUNCATED AT 400 WORDS)

Microneedle-mediated transcutaneous immunization with plasmid DNA coated on cationic PLGA nanoparticles.

PubMed

Kumar, Amit; Wonganan, Piyanuch; Sandoval, Michael A; Li, Xinran; Zhu, Saijie; Cui, Zhengrong

2012-10-28

Previously, it was shown that microneedle-mediated transcutaneous immunization with plasmid DNA can potentially induce a stronger immune response than intramuscular injection of the same plasmid DNA. In the present study, we showed that the immune responses induced by transcutaneous immunization by applying plasmid DNA onto a skin area pretreated with solid microneedles were significantly enhanced by coating the plasmid DNA on the surface of cationic nanoparticles. In addition, the net surface charge of the DNA-coated nanoparticles significantly affected their in vitro skin permeation and their ability to induce immune responses in vivo. Transcutaneous immunization with plasmid DNA-coated net positively charged nanoparticles elicited a stronger immune response than with plasmid DNA-coated net negatively charged nanoparticles or by intramuscular immunization with plasmid DNA alone. Transcutaneous immunization with plasmid DNA-coated net positively charged nanoparticles induced comparable immune responses as intramuscular injection of them, but transcutaneous immunization was able to induce specific mucosal immunity and a more balanced T helper type 1 and type 2 response. The ability of the net positively charged DNA-coated nanoparticles to induce a strong immune response through microneedle-mediated transcutaneous immunization may be attributed to their ability to increase the expression of the antigen gene encoded by the plasmid and to more effectively stimulate the maturation of antigen-presenting cells. Copyright © 2012 Elsevier B.V. All rights reserved.

Plasmid Vectors for Xylella fastidiosa Utilizing a Toxin-Antitoxin System for Stability in the Absence of Antibiotic Selection.

PubMed

Burbank, Lindsey P; Stenger, Drake C

2016-08-01

The phytopathogen Xylella fastidiosa causes disease in a variety of important crop and landscape plants. Functional genetic studies have led to a broader understanding of virulence mechanisms used by this pathogen in the grapevine host. Plasmid shuttle vectors are important tools in studies of bacterial genetics but there are only a limited number of plasmid vectors available that replicate in X. fastidiosa, and even fewer that are retained without antibiotic selection. Two plasmids are described here that show stable replication in X. fastidiosa and are effective for gene complementation both in vitro and in planta. Plasmid maintenance is facilitated by incorporation of the PemI/PemK plasmid addiction system, consisting of PemK, an endoribonuclease toxin, and its cognate antitoxin, PemI. Vector pXf20pemIK utilizes a native X. fastidiosa replication origin as well as a high-copy-number pUC origin for propagation in Escherichia coli cloning strains. Broad-host-range vector pBBR5pemIK is a medium- to low-copy-number plasmid based on the pBBR1 backbone. Both plasmids are maintained for extended periods of time in the absence of antibiotic selection, as well as up to 14 weeks in grapevine, without affecting bacterial fitness. These plasmids present an alternative to traditional complementation and expression vectors which rely on antibiotic selection for plasmid retention.

Mobility of the native Bacillus subtilis conjugative plasmid pLS20 is regulated by intercellular signaling.

PubMed

Singh, Praveen K; Ramachandran, Gayetri; Ramos-Ruiz, Ricardo; Peiró-Pastor, Ramón; Abia, David; Wu, Ling J; Meijer, Wilfried J J

2013-10-01

Horizontal gene transfer mediated by plasmid conjugation plays a significant role in the evolution of bacterial species, as well as in the dissemination of antibiotic resistance and pathogenicity determinants. Characterization of their regulation is important for gaining insights into these features. Relatively little is known about how conjugation of Gram-positive plasmids is regulated. We have characterized conjugation of the native Bacillus subtilis plasmid pLS20. Contrary to the enterococcal plasmids, conjugation of pLS20 is not activated by recipient-produced pheromones but by pLS20-encoded proteins that regulate expression of the conjugation genes. We show that conjugation is kept in the default "OFF" state and identified the master repressor responsible for this. Activation of the conjugation genes requires relief of repression, which is mediated by an anti-repressor that belongs to the Rap family of proteins. Using both RNA sequencing methodology and genetic approaches, we have determined the regulatory effects of the repressor and anti-repressor on expression of the pLS20 genes. We also show that the activity of the anti-repressor is in turn regulated by an intercellular signaling peptide. Ultimately, this peptide dictates the timing of conjugation. The implications of this regulatory mechanism and comparison with other mobile systems are discussed.

Improvement of a yeast self-excising integrative vector by prevention of expression leakage of the intronated Cre recombinase gene during plasmid maintenance in Escherichia coli.

PubMed

Agaphonov, Michael O

2017-12-01

The use of plasmids possessing a regulatable gene coding for a site-specific recombinase together with its recognition sequences significantly facilitates genome manipulations since it allows self-excision of the portion of the genetic construct integrated into the host genome. Stable maintenance of such plasmids in Escherichia coli, which is used for plasmid preparation, requires prevention of recombinase synthesis in this host, which can be achieved by interrupting the recombinase gene with an intron. Based on this approach, Saccharomyces cerevisiae and Hansenula polymorpha self-excising vectors possessing intronated gene for Cre recombinase and its recognition sites (LoxP) were previously constructed. However, this work shows instability of the H. polymorpha vectors during plasmid maintenance in E. coli cells. This could be due to recombination between the loxP sites caused by residual expression of the cre gene. Prevention of translation reinitiation on an internal methionine codon completely solved this problem. A similar modification was made in a self-excising vector designed for S. cerevisiae. Apart from substantial improvement of yeast self-excising vectors, the obtained results also narrow down the essential part of Cre sequence. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Biosynthetic burden and plasmid burden limit expression of chromosomally integrated heterologous genes (pdc, adhB) in Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinez, A.; York, S.W.; Yomano, L.P.

1999-10-01

Previous studies have shown an unexpectedly high nutrient requirement for efficient ethanol production by ethanologenic recombinants of Escherichia coli B such as LY01 which contain chromosomally integrated Zymomonas mobilis genes (pdc, adhB) encoding the ethanol pathway. The basis for this requirement has been identified as a media-dependent effect on the expression of the Z. mobilis genes rather than a nutritional limitation. Ethanol production was substantially increased without additional nutrients simply by increasing the level of pyruvate decarboxylase activity. This was accomplished by adding a multicopy plasmid containing pdc alone (but not adhB alone) to strain LY01, and by adding multicopymore » plasmids which express pdc and adhB from strong promoters. New strong promoters were isolated from random fragments of Z. mobilis DNA and characterized but were not used to construct integrated biocatalysts. These promoters contained regions resembling recognition sites for 3 different E. coli sigma factors: {sigma}{sup 70}, {sigma}{sup 38}, and {sigma}{sup 28}. The most effective plasmid-based promoters for fermentation were recognized by multiple sigma factors, expressed both pdc and adhB at high levels, and produced ethanol efficiently while allowing up to 80% reduction in complex nutrients as compared to LY01. The ability to utilize multiple sigma factors may be advantageous to maintain the high levels of PDC and ADH needed for efficient ethanol production throughout batch fermentation.« less

The p40 Subunit of Interleukin (IL)-12 Promotes Stabilization and Export of the p35 Subunit

PubMed Central

Jalah, Rashmi; Rosati, Margherita; Ganneru, Brunda; Pilkington, Guy R.; Valentin, Antonio; Kulkarni, Viraj; Bergamaschi, Cristina; Chowdhury, Bhabadeb; Zhang, Gen-Mu; Beach, Rachel Kelly; Alicea, Candido; Broderick, Kate E.; Sardesai, Niranjan Y.; Pavlakis, George N.; Felber, Barbara K.

2013-01-01

IL-12 is a 70-kDa heterodimeric cytokine composed of the p35 and p40 subunits. To maximize cytokine production from plasmid DNA, molecular steps controlling IL-12p70 biosynthesis at the posttranscriptional and posttranslational levels were investigated. We show that the combination of RNA/codon-optimized gene sequences and fine-tuning of the relative expression levels of the two subunits within a cell resulted in increased production of the IL-12p70 heterodimer. We found that the p40 subunit plays a critical role in enhancing the stability, intracellular trafficking, and export of the p35 subunit. This posttranslational regulation mediated by the p40 subunit is conserved in mammals. Based on these findings, dual gene expression vectors were generated, producing an optimal ratio of the two subunits, resulting in a ∼1 log increase in human, rhesus, and murine IL-12p70 production compared with vectors expressing the wild type sequences. Such optimized DNA plasmids also produced significantly higher levels of systemic bioactive IL-12 upon in vivo DNA delivery in mice compared with plasmids expressing the wild type sequences. A single therapeutic injection of an optimized murine IL-12 DNA plasmid showed significantly more potent control of tumor development in the B16 melanoma cancer model in mice. Therefore, the improved IL-12p70 DNA vectors have promising potential for in vivo use as molecular vaccine adjuvants and in cancer immunotherapy. PMID:23297419

[Study of neutralization antibodie induced by DNA vaccine of HCV envelope protein 2 in mice].

PubMed

Shao, Shengwen; Zhou, Hongchang; Tong, Yimin; Ren, Yanli; Chen, Zhihui

2011-05-01

To explore the feasibility of induction of neutralization antibodies against hepatitis C virus (HCV) infection by HCV envelope 2 protein (E2) DNA vaccines immunization. Two kinds of expression plasmids of HCV envelope 2 protein, plasmid pCI-1b661 Delta encoding hydrophobic carboxyl terminal truncated E2 and pCI-1b661 Delta encoding E2 with deletion of hypervariable region 1 (HVR1) and carboxyl terminal, were constructed and respectively transfeted 293T cells, and truncated E2 protein in whole cell lysate and supernatant of 293T cells were analyzed by Western blot. After BALB/c mouse were intramuscularly immunized by the plasmids, sera antibodies against HVR1 were detected by ELISA and the neutralization activity of the antibodies were assayed with HCV pseudotype particle (HCVpp). Both plasmids could express secretary truncated E2 protein. All the mice immunized with plasmid pCI-1b661 produced HVR1 antibodies,while no HVR1 antibodies were detected in pCI-1b661 Delta immunized mice. The sera neutralization percentages against HCVpp in pCI1lb661 Delta and pCI-lb661 Delta immunized mice were (78.5 +/- 13.8)% and (38.7 +/- 6.5)%, respectively (P <0.01). Sera neutralization activity against HCVpp was positive correlated with the level of HVR1 antibodies in pCI-1b661 immunized mice (r = 0.967, P<0.01). DNA vaccines expressing truncated E2 protein could induce neutralization antibodies against HCV, and neutralization antibodies mainly was consisted of the antibodies against HVR1.

Nitrogen-fixing nodules induced by Agrobacterium tumefaciens harboring Rhizobium phaseoli plasmids.

PubMed Central

Martínez, E; Palacios, R; Sánchez, F

1987-01-01

Rhizobium phaseoli CFN299 forms nitrogen-fixing nodules in Phaseolus vulgaris (bean) and in Leucaena esculenta. It has three plasmids of 185, 225, and 410 kilobases. The 410-kilobase plasmid contains the nitrogenase structural genes. We have transferred these plasmids to the plasmid-free strain Agrobacterium tumefaciens GMI9023. Transconjugants containing different combinations of the R. phaseoli plasmids were obtained, and they were exhaustively purified before nodulation was assayed. Only transconjugants harboring the 410-kilobase plasmid nodulate P. vulgaris and L. esculenta. Nodules formed by all such transconjugants are able to reduce acetylene. Transconjugants containing the whole set of plasmids from CFN299 nodulate better and fix more nitrogen than the transconjugants carrying only the Sym plasmid. Microscopic analysis of nodules induced by A. tumefaciens transconjugants reveals infected cells and vascular bundles. None of the A. tumefaciens transconjugants, not even the one with the whole set of plasmids from CFN299, behaves in symbiosis like the original R. phaseoli strain; the transconjugants produce fewer nodules and have lower acetylene reduction (25% as compared to the original R. phaseoli strain) and more amyloplasts per nodule. More than 2,000 bacterial isolates from nodules of P. vulgaris and L. esculenta formed by the transconjugants were analyzed by different criteria. Not a single rhizobium could be detected. Our results show that R. phaseoli plasmids may be expressed in the A. tumefaciens background and direct the formation of effective, differentiated nodules. Images PMID:3584072

Strategy to approach stable production of recombinant nattokinase in Bacillus subtilis.

PubMed

Chen, Po Ting; Chiang, Chung-Jen; Chao, Yun-Peng

2007-01-01

Bacillus subtilis (B. subtilis) is widely accepted as an excellent host cell for the secretory production of recombinant proteins. In this study, a shuttle vector was constructed by fusion of Staphylococcus aureus (S. aureus) plasmid pUB110 with Escherichia coli (E. coli) plasmid pUC18 and used for the expression of nattokinase in B. subtilis. The pUB110/pUC-based plasmid was found to exhibit high structural instability with the identification of a DNA deletion between two repeated regions. An initial attempt was made to eliminate the homologous site in the plasmid, whereas the stability of the resulting plasmid was not improved. In an alternative way, the pUC18-derived region in this hybrid vector was replaced by the suicidal R6K plasmid origin of E. coli. As a consequence, the pUB110/R6K-based plasmid displayed full structural stability, leading to a high-level production of recombinant nattokinase in the culture broth. This was mirrored by the detection of a very low level of high molecular weight DNAs generated by the plasmid. Moreover, 2-fold higher nattokinase production was obtained by B. subtilis strain carrying the pUB110/R6K-based plasmid as compared to the cell with the pAMbeta1-derived vector, a plasmid known to have high structural stability. Overall, it indicates the feasibility of the approach by fusing two compatible plasmid origins for stable and efficient production of recombinant nattokinase in B. subtilis.

[Construction and expression of recombinant human serum albumin-EPO fusion protein].

PubMed

Huang, Ying-Chun; Gou, Xing-Hua; Han, Lei; Li, De-Hua; Zhao, Lan-Ying; Wu, Qia-Qing

2011-05-01

OBJECTIVE To construct the recombinant plasmid pCI-HLE encoding human serum album-EPO (HSA-EPO) fusion protein and to express it in CHO cell. The cDNA encoding human serum album and EPO were amplified by PCR, and then spliced with the synsitic DNA fragment encoding GS (GGGGS), by overlap PCR extension to form LEPO. After BamH I digestion, the HSA and LEPO was ligated to generate the fusion HSA-EPO gene and was then cloned into the expression vector pCI-neo to generate the recombinant plasmid pCI-HLE. The plasmid pCI-HLE was transfected into CHO cell by liposome protocol. Then, the recombinant cells were screened by G418 and identified by PCR and Western blot. Expression of fusion protein was evaluated by Enzyme Linked Immunosorbent Assay (ELISA). Restrictive enzymes digestion and DNA sequencing revealed that HSA-EPO fusion gene was cloned into expression vector pCI-neo successfully. PCR and Western blot analysis confirmed that the fusion gene was integrated in the genome of CHO cells and expressed successfully. The HSA-EPO production varied from 86 Iu/(mL x 10(6) x 72 h) to 637 IU/(mLx 10(6) x 72 h). The results confirmed that HSA-EPO fusion gene can be expressed in the CHO cells, with EPO immunogenicity, which could serve as foundation for the development of long-lasting recombinant HSA-EPO protein.

[Construction of the superantigen SEA transfected laryngocarcinoma cells].

PubMed

Ji, Xiaobin; Jingli, J V; Liu, Qicai; Xie, Jinghua

2013-04-01

To construct an eukaryotic expression vectors containing superantigen staphylococcal enterotoxin A (SEA) gene, and to identify its expression in laryngeal squamous carcinoma cells. SEA full-length gene fragment was obtained from ATCC13565 genome of the staphylococcus, referencing standard strains producing SEA. Coding sequence of SEA was artificially synthetized. Than, SEA gene fragments was subcloned into eukaryotic expression vector pIRES-EGFP. The recombinant plasmid pSEA-IRES-EGFP was constructed and was transfected to laryngocarcinoma Hep-2 cells. Resistant clones were screened by G418. The expression of SEA in laryngocarcinoma cells was identified with ELISA and RT-PCR method. The subclone of artificially synthetized SEA gene was subclone to eukaryotic expression vector pires-EGFP. Flanking sequence confirmed that SEA sequence was fully identical to the coding sequence of standard staphylococcus strains ATCC13565 in Genbank. After recombinant plasmid transfected to laryngocarcinoma cells, the resistant clones was obtained after screening for two weeks. The clones were selected. The specific gene fragment was obtained by RT-PCR amplification. ELISA assay confirmed that the content of SEA protein in supernatant fluid of cell culture had reached about Pg level. The recombinant eukaryotic expression vector containing superantigen SEA gene is successfully constructed, and is capable of effective expression and continued secretion of SEA protein in laryngochrcinoma Hep-2 cells after recombinant plasmid transfected to laryngocarcinoma cells.

An RNAi in silico approach to find an optimal shRNA cocktail against HIV-1

PubMed Central

2010-01-01

Background HIV-1 can be inhibited by RNA interference in vitro through the expression of short hairpin RNAs (shRNAs) that target conserved genome sequences. In silico shRNA design for HIV has lacked a detailed study of virus variability constituting a possible breaking point in a clinical setting. We designed shRNAs against HIV-1 considering the variability observed in naïve and drug-resistant isolates available at public databases. Methods A Bioperl-based algorithm was developed to automatically scan multiple sequence alignments of HIV, while evaluating the possibility of identifying dominant and subdominant viral variants that could be used as efficient silencing molecules. Student t-test and Bonferroni Dunn correction test were used to assess statistical significance of our findings. Results Our in silico approach identified the most common viral variants within highly conserved genome regions, with a calculated free energy of ≥ -6.6 kcal/mol. This is crucial for strand loading to RISC complex and for a predicted silencing efficiency score, which could be used in combination for achieving over 90% silencing. Resistant and naïve isolate variability revealed that the most frequent shRNA per region targets a maximum of 85% of viral sequences. Adding more divergent sequences maintained this percentage. Specific sequence features that have been found to be related with higher silencing efficiency were hardly accomplished in conserved regions, even when lower entropy values correlated with better scores. We identified a conserved region among most HIV-1 genomes, which meets as many sequence features for efficient silencing. Conclusions HIV-1 variability is an obstacle to achieving absolute silencing using shRNAs designed against a consensus sequence, mainly because there are many functional viral variants. Our shRNA cocktail could be truly effective at silencing dominant and subdominant naïve viral variants. Additionally, resistant isolates might be targeted under specific antiretroviral selective pressure, but in both cases these should be tested exhaustively prior to clinical use. PMID:21172023

Periodic Mechanical Stress INDUCES Chondrocyte Proliferation and Matrix Synthesis via CaMKII-Mediated Pyk2 Signaling.

PubMed

Liang, Wenwei; Li, Zeng; Wang, Zhen; Zhou, Jinchun; Song, Huanghe; Xu, Shun; Cui, Weiding; Wang, Qing; Chen, Zhefeng; Liu, Feng; Fan, Weimin

2017-01-01

Periodic mechanical stress can promote chondrocyte proliferation and matrix synthesis to improve the quality of tissue-engineered cartilage. Although the integrin β1-ERK1/2 signal cascade has been implicated in periodic mechanical stress-induced mitogenic effects in chondrocytes, the precise mechanisms have not been fully established. The current study was designed to probe the roles of CaMKII and Pyk2 signaling in periodic mechanical stress-mediated chondrocyte proliferation and matrix synthesis. Chondrocytes were subjected to periodic mechanical stress, proliferation was assessed by direct cell counting and CCK-8 assay; gene expressions were analyzed using quantitative real-time PCR, protein abundance by Western blotting. Mechanical stress, markedly enhanced the phosphorylation levels of Pyk2 at Tyr402 and CaMKII at Thr286. Both suppression of Pyk2 with Pyk2 inhibitor PF431396 or Pyk2 shRNA and suppression of CaMKII with CaMKII inhibitor KN-93 or CaMKII shRNA blocked periodic mechanical stress-induced chondrocyte proliferation and matrix synthesis. Additionally, either pretreatment with KN-93 or shRNA targeted to CaMKII prevented the activation of ERK1/2 and Pyk2 under conditions of periodic mechanical stress. Interestingly, in relation to periodic mechanical stress, in the context of Pyk2 inhibition with PF431396 or its targeted shRNA, only the phosphorylation levels of ERK1/2 were abrogated, while CaMKII signal activation was not affected. Moreover, the phosphorylation levels of CaMKII- Thr286 and Pyk2- Tyr402 were abolished after pretreatment with blocking antibody against integrinβ1 exposed to periodic mechanical stress. Our results collectively indicate that periodic mechanical stress promotes chondrocyte proliferation and matrix synthesis through the integrinβ1-CaMKII-Pyk2-ERK1/2 signaling cascade. © 2017 The Author(s). Published by S. Karger AG, Basel.

Electrical peripheral nerve stimulation relieves bone cancer pain by inducing Arc protein expression in the spinal cord dorsal horn

PubMed Central

Sun, Ke-fu; Feng, Wan-wen; Liu, Yue-peng; Dong, Yan-bin; Gao, Li; Yang, Hui-lin

2018-01-01

Objective The analgesic effect on chronic pain of peripheral nerve stimulation (PNS) has been proven, but its underlying mechanism remains unknown. Therefore, this study aimed to assess the analgesic effect of PNS on bone cancer pain in a rat model and to explore the underlying mechanism. Materials and methods PNS on sciatic nerves with bipolar electrode was performed in both naïve and bone cancer pain model rats. Then, the protein levels of activity-regulated cytoskeleton-associated protein (Arc), α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid–type glutamate receptor 1 (GluA1), and phosphate N-methyl-d-aspartic acid-type glutamate receptor subunit 2B (pGluNR2B) in spinal cord were evaluated by immunohistochemistry and Western blotting. Thermal paw withdraw latency and mechanical paw withdraw threshold were used to estimate the analgesic effect of PNS on bone cancer pain. Intrathecal administration of Arc shRNA was used to inhibit Arc expression in the spinal cord. Results PNS at 60 and 120 Hz for 20 min overtly induced Arc expression in the spinal cord, increased thermal pain thresholds in naïve rats, and relieved bone cancer pain; meanwhile, 10 Hz PNS did not achieve those results. In addition, PNS at 60 and 120 Hz also reduced the expression of GluA1, but not pGluNR2B, in the spinal cord. Finally, the anti-nociceptive effect and GluA1 downregulation induced by PNS were inhibited by intrathecal administration of Arc shRNA. Conclusion PNS (60 Hz, 0.3 mA) can relieve bone-cancer-induced allodynia and hyperalgesia by upregulating Arc protein expression and then by decreasing GluA1 transcription in the spinal cord dorsal horn. PMID:29606887

Celastrol attenuates incision-induced inflammation and pain associated with inhibition of the NF-κB signalling pathway via SARM.

PubMed

Chen, Xuhui; Zhang, Bo; Li, Jiayan; Feng, Miaomiao; Zhang, Yue; Yao, Wenlong; Zhang, Chuanhan; Wan, Li

2018-05-08

This study aimed to investigate whether celastrol (CEL) could alleviate incision-induced pain and decipher its possible mechanism. Sprague-Dawley rats were randomly divided into five groups: naïve, vehicle, CEL (5 μg/paw, 10 μg/paw and 20 μg/paw). CEL or vehicle was administered intraplantarly before plantar surgical incision. Histological examinations of skin tissues were performed after HE staining. Additionally, immunohistochemical staining, RT-PCR and western blot were performed to analyse macrophages, proinflammatory cytokines, SARM and NF-κB expression, respectively. Moreover, the previous mentioned factors were re-evaluated after suppressing SARM expression by shRNA. The plantar incision rats displayed pain-related behaviours and inflammatory infiltration in the skin. The mRNA levels of proinflammatory cytokines, such as IL-1β, IL-6, and TNFα were significantly upregulated in the skin of surgical rats. The expression of sterile α- and armadillo-motif-containing protein (SARM) was downregulated and nuclear factor kappa-B (NF-κB) was activated. Interestingly, CEL could partially restore the pain-related behavioural changes. Furthermore, molecular mechanism of CEL was explored, that included significantly reduction of proinflammatory cytokines mRNA expressions, a significant decrease of p-p65 and p65 levels and a markedly increase of SARM and IkBα expressions in skin tissues. However, supression SARM by shRNA partially eliminated those protective effect of CEL. Our data suggest that intraplantarly administration of CEL attenuates inflammatory and acute pain. This finding could be attributed to regulation of the NF-κB signalling pathway via SARM. These results provide pre-clinical evidence supporting the use of CEL in the treatment of surgical pain. Copyright © 2017. Published by Elsevier Inc.

Isolation of a novel plasmid from Couchioplanes caeruleus and construction of two plasmid vectors for gene expression in Actinoplanes missouriensis.

PubMed

Jang, Moon-Sun; Fujita, Azusa; Ikawa, Satomi; Hanawa, Keitaro; Yamamura, Hideki; Tamura, Tomohiko; Hayakawa, Masayuki; Tezuka, Takeaki; Ohnishi, Yasuo

2015-01-01

To date, no plasmid vector has been developed for the rare actinomycete Actinoplanes missouriensis. Moreover, no small circular plasmid has been reported to exist in the genus Actinoplanes. Here, a novel plasmid, designated pCAZ1, was isolated from Couchioplanes caeruleus subsp. azureus via screening for small circular plasmids in Actinoplanes (57 strains) and Couchioplanes (2 strains). Nucleotide sequencing revealed that pCAZ1 is a 5845-bp circular molecule with a G + C content of 67.5%. The pCAZ1 copy number was estimated at 30 per chromosome. pCAZ1 contains seven putative open reading frames, one of which encodes a protein containing three motifs conserved among plasmid-encoded replication proteins that are involved in the rolling-circle mechanism of replication. Detection of single-stranded DNA intermediates in C. caeruleus confirmed that pCAZ1 replicates by this mechanism. The ColE1 origin from pBluescript SK(+) and the oriT sequence with the apramycin resistance gene aac(3)IV from pIJ773 were inserted together into pCAZ1, to construct the Escherichia coli-A. missouriensis shuttle vectors, pCAM1 and pCAM2, in which the foreign DNA fragment was inserted into pCAZ1 in opposite directions. pCAM1 and pCAM2 were successfully transferred to A. missouriensis through the E. coli-mediated conjugative transfer system. The copy numbers of pCAM1 and pCAM2 in A. missouriensis were estimated to be one and four per chromosome, respectively. Thus, these vectors can be used as effective genetic tools for homologous and heterologous gene expression studies in A. missouriensis. Copyright © 2014 Elsevier Inc. All rights reserved.

Protection from ischemic heart injury by a vigilant heme oxygenase-1 plasmid system.

PubMed

Tang, Yao Liang; Tang, Yi; Zhang, Y Clare; Qian, Keping; Shen, Leping; Phillips, M Ian

2004-04-01

Although human heme oxygenase-1 (hHO-1) could provide a useful approach for cellular protection in the ischemic heart, constitutive overexpression of hHO-1 may lead to unwanted side effects. To avoid this, we designed a hypoxia-regulated hHO-1 gene therapy system that can be switched on and off. This vigilant plasmid system is composed of myosin light chain-2v promoter and a gene switch that is based on an oxygen-dependent degradation domain from the hypoxia inducible factor-1-alpha. The vector can sense ischemia and switch on the hHO-1 gene system, specifically in the heart. In an in vivo experiment, the vigilant hHO-1 plasmid or saline was injected intramyocardially into myocardial infarction mice or sham operation mice. After gene transfer, expression of hHO-1 was only detected in the ischemic heart treated with vigilant hHO-1 plasmids. Masson trichrome staining showed significantly fewer fibrotic areas in vigilant hHO-1 plasmids-treated mice compared with saline control (43.0%+/-4.8% versus 62.5%+/-3.3%, P<0.01). The reduction of interstitial fibrosis is accompanied by an increase in myocardial hHO-1 expression in peri-infarct border areas, concomitant with higher Bcl-2 levels and lower Bax, Bak, and caspase 3 levels in the ischemic myocardium compared with saline control. By use of a cardiac catheter, heart from vigilant hHO-1 plasmids-treated mice showed improved recovery of contractile and diastolic performance after myocardial infarction compared with saline control. This study documents the beneficial regulation and therapeutic potential of vigilant plasmid-mediated hHO-1 gene transfer. This novel gene transfer strategy can provide cardiac-specific protection from future repeated bouts of ischemic injury.

Inhibiting the role of Skp2 suppresses cell proliferation and tumorigenesis of human gastric cancer cells via the upregulation of p27kip1.

PubMed

Wen, Yanguang; Wang, Kuansong; Yang, Kaiyan

2016-10-01

Gastric cancer is a malignant disease of the digestive system with high rates of incidence and mortality. S‑phase kinase‑associated protein 2 (Skp2) is a novel oncogene, which has been identified to be important in tumor progression and metastasis. In order to clarify the role of Skp2 in human gastric cancer, the present study detected the expression of Skp2 in human gastric cancer tissues, and investigated the molecular mechanism of Skp2 in the progression of gastric carcinoma. The results of the initial bioinformatics analysis showed that Skp2 was significantly upregulated in 31 specimens of primary gastric cancer from a UK patient cohort, and in 10 gastric cancer lines of a side population, compared with normal gastric tissues (P<0.01). Specimens from 47 patients with gastric cancer and 19 normal gastric tissue specimens were obtained and analyzed using western blot analysis. The positive rate of expression of Skp2 was 87.2%, indicating that the expression of Skp2 was observed in 41 specimens of the detected gastric cancer samples, whereas the positive rate of the expression of Skp2 was 5.6% in the normal gastric samples (P<0.01). In the human gastric cancer cell lines, the defective regulation of Skp2 or presence of an Skp2 inhibitor inhibited the proliferation of BGC‑823 and MKN‑45 cells. In addition, the Skp2 inhibitor suppressed the proliferation of gastric cancer cells in a time‑ and dose‑dependent manner. Furthermore, transfection with Skp2 short hairpin (sh)RNA or treatment with SKP inhibitor C1 for 48 and 72 h led to the accumulation of p27kip1 in Hela cells. Tumorigenicity experiments involving nude mice showed that interference of the expression of Skp2 inhibited the growth of the human gastric tumor cells in the nude mice, and the tumor weights and volumes in the Skp2 shRNA group were significantly lower, compared with those in the negative control shRNA group (P<0.01) and untreated group (P<0.01). Taken together, these data suggested that Skp2 acted as an oncogene in human gastric cancer, and that Skp2‑mediated p27kip1 degradation contributed to the progression of gastric cancer. Abrogating the effects of Skp2 may effectively inhibit the growth of gastric cancer cells, which may be useful as a novel target in the clinical treatment of gastric cancer.

High Throughput Analyses of Budding Yeast ARSs Reveal New DNA Elements Capable of Conferring Centromere-Independent Plasmid Propagation

PubMed Central

Hoggard, Timothy; Liachko, Ivan; Burt, Cassaundra; Meikle, Troy; Jiang, Katherine; Craciun, Gheorghe; Dunham, Maitreya J.; Fox, Catherine A.

2016-01-01

The ability of plasmids to propagate in Saccharomyces cerevisiae has been instrumental in defining eukaryotic chromosomal control elements. Stable propagation demands both plasmid replication, which requires a chromosomal replication origin (i.e., an ARS), and plasmid distribution to dividing cells, which requires either a chromosomal centromere for segregation or a plasmid-partitioning element. While our knowledge of yeast ARSs and centromeres is relatively advanced, we know less about chromosomal regions that can function as plasmid partitioning elements. The Rap1 protein-binding site (RAP1) present in transcriptional silencers and telomeres of budding yeast is a known plasmid-partitioning element that functions to anchor a plasmid to the inner nuclear membrane (INM), which in turn facilitates plasmid distribution to daughter cells. This Rap1-dependent INM-anchoring also has an important chromosomal role in higher-order chromosomal structures that enhance transcriptional silencing and telomere stability. Thus, plasmid partitioning can reflect fundamental features of chromosome structure and biology, yet a systematic screen for plasmid partitioning elements has not been reported. Here, we couple deep sequencing with competitive growth experiments of a plasmid library containing thousands of short ARS fragments to identify new plasmid partitioning elements. Competitive growth experiments were performed with libraries that differed only in terms of the presence or absence of a centromere. Comparisons of the behavior of ARS fragments in the two experiments allowed us to identify sequences that were likely to drive plasmid partitioning. In addition to the silencer RAP1 site, we identified 74 new putative plasmid-partitioning motifs predicted to act as binding sites for DNA binding proteins enriched for roles in negative regulation of gene expression and G2/M-phase associated biology. These data expand our knowledge of chromosomal elements that may function in plasmid partitioning and suggest underlying biological roles shared by such elements. PMID:26865697

A versatile transfection assay system to evaluate the biological effects of diverse industrial chemicals.

PubMed

Koizumi, Shinji; Ohno, Shotaro; Otsuka, Fuminori

2012-01-01

Gene expression processes are now recognized as important targets of the toxic effects exerted by industrial chemicals. The transient transfection assay is a powerful tool to evaluate such effects. Thus, we developed a versatile assay system by constructing a basic reporter plasmid in which the regulatory DNA sequence to be studied can easily be substituted. To verify the performance of this system, reporter plasmids carrying any of the three distinct regulatory sequences, estrogen responsive element (ERE), glucocorticoid responsive element (GRE) and xenobiotic responsive element (XRE) were constructed. After transfection of human cells, these plasmids successfully expressed the relevant reporter genes in response to specific inducers, β-estradiol, dexamethasone and 3-methylcholanthrene, respectively. Several industrial chemicals were assayed using these reporter plasmids, and the ability of p-dimethylaminoazobenzene to elevate GRE- and XRE-mediated transcription was detected. α-Naphthylamine and o-tolidine were also observed to increase the XRE-mediated response. The transfection assay system established here will be useful to evaluate the effects of a wide variety of industrial chemicals.

Roles of Long and Short Replication Initiation Proteins in the Fate of IncP-1 Plasmids

PubMed Central

Yano, Hirokazu; Deckert, Gail E.; Rogers, Linda M.

2012-01-01

Broad-host-range IncP-1 plasmids generally encode two replication initiation proteins, TrfA1 and TrfA2. TrfA2 is produced from an internal translational start site within trfA1. While TrfA1 was previously shown to be essential for replication in Pseudomonas aeruginosa, its role in other bacteria within its broad host range has not been established. To address the role of TrfA1 and TrfA2 in other hosts, efficiency of transformation, plasmid copy number (PCN), and plasmid stability were first compared between a mini-IncP-1β plasmid and its trfA1 frameshift variant in four phylogenetically distant hosts: Escherichia coli, Pseudomonas putida, Sphingobium japonicum, and Cupriavidus necator. TrfA2 was sufficient for replication in these hosts, but the presence of TrfA1 enhanced transformation efficiency and PCN. However, TrfA1 did not contribute to, and even negatively affected, long-term plasmid persistence. When trfA genes were cloned under a constitutive promoter in the chromosomes of the four hosts, strains expressing either both TrfA1 and TrfA2 or TrfA1 alone, again, generally elicited a higher PCN of an IncP1-β replicon than strains expressing TrfA2 alone. When a single species of TrfA was produced at different concentrations in E. coli cells, TrfA1 maintained a 3- to 4-fold higher PCN than TrfA2 at the same TrfA concentrations, indicating that replication mediated by TrfA1 is more efficient than that by TrfA2. These results suggest that the broad-host-range properties of IncP-1 plasmids are essentially conferred by TrfA2 and the intact replication origin alone but that TrfA1 is nonetheless important to efficiently establish plasmid replication upon transfer into a broad range of hosts. PMID:22228734

[Comparison of TTR and CMV promoters in vivo and in vitro via a secreted luciferase reporter system].

PubMed

Luo, Shun-Tao; Tian, Wen-Hong; Wang, Gang; Dong, Xiao-Yan; Yang, Li; Wu, Xiao-Bing

2009-11-01

GLuc (Gaussia luciferase) is a secreted luciferase with high sensitivity. In this study, we primarily compared expression character of PTTR with that of PCMV, relied on easy secretion, high sensitivity and simple and fast detection of GLuc. We firstly constructed two plasmids pAAV2-neo-TTR-GLuc and pAAV2-neo-CMV-GLuc. Then, 4 cell lines were transfected with the two plasmids in aid of Lipofectamine 2000, including Huh7 and HepG2, which are derived from liver cells, as well as HEK293 and HeLaS3 cells, which are non-liver cell lines. We monitored the expression of GLuc in the supernatant of these cell cultures at different time points post-transfection. Furthermore, we injected the two plasmids with different doses into BALB/c mice by the means of hydrodynamic delivery and monitored the GLuc expression in vivo with 2.5 microl tail tip blood since 2 h post-injection. The cell assay results suggested that the expression of GLuc driven by CMV promoter was significantly higher than that of GLuc driven by TTR promoter. And, the luciferase activity of GLuc driven by CMV promoter was 50-300 times higher than that of GLuc driven by TTR promoter in HEK293 and HeLaS3 cell lines, but less than 10 times higher than that of GLuc driven by TTR promoter in the HepG2 and Huh7 cell lines, indicating the relative liver-specificity of TTR promoter. In the animal assay, the higher luciferase activity was determined in CMV promoter group than in TTR promoter group at different doses of the two plasmids. But the expression patterns for the two promoters differed obviously. The expression of GLuc driven by CMV promoter reached the maximum 10 hours post-injection and declined rapidly; while the expression of GLuc driven by TTR promoter reached the maximum 48 hours after delivery, and declined very slowly. These results implied that PTTR could keep expression of driven gene in a long time although its expression intensity is lower than PCMV's. Thus, it is more suitable for maintaining longer expression of target genes in liver.

Streamlined platform for short hairpin RNA interference and transgenesis in cultured mammalian cells.

PubMed

Khandelia, Piyush; Yap, Karen; Makeyev, Eugene V

2011-08-02

Sequence-specific gene silencing by short hairpin (sh) RNAs has recently emerged as an indispensable tool for understanding gene function and a promising avenue for drug discovery. However, a wider biomedical use of this approach is hindered by the lack of straightforward methods for achieving uniform expression of shRNAs in mammalian cell cultures. Here we report a high-efficiency and low-background (HILO) recombination-mediated cassette exchange (RMCE) technology that yields virtually homogeneous cell pools containing doxycycline-inducible shRNA elements in a matter of days and with minimal efforts. To ensure immediate utility of this approach for a wider research community, we modified 11 commonly used human (A549, HT1080, HEK293T, HeLa, HeLa-S3, and U2OS) and mouse (CAD, L929, N2a, NIH 3T3, and P19) cell lines to be compatible with the HILO-RMCE process. Because of its technical simplicity and cost efficiency, the technology will be advantageous for both low- and high-throughput shRNA experiments. We also provide evidence that HILO-RMCE will facilitate a wider range of molecular and cell biology applications by allowing one to rapidly engineer cell populations expressing essentially any transgene of interest.

Streamlined platform for short hairpin RNA interference and transgenesis in cultured mammalian cells

PubMed Central

Khandelia, Piyush; Yap, Karen; Makeyev, Eugene V.

2011-01-01

Sequence-specific gene silencing by short hairpin (sh) RNAs has recently emerged as an indispensable tool for understanding gene function and a promising avenue for drug discovery. However, a wider biomedical use of this approach is hindered by the lack of straightforward methods for achieving uniform expression of shRNAs in mammalian cell cultures. Here we report a high-efficiency and low-background (HILO) recombination-mediated cassette exchange (RMCE) technology that yields virtually homogeneous cell pools containing doxycycline-inducible shRNA elements in a matter of days and with minimal efforts. To ensure immediate utility of this approach for a wider research community, we modified 11 commonly used human (A549, HT1080, HEK293T, HeLa, HeLa-S3, and U2OS) and mouse (CAD, L929, N2a, NIH 3T3, and P19) cell lines to be compatible with the HILO-RMCE process. Because of its technical simplicity and cost efficiency, the technology will be advantageous for both low- and high-throughput shRNA experiments. We also provide evidence that HILO-RMCE will facilitate a wider range of molecular and cell biology applications by allowing one to rapidly engineer cell populations expressing essentially any transgene of interest. PMID:21768390

Study of the Regulation of Telomere Replication by Characterizing the Cdc-13p Pathway in Yeast

DTIC Science & Technology

2001-01-01

lev- 2.0 els of interaction or protein expression. (C) XhoI di- gested DNA from wild-type strain or cdc13A strains carrying a centromere plasmid with...expressed from 5). HA-Cdcl3-lp (Fig. 7, lane 2) and HA-Cdcl3-2p (Fig. 7, the centromere plasmid pKT/EST1 (Mitchell et al. 1993) lane 3) also interacted...sup- telomerase-mediated telomere lengthening. For the plants the need for Estip in telomere maintenance POLl mutations, this TLCl-dependent length

Enhanced Eradication of Lymphoma by Tumor-Specific Cytotoxic T Cells Secreting an Engineered Tumor-Specific Immunotoxin

DTIC Science & Technology

2008-06-01

verified the insertion of the genes in our expression plasmids and in our lentivirus vectors. Transduction/selection of the 293T with mutated E2F... mutation created in this gene is located in the PEA targeted region of EF-2, it prevents the interaction of these 2 proteins and thus the cell death...We have cloned this mutated elongation factor in an expression vector and in a lentivirus plasmid also encoding a marker gene . The mEF-2-lentivirus

A gene expression system offering multiple levels of regulation: the Dual Drug Control (DDC) system.

PubMed

Sudomoina, Marina; Latypova, Ekaterina; Favorova, Olga O; Golemis, Erica A; Serebriiskii, Ilya G

2004-04-29

Whether for cell culture studies of protein function, construction of mouse models to enable in vivo analysis of disease epidemiology, or ultimately gene therapy of human diseases, a critical enabling step is the ability to achieve finely controlled regulation of gene expression. Previous efforts to achieve this goal have explored inducible drug regulation of gene expression, and construction of synthetic promoters based on two-hybrid paradigms, among others. In this report, we describe the combination of dimerizer-regulated two-hybrid and tetracycline regulatory elements in an ordered cascade, placing expression of endpoint reporters under the control of two distinct drugs. In this Dual Drug Control (DDC) system, a first plasmid expresses fusion proteins to DBD and AD, which interact only in the presence of a small molecule dimerizer; a second plasmid encodes a cassette transcriptionally responsive to the first DBD, directing expression of the Tet-OFF protein; and a third plasmid encodes a reporter gene transcriptionally responsive to binding by Tet-OFF. We evaluate the dynamic range and specificity of this system in comparison to other available systems. This study demonstrates the feasibility of combining two discrete drug-regulated expression systems in a temporally sequential cascade, without loss of dynamic range of signal induction. The efficient layering of control levels allowed by this combination of elements provides the potential for the generation of complex control circuitry that may advance ability to regulate gene expression in vivo.

Molecular imaging of RNA interference therapy targeting PHD2 for treatment of myocardial ischemia.

PubMed

Huang, Mei; Wu, Joseph C

2011-01-01

Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments.

Molecular Imaging of RNA Interference Therapy Targeting PHD2 for Treatment of Myocardial Ischemia

PubMed Central

Huang, Mei; Wu, Joseph C.

2011-01-01

Summary Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments. PMID:21194030

[Construction and expression of recombinant Mycobacterium bovis BCG with the ompA-like membrane protein gene Loa22 of Leptospira interrogans serovar].

PubMed

Li, Dao-kun; Bao, Lang; Zhang, Ying; Sun, Zhan

2010-03-01

To study the immunity of Loa22 from Leptospira interrogans serovar Lai strain 56601 by expressing its protein in BCG. Amplified the mature peptide of Loa22 gene from the genome of of Leptospira interrogans serovar Lai strain 56601 and constructed recombinant plasmid rpMV36l-1oa22 with the E. coli-BCG integrating shuttle plasmid pMV361 and the Loa22 mature peptide gene. The rpMV36l-1oa22 plasmid was transformed into BCG by electroporation. The rBCG bearing rpMV36l-1oa22 was induced by high temperature of 45 degrees C and expressed protein was identified by SDS-PAGE and Western Blotting. Fifth 6-week-old BALB/c mice were randomly divided into five groups, which were inoculated intraperitoneally two times at 0-day and 21-day with BCG, rBCG-pMV361, rI3CG-1oa22, Loa22 and killed whole-leptospires respectively. All animals were dislocated from cervical vertebra on the 14Ih day after the last immunization. The proliferative reaction of splenic lymphocyte in tuitro were tested by XTT. The rpMV36l-1oa22 plasmid was constructed successfully and transformed into BCG. The rBCG expressed a 19 X io specifical protein identified by SDS-PAGE and Western Blotting. The splenic lymphocyte proliferate activity (SI) in rBCG-ioa22 group in intro was significantly higher than those in BCG group and rBCG-pMV361 group. We explored the expressing feasibility of Loa22 in Mycobacterium bovis BCG. may therefore make further researches on the induction of protective immunity against human and animal leptospirosis.

Electrotransformation and expression of bacterial genes encoding hygromycin phosphotransferase and beta-galactosidase in the pathogenic fungus Histoplasma capsulatum.

PubMed

Woods, J P; Heinecke, E L; Goldman, W E

1998-04-01

We developed an efficient electrotransformation system for the pathogenic fungus Histoplasma capsulatum and used it to examine the effects of features of the transforming DNA on transformation efficiency and fate of the transforming DNA and to demonstrate fungal expression of two recombinant Escherichia coli genes, hph and lacZ. Linearized DNA and plasmids containing Histoplasma telomeric sequences showed the greatest transformation efficiencies, while the plasmid vector had no significant effect, nor did the derivation of the selectable URA5 marker (native Histoplasma gene or a heterologous Podospora anserina gene). Electrotransformation resulted in more frequent multimerization, other modification, or possibly chromosomal integration of transforming telomeric plasmids when saturating amounts of DNA were used, but this effect was not observed with smaller amounts of transforming DNA. We developed another selection system using a hygromycin B resistance marker from plasmid pAN7-1, consisting of the E. coli hph gene flanked by Aspergillus nidulans promoter and terminator sequences. Much of the heterologous fungal sequences could be removed without compromising function in H. capsulatum, allowing construction of a substantially smaller effective marker fragment. Transformation efficiency increased when nonselective conditions were maintained for a time after electrotransformation before selection with the protein synthesis inhibitor hygromycin B was imposed. Finally, we constructed a readily detectable and quantifiable reporter gene by fusing Histoplasma URA5 with E. coli lacZ, resulting in expression of functional beta-galactosidase in H. capsulatum. Demonstration of expression of bacterial genes as effective selectable markers and reporters, together with a highly efficient electrotransformation system, provide valuable approaches for molecular genetic analysis and manipulation of H. capsulatum, which have proven useful for examination of targeted gene disruption, regulated gene expression, and potential virulence determinants in this fungus.

Delivery of RNAi reagents in murine models of obesity and diabetes.

PubMed

Wilcox, Denise M; Yang, Ruojing; Morgan, Sherry J; Nguyen, Phong T; Voorbach, Martin J; Jung, Paul M; Haasch, Deanna L; Lin, Emily; Bush, Eugene N; Opgenorth, Terry J; Jacobson, Peer B; Collins, Christine A; Rondinone, Cristina M; Surowy, Terry; Landschulz, Katherine T

2006-11-29

RNA interference (RNAi) is an exciting new tool to effect acute in vivo knockdown of genes for pharmacological target validation. Testing the application of this technology to metabolic disease targets, three RNAi delivery methods were compared in two frequently utilized preclinical models of obesity and diabetes, the diet-induced obese (DIO) and B6.V-Lep/J (ob/ob) mouse. Intraperitoneal (i.p.) and high pressure hydrodynamic intravenous (i.v.) administration of naked siRNA, and low pressure i.v. administration of shRNA-expressing adenovirus were assessed for both safety and gene knockdown efficacy using constructs targeting cJun N-terminal kinase 1 (JNK1). Hydrodynamic delivery of siRNA lowered liver JNK1 protein levels 40% in DIO mice, but was accompanied by iatrogenic liver damage. The ob/ob model proved even more intolerant of this technique, with hydrodynamic delivery resulting in severe liver damage and death of most animals. While well-tolerated, i.p. injections of siRNA in DIO mice did not result in any knockdown or phenotypic changes in the mice. On the other hand, i.v. injected adenovirus expressing shRNA potently reduced expression of JNK1 in vivo by 95% without liver toxicity. In conclusion, i.p. and hydrodynamic injections of siRNA were ineffective and/or inappropriate for in vivo gene targeting in DIO and ob/ob mice, while adenovirus-mediated delivery of shRNA provided a relatively benign and effective method for exploring liver target silencing.

FAK and BMP-9 synergistically trigger osteogenic differentiation and bone formation of adipose derived stem cells through enhancing Wnt-β-catenin signaling.

PubMed

Yuan, Cheng; Gou, Xiaoli; Deng, Jiang; Dong, Zhijun; Ye, Peng; Hu, Zhenming

2018-06-14

Adipose derived stem cells (ADSCs) could undergo osteogenesis via focal adhesion kinase (FAK) and bone morphogenetic protein (BMP) 9 signals, both of which could affect Wnt-β-catenin signal, a signal pathway closely related to ADSCs osteogenesis. It's still enigma whether FAK and BMP-9 contribute to osteogenesis. Here, we examined the effect of FAK on BMP9-inducedosteogenic differentiation, unveiled the possible molecular mechanism underling this process. In the present study, ADSCs were isolated and purified, and cells of passage 3 underwent virus mediated transfection to prepare ADSCs with stable FAK shRNA expression. Cell viability and migration were detected by MTT and transwell assay, respectively. Expression of osteogenic gene, phosphorylation of FAK and GSK were detected by western blot. Osteogenic potential was evaluated by activity of alkaline phosphatase (ALP) and calcium deposition by ALP staining and Alizarin Red S staining. BMP-9 administration promoted ADSCs osteogenesis. Knocking down FAK attenuated this process, inhibited osteogenic proteins expression through Wnt-β-catenin signal. BMP-9 also triggered ADSCs proliferation and migration, and shFAK antagonized such effects too. Although Wnt signal is affected by FAK shRNA, Smad signal remains intact in ADSCs with shFAK. FAK and BMP-9 could cross talk on Wnt signal pathway and promote ADSCs osteogenesis. FAK could participate in BMP-9 induced ADSCs osteogenesis via Wnt signal pathway other than Smads signals (see in graph). Copyright © 2018. Published by Elsevier Masson SAS.

Inhibition of TRPC3 downregulates airway hyperresponsiveness, remodeling of OVA-sensitized mouse

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Lingwei; Li, Jie; Integrated Chinese and Western Medicine Postdoctoral Research Station, Jinan University, Guangzhou

Airway hyperresponsiveness (AHR), airway remodeling and inflammation are the fundamental pathological alterations that occur in asthma. Transient receptor potential canonical 3 (TRPC3) has been implicated in diverse functions of airway smooth muscle cells (ASMCs) in asthma. However, the underlying mechanisms remain incompletely understood. We investigated the mRNA and protein expression of TRPC3 in ASMCs from normal and OVA-sensitized mouse. And the effects of inhibition or knockdown of TRPC3 with Ethyl-1- (4- (2,3,3-trichloroacrylamide) phenyl) −5 - (trifluoromethyl) -1H -pyrazole -4-carboxylate (Pyr3) and lentiviral shRNA on OVA-sensitized mouse AHR, airway remodeling, circulating inflammatory cytokines, cell proliferation and migration. We found that TRPC3 mRNAmore » and protein expression levels were significantly increased in ASMCs from OVA-sensitized mouse. Inhibiting TRPC3 with continuous subcutaneous administration of Pyr3 decreased enhanced pause (Penh) of OVA-sensitized mouse. Meanwhile, both Pyr3 and lentiviral shRNA treatment of ASMCs in OVA-sensitized mouse significantly decreased their proliferation and migration. These results suggest that TRPC3 plays a critical role in asthma and represents a promising new target for asthma treatment. - Highlights: • Penh, airway remodeling and the gene expression and protein of TRPC3 are increased in OVA-sensitized mice. • Inhibition of TRPC3 suppresses the OVA-sensitized mice Penh and airway remodeling. • Inhibition of TRPC3 decreases OVA-sensitized mice ASMC proliferation and migration.« less

[Algal oligosaccharides ameliorate osteoporosis via up-regulation of parathyroid hormone 1-84 and vascular endothelial growth factor].

PubMed

Wang, Li; Wang, Haiya; Fang, Ningyuan

2016-06-01

To determine whether algal oligosac- charide~ affects the levels of parathyroid hormone 1-84 (PTH1-84) and vascular endothelial growth fac- tor (VEGF). An osteoporosis rat model was estab- lished via bilateral ovariectomy. The model rats were fed algal oligosaccharides (molecular weights: 600-1, 200 Da) for 4 months. Bone mineral density (BMD) was then measured. MG-63 human osteo- blastic cells were treated with algal oligosaccha- rides. The expression of PTH1-84 and VEGF was then examined. Oligosaccharide-treated cells were transfected with PTH1-84 short hairpin RNA (shR- NA), VEGF shRNA, and PTH1-84-VEGF small interfer- ing RNA (siRNA). The growth rates were then com- pared between transfected and non-transfected Algal oligosaccharides increased the BMD of the osteoporosis rat model compared with untreated controls (P < 0.05). When MG-63 cells were treated with algal oligosaccharides, the growth rate increased by 25% compared with the control group at day 3 (P < 0.05). In addition, the ex- pression of P.TH84 and VEGF was. enhanced. Con- versey w hen tecells were tranfected with PTH84 shRNA, VEGF shRNA, or PTH1-84-VEGF siR- NA, the growth rate was decreased by 17%, 35% and 70%, respectively, compared with controls at day 3 (P < 0.05). Algal oligosaccharides ameliorate osteoporosis via up-regulation of PTH1-84 and VEGF. Algal oligosaccharides should be developed as a potential drug for osteoporosis treatment.

Rapid modification of the pET-28 expression vector for ligation independent cloning using homologous recombination in Saccharomyces cerevisiae

PubMed Central

Gay, Glen; Wagner, Drew T.; Keatinge-Clay, Adrian T.; Gay, Darren C.

2014-01-01

The ability to rapidly customize an expression vector of choice is a valuable tool for any researcher involved in high-throughput molecular cloning for protein overexpression. Unfortunately, it is common practice to amend or neglect protein targets if the gene that encodes the protein of interest is incompatible with the multiple-cloning region of a preferred expression vector. To address this issue, a method was developed to quickly exchange the multiple-cloning region of the popular expression plasmid pET-28 with a ligation-independent cloning cassette, generating pGAY-28. This cassette contains dual inverted restriction sites that reduce false positive clones by generating a linearized plasmid incapable of self-annealing after a single restriction-enzyme digest. We also establish that progressively cooling the vector and insert leads to a significant increase in ligation-independent transformation efficiency, demonstrated by the incorporation of a 10.3 kb insert into the vector. The method reported to accomplish plasmid reconstruction is uniquely versatile yet simple, relying on the strategic placement of primers combined with homologous recombination of PCR products in yeast. PMID:25304917

Streptomyces griseus streptomycin phosphotransferase: expression of its gene in Escherichia coli and sequence homology with other antibiotic phosphotransferases and with eukaryotic protein kinases.

PubMed

Lim, C K; Smith, M C; Petty, J; Baumberg, S; Wootton, J C

1989-12-01

The aphD gene of Streptomyces griseus, encoding a streptomycin 6-phosphotransferase (SPH), was sub-cloned in the pBR322-based expression vector pRK9 (which contains the Serratia marcescens trp promoter) with selection for expression of streptomycin resistance in Escherichia coli. Two hybrid plasmids, pCKL631 and pCKL711, were isolated which conferred resistance. Both contained a approximately 2 kbp fragment already suspected to include aphD. The properties of in vitro deletion derivatives of these plasmids were consistent with the presumed location of aphD. In vitro deletion of a sequence including most of the trp promoter largely, but not quite completely, abolished the ability of the plasmid to confer streptomycin resistance, confirming that expression was indeed principally from the trp promoter. A polypeptide of approximately 34.5 kDa was present in minicells containing plasmids that conferred streptomycin resistance, but was absent when the plasmids contained in vitro deletions removing streptomycin resistance. Part of the fragment was sequenced and an open reading frame corresponding to aphD identified. A computer-assisted comparison of the deduced SPH sequence with those of other antibiotic phosphotransferases suggested a common structure A-B-C-D-E, where B and D were conserved between all sequences compared while A, C and E divided between the streptomycin and hygromycin B phosphotransferases on one hand and kanamycin/neomycin ones on the other. A composite sequence data base was searched for homologues to consensus matrices constructed from five approximately 12-residue subsequences within blocks B and D. For one subsequence, corresponding to the N-terminal portion of block D, those sequences from the database that yielded the highest homology scores comprised almost entirely either antibiotic phosphotransferases or eukaryotic protein kinases. Possible evolutionary implications of this homology, previously described by other groups, are discussed.

Application of methylation in improving plasmid transformation into Helicobacter pylori.

PubMed

Zhao, Huilin; Xu, Linlin; Rong, Qianyu; Xu, Zheng; Ding, Yunfei; Zhang, Ying; Wu, Yulong; Li, Boqing; Ji, Xiaofei

2018-05-23

Helicobacter pylori is an important gastrointestinal pathogen. Its strains possess different levels of powerful restriction modification systems, which are significant barriers to genetic tools used for studying the role of functional genes in its pathogenesis. Methylating vectors in vitro was reported as an alternative to overcome this barrier in several bacteria. In this study we used two H. pylori-E. coli shuttle plasmids and several single/double-crossover homologous recombination gene-targeting plasmids, to test the role of methylation in H. pylori transformation. According to our results, transformants could be obtained only after shuttle plasmids were methylated before transformation. It is helpful in gene complementation and over-expression although at a low frequency. The frequency of gene-targeting transformation was also increased after methylation, especially for the single-crossover recombination plasmids, the transformants of which could only be obtained after methylation. For the double-crossover recombination targeting plasmids, the initial yield of transformants was 0.3-0.8 × 10 2 CFUs per microgram plasmid DNA. With the help of methylation, the yield was increased to 0.4-1.3 × 10 2 CFUs per microgram plasmid DNA. These results suggest that in vitro methylation can improve H. pylori transformation by different plasmids, which will benefit the pathogenic mechanism research. Copyright © 2018. Published by Elsevier B.V.

[Construction and functional identification of eukaryotic expression vector carrying Sprague-Dawley rat MSX-2 gene].

PubMed

Yang, Xian-Xian; Zhang, Mei; Yan, Zhao-Wen; Zhang, Ru-Hong; Mu, Xiong-Zheng

2008-01-01

To construct a high effective eukaryotic expressing plasmid PcDNA 3.1-MSX-2 encoding Sprague-Dawley rat MSX-2 gene for the further study of MSX-2 gene function. The full length SD rat MSX-2 gene was amplified by PCR, and the full length DNA was inserted in the PMD1 8-T vector. It was isolated by restriction enzyme digest with BamHI and Xhol, then ligated into the cloning site of the PcDNA3.1 expression plasmid. The positive recombinant was identified by PCR analysis, restriction endonudease analysis and sequence analysis. Expression of RNA and protein was detected by RT-PCR and Western blot analysis in PcDNA3.1-MSX-2 transfected HEK293 cells. Sequence analysis and restriction endonudease analysis of PcDNA3.1-MSX-2 demonstrated that the position and size of MSX-2 cDNA insertion were consistent with the design. RT-PCR and Western blot analysis showed specific expression of mRNA and protein of MSX-2 in the transfected HEK293 cells. The high effective eukaryotic expression plasmid PcDNA3.1-MSX-2 encoding Sprague-Dawley Rat MSX-2 gene which is related to craniofacial development can be successfully reconstructed. It may serve as the basis for the further study of MSX-2 gene function.

Construction of conjugative gene transfer system between E. coli and moderately thermophilic, extremely acidophilic Acidithiobacillus caldus MTH-04.

PubMed

Liu, Xiangmei; Lin, Jianqun; Zhang, Zheng; Bian, Jiang; Zhao, Qing; Liu, Ying; Lin, Jianqiang; Yan, Wangming

2007-01-01

A genetic transfer system for introducing foreign genes to biomining microorganisms is urgently needed. Thus, a conjugative gene transfer system was investigated for a moderately thermophilic, extremely acidophilic biomining bacterium, Acidithiobacillus caldus MTH-04. The broad-host-range IncP plasmids RP4 and R68.45 were transferred directly into A. caldus MTH-04 from Escherichia coli by conjugation at relatively high frequencies. Additionally the broad-host-range IncQ plasmids pJRD215, pVLT33, and pVLT35 were also transferred into A. caldus MTH-04 with the help of plasmid RP4 or strains with plasmid RP4 integrated into their chromosome, such as E. coli SM10. The Km(r) and Sm(r) selectable markers from these plasmids were successfully expressed in A. caldus MTH-04. Futhermore, the IncP and IncQ plasmids were transferred back into E. coli cells from A. caldus MTH-04, thereby confirming the initial transfer of these plasmids from E. coli to A. caldus MTH-04. All the IncP and IncQ plasmids studied were stable in A. caldus MTH-04. Consequently, this development of a conjugational system for A. caldus MTH-04 will greatly facilitate its genetic study.

Site-specific recombination in the cyanobacterium Anabaena sp. strain PCC 7120 catalyzed by the integrase of coliphage HK022.

PubMed

Melnikov, Olga; Zaritsky, Arieh; Zarka, Aliza; Boussiba, Sammy; Malchin, Natalia; Yagil, Ezra; Kolot, Mikhail

2009-07-01

The integrase (Int) of the lambda-like coliphage HK022 catalyzes the site-specific integration and excision of the phage DNA into and from the chromosome of its host, Escherichia coli. Int recognizes two different pairs of recombining sites attP x attB and attL x attR for integration and excision, respectively. This system was adapted to the cyanobacterium Anabaena sp. strain PCC 7120 as a potential tool for site-specific gene manipulations in the cyanobacterium. Two plasmids were consecutively cointroduced by conjugation into Anabaena cells, one plasmid that expresses HK022 Int recombinase and the other plasmid that carries the excision substrate P(glnA)-attL-T1/T2-attR-lacZ, where T1/T2 are the strong transcription terminators of rrnB, to prevent expression of the lacZ reporter under the constitutive promoter P(glnA). The Int-catalyzed site-specific recombination reaction was monitored by the expression of lacZ emanating as a result of T1/T2 excision. Int catalyzed the site-specific excision reaction in Anabaena cells when its substrate was located either on the plasmid or on the chromosome with no need to supply an accessory protein, such as integration host factor and excisionase (Xis), which are indispensable for this reaction in its host, E. coli.

[Experimental study of human umbilical cord blood derived stromal cells transfected with recombinant adenoviral vector co-expressing VCAM-1 and GFP].

PubMed

Zhang, Xi; Si, Ying-Jian; Chen, Xing-Hua; Liu, Yao; Gao, Li; Gao, Lei; Peng, Xian-Gui; Wang, Qing-Yu

2008-06-01

This study was aimed to investigate the effect of vcam-1 gene-modified human umbilical cord blood derived stromal cells (CBDSCs) on hematopoietic regulation so as to establish the experimental foundation for further study. The target gene vcam-1 was cloned into the shuttle plasmid with the report gene GFP. The recombinant shuttle plasmid was transformed into BJ5183 bacteria to recombine with backbone vector pAdeasy-l, and the recombinant adenoviral vector ad-vcam-1-gfp was confirmed after transfection with CBDSCs. The results indicated that two fragments of about 9 kb and 2 kb were obtained after digestion of recombinant plasmid pAdTrack-vcam-1 with NotIand XhoI, and single fragment of 600 bp was obtained after amplification with PCR; two fragments of about 31 kb and 4 kb were obtained after digestion of recombinant plasmid pad-vcam-1-gfp with PacI, which suggested a successful homologous recombination. The expression of vcam-1 gene in ad-vcam-1-gfp transfected CBDSCs could be detected by immunocytochemistry, RT-PCR and fluorescent microscopy. It is concluded that the recombinant adenoviral vector ad-vcam-1-gfp has been constructed successfully, and the expression of vcam-1 is up-regulated in CBDSCs transfected by gene ad-vcam-1-gfp.

Transfer of Herb-Resistance Plasmid From Escherichia coli to Staphylococcus aureus Residing in the Human Urinary Tract

PubMed Central

Tong, Yan Qing; Xin, Bing; Zhu, Li

2014-01-01

Background: Plasmid transfer among bacteria provides a means for dissemination of resistance. Plasmid Analysis has made it possible to track plasmids that induce resistance in bacterial population. Objectives: To screen the presence of herb-resistance plasmid in Escherichia coli strains and determine the transferability of this resistance plasmid directly from E. coli to the Gram-positive, Staphylococcus aureus. Materials and Methods: The donor strain E. coli CP9 and recipient strain S. aureus RN450RF were isolated from UTI patients. E. coli CP9 was highly resistant to herbal concoction. Isolates of S. aureus RN450RF were fully susceptible. Total plasmid DNA was prepared and transferred into E. coli DH5α. Transconjugants were selected on agar plates containing serial dilutions of herbal concoction. Resistance plasmid was transferred to susceptible S. aureus RN450RFin triple replicas. The mating experiments were repeated twice. Results: The identified 45 kb herb-resistance plasmid could be transferred from E. coli CP9 isolates to E. coli DH5α. As a consequence E. coli DH5α transconjugant MIC increased from 0.0125 g/mL to 0.25 g/mL. The plasmid was easily transferred from E. coli CP9 strain to S. aureus RN450RF with a mean transfer rate of 1×10-2 transconjugants/recipient. The E. coli donor and the S. aureus RN450RF transconjugant contained a plasmid of the same size, which was absent in the recipient before mating. Susceptibility testing showed that the S. aureus RN450RF transconjugant was resistant to herbal concoction. Conclusions: E. coli herb-resistance plasmid can replicate and be expressed in S. aureus. PMID:25147679

Process and genes for expression and overexpression of active [FeFe] hydrogenases

DOEpatents

Seibert, Michael; King, Paul W; Ghirardi, Maria Lucia; Posewitz, Matthew C; Smolinski, Sharon L

2014-09-16

A process for expression of active [FeFe]-hydrogenase in a host organism that does not contain either the structural gene(s) for [FeFe]-hydrogenases and/or homologues for the maturation genes HydE, HydF and HyG, comprising: cloning the structural hydrogenase gene(s) and/or the maturation genes HydE, HydF and HydG from an organisms that contains these genes into expression plasmids; transferring the plasmids into an organism that lacks a native [FeFe]-hydrogenase or that has a disrupted [FeFe]-hydrogenase and culturing it aerobically; and inducing anaerobiosis to provide [FeFe] hydrogenase biosynthesis and H?2#191 production.

Molecular cloning and expression in streptomyces lividans of a hygromycin B phosphotransferase gene from Streptomyces hygroscopicus.

PubMed

Malpartida, F; Zalacaín, M; Jiménez, A; Davies, J

1983-11-30

The gene encoding the phosphotransferase enzyme that modifies hygromycin B in its producing organism Streptomyces hygroscopicus, has been cloned in the Streptomyces vector pIJ41. Two plasmids, pFM4 and pFM6, containing 2.1 and 19.6 kb inserts of Streptomyces hygroscopicus DNA, respectively, which express the modifying enzyme, have been isolated. A 3.1 kb PstI restriction fragment from pFM4 was inserted in the Streptomyces vector pIJ350 and the resulting plasmids, pMZ11.1 and pMZ11.2, express the hygromycin B-resistance phenotype. The utility of this dominant marker for cloning experiments is discussed in the text.

Eye drop delivery of nano-polymeric micelle formulated genes with cornea-specific promoters.

PubMed

Tong, Yaw-Chong; Chang, Shwu-Fen; Liu, Chia-Yang; Kao, Winston W-Y; Huang, Chong Heng; Liaw, Jiahorng

2007-11-01

This study evaluates the eye drop delivery of genes with cornea-specific promoters, i.e., keratin 12 (K12) and keratocan (Kera3.2) promoters, by non-ionic poly(ethylene oxide)-poly(propylene oxide)-poly(ethylene oxide) (PEO-PPO-PEO) polymeric micelles (PM) to mouse and rabbit eyes, and investigates the underlying mechanisms. Three PM-formulated plasmids (pCMV-Lac Z, pK12-Lac Z and pKera3.2-Lac Z) containing the Lac Z gene for beta-galactosidase (beta-Gal) whose expression was driven by the promoter of either the cytomegalovirus early gene, the keratin 12 gene or the keratocan gene, were characterized by critical micelle concentration (CMC), dynamic light scattering (DLS), and atomic force microscopy (AFM). Transgene expression in ocular tissue after gene delivery was analyzed by 5-bromo-4-chloro-3-indolyl-beta-D-galactoside (X-Gal) color staining, 1,2-dioxetane beta-Gal enzymatic activity measurement, and real-time polymerase chain reaction (PCR) analysis. The delivery mechanisms of plasmid-PM on mouse and rabbit corneas were evaluated by EDTA and RGD (arginine-glycine-aspartic acid) peptide. The sizes of the three plasmid-PM complexes were around 150-200 nm with unimodal distribution. Enhanced stability was found for three plasmid-PM formulations after DNase I treatment. After six doses of eye drop delivery of pK12-Lac Z-PM three times a day, beta-Gal activity was significantly increased in both mouse and rabbit corneas. Stroma-specific Lac Z expression was only found in pKera3.2-Lac Z-PM-treated animals with pretreatment by 5 mM EDTA, an opener of junctions. Lac Z gene expression in both pK12-Lac Z-PM and pKera3.2-Lac Z-PM delivery groups was decreased by RGD peptide pretreatment. Cornea epithelium- and stroma-specific gene expression could be achieved using cornea-specific promoters of keratin 12 and keratocan genes, and the gene was delivered with PM formulation through non-invasive, eye drop in mice and rabbits. The transfection mechanism of plasmid-PM may involve endocytosis and particle size dependent paracellular transport. 2007 John Wiley & Sons, Ltd

Characterization of the aes gene of Escherichia coli encoding an enzyme with esterase activity.

PubMed Central

Peist, R; Koch, A; Bolek, P; Sewitz, S; Kolbus, T; Boos, W

1997-01-01

malQ mutants of Escherichia coli lacking amylomaltase cannot grow on maltose. They express the maltose system constitutively and are sensitive to maltose when grown on another carbon source. In an attempt to isolate a multicopy suppressor that would result in growth on maltose, we transformed a malQ mutant with a gene bank of E. coli DNA which had been digested with Sau3a and cloned in pBR322. We screened the transformants on MacConkey maltose plates. A colony was isolated that appeared to be resistant to maltose and was pink on these plates, but it was still unable to grow on minimal medium with maltose as the carbon source. The plasmid was isolated, and the gene causing this phenotype was characterized. The deduced amino acid sequence of the encoded protein shows homology to that of lipases and esterases. We termed the gene aes, for acetyl esterase. Extracts of cells harboring plasmid-encoded aes under its own promoter exhibit a fivefold higher capacity to hydrolyze p-nitrophenyl acetate than do extracts of cells of plasmid-free strains. Similarly, strains harboring plasmid-encoded aes are able to grow on triacetyl glycerol (triacetin) whereas the plasmid-free strains are not. The expression of plasmid-encoded aes resulted in strong repression of the maltose transport genes in malT+ strains (10-fold reduction), but not in a malT(Con) strain which is independent of the inducer. Also, overproduction of MalT counteracted the Aes-dependent repression, indicating a direct interaction between MalT and Aes. PMID:9401025

Reliable generation of induced pluripotent stem cells from human lymphoblastoid cell lines.

PubMed

Barrett, Robert; Ornelas, Loren; Yeager, Nicole; Mandefro, Berhan; Sahabian, Anais; Lenaeus, Lindsay; Targan, Stephan R; Svendsen, Clive N; Sareen, Dhruv

2014-12-01

Patient-specific induced pluripotent stem cells (iPSCs) hold great promise for many applications, including disease modeling to elucidate mechanisms involved in disease pathogenesis, drug screening, and ultimately regenerative medicine therapies. A frequently used starting source of cells for reprogramming has been dermal fibroblasts isolated from skin biopsies. However, numerous repositories containing lymphoblastoid cell lines (LCLs) generated from a wide array of patients also exist in abundance. To date, this rich bioresource has been severely underused for iPSC generation. We first attempted to create iPSCs from LCLs using two existing methods but were unsuccessful. Here we report a new and more reliable method for LCL reprogramming using episomal plasmids expressing pluripotency factors and p53 shRNA in combination with small molecules. The LCL-derived iPSCs (LCL-iPSCs) exhibited identical characteristics to fibroblast-derived iPSCs (fib-iPSCs), wherein they retained their genotype, exhibited a normal pluripotency profile, and readily differentiated into all three germ-layer cell types. As expected, they also maintained rearrangement of the heavy chain immunoglobulin locus. Importantly, we also show efficient iPSC generation from LCLs of patients with spinal muscular atrophy and inflammatory bowel disease. These LCL-iPSCs retained the disease mutation and could differentiate into neurons, spinal motor neurons, and intestinal organoids, all of which were virtually indistinguishable from differentiated cells derived from fib-iPSCs. This method for reliably deriving iPSCs from patient LCLs paves the way for using invaluable worldwide LCL repositories to generate new human iPSC lines, thus providing an enormous bioresource for disease modeling, drug discovery, and regenerative medicine applications. ©AlphaMed Press.

Genetic modification of bone-marrow mesenchymal stem cells and hematopoietic cells with human coagulation factor IX-expressing plasmids.

PubMed

Sam, Mohammad Reza; Azadbakhsh, Azadeh Sadat; Farokhi, Farrah; Rezazadeh, Kobra; Sam, Sohrab; Zomorodipour, Alireza; Haddad-Mashadrizeh, Aliakbar; Delirezh, Nowruz; Mokarizadeh, Aram

2016-05-01

Ex-vivo gene therapy of hemophilias requires suitable bioreactors for secretion of hFIX into the circulation and stem cells hold great potentials in this regard. Viral vectors are widely manipulated and used to transfer hFIX gene into stem cells. However, little attention has been paid to the manipulation of hFIX transgene itself. Concurrently, the efficacy of such a therapeutic approach depends on determination of which vectors give maximal transgene expression. With this in mind, TF-1 (primary hematopoietic lineage) and rat-bone marrow mesenchymal stem cells (BMSCs) were transfected with five hFIX-expressing plasmids containing different combinations of two human β-globin (hBG) introns inside the hFIX-cDNA and Kozak element and hFIX expression was evaluated by different methods. In BMSCs and TF-1 cells, the highest hFIX level was obtained from the intron-less and hBG intron-I,II containing plasmids respectively. The highest hFIX activity was obtained from the cells that carrying the hBG intron-I,II containing plasmids. BMSCs were able to produce higher hFIX by 1.4 to 4.7-fold increase with activity by 2.4 to 4.4-fold increase compared to TF-1 cells transfected with the same constructs. BMSCs and TF-1 cells could be effectively bioengineered without the use of viral vectors and hFIX minigene containing hBG introns could represent a particular interest in stem cell-based gene therapy of hemophilias. Copyright © 2016 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.

Armored Long RNA Controls or Standards for Branched DNA Assay for Detection of Human Immunodeficiency Virus Type 1▿

PubMed Central

Zhan, Sien; Li, Jinming; Xu, Ruihuan; Wang, Lunan; Zhang, Kuo; Zhang, Rui

2009-01-01

The branched DNA (bDNA) assay is a reliable method for quantifying the RNA of human immunodeficiency virus type 1 (HIV-1). The positive controls and standards for this assay for the detection of HIV-1 consist of naked RNA, which is susceptible to degradation by RNase. Armored RNA is a good candidate for an RNase-resistant positive control or standard. However, its use has been limited by the maximal length of the exogenous RNA packaged into virus-like particles by routine armored RNA technology. In the present study, we produced armored long RNA (armored L-RNA) controls or standards (AR-HIV-pol-3034b) for a bDNA assay of HIV-1 by increasing the amount and affinity of the pac sites (the pac site is a specific 19-nucleotide stem-loop region located at the 5′ terminus of the MS2 bacteriophage replicase gene) by a one-plasmid double-expression system. AR-HIV-pol-3034b was completely resistant to DNase and RNase, was stable in normal human EDTA-preserved plasma at 4°C for at least 6 months, and produced reproducible, linear results in the Versant HIV-1 RNA 3.0 assay. In conclusion, AR-HIV-pol-3034b could act as a positive control or standard in a bDNA assay for the detection of HIV-1. In addition, the one-plasmid double-expression system can be used as a better platform than the one-plasmid expression system and the two-plasmid coexpression system for expressing armored L-RNA. PMID:19494069

Armored long RNA controls or standards for branched DNA assay for detection of human immunodeficiency virus type 1.

PubMed

Zhan, Sien; Li, Jinming; Xu, Ruihuan; Wang, Lunan; Zhang, Kuo; Zhang, Rui

2009-08-01

The branched DNA (bDNA) assay is a reliable method for quantifying the RNA of human immunodeficiency virus type 1 (HIV-1). The positive controls and standards for this assay for the detection of HIV-1 consist of naked RNA, which is susceptible to degradation by RNase. Armored RNA is a good candidate for an RNase-resistant positive control or standard. However, its use has been limited by the maximal length of the exogenous RNA packaged into virus-like particles by routine armored RNA technology. In the present study, we produced armored long RNA (armored L-RNA) controls or standards (AR-HIV-pol-3034b) for a bDNA assay of HIV-1 by increasing the amount and affinity of the pac sites (the pac site is a specific 19-nucleotide stem-loop region located at the 5' terminus of the MS2 bacteriophage replicase gene) by a one-plasmid double-expression system. AR-HIV-pol-3034b was completely resistant to DNase and RNase, was stable in normal human EDTA-preserved plasma at 4 degrees C for at least 6 months, and produced reproducible, linear results in the Versant HIV-1 RNA 3.0 assay. In conclusion, AR-HIV-pol-3034b could act as a positive control or standard in a bDNA assay for the detection of HIV-1. In addition, the one-plasmid double-expression system can be used as a better platform than the one-plasmid expression system and the two-plasmid coexpression system for expressing armored L-RNA.

[Adenovirus-mediated canine interferon-gamma expression and its antiviral activity against canine parvovirus].

PubMed

Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia

2012-11-04

To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.

Sox2 regulatory region 2 sequence works as a DNA nuclear targeting sequence enhancing the efficiency of an exogenous gene expression in ES cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Funabashi, Hisakage; Takatsu, Makoto; Saito, Mikako

2010-10-01

Research highlights: {yields} SV40-DTS worked as a DTS in ES cells as well as other types of cells. {yields} Sox2 regulatory region 2 worked as a DTS in ES cells and thus was termed as SRR2-DTS. {yields} SRR2-DTS was suggested as an ES cell-specific DTS. -- Abstract: In this report, the effects of two DNA nuclear targeting sequence (DTS) candidates on the gene expression efficiency in ES cells were investigated. Reporter plasmids containing the simian virus 40 (SV40) promoter/enhancer sequence (SV40-DTS), a DTS for various types of cells but not being reported yet for ES cells, and the 81 basemore » pairs of Sox2 regulatory region 2 (SRR2) where two transcriptional factors in ES cells, Oct3/4 and Sox2, are bound (SRR2-DTS), were introduced into cytoplasm in living cells by femtoinjection. The gene expression efficiencies of each plasmid in mouse insulinoma cell line MIN6 cells and mouse ES cells were then evaluated. Plasmids including SV40-DTS and SRR2-DTS exhibited higher gene expression efficiency comparing to plasmids without these DTSs, and thus it was concluded that both sequences work as a DTS in ES cells. In addition, it was suggested that SRR2-DTS works as an ES cell-specific DTS. To the best of our knowledge, this is the first report to confirm the function of DTSs in ES cells.« less

Poly (lactide-co-glycolide)-polymethacrylate nanoparticles for intramuscular delivery of plasmid encoding interleukin-10 to prevent autoimmune diabetes in mice.

PubMed

Basarkar, Ashwin; Singh, Jagdish

2009-01-01

Determine the efficiency of cationic nanoparticles prepared by blending poly (lactide-co-glycolide; PLGA) and methacrylate copolymer (Eudragit(R) E100) to deliver a therapeutic gene encoding mouse interleukin-10, in vitro and in vivo. Nanoparticles prepared with PLGA and E100 were evaluated for delivery of plasmid DNA encoding mouse interleukin-10 in vitro and in vivo in mice upon intramuscular injection. Blood-glucose, serum interferon-gamma levels and histology of pancreas were studied to determine therapeutic efficacy. Histological evaluation of skeletal muscle from the injection site was performed to assess the biocompatibility of nanoparticles. PLGA/E100 nanoparticles showed endosomal escape evidenced by confocal microscopy and buffering ability. Transfecting HEK293 cells with plasmid-loaded PLGA/E100 nanoparticles resulted in significantly (p < 0.05) greater expression of interleukin-10 compared to PLGA nanoparticles. Mice treated with PLGA/E100 nanoparticles displayed higher serum levels of interleukin-10 and lower blood glucose levels compared to those treated with interleukin-10 plasmid alone or PLGA nanoparticles. High expression of interleukin-10 facilitated suppression of interferon-gamma levels and reduced islet infiltration. Histology of muscle showed that nanoparticles were biocompatible and did not cause chronic inflammatory response. Nanoparticles prepared by blending PLGA with methacrylate can efficiently and safely deliver plasmid DNA encoding mouse interleukin-10 leading to prevention of autoimmune diabetes.

Development of a high-copy plasmid for enhanced production of recombinant proteins in Leuconostoc citreum.

PubMed

Son, Yeon Jeong; Ryu, Ae Jin; Li, Ling; Han, Nam Soo; Jeong, Ki Jun

2016-01-15

Leuconostoc is a hetero-fermentative lactic acid bacteria, and its importance is widely recognized in the dairy industry. However, due to limited genetic tools including plasmids for Leuconostoc, there has not been much extensive research on the genetics and engineering of Leuconostoc yet. Thus, there is a big demand for high-copy-number plasmids for useful gene manipulation and overproduction of recombinant proteins in Leuconostoc. Using an existing low-copy plasmid, the copy number of plasmid was increased by random mutagenesis followed by FACS-based high-throughput screening. First, a random library of plasmids was constructed by randomizing the region responsible for replication in Leuconostoc citreum; additionally, a superfolder green fluorescent protein (sfGFP) was used as a reporter protein. With a high-speed FACS sorter, highly fluorescent cells were enriched, and after two rounds of sorting, single clone exhibiting the highest level of sfGFP was isolated. The copy number of the isolated plasmid (pCB4270) was determined by quantitative PCR (qPCR). It was found that the isolated plasmid has approximately a 30-fold higher copy number (approx. 70 copies per cell) than that of the original plasmid. From the sequence analysis, a single mutation (C→T) at position 4690 was found, and we confirmed that this single mutation was responsible for the increased plasmid copy number. The effectiveness of the isolated high-copy-number plasmid for the overproduction of recombinant proteins was successfully demonstrated with two protein models Glutathione-S-transferase (GST) and α-amylase. The high-copy number plasmid was successfully isolated by FACS-based high-throughput screening of a plasmid library in L. citreum. The isolated plasmid could be a useful genetic tool for high-level gene expression in Leuconostoc, and for extending the applications of this useful bacteria to various areas in the dairy and pharmaceutical industries.

[Involvement of interaction between TRPC1 and Orai1 in calcium sensing receptor-mediated calcium influx and nitric oxide generation in human umbilical vein endothelial cells].

PubMed

Wang, La-Mei; Tang, Na; Zhong, Hua; Pang, Li-Juan; Zhang, Chun-Jun; He, Fang

2018-06-25

The present study was to investigate the role of the interaction between canonical transient receptor potential channel 1 (TRPC1) and calcium release-activated calcium modulator 1 (Orai1) in extracellular Ca 2+ -sensing receptor (CaR)-induced extracellular Ca 2+ influx and nitric oxide (NO) production. Human umbilical vein endothelial cells (HUVECs) were incubated with CaR agonist Spermine [activating store-operated calcium channels (SOC) and receptor-operated calcium channels (ROC)] alone or in combination with the following reagents: CaR negative allosteric modulator Calhex231 plus ROC analogue TPA (activating ROC and blocking SOC), Ro31-8220 (PKC inhibitor that activates SOC and blocks ROC) or Go6967 (PKCs and PKCµ inhibitor that activates SOC and blocks ROC). The protein expressions and co-localization of TRPC1 and Orai1 were determined using immunofluorescent staining. The interaction between TRPC1 and Orai1 was examined by co-immunoprecipitation. We silenced the expressions of their genes in the HUVECs by transfection of constructed TRPC1 and Orai1 shRNA plasmids. Intracellular Ca 2+ concentration ([Ca 2+ ] i ) was detected using Ca 2+ indicator Fura-2/AM, and NO production was determined by DAF-FM staining. The results showed that TRPC1 and Orai1 protein expressions were co-located on the cell membrane of the HUVECs. Compared with Spermine+Ca 2+ group, Calhex231+ TPA+Spermine+Ca 2+ , Ro31-8220+Spermine+Ca 2+ and Go6976+Spermine+Ca 2+ groups exhibited down-regulated protein expressions of TRPC1 and Orai1 in cytoplasm and decreased co-localization on the cell membrane. Co-immunoprecipitation results showed that the interaction between TRPC1 and Orai1 was reduced by Calhex231 plus TPA, Ro31-8220 or Go6976 addition in the Spermine-stimulated HUVECs. Double knockdown of Trpc1 and Orai1 genes significantly decreased [Ca 2+ ] i level and NO production in all of the Spermine+Ca 2+ , Calhex231+TPA+Spermine+Ca 2+ , Ro31-8220+Spermine+Ca 2+ and Go6976+Spermine+Ca 2+ groups. These results suggest that TRPC1/Orai1 may form a complex that mediates Ca 2+ influx and No production via SOC and ROC activation.

Proteasome activity or expression is not altered by activation of the heat shock transcription factor Hsf1 in cultured fibroblasts or myoblasts.

PubMed

Taylor, David M; Kabashi, Edor; Agar, Jeffrey N; Minotti, Sandra; Durham, Heather D

2005-01-01

Heat shock proteins (Hsps) with chaperoning function work together with the ubiquitin-proteasome pathway to prevent the accumulation of misfolded, potentially toxic proteins, as well as to control catabolism of the bulk of cytoplasmic, cellular protein. There is evidence for the involvement of both systems in neurodegenerative disease, and a therapeutic target is the heat shock transcription factor, Hsf1, which mediates upregulation of Hsps in response to cellular stress. The mechanisms regulating expression of proteasomal proteins in mammalian cells are less well defined. To assess any direct effect of Hsf1 on expression of proteasomal subunits and activity in mammalian cells, a plasmid encoding a constitutively active form of Hsf1 (Hsf1act) was expressed in mouse embryonic fibroblasts lacking Hsf1 and in cultured human myoblasts. Plasmid encoding an inactivatible form of Hsf1 (Hsf1inact) served as control. In cultures transfected with plasmid hsf1act, robust expression of the major stress-inducible Hsp, Hsp70, occurred but not in cultures transfected with hsf1inact. No significant changes in the level of expression of representative proteasomal proteins (structural [20Salpha], a nonpeptidase beta subunit [20Sbeta3], or 2 regulatory subunits [19S subunit 6b, 11 Salpha]) or in chymotrypsin-, trypsin-, and caspaselike activities of the proteasome were measured. Thus, stress-induced or pharmacological activation of Hsf1 in mammalian cells would upregulate Hsps but not directly affect expression or activity of proteasomes.

Transient transfection of intraerythrocytic Babesia gibsoni using elongation factor-1 alpha promoter.

PubMed

Liu, Mingming; Asada, Masahito; Cao, Shinuo; Adjou Moumouni, Paul Franck; Vudriko, Patrick; Efstratiou, Artemis; Hakimi, Hassan; Masatani, Tatsunori; Sunaga, Fujiko; Kawazu, Shin-Ichiro; Yamagishi, Junya; Xuan, Xuenan

2017-09-01

The development of gene manipulation techniques has been reported in many protozoan parasites over the past few years. However, these techniques have not yet been established for Babesia gibsoni. Here, we report for the first time, the successful transient transfection of B. gibsoni. The plasmid containing the firefly luciferase reporter gene (pBS-ELA) was transfected into B. gibsoni by an AMAXA 4D Nucleofector™ device. Transfection using program FA113 and Lonza buffer SF showed the highest luciferase expression. Twenty micrograms of plasmid produced the highest relative transfection efficiency. The fluorescent protein-expressing parasites were determined by GFP-containing plasmid (pBS-EGA) at 48 and 72h post transfection. This finding is the first step towards a stable transfection method for B. gibsoni, which may contribute to a better understanding of the biology of the parasite. Copyright © 2017 Elsevier B.V. All rights reserved.

H-NS-like nucleoid-associated proteins, mobile genetic elements and horizontal gene transfer in bacteria.

PubMed

Dorman, Charles J

2014-09-01

Horizontal gene transfer plays an important role in the evolution of bacterial species, conferring new genetic traits on the recipient bacterium that extend its range of phenotypes and plasmids make important contributions to this process. However, the inappropriate expression of newly acquired genes may lead to a loss of competitive fitness, resulting in the elimination of the new gene-bacterium combination. It is thought that transcriptional silencing of horizontally acquired genes offers a route out of this dilemma and that nucleoid-associated proteins, especially those related to the H-NS protein, play a particularly important role in the silencing process. The discovery that many plasmids express orthologues of nucleoid-associated proteins adds an interesting dimension to current models of regulatory integration following lateral transfer of DNA. Other horizontally acquired genetic elements, such as genomic islands, also express nucleoid-associated proteins of their own. Here the interactions of H-NS-like nucleoid-associated proteins encoded by the core genome, genomic islands and plasmids are described. Copyright © 2014 Elsevier Inc. All rights reserved.

Directed chromosomal integration and expression of porcine rotavirus outer capsid protein VP4 in Lactobacillus casei ATCC393.

PubMed

Yin, Ji-Yuan; Guo, Chao-Qun; Wang, Zi; Yu, Mei-Ling; Gao, Shuai; Bukhari, Syed M; Tang, Li-Jie; Xu, Yi-Gang; Li, Yi-Jing

2016-11-01

Using two-step plasmid integration in the presence of 5-fluorouracil (5-FU), we developed a stable and markerless Lactobacillus casei strain for vaccine antigen expression. The upp of L. casei, which encodes uracil phosphoribosyltransferase (UPRTase), was used as a counterselection marker. We employed the Δupp isogenic mutant, which is resistant to 5-FU, as host and a temperature-sensitive suicide plasmid bearing upp expression cassette as counterselectable integration vector. Extrachromosomal expression of UPRTase complemented the mutated chromosomal upp allele and restored sensitivity to 5-FU. The resultant genotype can either be wild type or recombinant. The efficacy of the system was demonstrated by insertion and expression of porcine rotavirus (PRV) VP4. To improve VP4 expression, we analyzed L. casei transcriptional profiles and selected the constitutive highly expressed enolase gene (eno). The VP4 inserted after the eno termination codon were screened in the presence of 5-FU. Using genomic PCR amplification, we confirmed that VP4 was successfully integrated and stably inherited for at least 50 generations. Western blot demonstrated that VP4 was steadily expressed in medium with different carbohydrates. RT-qPCR and ELISA analysis showed that VP4 expression from the chromosomal location was similar to that achieved by a plasmid expression system. Applying the recombinant strain to immunize BALB/c mice via oral administration revealed that the VP4-expressing L. casei could induce both specific local and systemic humoral immune responses in mice. Overall, the improved gene replacement system represents an efficient method for chromosome recombination in L. casei and provides a safe tool for vaccine production.

High-level extracellular protein production in Bacillus subtilis using an optimized dual-promoter expression system.

PubMed

Zhang, Kang; Su, Lingqia; Duan, Xuguo; Liu, Lina; Wu, Jing

2017-02-20

We recently constructed a Bacillus subtilis strain (CCTCC M 2016536) from which we had deleted the srfC, spoIIAC, nprE, aprE and amyE genes. This strain is capable of robust recombinant protein production and amenable to high-cell-density fermentation. Because the promoter is among the factors that influence the production of target proteins, optimization of the initial promoter, P amyQ from Bacillus amyloliquefaciens, should improve protein expression using this strain. This study was undertaken to develop a new, high-level expression system in B. subtilis CCTCC M 2016536. Using the enzyme β-cyclodextrin glycosyltransferase (β-CGTase) as a reporter protein and B. subtilis CCTCC M 2016536 as the host, nine plasmids equipped with single promoters were screened using shake-flask cultivation. The plasmid containing the P amyQ' promoter produced the greatest extracellular β-CGTase activity; 24.1 U/mL. Subsequently, six plasmids equipped with dual promoters were constructed and evaluated using this same method. The plasmid containing the dual promoter P HpaII -P amyQ' produced the highest extracellular β-CGTase activity (30.5 U/mL) and was relatively glucose repressed. The dual promoter P HpaII -P amyQ' also mediated substantial extracellular pullulanase (90.7 U/mL) and α-CGTase expression (9.5 U/mL) during shake-flask cultivation, demonstrating the general applicability of this system. Finally, the production of β-CGTase using the dual-promoter P HpaII -P amyQ' system was investigated in a 3-L fermenter. Extracellular expression of β-CGTase reached 571.2 U/mL (2.5 mg/mL), demonstrating the potential of this system for use in industrial applications. The dual-promoter P HpaII -P amyQ' system was found to support superior expression of extracellular proteins in B. subtilis CCTCC M 2016536. This system appears generally applicable and is amenable to scale-up.

The Agrobacterium tumefaciens rnd Homolog Is Required for TraR-Mediated Quorum-Dependent Activation of Ti Plasmid tra Gene Expression

PubMed Central

Luo, Zhao-Qing; Farrand, Stephen K.

2001-01-01

Conjugal transfer of Agrobacterium tumefaciens Ti plasmids is regulated by quorum sensing via TraR and its cognate autoinducer, N-(3-oxo-octanoyl)-l-homoserine lactone. We isolated four Tn5-induced mutants of A. tumefaciens C58 deficient in TraR-mediated activation of tra genes on pTiC58ΔaccR. These mutations also affected the growth of the bacterium but had no detectable influence on the expression of two tester gene systems that are not regulated by quorum sensing. In all four mutants Tn5 was inserted in a chromosomal open reading frame (ORF) coding for a product showing high similarity to RNase D, coded for by rnd of Escherichia coli, an RNase known to be involved in tRNA processing. The wild-type allele of the rnd homolog cloned from C58 restored the two phenotypes to each mutant. Several ORFs, including a homolog of cya2, surround A. tumefaciens rnd, but none of these genes exerted a detectable effect on the expression of the tra reporter. In the mutant, traR was expressed from the Ti plasmid at a level about twofold lower than that in NT1. The expression of tra, but not the growth rate, was partially restored by increasing the copy number of traR or by disrupting traM, a Ti plasmid gene coding for an antiactivator specific for TraR. The mutation in rnd also slightly reduced expression of two tested vir genes but had no detectable effect on tumor induction by this mutant. Our data suggest that the defect in tra gene induction in the mutants results from lowered levels of TraR. In turn, production of sufficient amounts of TraR apparently is sensitive to a cellular function requiring RNase D. PMID:11395455

Rapid Creation and Quantitative Monitoring of High Coverage shRNA Libraries

PubMed Central

Bassik, Michael C.; Lebbink, Robert Jan; Churchman, L. Stirling; Ingolia, Nicholas T.; Patena, Weronika; LeProust, Emily M.; Schuldiner, Maya; Weissman, Jonathan S.; McManus, Michael T.

2009-01-01

Short hairpin RNA (shRNA) libraries are limited by the low efficacy of many shRNAs, giving false negatives, and off-target effects, giving false positives. Here we present a strategy for rapidly creating expanded shRNA pools (∼30 shRNAs/gene) that are analyzed by deep-sequencing (EXPAND). This approach enables identification of multiple effective target-specific shRNAs from a complex pool, allowing a rigorous statistical evaluation of whether a gene is a true hit. PMID:19448642

Cold Inducible RNA Binding Protein Is Involved in Chronic Hypoxia Induced Neuron Apoptosis by Down-Regulating HIF-1α Expression and Regulated By microRNA-23a.

PubMed

Chen, Xiaoming; Liu, Xinqin; Li, Bin; Zhang, Qian; Wang, Jiye; Zhang, Wenbin; Luo, Wenjing; Chen, Jingyuan

2017-01-01

Background: Neuron apoptosis mediated by hypoxia inducible factor 1α (HIF-1α) in hippocampus is one of the most important factors accounting for the chronic hypobaric hypoxia induced cognitive impairment. As a neuroprotective molecule that is up-regulated in response to various environmental stress, CIRBP was reported to crosstalk with HIF-1α under cellular stress. However, its function under chronic hypobaric hypoxia remains unknown. Objective: In this study, we tried to identify the role of CIRBP in HIF-1α mediated neuron apoptosis under chronic hypobaric hypoxia and find a possible method to maintain its potential neuroprotective in long-term high altitude environmental exposure. Methods: We established a chronic hypobaric hypoxia rat model as well as a tissue culture model where SH-SY5Y cells were exposed to 1% hypoxia. Based on these models, we measured the expressions of HIF-1α and CIRBP under hypoxia exposure and examined the apoptosis of neurons by TUNEL immunofluorescence staining and western blot analysis of apoptosis related proteins. In addition, by establishing HIF-1α shRNA and pEGFP-CIRBP plasmid transfected cells, we confirmed the role of HIF-1α in chronic hypoxia induced neuron apoptosis and identified the influence of CIRBP over-expression upon HIF-1α and neuron apoptosis in the process of exposure. Furthermore, we measured the expression of the reported hypoxia related miRNAs in both models and the influence of miRNAs' over-expression/knock-down upon CIRBP in the process of HIF-1α mediated neuron apoptosis. Results: HIF-1α expression as well as neuron apoptosis was significantly elevated by chronic hypobaric hypoxia both in vivo and in vitro . CIRBP was induced in the early stage of exposure (3d/7d); however as the exposure was prolonged (21d), CIRBP level of the hypoxia group became significantly lower than that of control. In addition, HIF-1α knockdown significantly decreased neuron apoptosis under hypoxia, suggesting HIF-1α may be pro-apoptotic in the process of exposure. CIRBP over-expression significantly suppressed HIF-1α up-regulation in hypoxia and inhibited HIF-1α mediated neuron apoptosis. Interestingly, miR-23a was also induced by hypoxia exposure and showed the same changing tendency with CIRBP (increasing in 3d/7d, decreasing in 21d). In addition, over-expressing miR-23a up-regulated CIRBP, down-regulated HIF-1α and attenuated neuron apoptosis. Conclusion: Cold inducible RNA binding protein is involved in chronic hypoxia induced neuron apoptosis by down-regulating HIF-1α expression, and MiR-23a may be an important tool to maintain CIRBP level and function.

Development and application of automated systems for plasmid-based functional proteomics to improve syntheitc biology of engineered industrial microbes for high level expression of proteases for biofertilizer production

USDA-ARS?s Scientific Manuscript database

In addition to microarray technology, which provides a robust method to study protein function in a rapid, economical, and proteome-wide fashion, plasmid-based functional proteomics is an important technology for rapidly obtaining large quantities of protein and determining protein function across a...

RELATIVE EXPRESSION AND STABILITY OF A CHROMOSOMALLY INTEGRATED AND PLASMID-BORNE MARKER GENE FUSION IN ENVIRONMENTALLY COMPETENT BACTERIA

EPA Science Inventory

A xyIE-iceC transcriptional fusion was created by ligating a DNA fragment harboring the cloned xyIE structural gene from the TOL plasmid of Pseudomonas putida mt-2 into the cloned iceC gene of Pseudomonas syringae Cit7. This fusion construct was integrated into chromosome of Pseu...

Transferable green fluorescence-tagged pEI2 in Edwardsiella ictaluri

USDA-ARS?s Scientific Manuscript database

The pEI2 plasmid of Edwardsiella ictaluri isolate, I49, was tagged using a Tn10-GFP-kan cassette to create the green fluorescence-expressing derivative I49-gfp. The Tn10-GFP-kan insertion site was mapped by plasmid sequencing to 663 bp upstream of orf2 and appeared to be at a neutral site in the pla...

Long-term increase in mVEGF164 in mouse hindlimb muscle mediated by phage phiC31 integrase after nonviral DNA delivery.

PubMed

Portlock, Joylette L; Keravala, Annahita; Bertoni, Carmen; Lee, Solomon; Rando, Thomas A; Calos, Michele P

2006-08-01

Peripheral vascular disease (PVD), characterized by insufficient blood supply to extremities, can be a devastating illness. Although many gene therapy strategies for PVD using vascular endothelial growth factor (VEGF) have resulted in increased blood vessel formation, the vessels are often impermanent and regress after therapy, probably because of the short-lived VEGF expression mediated by gene therapy vectors (14 days or less). phiC31 integrase is a recombinase originally isolated from a bacteriophage of Streptomyces. This integrase performs efficient chromosomal integration of plasmid DNA into mammalian genomes that results in long-term transgene expression. In this study, gene transfer was achieved by intramuscular injection of VEGF and integrase plasmid DNAs into the tibialis anterior muscle in the mouse hindlimb, followed by electroporation of the muscle with needle electrodes. We observed VEGF levels significantly above background 40 days after injection in animals that received phiC31 integrase and the VEGF plasmid. Site-specific integration of plasmid DNA in the chromosomes of muscle tissue was verified by polymerase chain reaction at a common integration site. These results suggest the possible utility of the phiC31 integrase system to treat ischemic disease.