Sample records for significant single-nucleotide polymorphisms

  1. Genetic polymorphisms in ESR1 and ESR2 genes, and risk of hypospadias in a multiethnic study population.

    PubMed

    Choudhry, Shweta; Baskin, Laurence S; Lammer, Edward J; Witte, John S; Dasgupta, Sudeshna; Ma, Chen; Surampalli, Abhilasha; Shen, Joel; Shaw, Gary M; Carmichael, Suzan L

    2015-05-01

    Estrogenic endocrine disruptors acting via estrogen receptors α (ESR1) and β (ESR2) have been implicated in the etiology of hypospadias, a common congenital malformation of the male external genitalia. We determined the association of single nucleotide polymorphisms in ESR1 and ESR2 genes with hypospadias in a racially/ethnically diverse study population of California births. We investigated the relationship between hypospadias and 108 ESR1 and 36 ESR2 single nucleotide polymorphisms in 647 cases and 877 population based nonmalformed controls among infants born in selected California counties from 1990 to 2003. Subgroup analyses were performed by race/ethnicity (nonHispanic white and Hispanic subjects) and by hypospadias severity (mild to moderate and severe). Odds ratios for 33 of the 108 ESR1 single nucleotide polymorphisms had p values less than 0.05 (p = 0.05 to 0.007) for risk of hypospadias. However, none of the 36 ESR2 single nucleotide polymorphisms was significantly associated. In stratified analyses the association results were consistent by disease severity but different sets of single nucleotide polymorphisms were significantly associated with hypospadias in nonHispanic white and Hispanic subjects. Due to high linkage disequilibrium across the single nucleotide polymorphisms, haplotype analyses were conducted and identified 6 haplotype blocks in ESR1 gene that had haplotypes significantly associated with an increased risk of hypospadias (OR 1.3 to 1.8, p = 0.04 to 0.00001). Similar to single nucleotide polymorphism analysis, different ESR1 haplotypes were associated with risk of hypospadias in nonHispanic white and Hispanic subjects. No significant haplotype association was observed for ESR2. The data provide evidence that ESR1 single nucleotide polymorphisms and haplotypes influence the risk of hypospadias in white and Hispanic subjects, and warrant further examination in other study populations. Copyright © 2015 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  2. CNTNAP2 Is Significantly Associated With Speech Sound Disorder in the Chinese Han Population.

    PubMed

    Zhao, Yun-Jing; Wang, Yue-Ping; Yang, Wen-Zhu; Sun, Hong-Wei; Ma, Hong-Wei; Zhao, Ya-Ru

    2015-11-01

    Speech sound disorder is the most common communication disorder. Some investigations support the possibility that the CNTNAP2 gene might be involved in the pathogenesis of speech-related diseases. To investigate single-nucleotide polymorphisms in the CNTNAP2 gene, 300 unrelated speech sound disorder patients and 200 normal controls were included in the study. Five single-nucleotide polymorphisms were amplified and directly sequenced. Significant differences were found in the genotype (P = .0003) and allele (P = .0056) frequencies of rs2538976 between patients and controls. The excess frequency of the A allele in the patient group remained significant after Bonferroni correction (P = .0280). A significant haplotype association with rs2710102T/+rs17236239A/+2538976A/+2710117A (P = 4.10e-006) was identified. A neighboring single-nucleotide polymorphism, rs10608123, was found in complete linkage disequilibrium with rs2538976, and the genotypes exactly corresponded to each other. The authors propose that these CNTNAP2 variants increase the susceptibility to speech sound disorder. The single-nucleotide polymorphisms rs10608123 and rs2538976 may merge into one single-nucleotide polymorphism. © The Author(s) 2015.

  3. Detecting associated single-nucleotide polymorphisms on the X chromosome in case control genome-wide association studies.

    PubMed

    Chen, Zhongxue; Ng, Hon Keung Tony; Li, Jing; Liu, Qingzhong; Huang, Hanwen

    2017-04-01

    In the past decade, hundreds of genome-wide association studies have been conducted to detect the significant single-nucleotide polymorphisms that are associated with certain diseases. However, most of the data from the X chromosome were not analyzed and only a few significant associated single-nucleotide polymorphisms from the X chromosome have been identified from genome-wide association studies. This is mainly due to the lack of powerful statistical tests. In this paper, we propose a novel statistical approach that combines the information of single-nucleotide polymorphisms on the X chromosome from both males and females in an efficient way. The proposed approach avoids the need of making strong assumptions about the underlying genetic models. Our proposed statistical test is a robust method that only makes the assumption that the risk allele is the same for both females and males if the single-nucleotide polymorphism is associated with the disease for both genders. Through simulation study and a real data application, we show that the proposed procedure is robust and have excellent performance compared to existing methods. We expect that many more associated single-nucleotide polymorphisms on the X chromosome will be identified if the proposed approach is applied to current available genome-wide association studies data.

  4. [Meta-analysis on relationship between single nucleotide polymorphism of rs2231142 in ABCG2 gene and gout in East Asian population].

    PubMed

    Wu, Lei; He, Yao; Zhang, Di

    2015-11-01

    To systematically evaluate the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout in East Asian population. The literature retrieval was conducted by using English databases (Medline, EMbase), Chinese databases (CNKI, Vip, Wanfang, SinaMed) and others to collect the published papers on the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout by the end of December 2014. Meta-analysis was performed with software Stata 12.0. Nine studies were included. There were significant associations between increased risk of gout and single nucleotide polymorphism of rs2231142, the combined OR was 2.04 (95%CI: 1.82-2.28) for A allele and C allele, 1.97 (95%CI: 1.57-2.48) for CA and CC, 3.71 (95%CI: 3.07-4.47) for AA and CC. Sex and region specific subgroup analysis showed less heterogeneity. There is significant association between gout and single nucleotide polymorphism of rs2231142 in East Asian population, and A allele is a high risk gene for gout.

  5. Improved prediction of biochemical recurrence after radical prostatectomy by genetic polymorphisms.

    PubMed

    Morote, Juan; Del Amo, Jokin; Borque, Angel; Ars, Elisabet; Hernández, Carlos; Herranz, Felipe; Arruza, Antonio; Llarena, Roberto; Planas, Jacques; Viso, María J; Palou, Joan; Raventós, Carles X; Tejedor, Diego; Artieda, Marta; Simón, Laureano; Martínez, Antonio; Rioja, Luis A

    2010-08-01

    Single nucleotide polymorphisms are inherited genetic variations that can predispose or protect individuals against clinical events. We hypothesized that single nucleotide polymorphism profiling may improve the prediction of biochemical recurrence after radical prostatectomy. We performed a retrospective, multi-institutional study of 703 patients treated with radical prostatectomy for clinically localized prostate cancer who had at least 5 years of followup after surgery. All patients were genotyped for 83 prostate cancer related single nucleotide polymorphisms using a low density oligonucleotide microarray. Baseline clinicopathological variables and single nucleotide polymorphisms were analyzed to predict biochemical recurrence within 5 years using stepwise logistic regression. Discrimination was measured by ROC curve AUC, specificity, sensitivity, predictive values, net reclassification improvement and integrated discrimination index. The overall biochemical recurrence rate was 35%. The model with the best fit combined 8 covariates, including the 5 clinicopathological variables prostate specific antigen, Gleason score, pathological stage, lymph node involvement and margin status, and 3 single nucleotide polymorphisms at the KLK2, SULT1A1 and TLR4 genes. Model predictive power was defined by 80% positive predictive value, 74% negative predictive value and an AUC of 0.78. The model based on clinicopathological variables plus single nucleotide polymorphisms showed significant improvement over the model without single nucleotide polymorphisms, as indicated by 23.3% net reclassification improvement (p = 0.003), integrated discrimination index (p <0.001) and likelihood ratio test (p <0.001). Internal validation proved model robustness (bootstrap corrected AUC 0.78, range 0.74 to 0.82). The calibration plot showed close agreement between biochemical recurrence observed and predicted probabilities. Predicting biochemical recurrence after radical prostatectomy based on clinicopathological data can be significantly improved by including patient genetic information. Copyright (c) 2010 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  6. Lack of Association Between Toll-like Receptor 2 Polymorphisms (R753Q and A-16934T) and Atopic Dermatitis in Children from Thrace Region of Turkey

    PubMed Central

    Can, Ceren; Yazıcıoğlu, Mehtap; Gürkan, Hakan; Tozkır, Hilmi; Görgülü, Adnan; Süt, Necdet Hilmi

    2017-01-01

    Background: Atopic dermatitis is the most common chronic inflammatory skin disease. A complex interaction of both genetic and environmental factors is thought to contribute to the disease. Aims: To evaluate whether single nucleotide polymorphisms in the TLR2 gene c.2258C>T (R753Q) (rs5743708) and TLR2 c.-148+1614T>A (A-16934T) (rs4696480) (NM_0032643) are associated with atopic dermatitis in Turkish children. Study Design: Case-control study. Methods: The study was conducted on 70 Turkish children with atopic dermatitis aged 0.5-18 years. The clinical severity of atopic dermatitis was evaluated by the severity scoring of atopic dermatitis index. Serum total IgE levels, specific IgE antibodies to inhalant and food allergens were measured in both atopic dermatitis patients and controls, skin prick tests were done on 70 children with atopic dermatitis. Genotyping for TLR2 (R753Q and A-16934T) single nucleotide polymorphisms was performed in both atopic dermatitis patients and controls. Results: Cytosine-cytosine and cytosin-thymine genotype frequencies of the TLR2 R753Q single nucleotide polymorphism in the atopic dermatitis group were determined as being 98.6% and 1.4%, cytosine allele frequency for TLR2 R753Q single nucleotide polymorphism was determined as 99.29% and the thymine allele frequency was 0.71%, thymine-thymine, thymine-adenine, and adenine-adenine genotype frequencies of the TLR2 A-16934T single nucleotide polymorphism were 24.3%, 44.3%, and 31.4%. The thymine allele frequency for the TLR2 A-16934T single nucleotide polymorphism in the atopic dermatitis group was 46.43%, and the adenine allele frequency was 53.57%, respectively. There was not statistically significant difference between the groups for all investigated polymorphisms (p>0.05). For all single nucleotide polymorphisms studied, allelic distribution was analogous among atopic dermatitis patients and controls, and no significant statistical difference was observed. No homozygous carriers of the TLR2 R753Q single nucleotide polymorphism were found in the atopic dermatitis and control groups. Conclusion: The TLR2 (R753Q and A-16934T) single nucleotide polymorphisms are not associated with atopic dermatitis in a group of Turkish patients. PMID:28443596

  7. Lack of Association Between Toll-like Receptor 2 Polymorphisms (R753Q and A-16934T) and Atopic Dermatitis in Children from Thrace Region of Turkey.

    PubMed

    Can, Ceren; Yazıcıoğlu, Mehtap; Gürkan, Hakan; Tozkır, Hilmi; Görgülü, Adnan; Süt, Necdet Hilmi

    2017-05-05

    Atopic dermatitis is the most common chronic inflammatory skin disease. A complex interaction of both genetic and environmental factors is thought to contribute to the disease. To evaluate whether single nucleotide polymorphisms in the TLR2 gene c.2258C>T (R753Q) (rs5743708) and TLR2 c.-148+1614T>A (A-16934T) (rs4696480) (NM_0032643) are associated with atopic dermatitis in Turkish children. Case-control study. The study was conducted on 70 Turkish children with atopic dermatitis aged 0.5-18 years. The clinical severity of atopic dermatitis was evaluated by the severity scoring of atopic dermatitis index. Serum total IgE levels, specific IgE antibodies to inhalant and food allergens were measured in both atopic dermatitis patients and controls, skin prick tests were done on 70 children with atopic dermatitis. Genotyping for TLR2 (R753Q and A-16934T) single nucleotide polymorphisms was performed in both atopic dermatitis patients and controls. Cytosine-cytosine and cytosin-thymine genotype frequencies of the TLR2 R753Q single nucleotide polymorphism in the atopic dermatitis group were determined as being 98.6% and 1.4%, cytosine allele frequency for TLR2 R753Q single nucleotide polymorphism was determined as 99.29% and the thymine allele frequency was 0.71%, thymine-thymine, thymine-adenine, and adenine-adenine genotype frequencies of the TLR2 A-16934T single nucleotide polymorphism were 24.3%, 44.3%, and 31.4%. The thymine allele frequency for the TLR2 A-16934T single nucleotide polymorphism in the atopic dermatitis group was 46.43%, and the adenine allele frequency was 53.57%, respectively. There was not statistically significant difference between the groups for all investigated polymorphisms (p>0.05). For all single nucleotide polymorphisms studied, allelic distribution was analogous among atopic dermatitis patients and controls, and no significant statistical difference was observed. No homozygous carriers of the TLR2 R753Q single nucleotide polymorphism were found in the atopic dermatitis and control groups. The TLR2 (R753Q and A-16934T) single nucleotide polymorphisms are not associated with atopic dermatitis in a group of Turkish patients.

  8. Association between Single Nucleotide Polymorphisms of the Major Histocompatibility Complex Class II Gene and Newcastle Disease Virus Titre and Body Weight in Leung Hang Khao Chickens

    PubMed Central

    Molee, A.; Kongroi, K.; Kuadsantia, P.; Poompramun, C.; Likitdecharote, B.

    2016-01-01

    The aim of the present study was to investigate the effect of single nucleotide polymorphisms in the major histocompatibility complex (MHC) class II gene on resistance to Newcastle disease virus and body weight of the Thai indigenous chicken, Leung Hang Khao (Gallus gallus domesticus). Blood samples were collected for single nucleotide polymorphism analysis from 485 chickens. Polymerase chain reaction sequencing was used to classify single nucleotide polymorphisms of class II MHC. Body weights were measured at the ages of 3, 4, 5, and 7 months. Titres of Newcastle disease virus at 2 weeks to 7 months were determined and the correlation between body weight and titre was analysed. The association between single nucleotide polymorphisms and body weight and titre were analysed by a generalized linear model. Seven single nucleotide polymorphisms were identified: C125T, A126T, C209G, C242T, A243T, C244T, and A254T. Significant correlations between log titre and body weight were found at 2 and 4 weeks. Associations between single nucleotide polymorphisms and titre were found for C209G and A254T, and between all single nucleotide polymorphisms (except A243T) and body weight. The results showed that class II MHC is associated with both titre of Newcastle disease virus and body weight in Leung Hang Khao chickens. This is of concern because improved growth traits are the main goal of breeding selection. Moreover, the results suggested that MHC has a pleiotropic effect on the titre and growth performance. This mechanism should be investigated in a future study. PMID:26732325

  9. TPH-2 Polymorphisms Interact with Early Life Stress to Influence Response to Treatment with Antidepressant Drugs.

    PubMed

    Xu, Zhi; Reynolds, Gavin P; Yuan, Yonggui; Shi, Yanyan; Pu, Mengjia; Zhang, Zhijun

    2016-11-01

    Variation in genes implicated in monoamine neurotransmission may interact with environmental factors to influence antidepressant response. We aimed to determine how a range of single nucleotide polymorphisms in monoaminergic genes influence this response to treatment and how they interact with childhood trauma and recent life stress in a Chinese sample. An initial study of monoaminergic coding region single nucleotide polymorphisms identified significant associations of TPH2 and HTR1B single nucleotide polymorphisms with treatment response that showed interactions with childhood and recent life stress, respectively (Xu et al., 2012). A total of 47 further single nucleotide polymorphisms in 17 candidate monoaminergic genes were genotyped in 281 Chinese Han patients with major depressive disorder. Response to 6 weeks' antidepressant treatment was determined by change in the 17-item Hamilton Depression Rating Scale score, and previous stressful events were evaluated by the Life Events Scale and Childhood Trauma Questionnaire-Short Form. Three TPH2 single nucleotide polymorphisms (rs11178998, rs7963717, and rs2171363) were significantly associated with antidepressant response in this Chinese sample, as was a haplotype in TPH2 (rs2171363 and rs1487278). One of these, rs2171363, showed a significant interaction with childhood adversity in its association with antidepressant response. These findings provide further evidence that variation in TPH2 is associated with antidepressant response and may also interact with childhood trauma to influence outcome of antidepressant treatment. © The Author 2016. Published by Oxford University Press on behalf of CINP.

  10. TPH-2 Polymorphisms Interact with Early Life Stress to Influence Response to Treatment with Antidepressant Drugs

    PubMed Central

    Reynolds, Gavin P.; Yuan, Yonggui; Shi, Yanyan; Pu, Mengjia; Zhang, Zhijun

    2016-01-01

    Background: Variation in genes implicated in monoamine neurotransmission may interact with environmental factors to influence antidepressant response. We aimed to determine how a range of single nucleotide polymorphisms in monoaminergic genes influence this response to treatment and how they interact with childhood trauma and recent life stress in a Chinese sample. An initial study of monoaminergic coding region single nucleotide polymorphisms identified significant associations of TPH2 and HTR1B single nucleotide polymorphisms with treatment response that showed interactions with childhood and recent life stress, respectively (Xu et al., 2012). Methods: A total of 47 further single nucleotide polymorphisms in 17 candidate monoaminergic genes were genotyped in 281 Chinese Han patients with major depressive disorder. Response to 6 weeks’ antidepressant treatment was determined by change in the 17-item Hamilton Depression Rating Scale score, and previous stressful events were evaluated by the Life Events Scale and Childhood Trauma Questionnaire-Short Form. Results: Three TPH2 single nucleotide polymorphisms (rs11178998, rs7963717, and rs2171363) were significantly associated with antidepressant response in this Chinese sample, as was a haplotype in TPH2 (rs2171363 and rs1487278). One of these, rs2171363, showed a significant interaction with childhood adversity in its association with antidepressant response. Conclusions: These findings provide further evidence that variation in TPH2 is associated with antidepressant response and may also interact with childhood trauma to influence outcome of antidepressant treatment. PMID:27521242

  11. Infectious mononucleosis-linked HLA class I single nucleotide polymorphism is associated with multiple sclerosis.

    PubMed

    Jafari, Naghmeh; Broer, Linda; Hoppenbrouwers, Ilse A; van Duijn, Cornelia M; Hintzen, Rogier Q

    2010-11-01

    Multiple sclerosis is a presumed autoimmune disease associated with genetic and environmental risk factors such as infectious mononucleosis. Recent research has shown infectious mononucleosis to be associated with a specific HLA class I polymorphism. Our aim was to test if the infectious mononucleosis-linked HLA class I single nucleotide polymorphism (rs6457110) is also associated with multiple sclerosis. Genotyping of the HLA-A single nucleotide polymorphism rs6457110 using TaqMan was performed in 591 multiple sclerosis cases and 600 controls. The association of multiple sclerosis with the HLA-A single nucleotide polymorphism was tested using logistic regression adjusted for age, sex and HLA-DRB1*1501. HLA-A minor allele (A) is associated with multiple sclerosis (OR = 0.68; p = 4.08 × 10( -5)). After stratification for HLA-DRB1*1501 risk allele (T) carrier we showed a significant OR of 0.70 (p = 0.003) for HLA-A. HLA class I single nucleotide polymorphism rs6457110 is associated with infectious mononucleosis and multiple sclerosis, independent of the major class II allele, supporting the hypothesis that shared genetics may contribute to the association between infectious mononucleosis and multiple sclerosis.

  12. The association of single-nucleotide polymorphisms in the oxytocin receptor and G protein-coupled receptor kinase 6 (GRK6) genes with oxytocin dosing requirements and labor outcomes.

    PubMed

    Grotegut, Chad A; Ngan, Emily; Garrett, Melanie E; Miranda, Marie Lynn; Ashley-Koch, Allison E; Swamy, Geeta K

    2017-09-01

    Oxytocin is a potent uterotonic agent that is widely used for induction and augmentation of labor. Oxytocin has a narrow therapeutic index and the optimal dosing for any individual woman varies widely. The objective of this study was to determine whether genetic variation in the oxytocin receptor (OXTR) or in the gene encoding G protein-coupled receptor kinase 6 (GRK6), which regulates desensitization of the oxytocin receptor, could explain variation in oxytocin dosing and labor outcomes among women being induced near term. Pregnant women with a singleton gestation residing in Durham County, NC, were prospectively enrolled as part of the Healthy Pregnancy, Healthy Baby cohort study. Those women undergoing an induction of labor at 36 weeks or greater were genotyped for 18 haplotype-tagging single-nucleotide polymorphisms in OXTR and 7 haplotype-tagging single-nucleotide polymorphisms in GRK6 using TaqMan assays. Linear regression was used to examine the relationship between maternal genotype and maximal oxytocin infusion rate, total oxytocin dose received, and duration of labor. Logistic regression was used to test for the association of maternal genotype with mode of delivery. For each outcome, backward selection techniques were utilized to control for important confounding variables and additive genetic models were used. Race/ethnicity was included in all models because of differences in allele frequencies across populations, and Bonferroni correction for multiple testing was used. DNA was available from 482 women undergoing induction of labor at 36 weeks or greater. Eighteen haplotype-tagging single-nucleotide polymorphisms within OXTR and 7 haplotype-tagging single-nucleotide polymorphisms within GRK6 were examined. Five single-nucleotide polymorphisms in OXTR showed nominal significance with maximal infusion rate of oxytocin, and two single-nucleotide polymorphisms in OXTR were associated with total oxytocin dose received. One single-nucleotide polymorphism in OXTR and two single-nucleotide polymorphisms in GRK6 were associated with duration of labor, one of which met the multiple testing threshold (P = .0014, rs2731664 [GRK6], mean duration of labor, 17.7 hours vs 20.2 hours vs 23.5 hours for AA, AC, and CC genotypes, respectively). Three single-nucleotide polymorphisms, two in OXTR and one in GRK6, showed nominal significance with mode of delivery. Genetic variation in OXTR and GRK6 is associated with the amount of oxytocin required as well as the duration of labor and risk for cesarean delivery among women undergoing induction of labor near term. With further research, pharmacogenomic approaches may potentially be utilized to develop personalized treatment to improve safety and efficacy outcomes among women undergoing induction of labor. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Bitterness of the Non-nutritive Sweetener Acesulfame Potassium Varies With Polymorphisms in TAS2R9 and TAS2R31

    PubMed Central

    2013-01-01

    Demand for nonnutritive sweeteners continues to increase due to their ability to provide desirable sweetness with minimal calories. Acesulfame potassium and saccharin are well-studied nonnutritive sweeteners commonly found in food products. Some individuals report aversive sensations from these sweeteners, such as bitter and metallic side tastes. Recent advances in molecular genetics have provided insight into the cause of perceptual differences across people. For example, common alleles for the genes TAS2R9 and TAS2R38 explain variable response to the bitter drugs ofloxacin in vitro and propylthiouracil in vivo. Here, we wanted to determine whether differences in the bitterness of acesulfame potassium could be predicted by common polymorphisms (genetic variants) in bitter taste receptor genes (TAS2Rs). We genotyped participants (n = 108) for putatively functional single nucleotide polymorphisms in 5 TAS2Rs and asked them to rate the bitterness of 25 mM acesulfame potassium on a general labeled magnitude scale. Consistent with prior reports, we found 2 single nucleotide polymorphisms in TAS2R31 were associated with acesulfame potassium bitterness. However, TAS2R9 alleles also predicted additional variation in acesulfame potassium bitterness. Conversely, single nucleotide polymorphisms in TAS2R4, TAS2R38, and near TAS2R16 were not significant predictors. Using 1 single nucleotide polymorphism each from TAS2R9 and TAS2R31, we modeled the simultaneous influence of these single nucleotide polymorphisms on acesulfame potassium bitterness; together, these 2 single nucleotide polymorphisms explained 13.4% of the variance in perceived bitterness. These data suggest multiple polymorphisms within TAS2Rs contribute to the ability to perceive the bitterness from acesulfame potassium. PMID:23599216

  14. Single nucleotide polymorphisms in CETP, SLC46A1, SLC19A1, CD36, BCOM1, APOA5, and ABCA1 are significant predictors of plasma HDL in healthy adults

    USDA-ARS?s Scientific Manuscript database

    In a marker-trait association study we estimated the statistical significance of 65 single nucleotide polymorphisms (SNP) in 23 candidate genes on HDL levels of two independent Caucasian populations. Each population consisted of men and women and their HDL levels were adjusted for gender and body we...

  15. Identification of rs7350481 at chromosome 11q23.3 as a novel susceptibility locus for metabolic syndrome in Japanese individuals by an exome-wide association study.

    PubMed

    Yamada, Yoshiji; Sakuma, Jun; Takeuchi, Ichiro; Yasukochi, Yoshiki; Kato, Kimihiko; Oguri, Mitsutoshi; Fujimaki, Tetsuo; Horibe, Hideki; Muramatsu, Masaaki; Sawabe, Motoji; Fujiwara, Yoshinori; Taniguchi, Yu; Obuchi, Shuichi; Kawai, Hisashi; Shinkai, Shoji; Mori, Seijiro; Arai, Tomio; Tanaka, Masashi

    2017-06-13

    We have performed exome-wide association studies to identify genetic variants that influence body mass index or confer susceptibility to obesity or metabolic syndrome in Japanese. The exome-wide association study for body mass index included 12,890 subjects, and those for obesity and metabolic syndrome included 12,968 subjects (3954 individuals with obesity, 9014 controls) and 6817 subjects (3998 individuals with MetS, 2819 controls), respectively. Exome-wide association studies were performed with Illumina HumanExome-12 DNA Analysis BeadChip or Infinium Exome-24 BeadChip arrays. The relation of genotypes of single nucleotide polymorphisms to body mass index was examined by linear regression analysis, and that of allele frequencies of single nucleotide polymorphisms to obesity or metabolic syndrome was evaluated with Fisher's exact test. The exome-wide association studies identified six, 11, and 40 single nucleotide polymorphisms as being significantly associated with body mass index, obesity (P <1.21 × 10-6), or metabolic syndrome (P <1.20 × 10-6), respectively. Subsequent multivariable logistic regression analysis with adjustment for age and sex revealed that three and five single nucleotide polymorphisms were related (P < 0.05) to obesity or metabolic syndrome, respectively, with one of these latter polymorphisms-rs7350481 (C/T) at chromosome 11q23.3-also being significantly (P < 3.13 × 10-4) associated with metabolic syndrome. The polymorphism rs7350481 may thus be a novel susceptibility locus for metabolic syndrome in Japanese. In addition, single nucleotide polymorphisms in three genes (CROT, TSC1, RIN3) and at four loci (ANKK1, ZNF804B, CSRNP3, 17p11.2) were implicated as candidate determinants of obesity and metabolic syndrome, respectively.

  16. Lack of Association Between Polymorphisms in Dopa Decarboxylase and Dopamine Receptor-1 Genes With Childhood Autism in Chinese Han Population.

    PubMed

    Yu, Hong; Liu, Jun; Yang, Aiping; Yang, Guohui; Yang, Wenjun; Lei, Heyue; Quan, Jianjun; Zhang, Zengyu

    2016-04-01

    Genetic factors play an important role in childhood autism. This study is to determine the association of single-nucleotide polymorphisms in dopa decarboxylase (DDC) and dopamine receptor-1 (DRD1) genes with childhood autism, in a Chinese Han population. A total of 211 autistic children and 250 age- and gender-matched healthy controls were recruited. The severity of disease was determined by Children Autism Rating Scale scores. TaqMan Probe by real-time polymerase chain reaction was used to determine genotypes and allele frequencies of single-nucleotide polymorphism rs6592961 in DDC and rs251937 in DRD1. Case-control and case-only studies were respectively performed, to determine the contribution of both single-nucleotide polymorphisms to the predisposition of disease and its severity. Our results showed that there was no significant association of the genotypes and allele frequencies of both single-nucleotide polymorphisms concerning childhood autism and its severity. More studies with larger samples are needed to corroborate their predicting roles. © The Author(s) 2015.

  17. Gender and single nucleotide polymorphisms in MTHFR, BHMT, SPTLC1, CRBP2R, and SCARB1 are significant predictors of plasma homocysteine normalized by RBC folate in healthy adults.

    USDA-ARS?s Scientific Manuscript database

    Using linear regression models, we studied the main and two-way interaction effects of the predictor variables gender, age, BMI, and 64 folate/vitamin B-12/homocysteine/lipid/cholesterol-related single nucleotide polymorphisms (SNP) on log-transformed plasma homocysteine normalized by red blood cell...

  18. Functional analysis of regulatory single-nucleotide polymorphisms.

    PubMed

    Pampín, Sandra; Rodríguez-Rey, José C

    2007-04-01

    The identification of regulatory polymorphisms has become a key problem in human genetics. In the past few years there has been a conceptual change in the way in which regulatory single-nucleotide polymorphisms are studied. We revise the new approaches and discuss how gene expression studies can contribute to a better knowledge of the genetics of common diseases. New techniques for the association of single-nucleotide polymorphisms with changes in gene expression have been recently developed. This, together with a more comprehensive use of the old in-vitro methods, has produced a great amount of genetic information. When added to current databases, it will help to design better tools for the detection of regulatory single-nucleotide polymorphisms. The identification of functional regulatory single-nucleotide polymorphisms cannot be done by the simple inspection of DNA sequence. In-vivo techniques, based on primer-extension, and the more recently developed 'haploChIP' allow the association of gene variants to changes in gene expression. Gene expression analysis by conventional in-vitro techniques is the only way to identify the functional consequences of regulatory single-nucleotide polymorphisms. The amount of information produced in the last few years will help to refine the tools for the future analysis of regulatory gene variants.

  19. Genome-wide divergence and linkage disequilibrium analyses for Capsicum baccatum revealed by genome-anchored single nucleotide polymorphisms

    USDA-ARS?s Scientific Manuscript database

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...

  20. Association of α-, β-, and γ-Synuclein With Diffuse Lewy Body Disease

    PubMed Central

    Nishioka, Kenya; Wider, Christian; Vilariño-Güell, Carles; Soto-Ortolaza, Alexandra I.; Lincoln, Sarah J.; Kachergus, Jennifer M.; Jasinska-Myga, Barbara; Ross, Owen A.; Rajput, Alex; Robinson, Christopher A.; Ferman, Tanis J.; Wszolek, Zbigniew K.; Dickson, Dennis W.; Farrer, Matthew J.

    2016-01-01

    Objective To determine the association of the genes that encode α-, β-, and γ-synuclein (SNCA, SNCB, and SNCG, respectively) with diffuse Lewy body disease (DLBD). Design Case-control study. Subjects A total of 172 patients with DLBD consistent with a clinical diagnosis of Parkinson disease dementia/dementia with Lewy bodies and 350 clinically and 97 pathologically normal controls. Interventions Sequencing of SNCA, SNCB, and SNCG and genotyping of single-nucleotide polymorphisms performed on an Applied Biosystems capillary sequencer and a Sequenom MassArray pLEX platform, respectively. Associations were determined using χ2 or Fisher exact tests. Results Initial sequencing studies of the coding regions of each gene in 89 patients with DLBD did not detect any pathogenic substitutions. Nevertheless, genotyping of known polymorphic variability in sequence-conserved regions detected several single-nucleotide polymorphisms in the SNCA and SNCG genes that were significantly associated with disease (P=.05 to <.001). Significant association was also observed for 3 single-nucleotide polymorphisms located in SNCB when comparing DLBD cases and pathologically confirmed normal controls (P=.03-.01); however, this association was not significant for the clinical controls alone or the combined clinical and pathological controls (P>.05). After correction for multiple testing, only 1 single-nucleotide polymorphism in SNCG (rs3750823) remained significant in all of the analyses (P=.05-.009). Conclusion These findings suggest that variants in all 3 members of the synuclein gene family, particularly SNCA and SNCG, affect the risk of developing DLBD and warrant further investigation in larger, pathologically defined data sets as well as clinically diagnosed Parkinson disease/dementia with Lewy bodies case-control series. PMID:20697047

  1. SRD5A1 and SRD5A2 are associated with treatment for benign prostatic hyperplasia with the combination of 5α-reductase inhibitors and α-adrenergic receptor antagonists.

    PubMed

    Gu, Xin; Na, Rong; Huang, Tao; Wang, Li; Tao, Sha; Tian, Lu; Chen, Zhuo; Jiao, Yang; Kang, Jian; Zheng, Siqun; Xu, Jianfeng; Sun, Jielin; Qi, Jun

    2013-08-01

    Common treatments for benign prostatic hyperplasia include 5α-reductase inhibitors and α-adrenergic receptor antagonists. However, these treatments can only partially decrease the risk of benign prostatic hyperplasia progression. SRD5A1 and SRD5A2 are 5α-reductase inhibitor targets. We investigated the association between drug efficacy and single nucleotide polymorphisms in the SRD5A1 and SRD5A2 genes in a Chinese population. We genotyped 11 tagging single nucleotide polymorphisms in the SRD5A1 and SRD5A2 genes in a total of 426 benign prostatic hyperplasia cases and 1,008 controls from Xinhua Hospital, Shanghai, People's Republic of China. Cases were treated with type II 5α-reductase inhibitors and α-adrenergic receptor antagonists. We tested the association of tagging single nucleotide polymorphisms with benign prostatic hyperplasia risk/progression, clinical characteristics at baseline, including the I-PSS (International Prostate Symptom Score) and total prostate volume, and changes in clinical characteristics after treatment. The 11 tagging single nucleotide polymorphisms were not significantly associated with benign prostatic hyperplasia risk or progression (each p >0.05). In the SRD5A1 gene rs6884552 and rs3797177 were significantly associated with baseline I-PSS (p = 0.04 and 0.003, respectively). In the SRD5A2 gene rs523349 (V89L) and rs9332975 were significantly associated with baseline total prostate volume (p = 0.01 and 0.001, respectively). In SRD5A1 rs166050 was significantly associated with the posttreatment change in total prostate volume (p = 0.04). In SRD5A2 rs523349 and rs612224 were significantly associated with the posttreatment I-PSS change (p = 0.03 and 0.009, respectively). SRD5A1 and SRD5A2 single nucleotide polymorphisms are significantly associated with the clinical characteristics of benign prostatic hyperplasia and the efficacy of benign prostatic hyperplasia treatment. Copyright © 2013 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  2. Variation of Cats under Domestication: Genetic Assignment of Domestic Cats to Breeds and Worldwide Random Bred Populations

    PubMed Central

    Kurushima, J. D.; Lipinski, M. J.; Gandolfi, B.; Froenicke, L.; Grahn, J. C.; Grahn, R. A.; Lyons, L. A.

    2012-01-01

    Summary Both cat breeders and the lay public have interests in the origins of their pets, not only in the genetic identity of the purebred individuals, but also the historical origins of common household cats. The cat fancy is a relatively new institution with over 85% of its 40–50 breeds arising only in the past 75 years, primarily through selection on single-gene aesthetic traits. The short, yet intense cat breed history poses a significant challenge to the development of a genetic marker-based breed identification strategy. Using different breed assignment strategies and methods, 477 cats representing 29 fancy breeds were analysed with 38 short tandem repeats, 148 intergenic and five phenotypic single nucleotide polymorphisms. Results suggest the frequentist method of Paetkau (accuracy single nucleotide polymorphisms = 0.78, short tandem repeats = 0.88) surpasses the Bayesian method of Rannala and Mountain (single nucleotide polymorphisms = 0.56, short tandem repeats = 0.83) for accurate assignment of individuals to the correct breed. Additionally, a post-assignment verification step with the five phenotypic single nucleotide polymorphisms accurately identified between 0.31 and 0.58 of the mis-assigned individuals raising the sensitivity of assignment with the frequentist method to 0.89 and 0.92 single nucleotide polymorphisms and short tandem repeats respectively. This study provides a novel multi-step assignment strategy and suggests that, despite their short breed history and breed family groupings, a majority of cats can be assigned to their proper breed or population of origin, i.e. race. PMID:23171373

  3. Compositions and methods for detecting single nucleotide polymorphisms

    DOEpatents

    Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.

    2016-11-22

    Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.

  4. A novel single-nucleotide polymorphism of the visfatin gene and its associations with performance traits in the chicken.

    PubMed

    Han, R-L; Lan, X-Y; Zhang, L-Z; Ren, G; Jing, Y-J; Li, M-J; Zhang, B; Zhao, M; Guo, Y-K; Kang, X-T; Chen, H

    2010-01-01

    Visfatin is a peptide that is predominantly expressed in visceral adipose tissue and is hypothesized to be related to obesity and insulin resistance. In this study, a novel silent single-nucleotide polymorphism (SNP) was found in exon 7 of the chicken visfatin gene (also known as PBEF1) by single-stranded conformation polymorphism (SSCP) and DNA sequencing. In total, 836 chickens forming an F2 resource population of Gushi chicken crossed with Anka broiler were genotyped by XbaI forced RFLP, and the associations of this polymorphism with chicken growth, carcass characteristics, and meat quality were analyzed. Significant associations were found between the polymorphism and 4-week body weight (BW4), 6-week body weight (BW6), 4-week body slanting length (BSL4), fat bandwidth (FBW), breast muscle water loss rate (BWLR) and breast muscle fiber density (BFD) (P < 0.05), as well as 4-week breastbone length (BBL4) (P < 0.01). These observations suggested that the polymorphism in exon7 of the visfatin gene had significant effects on the early growth traits of chicken.

  5. Obesity-Related Genomic Loci Are Associated with Type 2 Diabetes in a Han Chinese Population

    PubMed Central

    Zhao, Qi; He, Jiang; Chen, Li; Zhao, Zhigang; Li, Qiang; Ge, Jiapu; Chen, Gang; Guo, Xiaohui; Lu, Juming; Weng, Jianping; Jia, Weiping; Ji, Linong; Xiao, Jianzhong; Shan, Zhongyan; Liu, Jie; Tian, Haoming; Ji, Qiuhe; Zhu, Dalong; Zhou, Zhiguang; Shan, Guangliang; Yang, Wenying

    2014-01-01

    Background and Aims Obesity is a well-known risk factor for type 2 diabetes. Genome-wide association studies have identified a number of genetic loci associated with obesity. The aim of this study is to examine the contribution of obesity-related genomic loci to type 2 diabetes in a Chinese population. Methods We successfully genotyped 18 obesity-related single nucleotide polymorphisms among 5338 type 2 diabetic patients and 4663 controls. Both individual and joint effects of these single nucleotide polymorphisms on type 2 diabetes and quantitative glycemic traits (assessing β-cell function and insulin resistance) were analyzed using logistic and linear regression models, respectively. Results Two single nucleotide polymorphisms near MC4R and GNPDA2 genes were significantly associated with type 2 diabetes before adjusting for body mass index and waist circumference (OR (95% CI) = 1.14 (1.06, 1.22) for the A allele of rs12970134, P = 4.75×10−4; OR (95% CI) = 1.10 (1.03, 1.17) for the G allele of rs10938397, P = 4.54×10−3). When body mass index and waist circumference were further adjusted, the association of MC4R with type 2 diabetes remained significant (P = 1.81×10−2) and that of GNPDA2 was attenuated (P = 1.26×10−1), suggesting the effect of the locus including GNPDA2 on type 2 diabetes may be mediated through obesity. Single nucleotide polymorphism rs2260000 within BAT2 was significantly associated with type 2 diabetes after adjusting for body mass index and waist circumference (P = 1.04×10−2). In addition, four single nucleotide polymorphisms (near or within SEC16B, BDNF, MAF and PRL genes) showed significant associations with quantitative glycemic traits in controls even after adjusting for body mass index and waist circumference (all P values<0.05). Conclusions This study indicates that obesity-related genomic loci were associated with type 2 diabetes and glycemic traits in the Han Chinese population. PMID:25093408

  6. [Single nucleotide polymorphism and its application in allogeneic hematopoietic stem cell transplantation--review].

    PubMed

    Li, Su-Xia

    2004-12-01

    Single nucleotide polymorphism (SNP) is the third genetic marker after restriction fragment length polymorphism (RFLP) and short tandem repeat. It represents the most density genetic variability in the human genome and has been widely used in gene location, cloning, and research of heredity variation, as well as parenthood identification in forensic medicine. As steady heredity polymorphism, single nucleotide polymorphism is becoming the focus of attention in monitoring chimerism and minimal residual disease in the patients after allogeneic hematopoietic stem cell transplantation. The article reviews SNP heredity characterization, analysis techniques and its applications in allogeneic stem cell transplantation and other fields.

  7. Association Between Single Nucleotide Polymorphism +276G > T (rs1501299) in ADIPOQ and Endometrial Cancer.

    PubMed

    Bieńkiewicz, Jan; Smolarz, Beata; Malinowski, Andrzej

    2016-01-01

    Current literature gives evidence of an indisputable role adiponectin plays in adipose tissue metabolism and obesity-related diseases. Moreover, latest research efforts focus on linking genetic markers of this adipocytokine's gene (ADIPOQ) with cancer. Aim of this study was to determine the genotype distribution of single nucleotide polymorphism +276G > T (rs1501299) in ADIPOQ and an attempt to identify the impact this polymorphism exerts on endometrial cancer risk in obese females. The test group comprised 90 women treated surgically for endometrial cancer between 2000 and 2012 in the Department of Surgical & Endoscopic Gynecology and Gynecologic Oncology, Polish Mothers' Memorial Hospital - Research Institute, Lodz, Poland. 90 individuals treated in the parallel period for uterine fibroids constituted the control group. Patients within both groups were stratified according to BMI into: lean, overweight and obese subjects. Statistical analysis was performed between two major groups and, furthermore, within the abovementioned subgroups. The analysis revealed that allele G of the investigated polymorphism in obese women with endometrial cancer is significantly more frequent, and allele T is significantly less frequent than in lean controls. However, no significant correlation was observed between the polymorphism and endometrial cancer in lean and overweight females. Single nucleotide polymorphism +276G > T (rs1501299) in ADIPOQ may be considered to be a risk factor of endometrial cancer. Further research on SNP in EC is warranted to obtain more conclusive outcomes.

  8. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  9. The role of the methylenetetrahydrofolate reductase 677 and 1298 polymorphisms in Cretan children with acute lymphoblastic leukemia.

    PubMed

    Karathanasis, Nikolaos V; Stiakaki, Eftichia; Goulielmos, George N; Kalmanti, Maria

    2011-01-01

    Acute lymphoblastic leukemia (ALL) is the most common form of malignancy in children. Recently, many studies have examined factors influencing both the susceptibility to ALL and the metabolism of widely used chemotherapeutic agents. These factors include, among others, single-nucleotide polymorphisms in various genes, such as the gene encoding for methylenetetrahydrofolate reductase (MTHFR), which has been proven polymorphic at the nucleotide positions 677 and 1298. Thirty-five children with ALL and 48 healthy adults of Cretan origin were genotyped for the presence of the MTHFR 677 and 1298 single-nucleotide polymorphisms. The possible correlation of the polymorphisms with the risk for ALL and the presence of methotrexate-induced toxicities were examined. No significant association between the MTHFR genotypes and the susceptibility to ALL was observed. A borderline statistically significant relationship was detected after methotrexate administration, between the C677T genotype (polymorphisms) and leukopenia (p = 0.050) and between the A1298C polymorphism and normal aspartate transaminase and alanine transaminase values (p = 0.065 and p = 0.053, respectively), which was strengthened for aspartate transaminase, after grouping the A1298A and A1298C genotypes together (p = 0.039). In our population the MTHFR C677T and A1298C polymorphisms are related with hematologic toxicity and hepatotoxicity, respectively, and could be suggested as prognostic factors for these adverse events.

  10. A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms

    PubMed Central

    Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.

    2003-01-01

    A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708

  11. Clinical evaluation, biochemistry and genetic polymorphism analysis for the diagnosis of lactose intolerance in a population from northeastern Brazil.

    PubMed

    Ponte, Paulo Roberto Lins; de Medeiros, Pedro Henrique Quintela Soares; Havt, Alexandre; Caetano, Joselany Afio; Cid, David A C; Prata, Mara de Moura Gondim; Soares, Alberto Melo; Guerrant, Richard L; Mychaleckyj, Josyf; Lima, Aldo Ângelo Moreira

    2016-02-01

    This work aimed to evaluate and correlate symptoms, biochemical blood test results and single nucleotide polymorphisms for lactose intolerance diagnosis. A cross-sectional study was conducted in Fortaleza, Ceará, Brazil, with a total of 119 patients, 54 of whom were lactose intolerant. Clinical evaluation and biochemical blood tests were conducted after lactose ingestion and blood samples were collected for genotyping evaluation. In particular, the single nucleotide polymorphisms C>T-13910 and G>A-22018 were analyzed by restriction fragment length polymorphism/polymerase chain reaction and validated by DNA sequencing. Lactose-intolerant patients presented with more symptoms of flatulence (81.4%), bloating (68.5%), borborygmus (59.3%) and diarrhea (46.3%) compared with non-lactose-intolerant patients (p<0.05). We observed a significant association between the presence of the alleles T-13910 and A-22018 and the lactose-tolerant phenotype (p<0.05). After evaluation of the biochemical blood test results for lactose, we found that the most effective cutoff for glucose levels obtained for lactose malabsorbers was <15 mg/dL, presenting an area under the receiver operating characteristic curve greater than 80.3%, with satisfactory values for sensitivity and specificity. These data corroborate the association of these single nucleotide polymorphisms (C>T-13910 and G>A-22018) with lactose tolerance in this population and suggest clinical management for patients with lactose intolerance that considers single nucleotide polymorphism detection and a change in the biochemical blood test cutoff from <25 mg/dL to <15 mg/dL.

  12. Association of Nitric Oxide Synthase and Matrix Metalloprotease Single Nucleotide Polymorphisms with Preeclampsia and Its Complications

    PubMed Central

    Leonardo, Daniela P.; Albuquerque, Dulcinéia M.; Lanaro, Carolina; Baptista, Letícia C.; Cecatti, José G.; Surita, Fernanda G.; Parpinelli, Mary A.; Costa, Fernando F.; Franco-Penteado, Carla F.; Fertrin, Kleber Y.; Costa, Maria Laura

    2015-01-01

    Background Preeclampsia is one of the leading causes of maternal and neonatal morbidity and mortality in the world, but its appearance is still unpredictable and its pathophysiology has not been entirely elucidated. Genetic studies have associated single nucleotide polymorphisms in genes encoding nitric oxide synthase and matrix metalloproteases with preeclampsia, but the results are largely inconclusive across different populations. Objectives To investigate the association of single nucleotide polymorphisms (SNPs) in NOS3 (G894T, T-786C, and a variable number of tandem repetitions VNTR in intron 4), MMP2 (C-1306T), and MMP9 (C-1562T) genes with preeclampsia in patients from Southeastern Brazil. Methods This prospective case-control study enrolled 77 women with preeclampsia and 266 control pregnant women. Clinical data were collected to assess risk factors and the presence of severe complications, such as eclampsia and HELLP (hemolysis, elevated liver enzymes, and low platelets) syndrome. Results We found a significant association between the single nucleotide polymorphism NOS3 T-786C and preeclampsia, independently from age, height, weight, or the other SNPs studied, and no association was found with the other polymorphisms. Age and history of preeclampsia were also identified as risk factors. The presence of at least one polymorphic allele for NOS3 T-786C was also associated with the occurrence of eclampsia or HELLP syndrome among preeclamptic women. Conclusions Our data support that the NOS3 T-786C SNP is associated with preeclampsia and the severity of its complications. PMID:26317342

  13. Clinical evaluation, biochemistry and genetic polymorphism analysis for the diagnosis of lactose intolerance in a population from northeastern Brazil

    PubMed Central

    Ponte, Paulo Roberto Lins; de Medeiros, Pedro Henrique Quintela Soares; Havt, Alexandre; Caetano, Joselany Afio; Cid, David A C; de Moura Gondim Prata, Mara; Soares, Alberto Melo; Guerrant, Richard L; Mychaleckyj, Josyf; Lima, Aldo Ângelo Moreira

    2016-01-01

    OBJECTIVE: This work aimed to evaluate and correlate symptoms, biochemical blood test results and single nucleotide polymorphisms for lactose intolerance diagnosis. METHOD: A cross-sectional study was conducted in Fortaleza, Ceará, Brazil, with a total of 119 patients, 54 of whom were lactose intolerant. Clinical evaluation and biochemical blood tests were conducted after lactose ingestion and blood samples were collected for genotyping evaluation. In particular, the single nucleotide polymorphisms C>T-13910 and G>A-22018 were analyzed by restriction fragment length polymorphism/polymerase chain reaction and validated by DNA sequencing. RESULTS: Lactose-intolerant patients presented with more symptoms of flatulence (81.4%), bloating (68.5%), borborygmus (59.3%) and diarrhea (46.3%) compared with non-lactose-intolerant patients (p<0.05). We observed a significant association between the presence of the alleles T-13910 and A-22018 and the lactose-tolerant phenotype (p<0.05). After evaluation of the biochemical blood test results for lactose, we found that the most effective cutoff for glucose levels obtained for lactose malabsorbers was <15 mg/dL, presenting an area under the receiver operating characteristic curve greater than 80.3%, with satisfactory values for sensitivity and specificity. CONCLUSIONS: These data corroborate the association of these single nucleotide polymorphisms (C>T-13910 and G>A-22018) with lactose tolerance in this population and suggest clinical management for patients with lactose intolerance that considers single nucleotide polymorphism detection and a change in the biochemical blood test cutoff from <25 mg/dL to <15 mg/dL. PMID:26934237

  14. No association between polymorphisms in the DDC gene and paranoid schizophrenia in a northern Chinese population.

    PubMed

    Zhang, Boyu; Jia, Yanbin; Yuan, Yanbo; Yu, Xin; Xu, Qi; Shen, Yucun; Shen, Yan

    2004-09-01

    Several lines of evidence suggest that dysfunctions of neurotransmitters are associated with schizophrenia. DOPA decarboxylase (DDC) is an enzyme involved directly in the synthesis of dopamine and serotonin, and indirectly in the synthesis of noradrenaline. Therefore, the DDC gene can be considered a candidate gene for schizophrenia. We performed an association study between three single nucleotide polymorphisms in the DDC gene and paranoid schizophrenia. However, in our study no significant differences were found in the genotype distributions and allele frequencies between 80 paranoid schizophrenics and 108 controls for any of the polymorphisms. Neither did the haplotypes of the single nucleotide polymorphisms show any association with paranoid schizophrenia. Therefore, we conclude that the polymorphisms studied do not play a major role in paranoid schizophrenia pathogenesis in the population investigated.

  15. Single nucleotide polymorphisms in multiple sclerosis: disease susceptibility and treatment response biomarkers.

    PubMed

    Pravica, Vera; Popadic, Dusan; Savic, Emina; Markovic, Milos; Drulovic, Jelena; Mostarica-Stojkovic, Marija

    2012-04-01

    Multiple sclerosis (MS) is a chronic inflammatory demyelinating and neurodegenerative disease of the central nervous system characterized by unpredictable and variable clinical course. Etiology of MS involves both genetic and environmental factors. New technologies identified genetic polymorphisms associated with MS susceptibility among which immunologically relevant genes are significantly overrepresented. Although individual genes contribute only a small part to MS susceptibility, they might be used as biomarkers, thus helping to identify accurate diagnosis, predict clinical disease course and response to therapy. This review focuses on recent progress in research on MS genetics with special emphasis on the possibility to use single nucleotide polymorphism of candidate genes as biomarkers of susceptibility to disease and response to therapy.

  16. Single nucleotide polymorphisms of the bovine VEGF-B gene and their associations with growth traits in the Nanyang cattle breed.

    PubMed

    Pang, Y H; Lei, C Z; Zhang, C L; Lan, X Y; Shao, S M; Gao, X M; Chen, H

    2012-01-01

    PCR-SSCP and DNA sequencing methods were applied to reveal single nucleotide polymorphisms (SNPs) in the bovine VEGF-B gene in 675 samples belonging to three native Chinese cattle breeds. We found 3 SNPs and a duplication NC_007330.5: g. [782 A>G p. (Gly112 =) (;) 1000-1001dup CT (;) 1079 C>T (;) 2129 G>A p. (Arg184Gln)]. We also observed a statistically significant association of the polymorphism (1000-1001dup CT) in intron 3 of the VEGF-B gene with the body weight of the Nanyang cattle (p < 0.05). This polymorphisms of VEGF-B gene need to be verified among a larger cattle population before it can be identified as a marker for bovine body weight.

  17. Generalization of Associations of Kidney-Related Genetic Loci to American Indians

    PubMed Central

    Haack, Karin; Almasy, Laura; Laston, Sandra; Lee, Elisa T.; Best, Lyle G.; Fabsitz, Richard R.; MacCluer, Jean W.; Howard, Barbara V.; Umans, Jason G.; Cole, Shelley A.

    2014-01-01

    Summary Background and objectives CKD disproportionally affects American Indians, who similar to other populations, show genetic susceptibility to kidney outcomes. Recent studies have identified several loci associated with kidney traits, but their relevance in American Indians is unknown. Design, setting, participants, & measurements This study used data from a large, family-based genetic study of American Indians (the Strong Heart Family Study), which includes 94 multigenerational families enrolled from communities located in Oklahoma, the Dakotas, and Arizona. Individuals were recruited from the Strong Heart Study, a population-based study of cardiovascular disease in American Indians. This study selected 25 single nucleotide polymorphisms in 23 loci identified from recently published kidney-related genome-wide association studies in individuals of European ancestry to evaluate their associations with kidney function (estimated GFR; individuals 18 years or older, up to 3282 individuals) and albuminuria (urinary albumin to creatinine ratio; n=3552) in the Strong Heart Family Study. This study also examined the association of single nucleotide polymorphisms in the APOL1 region with estimated GFR in 1121 Strong Heart Family Study participants. GFR was estimated using the abbreviated Modification of Diet in Renal Disease Equation. Additive genetic models adjusted for age and sex were used. Results This study identified significant associations of single nucleotide polymorphisms with estimated GFR in or nearby PRKAG2, SLC6A13, UBE2Q2, PIP5K1B, and WDR72 (P<2.1 × 10-3 to account for multiple testing). Single nucleotide polymorphisms in these loci explained 2.2% of the estimated GFR total variance and 2.9% of its heritability. An intronic variant of BCAS3 was significantly associated with urinary albumin to creatinine ratio. APOL1 single nucleotide polymorphisms were not associated with estimated GFR in a single variant test or haplotype analyses, and the at-risk variants identified in individuals with African ancestry were not detected in DNA sequencing of American Indians. Conclusion This study extends the genetic associations of loci affecting kidney function to American Indians, a population at high risk of kidney disease, and provides additional support for a potential biologic relevance of these loci across ancestries. PMID:24311711

  18. Impact of IL-10 (−1082) Promoter–Single Nucleotide Polymorphism on the Outcome of Hepatitis C Virus Genotype 4 Infection

    PubMed Central

    Helal, Soheir F.; Gomaa, Howayda E.; Thabet, Eman H.; Younan, Mariam A.; Helmy, Neveen A.

    2014-01-01

    Immunoregulatory cytokines may influence the hepatitis C virus (HCV) infection outcome. This study aimed to determine the genotypic and allelic frequencies of the interleukin (IL)-10 (−1082) G/A polymorphism, and its association with chronicity or resolution of HCV genotype 4 infection in Egypt. The frequencies of different dimorphic polymorphisms based on single nucleotide substitution in chronic HCV patients (50) and resolved HCV patients (50) were: IL-10 (−1082) G/G 22 (44%) and 18 (36%), G/A 19 (38%) and 24 (48%), and A/A 9 (18%), and 8 (16%), respectively. In the sustained virologic response (SVR) (36) and spontaneously resolved subjects (14) groups, the frequencies were: IL-10 (−1082) G/G 11 (30.6%) and 7 (50%) G/A 18 (50%) and 6 (42.9%), A/A 7 (19.4%) and 1 (7.1%), respectively. An association between male gender and chronic hepatitis C outcome (P value 0.041) was found. However, no significant gender difference was found when we compared females versus males with elevated alanine transaminase (ALT) levels in the chronic HCV patient group (P value = 1). CONCLUSION No significant difference in the frequency of IL-10 single nucleotide polymorphism (SNP) at position 1082 was found between chronic and resolved HCV subjects. PMID:24833945

  19. Impact of IL-10 (-1082) promoter-single nucleotide polymorphism on the outcome of hepatitis C virus genotype 4 infection.

    PubMed

    Helal, Soheir F; Gomaa, Howayda E; Thabet, Eman H; Younan, Mariam A; Helmy, Neveen A

    2014-01-01

    Immunoregulatory cytokines may influence the hepatitis C virus (HCV) infection outcome. This study aimed to determine the genotypic and allelic frequencies of the interleukin (IL)-10 (-1082) G/A polymorphism, and its association with chronicity or resolution of HCV genotype 4 infection in Egypt. The frequencies of different dimorphic polymorphisms based on single nucleotide substitution in chronic HCV patients (50) and resolved HCV patients (50) were: IL-10 (-1082) G/G 22 (44%) and 18 (36%), G/A 19 (38%) and 24 (48%), and A/A 9 (18%), and 8 (16%), respectively. In the sustained virologic response (SVR) (36) and spontaneously resolved subjects (14) groups, the frequencies were: IL-10 (-1082) G/G 11 (30.6%) and 7 (50%) G/A 18 (50%) and 6 (42.9%), A/A 7 (19.4%) and 1 (7.1%), respectively. An association between male gender and chronic hepatitis C outcome (P value 0.041) was found. However, no significant gender difference was found when we compared females versus males with elevated alanine transaminase (ALT) levels in the chronic HCV patient group (P value = 1). No significant difference in the frequency of IL-10 single nucleotide polymorphism (SNP) at position 1082 was found between chronic and resolved HCV subjects.

  20. Failure of replicating the association between hippocampal volume and 3 single-nucleotide polymorphisms identified from the European genome-wide association study in Asian populations.

    PubMed

    Li, Ming; Ohi, Kazutaka; Chen, Chunhui; He, Qinghua; Liu, Jie-Wei; Chen, Chuansheng; Luo, Xiong-Jian; Dong, Qi; Hashimoto, Ryota; Su, Bing

    2014-12-01

    Hippocampal volume is a key brain structure for learning ability and memory process, and hippocampal atrophy is a recognized biological marker of Alzheimer's disease. However, the genetic bases of hippocampal volume are still unclear although it is a heritable trait. Genome-wide association studies (GWASs) on hippocampal volume have implicated several significantly associated genetic variants in Europeans. Here, to test the contributions of these GWASs identified genetic variants to hippocampal volume in different ethnic populations, we screened the GWAS-identified candidate single-nucleotide polymorphisms in 3 independent healthy Asian brain imaging samples (a total of 990 subjects). The results showed that none of these single-nucleotide polymorphisms were associated with hippocampal volume in either individual or combined Asian samples. The replication results suggested a complexity of genetic architecture for hippocampal volume and potential genetic heterogeneity between different ethnic populations. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Pei-Chun; Chen, Yen-Ching; Research Center for Gene, Environment, and Human Health, College of Public Health, National Taiwan University, Taiwan

    Purpose: To identify germline polymorphisms to predict concurrent chemoradiation therapy (CCRT) response in esophageal cancer patients. Materials and Methods: A total of 139 esophageal cancer patients treated with CCRT (cisplatin-based chemotherapy combined with 40 Gy of irradiation) and subsequent esophagectomy were recruited at the National Taiwan University Hospital between 1997 and 2008. After excluding confounding factors (i.e., females and patients aged {>=}70 years), 116 patients were enrolled to identify single nucleotide polymorphisms (SNPs) associated with specific CCRT responses. Genotyping arrays and mass spectrometry were used sequentially to determine germline polymorphisms from blood samples. These polymorphisms remain stable throughout disease progression,more » unlike somatic mutations from tumor tissues. Two-stage design and additive genetic models were adopted in this study. Results: From the 26 SNPs identified in the first stage, 2 SNPs were found to be significantly associated with CCRT response in the second stage. Single nucleotide polymorphism rs16863886, located between SGPP2 and FARSB on chromosome 2q36.1, was significantly associated with a 3.93-fold increase in pathologic complete response to CCRT (95% confidence interval 1.62-10.30) under additive models. Single nucleotide polymorphism rs4954256, located in ZRANB3 on chromosome 2q21.3, was associated with a 3.93-fold increase in pathologic complete response to CCRT (95% confidence interval 1.57-10.87). The predictive accuracy for CCRT response was 71.59% with these two SNPs combined. Conclusions: This is the first study to identify germline polymorphisms with a high accuracy for predicting CCRT response in the treatment of esophageal cancer.« less

  2. IRF6 rs2235375 single nucleotide polymorphism is associated with isolated non-syndromic cleft palate but not with cleft lip with or without palate in south Indian population.

    PubMed

    Gurramkonda, Venkatesh Babu; Syed, Altaf Hussain; Murthy, Jyotsna; Lakkakula, Bhaskar V K S

    2017-06-26

    Transcription factors are very diverse family of proteins involved in activating or repressing the transcription of a gene at a given time. Several studies using animal models demonstrated the role of transcription factor genes in craniofacial development. We aimed to investigate the association of IRF6 intron-6 polymorphism in the non-syndromic cleft lip with or without Palate in a south Indian population. 173 unrelated nonsyndromic cleft lip with or without Palate patients and 176 controls without clefts patients were genotyped for IRF6 rs2235375 variant by allele-specific amplification using the KASPar single nucleotide polymorphism genotyping system. The association between interferon regulatory factor-6 gene intron-6 dbSNP208032210:g.G>C (rs2235375) single nucleotide polymorphism and non-syndromic cleft lip with or without palate risk was investigated by chi-square test. There were significant differences in genotype or allele frequencies of rs2235375 single nucleotide polymorphism between controls and cases with non-syndromic cleft lip with or without palate. IRF6 rs2235375 variant was significantly associated with increased risk of non-syndromic cleft lip with or without palate in co-dominant, dominant (OR: 1.19; 95% CI 1.03-2.51; p=0.034) and allelic models (OR: 1.40; 95% CI 1.04-1.90; p=0.028). When subset analysis was applied significantly increased risk was observed in cleft palate only group (OR dominant: 4.33; 95% CI 1.44-12.97; p=0.005). These results suggest that IRF6 rs2235375 SNP play a major role in the pathogenesis and risk of developing non-syndromic cleft lip with or without palate. Copyright © 2017 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.

  3. Cacao single-nucleotide polymorphism (SNP) markers: A discovery strategy to identify SNPs for genotyping, genetic mapping and genome wide association studies (GWAS)

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide polymorphisms (SNPs) are the most common genetic markers in Theobroma cacao, occurring approximately once in every 200 nucleotides. SNPs, like microsatellites, are co-dominant and PCR-based, but they have several advantages over microsatellites. They are unambiguous, so that a SN...

  4. Association between polymorphisms in prostanoid receptor genes and aspirin-intolerant asthma.

    PubMed

    Kim, Sang-Heon; Kim, Yoon-Keun; Park, Heung-Woo; Jee, Young-Koo; Kim, Sang-Hoon; Bahn, Joon-Woo; Chang, Yoon-Seok; Kim, Seung-Hyun; Ye, Young-Min; Shin, Eun-Soon; Lee, Jong-Eun; Park, Hae-Sim; Min, Kyung-Up

    2007-04-01

    Genetic predisposition is linked to the pathogenesis of aspirin-intolerant asthma. Most candidate gene approaches have focused on leukotriene-related pathways, whereas there have been relatively few studies evaluating the effects of polymorphisms in prostanoid receptor genes on the development of aspirin-intolerant asthma. Therefore, we investigated the potential association between prostanoid receptor gene polymorphisms and the aspirin-intolerant asthma phenotype. We screened for genetic variations in the prostanoid receptor genes PTGER1, PTGER2, PTGER3, PTGER4, PTGDR, PTGIR, PTGFR, and TBXA2R using direct sequencing, and selected 32 tagging single nucleotide polymorphisms among the 77 polymorphisms with frequencies >0.02 based on linkage disequilibrium for genotyping. We compared the genotype distributions and allele frequencies of three participant groups (108 patients with aspirin-intolerant asthma, 93 patients with aspirin-tolerant asthma, and 140 normal controls). Through association analyses studies of the 32 single nucleotide polymorphisms, the following single nucleotide polymorphisms were found to have significant associations with the aspirin-intolerant asthma phenotype: -616C>G (P=0.038) and -166G>A (P=0.023) in PTGER2; -1709T>A (P=0.043) in PTGER3; -1254A>G (P=0.018) in PTGER4; 1915T>C (P=0.015) in PTGIR; and -4684C>T (P=0.027), and 795T>C (P=0.032) in TBXA2R. In the haplotype analysis of each gene, the frequency of PTGIR ht3[G-G-C-C], which includes 1915T>C, differed significantly between the aspirin-intolerant asthma patients and aspirin-tolerant asthma patients (P=0.015). These findings suggest that genetic polymorphisms in PTGER2, PTGER3, PTGER4, PTGIR, and TBXA2R play important roles in the pathogenesis of aspirin-intolerant asthma.

  5. Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

  6. Associations between single nucleotide polymorphisms in multiple candidate genes and body weight in rabbits

    PubMed Central

    El-Sabrout, Karim; Aggag, Sarah A.

    2017-01-01

    Aim: In this study, we examined parts of six growth genes (growth hormone [GH], melanocortin 4 receptor [MC4R], growth hormone receptor [GHR], phosphorglycerate mutase [PGAM], myostatin [MSTN], and fibroblast growth factor [FGF]) as specific primers for two rabbit lines (V-line, Alexandria) using nucleotide sequence analysis, to investigate association between detecting single nucleotide polymorphism (SNP) of these genes and body weight (BW) at market. Materials and Methods: Each line kits were grouped into high and low weight rabbits to identify DNA markers useful for association studies with high BW. DNA from blood samples of each group was extracted to amplify the six growth genes. SNP technique was used to study the associate polymorphism in the six growth genes and marketing BW (at 63 days) in the two rabbit lines. The purified polymerase chain reaction products were sequenced in those had the highest and lowest BW in each line. Results: Alignment of sequence data from each group revealed the following SNPs: At nucleotide 23 (A-C) and nucleotide 35 (T-G) in MC4R gene (sense mutation) of Alexandria and V-line high BW. Furthermore, we detected the following SNPs variation between the two lines: A SNP (T-C) at nucleotide 27 was identified by MC4R gene (sense mutation) and another one (A-C) at nucleotide 14 was identified by GHR gene (nonsense mutation) of Alexandria line. The results of individual BW at market (63 days) indicated that Alexandria rabbits had significantly higher BW compared with V-line rabbits. MC4R polymorphism showed significant association with high BW in rabbits. Conclusion: The results of polymorphism demonstrate the possibility to detect an association between BW in rabbits and the efficiency of the used primers to predict through the genetic specificity using the SNP of MC4R. PMID:28246458

  7. Aquaporin-4 polymorphisms and brain/body weight ratio in sudden infant death syndrome (SIDS).

    PubMed

    Studer, Jacqueline; Bartsch, Christine; Haas, Cordula

    2014-07-01

    Failure in the regulation of homeostatic water balance in the brain is associated with severe cerebral edema and increased brain weights and may also play an important role in the pathogenesis of sudden infant death syndrome (SIDS). We genotyped three single-nucleotide polymorphisms in the aquaporin-4 water channel-encoding gene (AQP4), which were previously shown to be associated with (i) SIDS in Norwegian infants (rs2075575), (ii) severe brain edema (rs9951307), and (iii) increased brain water permeability (rs3906956). We also determined whether the brain/body weight ratio is increased in SIDS infants compared with sex- and age-matched controls. Genotyping of the three AQP4 single-nucleotide polymorphisms was performed in 160 Caucasian SIDS infants and 181 healthy Swiss adults using a single-base extension method. Brain and body weights were measured during autopsy in 157 SIDS and 59 non-SIDS infants. No differences were detected in the allelic frequencies of the three AQP4 single-nucleotide polymorphisms between SIDS and adult controls. The brain/body weight ratio was similarly distributed in SIDS and non-SIDS infants. Variations in the AQP4 gene seem of limited significance as predisposing factors in Caucasian SIDS infants. Increased brain weights may only become evident in conjunction with environmental or other genetic risk factors.

  8. Identification and characterization of single nucleotide polymorphisms (SNPs) in Culex theileri (Diptera: Culicidae).

    PubMed

    Demirci, Berna; Lee, Yoosook; Lanzaro, Gregory C; Alten, Bulent

    2012-05-01

    Culex theileri Theobald (Diptera: Culicidae) is one of the most common mosquito species in northeastern Turkey and serves as a vector for various zoonotic diseases including West Nile virus. Although there have been some studies on the ecology of Cx. theileri, very little genetic data has been made available. We successfully sequenced 11 gene fragments from Cx. theileri specimens collected from the northeastern part of Turkey. On average, we found a Single nucleotide polymorphism every 45 bp. Transitions outnumbered transversions, at a ratio of 2:1. This is the first report of genetic polymorphisms in Cx. theileri and Single nucleotide polymorphism discovered from this study can be used to investigate population structure and gene-environmental interactions.

  9. Pooled genome wide association detects association upstream of FCRL3 with Graves' disease.

    PubMed

    Khong, Jwu Jin; Burdon, Kathryn P; Lu, Yi; Laurie, Kate; Leonardos, Lefta; Baird, Paul N; Sahebjada, Srujana; Walsh, John P; Gajdatsy, Adam; Ebeling, Peter R; Hamblin, Peter Shane; Wong, Rosemary; Forehan, Simon P; Fourlanos, Spiros; Roberts, Anthony P; Doogue, Matthew; Selva, Dinesh; Montgomery, Grant W; Macgregor, Stuart; Craig, Jamie E

    2016-11-18

    Graves' disease is an autoimmune thyroid disease of complex inheritance. Multiple genetic susceptibility loci are thought to be involved in Graves' disease and it is therefore likely that these can be identified by genome wide association studies. This study aimed to determine if a genome wide association study, using a pooling methodology, could detect genomic loci associated with Graves' disease. Nineteen of the top ranking single nucleotide polymorphisms including HLA-DQA1 and C6orf10, were clustered within the Major Histo-compatibility Complex region on chromosome 6p21, with rs1613056 reaching genome wide significance (p = 5 × 10 -8 ). Technical validation of top ranking non-Major Histo-compatablity complex single nucleotide polymorphisms with individual genotyping in the discovery cohort revealed four single nucleotide polymorphisms with p ≤ 10 -4 . Rs17676303 on chromosome 1q23.1, located upstream of FCRL3, showed evidence of association with Graves' disease across the discovery, replication and combined cohorts. A second single nucleotide polymorphism rs9644119 downstream of DPYSL2 showed some evidence of association supported by finding in the replication cohort that warrants further study. Pooled genome wide association study identified a genetic variant upstream of FCRL3 as a susceptibility locus for Graves' disease in addition to those identified in the Major Histo-compatibility Complex. A second locus downstream of DPYSL2 is potentially a novel genetic variant in Graves' disease that requires further confirmation.

  10. Association of glutathione S-transferase pi isoform single-nucleotide polymorphisms with exudative age-related macular degeneration in a Chinese population.

    PubMed

    Gu, Hong; Sun, Erdan; Cui, Lei; Yang, Xiufen; Lim, Apiradee; Xu, Jun; Snellingen, Torkel; Liu, Xipu; Wang, Ningli; Liu, Ningpu

    2012-10-01

    To investigate the association between single-nucleotide polymorphisms in the pi isoform of glutathione S-transferase (GSTP1) gene and the risk of exudative age-related macular degeneration (AMD) in a Chinese case-control cohort. A total of 131 Chinese patients with exudative AMD and 138 control individuals were recruited. Genomic DNA was extracted from venous blood leukocytes. Two common nonsynonymous single-nucleotide polymorphisms in GSTP1 (rs1695 and rs1138272) were genotyped by polymerase chain reaction followed by allele-specific restriction enzyme digestion and direct sequencing. Significant association with exudative AMD was detected for single-nucleotide polymorphism, rs1695 (P = 0.019). The risk G allele frequencies were 21.8% in AMD patients and 12.7% in control subjects (P = 0.007). Compared with the wild-type AA genotype, odds ratio for the risk of AMD was 1.91 (95% confidence interval, 1.09-3.35) for the heterozygous AG genotype and 2.52 (95% confidence interval, 0.6-10.61) for the homozygous GG genotype. In contrast, rs1138272 was not associated with exudative AMD (P = 1.00). The risk G allele frequencies of rs1138272 were 0.4% in AMD patients and 0.4% in control subjects (P = 1.00). Our data suggest that the GSTP1 variant rs1695 moderately increases the risk of exudative AMD. The variant rs1138272 was rare and was not associated with exudative AMD in this Chinese cohort.

  11. Contribution of 20 single nucleotide polymorphisms of 13 genes to dyslipidemia associated with antiretroviral therapy.

    PubMed

    Arnedo, Mireia; Taffé, Patrick; Sahli, Roland; Furrer, Hansjakob; Hirschel, Bernard; Elzi, Luigia; Weber, Rainer; Vernazza, Pietro; Bernasconi, Enos; Darioli, Roger; Bergmann, Sven; Beckmann, Jacques S; Telenti, Amalio; Tarr, Philip E

    2007-09-01

    HIV-1 infected individuals have an increased cardiovascular risk which is partially mediated by dyslipidemia. Single nucleotide polymorphisms in multiple genes involved in lipid transport and metabolism are presumed to modulate the risk of dyslipidemia in response to antiretroviral therapy. The contribution to dyslipidemia of 20 selected single nucleotide polymorphisms of 13 genes reported in the literature to be associated with plasma lipid levels (ABCA1, ADRB2, APOA5, APOC3, APOE, CETP, LIPC, LIPG, LPL, MDR1, MTP, SCARB1, and TNF) was assessed by longitudinally modeling more than 4400 plasma lipid determinations in 438 antiretroviral therapy-treated participants during a median period of 4.8 years. An exploratory genetic score was tested that takes into account the cumulative contribution of multiple gene variants to plasma lipids. Variants of ABCA1, APOA5, APOC3, APOE, and CETP contributed to plasma triglyceride levels, particularly in the setting of ritonavir-containing antiretroviral therapy. Variants of APOA5 and CETP contributed to high-density lipoprotein-cholesterol levels. Variants of CETP and LIPG contributed to non-high-density lipoprotein-cholesterol levels, a finding not reported previously. Sustained hypertriglyceridemia and low high-density lipoprotein-cholesterol during the study period was significantly associated with the genetic score. Single nucleotide polymorphisms of ABCA1, APOA5, APOC3, APOE, and CETP contribute to plasma triglyceride and high-density lipoprotein-cholesterol levels during antiretroviral therapy exposure. Genetic profiling may contribute to the identification of patients at risk for antiretroviral therapy-related dyslipidemia.

  12. Association of single nucleotide polymorphism in CD28(C/T-I3 + 17) and CD40 (C/T-1) genes with the Graves' disease.

    PubMed

    Mustafa, Saima; Fatima, Hira; Fatima, Sadia; Khosa, Tafheem; Akbar, Atif; Shaikh, Rehan Sadiq; Iqbal, Furhan

    2018-01-01

    To find out a correlation between the single nucleotide polymorphisms in cluster of differentiation 28 and cluster of differentiation 40 genes with Graves' disease, if any. This case-control study was conducted at the Multan Institute of Nuclear Medicine and Radiotherapy, Multan, Pakistan, and comprised blood samples of Graves' disease patients and controls. Various risk factors were also correlated either with the genotype at each single-nucleotide polymorphism or with various combinations of genotypes studied during present investigation. Of the 160 samples, there were 80(50%) each from patients and controls. Risk factor analysis revealed that gender (p=0.008), marital status (p<0.001), education (p<0.001), smoking (p<0.001), tri-iodothyronine (P <0.001), thyroxin (p<0.001) and thyroid-stimulating hormone (p<0.000) levels in blood were associated with Graves' disease. Both single-nucleotide polymorphisms in both genes were not associated with Graves' disease, either individually or in any combined form.

  13. Single nucleotide polymorphism of FSHβ gene associated with reproductive traits in Japanese flounder ( Paralichthys olivaceus)

    NASA Astrophysics Data System (ADS)

    He, Feng; Wen, Haishen; Yu, Dahui; Li, Jifang; Shi, Bao; Chen, Caifang; Zhang, Jiaren; Jin, Guoxiong; Chen, Xiaoyan; Shi, Dan; Yang, Yanping

    2010-12-01

    Follicle stimulating hormone β (FSHβ) of Japanese flounder ( Paralichthys olivaceus) plays a key role in the regulation of gonadal development. This study aimed to investigate molecular genetic characteristics of the FSHβ gene and elucidate the effects of single nucleotide polymorphisms (SNPs) of FSHβ on reproductive traits in Japanese flounder. We used polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) and sequencing of the FSHβ gene in 60 individuals. We identified only an SNP (T/C) in the coding region of exon3 of FSHβ. The SNP (T/C) did not lead to amino acid changes at the position 340 bp of FSHβ gene. Statistical analysis showed that the SNP was significantly associated with testosterone (T) level and gonadosomatic index (GSI) ( P < 0.05). Individuals with genotype TC of the SNP had significantly higher serum T levels and GSI ( P < 0.05) than that of genotype CC. Therefore, FSHβ gene could be a useful molecular marker in selection for prominent reproductive trait in Japanese Flounder.

  14. No Association between Oxytocin Receptor (OXTR) Gene Polymorphisms and Experimentally Elicited Social Preferences

    PubMed Central

    Apicella, Coren L.; Cesarini, David; Johannesson, Magnus; Dawes, Christopher T.; Lichtenstein, Paul; Wallace, Björn; Beauchamp, Jonathan; Westberg, Lars

    2010-01-01

    Background Oxytocin (OXT) has been implicated in a suite of complex social behaviors including observed choices in economic laboratory experiments. However, actual studies of associations between oxytocin receptor (OXTR) gene variants and experimentally elicited social preferences are rare. Methodology/Principal Findings We test hypotheses of associations between social preferences, as measured by behavior in two economic games, and 9 single nucleotide polymorphisms (SNPs) of the OXTR gene in a sample of Swedish twins (n = 684). Two standard economic games, the dictator game and the trust game, both involving real monetary consequences, were used to elicit such preferences. After correction for multiple hypothesis testing, we found no significant associations between any of the 9 single nucleotide polymorphisms (SNPs) and behavior in either of the games. Conclusion We were unable to replicate the most significant association reported in previous research between the amount donated in a dictator game and an OXTR genetic variant. PMID:20585395

  15. No association between oxytocin receptor (OXTR) gene polymorphisms and experimentally elicited social preferences.

    PubMed

    Apicella, Coren L; Cesarini, David; Johannesson, Magnus; Dawes, Christopher T; Lichtenstein, Paul; Wallace, Björn; Beauchamp, Jonathan; Westberg, Lars

    2010-06-16

    Oxytocin (OXT) has been implicated in a suite of complex social behaviors including observed choices in economic laboratory experiments. However, actual studies of associations between oxytocin receptor (OXTR) gene variants and experimentally elicited social preferences are rare. We test hypotheses of associations between social preferences, as measured by behavior in two economic games, and 9 single nucleotide polymorphisms (SNPs) of the OXTR gene in a sample of Swedish twins (n = 684). Two standard economic games, the dictator game and the trust game, both involving real monetary consequences, were used to elicit such preferences. After correction for multiple hypothesis testing, we found no significant associations between any of the 9 single nucleotide polymorphisms (SNPs) and behavior in either of the games. We were unable to replicate the most significant association reported in previous research between the amount donated in a dictator game and an OXTR genetic variant.

  16. Association between norepinephrine transporter gene (SLC6A2) polymorphisms and suicide in patients with major depressive disorder.

    PubMed

    Kim, Yong-Ku; Hwang, Jung-A; Lee, Heon-Jeong; Yoon, Ho-Kyoung; Ko, Young-Hoon; Lee, Bun-Hee; Jung, Han-Yong; Hahn, Sang-Woo; Na, Kyoung-Sae

    2014-04-01

    Although several studies have investigated possible associations between norepinephrine neurotransmitter transporter gene (SLC6A2) polymorphisms and depression, few studies have examined associations between SLC6A2 polymorphisms and suicide. Three single-nucleotide polymorphisms (rs2242446, rs28386840, and rs5569) were measured in 550 patients: 201 with major depressive disorder (MDD) and suicide attempt/s, 160 with MDD without suicide attempts, and 189 healthy controls. Analysis of single-nucleotide polymorphisms (SNPs) and haplotype was conducted for the three groups. Subsequently, multivariate logistic regression analysis adjusting for age and gender was conducted to identify independent influences of each SNP. A possible association between suicide lethality and SLC6A2 polymorphisms was also investigated. In the genotype and allele frequency analysis, there were significant differences in rs28386840 between suicidal MDD patients and healthy controls. In the haplotype analysis, TAA (rs2242446-rs28386840-rs5569, from left to right) was associated with suicide attempts in MDD, although the significance (p=0.043) disappeared after Bonferroni correction. There were no relationships between lethality scores and SLC6A2 polymorphisms in suicidal MDD. Modest sample size and a single type of neurotransmitter analyzed (norepinephrine) are the primary limitations. Our results suggest that SLC6A2 polymorphisms were associated with suicide risk in patients with MDD. Future studies are warranted to elucidate possible mechanisms by which SLC6A2 polymorphisms influence suicide risk. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Association study between alcoholism and endocannabinoid metabolic enzyme genes encoding fatty acid amide hydrolase and monoglyceride lipase in a Japanese population.

    PubMed

    Iwasaki, Shinya; Ishiguro, Hiroki; Higuchi, Susumu; Onaivi, Emmanuel S; Arinami, Tadao

    2007-08-01

    Fatty acid amide hydrolase (FAAH) and monoglyceride lipase (MGLL) are the major endocannabinoid metabolic enzymes. Owing to the importance of endocannabinoid system in addiction, the Pro129Thr polymorphism in the FAAH gene has reportedly been associated with substance abuse and dependence in a Caucasian population. To determine whether the single nucleodtide polymorphisms of the FAAH and MGLL genes are associated with alcoholism in a Japanese population. We conducted case-control studies for total 14 tag single nucleotide polymorphisms in those two genes using Japanese 729 patients with alcoholism and 799 healthy controls. Genotype and allele frequencies were compared between these groups. None of these genetic markers, however, showed significant association with alcoholism in Japanese. Whereas we examined associations in a larger sample size between alcoholism and tag single nucleotide polymorphisms that covered most regions of these endocannabinoid metabolic enzyme genes, we found that these are not associated with susceptibility to alcoholism in a Japanese population.

  18. A new single-nucleotide polymorphism database for rainbow trout generated through whole genome re-sequencing

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

  19. Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array

    USDA-ARS?s Scientific Manuscript database

    High-density single nucleotide polymorphism (SNP) genotyping chips are a powerful tool for studying genomic patterns of diversity, inferring ancestral relationships among individuals in populations and studying marker-trait associations in mapping experiments. We developed a genotyping array includ...

  20. Prediction of peripheral neuropathy in multiple myeloma patients receiving bortezomib and thalidomide: a genetic study based on a single nucleotide polymorphism array.

    PubMed

    García-Sanz, Ramón; Corchete, Luis Antonio; Alcoceba, Miguel; Chillon, María Carmen; Jiménez, Cristina; Prieto, Isabel; García-Álvarez, María; Puig, Noemi; Rapado, Immaculada; Barrio, Santiago; Oriol, Albert; Blanchard, María Jesús; de la Rubia, Javier; Martínez, Rafael; Lahuerta, Juan José; González Díaz, Marcos; Mateos, María Victoria; San Miguel, Jesús Fernando; Martínez-López, Joaquín; Sarasquete, María Eugenia

    2017-12-01

    Bortezomib- and thalidomide-based therapies have significantly contributed to improved survival of multiple myeloma (MM) patients. However, treatment-induced peripheral neuropathy (TiPN) is a common adverse event associated with them. Risk factors for TiPN in MM patients include advanced age, prior neuropathy, and other drugs, but there are conflicting results about the role of genetics in predicting the risk of TiPN. Thus, we carried out a genome-wide association study based on more than 300 000 exome single nucleotide polymorphisms in 172 MM patients receiving therapy involving bortezomib and thalidomide. We compared patients developing and not developing TiPN under similar treatment conditions (GEM05MAS65, NCT00443235). The highest-ranking single nucleotide polymorphism was rs45443101, located in the PLCG2 gene, but no significant differences were found after multiple comparison correction (adjusted P = .1708). Prediction analyses, cytoband enrichment, and pathway analyses were also performed, but none yielded any significant findings. A copy number approach was also explored, but this gave no significant results either. In summary, our study did not find a consistent genetic component associated with TiPN under bortezomib and thalidomide therapies that could be used for prediction, which makes clinical judgment essential in the practical management of MM treatment. Copyright © 2016 John Wiley & Sons, Ltd.

  1. Association of functional polymorphisms of the transforming growth factor B1 gene with survival and graft-versus-host disease after unrelated donor hematopoietic stem cell transplantation

    PubMed Central

    Berro, Mariano; Mayor, Neema P.; Maldonado-Torres, Hazael; Cooke, Louise; Kusminsky, Gustavo; Marsh, Steven G.E.; Madrigal, J. Alejandro; Shaw, Bronwen E.

    2010-01-01

    Background Many genetic factors play major roles in the outcome of hematopoietic stem cell transplants from unrelated donors. Transforming growth factor β1 is a member of a highly pleiotrophic family of growth factors involved in the regulation of numerous immunomodulatory processes. Design and Methods We investigated the impact of single nucleotide polymorphisms at codons 10 and 25 of TGFB1, the gene encoding for transforming growth factor β1, on outcomes in 427 mye-loablative-conditioned transplanted patients. In addition, transforming growth factor β1 plasma levels were measured in 263 patients and 327 donors. Results Patients homozygous for the single nucleotide polymorphism at codon 10 had increased non-relapse mortality (at 3 years: 46.8% versus 29.4%, P=0.014) and reduced overall survival (at 5 years 29.3% versus 42.2%, P=0.013); the differences remained statistically significant in multivariate analysis. Donor genotype alone had no impact, although multiple single nucleotide polymorphisms within the pair were significantly associated with higher non-relapse mortality (at 3 years: 44% versus 29%, P=0.021) and decreased overall survival (at 5 years: 33.8% versus 41.9%, P=0.033). In the 10/10 HLA matched transplants (n=280), recipients of non-wild type grafts tended to have a higher incidence of acute graft-versus-host disease grades II-IV (P=0.052). In multivariate analysis, when analyzed with patients’ genotype, the incidences of both overall and grades II-IV acute graft-versus-host disease were increased (P=0.025 and P=0.009, respectively) in non-wild-type pairs. Conclusions We conclude that increasing numbers of single nucleotide polymorphisms in codon 10 of TGFB1 in patients and donors are associated with a worse outcome following hematopoietic stem cell transplantation from unrelated donors. PMID:19713222

  2. Genome-wide association study of fertility traits in dairy cattle using high-density single nucleotide polymorphism marker panels

    USDA-ARS?s Scientific Manuscript database

    Unfavorable genetic correlations between production and fertility traits are well documented. Genetic selection for fertility traits is slow, however, due to low heritabilities. Identification of single nucleotide polymorphisms (SNP) involved in reproduction could improve reliability of genomic esti...

  3. Discovery, Validation and Characterization of 1039 Cattle Single Nucleotide Polymorphisms

    USDA-ARS?s Scientific Manuscript database

    We identified approximately 13000 putative single nucleotide polymorphisms (SNPs) by comparison of repeat-masked BAC-end sequences from the cattle RPCI-42 BAC library with whole-genome shotgun contigs of cattle genome assembly Btau 1.0. Genotyping of a subset of these SNPs was performed on a panel ...

  4. High-throughput single nucleotide polymorphism genotyping for breeding applications in rice using the BeadXpress platform

    USDA-ARS?s Scientific Manuscript database

    Multiplexed single nucleotide polymorphism (SNP) markers have the potential to increase the speed and cost-effectiveness of genotyping, provided that an optimal SNP density is used for each application. To test the efficiency of multiplexed SNP genotyping for diversity, mapping and breeding applicat...

  5. Developing Single Nucleotide Polymorphism (SNP) markers from transcriptome sequences for the identification of longan (Dimocarpus longan) germplasm

    USDA-ARS?s Scientific Manuscript database

    Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...

  6. Informativeness of single nucleotide polymorphisms and relationships among onion populations from important world production regions

    USDA-ARS?s Scientific Manuscript database

    Single nucleotide polymorphisms (SNPs) were genotyped using a high-density array and DNAs from individual plants from important onion populations from major production regions world-wide and the likely progenitor of onion, Allium vavilovii. Genotypes at 1226 SNPs were used to estimate genetic relati...

  7. Relationships among calpastatin single nucleotide polymorphisms, calpastatin expression and tenderness in pork longissimus

    USDA-ARS?s Scientific Manuscript database

    Genome scans in the pig have identified a region on chromosome 2 (SSC2) associated with tenderness. Calpastatin is a likely positional candidate gene in this region because of its inhibitory role in the calpain system that is involved in postmortem tenderization. Novel single nucleotide polymorphism...

  8. Lineage and genogroup-defining single nucleotide polymorphisms of Escherichia coli 0157:H7

    USDA-ARS?s Scientific Manuscript database

    Escherichia coli O157:H7 is a zoonotic human pathogen for which cattle are an important reservoir host. Using both previously published and new sequencing data, a 48-locus single nucleotide polymorphism (SNP) based typing panel was developed that redundantly identified eleven genogroups that span ...

  9. A new single-nucleotide polymorphisms database for rainbow trout generated through whole genome resequencing of selected samples

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

  10. Development of 101 novel EST-derived single nucleotide polymorphism markers for Zhikong scallop ( Chlamys farreri)

    NASA Astrophysics Data System (ADS)

    Li, Jiqin; Bao, Zhenmin; Li, Ling; Wang, Xiaojian; Wang, Shi; Hu, Xiaoli

    2013-09-01

    Zhikong scallop ( Chlamys farreri) is an important maricultured species in China. Many researches on this species, such as population genetics and QTL fine-mapping, need a large number of molecular markers. In this study, based on the expressed sequence tags (EST), a total of 300 putative single nucleotide polymorphisms (SNPs) were selected and validated using high resolution melting (HRM) technology with unlabeled probe. Of them, 101 (33.7%) were found to be polymorphic in 48 individuals from 4 populations. Further evaluation with 48 individuals from Qingdao population showed that all the polymorphic loci had two alleles with the minor allele frequency ranged from 0.046 to 0.500. The observed and expected heterozygosities ranged from 0.000 to 0.925 and from 0.089 to 0.505, respectively. Fifteen loci deviated significantly from Hardy-Weinberg equilibrium and significant linkage disequilibrate was detected in one pair of markers. BLASTx gave significant hits for 72 of the 101 polymorphic SNP-containing ESTs. Thirty four polymorphic SNP loci were predicted to be non-synonymous substitutions as they caused either the change of codons (33 SNPs) or pretermination of translation (1 SNP). The markers developed can be used for the population studies and genetic improvement on Zhikong scallop.

  11. Computational Analysis of Single Nucleotide Polymorphisms Associated with Altered Drug Responsiveness in Type 2 Diabetes

    PubMed Central

    Costa, Valerio; Federico, Antonio; Pollastro, Carla; Ziviello, Carmela; Cataldi, Simona; Formisano, Pietro; Ciccodicola, Alfredo

    2016-01-01

    Type 2 diabetes (T2D) is one of the most frequent mortality causes in western countries, with rapidly increasing prevalence. Anti-diabetic drugs are the first therapeutic approach, although many patients develop drug resistance. Most drug responsiveness variability can be explained by genetic causes. Inter-individual variability is principally due to single nucleotide polymorphisms, and differential drug responsiveness has been correlated to alteration in genes involved in drug metabolism (CYP2C9) or insulin signaling (IRS1, ABCC8, KCNJ11 and PPARG). However, most genome-wide association studies did not provide clues about the contribution of DNA variations to impaired drug responsiveness. Thus, characterizing T2D drug responsiveness variants is needed to guide clinicians toward tailored therapeutic approaches. Here, we extensively investigated polymorphisms associated with altered drug response in T2D, predicting their effects in silico. Combining different computational approaches, we focused on the expression pattern of genes correlated to drug resistance and inferred evolutionary conservation of polymorphic residues, computationally predicting the biochemical properties of polymorphic proteins. Using RNA-Sequencing followed by targeted validation, we identified and experimentally confirmed that two nucleotide variations in the CAPN10 gene—currently annotated as intronic—fall within two new transcripts in this locus. Additionally, we found that a Single Nucleotide Polymorphism (SNP), currently reported as intergenic, maps to the intron of a new transcript, harboring CAPN10 and GPR35 genes, which undergoes non-sense mediated decay. Finally, we analyzed variants that fall into non-coding regulatory regions of yet underestimated functional significance, predicting that some of them can potentially affect gene expression and/or post-transcriptional regulation of mRNAs affecting the splicing. PMID:27347941

  12. Single nucleotide polymorphisms of TNF-Α gene in febrile seizures.

    PubMed

    Zare-Shahabadi, Ameneh; Ashrafi, Mahmoud Reza; Shahrokhi, Amin; Soltani, Samaneh; Zoghi, Samaneh; Soleimani, Farin; Vameghi, Roshanak; Badv, Reza Shervin; Rezaei, Nima

    2015-09-15

    Febrile seizures (FS) is the most common seizure disorder during childhood. This study was performed in 78 patients with FS and 137 control subjects to assess polymorphisms of the TNF-α gene at positions -308 and -238, using the polymerase chain reaction and the sequence specific primers method. The highest positive allelic association that made the patients susceptible to FS was seen for TNF-α -238/G (p<0.0001). The GG genotype at TNF-α -238 was significantly higher in the patients with FS, compared to the controls (p=0.0001). Also, GA genotype at the same position was significantly lower in patients than in controls (P=0.0001). The GG haplotype had a significant positive association at TNF-α (308, 238) while GA haplotype showed a negative association (P<0.001). Our data support the idea that TNF-α single-nucleotide polymorphisms play a role in the pathogenesis of FS. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Single-Nucleotide Polymorphism-Microarray Ploidy Analysis of Paraffin-Embedded Products of Conception in Recurrent Pregnancy Loss Evaluations.

    PubMed

    Maslow, Bat-Sheva L; Budinetz, Tara; Sueldo, Carolina; Anspach, Erica; Engmann, Lawrence; Benadiva, Claudio; Nulsen, John C

    2015-07-01

    To compare the analysis of chromosome number from paraffin-embedded products of conception using single-nucleotide polymorphism (SNP) microarray with the recommended screening for the evaluation of couples presenting with recurrent pregnancy loss who do not have previous fetal cytogenetic data. We performed a retrospective cohort study including all women who presented for a new evaluation of recurrent pregnancy loss over a 2-year period (January 1, 2012, to December 31, 2013). All participants had at least two documented first-trimester losses and both the recommended screening tests and SNP microarray performed on at least one paraffin-embedded products of conception sample. Single-nucleotide polymorphism microarray identifies all 24 chromosomes (22 autosomes, X, and Y). Forty-two women with a total of 178 losses were included in the study. Paraffin-embedded products of conception from 62 losses were sent for SNP microarray. Single-nucleotide polymorphism microarray successfully diagnosed fetal chromosome number in 71% (44/62) of samples, of which 43% (19/44) were euploid and 57% (25/44) were noneuploid. Seven of 42 (17%) participants had abnormalities on recurrent pregnancy loss screening. The per-person detection rate for a cause of pregnancy loss was significantly higher in the SNP microarray (0.50; 95% confidence interval [CI] 0.36-0.64) compared with recurrent pregnancy loss evaluation (0.17; 95% CI 0.08-0.31) (P=.002). Participants with one or more euploid loss identified on paraffin-embedded products of conception were significantly more likely to have an abnormality on recurrent pregnancy loss screening than those with only noneuploid results (P=.028). The significance remained when controlling for age, number of losses, number of samples, and total pregnancies. These results suggest that SNP microarray testing of paraffin-embedded products of conception is a valuable tool for the evaluation of recurrent pregnancy loss in patients without prior fetal cytogenetic results. Recommended recurrent pregnancy loss screening was unnecessary in almost half the patients in our study. II.

  14. BDNF Polymorphism Predicts General Intelligence after Penetrating Traumatic Brain Injury

    PubMed Central

    Rostami, Elham; Krueger, Frank; Zoubak, Serguei; Dal Monte, Olga; Raymont, Vanessa; Pardini, Matteo; Hodgkinson, Colin A.; Goldman, David; Risling, Mårten; Grafman, Jordan

    2011-01-01

    Neuronal plasticity is a fundamental factor in cognitive outcome following traumatic brain injury. Brain-derived neurotrophic factor (BDNF), a member of the neurotrophin family, plays an important role in this process. While there are many ways to measure cognitive outcome, general cognitive intelligence is a strong predictor of everyday decision-making, occupational attainment, social mobility and job performance. Thus it is an excellent measure of cognitive outcome following traumatic brain injury (TBI). Although the importance of the single-nucleotide polymorphisms polymorphism on cognitive function has been previously addressed, its role in recovery of general intelligence following TBI is unknown. We genotyped male Caucasian Vietnam combat veterans with focal penetrating TBI (pTBI) (n = 109) and non-head injured controls (n = 38) for 7 BDNF single-nucleotide polymorphisms. Subjects were administrated the Armed Forces Qualification Test (AFQT) at three different time periods: pre-injury on induction into the military, Phase II (10–15 years post-injury, and Phase III (30–35 years post-injury). Two single-nucleotide polymorphisms, rs7124442 and rs1519480, were significantly associated with post-injury recovery of general cognitive intelligence with the most pronounced effect at the Phase II time point, indicating lesion-induced plasticity. The genotypes accounted for 5% of the variance of the AFQT scores, independently of other significant predictors such as pre-injury intelligence and percentage of brain volume loss. These data indicate that genetic variations in BDNF play a significant role in lesion-induced recovery following pTBI. Identifying the underlying mechanism of this brain-derived neurotrophic factor effect could provide insight into an important aspect of post-traumatic cognitive recovery. PMID:22087305

  15. Human leukocyte antigen and cytokine receptor gene polymorphisms associated with heterogeneous immune responses to mumps viral vaccine.

    PubMed

    Ovsyannikova, Inna G; Jacobson, Robert M; Dhiman, Neelam; Vierkant, Robert A; Pankratz, V Shane; Poland, Gregory A

    2008-05-01

    Mumps outbreaks continue to occur throughout the world, including in highly vaccinated populations. Vaccination against mumps has been successful; however, humoral and cellular immune responses to mumps vaccines vary significantly from person to person. We set out to assess whether HLA and cytokine gene polymorphisms are associated with variations in the immune response to mumps viral vaccine. To identify genetic factors that might contribute to variations in mumps vaccine-induced immune responses, we performed HLA genotyping in a group of 346 healthy schoolchildren (12-18 years of age) who previously received 2 doses of live mumps vaccine. Single-nucleotide polymorphisms (minor allele frequency of >5%) in cytokine and cytokine receptor genes were genotyped for a subset of 118 children. Median values for mumps-specific antibody titers and lymphoproliferative stimulation indices were 729 IU/mL and 4.8, respectively. Girls demonstrated significantly higher mumps antibody titers than boys, indicating gender-linked genetic differences in humoral immune response. Significant associations were found between the HLA-DQB1*0303 alleles and lower mumps-specific antibody titers. An interesting finding was the association of several HLA class II alleles with mumps-specific lymphoproliferation. Alleles of the DRB1 (*0101, *0301, *0801, *1001, *1201, and *1302), DQA1 (*0101, *0105, *0401, and *0501), and DQB1 (*0201, *0402, and *0501) loci were associated with significant variations in lymphoproliferative immune responses to mumps vaccine. Additional associations were observed with single-nucleotide polymorphisms in the interleukin-10RA, interleukin-12RB1, and interleukin-12RB2 cytokine receptor genes. Minor alleles for 4 single-nucleotide polymorphisms within interleukin-10RA and interleukin-12RB genes were associated with variations in humoral and cellular immune responses to mumps vaccination. These data suggest the important role of HLA and immunoregulatory cytokine receptor gene polymorphisms in explaining variations in mumps vaccine-induced immune responses.

  16. Human Leukocyte Antigen and Cytokine Receptor Gene Polymorphisms Associated With Heterogeneous Immune Responses to Mumps Viral Vaccine

    PubMed Central

    Ovsyannikova, Inna G.; Jacobson, Robert M.; Dhiman, Neelam; Vierkant, Robert A.; Pankratz, V. Shane; Poland, Gregory A.

    2009-01-01

    OBJECTIVES Mumps outbreaks continue to occur throughout the world, including in highly vaccinated populations. Vaccination against mumps has been successful; however, humoral and cellular immune responses to mumps vaccines vary significantly from person to person. We set out to assess whether HLA and cytokine gene polymorphisms are associated with variations in the immune response to mumps viral vaccine. METHODS To identify genetic factors that might contribute to variations in mumps vaccine–induced immune responses, we performed HLA genotyping in a group of 346 healthy schoolchildren (12–18 years of age) who previously received 2 doses of live mumps vaccine. Single-nucleotide polymorphisms (minor allele frequency of >5%) in cytokine and cytokine receptor genes were genotyped for a subset of 118 children. RESULTS Median values for mumps-specific antibody titers and lymphoproliferative stimulation indices were 729 IU/mL and 4.8, respectively. Girls demonstrated significantly higher mumps antibody titers than boys, indicating gender-linked genetic differences in humoral immune response. Significant associations were found between the HLA-DQB1*0303 alleles and lower mumps-specific antibody titers. An interesting finding was the association of several HLA class II alleles with mumps-specific lymphoproliferation. Alleles of the DRB1 (*0101, *0301, *0801, *1001, *1201, and *1302), DQA1 (*0101, *0105, *0401, and *0501), and DQB1 (*0201, *0402, and *0501) loci were associated with significant variations in lymphoproliferative immune responses to mumps vaccine. Additional associations were observed with single-nucleotide polymorphisms in the interleukin-10RA, interleukin-12RB1, and interleukin-12RB2 cytokine receptor genes. Minor alleles for 4 single-nucleotide polymorphisms within interleukin-10RA and interleukin-12RB genes were associated with variations in humoral and cellular immune responses to mumps vaccination. CONCLUSIONS These data suggest the important role of HLA and immunoregulatory cytokine receptor gene polymorphisms in explaining variations in mumps vaccine–induced immune responses. PMID:18450852

  17. A resource of single-nucleotide polymorphisms for rainbow trout generated by restriction-site associated DNA sequencing of doubled haploids

    USDA-ARS?s Scientific Manuscript database

    Salmonid genomes are considered to be in a pseudo-tetraploid state as a result of an evolutionarily recent genome duplication event. This situation complicates single nucleotide polymorphism (SNP) discovery in rainbow trout as many putative SNPs are actually paralogous sequence variants (PSVs) and ...

  18. Single nucleotide polymorphisms in candidate genes associated with fertilizing ability of sperm and subsequent embryonic development in cattle

    USDA-ARS?s Scientific Manuscript database

    Fertilization and development of the preimplantation embryo is under genetic control. The goal of the current study was to test 434 single nucleotide polymorphisms (SNPs) for association with genetic variation in fertilization and early embryonic development. The approach was to produce embryos from...

  19. Prospects for inferring pairwise relationships with single nucleotide polymorphisms

    Treesearch

    Jeffery C. Glaubitz; O. Eugene, Jr. Rhodes; J. Andrew DeWoody

    2003-01-01

    An extraordinarily large number of single nucleotide polymorphisms (SNPs) are now available in humans as well as in other model organisms. Technological advancements may soon make it feasible to assay hundreds of SNPs in virtually any organism of interest. One potential application of SNPs is the determination of pairwise genetic relationships in populations without...

  20. Short communication: Relationship of call rate and accuracy of single nucleotide polymorphism genotypes in dairy cattle

    USDA-ARS?s Scientific Manuscript database

    Call rate has been used as a measure of quality on both a single nucleotide polymorphism (SNP) and animal basis since SNP genotypes were first used in genomic evaluation of dairy cattle. The genotyping laboratories perform initial quality control screening and genotypes that fail are usually exclude...

  1. Single nucleotide polymorphisms generated by genotyping by sequencing to characterize genome-wide diversity, linkage disequilibrium, and selective sweeps in cultivated watermelon

    USDA-ARS?s Scientific Manuscript database

    Large datasets containing single nucleotide polymorphisms (SNPs) are used to analyze genome-wide diversity in a robust collection of cultivars from representative accessions, across the world. The extent of linkage disequilibrium (LD) within a population determines the number of markers required fo...

  2. 17q25 Locus Is Associated With White Matter Hyperintensity Volume in Ischemic Stroke, But Not With Lacunar Stroke Status

    PubMed Central

    Adib-Samii, Poneh; Rost, Natalia; Traylor, Matthew; Devan, William; Biffi, Alessandro; Lanfranconi, Silvia; Fitzpatrick, Kaitlin; Bevan, Steve; Kanakis, Allison; Valant, Valerie; Gschwendtner, Andreas; Malik, Rainer; Richie, Alexa; Gamble, Dale; Segal, Helen; Parati, Eugenio A.; Ciusani, Emilio; Holliday, Elizabeth G.; Maguire, Jane; Wardlaw, Joanna; Worrall, Bradford; Bis, Joshua; Wiggins, Kerri L.; Longstreth, Will; Kittner, Steve J.; Cheng, Yu-Ching; Mosley, Thomas; Falcone, Guido J.; Furie, Karen L.; Leiva-Salinas, Carlos; Lau, Benison C.; Khan, Muhammed Saleem; Sharma, Pankaj; Fornage, Myriam; Mitchell, Braxton D.; Psaty, Bruce M.; Sudlow, Cathie; Levi, Christopher; Boncoraglio, Giorgio B.; Rothwell, Peter M.; Meschia, James; Dichgans, Martin; Rosand, Jonathan; Markus, Hugh S.

    2013-01-01

    Background and Purpose Recently, a novel locus at 17q25 was associated with white matter hyperintensities (WMH) on MRI in stroke-free individuals. We aimed to replicate the association with WMH volume (WMHV) in patients with ischemic stroke. If the association acts by promoting a small vessel arteriopathy, it might be expected to also associate with lacunar stroke. Methods We quantified WMH on MRI in the stroke-free hemisphere of 2588 ischemic stroke cases. Association between WMHV and 6 single-nucleotide polymorphisms at chromosome 17q25 was assessed by linear regression. These single-nucleotide polymorphisms were also investigated for association with lacunar stroke in 1854 cases and 51 939 stroke-free controls from METASTROKE. Meta-analyses with previous reports and a genetic risk score approach were applied to identify other novel WMHV risk variants and uncover shared genetic contributions to WMHV in community participants without stroke and ischemic stroke. Results Single-nucleotide polymorphisms at 17q25 were associated with WMHV in ischemic stroke, the most significant being rs9894383 (P=0.0006). In contrast, there was no association between any single-nucleotide polymorphism and lacunar stroke. A genetic risk score analysis revealed further genetic components to WMHV shared between community participants without stroke and ischemic stroke. Conclusions This study provides support for an association between the 17q25 locus and WMH. In contrast, it is not associated with lacunar stroke, suggesting that the association does not act by promoting small-vessel arteriopathy or the same arteriopathy responsible for lacunar infarction. PMID:23674528

  3. Relationship between single nucleotide polymorphism of glycogen synthase gene of Pacific oyster Crassostrea gigas and its glycogen content

    NASA Astrophysics Data System (ADS)

    Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng

    2017-02-01

    Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P < 0.01), from which we constructed four main haplotypes due to linkage disequilibrium. Furthermore, the most effective haplotype H2 (GAGGAT) had extremely significant relationship with high glycogen content ( P < 0.0001). These findings revealed the potential influence of Cg-GYS polymorphism on the glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.

  4. Transcript-specific, single-nucleotide polymorphism discovery and linkage analysis in hexaploid bread wheat (Triticum aestivum L.).

    PubMed

    Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J

    2011-12-01

    Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  5. Polymorphisms in the microglial marker molecule CX3CR1 affect the blood volume of the human brain.

    PubMed

    Sakai, Mai; Takeuchi, Hikaru; Yu, Zhiqian; Kikuchi, Yoshie; Ono, Chiaki; Takahashi, Yuta; Ito, Fumiaki; Matsuoka, Hiroo; Tanabe, Osamu; Yasuda, Jun; Taki, Yasuyuki; Kawashima, Ryuta; Tomita, Hiroaki

    2018-06-01

    CX3CR1, a G-protein-coupled receptor, is involved in various inflammatory processes. Two non-synonymous single nucleotide polymorphisms, V249I (rs3732379) and T280M (rs3732378), are located in the sixth and seventh transmembrane domains of the CX3CR1 protein, respectively. Previous studies have indicated significant associations between T280M and leukocyte functional characteristics, including adhesion, signaling, and chemotaxis, while the function of V249I is unclear. In the brain, microglia are the only proven and widely accepted CX3CR1-expressing cells. This study aimed to specify whether there were specific brain regions on which these two single nucleotide polymorphisms exert their biological impacts through their functional effects on microglia. Associations between the single nucleotide polymorphisms and brain characteristics, including gray and white matter volumes, white matter integrity, resting arterial blood volume, and cerebral blood flow, were evaluated among 1300 healthy Japanese individuals. The major allele carriers (V249 and T280) were significantly associated with an increased total arterial blood volume of the whole brain, especially around the bilateral precuneus, left posterior cingulate cortex, and left posterior parietal cortex. There were no significant associations between the genotypes and other brain structural indicators. This finding suggests that the CX3CR1 variants may affect arterial structures in the brain, possibly via interactions between microglia and brain microvascular endothelial cells. © 2018 The Authors. Psychiatry and Clinical Neurosciences © 2018 Japanese Society of Psychiatry and Neurology.

  6. Effects of the BDNF Val66Met Polymorphism on Anxiety-Like Behavior Following Nicotine Withdrawal in Mice

    PubMed Central

    Lee, Bridgin G.; Anastasia, Agustin; Hempstead, Barbara L.; Lee, Francis S.

    2015-01-01

    Introduction: Nicotine withdrawal is characterized by both affective and cognitive symptoms. Identifying genetic polymorphisms that could affect the symptoms associated with nicotine withdrawal are important in predicting withdrawal sensitivity and identifying personalized cessation therapies. In the current study we used a mouse model of a non-synonymous single nucleotide polymorphism in the translated region of the brain-derived neurotrophic factor (BDNF) gene that substitutes a valine (Val) for a methionine (Met) amino acid (Val66Met) to examine the relationship between the Val66Met single nucleotide polymorphism and nicotine dependence. Methods: This study measured proBDNF and the BDNF prodomain levels following nicotine and nicotine withdrawal and examined a mouse model of a common polymorphism in this protein (BDNFMet/Met) in three behavioral paradigms: novelty-induced hypophagia, marble burying, and the open-field test. Results: Using the BDNF knock-in mouse containing the BDNF Val66Met polymorphism we found: (1) blunted anxiety-like behavior in BDNFMet/Met mice following withdrawal in three behavioral paradigms: novelty-induced hypophagia, marble burying, and the open-field test; (2) the anxiolytic effects of chronic nicotine are absent in BDNFMet/Met mice; and (3) an increase in BDNF prodomain in BDNFMet/Met mice following nicotine withdrawal. Conclusions: Our study is the first to examine the effect of the BDNF Val66Met polymorphism on the affective symptoms of withdrawal from nicotine in mice. In these mice, a single-nucleotide polymorphism in the translated region of the BDNF gene can result in a blunted withdrawal, as measured by decreased anxiety-like behavior. The significant increase in the BDNF prodomain in BDNFMet/Met mice following nicotine cessation suggests a possible role of this ligand in the circuitry remodeling after withdrawal. PMID:25744957

  7. Single Nucleotide Polymorphisms Predict Symptom Severity of Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H.

    2012-01-01

    Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs)…

  8. Single nucleotide polymorphisms in uracil-processing genes, intake of one-carbon nutrients and breast cancer risk

    USDA-ARS?s Scientific Manuscript database

    Background/Objectives: The misincorporation of uracil into DNA leads to genomic instability. In a previous study, some of us identified four common single nucleotide polymorphisms (SNPs) in uracil-processing genes (rs2029166 and rs7296239 in SMUG1, rs34259 in UNG and rs4775748 in DUT) that were asso...

  9. Single nucleotide polymorphisms in specific candidate genes are associated with phenotypic differences in days open for first lactation in Holstein cows

    USDA-ARS?s Scientific Manuscript database

    Previously, a candidate gene approach identified 51 single nucleotide polymorphisms (SNP) associated with genetic merit for reproductive traits and 26 associated with genetic merit for production in dairy bulls. We evaluated association of the 77 SNPs with days open (DO) for first lactation in a pop...

  10. An integrated genetic linkage map of watermelon and genetic diversity based on single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers

    USDA-ARS?s Scientific Manuscript database

    Watermelon (Citrullus lanatus var. lanatus) is an important vegetable fruit throughout the world. A high number of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers should provide large coverage of the watermelon genome and high phylogenetic resolution of germplasm acces...

  11. Association between ghrelin gene variations, body mass index, and waist-to-hip ratio in patients with polycystic ovary syndrome.

    PubMed

    Xu, L; Shi, Y; Gu, J; Wang, Y; Wang, L; You, L; Qi, X; Ye, Y; Chen, Z

    2014-03-01

    To investigate the association between 2 single nucleotide polymorphisms (SNP501A/C and 604 G/A) in the promoter of the ghrelin gene and the hormonal and metabolic phenotypes of polycystic ovary syndrome (PCOS) in a Chinese population. 285 patients with PCOS and 260 healthy controls were selected for a prospective, case-control study at Shandong Provincial Hospital, Jinan, China. All subjects underwent genotype analysis of the 2 single nucleotide polymorphisms of the ghrelin gene. Measurements were also taken of blood lipids, glucose, and hormone levels, and calculations of body mass index (BMI) and waist-to-hip ratio (WHR) were performed to detect hormonal and metabolic phenotypes. No significant diff erences in polymorphism genotypes were found between PCOS patients and healthy controls. However, the frequency of the -501 A/C A allele was significantly higher in the PCOS group than in the control group. PCOS -501 A/C A carriers had significantly higher BMI and WHR than PCOS women with the CC genotype. -604 G/A polymorphisms were not associated with clinical or biochemical characteristics of PCOS. The -501 A/C polymorphism of the ghrelin gene is associated with metabolic features of PCOS in a Chinese population. © J. A. Barth Verlag in Georg Thieme Verlag KG Stuttgart · New York.

  12. Meta-analysis of the relationship between single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease.

    PubMed

    Dai, Weiran; Ye, Ziliang; Lu, Haili; Su, Qiang; Li, Hui; Li, Lang

    2018-02-23

    The results showed that there was a certain correlation between the single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease, but there was no systematic study to verify this conclusion. Systematic review of the association between single nucleotide polymorphism of IL-10-1082G/A locus and rheumatic heart disease. Computer retrieval PubMed, EMbase, Cochrane Library, CBM, CNKI, VIP and Data WanFang, the retrieval time limit from inception to June 2017. A case control study of single nucleotide polymorphisms and rheumatic heart disease in patients with rheumatic heart disease in the IL-10-1082G/A was collected. Two researchers independently screened the literature, extracted data and evaluated the risk of bias in the study, and using RevMan5.3 software for data analysis. A total of 3 case control studies were included, including 318 patients with rheumatic heart disease and 502 controls. Meta-analysis showed that there was no correlation between IL-10-1082G/A gene polymorphism and rheumatic heart disease [AA+AG VS GG: OR = 0.62, 95% CI (0.28, 1.39), P = 0.25; AA VS AG+GG: OR = 0.73, 95% CI (0.54, 1.00), P = 0.05; AA VS GG: OR = 0.70, 95% CI(0.47, 1.05), P = 0.08; AG VS GG: OR = 0.65, 95% CI (0.22, 1.92), P = 0.43; A VS G: OR = 0.87, 95% CI (0.71, 1.06), P = 0.17]. When AA is a recessive gene, the single nucleotide polymorphism of IL-10-1082G/A is associated with the presence of rheumatic heart disease. Due to the limitations of the quantity and quality of the included literatures, the further research results were still needed.

  13. Evaluation of a Panel of Single-Nucleotide Polymorphisms in miR-146a and miR-196a2 Genomic Regions in Patients with Chronic Periodontitis.

    PubMed

    Venugopal, Priyanka; Lavu, Vamsi; RangaRao, Suresh; Venkatesan, Vettriselvi

    2017-04-01

    Periodontitis is an inflammatory disease caused by bacterial triggering of the host immune-inflammatory response, which in turn is regulated by microRNAs (miRNA). Polymorphisms in the miRNA pathways affect the expression of several target genes such as tumor necrosis factor-α and interleukins, which are associated with progression of disease. The objective of this study was to identify the association between the MiR-146a single nucleotide polymorphisms (SNPs) (rs2910164, rs57095329, and rs73318382), the MiR-196a2 (rs11614913) SNP and chronic periodontitis. Genotyping was performed for the MiR-146a (rs2910164, rs57095329, and rs73318382) and the MiR-196a2 (rs11614913) polymorphisms in 180 healthy controls and 190 cases of chronic periodontitis by the direct Sanger sequencing technique. The strength of the association between the polymorphisms and chronic periodontitis was evaluated using logistic regression analysis. Haplotype and linkage analyses among the polymorphisms was performed. Multifactorial dimensionality reduction was performed to determine epistatic interaction among the polymorphisms. The MiR-196a2 polymorphism revealed a significant inverse association with chronic periodontitis. Haplotype analysis of MiR-146a and MiR-196a2 polymorphisms revealed 13 different combinations, of which 5 were found to have an inverse association with chronic periodontitis. The present study has demonstrated a significant inverse association of MiR-196a2 polymorphism with chronic periodontitis.

  14. Gene-gene, gene-environment, gene-nutrient interactions and single nucleotide polymorphisms of inflammatory cytokines.

    PubMed

    Nadeem, Amina; Mumtaz, Sadaf; Naveed, Abdul Khaliq; Aslam, Muhammad; Siddiqui, Arif; Lodhi, Ghulam Mustafa; Ahmad, Tausif

    2015-05-15

    Inflammation plays a significant role in the etiology of type 2 diabetes mellitus (T2DM). The rise in the pro-inflammatory cytokines is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury, oxidative stress and beta cell apoptosis in T2DM. Among the recognized markers are interleukin (IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha (TNF-α), C-reactive protein, resistin, adiponectin, tissue plasminogen activator, fibrinogen and heptoglobins. Diabetes mellitus has firm genetic and very strong environmental influence; exhibiting a polygenic mode of inheritance. Many single nucleotide polymorphisms (SNPs) in various genes including those of pro and anti-inflammatory cytokines have been reported as a risk for T2DM. Not all the SNPs have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups. The inter-ethnic variations can be explained by the fact that gene expression may be regulated by gene-gene, gene-environment and gene-nutrient interactions. This review highlights the impact of these interactions on determining the role of single nucleotide polymorphism of IL-6, TNF-α, resistin and adiponectin in pathogenesis of T2DM.

  15. Allelic imbalance of multiple sclerosis susceptibility genes IKZF3 and IQGAP1 in human peripheral blood.

    PubMed

    Keshari, Pankaj K; Harbo, Hanne F; Myhr, Kjell-Morten; Aarseth, Jan H; Bos, Steffan D; Berge, Tone

    2016-04-14

    Multiple sclerosis is a chronic inflammatory, demyelinating disease of the central nervous system. Recent genome-wide studies have revealed more than 110 single nucleotide polymorphisms as associated with susceptibility to multiple sclerosis, but their functional contribution to disease development is mostly unknown. Consistent allelic imbalance was observed for rs907091 in IKZF3 and rs11609 in IQGAP1, which are in strong linkage disequilibrium with the multiple sclerosis associated single nucleotide polymorphisms rs12946510 and rs8042861, respectively. Using multiple sclerosis patients and healthy controls heterozygous for rs907091 and rs11609, we showed that the multiple sclerosis risk alleles at IKZF3 and IQGAP1 are expressed at higher levels as compared to the protective allele. Furthermore, individuals homozygous for the multiple sclerosis risk allele at IQGAP1 had a significantly higher total expression of IQGAP1 compared to individuals homozygous for the protective allele. Our data indicate a possible regulatory role for the multiple sclerosis-associated IKZF3 and IQGAP1 variants. We suggest that such cis-acting mechanisms may contribute to the multiple sclerosis association of single nucleotide polymorphisms at IKZF3 and IQGAP1.

  16. Sudden infant death syndrome (SIDS) and polymorphisms in Monoamine oxidase A gene (MAOA): a revisit.

    PubMed

    Groß, Maximilian; Bajanowski, Thomas; Vennemann, Mechtild; Poetsch, Micaela

    2014-01-01

    Literature describes multiple possible links between genetic variations in the neuroadrenergic system and the occurrence of sudden infant death syndrome. The X-chromosomal Monoamine oxidase A (MAOA) is one of the genes with regulatory activity in the noradrenergic and serotonergic neuronal systems and a polymorphism of the promoter which affects the activity of this gene has been proclaimed to contribute significantly to the prevalence of sudden infant death syndrome (SIDS) in three studies from 2009, 2012 and 2013. However, these studies described different significant correlations regarding gender or age of children. Since several studies, suggesting associations between genetic variations and SIDS, were disproved by follow-up analysis, this study was conducted to take a closer look at the MAOA gene and its polymorphisms. The functional MAOA promoter length polymorphism was investigated in 261 SIDS cases and 93 control subjects. Moreover, the allele distribution of 12 coding and non-coding single nucleotide polymorphisms (SNPs) of the MAOA gene was examined in 285 SIDS cases and 93 controls by a minisequencing technique. In contrast to prior studies with fewer individuals, no significant correlations between the occurrence of SIDS and the frequency of allele variants of the promoter polymorphism could be demonstrated, even including the results from the abovementioned previous studies. Regarding the SNPs, three statistically significant associations were observed which had not been described before. This study clearly disproves interactions between MAOA promoter polymorphisms and SIDS, even if variations in single nucleotide polymorphisms of MAOA should be subjected to further analysis to clarify their impact on SIDS.

  17. Genetic Factors Influencing Coagulation Factor XIII B-Subunit Contribute to Risk of Ischemic Stroke.

    PubMed

    Hanscombe, Ken B; Traylor, Matthew; Hysi, Pirro G; Bevan, Stephen; Dichgans, Martin; Rothwell, Peter M; Worrall, Bradford B; Seshadri, Sudha; Sudlow, Cathie; Williams, Frances M K; Markus, Hugh S; Lewis, Cathryn M

    2015-08-01

    Abnormal coagulation has been implicated in the pathogenesis of ischemic stroke, but how this association is mediated and whether it differs between ischemic stroke subtypes is unknown. We determined the shared genetic risk between 14 coagulation factors and ischemic stroke and its subtypes. Using genome-wide association study results for 14 coagulation factors from the population-based TwinsUK sample (N≈2000 for each factor), meta-analysis results from the METASTROKE consortium ischemic stroke genome-wide association study (12 389 cases, 62 004 controls), and genotype data for 9520 individuals from the WTCCC2 ischemic stroke study (3548 cases, 5972 controls-the largest METASTROKE subsample), we explored shared genetic risk for coagulation and stroke. We performed three analyses: (1) a test for excess concordance (or discordance) in single nucleotide polymorphism effect direction across coagulation and stroke, (2) an estimation of the joint effect of multiple coagulation-associated single nucleotide polymorphisms in stroke, and (3) an evaluation of common genetic risk between coagulation and stroke. One coagulation factor, factor XIII subunit B (FXIIIB), showed consistent effects in the concordance analysis, the estimation of polygenic risk, and the validation with genotype data, with associations specific to the cardioembolic stroke subtype. Effect directions for FXIIIB-associated single nucleotide polymorphisms were significantly discordant with cardioembolic disease (smallest P=5.7×10(-04)); the joint effect of FXIIIB-associated single nucleotide polymorphisms was significantly predictive of ischemic stroke (smallest P=1.8×10(-04)) and the cardioembolic subtype (smallest P=1.7×10(-04)). We found substantial negative genetic covariation between FXIIIB and ischemic stroke (rG=-0.71, P=0.01) and the cardioembolic subtype (rG=-0.80, P=0.03). Genetic markers associated with low FXIIIB levels increase risk of ischemic stroke cardioembolic subtype. © 2015 The Authors.

  18. The Single Nucleotide Polymorphism Consortium

    NASA Technical Reports Server (NTRS)

    Morgan, Michael

    2003-01-01

    I want to discuss both the Single Nucleotide Polymorphism (SNP) Consortium and the Human Genome Project. I am afraid most of my presentation will be thin on law and possibly too high on rhetoric. Having been engaged in a personal and direct way with these issues as a trained scientist, I find it quite difficult to be always as objective as I ought to be.

  19. Analysis of single nucleotide polymorphisms in case-control studies.

    PubMed

    Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer

    2011-01-01

    Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.

  20. A lateral flow biosensor for detection of single nucleotide polymorphism by circular strand displacement reaction.

    PubMed

    Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen

    2012-09-04

    A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.

  1. A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms

    ERIC Educational Resources Information Center

    Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.

    2016-01-01

    The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…

  2. The effects of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene on meat tenderness of yak.

    USDA-ARS?s Scientific Manuscript database

    The association of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene with shear force of 2.54 cm steaks from M. longissimus dorsi from Gannan yaks (Bos grunniens, n=181) was studied. Yaks were harvested at 2, 3, and 4 yr of age (n=51, 59, and 71, respectively), and samples of each ya...

  3. Microarray study of single nucleotide polymorphisms and expression of ATP-binding cassette genes in breast tumors

    NASA Astrophysics Data System (ADS)

    Tsyganov, M. M.; Ibragimova, M. K.; Karabut, I. V.; Freydin, M. B.; Choinzonov, E. L.; Litvyakov, N. V.

    2015-11-01

    Our previous research establishes that changes of expression of the ATP-binding cassette genes family is connected with the neoadjuvant chemotherapy effect. However, the mechanism of regulation of resistance gene expression remains unclear. As many researchers believe, single nucleotide polymorphisms can be involved in this process. Thereupon, microarray analysis is used to study polymorphisms in ATP-binding cassette genes. It is thus found that MDR gene expression is connected with 5 polymorphisms, i.e. rs241432, rs241429, rs241430, rs3784867, rs59409230, which participate in the regulation of expression of own genes.

  4. [Correlation analysis between single nucleotide polymorphism of FGF5 gene and wool yield in rabbits].

    PubMed

    Li, Chun-Xiao; Jiang, Mei-Shan; Chen, Shi-Yi; Lai, Song-Jia

    2008-07-01

    Single nucleotide polymorphism (SNP) in exon 1 and 3 of fibroblast growth factor (FGF5) gene was studied by DNA sequencing in Yingjing angora rabbit, Tianfu black rabbit and California rabbit. A frameshift mutation (TCT insert) at base position 217 (site A) of exon 1 and a T/C missense mutation at base position 59 (site B) of exon 3 were found in Yingjing angora rabbit with a high frequency; a T/C same-sense mutation at base position 3 (site C) of exon 3 was found with similar frequency in three rabbit breeds. Least square analysis showed that different genotypes had no significant association with wool yield in site A, and had high significant association with wool yield in site B (P<0.01) and significant association with wool yield in site C (P<0.05). It was concluded from the results that FGF5 gene could be the potential major gene affecting wool yield or link with the major gene, and polymorphic loci B and C may be used as molecular markers for im-proving wool yield in angora rabbits.

  5. Genetic Variants of TPCN2 Associated with Type 2 Diabetes Risk in the Chinese Population

    PubMed Central

    Zhang, Yu; Fan, Xiaofang; Zhang, Ning; Zheng, Hui; Song, Yuping; Shen, Chunfang; Shen, Jiayi; Ren, Fengdong; Yang, Jialin

    2016-01-01

    Objective The aim of this study was to determine whether TPCN2 genetic variants are associated with type 2 diabetes and to elucidate which variants in TPCN2 confer diabetes susceptibility in the Chinese population. Research Design and Methods The sample population included 384 patients with type 2 diabetes and 1468 controls. Anthropometric parameters, glycemic and lipid profiles and insulin resistance were measured. We selected 6 TPCN2 tag single nucleotide polymorphisms (rs35264875, rs267603153, rs267603154, rs3829241, rs1551305, and rs3750965). Genotypes were determined using a Sequenom MassARRAY SNP genotyping system. Results Ultimately, we genotyped 3 single nucleotide polymorphisms (rs3750965, rs3829241, and rs1551305) in all individuals. There was a 5.1% higher prevalence of the rs1551305 variant allele in type 2 diabetes individuals (A) compared with wild-type homozygous individuals (G). The AA genotype of rs1551305 was associated with a higher diabetes risk (p<0.05). The distributions of rs3829241 and rs3750965 polymorphisms were not significantly different between the two groups. HOMA-%B of subjects harboring the AA genotype of rs1551305 decreased by 14.87% relative to the GG genotype. Conclusions TPCN2 plays a role in metabolic regulation, and the rs1551305 single nucleotide polymorphism is associated with type 2 diabetes risk. Future work will begin to unravel the underlying mechanisms. PMID:26918892

  6. Demonstration of Protein-Based Human Identification Using the Hair Shaft Proteome

    PubMed Central

    Leppert, Tami; Anex, Deon S.; Hilmer, Jonathan K.; Matsunami, Nori; Baird, Lisa; Stevens, Jeffery; Parsawar, Krishna; Durbin-Johnson, Blythe P.; Rocke, David M.; Nelson, Chad; Fairbanks, Daniel J.; Wilson, Andrew S.; Rice, Robert H.; Woodward, Scott R.; Bothner, Brian; Hart, Bradley R.; Leppert, Mark

    2016-01-01

    Human identification from biological material is largely dependent on the ability to characterize genetic polymorphisms in DNA. Unfortunately, DNA can degrade in the environment, sometimes below the level at which it can be amplified by PCR. Protein however is chemically more robust than DNA and can persist for longer periods. Protein also contains genetic variation in the form of single amino acid polymorphisms. These can be used to infer the status of non-synonymous single nucleotide polymorphism alleles. To demonstrate this, we used mass spectrometry-based shotgun proteomics to characterize hair shaft proteins in 66 European-American subjects. A total of 596 single nucleotide polymorphism alleles were correctly imputed in 32 loci from 22 genes of subjects’ DNA and directly validated using Sanger sequencing. Estimates of the probability of resulting individual non-synonymous single nucleotide polymorphism allelic profiles in the European population, using the product rule, resulted in a maximum power of discrimination of 1 in 12,500. Imputed non-synonymous single nucleotide polymorphism profiles from European–American subjects were considerably less frequent in the African population (maximum likelihood ratio = 11,000). The converse was true for hair shafts collected from an additional 10 subjects with African ancestry, where some profiles were more frequent in the African population. Genetically variant peptides were also identified in hair shaft datasets from six archaeological skeletal remains (up to 260 years old). This study demonstrates that quantifiable measures of identity discrimination and biogeographic background can be obtained from detecting genetically variant peptides in hair shaft protein, including hair from bioarchaeological contexts. PMID:27603779

  7. A Polymorphism in the Retinol Binding Protein 4 Gene is Not Associated with Gestational Diabetes Mellitus in Several Different Ethnic Groups

    PubMed Central

    Urschitz, Johann; Sultan, Omar; Ward, Kenneth

    2011-01-01

    Objective Various Asian and Pacifific Islander groups have higher prevalence rates of type 2 diabetes and gestational diabetes. This increased incidence is likely to include genetic factors. Single nucleotide polymorphisms in the retinol binding protein 4 gene have been linked to the occurrence of type 2 diabetes. Hypothesizing a link between retinol binding protein 4 and gestational diabetes, we performed a candidate gene study to look for an association between an important retinol binding protein gene polymorphism (rs3758539) and gestational diabetes. Study Design Blood was collected from Caucasian, Asian, and Pacific Islander women diagnosed with gestational diabetes and from ethnically matched non-diabetic controls. DNA was extracted and real time PCR technology (TaqMan, Applied Biosystems) used to screen for the rs3758539 single nucleotide polymorphism located 5′ of exon 1 of the retinol binding protein 4 gene. Results Genotype and allele frequencies in the controls and gestational diabetes cases were tested using chi-square contingency tests. Genotype frequencies were in Hardy-Weinberg equilibrium. There was no association between the rs3758539 retinol binding protein 4 single nucleotide polymorphism and gestational diabetes in the Caucasian, Filipino, or Pacific Islander groups. Conclusion Interestingly, the rs3758539 retinol binding protein 4 single nucleotide polymorphism was not found to be associated with gestational diabetes. The absence of association suggests that gestational and type 2 diabetes may have more divergent molecular pathophysiology than previously suspected. PMID:21886308

  8. Brief Report: Glutamate Transporter Gene ("SLC1A1") Single Nucleotide Polymorphism (rs301430) and Repetitive Behaviors and Anxiety in Children with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Gadow, Kenneth D.; Roohi, Jasmin; DeVincent, Carla J.; Kirsch, Sarah; Hatchwell, Eli

    2010-01-01

    Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene ("SLC1A1") with severity of repetitive behaviors (obsessive-compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children…

  9. Effect of increasing the number of single-nucleotide polymorphisms from 60,000 to 85,000 in genomic evaluation of Holsteins

    USDA-ARS?s Scientific Manuscript database

    The periodic need to restock reagent pools for genotyping chips provides an opportunity to increase the number of single-nucleotide polymorphisms (SNP) on a chip at no increase in cost. A high-density chip with >140,000 SNP has been developed by GeneSeek Inc. (Lincoln, NE) to increase accuracy of ge...

  10. Development of single-nucleotide polymorphism markers for Bromus tectorum (Poaceae) from a partially sequenced transcriptome

    Treesearch

    Keith R. Merrill; Craig E. Coleman; Susan E. Meyer; Elizabeth A. Leger; Katherine A. Collins

    2016-01-01

    Premise of the study: Bromus tectorum (Poaceae) is an annual grass species that is invasive in many areas of the world but most especially in the U.S. Intermountain West. Single-nucleotide polymorphism (SNP) markers were developed for use in investigating the geospatial and ecological diversity of B. tectorum in the Intermountain West to better understand the...

  11. A Comprehensive Experiment for Molecular Biology: Determination of Single Nucleotide Polymorphism in Human REV3 Gene Using PCR-RFLP

    ERIC Educational Resources Information Center

    Zhang, Xu; Shao, Meng; Gao, Lu; Zhao, Yuanyuan; Sun, Zixuan; Zhou, Liping; Yan, Yongmin; Shao, Qixiang; Xu, Wenrong; Qian, Hui

    2017-01-01

    Laboratory exercise is helpful for medical students to understand the basic principles of molecular biology and to learn about the practical applications of molecular biology. We have designed a lab course on molecular biology about the determination of single nucleotide polymorphism (SNP) in human REV3 gene, the product of which is a subunit of…

  12. Antibiotic Resistance and Single-Nucleotide Polymorphism Cluster Grouping Type in a Multinational Sample of Resistant Mycobacterium tuberculosis Isolates▿

    PubMed Central

    Brimacombe, M.; Hazbon, M.; Motiwala, A. S.; Alland, D.

    2007-01-01

    A single-nucleotide polymorphism-based cluster grouping (SCG) classification system for Mycobacterium tuberculosis was used to examine antibiotic resistance type and resistance mutations in relationship to specific evolutionary lineages. Drug resistance and resistance mutations were seen across all SCGs. SCG-2 had higher proportions of katG codon 315 mutations and resistance to four drugs. PMID:17846140

  13. Association between methylenetetrahydrofolate reductase polymorphism C677T and risk of chronic myeloid leukemia in Serbian population.

    PubMed

    Jakovljevic, Ksenija; Malisic, Emina; Cavic, Milena; Radulovic, Sinisa; Jankovic, Radmila

    2012-07-01

    Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme regulating the intracellular folate metabolism which plays an important role in carcinogenesis through DNA methylation and nucleotide synthesis. The common MTHFR single nucleotide polymorphism C677T has been reported to be associated with reduced enzymatic activity. In order to investigate the influence of this polymorphism on the risk of chronic myeloid leukemia (CML), we performed a case-control study in a Serbian population of 52 patients with CML and 53 healthy control subjects. MTHFR C677T polymorphism genotyping was assessed using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. The results demonstrated no statistical difference in MTHFR 677 frequency distribution between patient and control groups. Our findings suggest that MTHFR 677 gene variants have no significant influence on the susceptibility to CML in a Serbian population.

  14. Identification of single nucleotide polymorphisms in the ASB15 gene and their associations with chicken growth and carcass traits.

    PubMed

    Wang, Y C; Jiang, R R; Kang, X T; Li, Z J; Han, R L; Geng, J; Fu, J X; Wang, J F; Wu, J P

    2015-09-25

    ASB15 is a member of the ankyrin repeat and suppressor of cytokine signaling box family, and is predominantly expressed in skeletal muscle. In the present study, an F2 resource population of Gushi chickens crossed with Anka broilers was used to investigate the genetic effects of the chicken ASB15 gene. Two single nucleotide polymorphisms (SNPs) (rs315759231 A>G and rs312619270 T>C) were identified in exon 7 of the ASB15 gene using forced chain reaction-restriction fragment length polymorphism and DNA sequencing. One was a missense SNP (rs315759231 A>G) and the other was a synonymous SNP (rs312619270 T>C). The rs315759231 A>G polymorphism was significantly associated with body weight at birth, 12-week body slanting length, semi-evisceration weight, evisceration weight, leg muscle weight, and carcass weight (P < 0.05). The rs312619270 T>C polymorphism was significantly associated with body weight at birth, 4, 8, and 12-week body weight, 8-week shank length, 12-week breast bone length, 8 and 12-week body slanting length, breast muscle weight, and carcass weight (P < 0.05). Our results suggest that the ASB15 gene profoundly affects chicken growth and carcass traits.

  15. Inherited variations in the SOD and GPX gene families and cancer risk.

    PubMed

    Yuzhalin, Arseniy E; Kutikhin, Anton G

    2012-05-01

    Antioxidant defence enzymes are essential protectors of living organisms against oxidative stress. These enzymes are involved in the detoxification and decomposition of harmful chemical compounds called reactive oxygen species (ROS), which are, first and foremost, a source of intracellular oxidative stress. ROS directly promote the oxidative damage of genes resulting in aberrant regulation of many vital cell processes. As a consequence, the presence of ROS can lead to genomic instability, deregulation of transcription, induction of mitogenic signal transduction pathways and replication errors, all of which may increase the risk of cancer development. Single nucleotide polymorphisms of antioxidant defence genes may significantly modify the functional activity of the encoded proteins; therefore, certain alleles can be established as risk factors for particular cancer types. In the future, these risk alleles may be utilized as genomic markers of cancer predisposition to allow for early prevention measures among carriers of these alleles. The review is devoted to common single nucleotide polymorphisms of the superoxide dismutase (SOD) and glutathione peroxidase (GPX) gene families and their impact on carcinogenesis. The predictive significance of several polymorphisms was determined, and these polymorphisms were recommended for further in-depth research.

  16. [Relationship of Ghrelin gene polymorphism with congenital anorectal malformation and Hirschsprung disease].

    PubMed

    Gao, Hong; Wang, Dajia; Zhao, Xiangxuan; Mi, Jie; Bai, Yuzuo; Wang, Weilin

    2015-07-01

    To explore the relationship of Ghrelin gene polymorphism with the occurrence of human anorectal malformations (ARMs) and Hirschsprung disease(HSCR). PCR and DNA sequencing were used to detect the single nucleotide polymorphism (SNPs) of 3 loci (rs139684563, rs149447194, rs186599567) genotype of Ghrelin gene in 100 children with ARMs, 100 children with HSCR, and 100 healthy children (normal group). Genovariation and gene mutation were analyzed with case-control method. Three loci SNPs were in accordance with Hardy-Weinberg genetic equilibrium. No significant differences were found in rs139684563 allele and genotype frequencies between the cases and the normal groups (P>0.05). The allele and genotype frequencies of rs149447194 and rs186599567 were significantly different between cases and normal group (P<0.05). DNA sequencing results showed that wild-type homozygous deletion (176th and 191th base A deletion, respectively) were found in rs149447194 and rs186599567of ARMs and HSCR children, and single base substitution was detected in rs149447194 of ARMs children (194th codon nucleotide CCT to CTC). The rs149447194 and the rs186599567 polymorphism changes may be associated with the pathogenesis of ARMs and HSCR.

  17. Genomic diversity of the human intestinal parasite Entamoeba histolytica

    PubMed Central

    2012-01-01

    Background Entamoeba histolytica is a significant cause of disease worldwide. However, little is known about the genetic diversity of the parasite. We re-sequenced the genomes of ten laboratory cultured lines of the eukaryotic pathogen Entamoeba histolytica in order to develop a picture of genetic diversity across the genome. Results The extreme nucleotide composition bias and repetitiveness of the E. histolytica genome provide a challenge for short-read mapping, yet we were able to define putative single nucleotide polymorphisms in a large portion of the genome. The results suggest a rather low level of single nucleotide diversity, although genes and gene families with putative roles in virulence are among the more polymorphic genes. We did observe large differences in coverage depth among genes, indicating differences in gene copy number between genomes. We found evidence indicating that recombination has occurred in the history of the sequenced genomes, suggesting that E. histolytica may reproduce sexually. Conclusions E. histolytica displays a relatively low level of nucleotide diversity across its genome. However, large differences in gene family content and gene copy number are seen among the sequenced genomes. The pattern of polymorphism indicates that E. histolytica reproduces sexually, or has done so in the past, which has previously been suggested but not proven. PMID:22630046

  18. The allele frequency of two single nucleotide polymorphisms in the von Hippel-Lindau (VHL) tumor suppressor gene in the Taiwanese population.

    PubMed

    Wang, Wen-Chung; Chen, Hui-Ju; Shu, Wei-Pang; Tsai, Yi-Chang; Lai, Yen-Chein

    2011-10-01

    The von Hippel-Lindau (VHL) tumor suppressor gene located on chromosome 3p25-26 is implicated in VHL disease. Two informative single nucleotide polymorphisms are at positions 19 and 1149 on the nucleotide sequence from Gene Bank NM_000551. In this study we examined the allele frequencies at these two loci in the Taiwanese population and compared the results to those from European ethnic populations. The allele frequency was examined in 616 healthy individuals including 301 university students and 315 neonates. Both A/G polymorphisms were investigated using restriction fragment length polymorphism analysis created by restriction enzymes, BsaJ I and Acc I. Among these subjects, the allele frequencies at 19 SNP and 1149 SNP for variant G were 0.130 and 0.133, respectively. And these results were significant differences from those of the Caucasian populations. In addition, 90% of the tested subjects had identical genotypes at these two loci suggesting the existence of nonrandom association of alleles. We found that the G allele frequency at these two loci in the Taiwanese population is much lower than that in people from Western countries. This phenomenon may be attributed to ethnic effects. Copyright © 2011. Published by Elsevier B.V.

  19. Rhabdomyolysis After Out-of-Water Exercise in an Elite Adolescent Water Polo Player Carrying the IL-6 174C Allele Single-Nucleotide Polymorphism.

    PubMed

    Eliakim, Alon; Ben Zaken, Sigal; Meckel, Yoav; Yamin, Chen; Dror, Nitzan; Nemet, Dan

    2015-12-01

    We present an adolescent elite water polo player who despite a genetic predisposition to develop exercise-induced severe muscle damage due to carrying the IL-6 174C allele single-nucleotide polymorphism, developed acute rhabdomyolysis only after a vigorous out-of-water training, suggesting that water polo training may be more suitable for genetically predisposed athletes.

  20. Genetic variants associated with the root system architecture of oilseed rape (Brassica napus L.) under contrasting phosphate supply.

    PubMed

    Wang, Xiaohua; Chen, Yanling; Thomas, Catherine L; Ding, Guangda; Xu, Ping; Shi, Dexu; Grandke, Fabian; Jin, Kemo; Cai, Hongmei; Xu, Fangsen; Yi, Bin; Broadley, Martin R; Shi, Lei

    2017-08-01

    Breeding crops with ideal root system architecture for efficient absorption of phosphorus is an important strategy to reduce the use of phosphate fertilizers. To investigate genetic variants leading to changes in root system architecture, 405 oilseed rape cultivars were genotyped with a 60K Brassica Infinium SNP array in low and high P environments. A total of 285 single-nucleotide polymorphisms were associated with root system architecture traits at varying phosphorus levels. Nine single-nucleotide polymorphisms corroborate a previous linkage analysis of root system architecture quantitative trait loci in the BnaTNDH population. One peak single-nucleotide polymorphism region on A3 was associated with all root system architecture traits and co-localized with a quantitative trait locus for primary root length at low phosphorus. Two more single-nucleotide polymorphism peaks on A5 for root dry weight at low phosphorus were detected in both growth systems and co-localized with a quantitative trait locus for the same trait. The candidate genes identified on A3 form a haplotype 'BnA3Hap', that will be important for understanding the phosphorus/root system interaction and for the incorporation into Brassica napus breeding programs. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  1. Single-nucleotide polymorphisms and mRNA expression for melatonin synthesis rate-limiting enzyme in recurrent depressive disorder.

    PubMed

    Gałecki, Piotr; Szemraj, Janusz; Bartosz, Grzegorz; Bieńkiewicz, Małgorzata; Gałecka, Elzbieta; Florkowski, Antoni; Lewiński, Andrzej; Karbownik-Lewińska, Małgorzata

    2010-05-01

    Depressive disorder (DD) is characterised by disturbances in blood melatonin concentration. It is well known that melatonin is involved in the control of circadian rhythms, sleep included. The use of melatonin and its analogues has been found to be effective in depression therapy. Melatonin synthesis is a multistage process, where the last stage is catalysed by acetylserotonin methyltransferase (ASMT), the reported rate-limiting melatonin synthesis enzyme. Taking into account the significance of genetic factors in depression development, the gene for ASMT may become an interesting focus for studies in patients with recurrent DD. The goal of the study was to evaluate two single-nucleotide polymorphisms (SNPs) (rs4446909; rs5989681) of the ASMT gene, as well as mRNA expression for ASMT in recurrent DD-affected patients. We genotyped two polymorphisms in a group of 181 recurrent DD patients and in 149 control subjects. The study was performed using the polymerase chain reaction/restriction fragment length polymorphism method. The distribution of genotypes in both studied SNPs in the ASMT gene differed significantly between DD and healthy subjects. The presence of AA genotype of rs4446909 polymorphism and of GG genotype of rs5989681 polymorphism was associated with lower risk for having recurrent DD. In turn, patients with depression were characterised by reduced mRNA expression for ASMT. In addition, ASMT transcript level in both recurrent DD patients and in healthy subjects depended significantly on genotype distributions in both polymorphisms. In conclusion, our results suggest the ASMT gene as a susceptibility gene for recurrent DD.

  2. Effects of the BDNF Val66Met Polymorphism on Anxiety-Like Behavior Following Nicotine Withdrawal in Mice.

    PubMed

    Lee, Bridgin G; Anastasia, Agustin; Hempstead, Barbara L; Lee, Francis S; Blendy, Julie A

    2015-12-01

    Nicotine withdrawal is characterized by both affective and cognitive symptoms. Identifying genetic polymorphisms that could affect the symptoms associated with nicotine withdrawal are important in predicting withdrawal sensitivity and identifying personalized cessation therapies. In the current study we used a mouse model of a non-synonymous single nucleotide polymorphism in the translated region of the brain-derived neurotrophic factor (BDNF) gene that substitutes a valine (Val) for a methionine (Met) amino acid (Val66Met) to examine the relationship between the Val66Met single nucleotide polymorphism and nicotine dependence. This study measured proBDNF and the BDNF prodomain levels following nicotine and nicotine withdrawal and examined a mouse model of a common polymorphism in this protein (BDNF(Met/Met)) in three behavioral paradigms: novelty-induced hypophagia, marble burying, and the open-field test. Using the BDNF knock-in mouse containing the BDNF Val66Met polymorphism we found: (1) blunted anxiety-like behavior in BDNF(Met/Met) mice following withdrawal in three behavioral paradigms: novelty-induced hypophagia, marble burying, and the open-field test; (2) the anxiolytic effects of chronic nicotine are absent in BDNF(Met/Met) mice; and (3) an increase in BDNF prodomain in BDNF(Met/Met) mice following nicotine withdrawal. Our study is the first to examine the effect of the BDNF Val66Met polymorphism on the affective symptoms of withdrawal from nicotine in mice. In these mice, a single-nucleotide polymorphism in the translated region of the BDNF gene can result in a blunted withdrawal, as measured by decreased anxiety-like behavior. The significant increase in the BDNF prodomain in BDNF(Met/Met) mice following nicotine cessation suggests a possible role of this ligand in the circuitry remodeling after withdrawal. © The Author 2015. Published by Oxford University Press on behalf of the Society for Research on Nicotine and Tobacco. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  3. Polycystic ovary syndrome: association of a C/T single nucleotide polymorphism at tyrosine kinase domain of insulin receptor gene with pathogenesis among lean Japanese women.

    PubMed

    Kashima, Katsunori; Yahata, Tetsuro; Fujita, Kazuyuki; Tanaka, Kenichi

    2013-01-01

    To assess whether the insulin receptor (INSR) gene contributes to genetic susceptibility to polycystic ovary syndrome (PCOS) in a Japanese population. We ex-amined the frequency of the His 1058 C/T single nucleotide polymorphism (SNP) found in exon 17 of the INSR gene in 61 Japanese PCOS patients and 99 Japanese healthy controls. In addition, we analyzed the association between the genotype of this SNP and the clinical phenotypes. The frequency of the C/C genotype was not significantly different between all PCOS patients (47.5%) and controls (35.4%). However, among the lean cases (body mass index < or = 20 kg/m2) the frequency of the C/C genotype was significantly increased (p < 0.05) in PCOS patients (65.0%) as compared with controls (36.6%). We concluded that the His 1058 C/T polymorphism at the tyrosine kinase domain of the INSR gene had a relationship to the pathogenesis of lean PCOS patients in a Japanese population.

  4. Genetic polymorphisms and the risk of stroke after cardiac surgery.

    PubMed

    Grocott, Hilary P; White, William D; Morris, Richard W; Podgoreanu, Mihai V; Mathew, Joseph P; Nielsen, Dahlia M; Schwinn, Debra A; Newman, Mark F

    2005-09-01

    Stroke represents a significant cause of morbidity and mortality after cardiac surgery. Although the risk of stroke varies according to both patient and procedural factors, the impact of genetic variants on stroke risk is not well understood. Therefore, we tested the hypothesis that specific genetic polymorphisms are associated with an increased risk of stroke after cardiac surgery. Patients undergoing cardiac surgery utilizing cardiopulmonary bypass surgery were studied. DNA was isolated from preoperative blood and analyzed for 26 different single-nucleotide polymorphisms. Multivariable logistic regression modeling was used to determine the association of clinical and genetic characteristics with stroke. Permutation analysis was used to adjust for multiple comparisons inherent in genetic association studies. A total of 1635 patients experiencing 28 strokes (1.7%) were included in the final genetic model. The combination of the 2 minor alleles of C-reactive protein (CRP; 3'UTR 1846C/T) and interleukin-6 (IL-6; -174G/C) polymorphisms, occurring in 583 (35.7%) patients, was significantly associated with stroke (odds ratio, 3.3; 95% CI, 1.4 to 8.1; P=0.0023). In a multivariable logistic model adjusting for age, the CRP and IL-6 single-nucleotide polymorphism combination remained significantly associated with stroke (P=0.0020). We demonstrate that common genetic variants of CRP (3'UTR 1846C/T) and IL-6 (-174G/C) are significantly associated with the risk of stroke after cardiac surgery, suggesting a pivotal role of inflammation in post-cardiac surgery stroke.

  5. Brief Report: Glutamate Transporter Gene (SLC1A1) Single Nucleotide Polymorphism (rs301430) and Repetitive Behaviors and Anxiety in Children with Autism Spectrum Disorder

    PubMed Central

    Gadow, Kenneth D.; Roohi, Jasmin; DeVincent, Carla J.; Kirsch, Sarah; Hatchwell, Eli

    2015-01-01

    Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene (SLC1A1) with severity of repetitive behaviors (obsessive–compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children with autism spectrum disorder. Although analyses were not significant for repetitive behaviors, youths homozygous for the high expressing C allele had more severe anxiety than carriers of the T allele. Allelic variation in SLC1A1 may be a biomarker for or modifier of anxiety symptom severity in children with ASD, but study findings are best conceptualized as tentative pending replication with larger independent samples. PMID:20155310

  6. Glutamate transporter gene (SLC1A1) single nucleotide polymorphism (rs301430) and repetitive behaviors and anxiety in children with autism spectrum disorder.

    PubMed

    Gadow, Kenneth D; Roohi, Jasmin; DeVincent, Carla J; Kirsch, Sarah; Hatchwell, Eli

    2010-09-01

    Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene (SLC1A1) with severity of repetitive behaviors (obsessive-compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children with autism spectrum disorder. Although analyses were not significant for repetitive behaviors, youths homozygous for the high expressing C allele had more severe anxiety than carriers of the T allele. Allelic variation in SLC1A1 may be a biomarker for or modifier of anxiety symptom severity in children with ASD, but study findings are best conceptualized as tentative pending replication with larger independent samples.

  7. Large meta-analysis of genome-wide association studies identifies five loci for lean body mass.

    PubMed

    Zillikens, M Carola; Demissie, Serkalem; Hsu, Yi-Hsiang; Yerges-Armstrong, Laura M; Chou, Wen-Chi; Stolk, Lisette; Livshits, Gregory; Broer, Linda; Johnson, Toby; Koller, Daniel L; Kutalik, Zoltán; Luan, Jian'an; Malkin, Ida; Ried, Janina S; Smith, Albert V; Thorleifsson, Gudmar; Vandenput, Liesbeth; Hua Zhao, Jing; Zhang, Weihua; Aghdassi, Ali; Åkesson, Kristina; Amin, Najaf; Baier, Leslie J; Barroso, Inês; Bennett, David A; Bertram, Lars; Biffar, Rainer; Bochud, Murielle; Boehnke, Michael; Borecki, Ingrid B; Buchman, Aron S; Byberg, Liisa; Campbell, Harry; Campos Obanda, Natalia; Cauley, Jane A; Cawthon, Peggy M; Cederberg, Henna; Chen, Zhao; Cho, Nam H; Jin Choi, Hyung; Claussnitzer, Melina; Collins, Francis; Cummings, Steven R; De Jager, Philip L; Demuth, Ilja; Dhonukshe-Rutten, Rosalie A M; Diatchenko, Luda; Eiriksdottir, Gudny; Enneman, Anke W; Erdos, Mike; Eriksson, Johan G; Eriksson, Joel; Estrada, Karol; Evans, Daniel S; Feitosa, Mary F; Fu, Mao; Garcia, Melissa; Gieger, Christian; Girke, Thomas; Glazer, Nicole L; Grallert, Harald; Grewal, Jagvir; Han, Bok-Ghee; Hanson, Robert L; Hayward, Caroline; Hofman, Albert; Hoffman, Eric P; Homuth, Georg; Hsueh, Wen-Chi; Hubal, Monica J; Hubbard, Alan; Huffman, Kim M; Husted, Lise B; Illig, Thomas; Ingelsson, Erik; Ittermann, Till; Jansson, John-Olov; Jordan, Joanne M; Jula, Antti; Karlsson, Magnus; Khaw, Kay-Tee; Kilpeläinen, Tuomas O; Klopp, Norman; Kloth, Jacqueline S L; Koistinen, Heikki A; Kraus, William E; Kritchevsky, Stephen; Kuulasmaa, Teemu; Kuusisto, Johanna; Laakso, Markku; Lahti, Jari; Lang, Thomas; Langdahl, Bente L; Launer, Lenore J; Lee, Jong-Young; Lerch, Markus M; Lewis, Joshua R; Lind, Lars; Lindgren, Cecilia; Liu, Yongmei; Liu, Tian; Liu, Youfang; Ljunggren, Östen; Lorentzon, Mattias; Luben, Robert N; Maixner, William; McGuigan, Fiona E; Medina-Gomez, Carolina; Meitinger, Thomas; Melhus, Håkan; Mellström, Dan; Melov, Simon; Michaëlsson, Karl; Mitchell, Braxton D; Morris, Andrew P; Mosekilde, Leif; Newman, Anne; Nielson, Carrie M; O'Connell, Jeffrey R; Oostra, Ben A; Orwoll, Eric S; Palotie, Aarno; Parker, Stephen C J; Peacock, Munro; Perola, Markus; Peters, Annette; Polasek, Ozren; Prince, Richard L; Räikkönen, Katri; Ralston, Stuart H; Ripatti, Samuli; Robbins, John A; Rotter, Jerome I; Rudan, Igor; Salomaa, Veikko; Satterfield, Suzanne; Schadt, Eric E; Schipf, Sabine; Scott, Laura; Sehmi, Joban; Shen, Jian; Soo Shin, Chan; Sigurdsson, Gunnar; Smith, Shad; Soranzo, Nicole; Stančáková, Alena; Steinhagen-Thiessen, Elisabeth; Streeten, Elizabeth A; Styrkarsdottir, Unnur; Swart, Karin M A; Tan, Sian-Tsung; Tarnopolsky, Mark A; Thompson, Patricia; Thomson, Cynthia A; Thorsteinsdottir, Unnur; Tikkanen, Emmi; Tranah, Gregory J; Tuomilehto, Jaakko; van Schoor, Natasja M; Verma, Arjun; Vollenweider, Peter; Völzke, Henry; Wactawski-Wende, Jean; Walker, Mark; Weedon, Michael N; Welch, Ryan; Wichmann, H-Erich; Widen, Elisabeth; Williams, Frances M K; Wilson, James F; Wright, Nicole C; Xie, Weijia; Yu, Lei; Zhou, Yanhua; Chambers, John C; Döring, Angela; van Duijn, Cornelia M; Econs, Michael J; Gudnason, Vilmundur; Kooner, Jaspal S; Psaty, Bruce M; Spector, Timothy D; Stefansson, Kari; Rivadeneira, Fernando; Uitterlinden, André G; Wareham, Nicholas J; Ossowski, Vicky; Waterworth, Dawn; Loos, Ruth J F; Karasik, David; Harris, Tamara B; Ohlsson, Claes; Kiel, Douglas P

    2017-07-19

    Lean body mass, consisting mostly of skeletal muscle, is important for healthy aging. We performed a genome-wide association study for whole body (20 cohorts of European ancestry with n = 38,292) and appendicular (arms and legs) lean body mass (n = 28,330) measured using dual energy X-ray absorptiometry or bioelectrical impedance analysis, adjusted for sex, age, height, and fat mass. Twenty-one single-nucleotide polymorphisms were significantly associated with lean body mass either genome wide (p < 5 × 10 -8 ) or suggestively genome wide (p < 2.3 × 10 -6 ). Replication in 63,475 (47,227 of European ancestry) individuals from 33 cohorts for whole body lean body mass and in 45,090 (42,360 of European ancestry) subjects from 25 cohorts for appendicular lean body mass was successful for five single-nucleotide polymorphisms in/near HSD17B11, VCAN, ADAMTSL3, IRS1, and FTO for total lean body mass and for three single-nucleotide polymorphisms in/near VCAN, ADAMTSL3, and IRS1 for appendicular lean body mass. Our findings provide new insight into the genetics of lean body mass.Lean body mass is a highly heritable trait and is associated with various health conditions. Here, Kiel and colleagues perform a meta-analysis of genome-wide association studies for whole body lean body mass and find five novel genetic loci to be significantly associated.

  8. Polymorphism in the GALNT1 Gene and Epithelial Ovarian Cancer in Non-Hispanic White Women: The Ovarian Cancer Association Consortium

    PubMed Central

    Phelan, Catherine M.; Tsai, Ya-Yu; Goode, Ellen L.; Vierkant, Robert A.; Fridley, Brooke L.; Beesley, Jonathan; Chen, Xiao Qing; Webb, Penelope M.; Chanock, Stephen; Cramer, Daniel W.; Moysich, Kirsten; Edwards, Robert P.; Chang-Claude, Jenny; Garcia-Closas, Montserrat; Yang, Hannah; Wang-Gohrke, Shan; Hein, Rebecca; Green, Adele C.; Lissowska, Jolanta; Carney, Michael E.; Lurie, Galina; Wilkens, Lynne R.; Ness, Roberta B.; Pearce, Celeste Leigh; Wu, Anna H.; Van Den Berg, David J.; Stram, Daniel O.; Terry, Kathryn L.; Whiteman, David C.; Whittemore, Alice S.; DiCioccio, Richard A.; McGuire, Valerie; Doherty, Jennifer A.; Rossing, Mary Anne; Anton-Culver, Hoda; Ziogas, Argyrios; Hogdall, Claus; Hogdall, Estrid; Kjaer, Susanne Krüger; Blaakaer, Jan; Quaye, Lydia; Ramus, Susan J.; Jacobs, Ian; Song, Honglin; Pharoah, Paul D.P.; Iversen, Edwin S.; Marks, Jeffrey R.; Pike, Malcolm C.; Gayther, Simon A.; Cunningham, Julie M.; Goodman, Marc T.; Schildkraut, Joellen M.; Chenevix-Trench, Georgia; Berchuck, Andrew; Sellers, Thomas A.

    2010-01-01

    Aberrant glycosylation is a well-described hallmark of cancer. In a previous ovarian cancer case control study that examined polymorphisms in 26 glycosylation-associated genes, we found strong statistical evidence (P = 0.00017) that women who inherited two copies of a single-nucleotide polymorphism in the UDP-N-acetylgalactosamine:polypeptide N-acetylgalactosaminyltransferase, GALNT1, had decreased ovarian cancer risk. The current study attempted to replicate this observation. The GALNT1 single-nucleotide polymorphism rs17647532 was genotyped in 6,965 cases and 8,377 controls from 14 studies forming the Ovarian Cancer Association Consortium. The fixed effects estimate per rs17647532 allele was null (odds ratio, 0.99; 95% confidence interval, 0.92–1.07). When a recessive model was fit, the results were unchanged. Test for hetero geneity of the odds ratios revealed consistency across the 14 replication sites but significant differences compared with the original study population (P = 0.03). This study underscores the need for replication of putative findings in genetic association studies. PMID:20142253

  9. Effect of functionally significant deiodinase single nucleotide polymorphisms on drinking behavior in alcohol dependence: an exploratory investigation

    PubMed Central

    Lee, MR; Schwandt, ML; Bollinger, JW; Dias, AA; Oot, EN; Goldman, D; Hodgkinson, CA; Leggio, L

    2016-01-01

    Background Abnormalities of the hypothalamic-pituitary-thyroid (HPT) axis have been reported in alcoholism, however, there is no definitive agreement on the specific thyroid abnormalities and their underlying mechanisms in alcohol dependence (AD). The biological activity of thyroid hormones or the availability of T3 is regulated by the three deiodinase enzymes D1, D2 and D3. In the context of alcohol use, functionally significant single nucleotide polymorphisms (SNP’s) of these deiodinase genes may play a role in HPT dysfunction. Methods The present study explored the effect of three functionally significant SNP’s (D1: rs2235544, D2: rs225014 and rs12885300) of deiodinase genes on drinking behavior and thyroid stimulating hormone (TSH) levels in alcohol dependent (N=521) and control subjects (N=228). Results Rs225014 was associated with significant differences in the amount of naturalistic alcohol drinking assessed by the Timeline Follow-Back (TLFB). Alcohol-dependent subjects had significantly higher thyroid stimulating hormone levels compared to controls; however, there was no effect of genotype on TSH levels for either group. Conclusions These findings extend previous studies on thyroid dysfunction in alcoholism and provide novel, albeit preliminary, information by linking functionally significant genetic polymorphisms of the deiodinase enzymes with alcohol drinking behavior. PMID:26207529

  10. Clinical Significance of the Single Nucleotide Polymorphism TLR2 R753Q in Heart Transplant Recipients at Risk for Cytomegalovirus Disease

    PubMed Central

    Schneider, Martina; Matiqi, Teresa; Kundi, Michael; Rieder, Franz JJ; Andreas, Martin; Strassl, Robert; Zuckermann, Andreas; Jungbauer, Christof; Steininger, Christoph

    2017-01-01

    Background The Toll-like receptor 2 (TLR2) is a significant component of innate immunity against cytomegalovirus (CMV) infection but information on the clinical significance of the most common single nucleotide polymorphism (SNP) (R753Q) is conflicting. Objectives The inconsistent observations of the immunological and clinical significance of the TLR2 R753Q polymorphism for CMV infection indicates the influence of confounders. Study design The presence of the TLR2 polymorphism was determined by a genotyping assay of 175 HTX patients and 281 healthy blood donors and evaluated in relation to selected virological and clinical parameters. Results Relative frequency of TLR2 polymorphism was similar in HTX patients and blood donors (homozygous wild-type, 94.3% vs. 94.0%; heterozygous, 5.1% vs. 5.7%; homozygous mutated, <1%). CMV viremia was detectable in 108 (61.7%) of HTX patients. The TLR2 polymorphism was neither associated with occurrence or level of CMV infection nor with survival, graft failure or rejection, or CMV serostatus of patient before transplantation. Nevertheless, CMV viremia occurred in 83.1% of R+/D+, 77.1% of R+/D-, and 64.3% of R-/D+ patients. Time of first CMV viremia was in R-/D+ patients later than in CMV-seropositive patients (median, 182 days versus 23 days; P<0.001) corresponding to the duration of antiviral prophylaxis in R-/D+ patients. Conclusions The TLR2 R753Q polymorphism is extremely rare in the general population and HTX patients. Screening for this risk factor of CMV disease may not be cost-effective in contrast to testing for CMV viremia. PMID:27723526

  11. [Association of single nucleotide polymorphism at interleukin-10 gene 1082 nt with the risk of gastric cancer in Chinese population].

    PubMed

    Zhou, Shao-zhang; Zhu, Wei-liang; Li, Ming-ying; Li, Hong-yi; Zhang, Ji-ren

    2008-08-01

    To study the association of single nucleotide polymorphism at interleukin-10 gene 1082 locus with Helicobacter pylori (Hp) infection and the risk of gastric cancer in high prevalent region (Shaanxi Province)aand low prevalence region (Guangdong Province) in China. The genomic DNA was extracted from the peripheral blood of 104 healthy individuals, 104 gastric cancer patients from Guangdong Province, and from 102 healthy volunteers and 102 gastric cancer patients in Shaanxi Province, China. The single nucleotide polymorphism at IL-10 gene 1082 locus was analyzed by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP). The serum levels of anit-Hp IgG was measured by enzyme-linked immunosorbent assay. The frequencies of IL-10-1082 A/A, A/G and G/G genotypes in the 412 subjects were 86.7%, 10.7% and 2.4%, respectively. In the low prevalence region, the number of carriers of IL-10-1082 G* was much greater in the cancer patients than in the healthy controls (14.4% vs 7.7%, Chi2=4.02, P<0.05, OR=1.01, 95% CI=1.08-3.10). The presence of IL-10-1082 G* was associated with significantly increased risk of gastric cancer following Hp infection (Chi(2)=5.36, P<0.05, OR=6.0, 95% CI=1.23-17.52). In the high prevalence region, the frequency of IL-10-1082 G* was slightly higher among the cancer patients than in the healthy controls, but this difference was not statistically significant (12.7% vs 16.6%, P>0.05). The G* genotype of IL-10 gene 1082 locus may be associated with increased risk of gastric cancer in China.

  12. Polygenic Overlap Between C-Reactive Protein, Plasma Lipids, and Alzheimer Disease.

    PubMed

    Desikan, Rahul S; Schork, Andrew J; Wang, Yunpeng; Thompson, Wesley K; Dehghan, Abbas; Ridker, Paul M; Chasman, Daniel I; McEvoy, Linda K; Holland, Dominic; Chen, Chi-Hua; Karow, David S; Brewer, James B; Hess, Christopher P; Williams, Julie; Sims, Rebecca; O'Donovan, Michael C; Choi, Seung Hoan; Bis, Joshua C; Ikram, M Arfan; Gudnason, Vilmundur; DeStefano, Anita L; van der Lee, Sven J; Psaty, Bruce M; van Duijn, Cornelia M; Launer, Lenore; Seshadri, Sudha; Pericak-Vance, Margaret A; Mayeux, Richard; Haines, Jonathan L; Farrer, Lindsay A; Hardy, John; Ulstein, Ingun Dina; Aarsland, Dag; Fladby, Tormod; White, Linda R; Sando, Sigrid B; Rongve, Arvid; Witoelar, Aree; Djurovic, Srdjan; Hyman, Bradley T; Snaedal, Jon; Steinberg, Stacy; Stefansson, Hreinn; Stefansson, Kari; Schellenberg, Gerard D; Andreassen, Ole A; Dale, Anders M

    2015-06-09

    Epidemiological findings suggest a relationship between Alzheimer disease (AD), inflammation, and dyslipidemia, although the nature of this relationship is not well understood. We investigated whether this phenotypic association arises from a shared genetic basis. Using summary statistics (P values and odds ratios) from genome-wide association studies of >200 000 individuals, we investigated overlap in single-nucleotide polymorphisms associated with clinically diagnosed AD and C-reactive protein (CRP), triglycerides, and high- and low-density lipoprotein levels. We found up to 50-fold enrichment of AD single-nucleotide polymorphisms for different levels of association with C-reactive protein, low-density lipoprotein, high-density lipoprotein, and triglyceride single-nucleotide polymorphisms using a false discovery rate threshold <0.05. By conditioning on polymorphisms associated with the 4 phenotypes, we identified 55 loci associated with increased AD risk. We then conducted a meta-analysis of these 55 variants across 4 independent AD cohorts (total: n=29 054 AD cases and 114 824 healthy controls) and discovered 2 genome-wide significant variants on chromosome 4 (rs13113697; closest gene, HS3ST1; odds ratio=1.07; 95% confidence interval=1.05-1.11; P=2.86×10(-8)) and chromosome 10 (rs7920721; closest gene, ECHDC3; odds ratio=1.07; 95% confidence interval=1.04-1.11; P=3.38×10(-8)). We also found that gene expression of HS3ST1 and ECHDC3 was altered in AD brains compared with control brains. We demonstrate genetic overlap between AD, C-reactive protein, and plasma lipids. By conditioning on the genetic association with the cardiovascular phenotypes, we identify novel AD susceptibility loci, including 2 genome-wide significant variants conferring increased risk for AD. © 2015 American Heart Association, Inc.

  13. Association of Cytokine Candidate Genes with Severity of Pain and Co-Occurring Symptoms in Breast Cancer Patients Receiving Chemotherapy

    DTIC Science & Technology

    2013-10-01

    identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in cytokine genes, as well demographic, clinical, and...Center. The purpose of the proposed project is to identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in...research team continues to meet monthly to discuss progress with regards to recruitment, enrollment, and data collection. Training in Genetics In year

  14. Mycobacterium leprae: genes, pseudogenes and genetic diversity

    PubMed Central

    Singh, Pushpendra; Cole, Stewart T

    2011-01-01

    Leprosy, which has afflicted human populations for millenia, results from infection with Mycobacterium leprae, an unculturable pathogen with an exceptionally long generation time. Considerable insight into the biology and drug resistance of the leprosy bacillus has been obtained from genomics. M. leprae has undergone reductive evolution and pseudogenes now occupy half of its genome. Comparative genomics of four different strains revealed remarkable conservation of the genome (99.995% identity) yet uncovered 215 polymorphic sites, mainly single nucleotide polymorphisms, and a handful of new pseudogenes. Mapping these polymorphisms in a large panel of strains defined 16 single nucleotide polymorphism-subtypes that showed strong geographical associations and helped retrace the evolution of M. leprae. PMID:21162636

  15. Estrogen Receptor 1 ( ESR1) Gene Polymorphisms and Obesity Phenotypes in a Population of Young Adults.

    PubMed

    Correa-Rodríguez, María; Schmidt-RioValle, Jacqueline; González-Jiménez, Emilio; Rueda-Medina, Blanca

    2017-06-01

    Obesity is considered an increasingly serious health problem determined by multiple genetic and environmental factors. Estrogens have been found to play a major role in body weight and adiposity regulation through estrogen receptor 1 ( ESR1). The aim of this study was to determine whether genotype and haplotype frequencies of ESR1 polymorphisms are associated with body composition measures in a population of 572 young adults. A lack of significant association between genotypes of ESR1 gene polymorphisms and obesity phenotypes was seen after adjustment for confounding factors. Linkage disequilibrium (LD) analysis identified a single LD block for the ESR1 gene including PvuII and XbaI single-nucleotide polymorphisms (SNPs) (pairwise r 2 = .66). None of the haplotypes identified revealed statistically significant associations with any of the obesity phenotypes. Our results suggest that polymorphisms of the ESR1 gene do not contribute significantly to the genetic risk for obesity phenotypes in a population of young Caucasian adults.

  16. High-throughput discovery of rare human nucleotide polymorphisms by Ecotilling

    PubMed Central

    Till, Bradley J.; Zerr, Troy; Bowers, Elisabeth; Greene, Elizabeth A.; Comai, Luca; Henikoff, Steven

    2006-01-01

    Human individuals differ from one another at only ∼0.1% of nucleotide positions, but these single nucleotide differences account for most heritable phenotypic variation. Large-scale efforts to discover and genotype human variation have been limited to common polymorphisms. However, these efforts overlook rare nucleotide changes that may contribute to phenotypic diversity and genetic disorders, including cancer. Thus, there is an increasing need for high-throughput methods to robustly detect rare nucleotide differences. Toward this end, we have adapted the mismatch discovery method known as Ecotilling for the discovery of human single nucleotide polymorphisms. To increase throughput and reduce costs, we developed a universal primer strategy and implemented algorithms for automated band detection. Ecotilling was validated by screening 90 human DNA samples for nucleotide changes in 5 gene targets and by comparing results to public resequencing data. To increase throughput for discovery of rare alleles, we pooled samples 8-fold and found Ecotilling to be efficient relative to resequencing, with a false negative rate of 5% and a false discovery rate of 4%. We identified 28 new rare alleles, including some that are predicted to damage protein function. The detection of rare damaging mutations has implications for models of human disease. PMID:16893952

  17. Genetic risk profiling and gene signature modeling to predict risk of complications after IPAA.

    PubMed

    Sehgal, Rishabh; Berg, Arthur; Polinski, Joseph I; Hegarty, John P; Lin, Zhenwu; McKenna, Kevin J; Stewart, David B; Poritz, Lisa S; Koltun, Walter A

    2012-03-01

    Severe pouchitis and Crohn's disease-like complications are 2 adverse postoperative complications that confound the success of the IPAA in patients with ulcerative colitis. To date, approximately 83 single nucleotide polymorphisms within 55 genes have been associated with IBD. The aim of this study was to identify single-nucleotide polymorphisms that correlate with complications after IPAA that could be utilized in a gene signature fashion to predict postoperative complications and aid in preoperative surgical decision making. One hundred forty-two IPAA patients were retrospectively classified as "asymptomatic" (n = 104, defined as no Crohn's disease-like complications or severe pouchitis for at least 2 years after IPAA) and compared with a "severe pouchitis" group (n = 12, ≥ 4 episodes pouchitis per year for 2 years including the need for long-term therapy to maintain remission) and a "Crohn's disease-like" group (n = 26, presence of fistulae, pouch inlet stricture, proximal small-bowel disease, or pouch granulomata, occurring at least 6 months after surgery). Genotyping for 83 single-nucleotide polymorphisms previously associated with Crohn's disease and/or ulcerative colitis was performed on a customized Illumina genotyping platform. The top 2 single-nucleotide polymorphisms statistically identified as being independently associated with each of Crohn's disease-like and severe pouchitis were used in a multivariate logistic regression model. These single-nucleotide polymorphisms were then used to create probability equations to predict overall chance of a positive or negative outcome for that complication. The top 2 single-nucleotide polymorphisms for Crohn's disease-like complications were in the 10q21 locus and the gene for PTGER4 (p = 0.006 and 0.007), whereas for severe pouchitis it was NOD2 and TNFSF15 (p = 0.003 and 0.011). Probability equations suggested that the risk of these 2 complications greatly increased with increasing number of risk alleles, going as high as 92% for severe pouchitis and 65% for Crohn's disease-like complications. In this IPAA patient cohort, mutations in the 10q21 locus and the PTGER4 gene were associated with Crohn's disease-like complications, whereas mutations in NOD2 and TNFSF15 correlated with severe pouchitis. Preoperative genetic analysis and use of such gene signatures hold promise for improved preoperative surgical patient selection to minimize these IPAA complications.

  18. SNPs in DNA repair or oxidative stress genes and late subcutaneous fibrosis in patients following single shot partial breast irradiation

    PubMed Central

    2012-01-01

    Background The aim of this study was to evaluate the potential association between single nucleotide polymorphisms related response to radiotherapy injury, such as genes related to DNA repair or enzymes involved in anti-oxidative activities. The paper aims to identify marker genes able to predict an increased risk of late toxicity studying our group of patients who underwent a Single Shot 3D-CRT PBI (SSPBI) after BCS (breast conserving surgery). Methods A total of 57 breast cancer patients who underwent SSPBI were genotyped for SNPs (single nucleotide polymorphisms) in XRCC1, XRCC3, GST and RAD51 by Pyrosequencing technology. Univariate analysis (ORs and 95% CI) was performed to correlate SNPs with the risk of developing ≥ G2 fibrosis or fat necrosis. Results A higher significant risk of developing ≥ G2 fibrosis or fat necrosis in patients with: polymorphic variant GSTP1 (Ile105Val) (OR = 2.9; 95%CI, 0.88-10.14, p = 0.047). Conclusions The presence of some SNPs involved in DNA repair or response to oxidative stress seem to be able to predict late toxicity. Trial Registration ClinicalTrials.gov: NCT01316328 PMID:22272830

  19. Prediction of Adult Dyslipidemia Using Genetic and Childhood Clinical Risk Factors: The Cardiovascular Risk in Young Finns Study.

    PubMed

    Nuotio, Joel; Pitkänen, Niina; Magnussen, Costan G; Buscot, Marie-Jeanne; Venäläinen, Mikko S; Elo, Laura L; Jokinen, Eero; Laitinen, Tomi; Taittonen, Leena; Hutri-Kähönen, Nina; Lyytikäinen, Leo-Pekka; Lehtimäki, Terho; Viikari, Jorma S; Juonala, Markus; Raitakari, Olli T

    2017-06-01

    Dyslipidemia is a major modifiable risk factor for cardiovascular disease. We examined whether the addition of novel single-nucleotide polymorphisms for blood lipid levels enhances the prediction of adult dyslipidemia in comparison to childhood lipid measures. Two thousand four hundred and twenty-two participants of the Cardiovascular Risk in Young Finns Study who had participated in 2 surveys held during childhood (in 1980 when aged 3-18 years and in 1986) and at least once in a follow-up study in adulthood (2001, 2007, and 2011) were included. We examined whether inclusion of a lipid-specific weighted genetic risk score based on 58 single-nucleotide polymorphisms for low-density lipoprotein cholesterol, 71 single-nucleotide polymorphisms for high-density lipoprotein cholesterol, and 40 single-nucleotide polymorphisms for triglycerides improved the prediction of adult dyslipidemia compared with clinical childhood risk factors. Adjusting for age, sex, body mass index, physical activity, and smoking in childhood, childhood lipid levels, and weighted genetic risk scores were associated with an increased risk of adult dyslipidemia for all lipids. Risk assessment based on 2 childhood lipid measures and the lipid-specific weighted genetic risk scores improved the accuracy of predicting adult dyslipidemia compared with the approach using only childhood lipid measures for low-density lipoprotein cholesterol (area under the receiver-operating characteristic curve 0.806 versus 0.811; P =0.01) and triglycerides (area under the receiver-operating characteristic curve 0.740 versus area under the receiver-operating characteristic curve 0.758; P <0.01). The overall net reclassification improvement and integrated discrimination improvement were significant for all outcomes. The inclusion of weighted genetic risk scores to lipid-screening programs in childhood could modestly improve the identification of those at highest risk of dyslipidemia in adulthood. © 2017 American Heart Association, Inc.

  20. Single nucleotide polymorphism analysis reveals heterogeneity within a seedling tree population of a polyembryonic mango cultivar.

    PubMed

    Winterhagen, Patrick; Wünsche, Jens-Norbert

    2016-05-01

    Within a polyembryonic mango seedling tree population, the genetic background of individuals should be identical because vigorous plants for cultivation are expected to develop from nucellar embryos representing maternal clones. Due to the fact that the mango cultivar 'Hôi' is assigned to the polyembryonic ecotype, an intra-cultivar variability of ethylene receptor genes was unexpected. Ethylene receptors in plants are conserved, but the number of receptors or receptor isoforms is variable regarding different plant species. However, it is shown here that the ethylene receptor MiETR1 is present in various isoforms within the mango cultivar 'Hôi'. The investigation of single nucleotide polymorphisms revealed that different MiETR1 isoforms can not be discriminated simply by individual single nucleotide exchanges but by the specific arrangement of single nucleotide polymorphisms at certain positions in the exons of MiETR1. Furthermore, an MiETR1 isoform devoid of introns in the genomic sequence was identified. The investigation demonstrates some limitations of high resolution melting and ScreenClust analysis and points out the necessity of sequencing to identify individual isoforms and to determine the variability within the tree population.

  1. Demonstration of protein-based human identification using the hair shaft proteome [Protein-based human identification: A proof of concept using the hair shaft proteome

    DOE PAGES

    Parker, Glendon J.; Leppert, Tami; Anex, Deon S.; ...

    2016-09-07

    Human identification from biological material is largely dependent on the ability to characterize genetic polymorphisms in DNA. Unfortunately, DNA can degrade in the environment, sometimes below the level at which it can be amplified by PCR. Protein however is chemically more robust than DNA and can persist for longer periods. Protein also contains genetic variation in the form of single amino acid polymorphisms. These can be used to infer the status of non-synonymous single nucleotide polymorphism alleles. To demonstrate this, we used mass spectrometry-based shotgun proteomics to characterize hair shaft proteins in 66 European-American subjects. A total of 596 singlemore » nucleotide polymorphism alleles were correctly imputed in 32 loci from 22 genes of subjects’ DNA and directly validated using Sanger sequencing. Estimates of the probability of resulting individual non-synonymous single nucleotide polymorphism allelic profiles in the European population, using the product rule, resulted in a maximum power of discrimination of 1 in 12,500. Imputed non-synonymous single nucleotide polymorphism profiles from European–American subjects were considerably less frequent in the African population (maximum likelihood ratio = 11,000). The converse was true for hair shafts collected from an additional 10 subjects with African ancestry, where some profiles were more frequent in the African population. Genetically variant peptides were also identified in hair shaft datasets from six archaeological skeletal remains (up to 260 years old). Furthermore, this study demonstrates that quantifiable measures of identity discrimination and biogeographic background can be obtained from detecting genetically variant peptides in hair shaft protein, including hair from bioarchaeological contexts.« less

  2. Demonstration of protein-based human identification using the hair shaft proteome [Protein-based human identification: A proof of concept using the hair shaft proteome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Parker, Glendon J.; Leppert, Tami; Anex, Deon S.

    Human identification from biological material is largely dependent on the ability to characterize genetic polymorphisms in DNA. Unfortunately, DNA can degrade in the environment, sometimes below the level at which it can be amplified by PCR. Protein however is chemically more robust than DNA and can persist for longer periods. Protein also contains genetic variation in the form of single amino acid polymorphisms. These can be used to infer the status of non-synonymous single nucleotide polymorphism alleles. To demonstrate this, we used mass spectrometry-based shotgun proteomics to characterize hair shaft proteins in 66 European-American subjects. A total of 596 singlemore » nucleotide polymorphism alleles were correctly imputed in 32 loci from 22 genes of subjects’ DNA and directly validated using Sanger sequencing. Estimates of the probability of resulting individual non-synonymous single nucleotide polymorphism allelic profiles in the European population, using the product rule, resulted in a maximum power of discrimination of 1 in 12,500. Imputed non-synonymous single nucleotide polymorphism profiles from European–American subjects were considerably less frequent in the African population (maximum likelihood ratio = 11,000). The converse was true for hair shafts collected from an additional 10 subjects with African ancestry, where some profiles were more frequent in the African population. Genetically variant peptides were also identified in hair shaft datasets from six archaeological skeletal remains (up to 260 years old). Furthermore, this study demonstrates that quantifiable measures of identity discrimination and biogeographic background can be obtained from detecting genetically variant peptides in hair shaft protein, including hair from bioarchaeological contexts.« less

  3. Association between RTEL1, PHLDB1, and TREH Polymorphisms and Glioblastoma Risk: A Case-Control Study

    PubMed Central

    Yang, Bo; Heng, Liang; Du, Shuli; Yang, Hua; Jin, Tianbo; Lang, Hongjuan; Li, Shanqu

    2015-01-01

    Background Glioblastoma (GBM) is a highly invasive, aggressive, and incurable brain tumor. Genetic factors play important roles in GBM risk. The aim of this study was to elucidate the influence of gene polymorphism on GBM susceptibility. Material/Methods In this case-control study, we included 72 GBM patients and 320 healthy controls to analyze the association between 29 single-nucleotide polymorphisms and GBM cancer risk in the Chinese Han population. The single-nucleotide polymorphisms were determined by Sequenom MassARRAY RS1000 and statistical analysis was performed using SPSS software and SNPStats software. Results Using the χ2 test, we found that rs2297440 and rs6010620 in RTEL1 increased risk of GBM. In the recessive model, we also found that the genotypes “CC” of rs2297440 and “GG” of rs6010620 in RTEL1 significantly increased GBM risk. The variant TT genotype of TREH rs17748 and the variant TT genotype of PHLDB1 rs498872 decreased GBM risk in the recessive model. We also found that the TREH rs17748 variant C allele showed an increased risk in males in the dominant model. Conclusions Our results suggest a significant association between the RETL1, TREH, and PHLDB1 genes and GBM development in the Han Chinese population. PMID:26156397

  4. Association between RTEL1, PHLDB1, and TREH Polymorphisms and Glioblastoma Risk: A Case-Control Study.

    PubMed

    Yang, Bo; Heng, Liang; Du, Shuli; Yang, Hua; Jin, Tianbo; Lang, Hongjun; Li, Shanqu

    2015-07-09

    Glioblastoma (GBM) is a highly invasive, aggressive, and incurable brain tumor. Genetic factors play important roles in GBM risk. The aim of this study was to elucidate the influence of gene polymorphism on GBM susceptibility. In this case-control study, we included 72 GBM patients and 320 healthy controls to analyze the association between 29 single-nucleotide polymorphisms and GBM cancer risk in the Chinese Han population. The single-nucleotide polymorphisms were determined by Sequenom MassARRAY RS1000 and statistical analysis was performed using SPSS software and SNPStats software. Using the χ(2) test, we found that rs2297440 and rs6010620 in RTEL1 increased risk of GBM. In the recessive model, we also found that the genotypes "CC" of rs2297440 and "GG" of rs6010620 in RTEL1 significantly increased GBM risk. The variant TT genotype of TREH rs17748 and the variant TT genotype of PHLDB1 rs498872 decreased GBM risk in the recessive model. We also found that the TREH rs17748 variant C allele showed an increased risk in males in the dominant model. Our results suggest a significant association between the RETL1, TREH, and PHLDB1 genes and GBM development in the Han Chinese population.

  5. Relationship Between Some Single-nucleotide Polymorphism and Response to Hydroxyurea Therapy in Iranian Patients With β-Thalassemia Intermedia.

    PubMed

    Karimi, Mehran; Zarei, Tahereh; Haghpanah, Sezaneh; Moghadam, Mohamad; Ebrahimi, Ahmad; Rezaei, Narges; Heidari, Ghazaleh; Vazin, Afsaneh; Khavari, Maryam; Miri, Hamid R

    2017-05-01

    To evaluate the possible relationship between hydroxyurea (HU) response and some single-nucleotide polymorphism (SNP) in patients affected by β-thalassemia intermedia. In this cross-sectional study, 100 β-thalassemia intermedia patients who were taking HU with a dose of 8 to 15 mg/kg body weight per day for a period of at least 6 months were randomly selected between February 2013 and October 2014 in southern Iran. HU response was defined based on decrease or cessation of the blood transfusion need and evaluation of Hb level. In univariate analysis, from all evaluated SNPs, only rs10837814 SNP of olfactory receptors (ORs) OR51B2 showed a significant association with HU response (P=0.038) and from laboratory characteristics, only nucleated red blood cells showed significant associations (116%±183%) in good responders versus (264%±286%) in poor responders (P=0.045). In multiple logistic regression, neither laboratory variables nor different SNPs, showed significant association with HU response. Three novel nucleotide variations (-665 [A→C], -1301 [T→G],-1199 delA) in OR51B2 gene were found in good responders. None of the evaluated SNPs in our study showed significant association with HU response. Further larger studies and evaluation of other genes are suggested.

  6. Characterizing the genetic risk for Type 2 diabetes in a Malaysian multi-ethnic cohort.

    PubMed

    Abdullah, N; Abdul Murad, N A; Attia, J; Oldmeadow, C; Mohd Haniff, E A; Syafruddin, S E; Abd Jalal, N; Ismail, N; Ishak, M; Jamal, R; Scott, R J; Holliday, E G

    2015-10-01

    To characterize the association with Type 2 diabetes of known Type 2 diabetes risk variants in people in Malaysia of Malay, Chinese and Indian ancestry who participated in the Malaysian Cohort project. We genotyped 1604 people of Malay ancestry (722 cases, 882 controls), 1654 of Chinese ancestry (819 cases, 835 controls) and 1728 of Indian ancestry (851 cases, 877 controls). First, 62 candidate single-nucleotide polymorphisms previously associated with Type 2 diabetes were assessed for association via logistic regression within ancestral groups and then across ancestral groups using a meta-analysis. Second, estimated odds ratios were assessed for excess directional concordance with previously studied populations. Third, a genetic risk score aggregating allele dosage across the candidate single-nucleotide polymorphisms was tested for association within and across ancestral groups. After Bonferroni correction, seven individual single-nucleotide polymorphisms were associated with Type 2 diabetes in the combined Malaysian sample. We observed a highly significant excess in concordance of effect directions between Malaysian and previously studied populations. The genetic risk score was strongly associated with Type 2 diabetes in all Malaysian groups, explaining from 1.0 to 1.7% of total Type 2 diabetes risk variance. This study suggests there is substantial overlap of the genetic risk alleles underlying Type 2 diabetes in Malaysian and other populations. © 2015 The Authors. Diabetic Medicine © 2015 Diabetes UK.

  7. Identification of single-nucleotide polymorphisms of the prion protein gene in sika deer (Cervus nippon laiouanus)

    PubMed Central

    Jeong, Hyun-Jeong; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Kim, Bo-Sook; Rho, Jung-Rae; Yoo, Mi-Hyun; Jeong, Byung-Hoon; Kim, Yong-Sun

    2007-01-01

    Polymorphisms of the prion protein gene (PRNP) have been detected in several cervid species. In order to confirm the genetic variations, this study examined the DNA sequences of the PRNP obtained from 33 captive sika deer (Cervus nippon laiouanus) in Korea. A total of three single-nucleotide polymorphisms (SNPs) at codons 100, 136 and 226 in the PRNP of the sika deer were identified. The polymorphic site located at codon 100 has not been reported. The SNPs detected at codons 100 and 226 induced amino acid substitutions. The SNP at codon 136 was a silent mutation that does not induce any amino acid change. The genotype and allele frequencies were determined for each of the SNPs. PMID:17679779

  8. Increased frequency of de novo copy number variants in congenital heart disease by integrative analysis of single nucleotide polymorphism array and exome sequence data.

    PubMed

    Glessner, Joseph T; Bick, Alexander G; Ito, Kaoru; Homsy, Jason; Rodriguez-Murillo, Laura; Fromer, Menachem; Mazaika, Erica; Vardarajan, Badri; Italia, Michael; Leipzig, Jeremy; DePalma, Steven R; Golhar, Ryan; Sanders, Stephan J; Yamrom, Boris; Ronemus, Michael; Iossifov, Ivan; Willsey, A Jeremy; State, Matthew W; Kaltman, Jonathan R; White, Peter S; Shen, Yufeng; Warburton, Dorothy; Brueckner, Martina; Seidman, Christine; Goldmuntz, Elizabeth; Gelb, Bruce D; Lifton, Richard; Seidman, Jonathan; Hakonarson, Hakon; Chung, Wendy K

    2014-10-24

    Congenital heart disease (CHD) is among the most common birth defects. Most cases are of unknown pathogenesis. To determine the contribution of de novo copy number variants (CNVs) in the pathogenesis of sporadic CHD. We studied 538 CHD trios using genome-wide dense single nucleotide polymorphism arrays and whole exome sequencing. Results were experimentally validated using digital droplet polymerase chain reaction. We compared validated CNVs in CHD cases with CNVs in 1301 healthy control trios. The 2 complementary high-resolution technologies identified 63 validated de novo CNVs in 51 CHD cases. A significant increase in CNV burden was observed when comparing CHD trios with healthy trios, using either single nucleotide polymorphism array (P=7×10(-5); odds ratio, 4.6) or whole exome sequencing data (P=6×10(-4); odds ratio, 3.5) and remained after removing 16% of de novo CNV loci previously reported as pathogenic (P=0.02; odds ratio, 2.7). We observed recurrent de novo CNVs on 15q11.2 encompassing CYFIP1, NIPA1, and NIPA2 and single de novo CNVs encompassing DUSP1, JUN, JUP, MED15, MED9, PTPRE SREBF1, TOP2A, and ZEB2, genes that interact with established CHD proteins NKX2-5 and GATA4. Integrating de novo variants in whole exome sequencing and CNV data suggests that ETS1 is the pathogenic gene altered by 11q24.2-q25 deletions in Jacobsen syndrome and that CTBP2 is the pathogenic gene in 10q subtelomeric deletions. We demonstrate a significantly increased frequency of rare de novo CNVs in CHD patients compared with healthy controls and suggest several novel genetic loci for CHD. © 2014 American Heart Association, Inc.

  9. A Genome-Wide Association Study of Chronic Obstructive Pulmonary Disease in Hispanics

    PubMed Central

    Chen, Wei; Brehm, John M.; Manichaikul, Ani; Cho, Michael H.; Boutaoui, Nadia; Yan, Qi; Burkart, Kristin M.; Enright, Paul L.; Rotter, Jerome I.; Petersen, Hans; Leng, Shuguang; Obeidat, Ma’en; Bossé, Yohan; Brandsma, Corry-Anke; Hao, Ke; Rich, Stephen S.; Powell, Rhea; Avila, Lydiana; Soto-Quiros, Manuel; Silverman, Edwin K.; Tesfaigzi, Yohannes; Barr, R. Graham

    2015-01-01

    Rationale: Genome-wide association studies (GWAS) of chronic obstructive pulmonary disease (COPD) have identified disease-susceptibility loci, mostly in subjects of European descent. Objectives: We hypothesized that by studying Hispanic populations we would be able to identify unique loci that contribute to COPD pathogenesis in Hispanics but remain undetected in GWAS of non-Hispanic populations. Methods: We conducted a metaanalysis of two GWAS of COPD in independent cohorts of Hispanics in Costa Rica and the United States (Multi-Ethnic Study of Atherosclerosis [MESA]). We performed a replication study of the top single-nucleotide polymorphisms in an independent Hispanic cohort in New Mexico (the Lovelace Smokers Cohort). We also attempted to replicate prior findings from genome-wide studies in non-Hispanic populations in Hispanic cohorts. Measurements and Main Results: We found no genome-wide significant association with COPD in our metaanalysis of Costa Rica and MESA. After combining the top results from this metaanalysis with those from our replication study in the Lovelace Smokers Cohort, we identified two single-nucleotide polymorphisms approaching genome-wide significance for an association with COPD. The first (rs858249, combined P value = 6.1 × 10−8) is near the genes KLHL7 and NUPL2 on chromosome 7. The second (rs286499, combined P value = 8.4 × 10−8) is located in an intron of DLG2. The two most significant single-nucleotide polymorphisms in FAM13A from a previous genome-wide study in non-Hispanics were associated with COPD in Hispanics. Conclusions: We have identified two novel loci (in or near the genes KLHL7/NUPL2 and DLG2) that may play a role in COPD pathogenesis in Hispanic populations. PMID:25584925

  10. A genome-wide association study of chronic obstructive pulmonary disease in Hispanics.

    PubMed

    Chen, Wei; Brehm, John M; Manichaikul, Ani; Cho, Michael H; Boutaoui, Nadia; Yan, Qi; Burkart, Kristin M; Enright, Paul L; Rotter, Jerome I; Petersen, Hans; Leng, Shuguang; Obeidat, Ma'en; Bossé, Yohan; Brandsma, Corry-Anke; Hao, Ke; Rich, Stephen S; Powell, Rhea; Avila, Lydiana; Soto-Quiros, Manuel; Silverman, Edwin K; Tesfaigzi, Yohannes; Barr, R Graham; Celedón, Juan C

    2015-03-01

    Genome-wide association studies (GWAS) of chronic obstructive pulmonary disease (COPD) have identified disease-susceptibility loci, mostly in subjects of European descent. We hypothesized that by studying Hispanic populations we would be able to identify unique loci that contribute to COPD pathogenesis in Hispanics but remain undetected in GWAS of non-Hispanic populations. We conducted a metaanalysis of two GWAS of COPD in independent cohorts of Hispanics in Costa Rica and the United States (Multi-Ethnic Study of Atherosclerosis [MESA]). We performed a replication study of the top single-nucleotide polymorphisms in an independent Hispanic cohort in New Mexico (the Lovelace Smokers Cohort). We also attempted to replicate prior findings from genome-wide studies in non-Hispanic populations in Hispanic cohorts. We found no genome-wide significant association with COPD in our metaanalysis of Costa Rica and MESA. After combining the top results from this metaanalysis with those from our replication study in the Lovelace Smokers Cohort, we identified two single-nucleotide polymorphisms approaching genome-wide significance for an association with COPD. The first (rs858249, combined P value = 6.1 × 10(-8)) is near the genes KLHL7 and NUPL2 on chromosome 7. The second (rs286499, combined P value = 8.4 × 10(-8)) is located in an intron of DLG2. The two most significant single-nucleotide polymorphisms in FAM13A from a previous genome-wide study in non-Hispanics were associated with COPD in Hispanics. We have identified two novel loci (in or near the genes KLHL7/NUPL2 and DLG2) that may play a role in COPD pathogenesis in Hispanic populations.

  11. Aspergillus and Penicillium identification using DNA sequences: Barcode or MLST?

    USDA-ARS?s Scientific Manuscript database

    Current methods in DNA technology can detect single nucleotide polymorphisms with measurable accuracy using several different approaches appropriate for different uses. If there are even single nucleotide differences that are invariant markers of the species, we can accomplish identification through...

  12. Makeup of the genetic correlation between milk production traits using genome-wide single nucleotide polymorphism information.

    PubMed

    van Binsbergen, R; Veerkamp, R F; Calus, M P L

    2012-04-01

    The correlated responses between traits may differ depending on the makeup of genetic covariances, and may differ from the predictions of polygenic covariances. Therefore, the objective of the present study was to investigate the makeup of the genetic covariances between the well-studied traits: milk yield, fat yield, protein yield, and their percentages in more detail. Phenotypic records of 1,737 heifers of research farms in 4 different countries were used after homogenizing and adjusting for management effects. All cows had a genotype for 37,590 single nucleotide polymorphisms (SNP). A bayesian stochastic search variable selection model was used to estimate the SNP effects for each trait. About 0.5 to 1.0% of the SNP had a significant effect on 1 or more traits; however, the SNP without a significant effect explained most of the genetic variances and covariances of the traits. Single nucleotide polymorphism correlations differed from the polygenic correlations, but only 10 regions were found with an effect on multiple traits; in 1 of these regions the DGAT1 gene was previously reported with an effect on multiple traits. This region explained up to 41% of the variances of 4 traits and explained a major part of the correlation between fat yield and fat percentage and contributes to asymmetry in correlated response between fat yield and fat percentage. Overall, for the traits in this study, the infinitesimal model is expected to be sufficient for the estimation of the variances and covariances. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  13. Predicting stroke through genetic risk functions: the CHARGE Risk Score Project.

    PubMed

    Ibrahim-Verbaas, Carla A; Fornage, Myriam; Bis, Joshua C; Choi, Seung Hoan; Psaty, Bruce M; Meigs, James B; Rao, Madhu; Nalls, Mike; Fontes, Joao D; O'Donnell, Christopher J; Kathiresan, Sekar; Ehret, Georg B; Fox, Caroline S; Malik, Rainer; Dichgans, Martin; Schmidt, Helena; Lahti, Jari; Heckbert, Susan R; Lumley, Thomas; Rice, Kenneth; Rotter, Jerome I; Taylor, Kent D; Folsom, Aaron R; Boerwinkle, Eric; Rosamond, Wayne D; Shahar, Eyal; Gottesman, Rebecca F; Koudstaal, Peter J; Amin, Najaf; Wieberdink, Renske G; Dehghan, Abbas; Hofman, Albert; Uitterlinden, André G; Destefano, Anita L; Debette, Stephanie; Xue, Luting; Beiser, Alexa; Wolf, Philip A; Decarli, Charles; Ikram, M Arfan; Seshadri, Sudha; Mosley, Thomas H; Longstreth, W T; van Duijn, Cornelia M; Launer, Lenore J

    2014-02-01

    Beyond the Framingham Stroke Risk Score, prediction of future stroke may improve with a genetic risk score (GRS) based on single-nucleotide polymorphisms associated with stroke and its risk factors. The study includes 4 population-based cohorts with 2047 first incident strokes from 22,720 initially stroke-free European origin participants aged ≥55 years, who were followed for up to 20 years. GRSs were constructed with 324 single-nucleotide polymorphisms implicated in stroke and 9 risk factors. The association of the GRS to first incident stroke was tested using Cox regression; the GRS predictive properties were assessed with area under the curve statistics comparing the GRS with age and sex, Framingham Stroke Risk Score models, and reclassification statistics. These analyses were performed per cohort and in a meta-analysis of pooled data. Replication was sought in a case-control study of ischemic stroke. In the meta-analysis, adding the GRS to the Framingham Stroke Risk Score, age and sex model resulted in a significant improvement in discrimination (all stroke: Δjoint area under the curve=0.016, P=2.3×10(-6); ischemic stroke: Δjoint area under the curve=0.021, P=3.7×10(-7)), although the overall area under the curve remained low. In all the studies, there was a highly significantly improved net reclassification index (P<10(-4)). The single-nucleotide polymorphisms associated with stroke and its risk factors result only in a small improvement in prediction of future stroke compared with the classical epidemiological risk factors for stroke.

  14. Single nucleotide polymorphism-specific regulation of matrix metalloproteinase-9 by multiple miRNAs targeting the coding exon

    PubMed Central

    Duellman, Tyler; Warren, Christopher; Yang, Jay

    2014-01-01

    Microribonucleic acids (miRNAs) work with exquisite specificity and are able to distinguish a target from a non-target based on a single nucleotide mismatch in the core nucleotide domain. We questioned whether miRNA regulation of gene expression could occur in a single nucleotide polymorphism (SNP)-specific manner, manifesting as a post-transcriptional control of expression of genetic polymorphisms. In our recent study of the functional consequences of matrix metalloproteinase (MMP)-9 SNPs, we discovered that expression of a coding exon SNP in the pro-domain of the protein resulted in a profound decrease in the secreted protein. This missense SNP results in the N38S amino acid change and a loss of an N-glycosylation site. A systematic study demonstrated that the loss of secreted protein was due not to the loss of an N-glycosylation site, but rather an SNP-specific targeting by miR-671-3p and miR-657. Bioinformatics analysis identified 41 SNP-specific miRNA targeting MMP-9 SNPs, mostly in the coding exon and an extension of the analysis to chromosome 20, where the MMP-9 gene is located, suggesting that SNP-specific miRNAs targeting the coding exon are prevalent. This selective post-transcriptional regulation of a target messenger RNA harboring genetic polymorphisms by miRNAs offers an SNP-dependent post-transcriptional regulatory mechanism, allowing for polymorphic-specific differential gene regulation. PMID:24627221

  15. Interactions between genetic variants associated with adiposity traits and soft drinks in relation to longitudinal changes in body weight and waist circumference.

    PubMed

    Olsen, Nanna J; Ängquist, Lars; Larsen, Sofus C; Linneberg, Allan; Skaaby, Tea; Husemoen, Lise Lotte N; Toft, Ulla; Tjønneland, Anne; Halkjær, Jytte; Hansen, Torben; Pedersen, Oluf; Overvad, Kim; Ahluwalia, Tarunveer S; Sørensen, Thorkild Ia; Heitmann, Berit L

    2016-09-01

    Intake of sugar-sweetened beverages is associated with obesity, and this association may be modified by a genetic predisposition to obesity. We examined the interactions between a molecular genetic predisposition to various aspects of obesity and the consumption of soft drinks, which are a major part of sugar-sweetened beverages, in relation to changes in adiposity measures. A total of 4765 individuals were included in the study. On the basis of 50 obesity-associated single nucleotide polymorphisms that are associated with body mass index (BMI), waist circumference (WC), or the waist-to-hip ratio adjusted for BMI (WHRBMI), the following 4 genetic predisposition scores (GRSs) were constructed: a complete genetic predisposition score including all 50 single nucleotide polymorphisms (GRSComplete), a genetic predisposition score including BMI-associated single nucleotide polymorphisms (GRSBMI), a genetic predisposition score including waist circumference-associated single nucleotide polymorphisms (GRSWC), and a genetic predisposition score including the waist-to-hip ratio adjusted for BMI-associated single nucleotide polymorphisms (GRSWHR). Associations between soft drink intake and the annual change (Δ) in body weight (BW), WC, or waist circumference adjusted for BMI (WCBMI) and possible interactions with the GRSs were examined with the use of linear regression analyses and meta-analyses. For each soft drink serving per day, soft drink consumption was significantly associated with a higher ΔBW of 0.07 kg/y (95% CI: 0.01, 0.13 kg/y; P = 0.020) but not with the ΔWC or ΔWCBMI In analyses of the ΔBW, we showed an interaction only with the GRSWC (per risk allele for each soft drink serving per day: -0.06 kg/y; 95% CI: -0.10, -0.02 kg/y; P = 0.006). In analyses of the ΔWC, we showed interactions only with the GRSBMI and GRSComplete [per risk allele for each soft drink serving per day: 0.05 cm/y (95% CI: 0.02, 0.09 cm/y; P = 0.001) and 0.05 cm/y (95% CI: 0.02, 0.07 cm/y; P = 0.001), respectively]. Nearly identical results were observed in analyses of the ΔWCBMI CONCLUSIONS: A genetic predisposition to a high WC may attenuate the association between soft drink intake and BW gain. A genetic predisposition to high BMI as well as a genetic predisposition to high BMI, WC, and WHRBMI combined may strengthen the association between soft drink intake and WC gain. However, the public health impact may be limited. © 2016 American Society for Nutrition.

  16. Adolescent idiopathic scoliosis and the single-nucleotide polymorphism of the growth hormone receptor and IGF-1 genes.

    PubMed

    Yang, Yong; Wu, Zhihong; Zhao, Taimao; Wang, Hai; Zhao, Dong; Zhang, Jianguo; Wang, Yipeng; Ding, Yaozhong; Qiu, Guixing

    2009-06-01

    The etiology of adolescent idiopathic scoliosis is undetermined despite years of research. A number of hypotheses have been postulated to explain its development, including growth abnormalities. The irregular expression of growth hormone and insulin-like growth factor-1 (IGF-1) may disturb hormone metabolism, result in a gross asymmetry, and promote the progress of adolescent idiopathic scoliosis. Initial association studies in complex diseases have demonstrated the power of candidate gene association. Prior to our study, 1 study in this field had a negative result. A replicable study is vital for reliability. To determine the relationship of growth hormone receptor and IGF-1 genes with adolescent idiopathic scoliosis, a population-based association study was performed. Single nucleotide polymorphisms with potential function were selected from candidate genes and a distribution analysis was performed. A conclusion was made confirming the insufficiency of an association between adolescent idiopathic scoliosis and the single-nucleotide polymorphism of the growth hormone receptor and IGF-1 genes in Han Chinese.

  17. Polymorphism of the renalase gene in gestational diabetes mellitus.

    PubMed

    Fatima, Syeda Sadia; Jamil, Zehra; Alam, Faiza; Malik, Hajira Zafar; Madhani, Sarosh Irfan; Ahmad, Muhammad Saad; Shabbir, Tayyab; Rehmani, Muhammed Noman; Rabbani, Amna

    2017-01-01

    Renalase is considered as a novel candidate gene for type 2 diabetes. In this study, we aimed to investigate the relationship of serum renalase and two single nucleotide polymorphisms with gestational diabetes mellitus. One hundred and ninety-eight normotensive pregnant females (n = 99 gestational diabetes mellitus; n = 99 euglycemic pregnant controls) were classified according to the International Association of the Diabetes and Pregnancy Study criteria. Fasting and 2-h post glucose load blood levels and anthropometric assessment was performed. Serum renalase was measured using enzyme-linked immunosorbent assay, whereas DNA samples were genotyped for renalase single nucleotide polymorphisms rs2576178 and rs10887800 using Polymerase chain reaction-Restriction fragment length polymorphism method. In an age-matched case control study, no difference was observed in the serum levels of renalase (p > 0.05). The variant rs10887800 showed an association with gestational diabetes mellitus and remained significant after multiple adjustments (p < 0.05), whereas rs2576178 showed weak association (p = 0.030) that was lost after multiple adjustments (p = 0.09). We inferred a modest association of the rs10887800 polymorphism with gestational diabetes. Although gestational diabetes mellitus is self-reversible, yet presence of this minor G allele might predispose to metabolic syndrome phenotypes in near the future.

  18. CLC-2 single nucleotide polymorphisms (SNPs) as potential modifiers of cystic fibrosis disease severity

    PubMed Central

    Blaisdell, Carol J; Howard, Timothy D; Stern, Augustus; Bamford, Penelope; Bleecker, Eugene R; Stine, O Colin

    2004-01-01

    Background Cystic fibrosis (CF) lung disease manifest by impaired chloride secretion leads to eventual respiratory failure. Candidate genes that may modify CF lung disease severity include alternative chloride channels. The objectives of this study are to identify single nucleotide polymorphisms (SNPs) in the airway epithelial chloride channel, CLC-2, and correlate these polymorphisms with CF lung disease. Methods The CLC-2 promoter, intron 1 and exon 20 were examined for SNPs in adult CF dF508/dF508 homozygotes with mild and severe lung disease (forced expiratory volume at one second (FEV1) > 70% and < 40%). Results PCR amplification of genomic CLC-2 and sequence analysis revealed 1 polymorphism in the hClC -2 promoter, 4 in intron 1, and none in exon 20. Fisher's analysis within this data set, did not demonstrate a significant relationship between the severity of lung disease and SNPs in the CLC-2 gene. Conclusions CLC-2 is not a key modifier gene of CF lung phenotype. Further studies evaluating other phenotypes associated with CF may be useful in the future to assess the ability of CLC-2 to modify CF disease severity. PMID:15507145

  19. A map of single nucleotide polymorphisms of the date palm (Phoenix dactylifera) based on whole genome sequencing of 62 varieties

    USDA-ARS?s Scientific Manuscript database

    Date palm is one of the few crop species that thrive in arid environments and are the most significant fruit crop in the Middle East and North Africa, but lacks genomic resources that can accelerate breeding efforts. Here, we present the first comprehensive catalogue of ~12 million common single nuc...

  20. Polymorphism of SLC25A32, the folate transporter gene, is associated with plasma folate levels and bone fractures in Japanese postmenopausal women.

    PubMed

    Urano, Tomohiko; Shiraki, Masataka; Saito, Mitsuru; Sasaki, Noriko; Ouchi, Yasuyoshi; Inoue, Satoshi

    2014-10-01

    Elevation of homocysteine is associated with an increased risk for bone fractures. We previously reported that the methylenetetrahydrofolate reductase (MTHFR) gene polymorphism is associated with homocysteine levels and fracture. The association between the fracture and folate levels or their related gene polymorphisms is not completely clear. We speculated that the SLC25A32 gene, the mitochondrial inner membrane folate transporter, also could be implicated in the regulation of folate metabolism and fracture. A total of 851 Japanese postmenopausal women participated in the association study between the single nucleotide polymorphism genotype and plasma homocysteine or folate. We also tested the association between the candidate single nucleotide polymorphism and 663 postmenopausal women. The AA genotype of rs2241777 single nucleotide polymorphism at the 3'UTR region in the SLC25A32 gene was associated with lower plasma folate concentration compared with the other genotypes in 851 postmenopausal women. A total of 674 postmenopausal ambulatory Japanese women were followed up for 5.5 ± 0.1 years (mean ± SE). The AA genotype groups also showed an apparently higher rate and earlier onset of incident fractures than the other genotypes. A total of 407 participants had >70% young-adult mean bone mineral density at the start of the observation. These results show that the SLC25A32 gene polymorphism could be a risk factor for lower folate concentration and future fracture. © 2013 Japan Geriatrics Society.

  1. Interleukin gene polymorphisms and breast cancer: a case control study and systematic literature review

    PubMed Central

    Balasubramanian, SP; Azmy, IAF; Higham, SE; Wilson, AG; Cross, SS; Cox, A; Brown, NJ; Reed, MW

    2006-01-01

    Background Interleukins and cytokines play an important role in the pathogenesis of many solid cancers. Several single nucleotide polymorphisms (SNPs) identified in cytokine genes are thought to influence the expression or function of these proteins and many have been evaluated for their role in inflammatory disease and cancer predisposition. The aim of this study was to evaluate any role of specific SNPs in the interleukin genes IL1A, IL1B, IL1RN, IL4R, IL6 and IL10 in predisposition to breast cancer susceptibility and severity. Methods Candidate single nucleotide polymorphisms (SNPs) in key cytokine genes were genotyped in breast cancer patients and in appropriate healthy volunteers who were similar in age, race and sex. Genotyping was performed using a high throughput allelic discrimination method. Data on clinico-pathological details and survival were collected. A systematic review of Medline English literature was done to retrieve previous studies of these polymorphisms in breast cancer. Results None of the polymorphisms studied showed any overall predisposition to breast cancer susceptibility, severity or to time to death or occurrence of distant metastases. The results of the systematic review are summarised. Conclusion Polymorphisms within key interleukin genes (IL1A, IL1B, IL1RN, IL4R, IL6 and IL10 do not appear to play a significant overall role in breast cancer susceptibility or severity. PMID:16842617

  2. The Association of Polymorphisms in Leptin/Leptin Receptor Genes and Ghrelin/Ghrelin Receptor Genes With Overweight/Obesity and the Related Metabolic Disturbances: A Review.

    PubMed

    Ghalandari, Hamid; Hosseini-Esfahani, Firoozeh; Mirmiran, Parvin

    2015-07-01

    Leptin and ghrelin are two important appetite and energy balance-regulating peptides. Common polymorphisms in the genes coding these peptides and their related receptors are shown to be associated with body weight, different markers of obesity and metabolic abnormalities. This review article aims to investigate the association of common polymorphisms of these genes with overweight/obesity and the metabolic disturbances related to it. The keywords leptin, ghrelin, polymorphism, single-nucleotide polymorphism (SNP), obesity, overweight, Body Mass Index, metabolic syndrome, and type 2 diabetes mellitus (T2DM) (MeSH headings) were used to search in the following databases: Pubmed, Sciencedirect (Elsevier), and Google scholar. Overall, 24 case-control studies, relevant to our topic, met the criteria and were included in the review. The most prevalent leptin/leptin receptor genes (LEP/LEPR) and ghrelin/ghrelin receptor genes (GHRL/GHSR) single nucleotide polymorphisms studied were LEP G-2548A, LEPR Q223R, and Leu72Met, respectively. Nine studies of the 17 studies on LEP/LEPR, and three studies of the seven studies on GHRL/GHSR showed significant relationships. In general, our study suggests that the association between LEP/LEPR and GHRL/GHSR with overweight/obesity and the related metabolic disturbances is inconclusive. These results may be due to unidentified gene-environment interactions. More investigations are needed to further clarify this association.

  3. Application of virtual phase-shifting speckle-interferometry for detection of polymorphism in the Chlamydia trachomatis omp1 gene

    NASA Astrophysics Data System (ADS)

    Feodorova, Valentina A.; Saltykov, Yury V.; Zaytsev, Sergey S.; Ulyanov, Sergey S.; Ulianova, Onega V.

    2018-04-01

    Method of phase-shifting speckle-interferometry has been used as a new tool with high potency for modern bioinformatics. Virtual phase-shifting speckle-interferometry has been applied for detection of polymorphism in the of Chlamydia trachomatis omp1 gene. It has been shown, that suggested method is very sensitive to natural genetic mutations as single nucleotide polymorphism (SNP). Effectiveness of proposed method has been compared with effectiveness of the newest bioinformatic tools, based on nucleotide sequence alignment.

  4. Single nucleotide polymorphism analysis using different colored dye dimer probes

    NASA Astrophysics Data System (ADS)

    Marmé, Nicole; Friedrich, Achim; Denapaite, Dalia; Hakenbeck, Regine; Knemeyer, Jens-Peter

    2006-09-01

    Fluorescence quenching by dye dimer formation has been utilized to develop hairpin-structured DNA probes for the detection of a single nucleotide polymorphism (SNP) in the penicillin target gene pbp2x, which is implicated in the penicillin resistance of Streptococcus pneumoniae. We designed two specific DNA probes for the identification of the pbp2x genes from a penicillin susceptible strain R6 and a resistant strain Streptococcus mitis 661 using green-fluorescent tetramethylrhodamine (TMR) and red-fluorescent DY-636, respectively. Hybridization of each of the probes to its respective target DNA sequence opened the DNA hairpin probes, consequently breaking the nonfluorescent dye dimers into fluorescent species. This hybridization of the target with the hairpin probe achieved single nucleotide specific detection at nanomolar concentrations via increased fluorescence.

  5. Evidence from single nucleotide polymorphism analyses of ADVANCE study demonstrates EFNB3 as a hypertension risk gene.

    PubMed

    Tremblay, Johanne; Wang, Yujia; Raelson, John; Marois-Blanchet, Francois-Christophe; Wu, Zenghui; Luo, Hongyu; Bradley, Edward; Chalmers, John; Woodward, Mark; Harrap, Stephen; Hamet, Pavel; Wu, Jiangping

    2017-03-08

    EPH kinases and their ligands, ephrins (EFNs), have vital and diverse biological functions. We recently reported that Efnb3 gene deletion results in hypertension in female but not male mice. These data suggest that EFNB3 regulates blood pressure in a sex- and sex hormone-dependent way. In the present study, we conducted a human genetic study to assess the association of EFNB3 single nucleotide polymorphisms with human hypertension risks, using 3,448 patients with type 2 diabetes from the ADVANCE study (Action in Diabetes and Vascular Disease: Peterax and Diamicron MR Controlled Evaluation). We have observed significant association between 2 SNPs in the 3' untranslated region or within the adjacent region just 3' of the EFNB3 gene with hypertension, corroborating our findings from the mouse model. Thus, our investigation has shown that EFNB3 is a hypertension risk gene in certain individuals.

  6. Cyclooxygenase 2 gene polymorphisms and chronic periodontitis in a North Indian population: a pilot study

    PubMed Central

    Daing, Anika; Singh, Sarvendra Vikram; Saimbi, Charanjeet Singh; Khan, Mohammad Akhlaq

    2012-01-01

    Purpose Cyclooxygenase (COX) enzyme catalyzes the production of prostaglandins, which are important mediators of tissue destruction in periodontitis. Single nucleotide polymorphisms of COX2 enzyme have been associated with increasing susceptibility to inflammatory diseases. The present study evaluates the association of two single nucleotide polymorphisms in COX2 gene (-1195G>A and 8473C>T) with chronic periodontitis in North Indians. Methods Both SNPs and their haplotypes were used to explore the associations between COX2 polymorphisms and chronic periodontitis in 56 patients and 60 controls. Genotyping was done by polymerase chain reaction followed by restriction fragment length polymorphism. Chi-square test and logistic regression analysis were performed for association analysis. Results By the individual genotype analysis, mutant genotypes (GA and AA) of COX2 -1195 showed more than a two fold risk (odds ratio [OR]>2) and COX2 8473 (TC and CC) showed a reduced risk for the disease, but the findings were not statistically significant. Haplotype analysis showed that the frequency of the haplotype AT was higher in the case group and a significant association was found for haplotype AT (OR, 1.79; 95% confidence interval, 1.03 to 3.11; P=0.0370) indicating an association between the AT haplotype of COX2 gene SNPs and chronic periodontitis. Conclusions Individual genotypes of both the SNPs were not associated while haplotype AT was found to be associated with chronic periodontitis in North Indians. PMID:23185695

  7. Structural and functional impacts of copy number variations on the cattle genome

    USDA-ARS?s Scientific Manuscript database

    Although there have been significant advances in resolving the pattern and nature of single nucleotide polymorphisms (SNPs), similar realizations for larger, more complex forms of genetic variation have just emerged. Several recent publications reveal that copy number variations (CNVs) are common an...

  8. Single nucleotide polymorphisms in the CXCR1 gene and its association with clinical mastitis incidence in Polish Holstein-Friesian cows.

    PubMed

    Pokorska, J; Dusza, M; Kułaj, D; Żukowski, K; Makulska, J

    2016-04-28

    The aim of this study was to identify the association between single nucleotide polymorphisms (SNPs) in the bovine chemokine receptor (CXCR1) gene and the resistance or susceptibility of cows to mastitis. The analysis of the CXCR1 polymorphism was carried out using polymerase chain reaction restriction fragment length polymorphism analysis for six SNP mutations (c.+291C>T, c.+365T>C, c.+816C>A, c.+819G>A, +1093C>T, and +1373C>A), of which four were located within the coding region and two in the 3'UTR region of the CXCR1 gene. Genetic material from 146 Polish Holstein-Friesian cows was analyzed after dividing into two groups depending on the incidence of clinical mastitis. Identified polymorphisms were in linkage disequilibrium and formed two linkage groups. Three haplotypes (CCCATA, TTAGCC, CTCGCC), forming six haplotype combinations, were detected. The logistic regression showed a significant association between the CC genotype at c.+365T>C and susceptibility of cows to clinical mastitis (P = 0.047). The frequency of haplotype combination 1/1 (CCCATA/CCCATA) was not significantly higher in cows susceptible to mastitis (P = 0.062). Of the identified SNP mutations, only c.+365T>C is a nonsynonymous mutation that induces a change in the coded protein [GCC (Ala) to GTC (Val) at the 122nd amino acid]. This amino acid change can result in changes in receptor function, which may be a reason for the increased mastitis incidence observed in cows with polymorphism at this site.

  9. N-acetyltransferase single nucleotide polymorphisms: Emerging concepts serve as a paradigm for understanding complexities of personalized medicine

    PubMed Central

    Hein, David W.

    2009-01-01

    Arylamine N-acetyltransferase 1 (NAT1) and 2 (NAT2) exhibit single nucleotide polymorphisms (SNPs) in human populations that modify drug and carcinogen metabolism. This paper updates the identity, location, and functional effects of these SNPs and then follows with emerging concepts for understanding why pharmacogenetic findings may not be replicated consistently. Using this paradigm as an example, laboratory-based mechanistic analyses can reveal complexities such that genetic polymorphisms become biologically and medically relevant when confounding factors are more fully understood and considered. As medical care moves to a more personalized approach, the implications of these confounding factors will be important in understanding the complexities of personalized medicine. PMID:19379125

  10. Single nucleotide polymorphisms in the mitochondrial displacement loop and outcome of esophageal squamous cell carcinoma.

    PubMed

    Zhang, Ruixing; Wang, Rui; Zhang, Fengbin; Wu, Chensi; Fan, Haiyan; Li, Yan; Wang, Cuiju; Guo, Zhanjun

    2010-11-26

    Accumulation of single nucleotide polymorphisms (SNPs) in the displacement loop (D-loop) of mitochondrial DNA (mtDNA) has been described for different types of cancers and might be associated with cancer risk and disease outcome. We used a population-based series of esophageal squamous cell carcinoma (ESCC) patients for investigating the prediction power of SNPs in mitochondrial D-loop. The D-loop region of mtDNA was sequenced for 60 ESCC patients recorded in the Fourth Hospital of Hebei Medical University between 2003 and 2004. The 5 year survival curve were calculated with the Kaplan-Meier method and compared by the log-rank test at each SNP site, a multivariate survival analysis was also performed with the Cox proportional hazards method. The SNP sites of nucleotides 16274G/A, 16278C/T and 16399A/G were identified for prediction of post-operational survival by the log-rank test. In an overall multivariate analysis, the 16278 and 16399 alleles were identified as independent predictors of ESCC outcome. The length of survival of patients with the minor allele 16278T genotype was significantly shorter than that of patients with 16278C at the 16278 site (relative risk, 3.001; 95% CI, 1.029 - 8.756; p = 0.044). The length of survival of patients with the minor allele 16399G genotype was significantly shorter than that of patients with the more frequent allele 16399A at the 16399 site in ESCC patients (relative risk, 3.483; 95% CI, 1.068 - 11.359; p = 0.039). Genetic polymorphisms in the D-loop are independent prognostic markers for patients with ESCC. Accordingly, the analysis of genetic polymorphisms in the mitochondrial D-loop can help identify patient subgroups at high risk of a poor disease outcome.

  11. Leu72Met408 Polymorphism of the Ghrelin Gene Is Associated With Early Phase of Gastric Emptying in the Patients With Functional Dyspepsia in Japan

    PubMed Central

    Yamawaki, Hiroshi; Futagami, Seiji; Shimpuku, Mayumi; Shindo, Tomotaka; Maruki, Yuuta; Nagoya, Hiroyuki; Kodaka, Yasuhiro; Sato, Hitomi; Gudis, Katya; Kawagoe, Tetsuro; Sakamoto, Choitsu

    2015-01-01

    Background/Aims There are no available data about the relationship between ghrelin gene genotypes and early phase of gastric emptying in functional dyspepsia (FD) as defined by Rome III classification. Methods We enrolled 74 patients presenting with typical symptoms of FD and 64 healthy volunteers. Gastric motility was evaluated using the 13C-acetate breath test. We used Rome III criteria to evaluate upper abdominal symptoms and self-rating questionnaires for depression (SRQ-D) scores to determine status of depression. The Arg51Gln (346G>A), preproghrelin (3056T>C), Leu72Met (408C>A), Gln90Leu (3412T>A) and G-protein β3 (825C>T) polymorphisms were analyzed in the DNA from blood samples of enrolled subjects. Genotyping was performed by polymerase chain reaction. Results There was a significant relationship between the Gln90Leu3412 genotype and SRQ-D score in FD patients (P = 0.009). Area under the curve at 15 minutes (AUC15) value was significantly associated with the Leu72Met408 genotype (P = 0.015) but not with entire gastric emptying. Conclusions The Leu72Met (408C>A) single nucleotide polymorphism was significantly associated with early phase of gastric emptying in FD patients. Further studies will be necessary to clarify the association between ghrelin gene single nucleotide polymorphisms and early phase of gastric emptying in FD patients. PMID:25540946

  12. Leu72Met408 Polymorphism of the Ghrelin Gene Is Associated With Early Phase of Gastric Emptying in the Patients With Functional Dyspepsia in Japan.

    PubMed

    Yamawaki, Hiroshi; Futagami, Seiji; Shimpuku, Mayumi; Shindo, Tomotaka; Maruki, Yuuta; Nagoya, Hiroyuki; Kodaka, Yasuhiro; Sato, Hitomi; Gudis, Katya; Kawagoe, Tetsuro; Sakamoto, Choitsu

    2015-01-01

    There are no available data about the relationship between ghrelin gene genotypes and early phase of gastric emptying in functional dyspepsia (FD) as defined by Rome III classification. We enrolled 74 patients presenting with typical symptoms of FD and 64 healthy volunteers. Gastric motility was evaluated using the 13C-acetate breath test. We used Rome III criteria to evaluate upper abdominal symptoms and self-rating questionnaires for depression (SRQ-D) scores to determine status of depression. The Arg51Gln (346G->A), preproghrelin (3056T->C), Leu72Met (408C->A), Gln90Leu (3412T->A) and G-protein 3 (825C->T) polymorphisms were analyzed in the DNA from blood samples of enrolled subjects. Genotyping was performed by polymerase chain reaction. There was a significant relationship between the Gln90Leu3412 genotype and SRQ-D score in FD patients (P = 0.009). Area under the curve at 15 minutes (AUC15) value was significantly associated with the Leu72Met408 genotype (P = 0.015) but not with entire gastric emptying. The Leu72Met (408C->A) single nucleotide polymorphism was significantly associated with early phase of gastric emptying in FD patients. Further studies will be necessary to clarify the association between ghrelin gene single nucleotide polymorphisms and early phase of gastric emptying in FD patients.

  13. A genotyping system capable of simultaneously analyzing >1000 single nucleotide polymorphisms in a haploid genome.

    PubMed

    Wang, Hui-Yun; Luo, Minjie; Tereshchenko, Irina V; Frikker, Danielle M; Cui, Xiangfeng; Li, James Y; Hu, Guohong; Chu, Yi; Azaro, Marco A; Lin, Yong; Shen, Li; Yang, Qifeng; Kambouris, Manousos E; Gao, Richeng; Shih, Weichung; Li, Honghua

    2005-02-01

    A high-throughput genotyping system for scoring single nucleotide polymorphisms (SNPs) has been developed. With this system, >1000 SNPs can be analyzed in a single assay, with a sensitivity that allows the use of single haploid cells as starting material. In the multiplex polymorphic sequence amplification step, instead of attaching universal sequences to the amplicons, primers that are unlikely to have nonspecific and productive interactions are used. Genotypes of SNPs are then determined by using the widely accessible microarray technology and the simple single-base extension assay. Three SNP panels, each consisting of >1000 SNPs, were incorporated into this system. The system was used to analyze 24 human genomic DNA samples. With 5 ng of human genomic DNA, the average detection rate was 98.22% when single probes were used, and 96.71% could be detected by dual probes in different directions. When single sperm cells were used, 91.88% of the SNPs were detectable, which is comparable to the level that was reached when very few genetic markers were used. By using a dual-probe assay, the average genotyping accuracy was 99.96% for 5 ng of human genomic DNA and 99.95% for single sperm. This system may be used to significantly facilitate large-scale genetic analysis even if the amount of DNA template is very limited or even highly degraded as that obtained from paraffin-embedded cancer specimens, and to make many unpractical research projects highly realistic and affordable.

  14. Niemann-Pick C1 modulates hepatic triglyceride metabolism and its genetic variation contributes to serum triglyceride levels.

    PubMed

    Uronen, Riikka-Liisa; Lundmark, Per; Orho-Melander, Marju; Jauhiainen, Matti; Larsson, Kristina; Siegbahn, Agneta; Wallentin, Lars; Zethelius, Björn; Melander, Olle; Syvänen, Ann-Christine; Ikonen, Elina

    2010-08-01

    To study how Niemann-Pick disease type C1 (NPC1) influences hepatic triacylglycerol (TG) metabolism and to determine whether this is reflected in circulating lipid levels. In Npc1(-/-) mice, the hepatic cholesterol content is increased but the TG content is decreased. We investigated lipid metabolism in Npc1(-/-) mouse hepatocytes and the association of NPC1 single-nucleotide polymorphisms with circulating TGs in humans. TGs were reduced in Npc1(-/-) mouse serum and hepatocytes. In Npc1(-/-) hepatocytes, the incorporation of [3H]oleic acid and [3H]acetate into TG was decreased, but shunting of oleic acid- or acetate-derived [3H]carbons into cholesterol was increased. Inhibition of cholesterol synthesis normalized TG synthesis, content, and secretion in Npc1(-/-) hepatocytes, suggesting increased hepatic cholesterol neogenesis as a cause for the reduced TG content and secretion. We found a significant association between serum TG levels and 5 common NPC1 single-nucleotide polymorphisms in a cohort of 1053 men, with the lowest P=8.7 x 10(-4) for the single-nucleotide polymorphism rs1429934. The association between the rs1429934 A allele and higher TG levels was replicated in 2 additional cohorts, which included 8041 individuals. This study provides evidence of the following: (1) in mice, loss of NPC1 function reduces hepatocyte TG content and secretion by increasing the metabolic flux of carbons into cholesterol synthesis; and (2) common variation in NPC1 contributes to serum TG levels in humans.

  15. Association of ABCB1 and ABCG2 single nucleotide polymorphisms with clinical findings and response to chemotherapy treatments in Kurdish patients with breast cancer.

    PubMed

    Ghafouri, Houshiyar; Ghaderi, Bayazid; Amini, Sabrieh; Nikkhoo, Bahram; Abdi, Mohammad; Hoseini, Abdolhakim

    2016-06-01

    The possible interaction between gene polymorphisms and risk of cancer progression is very interesting. Polymorphisms in multi-drug resistance genes have an important role in response to anti-cancer drugs. The present study was aimed to evaluate the possible effects of ABCB1 C3435T and ABCG2 C421A single nucleotide polymorphisms on clinical and pathological outcomes of Kurdish patients with breast cancer. One hundred breast cancer patients and 200 healthy controls were enrolled in this case-control study. Clinical and pathological findings of all individuals were reported, and immunohistochemistry staining was used to assess the tissue expression of specific breast cancer proteins. The ABCB1 C3435T and ABCG2 C421 genotypes were determined by polymerase chain reaction-restriction fragment length polymorphism method (PCR-RFLP). The distribution of different genotypes between patient and control groups was only significant for ABCG2 C421A. A allele of ABCG2 C421A polymorphisms were significantly higher in patients than in controls. Patients with AA genotype of ABCG2 C421A were at higher risk of progressing breast cancer. Patients with A allele of ABCG2 had complete response to chemotherapeutic agents. There was no statistically significant association between ABCB1 C3435T and ABCG2 C421A polymorphisms and tissue expression of ER, PR, Her2/neu, and Ki67. The ABCB1 C3435T has no correlation with clinical findings and treatment with chemotherapy drugs. The A allele of ABCG2 C421A may be a risk factor for progression of breast cancer in Kurdish patients. In addition, breast cancer patients with C allele of this polymorphism have weaker response to treatments with anthracyclines and Paclitaxol.

  16. Amino acid sequence of the Amur tiger prion protein.

    PubMed

    Wu, Changde; Pang, Wanyong; Zhao, Deming

    2006-10-01

    Prion diseases are fatal neurodegenerative disorders in human and animal associated with conformational conversion of a cellular prion protein (PrP(C)) into the pathologic isoform (PrP(Sc)). Various data indicate that the polymorphisms within the open reading frame (ORF) of PrP are associated with the susceptibility and control the species barrier in prion diseases. In the present study, partial Prnp from 25 Amur tigers (tPrnp) were cloned and screened for polymorphisms. Four single nucleotide polymorphisms (T423C, A501G, C511A, A610G) were found; the C511A and A610G nucleotide substitutions resulted in the amino acid changes Lysine171Glutamine and Alanine204Threoine, respectively. The tPrnp amino acid sequence is similar to house cat (Felis catus ) and sheep, but differs significantly from other two cat Prnp sequences that were previously deposited in GenBank.

  17. Genetic associations with lipoprotein subfraction measures differ by ethnicity in the multi-ethnic study of atherosclerosis (MESA)

    USDA-ARS?s Scientific Manuscript database

    A recent genome-wide association study associated 62 single nucleotide polymorphisms (SNPs) from 43 genomic loci, with fasting lipoprotein subfractions in European–Americans (EAs) at genome-wide levels of significance across three independent samples. Whether these associations are consistent across...

  18. Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

    PubMed

    Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

    2006-03-01

    Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

  19. Integrated Cox's model for predicting survival time of glioblastoma multiforme.

    PubMed

    Ai, Zhibing; Li, Longti; Fu, Rui; Lu, Jing-Min; He, Jing-Dong; Li, Sen

    2017-04-01

    Glioblastoma multiforme is the most common primary brain tumor and is highly lethal. This study aims to figure out signatures for predicting the survival time of patients with glioblastoma multiforme. Clinical information, messenger RNA expression, microRNA expression, and single-nucleotide polymorphism array data of patients with glioblastoma multiforme were retrieved from The Cancer Genome Atlas. Patients were separated into two groups by using 1 year as a cutoff, and a logistic regression model was used to figure out any variables that can predict whether the patient was able to live longer than 1 year. Furthermore, Cox's model was used to find out features that were correlated with the survival time. Finally, a Cox model integrated the significant clinical variables, messenger RNA expression, microRNA expression, and single-nucleotide polymorphism was built. Although the classification method failed, signatures of clinical features, messenger RNA expression levels, and microRNA expression levels were figured out by using Cox's model. However, no single-nucleotide polymorphisms related to prognosis were found. The selected clinical features were age at initial diagnosis, Karnofsky score, and race, all of which had been suggested to correlate with survival time. Both of the two significant microRNAs, microRNA-221 and microRNA-222, were targeted to p27 Kip1 protein, which implied the important role of p27 Kip1 on the prognosis of glioblastoma multiforme patients. Our results suggested that survival modeling was more suitable than classification to figure out prognostic biomarkers for patients with glioblastoma multiforme. An integrated model containing clinical features, messenger RNA levels, and microRNA expression levels was built, which has the potential to be used in clinics and thus to improve the survival status of glioblastoma multiforme patients.

  20. Atrial Fibrillation Genetic Risk and Ischemic Stroke Mechanisms.

    PubMed

    Lubitz, Steven A; Parsons, Owen E; Anderson, Christopher D; Benjamin, Emelia J; Malik, Rainer; Weng, Lu-Chen; Dichgans, Martin; Sudlow, Cathie L; Rothwell, Peter M; Rosand, Jonathan; Ellinor, Patrick T; Markus, Hugh S; Traylor, Matthew

    2017-06-01

    Atrial fibrillation (AF) is a leading cause of cardioembolic stroke, but the relationship between AF and noncardioembolic stroke subtypes are unclear. Because AF may be unrecognized, and because AF has a substantial genetic basis, we assessed for predisposition to AF across ischemic stroke subtypes. We examined associations between AF genetic risk and Trial of Org 10172 in Acute Stroke Treatment stroke subtypes in 2374 ambulatory individuals with ischemic stroke and 5175 without from the Wellcome Trust Case-Control Consortium 2 using logistic regression. We calculated AF genetic risk scores using single-nucleotide polymorphisms associated with AF in a previous independent analysis across a range of preselected significance thresholds. There were 460 (19.4%) individuals with cardioembolic stroke, 498 (21.0%) with large vessel, 474 (20.0%) with small vessel, and 814 (32.3%) individuals with strokes of undetermined cause. Most AF genetic risk scores were associated with stroke, with the strongest association ( P =6×10 - 4 ) attributed to scores of 944 single-nucleotide polymorphisms (each associated with AF at P <1×10 - 3 in a previous analysis). Associations between AF genetic risk and stroke were enriched in the cardioembolic stroke subset (strongest P =1.2×10 - 9 , 944 single-nucleotide polymorphism score). In contrast, AF genetic risk was not significantly associated with noncardioembolic stroke subtypes. Comprehensive AF genetic risk scores were specific for cardioembolic stroke. Incomplete workups and subtype misclassification may have limited the power to detect associations with strokes of undetermined pathogenesis. Future studies are warranted to determine whether AF genetic risk is a useful biomarker to enhance clinical discrimination of stroke pathogeneses. © 2017 American Heart Association, Inc.

  1. Chosen single nucleotide polymorphisms (SNPs) of enamel formation genes and dental caries in a population of Polish children.

    PubMed

    Gerreth, Karolina; Zaorska, Katarzyna; Zabel, Maciej; Borysewicz-Lewicka, Maria; Nowicki, Michał

    2017-09-01

    It is increasingly emphasized that the influence of a host's factors in the etiology of dental caries are of most interest, particularly those concerned with genetic aspect. The aim of the study was to analyze the genotype and allele frequencies of single nucleotide polymorphisms (SNPs) in AMELX, AMBN, TUFT1, TFIP11, MMP20 and KLK4 genes and to prove their association with dental caries occurrence in a population of Polish children. The study was performed in 96 children (48 individuals with caries - "cases" and 48 free of this disease - "controls"), aged 20-42 months, chosen out of 262 individuals who had dental examination performed and attended 4 day nurseries located in Poznań (Poland). From both groups oral swab was collected for molecular evaluation. Eleven selected SNPs markers were genotyped by Sanger sequencing. Genotype and allele frequencies were calculated and a standard χ2 analysis was used to test for deviation from Hardy-Weinberg equilibrium. The association of genetic variations with caries susceptibility or resistance was assessed by the Fisher's exact test and p ≤ 0.05 was considered statistically significant. Five markers were significantly associated with caries incidence in children in the study: rs17878486 in AMELX (p < 0.0001), rs34538475 in AMBN (p < 0.0001), rs2337360 in TUFT1 (p < 0.0001), and rs2235091 (p = 0.0085) and rs198969 (p = 0.0069) in KLK4. Genotype and allele frequencies indicated both risk and protective variants for these markers. Single nucleotide polymorphisms in AMELX, AMBN, TUFT1, KLK4 genes may be considered as a risk factor for dental caries occurrence in Polish children.

  2. An EPAS1 haplotype is associated with high altitude polycythemia in male Han Chinese at the Qinghai-Tibetan plateau.

    PubMed

    Chen, Yu; Jiang, Chunhua; Luo, Yongjun; Liu, Fuyu; Gao, Yuqi

    2014-12-01

    Hemoglobin concentration at high altitude is considered an important marker of high altitude adaptation, and native Tibetans in the Qinghai-Tibetan plateau show lower hemoglobin concentrations than Han people who have emigrated from plains areas. Genetic studies revealed that EPAS1 plays a key role in high altitude adaptation and is associated with the low hemoglobin concentration in Tibetans. Three single nucleotide polymorphisms (rs13419896, rs4953354, rs1868092) of noncoding regions in EPAS1 exhibited significantly different allele frequencies in the Tibetan and Han populations and were associated with low hemoglobin concentrations in Tibetans. To explore the hereditary basis of high altitude polycythemia (HAPC) and investigate the association between EPAS1 and HAPC in the Han population, these 3 single nucleotide polymorphisms were assessed in 318 male Han Chinese HAPC patients and 316 control subjects. Genotyping was performed by high resolution melting curve analysis. The G-G-G haplotype of rs13419896, rs4953354, and rs1868092 was significantly more frequent in HAPC patients than in control subjects, whereas no differences in the allele or genotype frequencies of the 3 single nucleotide polymorphisms were found between HAPC patients and control subjects. Moreover, genotypes of rs1868092 (AA) and rs4953354 (GG) that were not observed in the Chinese Han in the Beijing population were found at frequencies of 1.6% and 0.9%, respectively, in our study population of HAPC patients and control subjects. Carriers of this EPAS1 haplotype (G-G-G, rs13419896, rs4953354, and rs1868092) may have a higher risk for HAPC. These results may contribute to a better understanding of the pathogenesis of HAPC in the Han population. Copyright © 2014 Wilderness Medical Society. Published by Elsevier Inc. All rights reserved.

  3. Single-feature polymorphism discovery in the barley transcriptome

    PubMed Central

    Rostoks, Nils; Borevitz, Justin O; Hedley, Peter E; Russell, Joanne; Mudie, Sharon; Morris, Jenny; Cardle, Linda; Marshall, David F; Waugh, Robbie

    2005-01-01

    A probe-level model for analysis of GeneChip gene-expression data is presented which identified more than 10,000 single-feature polymorphisms (SFP) between two barley genotypes. The method has good sensitivity, as 67% of known single-nucleotide polymorphisms (SNP) were called as SFPs. This method is applicable to all oligonucleotide microarray data, accounts for SNP effects in gene-expression data and represents an efficient and versatile approach for highly parallel marker identification in large genomes. PMID:15960806

  4. Associations of polymorphisms in the Pit-1 gene with growth and carcass traits in Angus beef cattle.

    PubMed

    Zhao, Q; Davis, M E; Hines, H C

    2004-08-01

    The Pit-1 gene was studied as a candidate for genetic markers of growth and carcass traits. Angus beef cattle that were divergently selected for high- or low-blood serum IGF-I concentration were used in this study. The single-strand conformation polymorphism method was used to identify polymorphism in the Pit-1 gene including regions from intron 2 to exon 6. Two polymorphisms, Pit1I3H (HinfI) and Pit1I3NL (NlaIII), were detected in intron 3 of the Pit-1 gene. One polymorphism, Pit1I4N (BstNI), was found in intron 4, and a single nucleotide polymorphism, Pit1I5, was found in intron 5. The previously reported polymorphism in exon 6, Pit1E6H (HinfI), was also studied in 416 Angus beef cattle. Associations of the polymorphisms with growth traits, carcass traits, and IGF-I concentration were analyzed using a general linear model procedure. No significant associations were observed between these polymorphisms and growth and carcass traits.

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mangoni, Monica; Bisanzi, Simonetta; Carozzi, Francesca

    Purpose: Clinical radiosensitivity varies considerably among patients, and radiation-induced side effects developing in normal tissue can be therapy limiting. Some single nucleotide polymorphisms (SNPs) have been shown to correlate with hypersensitivity to radiotherapy. We conducted a prospective study of 87 female patients with breast cancer who received radiotherapy after breast surgery. We evaluated the association between acute skin reaction following radiotherapy and 11 genetic polymorphisms in DNA repair genes: XRCC1 (Arg399Gln and Arg194Trp), XRCC3 (Thr241Met), XPD (Asp312Asn and Lys751Gln), MSH2 (gIVS12-6T>C), MLH1 (Ile219Val), MSH3 (Ala1045Thr), MGMT (Leu84Phe), and in damage-detoxification GSTM1 and GSTT1 genes (allele deletion). Methods and Materials: Individualmore » genetic polymorphisms were determined by polymerase chain reaction and single nucleotide primer extension for single nucleotide polymorphisms or by a multiplex polymerase chain reaction assay for deletion polymorphisms. The development of severe acute skin reaction (moist desquamation or interruption of radiotherapy due to toxicity) associated with genetic polymorphisms was modeled using Cox proportional hazards, accounting for cumulative biologically effective radiation dose. Results: Radiosensitivity developed in eight patients and was increased in carriers of variants XRCC3-241Met allele (hazard ratio [HR] unquantifiably high), MSH2 gIVS12-6nt-C allele (HR = 53.36; 95% confidence intervals [95% CI], 3.56-798.98), and MSH3-1045Ala allele (HR unquantifiably high). Carriers of XRCC1-Arg194Trp variant allele in combination with XRCC1-Arg399Gln wild-type allele had a significant risk of radiosensitivity (HR = 38.26; 95% CI, 1.19-1232.52). Conclusions: To our knowledge, this is the first report to find an association between MSH2 and MSH3 genetic variants and the development of radiosensitivity in breast cancer patients. Our findings suggest the hypothesis that mismatch repair mechanisms may be involved in cellular response to radiotherapy. Genetic polymorphisms may be promising candidates for predicting acute radiosensitivity, but further studies are necessary to confirm our findings.« less

  6. Association of genome-wide variation with the risk of incident heart failure in adults of European and African ancestry: a prospective meta-analysis from the cohorts for heart and aging research in genomic epidemiology (CHARGE) consortium.

    PubMed

    Smith, Nicholas L; Felix, Janine F; Morrison, Alanna C; Demissie, Serkalem; Glazer, Nicole L; Loehr, Laura R; Cupples, L Adrienne; Dehghan, Abbas; Lumley, Thomas; Rosamond, Wayne D; Lieb, Wolfgang; Rivadeneira, Fernando; Bis, Joshua C; Folsom, Aaron R; Benjamin, Emelia; Aulchenko, Yurii S; Haritunians, Talin; Couper, David; Murabito, Joanne; Wang, Ying A; Stricker, Bruno H; Gottdiener, John S; Chang, Patricia P; Wang, Thomas J; Rice, Kenneth M; Hofman, Albert; Heckbert, Susan R; Fox, Ervin R; O'Donnell, Christopher J; Uitterlinden, Andre G; Rotter, Jerome I; Willerson, James T; Levy, Daniel; van Duijn, Cornelia M; Psaty, Bruce M; Witteman, Jacqueline C M; Boerwinkle, Eric; Vasan, Ramachandran S

    2010-06-01

    Although genetic factors contribute to the onset of heart failure (HF), no large-scale genome-wide investigation of HF risk has been published to date. We have investigated the association of 2,478,304 single-nucleotide polymorphisms with incident HF by meta-analyzing data from 4 community-based prospective cohorts: the Atherosclerosis Risk in Communities Study, the Cardiovascular Health Study, the Framingham Heart Study, and the Rotterdam Study. Eligible participants for these analyses were of European or African ancestry and free of clinical HF at baseline. Each study independently conducted genome-wide scans and imputed data to the approximately 2.5 million single-nucleotide polymorphisms in HapMap. Within each study, Cox proportional hazards regression models provided age- and sex-adjusted estimates of the association between each variant and time to incident HF. Fixed-effect meta-analyses combined results for each single-nucleotide polymorphism from the 4 cohorts to produce an overall association estimate and P value. A genome-wide significance P value threshold was set a priori at 5.0x10(-7). During a mean follow-up of 11.5 years, 2526 incident HF events (12%) occurred in 20 926 European-ancestry participants. The meta-analysis identified a genome-wide significant locus at chromosomal position 15q22 (1.4x10(-8)), which was 58.8 kb from USP3. Among 2895 African-ancestry participants, 466 incident HF events (16%) occurred during a mean follow-up of 13.7 years. One genome-wide significant locus was identified at 12q14 (6.7x10(-8)), which was 6.3 kb from LRIG3. We identified 2 loci that were associated with incident HF and exceeded genome-wide significance. The findings merit replication in other community-based settings of incident HF.

  7. Functional Analysis of a Novel Genome-Wide Association Study Signal in SMAD3 That Confers Protection From Coronary Artery Disease.

    PubMed

    Turner, Adam W; Martinuk, Amy; Silva, Anada; Lau, Paulina; Nikpay, Majid; Eriksson, Per; Folkersen, Lasse; Perisic, Ljubica; Hedin, Ulf; Soubeyrand, Sebastien; McPherson, Ruth

    2016-05-01

    A recent genome-wide association study meta-analysis identified an intronic single nucleotide polymorphism in SMAD3, rs56062135C>T, the minor allele (T) which associates with protection from coronary artery disease. Relevant to atherosclerosis, SMAD3 is a key contributor to transforming growth factor-β pathway signaling. Here, we seek to identify ≥1 causal coronary artery disease-associated single nucleotide polymorphisms at the SMAD3 locus and characterize mechanisms whereby the risk allele(s) contribute to coronary artery disease risk. By genetic and epigenetic fine mapping, we identified a candidate causal single nucleotide polymorphism rs17293632C>T (D', 0.97; r(2), 0.94 with rs56062135) in intron 1 of SMAD3 with predicted functional effects. We show that the sequence encompassing rs17293632 acts as a strong enhancer in human arterial smooth muscle cells. The common allele (C) preserves an activator protein (AP)-1 site and enhancer function, whereas the protective (T) allele disrupts the AP-1 site and significantly reduces enhancer activity (P<0.001). Pharmacological inhibition of AP-1 activity upstream demonstrates that this allele-specific enhancer effect is AP-1 dependent (P<0.001). Chromatin immunoprecipitation experiments reveal binding of several AP-1 component proteins with preferential binding to the (C) allele. We show that rs17293632 is an expression quantitative trait locus for SMAD3 in blood and atherosclerotic plaque with reduced expression of SMAD3 in carriers of the protective allele. Finally, siRNA knockdown of SMAD3 in human arterial smooth muscle cells increases cell viability, consistent with an antiproliferative role. The coronary artery disease-associated rs17293632C>T single nucleotide polymorphism represents a novel functional cis-acting element at the SMAD3 locus. The protective (T) allele of rs17293632 disrupts a consensus AP-1 binding site in a SMAD3 intron 1 enhancer, reduces enhancer activity and SMAD3 expression, altering human arterial smooth muscle cell proliferation. © 2016 American Heart Association, Inc.

  8. Interferon-gamma +874 T/A and interleukin-10 -1082 A/G single nucleotide polymorphism in Egyptian children with tuberculosis.

    PubMed

    Mosaad, Y M; Soliman, O E; Tawhid, Z E; Sherif, D M

    2010-10-01

    The aim was to investigate the association of interferon-gamma (IFN-γ) +874 T/A and interleukin-10 (IL-10)-1082 A/G single nucleotide polymorphisms with tuberculous infection and post-BCG lymphadenitis in Egyptian children. IFN-γ +874 T/A and IL-10 -1082 A/G polymorphism detection by amplification refractory mutation system technique was carried out for 110 patients with TB, 40 patients with post-BCG lymphadenitis and 118 healthy controls. IFN-γ +874 A allele was higher in TB and post-BCG patients than those in healthy controls (Pc=0.006 and 0.002, respectively). IFN-γ +874 genotype AA was significantly higher in patients with TB than that in control (Pc=0.015), in extrapulmonary than patients with pulmonary TB (PTB) (Pc=0.009), and young children with TB below 5 years (Pc=0.024). No statistically significant differences were observed between patients with TB and controls for the frequency of IL-10(-1082) alleles or genotypes (P>0.05); however, a statistically significant difference in the frequency of IL-10 (-1082) GG genotype was found between patients with pulmonary and extrapulmonary TB (Pc=0.003). Low producer IFN-γ +874 A/A genotype is associated with post-BCG lymphadenitis and TB disease especially in younger children below 5 years. IL-10-1082 G/G genotype did not exhibit significant association except for increased GG frequency in PTB. Both cytokine polymorphisms have no relation to tuberculin reaction in patients with TB. © 2010 The Authors. Scandinavian Journal of Immunology © 2010 Blackwell Publishing Ltd.

  9. Association of Ugrp2 gene polymorphisms with adenoid hypertrophy in the pediatric population.

    PubMed

    Atilla, Mahmut Huntürk; Özdaş, Sibel; Özdaş, Talih; Baştimur, Sibel; Muz, Sami Engin; Öz, Işılay; Kurt, Kenan; İzbirak, Afife; Babademez, Mehmet Ali; Vatandaş, Nilgün

    2017-08-01

    Adenoid hypertrophy is a condition that presents itself as the chronic enlargement of adenoid tissues; it is frequently observed in the pediatric population. The Ugrp2 gene, a member of the secretoglobin superfamily, encodes a low-molecular weight protein that functions in the differentiation of upper airway epithelial cells. However, little is known about the association of Ugrp2 genetic variations with adenoid hypertrophy. The aim of this study is to investigate the association of single nucleotide polymorphisms in the Ugrp2 gene with adenoid hypertrophy and its related phenotypes. A total of 219 children, comprising 114 patients suffering from adenoid hypertrophy and 105 healthy patients without adenoid hypertrophy, were enrolled in this study. Genotypes of the Ugrp2 gene were determined by DNA sequencing. We identified four single nucleotide polymorphisms (IVS1-189G>A, IVS1-89T>G, c.201delC, and IVS2-15G>A) in the Ugrp2 gene. Our genotype analysis showed that the Ugrp2 (IVS1-89T>G) TG and (c.201delC) CdelC genotypes and their minor alleles were associated with a considerable increase in the risk of adenoid hypertrophy compared with the controls (p=0.012, p=0.009, p=0.013, and p=0.037, respectively). Furthermore, Ugrp2 (GTdelCG, GTdelCA) haplotypes were significantly associated with adenoid hypertrophy (four single nucleotide polymorphisms ordered from 5' to 3'; p=0.0001). Polymorfism-Polymorfism interaction analysis indicated a strong interaction between combined genotypes of the Ugrp2 gene contributing to adenoid hypertrophy, as well as an increased chance of its diagnosis (p<0.0001). In addition, diplotypes carrying the mutant Ugrp2 (c.201delC) allele were strongly associated with an increased risk of adenoid hypertrophy with asthma and adenoid hypertrophy with allergies (p=0.003 and p=0.0007, respectively). Some single nucleotide polymorphisms and their combinations in the Ugrp2 gene are associated with an increased risk of developing adenoid hypertrophy. Therefore, we tried to underline the importance of genetic factors associated with adenoid hypertrophy and adenoid hypertrophy-related clinical phenotypes. Copyright © 2017 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.

  10. Evaluation of targeted exome sequencing for 28 protein-based blood group systems, including the homologous gene systems, for blood group genotyping.

    PubMed

    Schoeman, Elizna M; Lopez, Genghis H; McGowan, Eunike C; Millard, Glenda M; O'Brien, Helen; Roulis, Eileen V; Liew, Yew-Wah; Martin, Jacqueline R; McGrath, Kelli A; Powley, Tanya; Flower, Robert L; Hyland, Catherine A

    2017-04-01

    Blood group single nucleotide polymorphism genotyping probes for a limited range of polymorphisms. This study investigated whether massively parallel sequencing (also known as next-generation sequencing), with a targeted exome strategy, provides an extended blood group genotype and the extent to which massively parallel sequencing correctly genotypes in homologous gene systems, such as RH and MNS. Donor samples (n = 28) that were extensively phenotyped and genotyped using single nucleotide polymorphism typing, were analyzed using the TruSight One Sequencing Panel and MiSeq platform. Genes for 28 protein-based blood group systems, GATA1, and KLF1 were analyzed. Copy number variation analysis was used to characterize complex structural variants in the GYPC and RH systems. The average sequencing depth per target region was 66.2 ± 39.8. Each sample harbored on average 43 ± 9 variants, of which 10 ± 3 were used for genotyping. For the 28 samples, massively parallel sequencing variant sequences correctly matched expected sequences based on single nucleotide polymorphism genotyping data. Copy number variation analysis defined the Rh C/c alleles and complex RHD hybrids. Hybrid RHD*D-CE-D variants were correctly identified, but copy number variation analysis did not confidently distinguish between D and CE exon deletion versus rearrangement. The targeted exome sequencing strategy employed extended the range of blood group genotypes detected compared with single nucleotide polymorphism typing. This single-test format included detection of complex MNS hybrid cases and, with copy number variation analysis, defined RH hybrid genes along with the RHCE*C allele hitherto difficult to resolve by variant detection. The approach is economical compared with whole-genome sequencing and is suitable for a red blood cell reference laboratory setting. © 2017 AABB.

  11. Genetics of Oxidative Stress in Obesity

    PubMed Central

    Rupérez, Azahara I.; Gil, Angel; Aguilera, Concepción M.

    2014-01-01

    Obesity is a multifactorial disease characterized by the excessive accumulation of fat in adipose tissue and peripheral organs. Its derived metabolic complications are mediated by the associated oxidative stress, inflammation and hypoxia. Oxidative stress is due to the excessive production of reactive oxygen species or diminished antioxidant defenses. Genetic variants, such as single nucleotide polymorphisms in antioxidant defense system genes, could alter the efficacy of these enzymes and, ultimately, the risk of obesity; thus, studies investigating the role of genetic variations in genes related to oxidative stress could be useful for better understanding the etiology of obesity and its metabolic complications. The lack of existing literature reviews in this field encouraged us to gather the findings from studies focusing on the impact of single nucleotide polymorphisms in antioxidant enzymes, oxidative stress-producing systems and transcription factor genes concerning their association with obesity risk and its phenotypes. In the future, the characterization of these single nucleotide polymorphisms (SNPs) in obese patients could contribute to the development of controlled antioxidant therapies potentially beneficial for the treatment of obesity-derived metabolic complications. PMID:24562334

  12. Genetics of oxidative stress in obesity.

    PubMed

    Rupérez, Azahara I; Gil, Angel; Aguilera, Concepción M

    2014-02-20

    Obesity is a multifactorial disease characterized by the excessive accumulation of fat in adipose tissue and peripheral organs. Its derived metabolic complications are mediated by the associated oxidative stress, inflammation and hypoxia. Oxidative stress is due to the excessive production of reactive oxygen species or diminished antioxidant defenses. Genetic variants, such as single nucleotide polymorphisms in antioxidant defense system genes, could alter the efficacy of these enzymes and, ultimately, the risk of obesity; thus, studies investigating the role of genetic variations in genes related to oxidative stress could be useful for better understanding the etiology of obesity and its metabolic complications. The lack of existing literature reviews in this field encouraged us to gather the findings from studies focusing on the impact of single nucleotide polymorphisms in antioxidant enzymes, oxidative stress-producing systems and transcription factor genes concerning their association with obesity risk and its phenotypes. In the future, the characterization of these single nucleotide polymorphisms (SNPs) in obese patients could contribute to the development of controlled antioxidant therapies potentially beneficial for the treatment of obesity-derived metabolic complications.

  13. Imputation of single nucleotide polymorhpism genotypes of Hereford cattle: reference panel size, family relationship and population structure

    USDA-ARS?s Scientific Manuscript database

    The objective of this study is to investigate single nucleotide polymorphism (SNP) genotypes imputation of Hereford cattle. Purebred Herefords were from two sources, Line 1 Hereford (N=240) and representatives of Industry Herefords (N=311). Using different reference panels of 62 and 494 males with 1...

  14. Genetic variation and willingness to participate in epidemiologic research: data from three studies.

    PubMed

    Bhatti, Parveen; Sigurdson, Alice J; Wang, Sophia S; Chen, Jinbo; Rothman, Nathaniel; Hartge, Patricia; Bergen, Andrew W; Landi, Maria Teresa

    2005-10-01

    The differences in common genetic polymorphism frequencies by willingness to participate in epidemiologic studies are unexplored, but the same threats to internal validity operate as for studies with nongenetic information. We analyzed single nucleotide polymorphism genotypes, haplotypes, and short tandem repeats among control groups from three studies with different recruitment designs that included early, late, and never questionnaire responders, one or more participation incentives, and blood or buccal DNA collection. Among 2,955 individuals, we compared 108 genotypes, 8 haplotypes, and 9 to 15 short tandem repeats by respondent type. Among our main comparisons, single nucleotide polymorphism genotype frequencies differed significantly (P < 0.05) between respondent groups in six instances, with 13 expected by chance alone. When comparing the odds of carrying a variant among the various response groups, 19 odds ratios were /=1.40, levels that might be notably different. Among the various respondent group comparisons, haplotype and short tandem repeat frequencies were not significantly different by willingness to participate. We observed little evidence to suggest that genotype differences underlie response characteristics in molecular epidemiologic studies, but a greater variety of genes should be examined, including those related to behavioral traits potentially associated with willingness to participate. To the extent possible, investigators should evaluate their own genetic data for bias in response categories.

  15. Identification of a New Single-nucleotide Polymorphism within the Apolipoprotein A5 Gene, Which is Associated with Metabolic Syndrome.

    PubMed

    Salehi, Samaneh; Emadi-Baygi, Modjtaba; Rezaei, Majdaddin; Kelishadi, Roya; Nikpour, Parvaneh

    2017-01-01

    Metabolic syndrome (MetS) is a common disorder which is a constellation of clinical features including abdominal obesity, increased level of serum triglycerides (TGs) and decrease of serum high-density lipoprotein-cholesterol (HDL-C), elevated blood pressure, and glucose intolerance. The apolipoprotein A5 (APOA5) is involved in lipid metabolism, influencing the level of plasma TG and HDL-C. In the present study, we aimed to investigate the associations between four INDEL variants of APOA5 gene and the MetS risk. In this case-control study, we genotyped 116 Iranian children and adolescents with/without MetS by using Sanger sequencing method for these INDELs. Then, we explored the association of INDELs with MetS risk and their clinical components by logistic regression and one-way analysis of variance analyses. We identified a novel insertion polymorphism, c. *282-283 insAG/c. *282-283 insG variant, which appears among case and control groups. rs72525532 showed a significant difference for TG levels between various genotype groups. In addition, there were significant associations between newly identified single-nucleotide polymorphism (SNP) and rs72525532 with MetS risk. These results show that rs72525532 and the newly identified SNP may influence the susceptibility of the individuals to MetS.

  16. Association between a polymorphism in the IL-12p40 gene and cytomegalovirus reactivation after kidney transplantation.

    PubMed

    Hoffmann, Thomas W; Halimi, Jean-Michel; Büchler, Mathias; Velge-Roussel, Florence; Goudeau, Alain; Al Najjar, Azmi; Boulanger, Marie-Denise; Houssaini, Tarik Sqalli; Marliere, Jean-Frédéric; Lebranchu, Yvon; Baron, Christophe

    2008-05-27

    Cytomegalovirus (CMV) infection is associated with a significant rate of morbidity after organ transplantation. The genetic factors influencing its occurrence have been little investigated. IL-12 plays a crucial role in anti-infectious immune responses, especially by stimulating IFNgamma production. An A-to-C single nucleotide polymorphism (SNP) within the 3'-untranslated region of the IL-12p40 gene has been characterized and was reported to be both functionally and clinically relevant. However, the impact of this single nucleotide polymorphism on events after organ transplantation has never been reported. In this study, we investigated the impact of the 3'-untranslated region polymorphism on the occurrence of CMV infection in 469 kidney recipients transplanted at the University Hospital of Tours between 1995 and 2005. The polymorphism was genotyped using the restriction fragment length polymorphism method and CMV infection was determined by pp65 antigenemia. Multifactorial Cox regression analysis demonstrated that the presence of the C allele was an independent risk factor for CMV infection (OR=1.52, P=0.043), the risk being even higher when study was restricted to patients with positive CMV serological status before the graft and who did not receive any CMV prophylaxis (OR=1.88, P=0.028). This study identified a new genetic risk factor for CMV reactivation after kidney transplantation. The results of our study suggest that C carriers might especially benefit from CMV prophylaxis.

  17. The Association of Polymorphisms in Leptin/Leptin Receptor Genes and Ghrelin/Ghrelin Receptor Genes With Overweight/Obesity and the Related Metabolic Disturbances: A Review

    PubMed Central

    Ghalandari, Hamid; Hosseini-Esfahani, Firoozeh; Mirmiran, Parvin

    2015-01-01

    Context: Leptin and ghrelin are two important appetite and energy balance-regulating peptides. Common polymorphisms in the genes coding these peptides and their related receptors are shown to be associated with body weight, different markers of obesity and metabolic abnormalities. This review article aims to investigate the association of common polymorphisms of these genes with overweight/obesity and the metabolic disturbances related to it. Evidence Acquisition: The keywords leptin, ghrelin, polymorphism, single-nucleotide polymorphism (SNP), obesity, overweight, Body Mass Index, metabolic syndrome, and type 2 diabetes mellitus (T2DM) (MeSH headings) were used to search in the following databases: Pubmed, Sciencedirect (Elsevier), and Google scholar. Overall, 24 case-control studies, relevant to our topic, met the criteria and were included in the review. Results: The most prevalent leptin/leptin receptor genes (LEP/LEPR) and ghrelin/ghrelin receptor genes (GHRL/GHSR) single nucleotide polymorphisms studied were LEP G-2548A, LEPR Q223R, and Leu72Met, respectively. Nine studies of the 17 studies on LEP/LEPR, and three studies of the seven studies on GHRL/GHSR showed significant relationships. Conclusions: In general, our study suggests that the association between LEP/LEPR and GHRL/GHSR with overweight/obesity and the related metabolic disturbances is inconclusive. These results may be due to unidentified gene-environment interactions. More investigations are needed to further clarify this association. PMID:26425125

  18. Genotype-Phenotype Study of the Middle Gangetic Plain in India Shows Association of rs2470102 with Skin Pigmentation.

    PubMed

    Mishra, Anshuman; Nizammuddin, Sheikh; Mallick, Chandana Basu; Singh, Sakshi; Prakash, Satya; Siddiqui, Niyamat Ali; Rai, Niraj; Carlus, S Justin; Sudhakar, Digumarthi V S; Tripathi, Vishnu P; Möls, Märt; Kim-Howard, Xana; Dewangan, Hemlata; Mishra, Abhishek; Reddy, Alla G; Roy, Biswajit; Pandey, Krishna; Chaubey, Gyaneshwer; Das, Pradeep; Nath, Swapan K; Singh, Lalji; Thangaraj, Kumarasamy

    2017-03-01

    Our understanding of the genetics of skin pigmentation has been largely skewed towards populations of European ancestry, imparting less attention to South Asian populations, who behold huge pigmentation diversity. Here, we investigate skin pigmentation variation in a cohort of 1,167 individuals in the Middle Gangetic Plain of the Indian subcontinent. Our data confirm the association of rs1426654 with skin pigmentation among South Asians, consistent with previous studies, and also show association for rs2470102 single nucleotide polymorphism. Our haplotype analyses further help us delineate the haplotype distribution across social categories and skin color. Taken together, our findings suggest that the social structure defined by the caste system in India has a profound influence on the skin pigmentation patterns of the subcontinent. In particular, social category and associated single nucleotide polymorphisms explain about 32% and 6.4%, respectively, of the total phenotypic variance. Phylogeography of the associated single nucleotide polymorphisms studied across 52 diverse populations of the Indian subcontinent shows wide presence of the derived alleles, although their frequencies vary across populations. Our results show that both polymorphisms (rs1426654 and rs2470102) play an important role in the skin pigmentation diversity of South Asians. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  19. [Single-nucleotide polymorphism in populations of sockeye salmon Oncorhynchus nerka from Kamchatka Peninsula].

    PubMed

    Khrustaleva, A M; Gritsenko, O F; Klovach, N V

    2013-11-01

    The genetic polymorphism of 45 single-nucleotide polymorphism loci was examined in the four largest wild populations of sockeye salmon Oncorhynchusnerka from drainages of the Asian coast of the Pacific Ocean (Eastern and Western Kamchatka). It was demonstrated that sockeye salmon from the Palana River were considerably different from all other populations examined. The most probable explanation of the observed differences is the suggestion on possible demographic events in the history of this population associated with the decrease in its effective number. To study the origin, colonization patterns, and evolution of Asian sockeye salmon, as well as to resolve some of the applied tasks, like population assignment and genetic identification, a differentiation approach to SNP-marker selection was suggested. Adaptively important loci that evolve under the pressure of balancing (stabilizing) selection were identified, thanks to which the number of loci that provide the baseline classification error rates in the population assignment tests was reduced to 30. It was demonstrated that SNPs located in the MHC2 and GPH genes were affected by diversifying selection. Procedures for selecting single-nucleotide polymorphisms for phylogenetic studies of Asian sockeye salmon were suggested. Using principal-component analysis, 17 loci that adequately reproduce genetic differentiation within arid among the regions of the origin of Kamchatka sockeye salmon, were selected.

  20. Trichomonas vaginalis Metronidazole Resistance Is Associated with Single Nucleotide Polymorphisms in the Nitroreductase Genes ntr4Tv and ntr6Tv

    PubMed Central

    Paulish-Miller, Teresa E.; Augostini, Peter; Schuyler, Jessica A.; Smith, William L.; Mordechai, Eli; Adelson, Martin E.; Gygax, Scott E.; Secor, William E.

    2014-01-01

    Metronidazole resistance in the sexually transmitted parasite Trichomonas vaginalis is a problematic public health issue. We have identified single nucleotide polymorphisms (SNPs) in two nitroreductase genes (ntr4Tv and ntr6Tv) associated with resistance. These SNPs were associated with one of two distinct T. vaginalis populations identified by multilocus sequence typing, yet one SNP (ntr6Tv A238T), which results in a premature stop codon, was associated with resistance independent of population structure and may be of diagnostic value. PMID:24550324

  1. No association between apolipoprotein E or N-acetyltransferase 2 gene polymorphisms and age-related hearing loss.

    PubMed

    Dawes, Piers; Platt, Hazel; Horan, Michael; Ollier, William; Munro, Kevin; Pendleton, Neil; Payton, Antony

    2015-01-01

    Age-related hearing loss has a genetic component, but there have been limited genetic studies in this field. Both N-acetyltransferase 2 and apolipoprotein E genes have previously been associated. However, these studies have either used small sample sizes, examined a limited number of polymorphisms, or have produced conflicting results. Here we use a haplotype tagging approach to determine association with age-related hearing loss and investigate epistasis between these two genes. Candidate gene association study of a continuous phenotype. We investigated haplotype tagging single nucleotide polymorphisms in the N-acetyltransferase 2 gene and the presence/absence of the apolipoprotein E ε4 allele for association with age-related hearing loss in a cohort of 265 Caucasian elderly volunteers from Greater Manchester, United Kingdom. Hearing phenotypes were generated using principal component analysis of the hearing threshold levels for the better ear (severity, slope, and concavity). Genotype data for the N-acetyltransferase 2 gene was obtained from existing genome-wide association study data from the Illumina 610-Quadv1 chip. Apolipoprotein E genotyping was performed using Sequenom technology. Linear regression analysis was performed using Plink and Stata software. No significant associations (P value, > 0.05) were observed between the N-acetyltransferase 2 or apolipoprotein E gene polymorphisms and any hearing factor. No significant association was observed for epistasis analysis of apolipoprotein E ε4 and the N-acetyltransferase 2 single nucleotide polymorphism rs1799930 (NAT2*6A). We found no evidence to support that either N-acetyltransferase 2 or apolipoprotein E gene polymorphisms are associated with age-related hearing loss in a cohort of 265 elderly volunteers. © 2014 The American Laryngological, Rhinological and Otological Society, Inc.

  2. Polymorphism of LRP5, but not of TNFRSF11B, is associated with a decrease in bone mineral density in postmenopausal Maya-Mestizo women.

    PubMed

    Canto-Cetina, Thelma; Polanco Reyes, Lucila; González Herrera, Lizbeth; Rojano-Mejía, David; Coral-Vázquez, Ramón Mauricio; Coronel, Agustín; Canto, Patricia

    2013-01-01

    Osteoporosis is a complex disease characterized principally by low bone mineral density (BMD), which is determined by an interaction of genetic, metabolic, and environmental factors. The aim of this study was to analyze the possible association among one polymorphism of LRP5 and three polymorphisms of TNFRSF11B as well as their haplotypes with BMD variations in Maya-Mestizo postmenopausal women. We studied 583 postmenopausal women of Maya-Mestizo ethnic origin. A structured questionnaire for risk factors was applied and BMD was measured in lumbar spine (LS), total hip (TH), and femoral neck (FN) by dual-energy X-ray absorptiometry. DNA was obtained from blood leukocytes. One single-nucleotide polymorphism of LRP5 (rs3736228, p.A1330V) and three of TNFRSF11B (rs4355801, rs2073618, and rs6993813) were studied using real-time PCR allelic discrimination for genotyping. Differences between the means of the BMDs according to the genotype were analyzed with covariance. Deviations from Hardy-Weinberg equilibrium were tested. Pairwise linkage disequilibrium between single nucleotide polymorphisms was calculated by direct correlation r(2), and haplotype analysis of TNFRSF11B was conducted. The Val genotype of the rs3736228 (p.A1330V) of LRP5 was significantly associated with BMD variations at the LS, TH, and FN. None of the three polymorphisms of TNFRSF11B was associated with BMD variations. Our results show that p.A1330V was significantly associated with BMD variations at all three skeletal sites analyzed; the Val allele and the Val/Val genotype were those most frequently found in our population. Copyright © 2013 Wiley Periodicals, Inc.

  3. Unique CD44 intronic SNP is associated with tumor grade in breast cancer: a case control study and in silico analysis.

    PubMed

    Esmaeili, Rezvan; Abdoli, Nasrin; Yadegari, Fatemeh; Neishaboury, Mohamadreza; Farahmand, Leila; Kaviani, Ahmad; Majidzadeh-A, Keivan

    2018-01-01

    CD44 encoded by a single gene is a cell surface transmembrane glycoprotein. Exon 2 is one of the important exons to bind CD44 protein to hyaluronan. Experimental evidences show that hyaluronan-CD44 interaction intensifies the proliferation, migration, and invasion of breast cancer cells. Therefore, the current study aimed at investigating the association between specific polymorphisms in exon 2 and its flanking region of CD44 with predisposition to breast cancer. In the current study, 175 Iranian female patients with breast cancer and 175 age-matched healthy controls were recruited in biobank, Breast Cancer Research Center, Tehran, Iran. Single nucleotide polymorphisms of CD44 exon 2 and its flanking were analyzed via polymerase chain reaction and gene sequencing techniques. Association between the observed variation with breast cancer risk and clinico-pathological characteristics were studied. Subsequently, bioinformatics analysis was conducted to predict potential exonic splicing enhancer (ESE) motifs changed as the result of a mutation. A unique polymorphism of the gene encoding CD44 was identified at position 14 nucleotide upstream of exon 2 (A37692→G) by the sequencing method. The A > G polymorphism exhibited a significant association with higher-grades of breast cancer, although no significant relation was found between this polymorphism and breast cancer risk. Finally, computational analysis revealed that the intronic mutation generated a new consensus-binding motif for the splicing factor, SC35, within intron 1. The current study results indicated that A > G polymorphism was associated with breast cancer development; in addition, in silico analysis with ESE finder prediction software showed that the change created a new SC35 binding site.

  4. Correlations between ACE single nucleotide polymorphisms and prognosis of patients with septic shock.

    PubMed

    Dou, Xin-Man; Cheng, Hui-Juan; Meng, Ling; Zhou, Lin-Lin; Ke, Yi-Hong; Liu, Li-Ping; Li, Yu-Min

    2017-04-30

    The aim of the present study is to investigate association between septic shock (SS) and angiotensin I-converting enzyme ( ACE ) single nucleotide polymorphisms (SNPs). From October 2009 to December 2016, 238 SS patients and 242 healthy individuals were selected for our study. ACE activity was detected, ACE rs4291 and rs4646994 polymorphisms were detected using PCR-restriction fragment length polymorphism (PCR-RFLP). The Kaplan-Meier survival curve was employed to evaluate the association between ACE SNPs and patients' survival and univariate and multivariate analyses to estimate risk factors for SS. ACE activity in the case group was increased in comparison with the control group. Allele and genotype frequencies of rs4291 and rs4646994 were different between the case and control groups. The TT genotype frequency of the rs4291 polymorphisms and the DD genotype of the rs4646994 polymorphisms of the case group were higher than those in the control group. The AT and TT genotypes indicated a significant elevation of ACE activity than the AA genotype, while a significant decline was found in the DI and II genotypes in comparison with the DI genotype. Patients with TT or DD genotypes had increased fatality rate within 7 and 30 days when compared with those with non-TT or non-DD genotypes. Lower sepsis-related organ failure assessment (SOFA) scores, rs4291, serum ACE and rs4646994 were all considered as risky factors for SS patients. The study demonstrates that TT genotype of rs4291 or DD genotype of rs4646994 may be indicative of a higher risk of SS and a poorer prognosis in SS patients. © 2017 The Author(s).

  5. Association of MAP4K4 gene single nucleotide polymorphism with mastitis and milk traits in Chinese Holstein cattle.

    PubMed

    Bhattarai, Dinesh; Chen, Xing; Ur Rehman, Zia; Hao, Xingjie; Ullah, Farman; Dad, Rahim; Talpur, Hira Sajjad; Kadariya, Ishwari; Cui, Lu; Fan, Mingxia; Zhang, Shujun

    2017-02-01

    The objective of the studies presented in this Research Communication was to investigate the association of single nucleotide polymorphisms present in the MAP4K4 gene with different milk traits in dairy cows. Based on previous QTL fine mapping results on bovine chromosome 11, the MAP4K4 gene was selected as a candidate gene to evaluate its effect on somatic cell count and milk traits in ChineseHolstein cows. Milk production traits including milk yield, fat percentage, and protein percentage of each cow were collected using 305 d lactation records. Association between MAP4K4 genotype and different traits and Somatic Cell Score (SCS) was performed using General Linear Regression Model of R. Two SNPs at exon 18 (c.2061T > G and c.2196T > C) with genotype TT in both SNPs were found significantly higher for somatic SCS. We found the significant effect of exon 18 (c.2061T > G) on protein percentage, milk yield and SCS. We identified SNPs at different location of MAP4K4 gene of the cattle and several of them were significantly associated with the somatic cell score and other different milk traits. Thus, MAP4K4 gene could be a useful candidate gene for selection of dairy cattle against mastitis and the identified polymorphisms might potentially be strong genetic markers.

  6. The Q705K and F359L Single-Nucleotide Polymorphisms of NOD-Like Receptor Signaling Pathway: Association with Chronic Pancreatitis, Pancreatic Cancer, and Periodontitis.

    PubMed

    Miskiewicz, Andrzej; Szparecki, Grzegorz; Durlik, Marek; Rydzewska, Grażyna; Ziobrowski, Ireneusz; Górska, Renata

    2015-12-01

    The aim of this study was to establish the correlation between the occurrence of Q705K and F359L polymorphisms in patients diagnosed with pancreatic diseases and periodontal conditions of various degrees of severity. The above-mentioned genetic markers were assessed in patients with pancreatic cancer (n = 18) and chronic pancreatitis (n = 39) as well as in a healthy control group (n = 115). The established inclusion criteria were the following: Caucasian descent, non-smoking, and age range 20-80, with different levels of periodontitis activity according to S. Offenbacher's scale. The genotyping reactions were performed by means of an RT-PCR with the use of TaqMan(®) genotyping assay. Results of the study revealed that the state of periodontium was significantly worse in patients with chronic pancreatitis. The Q705K and F359L polymorphisms were associated with more advanced cases of periodontitis measured by clinical attachment level, whereas the Q705K was associated with intensified bleeding index. Furthermore, the F359L single-nucleotide polymorphism was significantly higher in the group with chronic pancreatitis (p < 0.0001; OR = 6.8571). Whereas, the prevalence of Q705K polymorphism was higher in the group of pancreatic cancer (p = 0.107; OR = 3.3939). This study suggests that the exaggerated inflammatory response provoked by Q705K and F359L might be the common denominator for periodontitis, pancreatic cancer, and chronic pancreatitis. These findings might constitute the basis for a new diagnostic and therapeutic approach.

  7. Identification of QTL associated with resistance to leafhopper species Empoasca fabae and Empoasca kraemeri in common bean

    USDA-ARS?s Scientific Manuscript database

    Empoasca species leafhoppers are a major insect pest of common bean, Phaseolus vulgaris that cause significant economic losses in both tropical (E. kraemeri) and temperate (E. fabae) regions of the Americas. The objective of this study was to use Indel and single nucleotide polymorphism (SNP) marker...

  8. Association between Single Nucleotide Polymorphism of Vitamin D Receptor Gene FokI Polymorphism and Clinical Progress of Benign Prostatic Hyperplasia

    PubMed Central

    Ruan, Li; Zhu, Jian-guo; Pan, Cong; Hua, Xing; Yuan, Dong-bo; Li, Zheng-ming; Zhong, Wei-de

    2015-01-01

    Background. The aim of the study was to investigate the association between single nucleotide polymorphism (SNP) of vitamin D receptor (VDR) gene and clinical progress of benign prostatic hyperplasia (BPH) in Chinese men. Methods. The DNA was extracted from blood of 200 BPH patients with operation (progression group) and 200 patients without operation (control group), respectively. The genotypes of VDR gene FokI SNP represented by “F/f” were identified by PCR-restriction fragment length polymorphism. The odds ratio (OR) of having progression of BPH for having the genotype were calculated. Results. Our date indicated that the f alleles of the VDR gene FokI SNP associated with the progression of BPH (P = 0.009). Conclusion. For the first time, our study demonstrated that VDR gene FokI SNP may be associated with the risk of BPH progress. PMID:25685834

  9. TERT rs2736098 polymorphism and cancer risk: results of a meta-analysis.

    PubMed

    Qi, Hao-Yu; Zou, Peng; Zhao, Lin; Zhu, Jue; Gu, Ai-Hua

    2012-01-01

    Several studies have demonstrated associations between the TERT rs2736098 single nucleotide polymorphisms (SNPs) and susceptibility to cancer development. However, there are conflicting results. A systematic meta-analysis was therefore performed to establish the cancer risk associated with the polymorphism. In this meta-analysis, a total of 6 case-control studies, including 5,567 cases and 6,191 controls, were included. Crude odds ratios with 95% confidence intervals were used to assess the strength of associations in several genetic models. Our results showed no association reaching the level of statistical significance for overall risk. Interestingly, in the stratified analyses (subdivided by ethnicity), significantly increased risks were found in the Asian subgroup which indicates the TERT rs2736098 polymorphism may have controversial involvement in cancer susceptibility. Overall, this meta-analysis indicates that the TERT rs2736098 polymorphism may have little involvement in cancer susceptibility.

  10. Single-nucleotide polymorphisms in Toll-like receptor (TLR)-2, TLR4 and heat shock protein 70 genes and susceptibility to scrub typhus.

    PubMed

    Janardhanan, Jeshina; Joseph Martin, Sherry; Astrup, Elisabeth; Veeramanikandan, R; Aukrust, Pål; Abraham, Ooriapadickal C; Varghese, George M

    2013-11-01

    Scrub typhus is a highly prevalent bacterial infection in India and South Asia that is caused by Orientia tsutsugamushi. The innate immune response to infections is modulated by Toll-like receptors (TLRs) and heat shock proteins (HSPs). This study was done to assess the prevalence and possible association of TLR and HSP polymorphisms in scrub typhus. TLR4 Asp299Gly, TLR4 Thr399Ile, TLR2 Arg753Gln and HSP70-2 A1267G are single-nucleotide polymorphisms (SNPs) that may modulate their activities, and these SNPs were assessed in 137 scrub typhus patients and 134 controls by PCR restriction fragment length polymorphism. We found that the two TLR4 mutations, TLR4 D299G and TLR4T399I, were present in 19.5% and 22% of the study population, respectively, and was in significant linkage disequilibrium with a D' of 0.8. The TLR2 mutation was found to be rare, whereas the HSP A>G mutation was very common (77.5%). Compared with the controls, the prevalence of heterozygous genotype of the TLR4D299G SNP, but not any of the other SNPs, was significantly higher among scrub typhus patients. Further studies using a larger sample size and more candidate genes may better enable in determining the role of these associations in susceptibility and severity of scrub typhus.

  11. Association between genetic polymorphisms in the XRCC1, XRCC3, XPD, GSTM1, GSTT1, MSH2, MLH1, MSH3, and MGMT genes and radiosensitivity in breast cancer patients.

    PubMed

    Mangoni, Monica; Bisanzi, Simonetta; Carozzi, Francesca; Sani, Cristina; Biti, Giampaolo; Livi, Lorenzo; Barletta, Emanuela; Costantini, Adele Seniori; Gorini, Giuseppe

    2011-09-01

    Clinical radiosensitivity varies considerably among patients, and radiation-induced side effects developing in normal tissue can be therapy limiting. Some single nucleotide polymorphisms (SNPs) have been shown to correlate with hypersensitivity to radiotherapy. We conducted a prospective study of 87 female patients with breast cancer who received radiotherapy after breast surgery. We evaluated the association between acute skin reaction following radiotherapy and 11 genetic polymorphisms in DNA repair genes: XRCC1 (Arg399Gln and Arg194Trp), XRCC3 (Thr241Met), XPD (Asp312Asn and Lys751Gln), MSH2 (gIVS12-6T>C), MLH1 (Ile219Val), MSH3 (Ala1045Thr), MGMT (Leu84Phe), and in damage-detoxification GSTM1 and GSTT1 genes (allele deletion). Individual genetic polymorphisms were determined by polymerase chain reaction and single nucleotide primer extension for single nucleotide polymorphisms or by a multiplex polymerase chain reaction assay for deletion polymorphisms. The development of severe acute skin reaction (moist desquamation or interruption of radiotherapy due to toxicity) associated with genetic polymorphisms was modeled using Cox proportional hazards, accounting for cumulative biologically effective radiation dose. Radiosensitivity developed in eight patients and was increased in carriers of variants XRCC3-241Met allele (hazard ratio [HR] unquantifiably high), MSH2 gIVS12-6nt-C allele (HR=53.36; 95% confidence intervals [95% CI], 3.56-798.98), and MSH3-1045Ala allele (HR unquantifiably high). Carriers of XRCC1-Arg194Trp variant allele in combination with XRCC1-Arg399Gln wild-type allele had a significant risk of radiosensitivity (HR=38.26; 95% CI, 1.19-1232.52). To our knowledge, this is the first report to find an association between MSH2 and MSH3 genetic variants and the development of radiosensitivity in breast cancer patients. Our findings suggest the hypothesis that mismatch repair mechanisms may be involved in cellular response to radiotherapy. Genetic polymorphisms may be promising candidates for predicting acute radiosensitivity, but further studies are necessary to confirm our findings. Copyright © 2011 Elsevier Inc. All rights reserved.

  12. Do genetic modifiers of high-density lipoprotein cholesterol and triglyceride levels also modify their response to a lifestyle intervention in the setting of obesity and type-2 diabetes mellitus?: The Action for Health in Diabetes (Look AHEAD) study.

    PubMed

    Huggins, Gordon S; Papandonatos, George D; Erar, Bahar; Belalcazar, L Maria; Brautbar, Ariel; Ballantyne, Christie; Kitabchi, Abbas E; Wagenknecht, Lynne E; Knowler, William C; Pownall, Henry J; Wing, Rena R; Peter, Inga; McCaffery, Jeanne M

    2013-08-01

    High-density lipoprotein cholesterol (HDL-C) and triglycerides are cardiovascular risk factors susceptible to lifestyle behavior modification and genetics. We hypothesized that genetic variants identified by genome-wide association studies as associated with HDL-C or triglyceride levels modify 1-year treatment response to an intensive lifestyle intervention, relative to a usual care of diabetes mellitus support and education. We evaluated 82 single-nucleotide polymorphisms, which represent 31 loci demonstrated by genome-wide association studies to be associated with HDL-C and triglycerides, in 3561 participants who consented for genetic studies and met eligibility criteria. Variants associated with higher baseline HDL-C levels, cholesterol ester transfer protein (CETP) rs3764261 and hepatic lipase (LIPC) rs8034802, were found to be associated with HDL-C increases with intensive lifestyle intervention (P=0.0038 and 0.013, respectively) and had nominally significant treatment interactions (P=0.047 and 0.046, respectively). The fatty acid desaturase-2 rs1535 variant, associated with low baseline HDL-C (P=0.017), was associated with HDL-C increases with intensive lifestyle intervention (0.0037) and had a nominal treatment interaction (P=0.035). Apolipoprotein B (rs693) and LIPC (rs8034802) single-nucleotide polymorphisms showed nominally significant associations with HDL-C and triglyceride changes with intensive lifestyle intervention and a treatment interaction (P<0.05). Phosphatidylglycerophosphate synthase-1 single-nucleotide polymorphisms (rs4082919) showed the most significant triglyceride treatment interaction in the full cohort (P=0.0009). This is the first study to identify genetic variants modifying lipid responses to a randomized lifestyle behavior intervention in overweight or obese individuals with diabetes mellitus. The effects of genetic factors on lipid changes may differ from the effects on baseline lipids and are modifiable by behavioral intervention.

  13. A Single Nucleotide Polymorphism in the Phospholipase D1 Gene is Associated with Risk of Non-Small Cell Lung Cancer

    PubMed Central

    Ahn, Myung-Ju; Park, Shin-Young; Kim, Won Kyu; Cho, Ju Hwan; Chang, Brian Junho; Kim, Dong Jo; Ahn, Jin Seok; Park, Keunchil; Han, Joong-Soo

    2012-01-01

    Phospholipase D (PLD) has an important role in various biological functions including vesicular transport, endocytosis, exocytosis, cell migration, and mitosis. These cellular biological processes are deregulated in the development of various human tumors. In order to explore the relationship between the PLD1 gene and risk of non-small cell lung cancer (NSCLC), single nucleotide polymorphisms (SNP) in the PLD1 exon region were surveyed in 211 NSCLC patients and 205 normal controls. In this study, we identified six SNPs at exon 23 in the PLD1 gene. Among the six SNPs, the most notable was a heterozygous A to C transition at nucleotide 2698 (A2698C, p<0.001). In addition, the genotype frequencies of A2744C (AC+CC) and A2756C (AC+CC) were associated with gender (female, A2744C and A2756C: p=0.071) in NSCLC patients. Interestingly, although the SNP A2698C did not cause change in amino acid, correlation between odd ratio of NSCLC patients and the SNP A2698C was observed to be statistically significant. PMID:23675264

  14. IGF-I gene variability is associated with an increased risk for AD.

    PubMed

    Vargas, Teo; Martinez-Garcia, Ana; Antequera, Desiree; Vilella, Elisabet; Clarimon, Jordi; Mateo, Ignacio; Sanchez-Juan, Pascual; Rodriguez-Rodriguez, Eloy; Frank, Ana; Rosich-Estrago, Marcel; Lleo, Alberto; Molina-Porcel, Laura; Blesa, Rafael; Gomez-Isla, Teresa; Combarros, Onofre; Bermejo-Pareja, Felix; Valdivieso, Fernando; Bullido, Maria Jesus; Carro, Eva

    2011-03-01

    Insulin-like growth factor I (IGF-I), a neuroprotective factor with a wide spectrum of actions in the adult brain, is involved in the pathogenesis of Alzheimer's disease (AD). Circulating levels of IGF-I change in AD patients and are implicated in the clearance of brain amyloid beta (Aβ) complexes. To investigate this hypothesis, we screened the IGF-I gene for various well known single nucleotide polymorphisms (SNPs) covering % of the gene variability in a population of 2352 individuals. Genetic analysis indicated different distribution of genotypes of 1 single nucleotide polymorphism, and 1 extended haplotype in the AD population compared with healthy control subjects. In particular, the frequency of rs972936 GG genotype was significantly greater in AD patients than in control subjects (63% vs. 55%). The rs972936 GG genotype was associated with an increased risk for disease, independently of apolipoprotein E genotype, and with enhanced circulating levels of IGF-I. These findings suggest that polymorphisms within the IGF-I gene could infer greater risk for AD through their effect on IGF-I levels, and confirm the physiological role IGF-I in the pathogenesis of AD. Copyright © 2011 IBRO. Published by Elsevier Inc. All rights reserved.

  15. Single nucleotide polymorphisms in the bovine MHC region of Japanese Black cattle are associated with bovine leukemia virus proviral load.

    PubMed

    Takeshima, Shin-Nosuke; Sasaki, Shinji; Meripet, Polat; Sugimoto, Yoshikazu; Aida, Yoko

    2017-04-04

    Bovine leukemia virus (BLV) is the causative agent of enzootic bovine leukosis, a malignant B cell lymphoma that has spread worldwide and causes serious problems for the cattle industry. The BLV proviral load, which represents the BLV genome integrated into host genome, is a useful index for estimating disease progression and transmission risk. Here, we conducted a genome-wide association study to identify single nucleotide polymorphisms (SNPs) associated with BLV proviral load in Japanese Black cattle. The study examined 93 cattle with a high proviral load and 266 with a low proviral load. Three SNPs showed a significant association with proviral load. One SNP was detected in the CNTN3 gene on chromosome 22, and two (which were not in linkage disequilibrium) were detected in the bovine major histocompatibility complex region on chromosome 23. These results suggest that polymorphisms in the major histocompatibility complex region affect proviral load. This is the first report to detect SNPs associated with BLV proviral load in Japanese Black cattle using whole genome association study, and understanding host factors may provide important clues for controlling the spread of BLV in Japanese Black cattle.

  16. Association of a single nucleotide polymorphism in the akirin 2 gene with economically important traits in Korean native cattle.

    PubMed

    Kim, H; Lee, S K; Hong, M W; Park, S R; Lee, Y S; Kim, J W; Lee, H K; Jeong, D K; Song, Y H; Lee, S J

    2013-12-01

    The akirin 2 gene, located on chromosome 9 in cattle, was previously reported to be associated with nuclear factor-kappa B (NF-κB), involved in immune reactions and marbling of meat. To determine whether a single nucleotide polymorphism (SNP) in akirin 2 is associated with economically important traits of Korean native cattle, the c.*188G>A SNP DNA marker in the 3'-UTR region of akirin 2 was analyzed for its association with carcass weight, longissimus muscle area and marbling. The c.*188G>A SNP was genotyped by polymerase chain reaction restriction fragment length polymorphism, and the frequency of the AA, AG, and GG genotypes were 6.82%, 71.29% and 21.88% respectively. This SNP was significantly associated with longissimus muscle area (Bonferroni corrected P < 0.05), and marbling score (Bonferroni corrected P < 0.01). These results suggest that the c.*188G>A SNP of akirin 2 might be useful as a DNA marker for longissimus muscle area and marbling scores in Korean native cattle. © 2013 The Authors, Animal Genetics © 2013 Stichting International Foundation for Animal Genetics.

  17. Paclitaxel sensitivity in relation to ABCB1 expression, efflux and single nucleotide polymorphisms in ovarian cancer.

    PubMed

    Gao, Bo; Russell, Amanda; Beesley, Jonathan; Chen, Xiao Qing; Healey, Sue; Henderson, Michelle; Wong, Mark; Emmanuel, Catherine; Galletta, Laura; Johnatty, Sharon E; Bowtell, David; Haber, Michelle; Norris, Murray; Harnett, Paul; Chenevix-Trench, Georgia; Balleine, Rosemary L; deFazio, Anna

    2014-05-09

    ABCB1 (adenosine triphosphate-binding cassette transporter B1) mediates cellular elimination of many chemotherapeutic agents including paclitaxel, which is commonly used to treat ovarian cancer. A significant association between common single nucleotide polymorphisms (SNPs) in ABCB1 and progression-free survival has been reported in patients with ovarian cancer. Variable paclitaxel clearance due to genotype specific differences in ABCB1 activity in cancer cells and/or normal tissues may underlie the association. Using cell-based models, we evaluated the correlations between ABCB1 expression, polymorphisms, transporter activity and paclitaxel sensitivity in ovarian cancer (n = 10) and lymphoblastoid (n = 19) cell lines. Close associations between ABCB1 expression, transporter function and paclitaxel sensitivity were found in lymphoblastoid cell lines, although we could not demonstrate an association with common SNPs. In ovarian cancer cell lines, ABCB1 expression was low and the association between expression and function was lost. These results suggest that ABCB1 related survival difference in ovarian cancer patients is more likely to be due to differential whole body paclitaxel clearance mediated by normal cells rather than a direct effect on cancer cells.

  18. Functional single nucleotide polymorphisms of matrix metalloproteinase 7 and 12 genes in idiopathic recurrent spontaneous abortion.

    PubMed

    Barišić, Anita; Pereza, Nina; Hodžić, Alenka; Kapović, Miljenko; Peterlin, Borut; Ostojić, Saša

    2017-03-01

    The aim of this study was to investigate the potential association of matrix metalloproteinase 7 (MMP7) -181 A/G and MMP12 -82 A/G functional single nucleotide polymorphisms (SNP) with idiopathic recurrent spontaneous abortion (IRSA) in Slovenian reproductive couples. A case-control study was conducted on 149 couples with 3 or more consecutive idiopathic spontaneous pregnancy loses and 149 women and men with at least 2 live births and no history of pregnancy complications. Genotyping of MMP7 -181 A/G and MMP12 -82 A/G SNPs was performed using polymerase chain reaction and restriction fragment length polymorphism methods. There were no statistically significant differences in the distribution of MMP7 -181 A/G and MMP12 -82 A/G genotype, allele, or haplotype frequencies between IRSA patients and controls, as well as patients' primary and secondary IRSA. We also found no association of MMP7 -181 A/G and MMP12 -82 A/G genotypes, alleles, and haplotypes with IRSA. We found no evidence to support the association between IRSA and MMP7 -181 A/G and MMP12 -82 A/G SNPs in Slovenian reproductive couples.

  19. Identification of a psoriasis susceptibility candidate gene by linkage disequilibrium mapping with a localized single nucleotide polymorphism map.

    PubMed

    Hewett, Duncan; Samuelsson, Lena; Polding, Joanne; Enlund, Fredrik; Smart, Devi; Cantone, Kathryn; See, Chee Gee; Chadha, Sapna; Inerot, Annica; Enerback, Charlotta; Montgomery, Doug; Christodolou, Chris; Robinson, Phil; Matthews, Paul; Plumpton, Mary; Wahlstrom, Jan; Swanbeck, Gunnar; Martinsson, Tommy; Roses, Allen; Riley, John; Purvis, Ian

    2002-03-01

    Psoriasis is a chronic inflammatory disease of the skin with both genetic and environmental risk factors. Here we describe the creation of a single-nucleotide polymorphism (SNP) map spanning 900-1200 kb of chromosome 3q21, which had been previously recognized as containing a psoriasis susceptibility locus, PSORS5. We genotyped 644 individuals, from 195 Swedish psoriatic families, for 19 polymorphisms. Linkage disequilibrium (LD) between marker and disease was assessed using the transmission/disequilibrium test (TDT). In the TDT analysis, alleles of three of these SNPs showed significant association with disease (P<0.05). A 160-kb interval encompassing these three SNPs was sequenced, and a coding sequence consisting of 13 exons was identified. The predicted protein shares 30-40% homology with the family of cation/chloride cotransporters. A five-marker haplotype spanning the 3' half of this gene is associated with psoriasis to a P value of 3.8<10(-5). We have called this gene SLC12A8, coding for a member of the solute carrier family 12 proteins. It belongs to a class of genes that were previously unrecognized as playing a role in psoriasis pathogenesis.

  20. GSTO and AS3MT genetic polymorphisms and differences in urinary arsenic concentrations among residents in Bangladesh.

    PubMed

    Rodrigues, Ema G; Kile, Molly; Hoffman, Elaine; Quamruzzaman, Quazi; Rahman, Mahmuder; Mahiuddin, Golam; Hsueh, Yumei; Christiani, David C

    2012-05-01

    We determined whether single nucleotide polymorphisms (SNPs) in the glutathione S-transferase omega (GSTO) and arsenic(III)methyltransferase (AS3MT) genes were associated with concentrations of urinary arsenic metabolites among 900 individuals without skin lesions in Bangladesh. Four SNPs were assessed in these genes. A pathway analysis evaluated the association between urinary arsenic metabolites and SNPs. GSTO1 rs4925 homozygous wild type was significantly associated with higher monomethylarsonic acid (MMA) and dimethylarsinic acid urinary concentrations, whereas wild-type AS3MT rs11191439 had significantly lower levels of As(III) and MMA. Genetic polymorphisms GSTO and As3MT modify arsenic metabolism as evidenced by altered urinary arsenic excretion.

  1. Association of the rs7903146 single nucleotide polymorphism at the Transcription Factor 7-like 2 (TCF7L2) locus with type 2 diabetes in Brazilian subjects.

    PubMed

    Barra, Gustavo Barcelos; Dutra, Ludmila Alves Sanches; Watanabe, Sílvia Conde; Costa, Patrícia Godoy Garcia; Cruz, Patrícia Sales Marques da; Azevedo, Monalisa Ferreira; Amato, Angélica Amorim

    2012-11-01

    To investigate the association of the T allele of the single nucleotide polymorphism (SNP) rs7903146 of TCF7L2 with the occurrence of T2D in a sample of subjects followed up at the Brasilia University Hospital. The SNP rs7903146 of TCF7L2 was genotyped by allele-specific PCR in 113 patients with known T2D and in 139 non-diabetic controls in Brasilia, Brazil. We found that the T allele of the SNP rs7903146 of TCF7L2 was significantly associated with T2D risk (odds ratio of 3.92 for genotype TT in the recessive genetic model, p = 0.004 and 1.5 for T allele, p = 0.032). These results reinforce previous findings on the consistent association of this genetic factor and the risk of T2D in populations of diverse ethnic backgrounds.

  2. Single-nucleotide polymorphisms at the 9p21.3 genomic region not associated with the risk of cardiovascular disease in patients with rheumatoid arthritis.

    PubMed

    García-Bermúdez, M; López-Mejías, R; Genre, F; Castañeda, S; González-Juanatey, C; Llorca, J; Corrales, A; Miranda-Filloy, J A; Pina, T; Gómez-Vaquero, C; Rodríguez-Rodríguez, L; Fernández-Gutiérrez, B; Pascual-Salcedo, D; Balsa, A; López-Longo, F J; Carreira, P; Blanco, R; González-Álvaro, I; Martín, J; González-Gay, M A

    2013-12-01

    Rheumatoid arthritis (RA) is a chronic polygenic inflammatory disease associated with accelerated atherosclerosis and high risk of cardiovascular disease (CVD). In this study, we evaluated the potential association of 9p21.3 single-nucleotide polymorphisms (SNPs) - previously linked to coronary artery disease - and CVD risk in 2001 Spanish RA patients genotyped for 9p21.3 SNPs using TaqMan™ assays. Carotid intima media thickness (cIMT) and presence of carotid plaques were also analyzed. Cox regression model did not disclose significant differences between patients who experienced CVD and those who did not. Neither association was found between cIMT or carotid plaques and SNPs allele distribution. In conclusion, results do not support a role of rs10116277 or rs1537375 SNPs in CVD risk in Spanish RA patients. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  3. Developing single nucleotide polymorphism (SNP) markers from transcriptome sequences for identification of longan (Dimocarpus longan) germplasm

    PubMed Central

    Wang, Boyi; Tan, Hua-Wei; Fang, Wanping; Meinhardt, Lyndel W; Mischke, Sue; Matsumoto, Tracie; Zhang, Dapeng

    2015-01-01

    Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in 50 longan germplasm accessions, including cultivated varieties and wild germplasm; and designated 25 SNP markers that unambiguously identified all tested longan varieties with high statistical rigor (P<0.0001). Multiple trees from the same clone were verified and off-type trees were identified. Diversity analysis revealed genetic relationships among analyzed accessions. Cultivated varieties differed significantly from wild populations (Fst=0.300; P<0.001), demonstrating untapped genetic diversity for germplasm conservation and utilization. Within cultivated varieties, apparent differences between varieties from China and those from Thailand and Hawaii indicated geographic patterns of genetic differentiation. These SNP markers provide a powerful tool to manage longan genetic resources and breeding, with accurate and efficient genotype identification. PMID:26504559

  4. Identification of rheumatoid arthritis biomarkers based on single nucleotide polymorphisms and haplotype blocks: A systematic review and meta-analysis

    PubMed Central

    Saad, Mohamed N.; Mabrouk, Mai S.; Eldeib, Ayman M.; Shaker, Olfat G.

    2015-01-01

    Genetics of autoimmune diseases represent a growing domain with surpassing biomarker results with rapid progress. The exact cause of Rheumatoid Arthritis (RA) is unknown, but it is thought to have both a genetic and an environmental bases. Genetic biomarkers are capable of changing the supervision of RA by allowing not only the detection of susceptible individuals, but also early diagnosis, evaluation of disease severity, selection of therapy, and monitoring of response to therapy. This review is concerned with not only the genetic biomarkers of RA but also the methods of identifying them. Many of the identified genetic biomarkers of RA were identified in populations of European and Asian ancestries. The study of additional human populations may yield novel results. Most of the researchers in the field of identifying RA biomarkers use single nucleotide polymorphism (SNP) approaches to express the significance of their results. Although, haplotype block methods are expected to play a complementary role in the future of that field. PMID:26843965

  5. Bridging the Gap Between Large-scale Data Sets and Analyses: Semi-automated Methods to Facilitate Length Polymorphism Scoring and Data Analyses.

    EPA Science Inventory

    Amplified fragment length polymorphism (AFLP) markers can be developed more quickly and at a lower cost than microsatellite and single nucleotide polymorphism markers, which makes them ideal markers for large-scale studies of understudied taxa — such as species at risk. However,...

  6. Single nucleotide polymorphisms of IFNγ (+874 A/T) and IFNγR1 (-56 C/T) in Iranian patients with TB.

    PubMed

    Beiranvand, Elham; Abediankenari, Saeid; Valiyari, Samira; Rezaei, Mohammad Sadegh; Rostamian, Mosayeb; Beiranvand, Behnoush; Khaligh, Ali; Khani, Soghra

    2016-12-01

    Two important genes for controlling TB are IFNγ and IFNγR1. However, little information exists regarding genetic susceptibility of the Iranian TB population. We investigated the single nucleotide polymorphisms (SNPs) in genes of IFNγ (+874 A/T) and IFNγR1 (-56 C/T) and serum level of IFNγ and their influence on TB in patients; 300 patients with TB and 300 healthy controls were enrolled in this study. PCR-restriction fragment length polymorphism was used to identify SNPs and serum level of IFNγ was measured by ELISA. The allelic and the genotypic form of IFNγ+874 A/T SNP of the studied population were not significant (p>0.05). Allele T frequencies of IFNγR1 -56 C/T promoter region in patients with pulmonary TB (PTB) or extrapulmonary TB (EPTB) were significantly greater than allele C. The -56 TT motif of IFNγR1 is associated with both forms of TB (p<0.05). The serum level of IFNγ was significantly higher in patients with TB than in controls, but there was no significant difference between serum level of IFNγ and the studied genotypes (p>0.05). The cause of active TB in the patients seems to be due to the lack of effective IFNγ function or the lack of effective signaling connection between IFNγ and its receptor in presence of -56 C/T polymorphism in promoter region of IFNγR1 gene. © The Author 2016. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  7. Novel high-speed droplet-allele specific-polymerase chain reaction: application in the rapid genotyping of single nucleotide polymorphisms.

    PubMed

    Taira, Chiaki; Matsuda, Kazuyuki; Yamaguchi, Akemi; Sueki, Akane; Koeda, Hiroshi; Takagi, Fumio; Kobayashi, Yukihiro; Sugano, Mitsutoshi; Honda, Takayuki

    2013-09-23

    Single nucleotide alterations such as single nucleotide polymorphisms (SNP) and single nucleotide mutations are associated with responses to drugs and predisposition to several diseases, and they contribute to the pathogenesis of malignancies. We developed a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) with our droplet-PCR machine (droplet-AS-PCR). Using 8 SNP loci, we evaluated the specificity and sensitivity of droplet-AS-PCR. Buccal cells were pretreated with proteinase K and subjected directly to the droplet-AS-PCR without DNA extraction. The genotypes determined using the droplet-AS-PCR were then compared with those obtained by direct sequencing. Specific PCR amplifications for the 8 SNP loci were detected, and the detection limit of the droplet-AS-PCR was found to be 0.1-5.0% by dilution experiments. Droplet-AS-PCR provided specific amplification when using buccal cells, and all the genotypes determined within 9 min were consistent with those obtained by direct sequencing. Our novel droplet-AS-PCR assay enabled high-speed amplification retaining specificity and sensitivity and provided ultra-rapid genotyping. Crude samples such as buccal cells were available for the droplet-AS-PCR assay, resulting in the reduction of the total analysis time. Droplet-AS-PCR may therefore be useful for genotyping or the detection of single nucleotide alterations. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Population structure and the rapid increase of QoI fungicide resistance in frogeye leaf spot (Cercospora sojina) from Tennessee

    USDA-ARS?s Scientific Manuscript database

    Frogeye leaf spot (FLS), caused by Cercospora sojina, causes significant damage to soybean in the US. In this study, C. sojina isolates collected from Jackson and Milan, TN in 2015 and historical isolates collected before 2015 were included. Fifty novel single nucleotide polymorphism (SNP) markers, ...

  9. [The joint applications of DNA chips and single nucleotide polymorphisms in forensic science].

    PubMed

    Bai, Peng; Tian, Li; Zhou, Xue-ping

    2005-05-01

    DNA chip technology, being a new high-technology, shows its vigorous life and rapid growth. Single Nucleotide Polymorphisms (SNPs) is the most common diversity in the human genome. It provides suitable genetic markers which play a key role in disease linkage study, pharmacogenomics, forensic medicine, population evolution and immigration study. Their advantage such as being analyzed with DNA chips technology, is predicted to play an important role in the field of forensic medicine, especially in paternity test and individual identification. This report mainly reviews the characteristics of DNA chip and SNPs, and their joint applications in the practice of forensic medicine.

  10. Testing for genetic association taking into account phenotypic information of relatives.

    PubMed

    Uh, Hae-Won; Wijk, Henk Jan van der; Houwing-Duistermaat, Jeanine J

    2009-12-15

    We investigated efficient case-control association analysis using family data. The outcome of interest was coronary heart disease. We employed existing and new methods that take into account the correlations among related individuals to obtain the proper type I error rates. The methods considered for autosomal single-nucleotide polymorphisms were: 1) generalized estimating equations-based methods, 2) variance-modified Cochran-Armitage (MCA) trend test incorporating kinship coefficients, and 3) genotypic modified quasi-likelihood score test. Additionally, for X-linked single-nucleotide polymorphisms we proposed a two-degrees-of-freedom test. Performance of these methods was tested using Framingham Heart Study 500 k array data.

  11. Simultaneous genotyping of single-nucleotide polymorphisms in alcoholism-related genes using duplex and triplex allele-specific PCR with two-step thermal cycles.

    PubMed

    Shirasu, Naoto; Kuroki, Masahide

    2014-01-01

    We developed a time- and cost-effective multiplex allele-specific polymerase chain reaction (AS-PCR) method based on the two-step PCR thermal cycles for genotyping single-nucleotide polymorphisms in three alcoholism-related genes: alcohol dehydrogenase 1B, aldehyde dehydrogenase 2 and μ-opioid receptor. Applying MightyAmp(®) DNA polymerase with optimized AS-primers and PCR conditions enabled us to achieve effective and selective amplification of the target alleles from alkaline lysates of a human hair root, and simultaneously to determine the genotypes within less than 1.5 h using minimal lab equipment.

  12. Prevalence of combinatorial CYP2C9 and VKORC1 genotypes in Puerto Ricans: implications for warfarin management in Hispanics.

    PubMed

    Duconge, Jorge; Cadilla, Carmen L; Windemuth, Andreas; Kocherla, Mohan; Gorowski, Krystyna; Seip, Richard L; Bogaard, Kali; Renta, Jessica Y; Piovanetti, Paola; D'Agostino, Darrin; Santiago-Borrero, Pedro J; Ruaño, Gualberto

    2009-01-01

    Polymorphisms in the cytochrome P450 2C9 (CYP2C9) and vitamin K epoxide reductase complex subunit 1 (VKORC1) genes significantly alter the effective warfarin dose. We determined the frequencies of alleles, single carriers, and double carriers of single nucleotide polymorphisms (SNPs) in the CYP2C9 and VKORC1 genes in a Puerto Rican cohort and gauged the impact of these polymorphisms on warfarin dosage using a published algorithm. A total of 92 DNA samples were genotyped using Luminex x-MAP technology. The polymorphism frequencies were 6.52%, 5.43% and 28.8% for CYP2C9 *2, *3 and VKORC1-1639 C>A polymorphisms, respectively. The prevalence of combinatorial genotypes was 16% for carriers of both the CYP2C9 and VKORC1 polymorphisms, 9% for carriers of CYP2C9 polymorphisms, 35% for carriers of the VKORC1 polymorphism, and the remaining 40% were non-carriers for either gene. Based on a published warfarin dosing algorithm, single, double and triple carriers of functionally deficient polymorphisms predict reductions of 1.0-1.6, 2.0-2.9, and 2.9-3.7 mg/day, respectively, in warfarin dose. Overall, 60% of the population carried at least a single polymorphism predicting deficient warfarin metabolism or responsiveness and 13% were double carriers with polymorphisms in both genes studied. Combinatorial genotyping of CYP2C9 and VKORC1 can allow for individualized dosing of warfarin among patients with gene polymorphisms, potentially reducing the risk of stroke or bleeding.

  13. Association of CYP1A1 and CYP1B1 polymorphisms with bone mineral density variations in postmenopausal Mexican-Mestizo women.

    PubMed

    Chávez, Bertha; Vilchis, Felipe; Rojano-Mejía, David; Coral Vázquez, Ramón Mauricio; Aguirre-García, María Del Carmen; Canto, Patricia

    2017-08-01

    Herein, we investigated potential associations between polymorphisms of genes related to estrogen metabolism and bone mineral density (BMD) in postmenopausal women. This was a cross-sectional study, in which two hundred and ninety postmenopausal Mexican-Mestizo women were studied. The BMD of the lumbar spine (LS), total hip (TH), and femoral neck (FN) was measured. The distribution of the genetic polymorphisms, including rs1799814 and rs1048943 at CYP1A1 as well as rs1056836 at CYP1B1, were analyzed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), single-stranded conformational polymorphism (SSCP), and DNA sequencing. Deviations from Hardy-Weinberg equilibrium (HWE) were tested, and linkage disequilibrium (LD) was calculated by direct correlation (r 2 ). Moreover, haplotype analysis was performed. All polymorphisms were in HWE. The genotype and allele distributions of the three single nucleotide polymorphisms (SNPs) studied showed no significant differences. However, statistical significance was reached when constructing haplotypes. The CG haplotype in CYP1A1 was associated with variations in LS and FN BMD after adjustment for covariates (p = 0.021 and 0.045, respectively), but the association with TH BMD was not significant. These results suggested that the CG haplotype in CYP1A1 may play an important role in the mechanism of osteoporosis and may be useful as a genetic marker.

  14. Association of N-acetyltransferase-2 and glutathione S-transferase polymorphisms with idiopathic male infertility in Vietnam male subjects.

    PubMed

    Trang, Nguyen Thi; Huyen, Vu Thi; Tuan, Nguyen Thanh; Phan, Tran Duc

    2018-04-25

    N-acetyltransferase-2 (NAT2) and Glutathione S-transferases (GSTs) are phase-II xenobiotic metabolizing enzymes participating in detoxification of toxic arylamines, aromatic amines, hydrazines and reactive oxygen species (ROS), which are produced under oxidative and electrophile stresses. The purpose of this research was to investigate whether two common single-nucleotide polymorphisms (SNP) of NAT2 (rs1799929, rs1799930) and GSTP1 (rs1138272, rs1695) associated with susceptibility to idiopathic male infertility. A total 300 DNA samples (150 infertile patients and 150 healthy control) were genotyped for the polymorphisms by ARMS - PCR. We revealed a significant association between the NAT2 variant genotypes (CT + TT (rs1799929), (OR: 3.74; p < 0.001)) and (GA + AA (rs1799930), (OR: 3.75; p < 0.001)) or GSTP1 variant genotypes (GA + AA (rs1695), (OR: 5.11; p < 0,001)) and (CT + TT (rs1138272), (OR: 7.42; p < 0,001) with idiopathic infertility risk. Our findings rate the effect of single-nucleotide polymorphisms of GSTP1 and/or NAT2 in modulation of the risk of male infertility in subjects from Vietnam. This pilot study is the first (as far as we know) to reveal that polymorphisms of NAT2 (rs1799929, rs1799930) and GSTP1 (rs1138272, rs1695) are some novel genetic markers for susceptibility to idiopathic male infertility. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Single nucleotide polymorphism (SNP) discovery in duplicated genomes: intron-primed exon-crossing (IPEC) as a strategy for avoiding amplification of duplicated loci in Atlantic salmon (Salmo salar) and other salmonid fishes

    PubMed Central

    Ryynänen, Heikki J; Primmer, Craig R

    2006-01-01

    Background Single nucleotide polymorphisms (SNPs) represent the most abundant type of DNA variation in the vertebrate genome, and their applications as genetic markers in numerous studies of molecular ecology and conservation of natural populations are emerging. Recent large-scale sequencing projects in several fish species have provided a vast amount of data in public databases, which can be utilized in novel SNP discovery in salmonids. However, the suggested duplicated nature of the salmonid genome may hamper SNP characterization if the primers designed in conserved gene regions amplify multiple loci. Results Here we introduce a new intron-primed exon-crossing (IPEC) method in an attempt to overcome this duplication problem, and also evaluate different priming methods for SNP discovery in Atlantic salmon (Salmo salar) and other salmonids. A total of 69 loci with differing priming strategies were screened in S. salar, and 27 of these produced ~13 kb of high-quality sequence data consisting of 19 SNPs or indels (one per 680 bp). The SNP frequency and the overall nucleotide diversity (3.99 × 10-4) in S. salar was lower than reported in a majority of other organisms, which may suggest a relative young population history for Atlantic salmon. A subset of primers used in cross-species analyses revealed considerable variation in the SNP frequencies and nucleotide diversities in other salmonids. Conclusion Sequencing success was significantly higher with the new IPEC primers; thus the total number of loci to screen in order to identify one potential polymorphic site was six times less with this new strategy. Given that duplication may hamper SNP discovery in some species, the IPEC method reported here is an alternative way of identifying novel polymorphisms in such cases. PMID:16872523

  16. Masking as an effective quality control method for next-generation sequencing data analysis.

    PubMed

    Yun, Sajung; Yun, Sijung

    2014-12-13

    Next generation sequencing produces base calls with low quality scores that can affect the accuracy of identifying simple nucleotide variation calls, including single nucleotide polymorphisms and small insertions and deletions. Here we compare the effectiveness of two data preprocessing methods, masking and trimming, and the accuracy of simple nucleotide variation calls on whole-genome sequence data from Caenorhabditis elegans. Masking substitutes low quality base calls with 'N's (undetermined bases), whereas trimming removes low quality bases that results in a shorter read lengths. We demonstrate that masking is more effective than trimming in reducing the false-positive rate in single nucleotide polymorphism (SNP) calling. However, both of the preprocessing methods did not affect the false-negative rate in SNP calling with statistical significance compared to the data analysis without preprocessing. False-positive rate and false-negative rate for small insertions and deletions did not show differences between masking and trimming. We recommend masking over trimming as a more effective preprocessing method for next generation sequencing data analysis since masking reduces the false-positive rate in SNP calling without sacrificing the false-negative rate although trimming is more commonly used currently in the field. The perl script for masking is available at http://code.google.com/p/subn/. The sequencing data used in the study were deposited in the Sequence Read Archive (SRX450968 and SRX451773).

  17. Differential effects of chromosome 9p21 variation on subphenotypes of intracranial aneurysm: site distribution.

    PubMed

    Nakaoka, Hirofumi; Takahashi, Tomoko; Akiyama, Koichi; Cui, Tailin; Tajima, Atsushi; Krischek, Boris; Kasuya, Hidetoshi; Hata, Akira; Inoue, Ituro

    2010-08-01

    Recently, a genome-wide association study identified associations between single nucleotide polymorphisms on chromosome 9p21 and risk of harboring intracranial aneurysm (IA). Aneurysm characteristics or subphenotypes of IAs, such as history of subarachnoid hemorrhage, presence of multiple IAs and location of IAs, are clinically important. We investigated whether the association between 9p21 variation and risk of IA varied among these subphenotypes. We conducted a case-control study of 981 cases and 699 controls in Japanese. Four single nucleotide polymorphisms tagging the 9p21 risk locus were genotyped. The OR and 95% CI were estimated using logistic regression analyses. Among the 4 single nucleotide polymorphisms, rs1333040 showed the strongest evidence of association with IA (P=1.5x10(-6); per allele OR, 1.43; 95% CI, 1.24-1.66). None of the patient characteristics (gender, age, smoking, and hypertension) was a significant confounder or effect modifier of the association. Subgroup analyses of IA subphenotypes showed that among the most common sites of IAs, the association was strongest for IAs of the posterior communicating artery (OR, 1.69; 95% CI, 1.26-2.26) and not significant for IAs in the anterior communicating artery (OR, 1.22; 95% CI, 0.96-1.57). When dichotomizing IA sites, the association was stronger for IAs of the posterior circulation-posterior communicating artery group (OR, 1.73; 95% CI, 1.32-2.26) vs the anterior circulation group (OR, 1.28; 95% CI, 1.07-1.53). Heterogeneity in these ORs was significant (P=0.032). The associations did not vary when stratifying by history of subarachnoid hemorrhage (OR, 1.42; 95% CI, 1.18-1.71 for ruptured IA; OR, 1.27; 95% CI, 1.00-1.62 for unruptured IA) or by multiplicity of IA (OR, 1.57; 95% CI, 1.21-2.03 for multiple IAs; OR, 1.36; 95% CI, 1.15-1.61 for single IA). Our results suggest that genetic influence on formation may vary between IA subphenotypes.

  18. Association between Tryptophan Hydroxylase 2 Gene Polymorphism and Completed Suicide

    ERIC Educational Resources Information Center

    Fudalej, Sylwia; Ilgen, Mark; Fudalej, Marcin; Kostrzewa, Grazyna; Barry, Kristen; Wojnar, Marcin; Krajewski, Pawel; Blow, Frederic; Ploski, Rafal

    2010-01-01

    The association between suicide and a single nucleotide polymorphism (rs1386483) was examined in the recently identified tryptophan hydroxylase 2 (TPH2) gene. Blood samples of 143 suicide victims and 162 age- and sex-matched controls were examined. The frequency of the TT genotype in the TPH2 polymorphism was higher in suicide victims than in…

  19. The relationship between methylenetetrahydrofolate reductase polymorphism and hematological malignancy.

    PubMed

    Jiang, Ni; Zhu, Xishan; Zhang, Hongmei; Wang, Xiaoli; Zhou, Xinna; Gu, Jiezhun; Chen, Baoan; Ren, Jun

    2014-01-01

    Methylenetetrahydrofolate reductase (MTHFR) is the key enzyme for folate metabolism. Previous studies suggest a relationship between its single nucleotide polymorphisms (SNP) of C677T and A1298C with a variety of tumor susceptibility including hematological malignancy. SNP frequency distribution in different ethnic populations might lead to differences in disease susceptibility. There has been little research in Chinese people on the MTHFR SNP with the susceptibility of the hematological malignancy. Therefore, this study investigated the relationship between MTHFR SNPs and hematological malignancy in Jiangsu province in China. Gene microarray was used to detect MTHFR C677T and A1298C single nucleotide polymorphism loci on 157 healthy controls and 127 patients from Jiangsu province with hematological malignancies (30 with multiple myeloma, 28 with non-Hodgkin's lymphoma, 22 with acute lymphoblastic leukemia, 40 with acute myeloid leukemia, and seven with chronic myeloid leukemia). The allele frequency of 677T was 41.3% in patients and 33.1% in controls, showed significant difference (chi2 = 4.08, p = 0.043); 677TT genotype with a high susceptibility to hematological malignancy (OR 1.96, 95% CI 1.01 - 4.45, p = 0.041). In subgroup analyses, the genotypes 677TT and 1298CC were associated with significantly increased multiple myeloma risk (TT vs. CC: OR 8.92, 95% CI 1.06 - 75.24, p = 0.006; CC vs. AA: OR = 4.80, 95% CI 1.56 - 14.73, p = 0.044). No associations were found between polymorphisms and susceptibilities to acute lymphoblastic leukemia, acute myeloid leukemia, or non-Hodgkin's lymphoma. MTHFRC677T polymorphisms influence the risk of hematological malignancy among the population in Jiangsu province. Both MTHFR 677TT and MTHFR 1298CC genotypes increase susceptibility to myeloid leukemia.

  20. Influence of variation in the catechol-O-methyltransferase gene on the clinical outcome after lumbar spine surgery for one-level symptomatic disc disease: a report on 176 cases.

    PubMed

    Rut, Marcin; Machoy-Mokrzyńska, Anna; Ręcławowicz, Daniel; Słoniewski, Paweł; Kurzawski, Mateusz; Droździk, Marek; Safranow, Krzysztof; Morawska, Michalina; Białecka, Monika

    2014-02-01

    This study was aimed at the evaluation of the relationship between genetic polymorphisms of catechol-O-methyltransferase (COMT) (rs4680:A > G-Val158Met, rs6269:A > G, rs4633:C > T, rs4818:C > G) and pain sensitivity after lumbar discectomy. All patients had one-level symptomatic disc herniation from L3 to S1. The primary data recorded included visual analogue pain scales assessing back and leg pain, Oswestry Disability Questionnaire assessing quality of life and pain intensity, received/filled pre- and postoperatively. Each subject was genotyped for single-nucleotide polymorphism in the COMT gene. Clinical outcome was measured by difference between pre- and postoperative values and those results were analyzed with genetics findings. Pain intensity was associated with the COMT polymorphism. Carriers of rs6269 AA, rs4633 TT, rs4818 CC, and rs4680 AA genotypes were characterized by the lowest preoperative scores related to pain intensity and lower pain intensity at 1 year after the surgery. The rs4633 CC, rs4680 GG genotypes demonstrated significant clinical improvement in VASBACK score at 1 year after the surgery. Patients with COMT haplotype associated with low metabolic activity of enzyme (A_C_C_G) showed better clinical outcome measured by ODI score and VASBACK score 1 year after surgery. We did not observe any significant correlation between leg pain and single-nucleotide polymorphisms in the COMT gene. The results of our study indicate that polymorphism in the COMT gene may play an important role in the mechanism of pain perception, which may have a potential implication for clinical decision-making in the future.

  1. Single Nucleotide Polymorphisms of the Angiotensin-Converting Enzyme (ACE) Gene Are Associated with Essential Hypertension and Increased ACE Enzyme Levels in Mexican Individuals

    PubMed Central

    Martínez-Rodríguez, Nancy; Posadas-Romero, Carlos; Villarreal-Molina, Teresa; Vallejo, Maite; Del-Valle-Mondragón, Leonardo; Ramírez-Bello, Julian; Valladares, Adan; Cruz-López, Miguel; Vargas-Alarcón, Gilberto

    2013-01-01

    Aim To explore the role of the ACE gene polymorphisms in the risk of essential hypertension in Mexican Mestizo individuals and evaluate the correlation between these polymorphisms and the serum ACE levels. Methods Nine ACE gene polymorphisms were genotyped by 5′ exonuclease TaqMan genotyping assays and polymerase chain reaction (PCR) in 239 hypertensive and 371 non- hypertensive Mexican individuals. Haplotypes were constructed after linkage disequilibrium analysis. ACE serum levels were determined in selected individuals according to different haplotypes. Results Under a dominant model, rs4291 rs4335, rs4344, rs4353, rs4362, and rs4363 polymorphisms were associated with an increased risk of hypertension after adjusting for age, gender, BMI, triglycerides, alcohol consumption, and smoking. Five polymorphisms (rs4335, rs4344, rs4353, rs4362 and rs4363) were in strong linkage disequilibrium and were included in four haplotypes: H1 (AAGCA), H2 (GGATG), H3 (AGATG), and H4 (AGACA). Haplotype H1 was associated with decreased risk of hypertension, while haplotype H2 was associated with an increased risk of hypertension (OR = 0.77, P = 0.023 and OR = 1.41, P = 0.004 respectively). According to the codominant model, the H2/H2 and H1/H2 haplotype combinations were significantly associated with risk of hypertension after adjusted by age, gender, BMI, triglycerides, alcohol consumption, and smoking (OR = 2.0; P = 0.002 and OR = 2.09; P = 0.011, respectively). Significant elevations in serum ACE concentrations were found in individuals with the H2 haplotype (H2/H2 and H2/H1) as compared to H1/H1 individuals (P = 0.0048). Conclusion The results suggest that single nucleotide polymorphisms and the “GGATG” haplotype of the ACE gene are associated with the development of hypertension and with increased ACE enzyme levels. PMID:23741507

  2. Single nucleotide polymorphisms of the angiotensin-converting enzyme (ACE) gene are associated with essential hypertension and increased ACE enzyme levels in Mexican individuals.

    PubMed

    Martínez-Rodríguez, Nancy; Posadas-Romero, Carlos; Villarreal-Molina, Teresa; Vallejo, Maite; Del-Valle-Mondragón, Leonardo; Ramírez-Bello, Julian; Valladares, Adan; Cruz-López, Miguel; Vargas-Alarcón, Gilberto

    2013-01-01

    To explore the role of the ACE gene polymorphisms in the risk of essential hypertension in Mexican Mestizo individuals and evaluate the correlation between these polymorphisms and the serum ACE levels. Nine ACE gene polymorphisms were genotyped by 5' exonuclease TaqMan genotyping assays and polymerase chain reaction (PCR) in 239 hypertensive and 371 non- hypertensive Mexican individuals. Haplotypes were constructed after linkage disequilibrium analysis. ACE serum levels were determined in selected individuals according to different haplotypes. Under a dominant model, rs4291 rs4335, rs4344, rs4353, rs4362, and rs4363 polymorphisms were associated with an increased risk of hypertension after adjusting for age, gender, BMI, triglycerides, alcohol consumption, and smoking. Five polymorphisms (rs4335, rs4344, rs4353, rs4362 and rs4363) were in strong linkage disequilibrium and were included in four haplotypes: H1 (AAGCA), H2 (GGATG), H3 (AGATG), and H4 (AGACA). Haplotype H1 was associated with decreased risk of hypertension, while haplotype H2 was associated with an increased risk of hypertension (OR = 0.77, P = 0.023 and OR = 1.41, P = 0.004 respectively). According to the codominant model, the H2/H2 and H1/H2 haplotype combinations were significantly associated with risk of hypertension after adjusted by age, gender, BMI, triglycerides, alcohol consumption, and smoking (OR = 2.0; P = 0.002 and OR = 2.09; P = 0.011, respectively). Significant elevations in serum ACE concentrations were found in individuals with the H2 haplotype (H2/H2 and H2/H1) as compared to H1/H1 individuals (P = 0.0048). The results suggest that single nucleotide polymorphisms and the "GGATG" haplotype of the ACE gene are associated with the development of hypertension and with increased ACE enzyme levels.

  3. Variation in the γ-glutamyltransferase 1 gene and risk of chronic pancreatitis.

    PubMed

    Brand, Harrison; Diergaarde, Brenda; O'Connell, Michael R; Whitcomb, David C; Brand, Randall E

    2013-07-01

    Individuals with chronic pancreatitis are at increased risk for pancreatic cancer. We hypothesized that genetic variation in the γ-glutamyltransferase 1 (GGT1) gene, which was recently reported associated with pancreatic cancer risk in a genome-wide association study, is also associated with risk of chronic pancreatitis. Associations between common polymorphisms in GGT1 and chronic pancreatitis were evaluated using data and samples from the North American Pancreatitis Study 2. Patients (n = 496) and control subjects (n = 465) were genotyped for 4 single-nucleotide polymorphisms: rs4820599, rs2017869, rs8135987, and rs5751901. Odds ratios (ORs) and corresponding 95% confidence intervals (95% CI) for chronic pancreatitis risk were calculated using multiple logistic regression models. Interactions with cigarette smoking and alcohol use were explored. Single-nucleotide polymorphisms rs8135987 and rs4820599 were both statistically significantly associated with risk of chronic pancreatitis; compared with common allele homozygotes, individuals with at least 1 minor allele were at increased risk (rs8135987: OR, 1.36; 95% CI, 1.03-1.80 [P(trend) = 0.01]; rs4820599: OR, 1.39; 95% CI, 1.04-1.84 [P(trend) = 0.0]; adjusted for age, sex, race, smoking status, and alcohol use). No significant interactions with cigarette smoking and alcohol use were observed. Our results suggest that common variation in the GGT1 gene may also affect risk of chronic pancreatitis.

  4. Genetic variants in PNPLA3 and risk of non-alcoholic fatty liver disease in a Han Chinese population.

    PubMed

    Peng, Xian-E; Wu, Yun-Li; Lin, Shao-Wei; Lu, Qing-Qing; Hu, Zhi-Jian; Lin, Xu

    2012-01-01

    We investigated the possible association between genetic variants in the Patatin like phospholipase-3 (PNPLA3) gene and nonalcoholic fatty liver disease (NAFLD) in a Han Chinese population. We evaluated twelve tagging single-nucleotide polymorphisms (tSNPs) of the PNPLA3 gene in a frequency matched case-control study from Fuzhou city of China (553 cases, 553 controls). In the multivariate logistic regression analysis, the rs738409 GG or GC, and rs139051 TT genotypes were found to be associated with increased risk of NAFLD, and a significant trend of increased risk with increasing numbers of risk genotype was observed in the cumulative effect analysis of these single nucleotide polymorphisms. Furthermore, haplotype association analysis showed that, compared with the most common haplotype, the CAAGAATGCGTG and CGAAGGTGTCCG haplotypes conferred a statistically significant increased risk for NAFLD, while the CGGGAACCCGCG haplotype decreased the risk of NAFLD. Moreover, rs738409 C>G appeared to have a multiplicative joint effect with tea drinking (P<0.005) and an additive joint effect with obesity (Interaction contrast ratio (ICR) = 2.31, 95% CI: 0.7-8.86), hypertriglyceridemia (ICR = 3.07, 95% CI: 0.98-5.09) or hypertension (ICR = 1.74, 95% CI: 0.52-3.12). Our data suggests that PNPLA3 genetic polymorphisms might influence the susceptibility to NAFLD development independently or jointly in Han Chinese.

  5. Further Evidence of the Association of the Diacylglycerol Kinase Kappa (DGKK) Gene With Hypospadias.

    PubMed

    Hozyasz, Kamil Konrad; Mostowska, Adrianna; Kowal, Andrzej; Mydlak, Dariusz; Tsibulski, Alexander; Jagodzinski, Pawel P

    2018-02-18

    Hypospadias is a common developmental anomaly of the male external genitalia. In previous studies conducted on West European, Californian, and Han Chinese populations the relationship between polymorphic variants of the diacylglycerol kinase kappa (DGKK) gene and hypospadias have been reported. The aim was to study the possible associations between polymorphic variants of the DGKK gene and hypospadias using an independent sample of the Polish population. Ten single nucleotide polymorphisms in DGKK, which were reported to have an impact on the risk of hypospadias in other populations, were genotyped using high-resolution melting curve analysis in a group of 166 boys with isolated anterior (66%) and middle (34%) forms of hypospadias and 285 properly matched controls without congenital anomalies. Two DGKK variants rs11091748 and rs12171755 were associated with increased risk of hypospadias in the Polish population. These results were statistically significant, even after applying the Bonferroni correction for multiple comparisons (P < .005). All the tested nucleotide variants were involved in haplotype combinations associated with hypospadias. The global p-values for haplotypes comprising of rs4143304-rs11091748, rs11091748-rs17328236, rs1934179-rs4554617, rs1934183-rs1934179-rs4554617 and rs12171755-rs1934183-rs1934179-rs4554617 were statistically significant, even after the permutation test correction. Our study provides strong evidence of an association between DGKK nucleotide variants, haplotypes and hypospadias susceptibility.

  6. Associations between serum bone-specific alkaline phosphatase activity, biochemical parameters, and functional polymorphisms of the tissue-nonspecific alkaline phosphatase gene in a Japanese population.

    PubMed

    Sogabe, Natsuko; Tanabe, Rieko; Haraikawa, Mayu; Maruoka, Yutaka; Orimo, Hideo; Hosoi, Takayuki; Goseki-Sone, Masae

    2013-01-01

    We had demonstrated that single nucleotide polymorphism (787T>C) in the tissue-nonspecific ALP (TNSALP) gene was associated with the bone mineral density (BMD). BMD was the lowest among TNSALP 787T homozygotes (TT-type) and highest among TNSALP 787T>C homozygotes (CC-type) in postmenopausal women. In the present study, we investigated the effects of the TNSALP genotype on associations among serum bonespecific alkaline phosphatase (BAP), serum calcium, and phosphorus in healthy young Japanese subjects. Young healthy adult subjects (n=193) were genotyped for the polymorphism, and we measured the levels of serum BAP, serum calcium, and phosphorus. Dietary nutrient intakes were calculated based on 3-day food records before the day of blood examinations. Grouped by the TNSALP genotype, a significant negative correlation between serum BAP and phosphorus was observed in 787T>C homozygotes (CC-type), but not in heterozygotes (TCtype), nor in 787T homozygotes (TT-type). In the present study, we revealed that the single nucleotide polymorphism 787T>C in the TNSALP gene had effects on the correlation between serum BAP and phosphorus in young adult subjects. These results suggest that variation in TNSALP may be an important determinant of phosphate metabolism. Our data may be useful for planning strategies to prevent osteoporosis.

  7. Impact of single nucleotide polymorphisms of cytarabine metabolic genes on drug toxicity in childhood acute lymphoblastic leukemia.

    PubMed

    Gabor, Krisztina Mita; Schermann, Geza; Lautner-Csorba, Orsolya; Rarosi, Ferenc; Erdelyi, Daniel J; Endreffy, Emoke; Berek, Krisztina; Bartyik, Katalin; Bereczki, Csaba; Szalai, Csaba; Semsei, Agnes F

    2015-04-01

    Cytarabine (cytosine arabinoside, ara-C) is a chemotherapeutical agent used in the treatment of pediatric acute lymphoblastic leukemia (ALL). Adverse drug reactions, such as interpatient variability in sensitivity to ara-C, are considerable and may cause difficulties during chemotherapy. Single nucleotide polymorphisms (SNPs) can play a significant role in modifying nucleoside-drug pharmacokinetics and pharmacodynamics and thus the development of adverse effects. Our aim was to determine whether polymorphisms in genes encoding transporters and enzymes responsible for the metabolism of ara-C are associated with toxicity and clinical outcome in a patient population with childhood ALL. We studied 8 SNPs in the CDA, DCK, DCTD, SLC28A3, and SLC29A1 genes in 144 patients with childhood acute lymphoblastic leukemia treated according to ALLIC BFM 1990, 1995 and 2002 protocols. DCK rs12648166 and DCK rs4694362 SNPs were associated with hematologic toxicity (OR = 2.63, CI 95% = 1.37-5.04, P = 0.0036 and OR = 2.53, CI 95% = 1.34-4.80, P = 0.0044, respectively). Our results indicate that DCK polymorphisms might be important genetic risk factors for hematologic toxicity during ALL treatment with ara-C. Individualized chemotherapy based on genetic profiling may help to optimize ara-C dosing, leading to improvements in clinical outcome and reduced toxicity. © 2015 Wiley Periodicals, Inc.

  8. Association analysis of single nucleotide polymorphisms in candidate genes with root traits in maize (Zea mays L.) seedlings.

    PubMed

    Kumar, Bharath; Abdel-Ghani, Adel H; Pace, Jordon; Reyes-Matamoros, Jenaro; Hochholdinger, Frank; Lübberstedt, Thomas

    2014-07-01

    Several genes involved in maize root development have been isolated. Identification of SNPs associated with root traits would enable the selection of maize lines with better root architecture that might help to improve N uptake, and consequently plant growth particularly under N deficient conditions. In the present study, an association study (AS) panel consisting of 74 maize inbred lines was screened for seedling root traits in 6, 10, and 14-day-old seedlings. Allele re-sequencing of candidate root genes Rtcl, Rth3, Rum1, and Rul1 was also carried out in the same AS panel lines. All four candidate genes displayed different levels of nucleotide diversity, haplotype diversity and linkage disequilibrium. Gene based association analyses were carried out between individual polymorphisms in candidate genes, and root traits measured in 6, 10, and 14-day-old maize seedlings. Association analyses revealed several polymorphisms within the Rtcl, Rth3, Rum1, and Rul1 genes associated with seedling root traits. Several nucleotide polymorphisms in Rtcl, Rth3, Rum1, and Rul1 were significantly (P<0.05) associated with seedling root traits in maize suggesting that all four tested genes are involved in the maize root development. Thus considerable allelic variation present in these root genes can be exploited for improving maize root characteristics. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  9. Cognitive function in adolescence: testing for interactions between breast-feeding and FADS2 polymorphisms.

    PubMed

    Martin, Nicolas W; Benyamin, Beben; Hansell, Narelle K; Montgomery, Grant W; Martin, Nicholas G; Wright, Margaret J; Bates, Timothy C

    2011-01-01

    Breast-fed C-allele carriers of the rs174575 single nucleotide polymorphism in the fatty acyl desaturase 2 (FADS2) gene have been reported to show a 6.4 to 7 IQ point advantage over formula-fed C-allele carriers, with no effect of breast-feeding in GG carriers. An Australian sample was examined to determine if an interaction between breast-feeding and the rs174575 single nucleotide polymorphism had any effect on IQ. This hypothesis was tested in more than 700 families of adolescent twins assessed for IQ and breast-feeding, birth weight, and FADS2 polymorphisms, and parental socioeconomic status and education, and maternal FADS2 status. No significant evidence for a moderating effect on IQ of rs174575 C-carrier status and breast-feeding was found, and there no effects of maternal FADS2 status on offspring IQ. In addition, no main effects of any FADS2 polymorphisms on IQ were found when the genotype was kept as two-homozygote and one-heterozygote categories and indeed no evidence for effects of breast-feeding on IQ scores after controlling for parental socioeconomic status and education. The investigation was extended to two additional FADS2 polymorphisms (rs1535 and rs174583), but again, although these polymorphisms code alleles affecting fatty acid metabolism, no main or interaction effects were found on IQ. These results support the view that apparent effects of breast-feeding on IQ reflect differential likelihood of breast-feeding as a function of parental education and did not support the predicted interaction effect of FADS2 and breast-feeding on IQ. Copyright © 2011 American Academy of Child and Adolescent Psychiatry. Published by Elsevier Inc. All rights reserved.

  10. The common single-nucleotide polymorphism rs2681472 is associated with early-onset preeclampsia in Northern Han Chinese women.

    PubMed

    Wan, Ji-Peng; Wang, Hong; Li, Chang-Zhong; Zhao, Han; You, Li; Shi, Dong-Hong; Sun, Xiu-Hua; Lv, Hong; Wang, Fei; Wen, Ze-Qing; Wang, Xie-Tong; Chen, Zi-Jiang

    2014-11-01

    Preeclampsia, characterized by hypertension and proteinuria, remains a leading cause of maternal morbidity and mortality. Recently, a genome-wide association study (GWAS) identified the single-nucleotide polymorphism, rs2681472, as a new hypertension susceptibility genetic variant. The purpose of this study was to evaluate the association between preeclampsia and rs268172 in a Northern Han Chinese population. We genotyped 1218 unrelated Northern Han Chinese women, including 515 patients with preeclampsia and 703 healthy controls. No significant differences were detected in the allele frequencies between patients and controls (P = .23). When patients were divided into early-onset and late-onset preeclampsia according to gestational age of disease onset, the allele frequencies significantly differed between controls and patients with early-onset preeclampsia (P = .02). Genotype frequencies also were significantly different between controls and patients early-onset preeclampsia when data were analyzed under additive (P = .03) and dominant (P = .009) models. We replicated this association in an independent Northern Han Chinese population and observed a significant difference in the allele frequencies between patients with early-onset preeclampsia and controls (P = .011). We report that rs2681472 is associated with early-onset preeclampsia in Northern Han Chinese women. © The Author(s) 2014.

  11. MicroRNA-196a2 Biomarker and Targetome Network Analysis in Solid Tumors.

    PubMed

    Toraih, Eman A; Fawzy, Manal S; Mohammed, Eman A; Hussein, Mohammad H; El-Labban, Mohamad M

    2016-12-01

    MicroRNAs (miRNAs) have been linked to cancer development and progression. The molecular mechanisms underlying the genetic associations of the miRNA single nucleotide polymorphism with cancer vary by cancer site. As there are no previous studies on the miR-196a2 variant or expression in any type of cancer among our population, we aimed to determine the expression profile of mature miR-196a2 in various types of solid tumors and to analyze the impact of its polymorphism (rs11614913; C/T) on the expression levels. The study included 230 cancer patients (including 17 types of cancer), 26 patients with pre-cancer lesions, and 100 unrelated controls. Archived formalin-fixed, paraffin-embedded specimens (n = 197) were available for both miRNA expression analysis and single nucleotide polymorphism identification. Venous blood was collected from 59 histologically confirmed sporadic cancer patients and the study controls for single nucleotide polymorphism identification. Real-time polymerase chain reaction analysis was performed for allelic discrimination and relative quantification of miR-196a2 in the study samples. In silico target gene prediction and network analysis was performed. We found that individuals with the T variant were associated with cancer risk under all genetic association models, especially in colorectal, esophageal, skin, lung, thyroid, and renal cancer. Overall and stratified analysis showed miR-196a2 over-expression in most of the current malignant tumor samples relative to their corresponding cancer-free tissues. Carriers of the C allele had significantly higher expression levels of miR-196a2. Correlation with the clinicopathological features of cancer showed organ-specific effects. Gene enrichment analysis of predicted and validated targets speculated the putative role of miR-196a2 in cancer-associated biology. We highlighted cancer-type specific expression profiles of miR-196a2, which was correlated with the clinicopathological features in various types of cancer. Taken together, our results suggest that the miRNA signature could have promising diagnostic and prognostic significance.

  12. The AVPR1A Gene and Its Single Nucleotide Polymorphism rs10877969: A Literature Review of Associations with Health Conditions and Pain.

    PubMed

    Roach, Keesha L; Hershberger, Patricia E; Rutherford, Julienne N; Molokie, Robert E; Wang, Zaijie Jim; Wilkie, Diana J

    2018-03-01

    Pain is the quintessential symptom for individuals suffering from sickle cell disease (SCD). Although the degree of suffering and the cost of treatment are staggering, SCD continues to be grossly understudied, including a lack of data for pain-related genes and prevalence of polymorphisms in this population. This lack of data adds to the inadequacy of pain therapy in this population. Pain genetics investigators have recently examined allele frequencies of single-nucleotide polymorphisms from candidate genes in people who have SCD. One of the genes identified was the arginine vasopressin receptor 1A gene (AVPR1A) and its associated single-nucleotide polymorphism (SNP) rs10877969. Progress in explaining pain-related polymorphisms associated with SCD can be facilitated by understanding the literature. The purpose of this literature review was to describe mechanisms of the polymorphic gene AVPR1A and the phenotypic variations associated with its SNPs relative to health conditions and pain. Published studies were included if the research addressed AVPR1A and was a full article in a peer-reviewed journal, in the English language, a human or animal study, and published 2009 to present. Abstracts were included if they were in English and provided information not found in a full article. The results of this review revealed that AVPR1A is associated with behavioral phenotypes, which include pair bonding, autism spectrum disorder, musical aptitude, infidelity, altruism, monogamy, mating, substance abuse, and alcohol preference. In addition, there were associations with pain, stress pain by sex, and sickle cell pain. Summary of this literature could provide insights into future pain research of this SNP in people with SCD. Copyright © 2018 American Society for Pain Management Nursing. Published by Elsevier Inc. All rights reserved.

  13. Exploring genetic variants predisposing to diabetes mellitus and their association with indicators of socioeconomic status.

    PubMed

    Schmidt, Börge; Dragano, Nico; Scherag, André; Pechlivanis, Sonali; Hoffmann, Per; Nöthen, Markus M; Erbel, Raimund; Jöckel, Karl-Heinz; Moebus, Susanne

    2014-06-16

    The relevance of disease-related genetic variants for the explanation of social inequalities in complex diseases is unclear and empirical analyses are largely missing. The aim of our study was to examine whether genetic variants predisposing to diabetes mellitus are associated with socioeconomic status in a population-based cohort. We genotyped 11 selected diabetes-related single nucleotide polymorphisms in 4655 participants (age 45-75 years) of the Heinz Nixdorf Recall study. Diabetes status was self-reported or defined by blood glucose levels. Education, income and paternal occupation were assessed as indicators of socioeconomic status. Multiple regression analyses were used to examine the association of socioeconomic status and diabetes by estimating sex-specific and age-adjusted prevalence ratios and their corresponding 95%-confidence intervals. To explore the relationship between individual single nucleotide polymorphisms and socioeconomic status sex- and age-adjusted odds ratios were computed. We adjusted the alpha-level for multiple testing of 11 single nucleotide polymorphisms using Bonferroni's method (α(BF) ~ 0.005). In addition, we explored the association of a genetic risk score with socioeconomic status. Social inequalities in diabetes were observed for all indicators of socioeconomic status. However, there were no significant associations between individual diabetes-related risk alleles and socioeconomic status with odds ratios ranging from 0.87 to 1.23. Similarly, the genetic risk score analysis revealed no evidence for an association. Our data provide no evidence for an association between 11 diabetes-related risk alleles and different indicators of socioeconomic status in a population-based cohort, suggesting that the explored genetic variants do not contribute to health inequalities in diabetes.

  14. No association of the neuropeptide Y (Leu7Pro) and ghrelin gene (Arg51Gln, Leu72Met, Gln90Leu) single nucleotide polymorphisms with eating disorders.

    PubMed

    Kindler, Jochen; Bailer, Ursula; de Zwaan, Martina; Fuchs, Karoline; Leisch, Friedrich; Grün, Bettina; Strnad, Alexandra; Stojanovic, Mirjana; Windisch, Julia; Lennkh-Wolfsberg, Claudia; El-Giamal, Nadja; Sieghart, Werner; Kasper, Siegfried; Aschauer, Harald

    2011-06-01

    Genetic factors likely contribute to the biological vulnerability of eating disorders. Case-control association study on one neuropeptide Y gene (Leu7Pro) polymorphism and three ghrelin gene (Arg51Gln, Leu72Met and Gln90Leu) polymorphisms. 114 eating disorder patients (46 with anorexia nervosa, 30 with bulimia nervosa, 38 with binge eating disorder) and 164 healthy controls were genotyped. No differences were detected between patients and controls for any of the four polymorphisms in allele frequency and genotype distribution (P > 0.05). Allele frequencies and genotypes had no significant influence on body mass index (P > 0.05) in eating disorder patients. Positive findings of former case-control studies of associations between ghrelin gene polymorphisms and eating disorders could not be replicated. Neuropeptide Y gene polymorphisms have not been investigated in eating disorders before.

  15. The balance of the immune system between HLA-G and NK cells in unexplained recurrent spontaneous abortion and polymorphisms analysis.

    PubMed

    Arjmand, Fateme; Ghasemi, Nasrin; Mirghanizadeh, Seyed Ali; Samadi, Morteza

    2016-06-01

    Human leukocyte antigen (HLA)-G is involved in immunoregulatory processes and particularly in pathogenesis of inflammatory disorders such as recurrent spontaneous abortions (RSA). The purpose of the current study was to examine whether two single nucleotide polymorphisms (SNPs) of HLA-G gene (rs1736936 and HLA-G*0105N) influence susceptibility to recurrent spontaneous abortion. Genomic DNA from 117 RSA patients and 117 normal fertile control individuals was isolated using the salted out method. The two single nucleotide polymorphisms in HLA-G gene were analyzed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Differences between the two groups were analyzed by SPSS19 software using Chi-square test. The results revealed a significant increase in HLA-G*0105N allele in the proportion of whole group of RSA women compared with fertile controls (P value = 0.015), OR (95 % CI) = 2.054 (1.798-2.347), as well as an absence of homozygosity for HLA-G*0105N in the study population. No significant difference was observed between the RSA and the fertile groups in terms of alleles and genotypes frequency of rs1736936 (P value = 0.323), OR (95 CI %) = 1.056 (0.844-1.319). The presented data suggest that the investigated HLA-G*0105N allele is potentially associated with RSA through linkage disequilibrium with other genetic elements. Meanwhile, the rs1736936 SNP do not predispose to RSA in the study population.

  16. Single-nucleotide polymorphisms g.151435C>T and g.173057T>C in PRLR gene regulated by bta-miR-302a are associated with litter size in goats.

    PubMed

    An, Xiaopeng; Hou, Jinxing; Gao, Teyang; Lei, Yingnan; Li, Guang; Song, Yuxuan; Wang, Jiangang; Cao, Binyun

    2015-06-01

    Single-nucleotide polymorphisms (SNPs) located at microRNA-binding sites (miR-SNPs) can affect the expression of genes. This study aimed to identify the miR-SNPs associated with litter size. Guanzhong (n = 321) and Boer (n = 191) goat breeds were used to detect SNPs in the caprine prolactin receptor (PRLR) gene by DNA sequencing, primer-introduced restriction analysis-polymerase chain reaction, and polymerase chain reaction-restriction fragment length polymorphism. Three novel SNPs (g.151435C>T, g.151454A>G, and g.173057T>C) were identified in the caprine PRLR gene. Statistical results indicated that the g.151435C>T and g.173057T>C SNPs were significantly associated with litter size in Guanzhong and Boer goat breeds. Further analysis revealed that combinative genotype C6 (TTAACC) was better than the others for litter size in both goat breeds. Furthermore, the PRLR g.173057T>C polymorphism was predicted to regulate the binding activity of bta-miR-302a. Luciferase reporter gene assay confirmed that 173057C to T substitution disrupted the binding site for bta-miR-302a, resulting in the reduced levels of luciferase. Taken together, these findings suggested that bta-miR-302a can influence the expression of PRLR protein by binding with 3'untranslated region, resulting in that the g.173057T>C SNP had significant effects on litter size. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Association of microRNA-125a and microRNA-499a polymorphisms in chronic periodontitis in a sample south Indian population: A hospital-based genetic association study.

    PubMed

    Venugopal, Priyanka; Lavu, Vamsi; Rao, Suresh Ranga; Venkatesan, Vettriselvi

    2017-10-05

    Periodontitis is a chronic inflammatory disease, caused by interaction between periodontopathic bacteria and the host immune response. MicroRNAs are small, single-stranded molecules, which play a key role in the regulation of diverse biological processes. Dysregulation of microRNAs function can lead to several diseases such as autoimmune and chronic inflammatory diseases. The objective of the study was to determine the association between selected single nucleotide polymorphisms in miR-125a, miR-499 and LIN28 homology A with chronic periodontitis susceptibility in a sample population from south India. Genotyping of the single nucleotide polymorphisms in miR-125a (rs41275794, rs12976445, rs10404453 and rs12975333), miR-499 (rs3746444) and LIN28 homolog A (rs3811463) was performed in DNA from288 controls (individuals with healthy gingiva) and 262 cases (chronic periodontitis patients) by direct dye-terminator sequencing. Disease association analysis revealed a significant association of the variant alleles of the miR-499a polymorphism (rs3746444) in chronic periodontitis [OR=2.07; 95%CI (1.35-3.17)]. The risk associated C-allele frequency was found to be higher in chronic periodontitis subjects as compared to that of healthy individuals. Similar results were also observed in the dominant model [OR=2.42; 95% CI (1.67-3.51)]. The recessive model for miR-125a polymorphism (rs12976445) was also found to be statistically significant with OR=1.54 and 95% CI (1.03-2.30). The haplotype "GCGGCA" was found to be higher in chronic periodontitis subjects than in healthy individuals. Pairwise linkage disequilibrium analysis exhibited that the polymorphisms, rs41275794 and rs12976445 in miR-125a, were in strong linkage equilibrium (D'=0.97). Epistatic interaction by multifactorial dimensionality reduction analysis revealed that the genotypes of the polymorphisms of miR-125a (rs41275794, rs12976445, rs10404453), miR-499a (rs3746444) and LIN28 (rs3811463) were interacting significantly [OR=2.54 (1.65-3.92)], thereby contributing to the risk of chronic periodontitis. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. [Comparative analysis of STR and SNP polymorphism in the populations of sockeye salmon (Oncorhynchus nerka) from Eastern and Western Kamchatka].

    PubMed

    Khrustaleva, A M; Volkov, A A; Stoklitskaia, D S; Miuge, N S; Zelenina, D A

    2010-11-01

    Sockeye salmon samples from five largest lacustrine-riverine systems of Kamchatka Peninsula were tested for polymorphism at six microsatellite (STR) and five single nucleotide polymorphism (SNP) loci. Statistically significant genetic differentiation among local populations from this part of the species range examined was demonstrated. The data presented point to pronounced genetic divergence of the populations from two geographical regions, Eastern and Western Kamchatka. For sockeye salmon, the individual identification test accuracy was higher for microsatellites compared to similar number of SNP markers. Pooling of the STR and SNP allele frequency data sets provided the highest accuracy of the individual fish population assignment.

  19. Gene-gene interactions among genetic variants from obesity candidate genes for nonobese and obese populations in type 2 diabetes.

    PubMed

    Lin, Eugene; Pei, Dee; Huang, Yi-Jen; Hsieh, Chang-Hsun; Wu, Lawrence Shih-Hsin

    2009-08-01

    Recent studies indicate that obesity may play a key role in modulating genetic predispositions to type 2 diabetes (T2D). This study examines the main effects of both single-locus and multilocus interactions among genetic variants in Taiwanese obese and nonobese individuals to test the hypothesis that obesity-related genes may contribute to the etiology of T2D independently and/or through such complex interactions. We genotyped 11 single nucleotide polymorphisms for 10 obesity candidate genes including adrenergic beta-2-receptor surface, adrenergic beta-3-receptor surface, angiotensinogen, fat mass and obesity associated gene, guanine nucleotide binding protein beta polypeptide 3 (GNB3), interleukin 6 receptor, proprotein convertase subtilisin/kexin type 1 (PCSK1), uncoupling protein 1, uncoupling protein 2, and uncoupling protein 3. There were 389 patients diagnosed with T2D and 186 age- and sex-matched controls. Single-locus analyses showed significant main effects of the GNB3 and PCSK1 genes on the risk of T2D among the nonobese group (p = 0.002 and 0.047, respectively). Further, interactions involving GNB3 and PCSK1 were suggested among the nonobese population using the generalized multifactor dimensionality reduction method (p = 0.001). In addition, interactions among angiotensinogen, fat mass and obesity associated gene, GNB3, and uncoupling protein 3 genes were found in a significant four-locus generalized multifactor dimensionality reduction model among the obese population (p = 0.001). The results suggest that the single nucleotide polymorphisms from the obesity candidate genes may contribute to the risk of T2D independently and/or in an interactive manner according to the presence or absence of obesity.

  20. The pharmacogenetics of body odor: as easy as ABCC?

    PubMed

    Brown, Sara

    2013-07-01

    ABCC11 genotype affects apocrine secretory cell function and determines individual body odor phenotype. Rodriguez et al. have applied genetic epidemiology using predetermined phenotype data to demonstrate an association between a single-nucleotide polymorphism (rs17822931) and the human behavior of deodorant application. Individuals with the ABCC11 genotype predicting a nonodorous phenotype report a significantly lower frequency of deodorant use.

  1. Multilocus patterns of nucleotide polymorphism and demographic change in Taxodium distichum (Cupressaceae) in the lower Mississippi River alluvial valley

    USGS Publications Warehouse

    Kusumi, Junko; Zidong, Li; Kado, Tomoyuki; Tsumura, Yoshihiko; Middleton, Beth A.; Tachida, Hidenori

    2010-01-01

    Conclusions: Taxodium distichum had significantly higher nucleotide variation than C. japonica, and its patterns of polymorphism contrasted strikingly with those of the latter, which previously has been inferred to have experienced a reduction in population size.

  2. Prenatal Diagnosis of DNA Copy Number Variations by Genomic Single-Nucleotide Polymorphism Array in Fetuses with Congenital Heart Defects.

    PubMed

    Tang, Shaohua; Lv, Jiaojiao; Chen, Xiangnan; Bai, Lili; Li, Huanzheng; Chen, Chong; Wang, Ping; Xu, Xueqin; Lu, Jianxin

    2016-01-01

    To evaluate the usefulness of single-nucleotide polymorphism (SNP) array for prenatal genetic diagnosis of congenital heart defect (CHD), we used this approach to detect clinically significant copy number variants (CNVs) in fetuses with CHDs. A HumanCytoSNP-12 array was used to detect genomic samples obtained from 39 fetuses that exhibited cardiovascular abnormalities on ultrasound and had a normal karyotype. The relationship between CNVs and CHDs was identified by using genotype-phenotype comparisons and searching of chromosomal databases. All clinically significant CNVs were confirmed by real-time PCR. CNVs were detected in 38/39 (97.4%) fetuses: variants of unknown significance were detected in 2/39 (5.1%), and clinically significant CNVs were identified in 7/39 (17.9%). In 3 of the 7 fetuses with clinically significant CNVs, 3 rare and previously undescribed CNVs were detected, and these CNVs encompassed the CHD candidate genes FLNA (Xq28 dup), BCOR (Xp11.4 dup), and RBL2 (16q12.2 del). Compared with conventional cytogenetic genomics, SNP array analysis provides significantly improved detection of submicroscopic genomic aberrations in pregnancies with CHDs. Based on these results, we propose that genomic SNP array is an effective method which could be used in the prenatal diagnostic test to assist genetic counseling for pregnancies with CHDs. © 2015 S. Karger AG, Basel.

  3. Single nucleotide polymorphism in toll-like receptor 6 is associated with a decreased risk for ureaplasma respiratory tract colonization and bronchopulmonary dysplasia in preterm infants.

    PubMed

    Winters, Alexandra H; Levan, Tricia D; Vogel, Stefanie N; Chesko, Kirsty L; Pollin, Toni I; Viscardi, Rose M

    2013-08-01

    Ureaplasma spp. respiratory tract colonization is a risk factor for bronchopulmonary dysplasia (BPD) in preterm infants, but differences in host susceptibility have not been elucidated. We hypothesized that variants in genes regulating the innate immune response are associated with altered risk for Ureaplasma spp. respiratory colonization and BPD in preterm infants. Twenty-four tag single nucleotide polymorphisms (SNPs) from Toll-like receptor (TLR)1, TLR2, TLR4 and TLR6 were assayed in 298 infants <33 weeks gestation who had serial respiratory cultures for Ureaplasma spp. and were evaluated for BPD. The majority of subjects (N = 205 [70%]) were African-American. One hundred ten (37%) were Ureaplasma positive. Four SNPs in TLR2 and TLR6 were significantly associated with Ureaplasma respiratory tract colonization. Single SNPs in TLR2, TLR4 and TLR6 were associated with BPD. TLR6 SNP rs5743827 was associated with both a decreased risk for Ureaplasma respiratory tract colonization and decreased risk for BPD (odds ratio: 0.54 [0.34-0.86] and odds ratio: 0.54 [0.31-0.95], respectively). There was a significant additive interaction between Ureaplasma colonization and genotype at TLR6 SNP rs5743827 (Padditive = 0.023), with an attributable proportion due to interaction of 0.542. Polymorphisms in host defense genes may alter susceptibility to Ureaplasma infection and severity of the inflammatory response contributing to BPD. These observations implicate host genetic susceptibility as a major factor in BPD pathogenesis in Ureaplasma-infected preterms.

  4. Canine olfactory receptor gene polymorphism and its relation to odor detection performance by sniffer dogs.

    PubMed

    Lesniak, Anna; Walczak, Marta; Jezierski, Tadeusz; Sacharczuk, Mariusz; Gawkowski, Maciej; Jaszczak, Kazimierz

    2008-01-01

    The outstanding sensitivity of the canine olfactory system has been acknowledged by using sniffer dogs in military and civilian service for detection of a variety of odors. It is hypothesized that the canine olfactory ability is determined by polymorphisms in olfactory receptor (OR) genes. We investigated 5 OR genes for polymorphic sites which might affect the olfactory ability of service dogs in different fields of specific substance detection. All investigated OR DNA sequences proved to have allelic variants, the majority of which lead to protein sequence alteration. Homozygous individuals at 2 gene loci significantly differed in their detection skills from other genotypes. This suggests a role of specific alleles in odor detection and a linkage between single-nucleotide polymorphism and odor recognition efficiency.

  5. Significant SNPs have limited prediction ability for thyroid cancer

    PubMed Central

    Guo, Shicheng; Wang, Yu-Long; Li, Yi; Jin, Li; Xiong, Momiao; Ji, Qing-Hai; Wang, Jiucun

    2014-01-01

    Recently, five thyroid cancer significantly associated genetic variants (rs965513, rs944289, rs116909374, rs966423, and rs2439302) have been discovered and validated in two independent GWAS and numerous case–control studies, which were conducted in different populations. We genotyped the above five single nucleotide polymorphisms (SNPs) in Han Chinese populations and performed thyroid cancer-risk predictions with nine machine learning methods. We found that four SNPs were significantly associated with thyroid cancer in Han Chinese population, while no polymorphism was observed for rs116909374. Small familial relative risks (1.02–1.05) and limited power to predict thyroid cancer (AUCs: 0.54–0.60) indicate limited clinical potential. Four significant SNPs have limited prediction ability for thyroid cancer. PMID:24591304

  6. PREVALENCE OF COMBINATORIAL CYP2C9 AND VKORC1 GENOTYPES IN PUERTO RICANS: IMPLICATIONS FOR WARFARIN MANAGEMENT IN HISPANICS

    PubMed Central

    Duconge, Jorge; Cadilla, Carmen L.; Windemuth, Andreas; Kocherla, Mohan; Gorowski, Krystyna; Seip, Richard L.; Bogaard, Kali; Renta, Jessica Y.; Piovanetti, Paola; D’Agostino, Darrin; Santiago-Borrero, Pedro J.; Ruaño, Gualberto

    2010-01-01

    Polymorphisms in the cytochrome P450 2C9 (CYP2C9) and vitamin K epoxide reductase complex subunit 1 (VKORC1) genes significantly alter the effective warfarin dose. We determined the frequencies of alleles, single carriers, and double carriers of single nucleotide polymorphisms (SNPs) in the CYP2C9 and VKORC1 genes in a Puerto Rican cohort and gauged the impact of these polymorphisms on warfarin dosage using a published algorithm. A total of 92 DNA samples were genotyped using Luminex® x-MAP technology. The polymorphism frequencies were 6.52%, 5.43% and 28.8% for CYP2C9 *2, *3 and VKORC1-1639 G>A polymorphisms, respectively. The prevalence of combinatorial genotypes was 16% for carriers of both the CYP2C9 and VKORC1 polymorphisms, 9% for carriers of CYP2C9 polymorphisms, 35% for carriers of the VKORC1 polymorphism, and the remaining 40% were non-carriers for either gene. Based on a published warfarin dosing algorithm, single, double and triple carriers of functionally deficient polymorphisms predict reductions of 1.0–1.6, 2.0–2.9, and 2.9–3.7 mg/day, respectively, in warfarin dose. Overall, 60% of the population carried at least a single polymorphism predicting deficient warfarin metabolism or responsiveness and 13% were double carriers with polymorphisms in both genes studied. Combinatorial genotyping of CYP2C9 and VKORC1 can allow for individualized dosing of warfarin among patients with gene polymorphisms, potentially reducing the risk of stroke or bleeding. PMID:20073138

  7. A genetic variation map for chicken with 2.8 million single nucleotide polymorphisms

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wong, G K; Hillier, L; Brandstrom, M

    2005-02-20

    We describe a genetic variation map for the chicken genome containing 2.8 million single nucleotide polymorphisms (SNPs), based on a comparison of the sequences of 3 domestic chickens (broiler, layer, Silkie) to their wild ancestor Red Jungle Fowl (RJF). Subsequent experiments indicate that at least 90% are true SNPs, and at least 70% are common SNPs that segregate in many domestic breeds. Mean nucleotide diversity is about 5 SNP/kb for almost every possible comparison between RJF and domestic lines, between two different domestic lines, and within domestic lines--contrary to the idea that domestic animals are highly inbred relative to theirmore » wild ancestors. In fact, most of the SNPs originated prior to domestication, and there is little to no evidence of selective sweeps for adaptive alleles on length scales of greater than 100 kb.« less

  8. A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms.

    PubMed

    Zeng, Lingwen; Xiao, Zhuo

    2017-01-01

    A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.

  9. Single-nucleotide polymorphisms associated with symptomatic infection and differential human gene expression in healthy seropositive persons each implicate the cytoskeleton, integrin signaling, and oncosuppression in the pathogenesis of human parvovirus B19 infection.

    PubMed

    Kerr, Jonathan R; Kaushik, Narendra; Fear, David; Baldwin, Don A; Nuwaysir, Emile F; Adcock, Ian M

    2005-07-15

    This study was undertaken to further examine the role of the host response to parvovirus B19 in the development of symptoms and consequences of viral persistence. Genomic DNA from 42 patients with symptomatic B19 infection was analyzed using the HuSNP assay (Affymetrix), and the results were compared with those from analysis of 53 healthy control individuals. Fifty-seven single-nucleotide polymorphisms were identified that were significantly associated with symptomatic infection. Total RNA from peripheral blood mononuclear cells from 57 B19-seropositive and 13 B19-seronegative donors was analyzed by hybridization to a single-color microarray representing 9522 human genes. Ninety-two genes were shown to be differentially expressed. Differential expression was confirmed in 6 of 38 genes (SKIP, MACF1, SPAG7, FLOT1, c6orf48, and RASSF5) tested using real-time quantitative polymerase chain reaction in a different group of healthy subjects. Genes identified in both studies play a functional role in the cytoskeleton, integrin signaling, and oncosuppression, themes that have been shown to be important in parvovirus infections.

  10. Association between AMELX polymorphisms and dental caries in Koreans.

    PubMed

    Kang, S W; Yoon, I; Lee, H W; Cho, J

    2011-05-01

    Dental caries is greatly influenced disease by environmental factors, but recently there are increasing evidences for a genetic component in caries susceptibility. AMELX is the gene coding amelogenin, which is the most important factor for normal enamel development. The aim of this study was to examine the relationship between dental caries and single nucleotide polymorphisms (SNPs) in AMELX. For this study, we used DNA samples collected from 120 unrelated individuals older than 12 years of age. All of them were examined for their oral and dental status under the WHO recommended criteria, and clinical information such as DMFT and DMFS were evaluated. Individuals whose DMFT and DMFS index lower than 2 were designated 'very low caries experience' and higher than 3 were designated 'higher caries experience'. Genomic DNA was extracted from hair samples, and single nucleotide polymorphisms of AMELX were genotyped. Genotyping of three SNPs (rs17878486, rs5933871, rs5934997, intron) in AMELX gene was determined by direct sequencing and analyzed with SNPStats. There were significant associations between rs5933871 and rs5934997 SNP and caries susceptibility in the water fluoridation group. These results suggest that SNPs of AMELX might be associated with dental caries susceptibility in Korean population. © 2010 John Wiley & Sons A/S.

  11. Promoter polymorphism at the tumour necrosis factor/lymphotoxin-alpha locus is associated with type of diabetes but not with susceptibility to sight-threatening diabetic retinopathy.

    PubMed

    Kaidonis, Georgia; Craig, Jamie E; Gillies, Mark C; Abhary, Sotoodeh; Essex, Rohan W; Chang, John H; Pal, Bishwanath; Pefkianaki, Maria; Daniell, Mark; Lake, Stewart; Petrovsky, Nikolai; Burdon, Kathryn P

    2016-03-01

    To investigate, in a large cohort of 2494 individuals with diabetes mellitus, whether functional single nucleotide polymorphisms in the promoter region of tumour necrosis factor (TNF) and lymphotoxin-alpha (LTA) genes are associated with type of diabetes or presence of diabetic retinopathy. A total of 334 type 1 diabetes and 999 type 2 diabetes participants with sight-threatening diabetic retinopathy, and 260 type 1 diabetes and 901 type 2 diabetes participants with no diabetic retinopathy or minimal non-proliferative diabetic retinopathy, were genotyped for two single nucleotide polymorphisms (rs1800629 and rs361525). The A allele of rs1800629 was associated with type 1 diabetes (p < 0.001; odds ratio = 0.62). After adjustment for age, sex, diabetes duration, HbA1c, hypertension and nephropathy, no significant association was found between rs1800629 or rs361525 and sight-threatening diabetic retinopathy. An association between the A allele of rs1800629 and type of diabetes was found. No association was found between two promoter variants of TNF and LTA, and diabetic retinopathy in a large cohort of Caucasian patients with type 1 diabetes and type 2 diabetes. © The Author(s) 2016.

  12. Oxytocin Receptor (OXTR) Single Nucleotide Polymorphisms Indirectly Predict Prosocial Behavior Through Perspective Taking and Empathic Concern.

    PubMed

    Christ, Christa C; Carlo, Gustavo; Stoltenberg, Scott F

    2016-04-01

    Engaging in prosocial behavior can provide positive outcomes for self and others. Prosocial tendencies contribute to the propensity to engage in prosocial behavior. The oxytocin receptor gene (OXTR) has also been associated with prosocial tendencies and behaviors. There has been little research, however, investigating whether the relationship between OXTR and prosocial behaviors is mediated by prosocial tendencies. This relationship may also vary among different types of prosocial behavior. The current study examines the relationship between OXTR, gender, prosocial tendencies, and both altruistic and public prosocial behavior endorsement. Students at a midwestern university (N = 398; 89.2% Caucasian; Mage  = 20.76; 26.6% male) provided self-report measures of prosocial tendencies and behaviors and buccal cells for genotyping OXTR polymorphisms. Results indicated that OXTR single nucleotide polymorphism (SNP) rs2268498 genotype significantly predicted empathic concern, whereas gender moderated the association between several other OXTR SNPs and prosocial tendencies. Increased prosocial tendencies predicted increased altruistic prosocial behavior endorsement and decreased public prosocial behavior endorsement. Our findings suggest an association between genetic variation in OXTR and endorsement of prosocial behavior indirectly through prosocial tendencies, and that the pathway is dependent on the type of prosocial behavior and gender. © 2014 Wiley Periodicals, Inc.

  13. Initial evidence that polymorphisms in neurotransmitter-regulating genes contribute to being born small for gestational age

    PubMed Central

    Morgan, Angharad R.; Thompson, John M.D.; Waldie, Karen E.; Cornforth, Christine M.; Turic, Darko; Sonuga-Barke, Edmund J.S.; Lam, Wen-Jiun; Ferguson, Lynnette R.; Mitchell, Edwin A.

    2012-01-01

    Being born small for gestational age (SGA) is a putative risk factor for the development of later cognitive and psychiatric health problems. While the inter-uterine environment has been shown to play an important role in predicting birth weight, little is known about the genetic factors that might be important. Here we test the hypothesis that neurotransmitter-regulating genes implicated in psychiatric disorders previously shown to be associated with SGA (such as attention-deficit hyperactivity disorder) are themselves predictive of SGA. DNA was collected from 227 SGA and 319 appropriate for gestational age children taking part in the Auckland Birthweight Collaborative Study. Candidate single nucleotide polymorphisms in genes regulating activity within dopamine, serotonin, glutamate and gamma-aminobutyric acid pathways were genotyped. Multiple regression analysis, controlling for potentially confounding factors, supported nominally significant associations between SGA and single nucleotide polymorphisms in COMT, HTR2A, SLC1A1 and SLC6A1. This is the first evidence that genes implicated in psychiatric disorders previously linked to SGA status themselves predict SGA. This highlights the possibility that the link between SGA and psychiatric disorders such as attention-deficit hyperactivity disorder may in part be genetically determined – that SGA marks pre-existing genetic risk for later problems. PMID:27625810

  14. First High-Density Linkage Map and Single Nucleotide Polymorphisms Significantly Associated With Traits of Economic Importance in Yellowtail Kingfish Seriola lalandi.

    PubMed

    Nguyen, Nguyen H; Rastas, Pasi M A; Premachandra, H K A; Knibb, Wayne

    2018-01-01

    The genetic resources available for the commercially important fish species Yellowtail kingfish (YTK) ( Seriola lalandi) are relative sparse. To overcome this, we aimed (1) to develop a linkage map for this species, and (2) to identify markers/variants associated with economically important traits in kingfish (with an emphasis on body weight). Genetic and genomic analyses were conducted using 13,898 single nucleotide polymorphisms (SNPs) generated from a new high-throughput genotyping by sequencing platform, Diversity Arrays Technology (DArTseq TM ) in a pedigreed population comprising 752 animals. The linkage analysis enabled to map about 4,000 markers to 24 linkage groups (LGs), with an average density of 3.4 SNPs per cM. The linkage map was integrated into a genome-wide association study (GWAS) and identified six variants/SNPs associated with body weight ( P < 5e -8 ) when a multi-locus mixed model was used. Two out of the six significant markers were mapped to LGs 17 and 23, and collectively they explained 5.8% of the total genetic variance. It is concluded that the newly developed linkage map and the significantly associated markers with body weight provide fundamental information to characterize genetic architecture of growth-related traits in this population of YTK S. lalandi .

  15. Identification and validation of single nucleotide polymorphisms as tools to detect hybridization and population structure in freshwater stingrays.

    PubMed

    Cruz, Vanessa P; Vera, Manuel; Pardo, Belén G; Taggart, John; Martinez, Paulino; Oliveira, Claudio; Foresti, Fausto

    2017-05-01

    Single nucleotide polymorphism (SNP) markers were identified and validated for two stingrays species, Potamotrygon motoro and Potamotrygon falkneri, using double digest restriction-site associated DNA (ddRAD) reads using 454-Roche technology. A total of 226 774 reads (65.5 Mb) were obtained (mean read length 289 ± 183 bp) detecting a total of 5399 contigs (mean contig length: 396 ± 91 bp). Mining this data set, a panel of 143 in silico SNPs was selected. Eighty-two of these SNPs were successfully validated and 61 were polymorphic: 14 in P. falkneri, 21 in P. motoro, 3 in both species and 26 fixed for alternative variants in both species, thus being useful for population analyses and hybrid detection. © 2016 John Wiley & Sons Ltd.

  16. Single nucleotide polymorphisms associated with coronary heart disease predict incident ischemic stroke in the atherosclerosis risk in communities study.

    PubMed

    Morrison, Alanna C; Bare, Lance A; Luke, May M; Pankow, James S; Mosley, Thomas H; Devlin, James J; Willerson, James T; Boerwinkle, Eric

    2008-01-01

    Ischemic stroke and coronary heart disease (CHD) may share genetic factors contributing to a common etiology. This study investigates whether 51 single nucleotide polymorphisms (SNPs) associated with CHD in multiple antecedent studies are associated with incident ischemic stroke in the Atherosclerosis Risk in Communities (ARIC) study. From the multiethnic ARIC cohort of 14,215 individuals, 495 validated ischemic strokes were identified. Cox proportional hazards models, adjusted for age and gender, identified three SNPs in Whites and two SNPs in Blacks associated with incident stroke (p

  17. Associations between single nucleotide polymorphisms in folate uptake and metabolizing genes with blood folate, homocysteine and DNA uracil concentrations

    USDA-ARS?s Scientific Manuscript database

    Background: Folate is an essential nutrient which supports nucleotide synthesis and biological methylation reactions. Diminished folate status results in chromosome breakage and is associated with several diseases including colorectal cancer. Folate status is also inversely related to plasma homocys...

  18. Analysis of alkaptonuria (AKU) mutations and polymorphisms reveals that the CCC sequence motif is a mutational hot spot in the homogentisate 1,2 dioxygenase gene (HGO).

    PubMed Central

    Beltrán-Valero de Bernabé, D; Jimenez, F J; Aquaron, R; Rodríguez de Córdoba, S

    1999-01-01

    We recently showed that alkaptonuria (AKU) is caused by loss-of-function mutations in the homogentisate 1,2 dioxygenase gene (HGO). Herein we describe haplotype and mutational analyses of HGO in seven new AKU pedigrees. These analyses identified two novel single-nucleotide polymorphisms (INV4+31A-->G and INV11+18A-->G) and six novel AKU mutations (INV1-1G-->A, W60G, Y62C, A122D, P230T, and D291E), which further illustrates the remarkable allelic heterogeneity found in AKU. Reexamination of all 29 mutations and polymorphisms thus far described in HGO shows that these nucleotide changes are not randomly distributed; the CCC sequence motif and its inverted complement, GGG, are preferentially mutated. These analyses also demonstrated that the nucleotide substitutions in HGO do not involve CpG dinucleotides, which illustrates important differences between HGO and other genes for the occurrence of mutation at specific short-sequence motifs. Because the CCC sequence motifs comprise a significant proportion (34.5%) of all mutated bases that have been observed in HGO, we conclude that the CCC triplet is a mutational hot spot in HGO. PMID:10205262

  19. A variant of CLEC16A gene confers protection for Vogt-Koyanagi-Harada syndrome but not for Behcet's disease in a Chinese Han population.

    PubMed

    Li, Ke; Hou, Shengping; Qi, Jian; Kijlstra, Aize; Yang, Peizeng

    2015-03-01

    Vogt-Koyanagi-Harada (VKH) syndrome and Behcet's disease (BD) are two common form of uveitis in China. The aim of this study was to investigate the association of C-type lectin domain family 16, member A (CLEC16A) gene polymorphisms with Vogt-Koyanagi-Harada syndrome and Behcet's disease in a Chinese Han population. A two-stage association study was carried out in 988 VKH syndrome patients,400 BD patients and 976 healthy controls. Eight single nucleotide polymorphisms of CLEC16A gene were determined with the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. The data were analyzed by χ(2) test or Fisher's exact test and corrected for multiple comparisons by the Bonferroni method. The first stage study showed that the frequency of the A allele of rs6498169 was significantly decreased in VKH syndrome patients (Pc = 1.1 × 10(-2), OR = 0.7, 95%CI = 0.6-0.9). No significant association was observed in the other 7 SNPs between VKH syndrome patients and controls. No association was found with BD for the 8 SNPs tested. We further confirmed the association of single nucleotide polymorphism rs6498169 with VKH syndrome in another cohort. Consistent with the first stage study, the combined study showed significantly lower frequencies of the AA genotype and the A allele of rs6498169 in VKH syndrome patients (Pc = 3.5 × 10(-4), OR = 0.6, 95%CI = 0.5-0.7; Pc = 8.2 × 10(-4), OR = 0.8, 95%CI = 0.7-0.9, respectively). In conclusion, the study suggested that a CLEC16A polymorphism may be protective against VKH syndrome in a Chinese Han population. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Association of the Serotonin Receptor 3E Gene as a Functional Variant in the MicroRNA-510 Target Site with Diarrhea Predominant Irritable Bowel Syndrome in Chinese Women.

    PubMed

    Zhang, Yu; Li, Yaoyao; Hao, Zhenfeng; Li, Xiangming; Bo, Ping; Gong, Weijuan

    2016-04-30

    The functional variant (rs56109847) in the 3'-untranslated regions (3'-UTR) of the serotonin receptor 3E (HTR3E) gene is associated with female diarrhea predominant irritable bowel syndrome (IBS-D) in British populations. However, the relationship of the polymorphism both to HTR3E expression in the intestine and to the occurrence of Chinese functional gastrointestinal disorders has yet to be examined. Polymerase chain reaction amplification and restriction fragment length polymorphism analyses were employed to detect polymorphisms among Chinese Han women, particularly 107 patients with IBS-D, 99 patients with functional dyspepsia (FD), 115 patients with mixed IBS and 69 patients with IBS-D + FD. We also assessed microRNA-510 (miR-510) and HTR3Eexpression in human colonic mucosal tissues with immunohistochemistry and other methods. Dual-luciferase reporter assays were conducted to examine the binding ability of miR-510 and HTR3E 3'-UTR. Genotyping data showed the variant rs56109847 was significantly associated with IBS-D, but not with FD, mixed-IBS, or FD + IBS-D. HTR3E was abundantly expressed around the colonic mucosal glands but less expressed in the stroma. miR-510 expression decreased, whereas HTR3E expression increased in the colonic mucosal tissue of patients with IBS-D compared with those in controls. HTR3E expression was significantly higher in patients with the GA genotype than that in patients with the GG genotype. The single-nucleotide polymorphisms disrupted the binding site of miR-510 and significantly upregulated luciferase expression in HEK293 and HT-29 cells. The single-nucleotide polymorphisms rs56109847 led to reduced microRNA binding and overexpression of the target gene in intestinal cells, thereby increasing IBS-D risk in the Chinese Han population. The decreased expression of miR-510 might contribute to IBS-D.

  1. IL10A genotypic association with decreased IL-10 circulating levels in malaria infected individuals from endemic area of the Brazilian Amazon.

    PubMed

    Pereira, Virginia A; Sánchez-Arcila, Juan C; Teva, Antonio; Perce-da-Silva, Daiana S; Vasconcelos, Mariana P A; Lima, Cleoni A M; Aprígio, Cesarino J L; Rodrigues-da-Silva, Rodrigo N; Santos, Davi O; Banic, Dalma M; Bonecini-Almeida, Maria G; Lima-Júnior, Josué C; Oliveira-Ferreira, Joseli

    2015-01-28

    Cytokines play an important role in human immune responses to malaria and variation in their production may influence the course of infection and determine the outcome of the disease. The differential production of cytokines has been linked to single nucleotide polymorphisms in gene promoter regions, signal sequences, and gene introns. Although some polymorphisms play significant roles in susceptibility to malaria, gene polymorphism studies in Brazil are scarce. A population of 267 individuals from Brazilian Amazon exposed to malaria was genotyped for five single nucleotide polymorphisms (SNPs), IFNG + 874 T/A, IL10A-1082G/A, IL10A-592A/C, IL10A-819 T/C and NOS2A-954G/C. Specific DNA fragments were amplified by polymerase chain reaction, allowing the detection of the polymorphism genotypes. The polymorphisms IL10A-592A/C and IL10A-819 T/C were estimated by a single analysis due to the complete linkage disequilibrium between the two SNPs with D' = 0.99. Plasma was used to measure the levels of IFN-γ and IL-10 cytokines by Luminex and nitrogen radicals by Griess reaction. No differences were observed in genotype and allelic frequency of IFNG + 874 T/A and NOS2A-954G/C between positive and negative subjects for malaria infection. Interesting, the genotype NOS2A-954C/C was not identified in the study population. Significant differences were found in IL10A-592A/C and IL10A-819 T/C genotypes distribution, carriers of IL10A -592A/-819 T alleles (genotypes AA/TT + AC/TC) were more frequent among subjects with malaria than in negative subjects that presented a higher frequency of the variant C allele (p < 0.0001). The presence of the allele C was associated with low producer of IL-10 and low parasitaemia. In addition, the GTA haplotypes formed from combinations of investigated polymorphisms in IL10A were significantly associated with malaria (+) and the CCA haplotype with malaria (-) groups. The IL10A-1082G/A polymorphism showed high frequency of heterozygous AG genotype in the population, but it was not possible to infer any association of the polymorphism because their distribution was not in Hardy Weinberg equilibrium. This study shows that the IL10A-592A/C and IL10A-819 T/C polymorphisms were associated with malaria and decreased IL-10 levels and low parasite density suggesting that this polymorphism influence IL-10 levels and may influence in the susceptibility to clinical malaria.

  2. Identification and characterization of single nucleotide polymorphisms in 6 growth-correlated genes in porcine by denaturing high performance liquid chromatography.

    PubMed

    Liu, Dewu; Zhang, Yushan; Du, Yinjun; Yang, Guanfu; Zhang, Xiquan

    2007-06-01

    The growth-correlated genes that are part of the neuroendocrine growth axis play crucial roles in the regulation of growth and development of pig. The identification of genetic polymorphisms in these genes will enable the scientist to evaluate the biological relevance of such polymorphisms and to gain a better understanding of quantitative traits like growth. In the present study, seven pairs of primers were designed to obtain unknown sequences of growth-correlated genes, and other 25 pairs of primers were designed to identify single nucleotide polymorphisms (SNP) using the denaturing high-performance liquid chromatography (DHPLC) technology in four pig breeds (Duroc, Landrace, Lantang and Wuzhishan), significantly differing in growth and development characteristics. A total of 101 polymorphisms were discovered in 10,707 base pairs (bp) from six genes of the ghrelin (GHRL), leptin (LEP), insulin-like growth factor II (IGF-II), insulin-like growth factor binding protein 2 (IGFBP-2), insulin-like growth factor binding protein 3 (IGFBP-3), and somatostatin (SS). The observed average distances between the SNP in the 5'UTR, coding regions, introns and 3'UTR were 134, 521, 81 and 92 bp, respectively. Four SNPs were found in the coding regions of IGF-II, IGFBP-2 and LEP, respectively. Two synonymous mutations were obtained in IGF-II and LEP genes respectively, and two non-synonymous were found in IGFBP-2 and LEP genes, respectively. Seven other mutations were also observed. Thirty-two PCR-RFLP markers were found among 101 polymorphisms of the six genes. The SNP discovered in this study would provide suitable markers for association studies of candidate genes with growth related traits in pig.

  3. Whole exome sequencing to estimate alloreactivity potential between donors and recipients in stem cell transplantation

    PubMed Central

    Sampson, Juliana K.; Sheth, Nihar U.; Koparde, Vishal N.; Scalora, Allison F.; Serrano, Myrna G.; Lee, Vladimir; Roberts, Catherine H.; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H.; Buck, Gregory A.; Neale, Michael C.; Toor, Amir A.

    2016-01-01

    Summary Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. PMID:24749631

  4. Common rs5918 (PlA1/A2) polymorphism in the ITGB3 gene and risk of coronary artery disease

    PubMed Central

    Heidari, Mohammad Mehdi; Soheilyfar, Sorour

    2016-01-01

    Introduction The T to C transition at nucleotide 1565 of the human glycoprotein IIIa (ITGB3) gene represents a genetic polymorphism (PlA1/A2) that can influence both platelet activation and aggregation and that has been associated with many types of disease. Here, we present a newly designed multiplex tetra-primer amplification refractory mutation system – polymerase chain reaction (T-ARMS-PCR) for genotyping a single nucleotide polymorphism (SNP) (dbSNP ID: rs5918) in the human ITGB3 gene. Material and methods We set up T-ARMS-PCR for the rs5918 SNP in a single-step PCR and the results were validated by the PCR-RFLP method in 132 coronary artery disease (CAD) patients and 122 unrelated healthy individuals. Results Full accordance was found for genotype determination by the PCR-RFLP method. The multiple logistic regression analysis showed a significant association of the rs5918 polymorphism and CAD according to dominant and recessive models (dominant model OR: 2.40, 95% CI: 1.33–4.35; p = 0.003, recessive model OR: 4.71, 95% CI: 1.32–16.80; p = 0.0067). Conclusions Our T-ARMS-PCR in comparison with RFLP and allele-specific PCR is more advantageous because this PCR method allows the evaluation of both the wild type and the mutant allele in the same tube. Our results suggest that the rs5918 (PlA1/A2) polymorphism in the ITGB3 gene may contribute to the susceptibility of sporadic Iranian coronary artery disease (CAD) patients. PMID:28905013

  5. IL10 single nucleotide polymorphisms are related to upregulation of constitutive IL-10 production and susceptibility to Helicobacter pylori infection.

    PubMed

    Assis, Shirleide; Marques, Cintia Rodrigues; Silva, Thiago Magalhães; Costa, Ryan Santos; Alcantara-Neves, Neuza Maria; Barreto, Mauricio Lima; Barnes, Kathleen Carole; Figueiredo, Camila Alexandrina

    2014-06-01

    Helicobacter pylori infection is a strong risk factor for gastric cancer, likely due to the extensive inflammation in the stomach mucosa caused by these bacteria. Many studies have reported an association between IL10 polymorphisms, the risk of gastric cancer, and IL-10 production. The aim of the study was to evaluate the association between IL10 genetic variants, Helicobacter pylori infection, and IL-10 production by peripheral blood leukocytes in children. We genotyped a total of 12 single nucleotide polymorphisms in IL10 in 1259 children aged 4-11 years living in a poor urban area in Salvador, Brazil, using TaqMan probe based, 5' nuclease assay minor groove binder chemistry. Association tests were performed by logistic regression for Helicobacter pylori infection and linear regression for IL-10 spontaneous production (whole-blood cultures) including sex, age, and principal components for informative ancestry markers as covariates, using PLINK. Our results shown that IL10 single nucleotide polymorphisms rs1800896 (OR = 1.63; 95% CI = 1.11-2.39), rs3024491 (OR = 1.71; 95% CI = 1.14-2.57), rs1878672 (OR = 1.79; 95% CI = 1.19-2.68), and rs3024496 (OR = 1.48; 95% CI = 1.05-2.08) were positively associated with Helicobacter pylori infection. Eight single nucleotide polymorphisms were associated with spontaneous production of IL-10 in culture, of which three (rs1800896 and rs1878672, p = .04; rs3024491, p = .01) were strongly associated with infection by Helicobacter pylori. Our results indicate that IL10 variants rs1800896, rs3024491, rs1878672, and rs3024496 are more consistently associated with the presence of anti-H. pylori IgG by inducing increased production of IL-10. Further studies are underway to elucidate the role of additional genetic variants and to investigate their impact on the occurrence of gastric cancer. © 2014 John Wiley & Sons Ltd.

  6. Association study between single nucleotide polymorphisms in promoter region of AVPR1A and Korean autism spectrum disorders.

    PubMed

    Yang, So Young; Cho, Soo-Churl; Yoo, Hee Jeong; Cho, In Hee; Park, Mira; Kim, Boong-Nyun; Kim, Jae-Won; Shin, Min-Sup; Park, Tae-Won; Son, Jung-Woo; Chung, Un-Sun; Kim, Hyo-Won; Yang, Young-Hui; Kang, Je-Ouk; Kim, Soon Ae

    2010-08-02

    To determine the association between arginine vasopressin receptor 1A gene (AVPR1A) and autism spectrum disorders (ASDs), we examined 3 single nucleotide polymorphisms (SNPs), namely, rs7294536, rs3759292, and rs10877969, in the promoter region of AVPR1A by using a family-based association test (FBAT) in 151 Korean trios. Our results demonstrated a statistically significant association between autism and SNPs (additive model: rs7294536, chi(2)=9.328, df=2, P=0.002; rs10877969, chi(2)=11.529, df=2, P<0.001) as well as between autism and haplotype analysis (additive model: chi(2)=14.122, df=3, P=0.003). In addition, we found that ADI-R scores calculated by using a diagnostic algorithm for failure to develop peer relationships (A2) were higher in subjects having the AA genotype than in subjects having the AG and GG genotypes of rs7294536. Thus, our study provides evidence for a possible association between these SNPs and the phenotype of ASDs. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  7. Cumulative Risk on the Oxytocin Receptor Gene (OXTR) Predicts Empathic Communication by Physician Assistant Students.

    PubMed

    Floyd, Kory; Generous, Mark Alan; Clark, Lou; McLeod, Ian; Simon, Albert

    2017-10-01

    In the relationship between patients and health care providers, few communicative features are as significant as the providers' ability to express empathy. A robust empirical literature describes the importance of physician communication skills-particularly those that convey empathy-yet few studies have examined empathic communication by physician assistants, who provide primary care for an increasing number of Americans. The present study examines the empathic communication of physician assistant students in interactions with standardized patients. Over a 6-month period, each student conducted three clinical interviews, each of which was evaluated for empathic communication by the patients, the students' clinical instructors, and third-party observers. Students also provided saliva samples for genotyping six single-nucleotide polymorphisms on the oxytocin receptor gene (OXTR) that are linked empirically to empathic behavior. Consistent with recent research, this study adopted a cumulative risk approach wherein students were scored for their number of risky alleles on the single-nucleotide polymorphisms. Results indicated that cumulative risk on OXTR receptor gene predicted lower patient empathy scores as rated by instructors and observers, but not by standardized patients.

  8. The single-nucleotide polymorphisms in CHD5 affect the prognosis of patients with hepatocellular carcinoma

    PubMed Central

    Zhu, Xiao; Kong, Qingming; Xie, Liwei; Chen, Zhihong; Li, Hongmei; Zhu, Zhu; Huang, Yongmei; Lan, Feifei; Luo, Haiqing; Zhan, Jingting; Ding, Hongrong; Lei, Jinli; Xiao, Qin; Fu, Weiming; Fan, Wenguo; Zhang, Jinfang; Luo, Hui

    2018-01-01

    Previous studies showed that the low expressions of chromodomain-helicase-DNA-binding protein 5 (CHD5) were intensively associated with deteriorative biologic and clinical characteristics as well as outcomes in many tumors. The aim of this study is to determine whether CHD5 single nucleotide polymorphisms (SNPs) contribute to the prognosis of hepatocellular carcima (HCC). The SNPs were selected according to their linkage disequilibrium (LD) in the targeted next-generation sequencing (NGS) and then genotyped with TaqMan probers. We revealed a rare haplotype AG in CHD5 (SNPs: rs12564469-rs9434711) was markedly associated with HCC prognosis. The univariate and multivariate regression analyses revealed the patients with worse overall survival time were those with tumor metastasis and haplotype AG, as well as cirrhosis, poor differentiation and IV-TNM stage. Based on the available public databases, we discovered the significant association between haplotype AG and CHD5 mRNA expressions only existed in Chinese. These data proposed that the potentially genetic haplotype might functionally contribute to HCC prognosis and CHD5 mRNA expressions. PMID:29568352

  9. Polymorphic amplified typing sequences (PATS) and pulsed-field gel electrophoresis (PFGE) yield comparable results in the strain typing of a diverse set of bovine Escherichia coli O157 isolates

    USDA-ARS?s Scientific Manuscript database

    The PCR-based Escherichia coli O157 (O157) strain typing system, Polymorphic Amplified Typing Sequences (PATS), targets insertions-deletions (Indels) and single nucleotide polymorphisms (SNPs) at the XbaI and AvrII(BlnI) restriction enzyme sites, respectively, besides amplifying four known virulenc...

  10. Correlation of MSH3 polymorphisms with response and survival in advanced non-small cell lung cancer patients treated with first-line platinum-based chemotherapy.

    PubMed

    Xu, X-L; Yao, Y-L; Xu, W-Z; Feng, J-G; Mao, W-M

    2015-04-15

    Mismatch repair (MMR) genes, as well as the nucleotide excision repair genes, play an important role in removing cisplatin-DNA adducts, and the mutation of MMR genes in tumors can lead to a decreased response to platinum-based therapies. We examined MutS homolog 3 (MSH3), a mismatch repair gene, and whether polymorphisms of MSH3 were associated with response and survival in advanced non-small cell lung cancer (NCSLC) patients who were treated with platinum-based chemotherapy. The peripheral blood of 180 advanced NCSLC patients who were treated with first-line platinum-based chemotherapy was collected to determine the patients' genotypes of MSH3. The three genotypes of the MSH3 polymorphisms rs26279, rs1650697 and rs1105524 were investigated. A statistically significant association was observed between the polymorphism rs26279 (Ala1054Thr) and sensitivity to platinum-based chemotherapy (P = 0.014). A significant correlation was found between rs1105524 and progression-free survival (PFS), with the G/A and A/A genotypes (median survival time: 14.27 months; 95%CI = 9.80-18.75) suffering shorter survival than patients with the G/G genotype (median survival time: 26.37 months; 95%CI = 15.03-37.71) (P = 0.04). Our results showed that single nucleotide polymorphisms in MSH3 had an impact on the chemotherapy response and prognosis of advanced NCSLC patients who were treated with platinum-based chemotherapy.

  11. Radiogenomics Consortium (RGC)

    Cancer.gov

    The Radiogenomics Consortium's hypothesis is that a cancer patient's likelihood of developing toxicity to radiation therapy is influenced by common genetic variations, such as single nucleotide polymorphisms (SNPs).

  12. No association of dynamin binding protein (DNMBP) gene SNPs and Alzheimer's disease.

    PubMed

    Minster, Ryan L; DeKosky, Steven T; Kamboh, M Ilyas

    2008-10-01

    A recent scan of single nucleotide polymorphisms (SNPs) on chromosome 10q found significant association of six correlated SNPs with late-onset Alzheimer's disease (AD) among Japanese. We examined the SNP with the highest statistical significance (rs3740058) in a large Caucasian American case-control cohort and the remaining five SNPs in a smaller subset of cases and controls. We observed no association of statistical significance in either the total sample or the APOE*4 non-carriers for any of the SNPs.

  13. Association between ADAM metallopeptidase domain 33 gene polymorphism and risk of childhood asthma: a meta-analysis.

    PubMed

    Sun, F J; Zou, L Y; Tong, D M; Lu, X Y; Li, J; Deng, C B

    2017-08-31

    This study aimed to investigate the association between ADAM metallopeptidase domain 33 (ADAM33) gene polymorphisms and the risk of childhood asthma. The relevant studies about the relationship between ADAM33 gene polymorphisms and childhood asthma were searched from electronic databases and the deadline of retrieval was May 2016. The single nucleotide polymorphisms (SNPs) of ADAM33 (rs511898, rs2280092, rs3918396, rs528557, rs2853209, rs44707, rs2280091 and rs2280089) were analyzed based on several models including the allele, codominant, recessive and dominant models. The results showed that the ADAM33 rs2280091 polymorphism in all four genetic models was associated with an increased risk of childhood asthma. Positive associations were also found between the polymorphisms rs2280090, rs2787094, rs44707 and rs528557 and childhood asthma in some genetic models. This meta-analysis suggested that ADAM33 polymorphisms rs2280091, rs2280090, rs2787094, rs44707 and rs528557 were significantly associated with a high risk of childhood asthma.

  14. Association of HTRA1 polymorphism and bilaterality in advanced age-related macular degeneration.

    PubMed

    Chen, Haoyu; Yang, Zhenglin; Gibbs, Daniel; Yang, Xian; Hau, Vincent; Zhao, Peiquan; Ma, Xiang; Zeng, Jiexi; Luo, Ling; Pearson, Erik; Constantine, Ryan; Kaminoh, Yuuki; Harmon, Jennifer; Tong, Zongzhong; Stratton, Charity A; Cameron, D Joshua; Tang, Shibo; Zhang, Kang

    2008-02-01

    Single nucleotide polymorphism (SNP), rs11200638, in the promoter of HTRA1 has recently been shown to increase the risk for AMD. In order to investigate the association of this HTRA1 polymorphism and the bilaterality of AMD, we genotyped rs11200638 in control, unilateral, and bilateral advanced AMD patients. The A allele for SNP rs11200638 in HTRA1, was significantly more prevalent in bilateral wet AMD and GA patients than in unilateral groups (p=.02 and p=.03, respectively). The homozygote odds ratios of bilateral wet AMD and GA are significantly greater than those seen in unilateral groups (twofold and threefold increase, respectively). This finding is consistent with the role of HTRA1 in AMD pathogenesis and will help aid in the clinical management and prognosis of AMD patients.

  15. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  16. Analysis of glutathione S-transferase Pi isoform (GSTP1) single-nucleotide polymorphisms and macular telangiectasia type 2.

    PubMed

    Szental, Joshua A; Baird, Paul N; Richardson, Andrea J; Islam, F M Amirul; Scholl, Hendrik P N; Charbel Issa, Peter; Holz, Frank G; Gillies, Mark; Guymer, Robyn H

    2010-12-01

    Recent imaging studies have suggested that macular pigment is decreased centrally in macular telangiectasia type 2 (MT2). The uptake of xanthophyll pigment into the macula is thought to be facilitated by a xanthophyll-binding protein (XBP). The Pi isoform of glutathione S-transferase (GSTP1) represents one such XBP with high binding affinity. This case-control study aimed to determine whether two common single-nucleotide polymorphisms (SNPs) of GSTP1 were associated with MT2. DNA samples from 39 cases and 21 controls were collected. Two polymorphic sites of Ile105Val and Ala114Val in exons 5 and 6 respectively, of the GSTP1 gene were analysed. Comparison of alleles and genotypes between cases and controls indicated that there were no statistically significant differences for either the Ile105Val SNP (P=0.43) or the Ala114Val SNP (P=0.85), or for any combinations; however, the homozygous at-risk genotype (GG) of the Ile105Val SNP was present in 8% of cases but absent in controls. This study found no statistically significant association between two common GSTP1 SNPs and MT2; however, a trend towards a greater frequency of the GG genotype of the Ile105Val SNP in cases is of great interest. The biological plausibility of disturbed macular pigment uptake in MT2 makes GSTP1 an excellent candidate gene. Further investigation is warranted in future studies of MT2.

  17. Genetic Variants in PNPLA3 and Risk of Non-Alcoholic Fatty Liver Disease in a Han Chinese Population

    PubMed Central

    Lin, Shao-Wei; Lu, Qing-Qing; Hu, Zhi-Jian; Lin, Xu

    2012-01-01

    We investigated the possible association between genetic variants in the Patatin like phospholipase-3 (PNPLA3) gene and nonalcoholic fatty liver disease (NAFLD) in a Han Chinese population. We evaluated twelve tagging single-nucleotide polymorphisms (tSNPs) of the PNPLA3 gene in a frequency matched case–control study from Fuzhou city of China (553 cases, 553 controls). In the multivariate logistic regression analysis, the rs738409 GG or GC, and rs139051 TT genotypes were found to be associated with increased risk of NAFLD, and a significant trend of increased risk with increasing numbers of risk genotype was observed in the cumulative effect analysis of these single nucleotide polymorphisms. Furthermore, haplotype association analysis showed that, compared with the most common haplotype, the CAAGAATGCGTG and CGAAGGTGTCCG haplotypes conferred a statistically significant increased risk for NAFLD, while the CGGGAACCCGCG haplotype decreased the risk of NAFLD. Moreover, rs738409 C>G appeared to have a multiplicative joint effect with tea drinking (P<0.005) and an additive joint effect with obesity (Interaction contrast ratio (ICR) = 2.31, 95% CI: 0.7–8.86), hypertriglyceridemia (ICR = 3.07, 95% CI: 0.98–5.09) or hypertension (ICR = 1.74, 95% CI: 0.52–3.12). Our data suggests that PNPLA3 genetic polymorphisms might influence the susceptibility to NAFLD development independently or jointly in Han Chinese. PMID:23226254

  18. Association Analysis of Polymorphisms in TOMM40, CR1, PVRL2, SORL1, PICALM, and 14q32.13 Regions in Colombian Alzheimer Disease Patients.

    PubMed

    Ortega-Rojas, Jenny; Morales, Luis; Guerrero, Esneyder; Arboleda-Bustos, Carlos E; Mejia, Adriana; Forero, Diego; Lopez, Luis; Pardo, Rodrigo; Arboleda, Gonzalo; Yunis, Juan; Arboleda, Humberto

    2016-01-01

    We evaluated the association of several single-nucleotide polymorphisms in different genes including APOE, TOMM40, CR1, PVRL2, SORL1, PICALM, and GWA_14q32.13 in a Colombian sample of Late-Onset Alzheimer disease (LOAD) patients. A case-control study was conducted in 362 individuals (181 LOADs and 181 controls) to determine the association of single-nucleotide polymorphisms in APOE (e2, e3, and e4), TOMM40 (rs2075650), CR1 (rs665640), PVRL2 (rs6859), SORL1 (rs11218304), PICALM (rs3851179), and GWA_14q32.13 (rs11622883) with LOAD in a sample from Colombia. We were able to confirm the previously reported association of the APOE4 allele with AD. In addition, we report a new significant association with rs2075650 of TOMM40 for LOAD in our sample. We did not detect any significant interaction between TOMM40 and APOE4 carriers (heterozygous or homozygous) for disease risk development. However, Kaplan-Meier survival analyses suggest that AD patients with TOMM40 allele rs2075650-G have an average age of disease onset of 6 years earlier compared with carriers of the A allele. In addition, the age of disease onset is earlier if APOE4/4 is present. Our findings suggest that rs2075650 of TOMM40 could be involved in earlier presentation of LOAD in the Colombian population.

  19. Association of PTPN22 Single Nucleotide Polymorphisms with Celiac Disease.

    PubMed

    Aflatounian, Majid; Rezaei, Arezou; Sadr, Maryam; Saghazadeh, Amene; Elhamian, Nazanin; Sadeghi, Hengameh; Motevasselian, Fatemeh; Farahmand, Fatemeh; Fallahi, Gholamhossein; Motamed, Farzaneh; Najafi, Mehri; Rezaei, Nima

    2017-06-01

    Celiac disease is a chronic autoimmune disease in which gene-environment interactions cause the immune system to unfavorably react to naturally gluten-containing foods. PTPN22 plays a crucial role in regulating the function of various cells of the immune system, particularly T cells. Polymorphisms of the PTPN22 gene have been associated with many autoimmune diseases. The present genetic association study was conducted to investigate the possible associations between PTPNTT single nucleotide polymorphisms (SNPs) and celiac disease in an Iranian population. The study population consisted of 45 patients with celiac disease and 93 healthy controls. The study genotyped five SNPs of the PTPN22 gene: rs12760457, rs1310182, rs1217414, rs33996649, and rs2476601. Control and patient groups did not differ on the genotype distribution of four of five investigated SNPs in the PTPN22 gene, for example, rs12760457, rs2476601, rs1217414, and rs33996649. The only investigated PTPN22 variant, which could be associated with CD, was rs1310182. A significant increase in the carriage of the T allele of rs1310182 in CD patients was observed (OR (95% CI) = 11.42 (5.41, 24.1), p value < 0.0001). The TT genotype of this SNP was significantly associated with celiac disease. Our study suggests that the rs1310182 SNP of PTPN22 gene may be a predisposing factor of celiac disease in the Iranian population. Further studies are required to investigate the issue in other racial and ethnic subgroups.

  20. Validation of PDE9A Gene Identified in GWAS Showing Strong Association with Milk Production Traits in Chinese Holstein.

    PubMed

    Yang, Shao-Hua; Bi, Xiao-Jun; Xie, Yan; Li, Cong; Zhang, Sheng-Li; Zhang, Qin; Sun, Dong-Xiao

    2015-11-05

    Phosphodiesterase9A (PDE9A) is a cyclic guanosine monophosphate (cGMP)-specific enzyme widely expressed among the tissues, which is important in activating cGMP-dependent signaling pathways. In our previous genome-wide association study, a single nucleotide polymorphism (SNP) (BTA-55340-no-rs(b)) located in the intron 14 of PDE9A, was found to be significantly associated with protein yield. In addition, we found that PDE9A was highly expressed in mammary gland by analyzing its mRNA expression in different tissues. The objectives of this study were to identify genetic polymorphisms of PDE9A and to determine the effects of these variants on milk production traits in dairy cattle. DNA sequencing identified 11 single nucleotide polymorphisms (SNPs) and six SNPs in 5' regulatory region were genotyped to test for the subsequent association analyses. After Bonferroni correction for multiple testing, all these identified SNPs were statistically significant for one or more milk production traits (p < 0.0001~0.0077). Interestingly, haplotype-based association analysis revealed similar effects on milk production traits (p < 0.01). In follow-up RNA expression analyses, two SNPs (c.-1376 G>A, c.-724 A>G) were involved in the regulation of gene expression. Consequently, our findings provide confirmatory evidences for associations of PDE9A variants with milk production traits and these identified SNPs may serve as genetic markers to accelerate Chinese Holstein breeding program.

  1. Analysis of TLR2, TLR4, and TLR9 single nucleotide polymorphisms in children with bacterial meningitis and their healthy family members.

    PubMed

    Gowin, Ewelina; Świątek-Kościelna, Bogna; Kałużna, Ewelina; Nowak, Jerzy; Michalak, Michał; Wysocki, Jacek; Januszkiewicz-Lewandowska, Danuta

    2017-07-01

    The aim was to analyse TLR2 rs5743708, TLR2 rs4696480, TLR4 rs4986790, TLR9 rs5743836, and TLR9 rs352140 single nucleotide polymorphisms (SNPs) in children with pneumococcal and meningococcal meningitis and their family members. The study group consisted of 39 children with bacterial meningitis (25 with meningococcal meningitis and 14 with pneumococcal meningitis) and 49 family members. Laboratory test results and the course of the diseases were analyzed. Genomic DNA was extracted from 1.2ml of peripheral blood in order to analyze the five SNPs. Patients with pneumococcal and meningococcal meningitis showed a similar male/female ratio, mean age, and duration of symptoms. There were no statistically significant differences in biochemical markers between the two groups. All patients possessed at least one polymorphic variant of the analyzed SNPs. The most common SNP was TLR9 rs352140, detected in 89.7% of patients. No significant differences in SNP frequency were found between patients, family members, and the general population. The allele frequencies in the population studied are in accordance with the literature data. The study did not find an association between the analyzed SNPs and susceptibility to bacterial meningitis. The role of SNPs in genes coding toll-like receptors and the interactions between them in controlling inflammation in the central nervous system needs further evaluation. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  2. Reciprocal uniparental disomy in yeast.

    PubMed

    Andersen, Sabrina L; Petes, Thomas D

    2012-06-19

    In the diploid cells of most organisms, including humans, each chromosome is usually distinguishable from its partner homolog by multiple single-nucleotide polymorphisms. One common type of genetic alteration observed in tumor cells is uniparental disomy (UPD), in which a pair of homologous chromosomes are derived from a single parent, resulting in loss of heterozygosity for all single-nucleotide polymorphisms while maintaining diploidy. Somatic UPD events are usually explained as reflecting two consecutive nondisjunction events. Here we report a previously undescribed mode of chromosome segregation in Saccharomyces cerevisiae in which one cell division produces daughter cells with reciprocal UPD for the same pair of chromosomes without an aneuploid intermediate. One pair of sister chromatids is segregated into one daughter cell and the other pair is segregated into the other daughter cell, mimicking a meiotic chromosome segregation pattern. We term this process "reciprocal uniparental disomy."

  3. Single nucleotide polymorphisms from Theobroma cacao expressed sequence tags associated with witches' broom disease in cacao.

    PubMed

    Lima, L S; Gramacho, K P; Carels, N; Novais, R; Gaiotto, F A; Lopes, U V; Gesteira, A S; Zaidan, H A; Cascardo, J C M; Pires, J L; Micheli, F

    2009-07-14

    In order to increase the efficiency of cacao tree resistance to witches' broom disease, which is caused by Moniliophthora perniciosa (Tricholomataceae), we looked for molecular markers that could help in the selection of resistant cacao genotypes. Among the different markers useful for developing marker-assisted selection, single nucleotide polymorphisms (SNPs) constitute the most common type of sequence difference between alleles and can be easily detected by in silico analysis from expressed sequence tag libraries. We report the first detection and analysis of SNPs from cacao-M. perniciosa interaction expressed sequence tags, using bioinformatics. Selection based on analysis of these SNPs should be useful for developing cacao varieties resistant to this devastating disease.

  4. Institutional Protocol to Manage Consanguinity Detected by Genetic Testing in Pregnancy in a Minor

    PubMed Central

    Chen, Laura P.; Beck, Anita E.; Tsuchiya, Karen D.; Chow, Penny M.; Mirzaa, Ghayda M.; Wiester, Rebecca T.

    2015-01-01

    Single-nucleotide polymorphism arrays and other types of genetic tests have the potential to detect first-degree consanguinity and uncover parental rape in cases of minor teenage pregnancy. We present 2 cases in which genetic testing identified parental rape of a minor teenager. In case 1, single-nucleotide polymorphism array in a patient with multiple developmental abnormalities demonstrated multiple long stretches of homozygosity, revealing parental rape of a teenage mother. In case 2, a vague maternal sexual assault history and diagnosis of Pompe disease by direct gene sequencing identified parental rape of a minor. Given the medical, legal, and ethical implications of such revelations, a protocol was developed at our institution to manage consanguinity identified via genetic testing. PMID:25687148

  5. Single Nucleotide Polymorphism in Gene Encoding Transcription Factor Prep1 Is Associated with HIV-1-Associated Dementia

    PubMed Central

    van Manen, Daniëlle; Bunnik, Evelien M.; van Sighem, Ard I.; Sieberer, Margit; Boeser-Nunnink, Brigitte; de Wolf, Frank; Schuitemaker, Hanneke; Portegies, Peter; Kootstra, Neeltje A.; van 't Wout, Angélique B.

    2012-01-01

    Background Infection with HIV-1 may result in severe cognitive and motor impairment, referred to as HIV-1-associated dementia (HAD). While its prevalence has dropped significantly in the era of combination antiretroviral therapy, milder neurocognitive disorders persist with a high prevalence. To identify additional therapeutic targets for treating HIV-associated neurocognitive disorders, several candidate gene polymorphisms have been evaluated, but few have been replicated across multiple studies. Methods We here tested 7 candidate gene polymorphisms for association with HAD in a case-control study consisting of 86 HAD cases and 246 non-HAD AIDS patients as controls. Since infected monocytes and macrophages are thought to play an important role in the infection of the brain, 5 recently identified single nucleotide polymorphisms (SNPs) affecting HIV-1 replication in macrophages in vitro were also tested. Results The CCR5 wt/Δ32 genotype was only associated with HAD in individuals who developed AIDS prior to 1991, in agreement with the observed fading effect of this genotype on viral load set point. A significant difference in genotype distribution among all cases and controls irrespective of year of AIDS diagnosis was found only for a SNP in candidate gene PREP1 (p = 1.2×10−5). Prep1 has recently been identified as a transcription factor preferentially binding the −2,518 G allele in the promoter of the gene encoding MCP-1, a protein with a well established role in the etiology of HAD. Conclusion These results support previous findings suggesting an important role for MCP-1 in the onset of HIV-1-associated neurocognitive disorders. PMID:22347417

  6. Association between the TRAIL single nucleotide polymorphism rs1131580 and type 2 diabetes mellitus in a Han Chinese population.

    PubMed

    Yu, M Y; Zhao, P Q; Yan, X H; Liu, B; Zhang, Q Q; Wang, R; Ma, C H; Liang, X H; Zhu, F L; Gao, L F

    2013-09-10

    Tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) is expressed in different tissues and cells, including the pancreas and lymphocytes, and it can selectively induce apoptosis in tumor cells but not in most normal cells. TRAIL plays critical roles in type 1 diabetes mellitus, and is involved in type 2 diabetes mellitus (T2DM). We recently discovered the association of nonalcoholic fatty liver disease, a risk factor for T2DM, with a single nucleotide polymorphism (SNP) in the TRAIL (TNFSF10) gene at site 1595C/T (rs1131580), indicating the possible association of T2DM with this TRAIL polymorphism. The aim of this study was to investigate the relationship of the TRAIL SNP at site 1595C/T (rs1131580) with T2DM susceptibility and the biometabolic parameters of T2DM in a Han Chinese population. The polymerase chain reaction-restriction fragment length polymorphism method was used to genotype SNP rs1131580 in 292 patients with T2DM and 266 healthy controls. We found that the frequency of the CC genotype and that of the C allele of rs1131580 were significantly higher in T2DM patients than in the control group. Additionally, the triglyceride and serum creatinine levels of T2DM patients with the CC genotype were significantly higher than those of patients with the TT genotype. Thus, the CC genotype of the TRAIL SNP at 1595C/T (rs1131580) confers increased susceptible to T2DM in a Han Chinese population from Shandong Province. These data suggest that the CC genotype at this SNP is related to diabetic severity and it might be a candidate for the prognostic assessment of T2DM.

  7. Influence of angiotensin converting enzyme (ACE) gene rs4362 polymorphism on the progression of kidney failure in patients with autosomal dominant polycystic kidney disease (ADPKD).

    PubMed

    Ramanathan, Gnanasambandan; Ghosh, Santu; Elumalai, Ramprasad; Periyasamy, Soundararajan; Lakkakula, Bhaskar V K S

    2016-06-01

    Autosomal dominant polycystic kidney disease (ADPKD) is an inherited systemic disorder, characterized by the fluid filled cysts in the kidneys leading to end stage renal failure in later years of life. Hypertension is one of the major factors independently contributing to the chronic kidney disease (CKD) progression. The renin-angiotensin aldosterone system (RAAS) genes have been extensively studied as hypertension candidate genes. The aim of the present study was to investigate the role of angiotensin converting enzyme tagging - single nucleotide polymorphisms (ACE tag-SNPs) in progression of CKD in patients with ADPKD. m0 ethods: In the present study six ACE tagSNPs (angiotensin converting enzyme tag single nucleotide polymorphisms) and insertion/deletion (I/D) in 102 ADPKD patients and 106 control subjects were investigated. The tagSNPs were genotyped using FRET-based KASPar method and ACE ID by polymerase chain reaction (PCR) and electrophoresis. Genotypes and haplotypes were compared between ADPKD patients and controls. Univariate and multivariate logistic regression analyses were performed to assess the effect of genotypes and hypertension on CKD advancement. Mantel-Haenszel (M-H) stratified analysis was performed to study the relationship between different CKD stages and hypertension and their interaction. All loci were polymorphic and except rs4293 SNP the remaining loci followed Hardy-Weinberg equilibrium. Distribution of ACE genotypes and haplotypes in controls and ADPKD patients was not significant. A significant linkage disequilibrium (LD) was observed between SNPs forming two LD blocks. The univariate analysis revealed that the age, hypertension, family history of diabetes and ACE rs4362 contributed to the advancement of CKD. The results suggest that the ACE genotypes are effect modifiers of the relationship between hypertension and CKD advancement among the ADPKD patients.

  8. Breast cancer resistance protein (BCRP)-mediated glyburide transport: effect of the C421A/Q141K BCRP single-nucleotide polymorphism.

    PubMed

    Pollex, Erika K; Anger, Gregory; Hutson, Janine; Koren, Gideon; Piquette-Miller, Micheline

    2010-05-01

    The antidiabetic agent glyburide (glibenclamide) is frequently used for the treatment of type II diabetes and is increasingly being used for the treatment of gestational diabetes. Evidence suggests that breast cancer resistance protein/ATP-binding cassette, subfamily G, member 2 (ABCG2) expressed in the placenta protects the fetus against the accumulation of glyburide. A number of studies have investigated the significance of several single-nucleotide polymorphisms (SNPs) in the ABCG2 gene. Associations between the Q141K (C421A) SNP and ABCG2 protein expression, membrane surface translocation, efflux activity, or ATPase activity have been shown. Therefore, alterations in glyburide transport across the placenta, resulting in increased fetal glyburide exposure, may be seen in individuals carrying the C421A allele. The purpose of this study is to investigate whether the Q141K SNP causes alterations in ABCG2-mediated glyburide transport. Glyburide accumulation assays were carried out with stably transfected human embryonic kidney (HEK)-293 cells expressing wild-type ABCG2 (Arg482) and polymorphic ABCG2 (Q141K). Glyburide kinetic parameters were determined for comparison of wild-type and SNP ABCG2 activity by simultaneously fitting data for ABCG2-expressing cells (saturable transport) and empty vector-expressing cells (nonsaturable transport) by nonlinear regression analysis. The apparent K(t) and V(max) values for the transfected HEK-293 cells expressing the polymorphic variant (Q141K) of ABCG2 were significantly higher than those values determined for the wild-type ABCG2-expressing cells (p < 0.05). Our results indicate that the Q141K variant of ABCG2 may have the potential to alter the placental pharmacokinetics of glyburide used in pregnancy.

  9. Association of gene polymorphism with serum levels of inflammatory and angiogenic factors in Pakistani patients with age-related macular degeneration.

    PubMed

    Ambreen, Fareeha; Ismail, Muhammad; Qureshi, Irfan Zia

    2015-01-01

    To study the association of serum levels of inflammatory mediators and angiogenic factors with genetic polymorphism in Pakistani age-related macular degeneration (AMD) patients. This was a cross-sectional and case-control study that included 90 AMD patients diagnosed through slit-lamp examination, fundoscopy, and ocular coherence tomography. For reference and comparison purposes, 100 healthy age-matched subjects (controls) were also recruited. IL-6, IL-8, VEGF, and CRP levels were estimated in the serum samples of patients and control subjects. Using restriction fragment length polymorphism, single nucleotide polymorphisms were studied in IL-6 (rs1800795, rs1800796, rs1800797), IL-8 (rs4073, rs2227306, rs2227543), VEGF (rs3025039, rs699947), and CRP genes (rs1205, rs1130864). Since the data were obtained from a sample population, the Box-Cox transformation algorithm was applied to reduce heterogeneity of error. Multivariate analyses of variance (M-ANOVA) were applied on the transformed data to investigate the association of serum levels of IL-6, IL-8, VEGF, and CRP with AMD. Genotype and allele frequencies were compared through χ(2) tests applying Hardy-Weinberg equilibrium. The serum concentrations of IL-6 and IL-8, VEGF, and CRP between homozygotes and heterozygotes were compared through one-way ANOVA. Significance level was p<0.05. Compared to control subjects, serum IL-6 (p<0.0001), IL-8 (p<0.0001), VEGF (p<0.0001), and CRP (p<0.0001) levels were significantly elevated in the AMD patients. For rs1800795, patients with the GG genotype showed significantly raised levels of IL-6 compared to those with GC and CC genotypes (p<0.0001). Serum IL-8 levels were significantly higher in patients with the GG genotype compared to the GC and CC genotypes for the single nucleotide polymorphism (SNP) rs2227543 (p<0.002). Similarly, significantly higher VEGF levels were detected for genotype TT for rs3025039 SNP (p<0.038). However, no significant alteration in serum CRP levels was detected in hetero- or homozygotes for rs1205 and rs1130864 SNPs. Serum IL-6, IL-8, and VEGF levels are substantially increased in AMD, and the levels coincide with polymorphism in the respective gene. No such relationship appears to exist with regard to SNPs of CRP.

  10. A few nucleotide polymorphisms are sufficient to recruit nuclear factors differentially to the intron 1 of HPV-16 intratypic variants.

    PubMed

    López-Urrutia, Eduardo; Valdés, Jesús; Bonilla-Moreno, Raúl; Martínez-Salazar, Martha; Martínez-Garcia, Martha; Berumen, Jaime; Villegas-Sepúlveda, Nicolás

    2012-06-01

    The HPV-16 E6/E7 genes, which contain intron 1, are processed by alternative splicing and its transcripts are detected with a heterogeneous profile in tumours cells. Frequently, the HPV-16 positive carcinoma cells bear viral variants that contain single nucleotide polymorphisms into its DNA sequence. We were interested in analysing the contribution of this polymorphism to the heterogeneity in the pattern of the E6/E7 spliced transcripts. Using the E6/E7 sequences from three closely related HPV-16 variants, we have shown that a few nucleotide changes are sufficient to produce heterogeneity in the splicing profile. Furthermore, using mutants that contained a single SNP, we also showed that one nucleotide change was sufficient to reproduce the heterogeneous splicing profile. Additionally, a difference of two or three SNPs among these viral sequences was sufficient to recruit differentially several splicing factors to the polymorphic E6/E7 transcripts. Moreover, only one SNP was sufficient to alter the binding site of at least one splicing factor, changing the ability of splicing factors to bind the transcript. Finally, the factors that were differentially bound to the short form of intron 1 of one of these E6/E7 variants were identified as TIA1 and/or TIAR and U1-70k, while U2AF65, U5-52k and PTB were preferentially bound to the transcript of the other variants. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. Single nucleotide polymorphisms in bone turnover-related genes in Koreans: ethnic differences in linkage disequilibrium and haplotype

    PubMed Central

    Kim, Kyung-Seon; Kim, Ghi-Su; Hwang, Joo-Yeon; Lee, Hye-Ja; Park, Mi-Hyun; Kim, Kwang-joong; Jung, Jongsun; Cha, Hyo-Soung; Shin, Hyoung Doo; Kang, Jong-Ho; Park, Eui Kyun; Kim, Tae-Ho; Hong, Jung-Min; Koh, Jung-Min; Oh, Bermseok; Kimm, Kuchan; Kim, Shin-Yoon; Lee, Jong-Young

    2007-01-01

    Background Osteoporosis is defined as the loss of bone mineral density that leads to bone fragility with aging. Population-based case-control studies have identified polymorphisms in many candidate genes that have been associated with bone mass maintenance or osteoporotic fracture. To investigate single nucleotide polymorphisms (SNPs) that are associated with osteoporosis, we examined the genetic variation among Koreans by analyzing 81 genes according to their function in bone formation and resorption during bone remodeling. Methods We resequenced all the exons, splice junctions and promoter regions of candidate osteoporosis genes using 24 unrelated Korean individuals. Using the common SNPs from our study and the HapMap database, a statistical analysis of deviation in heterozygosity depicted. Results We identified 942 variants, including 888 SNPs, 43 insertion/deletion polymorphisms, and 11 microsatellite markers. Of the SNPs, 557 (63%) had been previously identified and 331 (37%) were newly discovered in the Korean population. When compared SNPs in the Korean population with those in HapMap database, 1% (or less) of SNPs in the Japanese and Chinese subpopulations and 20% of those in Caucasian and African subpopulations were significantly differentiated from the Hardy-Weinberg expectations. In addition, an analysis of the genetic diversity showed that there were no significant differences among Korean, Han Chinese and Japanese populations, but African and Caucasian populations were significantly differentiated in selected genes. Nevertheless, in the detailed analysis of genetic properties, the LD and Haplotype block patterns among the five sub-populations were substantially different from one another. Conclusion Through the resequencing of 81 osteoporosis candidate genes, 118 unknown SNPs with a minor allele frequency (MAF) > 0.05 were discovered in the Korean population. In addition, using the common SNPs between our study and HapMap, an analysis of genetic diversity and deviation in heterozygosity was performed and the polymorphisms of the above genes among the five populations were substantially differentiated from one another. Further studies of osteoporosis could utilize the polymorphisms identified in our data since they may have important implications for the selection of highly informative SNPs for future association studies. PMID:18036257

  12. Genetic Risk Conferred from Single Nucleotide Polymorphisms Towards Type II Diabetes Mellitus

    DTIC Science & Technology

    2013-02-14

    prediabetes ” 4 . Among MHS beneficiaries ages 40 – 49, the prevalence of obesity (e.g., body mass index > 30kg/m 3 ) has been recently reported to...polymorphisms in WFS1 on prediabetic phenotypes in a population-based sample of middle-aged people with normal and abnormal glucose regulation

  13. Calving traits of crossbred Brahman Cows are Associated with Heat Shock Protein 70 Genetic Polymorphisms

    USDA-ARS?s Scientific Manuscript database

    Objectives were to: 1) identify single nucleotide polymorphisms (SNP) located in the promoter region of the bovine heat shock protein 70 gene, and 2) evaluate associations between Hsp70 SNP and calving rates of Brahman-influenced cows. Specific primers were designed for PCR amplification of a 539 b...

  14. A domesticated transposon mediates the effects of a single-nucleotide polymorphism responsible for enhanced muscle growth.

    PubMed

    Butter, Falk; Kappei, Dennis; Buchholz, Frank; Vermeulen, Michiel; Mann, Matthias

    2010-04-01

    Single-nucleotide polymorphisms (SNPs) in the regulatory regions of the genome can have a profound impact on phenotype. The G3072A polymorphism in intron 3 of insulin-like growth factor 2 (IGF2) is implicated in higher muscle content and reduced fat in European pigs and is bound by a putative repressor. Here, we identify this repressor--which we call muscle growth regulator (MGR)--by using a DNA protein interaction screen based on quantitative mass spectrometry. MGR has a bipartite nuclear localization signal, two BED-type zinc fingers and is highly conserved between placental mammals. Surprisingly, the gene is located in an intron and belongs to the hobo-Ac-Tam3 transposase superfamily, suggesting regulatory use of a formerly parasitic element. In transactivation assays, MGR differentially represses the expression of the two SNP variants. Knockdown of MGR in C2C12 myoblast cells upregulates Igf2 expression and mild overexpression retards growth. Thus, MGR is the repressor responsible for enhanced muscle growth in the IGF2 G3072A polymorphism in commercially bred pigs.

  15. A graphene-based platform for single nucleotide polymorphism (SNP) genotyping.

    PubMed

    Liu, Meng; Zhao, Huimin; Chen, Shuo; Yu, Hongtao; Zhang, Yaobin; Quan, Xie

    2011-06-15

    A facile, rapid, stable and sensitive approach for fluorescent detection of single nucleotide polymorphism (SNP) is designed based on DNA ligase reaction and π-stacking between the graphene and the nucleotide bases. In the presence of perfectly matched DNA, DNA ligase can catalyze the linkage of fluorescein amidite-labeled single-stranded DNA (ssDNA) and a phosphorylated ssDNA, and thus the formation of a stable duplex in high yield. However, the catalytic reaction cannot effectively carry out with one-base mismatched DNA target. In this case, we add graphene to the system in order to produce different quenching signals due to its different adsorption affinity for ssDNA and double-stranded DNA. Taking advantage of the unique surface property of graphene and the high discriminability of DNA ligase, the proposed protocol exhibits good performance in SNP genotyping. The results indicate that it is possible to accurately determine SNP with frequency as low as 2.6% within 40 min. Furthermore, the presented flexible strategy facilitates the development of other biosensing applications in the future. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. SNPing Away at Complex Diseases: Analysis of Single-Nucleotide Polymorphisms around APOE in Alzheimer Disease

    PubMed Central

    Martin, Eden R.; Lai, Eric H.; Gilbert, John R.; Rogala, Allison R.; Afshari, A. J.; Riley, John; Finch, K. L.; Stevens, J. F.; Livak, K. J.; Slotterbeck, Brandon D.; Slifer, Susan H.; Warren, Liling L.; Conneally, P. Michael; Schmechel, Donald E.; Purvis, Ian; Pericak-Vance, Margaret A.; Roses, Allen D.; Vance, Jeffery M.

    2000-01-01

    There has been great interest in the prospects of using single-nucleotide polymorphisms (SNPs) in the search for complex disease genes, and several initiatives devoted to the identification and mapping of SNPs throughout the human genome are currently underway. However, actual data investigating the use of SNPs for identification of complex disease genes are scarce. To begin to look at issues surrounding the use of SNPs in complex disease studies, we have initiated a collaborative SNP mapping study around APOE, the well-established susceptibility gene for late-onset Alzheimer disease (AD). Sixty SNPs in a 1.5-Mb region surrounding APOE were genotyped in samples of unrelated cases of AD, in controls, and in families with AD. Standard tests were conducted to look for association of SNP alleles with AD, in cases and controls. We also used family-based association analyses, including recently developed methods to look for haplotype association. Evidence of association (P⩽.05) was identified for 7 of 13 SNPs, including the APOE-4 polymorphism, spanning 40 kb on either side of APOE. As expected, very strong evidence for association with AD was seen for the APOE-4 polymorphism, as well as for two other SNPs that lie <16 kb from APOE. Haplotype analysis using family data increased significance over that seen in single-locus tests for some of the markers, and, for these data, improved localization of the gene. Our results demonstrate that associations can be detected at SNPs near a complex disease gene. We found that a high density of markers will be necessary in order to have a good chance of including SNPs with detectable levels of allelic association with the disease mutation, and statistical analysis based on haplotypes can provide additional information with respect to tests of significance and fine localization of complex disease genes. PMID:10869235

  17. SNPing away at complex diseases: analysis of single-nucleotide polymorphisms around APOE in Alzheimer disease.

    PubMed

    Martin, E R; Lai, E H; Gilbert, J R; Rogala, A R; Afshari, A J; Riley, J; Finch, K L; Stevens, J F; Livak, K J; Slotterbeck, B D; Slifer, S H; Warren, L L; Conneally, P M; Schmechel, D E; Purvis, I; Pericak-Vance, M A; Roses, A D; Vance, J M

    2000-08-01

    There has been great interest in the prospects of using single-nucleotide polymorphisms (SNPs) in the search for complex disease genes, and several initiatives devoted to the identification and mapping of SNPs throughout the human genome are currently underway. However, actual data investigating the use of SNPs for identification of complex disease genes are scarce. To begin to look at issues surrounding the use of SNPs in complex disease studies, we have initiated a collaborative SNP mapping study around APOE, the well-established susceptibility gene for late-onset Alzheimer disease (AD). Sixty SNPs in a 1.5-Mb region surrounding APOE were genotyped in samples of unrelated cases of AD, in controls, and in families with AD. Standard tests were conducted to look for association of SNP alleles with AD, in cases and controls. We also used family-based association analyses, including recently developed methods to look for haplotype association. Evidence of association (P

  18. Whole exome sequencing to estimate alloreactivity potential between donors and recipients in stem cell transplantation.

    PubMed

    Sampson, Juliana K; Sheth, Nihar U; Koparde, Vishal N; Scalora, Allison F; Serrano, Myrna G; Lee, Vladimir; Roberts, Catherine H; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H; Buck, Gregory A; Neale, Michael C; Toor, Amir A

    2014-08-01

    Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. © 2014 John Wiley & Sons Ltd.

  19. Genetic differences in ChTLR15 gene polymorphism and expression involved in Salmonella enterica natural and artificial infection respectively, of Chinese native chicken breeds, with a focus on sexual dimorphism.

    PubMed

    Hu, Y; Chen, W W; Liu, H X; Shan, Y J; Zhu, C H; Li, H F; Zou, J M

    2016-01-01

    Chicken Toll-like receptor 15 (ChTLR15) has been shown to participate in immune activation in response to various pathogens and in the innate defence against infection. Two genetically distinct Chinese breeds of chicken (Qinyuan Partridge and Baier breeds) were used to study the correlation between ChTLR15 single nucleotide polymorphisms and the natural infection status of salmonella in hens, and also to examine genetic and sex-specific effects on ChTLR15 mRNA expression in heterophils and spleen during acute infection with Salmonella enterica serovar Enteritidis (SE) from 1 to 10 days after experimental infection. Three single-nucleotide polymorphisms (G168A, C726T and A1166G) in a single exon of ChTLR15 were identified in the two breeds, but only C726T showed a significant association with salmonella infection. Compared with layer-type Baier chicks, meat-type Qingyuan chicks showed a higher tolerance for capture stress and (SE) infection, as measured, respectively, by the modified body weight of chicks in the control group and in the infection group. Meanwhile, ChTLR15 down-regulation in heterophils and up-regulation in spleen were involved in the response to pathogenic SE colonization during the acute infection period. These significant genetic effects in females led to greater differences in both innate and adaptive immune responses than those exhibited in males. These results suggest that genetics, time and gender play important roles in the modulation of ChTLR15 mRNA level elicited by the SE-mediated immune response differentially in the two genetically distinct breeds, with a focus on sexual dimorphism.

  20. Quantitative Analysis of Single-Nucleotide Polymorphism for Rapid Detection of TR34/L98H- and TR46/Y121F/T289A-Positive Aspergillus fumigatus Isolates Obtained from Patients in Iran from 2010 to 2014

    PubMed Central

    Mohammadi, Faezeh; Hashemi, Seyed Jamal; Zoll, Jan; Melchers, Willem J. G.; Rafati, Haleh; Dehghan, Parvin; Rezaie, Sasan; Tolooe, Ali; Tamadon, Yalda; van der Lee, Henrich A.; Verweij, Paul E.

    2015-01-01

    We employed an endpoint genotyping method to update the prevalence rate of positivity for the TR34/L98H mutation (a 34-bp tandem repeat mutation in the promoter region of the cyp51A gene in combination with a substitution at codon L98) and the TR46/Y121F/T289A mutation (a 46-bp tandem repeat mutation in the promoter region of the cyp51A gene in combination with substitutions at codons Y121 and T289) among clinical Aspergillus fumigatus isolates obtained from different regions of Iran over a recent 5-year period (2010 to 2014). The antifungal activities of itraconazole, voriconazole, and posaconazole against 172 clinical A. fumigatus isolates were investigated using the European Committee on Antimicrobial Susceptibility Testing (EUCAST) broth microdilution method. For the isolates with an azole resistance phenotype, the cyp51A gene and its promoter were amplified and sequenced. In addition, using a LightCycler 480 real-time PCR system, a novel endpoint genotyping analysis method targeting single-nucleotide polymorphisms was evaluated to detect the L98H and Y121F mutations in the cyp51A gene of all isolates. Of the 172 A. fumigatus isolates tested, the MIC values of itraconazole (≥16 mg/liter) and voriconazole (>4 mg/liter) were high for 6 (3.5%). Quantitative analysis of single-nucleotide polymorphisms showed the TR34/L98H mutation in the cyp51A genes of six isolates. No isolates harboring the TR46/Y121F/T289A mutation were detected. DNA sequencing of the cyp51A gene confirmed the results of the novel endpoint genotyping method. By microsatellite typing, all of the azole-resistant isolates had genotypes different from those previously recovered from Iran and from the Dutch TR34/L98H controls. In conclusion, there was not a significant increase in the prevalence of azole-resistant A. fumigatus isolates harboring the TR34/L98H resistance mechanism among isolates recovered over a recent 5-year period (2010 to 2014) in Iran. A quantitative assay detecting a single-nucleotide polymorphism in the cyp51A gene of A. fumigatus is a reliable tool for the rapid screening and monitoring of TR34/L98H- and TR46/Y121F/T289A-positive isolates and can easily be incorporated into clinical mycology algorithms. PMID:26525787

  1. A comparative genomics strategy for targeted discovery of single-nucleotide polymorphisms and conserved-noncoding sequences in orphan crops.

    PubMed

    Feltus, F A; Singh, H P; Lohithaswa, H C; Schulze, S R; Silva, T D; Paterson, A H

    2006-04-01

    Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species.

  2. A Comparative Genomics Strategy for Targeted Discovery of Single-Nucleotide Polymorphisms and Conserved-Noncoding Sequences in Orphan Crops1[W

    PubMed Central

    Feltus, F.A.; Singh, H.P.; Lohithaswa, H.C.; Schulze, S.R.; Silva, T.D.; Paterson, A.H.

    2006-01-01

    Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species. PMID:16607031

  3. A Family-Based Association Study of CYP11A1 and CYP11B1 Gene Polymorphisms With Autism in Chinese Trios.

    PubMed

    Deng, Hong-Zhu; You, Cong; Xing, Yu; Chen, Kai-Yun; Zou, Xiao-Bing

    2016-05-01

    Autism spectrum disorder is a group of neurodevelopmental disorders with the higher prevalence in males. Our previous studies have indicated lower progesterone levels in the children with autism spectrum disorder, suggesting involvement of the cytochrome P-450scc gene (CYP11A1) and cytochrome P-45011beta gene (CYP11B1) as candidate genes in autism spectrum disorder. The aim of this study was to investigate the family-based genetic association between single-nucleotide polymorphisms, rs2279357 in the CYP11A1 gene and rs4534 and rs4541 in the CYP11B1 gene and autism spectrum disorder in Chinese children, which were selected according to the location in the coding region and 5' and 3' regions and minor allele frequencies of greater than 0.05 in the Chinese populations. The transmission disequilibrium test and case-control association analyses were performed in 100 Chinese Han autism spectrum disorder family trios. The genotype and allele frequency of the 3 single-nucleotide polymorphisms had no statistical difference between the children with autism spectrum disorder and their parents (P> .05). Transmission disequilibrium test analysis showed transmission disequilibrium of CYP11A1 gene rs2279357 single-nucleotide polymorphisms (χ(2)= 5.038,P< .001). Our findings provide further support for the hypothesis that a susceptibility gene for autism spectrum disorder exists within or near the CYP11A1 gene in the Han Chinese population. © The Author(s) 2015.

  4. Single nucleotide polymorphism in the STAT5b gene is associated with body weight and reproductive traits of the Jinghai Yellow chicken.

    PubMed

    Zhao, X H; Wang, J Y; Zhang, G X; Wei, Y; Gu, Y P; Yu, Y B

    2012-04-01

    In our research, signal transducer and activator of transcription 5b (STAT5b) gene was studied as candidate gene associated with body weight and reproductive traits of Jinghai Yellow chicken. Single nucleotide polymorphisms (SNPs) of STAT5b gene were examined in both Jinghai Yellow chicken and three reference chicken populations including the Bian, Youxi and Arbor Acre chickens. Two SNPs (C-1591T and G-250A) were detected in the 5' flanking region of STAT5b gene. Association indicated that the C-1591T mutation is significantly associated with age at fist egg, The G-250A mutation is significantly related with hatch weight and body weight at 300 days. Additionally four STAT5b haplotypes (H1, CG; H2, TG; H3, AC and H4, TA) and their frequency distributions were estimated using the phase program. Diplotype H3H4 is dominant for 8, 16 week-age-weight and body weight at first egg. Thus STAT5b gene may be served as a potential genetic marker for growth and reproduction traits evaluation of the Jinghai Yellow chicken. This study will provide valuable information for the protection and breeding of Jinghai Yellow chicken.

  5. Replication of CLU, CR1, and PICALM associations with alzheimer disease.

    PubMed

    Carrasquillo, Minerva M; Belbin, Olivia; Hunter, Talisha A; Ma, Li; Bisceglio, Gina D; Zou, Fanggeng; Crook, Julia E; Pankratz, V Shane; Dickson, Dennis W; Graff-Radford, Neill R; Petersen, Ronald C; Morgan, Kevin; Younkin, Steven G

    2010-08-01

    To test for replication of the association between variants in the CLU, CR1, and PICALM genes with Alzheimer disease. Follow-up case-control association study. The Mayo Clinics at Jacksonville, Florida, and Rochester, Minnesota. Community-based patients of European descent with late-onset Alzheimer disease (LOAD) and controls without dementia who were seen at the Mayo clinics, and autopsy-confirmed cases and controls whose pathology was evaluated at the Mayo Clinic in Jacksonville. Additional samples were obtained from the National Cell Repository for Alzheimer Disease (NCRAD). A total of 1829 LOAD cases and 2576 controls were analyzed. The most significant single-nucleotide polymorphisms in CLU (rs11136000), CR1 (rs3818361), and PICALM (rs3851179) were tested for allelic association with LOAD. Main Outcome Measure Clinical or pathology-confirmed diagnosis of LOAD. Odds ratios for CLU, CR1, and PICALM were 0.82, 1.15, and 0.80, respectively, comparable in direction and magnitude with those originally reported. P values were 8.6 x 10(-5), .014, and 1.3 x 10(-5), respectively; they remain significant even after Bonferroni correction for the 3 single-nucleotide polymorphisms tested. These results show near-perfect replication and provide the first additional evidence that CLU, CR1, and PICALM are associated with the risk of LOAD.

  6. Single Locked Nucleic Acid-Enhanced Nanopore Genetic Discrimination of Pathogenic Serotypes and Cancer Driver Mutations.

    PubMed

    Tian, Kai; Chen, Xiaowei; Luan, Binquan; Singh, Prashant; Yang, Zhiyu; Gates, Kent S; Lin, Mengshi; Mustapha, Azlin; Gu, Li-Qun

    2018-05-22

    Accurate and rapid detection of single-nucleotide polymorphism (SNP) in pathogenic mutants is crucial for many fields such as food safety regulation and disease diagnostics. Current detection methods involve laborious sample preparations and expensive characterizations. Here, we investigated a single locked nucleic acid (LNA) approach, facilitated by a nanopore single-molecule sensor, to accurately determine SNPs for detection of Shiga toxin producing Escherichia coli (STEC) serotype O157:H7, and cancer-derived EGFR L858R and KRAS G12D driver mutations. Current LNA applications that require incorporation and optimization of multiple LNA nucleotides. But we found that in the nanopore system, a single LNA introduced in the probe is sufficient to enhance the SNP discrimination capability by over 10-fold, allowing accurate detection of the pathogenic mutant DNA mixed in a large amount of the wild-type DNA. Importantly, the molecular mechanistic study suggests that such a significant improvement is due to the effect of the single-LNA that both stabilizes the fully matched base-pair and destabilizes the mismatched base-pair. This sensitive method, with a simplified, low cost, easy-to-operate LNA design, could be generalized for various applications that need rapid and accurate identification of single-nucleotide variations.

  7. Whole genome sequencing options for bacterial strain typing and epidemiologic analysis based on single nucleotide polymorphism versus gene-by-gene-based approaches.

    PubMed

    Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V

    2018-04-01

    Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  8. Population Structure Shapes Copy Number Variation in Malaria Parasites.

    PubMed

    Cheeseman, Ian H; Miller, Becky; Tan, John C; Tan, Asako; Nair, Shalini; Nkhoma, Standwell C; De Donato, Marcos; Rodulfo, Hectorina; Dondorp, Arjen; Branch, Oralee H; Mesia, Lastenia Ruiz; Newton, Paul; Mayxay, Mayfong; Amambua-Ngwa, Alfred; Conway, David J; Nosten, François; Ferdig, Michael T; Anderson, Tim J C

    2016-03-01

    If copy number variants (CNVs) are predominantly deleterious, we would expect them to be more efficiently purged from populations with a large effective population size (Ne) than from populations with a small Ne. Malaria parasites (Plasmodium falciparum) provide an excellent organism to examine this prediction, because this protozoan shows a broad spectrum of population structures within a single species, with large, stable, outbred populations in Africa, small unstable inbred populations in South America and with intermediate population characteristics in South East Asia. We characterized 122 single-clone parasites, without prior laboratory culture, from malaria-infected patients in seven countries in Africa, South East Asia and South America using a high-density single-nucleotide polymorphism/CNV microarray. We scored 134 high-confidence CNVs across the parasite exome, including 33 deletions and 102 amplifications, which ranged in size from <500 bp to 59 kb, as well as 10,107 flanking, biallelic single-nucleotide polymorphisms. Overall, CNVs were rare, small, and skewed toward low frequency variants, consistent with the deleterious model. Relative to African and South East Asian populations, CNVs were significantly more common in South America, showed significantly less skew in allele frequencies, and were significantly larger. On this background of low frequency CNV, we also identified several high-frequency CNVs under putative positive selection using an FST outlier analysis. These included known adaptive CNVs containing rh2b and pfmdr1, and several other CNVs (e.g., DNA helicase and three conserved proteins) that require further investigation. Our data are consistent with a significant impact of genetic structure on CNV burden in an important human pathogen. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  9. Geographically Distinct and Domain-Specific Sequence Variations in the Alleles of Rice Blast Resistance Gene Pib

    PubMed Central

    Vasudevan, Kumar; Vera Cruz, Casiana M.; Gruissem, Wilhelm; Bhullar, Navreet K.

    2016-01-01

    Rice blast is caused by Magnaporthe oryzae, which is the most destructive fungal pathogen affecting rice growing regions worldwide. The rice blast resistance gene Pib confers broad-spectrum resistance against Southeast Asian M. oryzae races. We investigated the allelic diversity of Pib in rice germplasm originating from 12 major rice growing countries. Twenty-five new Pib alleles were identified that have unique single nucleotide polymorphisms (SNPs), insertions and/or deletions, in addition to the polymorphic nucleotides that are shared between the different alleles. These partially or completely shared polymorphic nucleotides indicate frequent sequence exchange events between the Pib alleles. In some of the new Pib alleles, nucleotide diversity is high in the LRR domain, whereas, in others it is distributed among the NB-ARC and LRR domains. Most of the polymorphic amino acids in LRR and NB-ARC2 domains are predicted as solvent-exposed. Several of the alleles and the unique SNPs are country specific, suggesting a diversifying selection of alleles in various geographical locations in response to the locally prevalent M. oryzae population. Together, the new Pib alleles are an important genetic resource for rice blast resistance breeding programs and provide new information on rice-M. oryzae interactions at the molecular level. PMID:27446145

  10. SNPGenie: estimating evolutionary parameters to detect natural selection using pooled next-generation sequencing data.

    PubMed

    Nelson, Chase W; Moncla, Louise H; Hughes, Austin L

    2015-11-15

    New applications of next-generation sequencing technologies use pools of DNA from multiple individuals to estimate population genetic parameters. However, no publicly available tools exist to analyse single-nucleotide polymorphism (SNP) calling results directly for evolutionary parameters important in detecting natural selection, including nucleotide diversity and gene diversity. We have developed SNPGenie to fill this gap. The user submits a FASTA reference sequence(s), a Gene Transfer Format (.GTF) file with CDS information and a SNP report(s) in an increasing selection of formats. The program estimates nucleotide diversity, distance from the reference and gene diversity. Sites are flagged for multiple overlapping reading frames, and are categorized by polymorphism type: nonsynonymous, synonymous, or ambiguous. The results allow single nucleotide, single codon, sliding window, whole gene and whole genome/population analyses that aid in the detection of positive and purifying natural selection in the source population. SNPGenie version 1.2 is a Perl program with no additional dependencies. It is free, open-source, and available for download at https://github.com/hugheslab/snpgenie. nelsoncw@email.sc.edu or austin@biol.sc.edu Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  11. Investigation into the association between P2RX7 gene polymorphisms and susceptibility to primary gout and hyperuricemia in a Chinese Han male population.

    PubMed

    Ying, Ying; Chen, Yong; Li, Zhen; Huang, Haiyan; Gong, Qiongyao

    2017-04-01

    The purpose of this study was to investigate the relationship between P2RX7 gene single nucleotide polymorphisms and primary gout and hyperuricemia in a Chinese Han male population. The genetic distributions of the single nucleotide polymorphisms (SNPs) rs2230911, rs208294, rs435309, rs28360447, rs1718119, rs28360457, and rs3751143 in P2RX7 were detected in 293 primary gout patients, 187 hyperuricemia patients and 269 controls using SNaPshot technology. Statistical analyses were implemented using SPSS version 20.0. The genetic distributions of each group were tested for Hardy-Weinberg equilibrium (HWE). T test, analysis of variance, rank sum test and Chi-square test were measured to assess differences in clinical data and polymorphisms among groups. Logistic regression was used to assess susceptibility to disease with odds ratios (ORs) and 95% confidence intervals (95% CIs). SHEsis software was used to calculate linkage disequilibrium blocks and haplotype association risk. P < .05 was regarded as statistically significant. Three SNPs (rs2230911, rs208294 and rs435309) did not deviate significantly from HWE (P > .05). In the comparison between primary gout and control, the frequencies of rs2230911 genotypes were significantly different (P = .002), and allele G was associated with a higher risk of primary gout than allele C [OR (95% CI) = 1.755 (1.278, 2.410), P < .001]. There was also a higher risk of primary gout in genotype (CG + GG) compared with genotype CC [OR (95% CI) = 1.876 (1.303, 2.701), P = .001]. However, no significant difference in allelic or genotypic frequency was observed between primary gout patients and hyperuricemia patients (P > .0167). Similarly, there were no obvious differences in the other two polymorphisms among the three groups (P > .05). Our results reveal that P2RX7 rs2230911 may be associated with primary gout risk in a Chinese Han male population and allele G may be a susceptibility factor for primary gout.

  12. Translational genomics for abiotic stress in sorghum: transcriptional profiling and validation of SNP markers between germplasm with differential cold tolerance

    USDA-ARS?s Scientific Manuscript database

    One focus of the Sorghum Translational Genomics Lab (part of sorghum CRIS, PSGD, CSRL, USDA-ARS, Lubbock TX) is to utilize nucleotide variation between sorghum germplasm such as those derived from RNA seq for translation and validation of Single Nucleotide Polymorphism (SNP) into easy access DNA m...

  13. Effect of interactions of polymorphisms in the Melanocortin-4 receptor gene with dietary factors on the risk of obesity and Type 2 diabetes: a systematic review.

    PubMed

    Koochakpoor, G; Hosseini-Esfahani, F; Daneshpour, M S; Hosseini, S A; Mirmiran, P

    2016-08-01

    To perform a systematic review of the effect of interaction between Melanocortin-4 receptor (MC4R) single nucleotide polymorphisms and diet on the development of obesity and Type 2 diabetes. Environmental factors, such as nutrient intakes or feeding behaviours, can modulate the association of polymorphism in the MC4R gene with obesity and Type 2 diabetes mellitus. A systematic literature search was conducted in the PubMed, Scopus and Google Scholar databases, with a combination of the following keywords: Diet*, nutr*, melanocortin receptor, melanocortin 4 receptor and MC4R. To assess the quality of observational studies, we used a 12-item quality checklist, derived from the STREGA statement. A total of 14 articles were selected based on the inclusion and exclusion criteria. Consumption of highly salty foods and adherence to a Mediterranean dietary pattern can modulate the association between MC4R polymorphisms and the risk of obesity or Type 2 diabetes. Despite the highly contradictory results of intervention studies, after short-term lifestyle interventions, children with variant alleles of MC4R single nucleotide polymorphisms can lose more body weight, compared with non-carriers, although they may have difficulty in maintaining this weight loss in the long-term. To interpret the results of studies on adults, we need further studies. The interaction between MC4R genes with dietary factors plays a significant role in the development of obesity or Type 2 diabetes phenotypes. Early detection of MC4R risk alleles in individuals and modification of their diet based on these results could be an efficient strategy to prevent obesity or diabetes in these subgroups. © 2015 Diabetes UK.

  14. Association of Allelic Interaction of Single Nucleotide Polymorphisms of Influx and Efflux Transporters Genes With Nonhematologic Adverse Events of Docetaxel in Breast Cancer Patients.

    PubMed

    Jabir, Rafid Salim; Ho, Gwo Fuang; Annuar, Muhammad Azrif Bin Ahmad; Stanslas, Johnson

    2018-05-04

    Nonhematologic adverse events (AEs) of docetaxel constitute an extra burden in the treatment of cancer patients and necessitate either a dose reduction or an outright switch of docetaxel for other regimens. These AEs are frequently associated with genetic polymorphisms of genes encoding for proteins involved docetaxel disposition. Therefore, we investigated that association in Malaysian breast cancer patients. A total of 110 Malaysian breast cancer patients were enrolled in the present study, and their blood samples were investigated for different single nucleotide polymorphisms using polymerase chain reaction restriction fragment length polymorphism. AEs were evaluated using the Common Terminology Criteria for Adverse Events, version 4.0. Fatigue, nausea, oral mucositis, and vomiting were the most common nonhematologic AEs. Rash was associated with heterozygous and mutant genotypes of ABCB1 3435C>T (P < .05). Moreover, patients carrying the GG genotype of ABCB1 2677G>A/T reported more fatigue than those carrying the heterozygous genotype GA (P < .05). The presence of ABCB1 3435-T, ABCC2 3972-C, ABCC2 1249-G, and ABCB1 2677-G alleles was significantly associated with nausea and oral mucositis. The coexistence of ABCB1 3435-C, ABCC2 3972-C, ABCC2 1249-G, and ABCB1 2677-A was significantly associated with vomiting (P < .05). The prevalence of nonhematologic AEs in breast cancer patients treated with docetaxel has been relatively high. The variant allele of ABCB1 3435C>T polymorphism could be a potential predictive biomarker of docetaxel-induced rash, and homozygous wild-type ABCB1 2677G>A/T might predict for a greater risk of fatigue. In addition, the concurrent presence of specific alleles could be predictive of vomiting, nausea, and oral mucositis. Copyright © 2018 Elsevier Inc. All rights reserved.

  15. Inosine triphosphatase polymorphisms and ribavirin pharmacokinetics as determinants of ribavirin-associate anemia in patients receiving standard anti-HCV treatment.

    PubMed

    DʼAvolio, Antonio; Ciancio, Alessia; Siccardi, Marco; Smedile, Antonina; Baietto, Lorena; Simiele, Marco; Marucco, Diego Aguilar; Cariti, Giuseppe; Calcagno, Andrea; de Requena, Daniel Gonzalez; Sciandra, Mauro; Cusato, Jessica; Troshina, Giulia; Bonora, Stefano; Rizzetto, Mario; Di Perri, Giovanni

    2012-04-01

    Functional variants of inosine triphosphatase (ITPA) were recently found to protect against ribavirin (RBV)-induced hemolytic anemia. However, no definitive data are yet available on the role of plasma RBV concentrations on hemoglobin (Hb) decrement. Moreover, no data have been published on the possible interplay between these 2 factors. A retrospective analysis included 167 patients. The ITPA variants rs7270101 and rs1127354 were genotyped and tested using the χ test for association with Hb reduction at week 4. We also investigated, using multivariate logistic regression, the impact of RBV plasma exposure on Hb concentrations. Both single nucleotide polymorphisms were associated with Hb decrease. The carrier of at least 1 variant allele in the functional ITPA single nucleotide polymorphisms was associated with a lower decrement of Hb (-1.1 g/dL), as compared with patients without a variant allele (-2.75 g/dL; P = 4.09 × 10). RBV concentrations were not influenced by ITPA genotypes. A cut-off of 2.3 μg/mL of RBV was found to be associated with anemia (area-under-receiver operating characteristic = 0.630, sensitivity = 50.0%, and specificity = 69.5%, P = 0.008). In multivariate logistic regression analyses, the carrier of a variant allele (P = 0.005) and plasma RBV concentrations <2.3 μg/mL (P = 0.016) were independently associated with protection against clinically significant anemia at week 4. Although no direct relationship was found between ITPA polymorphisms and plasma RBV concentrations, both factors were shown to be significantly associated with anemia. A multivariate regression model based on ITPA genetic polymorphisms and RBV trough concentration was developed for predicting the risk of anemia. By relying upon these 2 variables, an individualized management of anemia seems to be feasible in recipients of pegylated interferon-RBV therapy.

  16. Acute chest syndrome is associated with single nucleotide polymorphism-defined beta globin cluster haplotype in children with sickle cell anaemia

    PubMed Central

    Bean, Christopher J.; Boulet, Sheree L.; Yang, Genyan; Payne, Amanda B.; Ghaji, Nafisa; Pyle, Meredith E.; Hooper, W. Craig; Bhatnagar, Pallav; Keefer, Jeffrey; Barron-Casella, Emily A.; Casella, James F.; DeBaun, Michael R.

    2013-01-01

    Summary Genetic diversity at the human β-globin locus has been implicated as a modifier of sickle cell anaemia (SCA) severity. However, haplotypes defined by restriction fragment length polymorphism sites across the β-globin locus have not been consistently associated with clinical phenotypes. To define the genetic structure at the β-globin locus more thoroughly, we performed high-density single nucleotide polymorphism (SNP) mapping in 820 children who were homozygous for the sickle cell mutation (HbSS). Genotyping results revealed very high linkage disequilibrium across a large region spanning the locus control region and the HBB (β-globin gene) cluster. We identified three predominant haplotypes accounting for 96% of the βS-carrying chromosomes in this population that could be distinguished using a minimal set of common SNPs. Consistent with previous studies, fetal haemoglobin level was significantly associated with βS-haplotypes. After controlling for covariates, an association was detected between haplotype and rate of hospitalization for acute chest syndrome (ACS) (incidence rate ratio 0.51, 95% confidence interval 0.29–0.89) but not incidence rate of vaso-occlusive pain or presence of silent cerebral infarct (SCI). Our results suggest that these SNP-defined βS-haplotypes may be associated with ACS, but not pain or SCI in a study population of children with SCA. PMID:23952145

  17. Single Nucleotide Polymorphism Array Analysis of Bone Marrow Failure Patients Reveals Characteristic Patterns of Genetic Changes

    PubMed Central

    Babushok, Daria V.; Xie, Hongbo M.; Roth, Jacquelyn J.; Perdigones, Nieves; Olson, Timothy S.; Cockroft, Joshua D.; Gai, Xiaowu; Perin, Juan C.; Li, Yimei; Paessler, Michele E.; Hakonarson, Hakon; Podsakoff, Gregory M.; Mason, Philip J.; Biegel, Jaclyn A.; Bessler, Monica

    2013-01-01

    Summary The bone marrow failure syndromes (BMFS) are a heterogeneous group of rare blood disorders characterized by inadequate haematopoiesis, clonal evolution, and increased risk of leukaemia. Single nucleotide polymorphism arrays (SNP-A) have been proposed as a tool for surveillance of clonal evolution in BMFS. To better understand the natural history of BMFS and to assess the clinical utility of SNP-A in these disorders, we analysed 124 SNP-A from a comprehensively characterized cohort of 91 patients at our BMFS centre. SNP-A were correlated with medical histories, haematopathology, cytogenetic and molecular data. To assess clonal evolution, longitudinal analysis of SNP-A was performed in 25 patients. We found that acquired copy number-neutral loss of heterozygosity (CN-LOH) was significantly more frequent in acquired aplastic anaemia (aAA) than in other BMFS (odds ratio 12.2, p<0.01). Homozygosity by descent was most common in congenital BMFS, frequently unmasking autosomal recessive mutations. Copy number variants (CNVs) were frequently polymorphic, and we identified CNVs enriched in neutropenia and aAA. Our results suggest that acquired CN-LOH is a general phenomenon in aAA that is probably mechanistically and prognostically distinct from typical CN-LOH of myeloid malignancies. Our analysis of clinical utility of SNP-A shows the highest yield of detecting new clonal haematopoiesis at diagnosis and at relapse. PMID:24116929

  18. Single nucleotide polymorphism array analysis of bone marrow failure patients reveals characteristic patterns of genetic changes.

    PubMed

    Babushok, Daria V; Xie, Hongbo M; Roth, Jacquelyn J; Perdigones, Nieves; Olson, Timothy S; Cockroft, Joshua D; Gai, Xiaowu; Perin, Juan C; Li, Yimei; Paessler, Michele E; Hakonarson, Hakon; Podsakoff, Gregory M; Mason, Philip J; Biegel, Jaclyn A; Bessler, Monica

    2014-01-01

    The bone marrow failure syndromes (BMFS) are a heterogeneous group of rare blood disorders characterized by inadequate haematopoiesis, clonal evolution, and increased risk of leukaemia. Single nucleotide polymorphism arrays (SNP-A) have been proposed as a tool for surveillance of clonal evolution in BMFS. To better understand the natural history of BMFS and to assess the clinical utility of SNP-A in these disorders, we analysed 124 SNP-A from a comprehensively characterized cohort of 91 patients at our BMFS centre. SNP-A were correlated with medical histories, haematopathology, cytogenetic and molecular data. To assess clonal evolution, longitudinal analysis of SNP-A was performed in 25 patients. We found that acquired copy number-neutral loss of heterozygosity (CN-LOH) was significantly more frequent in acquired aplastic anaemia (aAA) than in other BMFS (odds ratio 12·2, P < 0·01). Homozygosity by descent was most common in congenital BMFS, frequently unmasking autosomal recessive mutations. Copy number variants (CNVs) were frequently polymorphic, and we identified CNVs enriched in neutropenia and aAA. Our results suggest that acquired CN-LOH is a general phenomenon in aAA that is probably mechanistically and prognostically distinct from typical CN-LOH of myeloid malignancies. Our analysis of clinical utility of SNP-A shows the highest yield of detecting new clonal haematopoiesis at diagnosis and at relapse. © 2013 John Wiley & Sons Ltd.

  19. Development of a New Molecular Subtyping Tool for Salmonella enterica Serovar Enteritidis Based on Single Nucleotide Polymorphism Genotyping Using PCR

    PubMed Central

    Kelly, Hilary; Dupras, Andrée Ann; Belanger, Sebastien; Devenish, John

    2014-01-01

    The lack of a sufficiently discriminatory molecular subtyping tool for Salmonella enterica serovar Enteritidis has hindered source attribution efforts and impeded regulatory actions required to disrupt its food-borne transmission. The underlying biological reason for the ineffectiveness of current molecular subtyping tools such as pulsed-field gel electrophoresis (PFGE) and phage typing appears to be related to the high degree of clonality of S. Enteritidis. By interrogating the organism's genome, we previously identified single nucleotide polymorphisms (SNP) distributed throughout the chromosome and have designed a highly discriminatory PCR-based SNP typing test based on 60 polymorphic loci. The application of the SNP-PCR method to DNA samples from S. Enteritidis strains (n = 55) obtained from a variety of sources has led to the differentiation and clustering of the S. Enteritidis isolates into 12 clades made up of 2 to 9 isolates per clade. Significantly, the SNP-PCR assay was able to further differentiate predominant PFGE types (e.g., XAI.0003) and phage types (e.g., phage type 8) into smaller subsets. The SNP-PCR subtyping test proved to be an accurate, precise, and quantitative tool for evaluating the relationships among the S. Enteritidis isolates tested in this study and should prove useful for clustering related S. Enteritidis isolates involved in outbreaks. PMID:25297333

  20. Clinical relevance of the interleukin 10 promoter polymorphisms in Chinese Han patients with major trauma: genetic association studies.

    PubMed

    Zeng, Ling; Gu, Wei; Chen, Kehong; Jiang, Dongpo; Zhang, Lianyang; Du, Dingyuan; Hu, Ping; Liu, Qing; Huang, Suna; Jiang, Jianxin

    2009-01-01

    An excessive inflammatory response is thought to account for the pathogenesis of sepsis and multiple organ dysfunction syndrome (MODS) after severe trauma. The interleukin-10 (IL-10) is a potent anti-inflammatory cytokine. The objectives of this prospective study were to investigate the distribution of IL-10 promoter polymorphisms in a cohort of 308 Chinese Han patients with major trauma, and to identify associations of IL-10 promoter polymorphisms with IL-10 production and incidence of sepsis and MODS. A total of 308 patients with major trauma were included in this study. The genotypes of polymorphisms -1082, -819 and -592 were determined by polymerase chain reaction-restriction fragment length polymorphism. The IL-10 levels in the supernatants were determined with enzyme-linked immunoabsorbent assay. The -1082A and -592A alleles were significantly associated with lower lipopolysaccharide-induced IL-10 production in an allele-dose dependent fashion. There was no significant difference for the -819 polymorphism. Except for the -1082 polymorphism, the -819 and -592 polymorphisms were not significantly associated with sepsis morbidity rate and MOD scores. Our results further confirm the functionality of the IL-10 promoter single nucleotide polymorphisms in relation to IL-10 production. They also suggest that individual difference in IL-10 production in trauma patients might be at least in part related to genetic variations in the IL-10 promoter region.

  1. Recent developments in the study of opioid receptors.

    PubMed

    Cox, Brian M

    2013-04-01

    It is now about 40 years since Avram Goldstein proposed the use of the stereoselectivity of opioid receptors to identify these receptors in neural membranes. In 2012, the crystal structures of the four members of the opioid receptor family were reported, providing a structural basis for understanding of critical features affecting the actions of opiate drugs. This minireview summarizes these recent developments in our understanding of opiate receptors. Receptor function is also influenced by amino acid substitutions in the protein sequence. Among opioid receptor genes, one polymorphism is much more frequent in human populations than the many others that have been found, but the functional significance of this single nucleotide polymorphism (SNP) has been unclear. Recent studies have shed new light on how this SNP might influence opioid receptor function. In this minireview, the functional significance of the most prevalent genetic polymorphism among the opioid receptor genes is also considered.

  2. Homozygosity of single nucleotide polymorphisms in the 3' region of the canine estrogen receptor 1 gene is greater in Toy Poodles than in Miniature Dachshunds and Chihuahuas.

    PubMed

    Pathirana, Indunil N; Tanaka, Kakeru; Kawate, Noritoshi; Tsuji, Makoto; Hatoya, Shingo; Inaba, Toshio; Tamada, Hiromichi

    2011-06-01

    Differences in the distribution of single nucleotide polymorphisms (SNPs) and haplotypes in the estrogen receptor α gene (ESR1) were examined in Miniature Dachshunds (n = 48), Chihuahuas (n = 20) and Toy Poodles (n = 18). Five DNA fragments located in the 40-kb region at the 3' end of ESR1 were amplified by polymerase chain reaction and were directly sequenced. We compared allele, genotype and estimated haplotype frequencies at each SNP in the 3' end of ESR1 for these three breeds of small dog. The frequency of the major allele and the genotype frequency of the major allele homozygotes, were significantly higher in Toy Poodles for five SNPs (SNP #5, #14-17) than in Miniature Dachshunds, and significantly higher in Toy Poodles than Chihuahuas for three SNPs (SNP #15-17). A common haplotype block was identified in an approximately 20-kb region encompassing four SNPs (SNPs # 14-17). The frequencies of the most abundant estimated haplotype (GTTG) and GTTG homozygotes were significantly higher in Toy Poodles than in the other two breeds. These results imply that homozygosity for the allele, genotype and haplotype distribution within the block at the 3' end of ESR1 is greater in Toy Poodles than in Miniature Dachshunds and Chihuahuas. © 2011 The Authors; Animal Science Journal © 2011 Japanese Society of Animal Science.

  3. Mango (Mangifera indica L.) germplasm diversity based on single nucleotide polymorphisms derived from the transcriptome.

    PubMed

    Sherman, Amir; Rubinstein, Mor; Eshed, Ravit; Benita, Miri; Ish-Shalom, Mazal; Sharabi-Schwager, Michal; Rozen, Ada; Saada, David; Cohen, Yuval; Ophir, Ron

    2015-11-14

    Germplasm collections are an important source for plant breeding, especially in fruit trees which have a long duration of juvenile period. Thus, efforts have been made to study the diversity of fruit tree collections. Even though mango is an economically important crop, most of the studies on diversity in mango collections have been conducted with a small number of genetic markers. We describe a de novo transcriptome assembly from mango cultivar 'Keitt'. Variation discovery was performed using Illumina resequencing of 'Keitt' and 'Tommy Atkins' cultivars identified 332,016 single-nucleotide polymorphisms (SNPs) and 1903 simple-sequence repeats (SSRs). Most of the SSRs (70.1%) were of trinucleotide with the preponderance of motif (GGA/AAG)n and only 23.5% were di-nucleotide SSRs with the mostly of (AT/AT)n motif. Further investigation of the diversity in the Israeli mango collection was performed based on a subset of 293 SNPs. Those markers have divided the Israeli mango collection into two major groups: one group included mostly mango accessions from Southeast Asia (Malaysia, Thailand, Indonesia) and India and the other with mainly of Floridian and Israeli mango cultivars. The latter group was more polymorphic (FS=-0.1 on the average) and was more of an admixture than the former group. A slight population differentiation was detected (FST=0.03), suggesting that if the mango accessions of the western world apparently was originated from Southeast Asia, as has been previously suggested, the duration of cultivation was not long enough to develop a distinct genetic background. Whole-transcriptome reconstruction was used to significantly broaden the mango's genetic variation resources, i.e., SNPs and SSRs. The set of SNP markers described in this study is novel. A subset of SNPs was sampled to explore the Israeli mango collection and most of them were polymorphic in many mango accessions. Therefore, we believe that these SNPs will be valuable as they recapitulate and strengthen the history of mango diversity.

  4. Does Marriage Moderate Genetic Effects on Delinquency and Violence?

    PubMed Central

    Li, Yi; Liu, Hexuan; Guo, Guang

    2015-01-01

    Using data from the National Longitudinal Study of Adolescent to Adult Health (N = 1,254), the authors investigated whether marriage can foster desistance from delinquency and violence by moderating genetic effects. In contrast to existing gene–environment research that typically focuses on one or a few genetic polymorphisms, they extended a recently developed mixed linear model to consider the collective influence of 580 single nucleotide polymorphisms in 64 genes related to aggression and risky behavior. The mixed linear model estimates the proportion of variance in the phenotype that is explained by the single nucleotide polymorphisms. The authors found that the proportion of variance in delinquency/violence explained was smaller among married individuals than unmarried individuals. Because selection, confounding, and heterogeneity may bias the estimate of the Gene × Marriage interaction, they conducted a series of analyses to address these issues. The findings suggest that the Gene × Marriage interaction results were not seriously affected by these issues. PMID:26549892

  5. Val66Met Polymorphism of BDNF Alters Prodomain Structure to Induce Neuronal Growth Cone Retraction

    PubMed Central

    Anastasia, Agustin; Deinhardt, Katrin; Chao, Moses V.; Will, Nathan E.; Irmady, Krithi; Lee, Francis S.; Hempstead, Barbara L.; Bracken, Clay

    2013-01-01

    A common single-nucleotide polymorphism in the human brain-derived neurotrophic factor (BDNF) gene results in a Val66Met substitution in the BDNF prodomain region. This single-nucleotide polymorphism is associated with alterations in memory and with enhanced risk to develop depression and anxiety disorders in humans. Here we show that the isolated BDNF prodomain is detected in the hippocampus and that it can be secreted from neurons in an activity-dependent manner. Using nuclear magnetic resonance spectroscopy and circular dichroism we find that the prodomain is intrinsically disordered, and the Val66Met substitution induces structural changes. Surprisingly, application of Met66 (but not Val66) BDNF prodomain induces acute growth cone retraction and a decrease in Rac activity in hippocampal neurons. Expression of p75NTR and differential engagement of the Met66 prodomain to the SorCS2 receptor are required for this effect. These results identify the Met66 prodomain as a new active ligand which modulates neuronal morphology. PMID:24048383

  6. Genetic diversity revealed by single nucleotide polymorphism markers in a worldwide germplasm collection of durum wheat.

    PubMed

    Ren, Jing; Sun, Daokun; Chen, Liang; You, Frank M; Wang, Jirui; Peng, Yunliang; Nevo, Eviatar; Sun, Dongfa; Luo, Ming-Cheng; Peng, Junhua

    2013-03-28

    Evaluation of genetic diversity and genetic structure in crops has important implications for plant breeding programs and the conservation of genetic resources. Newly developed single nucleotide polymorphism (SNP) markers are effective in detecting genetic diversity. In the present study, a worldwide durum wheat collection consisting of 150 accessions was used. Genetic diversity and genetic structure were investigated using 946 polymorphic SNP markers covering the whole genome of tetraploid wheat. Genetic structure was greatly impacted by multiple factors, such as environmental conditions, breeding methods reflected by release periods of varieties, and gene flows via human activities. A loss of genetic diversity was observed from landraces and old cultivars to the modern cultivars released during periods of the Early Green Revolution, but an increase in cultivars released during the Post Green Revolution. Furthermore, a comparative analysis of genetic diversity among the 10 mega ecogeographical regions indicated that South America, North America, and Europe possessed the richest genetic variability, while the Middle East showed moderate levels of genetic diversity.

  7. AFLP fragment isolation technique as a method to produce random sequences for single nucleotide polymorphism discovery in the green turtle, Chelonia mydas.

    PubMed

    Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A

    2009-01-01

    The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.

  8. Genetic diversity and classification of Tibetan yak populations based on the mtDNA COIII gene.

    PubMed

    Song, Q Q; Chai, Z X; Xin, J W; Zhao, S J; Ji, Q M; Zhang, C F; Ma, Z J; Zhong, J C

    2015-03-13

    To determine the level of genetic diversity and phylogenetic relationships among Tibetan yak populations, the mitochondrial DNA cytochrome c oxidase subunit 3 (COIII) genes of 378 yak individuals from 16 populations were analyzed in this study. The results showed that the length of cytochrome c oxidase subunit 3 gene sequences was 781 bp, with nucleotide frequencies of 29.2, 29.4, 26.1, and 15.2% for T, C, A, and G, respectively. A total of 26 haplotypes were identified, with 69 polymorphic sites, including 11 parsimony-informative sites and 58 single-nucleotide polymorphism sites. No deletions/insertions were found in sequence comparison, indicating that nucleotide mutation types were transitions and transversions. Haplotype and nucleotide diversities were 0.562 and 0.00138, respectively, indicating a high level of genetic diversity in Tibetan yak populations. Phylogenetic relationship analysis indicated that Tibetan yak populations are divided into 2 groups.

  9. Deep sequencing revealed genome-wide single-nucleotide polymorphism and plasmid content of Erwinia amylovora strains isolated in Middle Atlas, Morocco.

    PubMed

    Hannou, Najat; Mondy, Samuel; Planamente, Sara; Moumni, Mohieddine; Llop, Pablo; López, María; Manceau, Charles; Barny, Marie-Anne; Faure, Denis

    2013-10-01

    Erwinia amylovora causes economic losses that affect pear and apple production in Morocco. Here, we report comparative genomics of four Moroccan E. amylovora strains with the European strain CFBP1430 and North-American strain ATCC49946. Analysis of single nucleotide polymorphisms (SNPs) revealed genetic homogeneity of Moroccan's strains and their proximity to the European strain CFBP1430. Moreover, the collected sequences allowed the assembly of a 65 kpb plasmid, which is highly similar to the plasmid pEI70 harbored by several European E. amylovora isolates. This plasmid was found in 33% of the 40 E. amylovora strains collected from several host plants in 2009 and 2010 in Morocco. Copyright © 2013 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  10. Sub-micro-liter Electrochemical Single-Nucleotide-Polymorphism Detector for Lab-on-a-Chip System

    NASA Astrophysics Data System (ADS)

    Tanaka, Hiroyuki; Fiorini, Paolo; Peeters, Sara; Majeed, Bivragh; Sterken, Tom; de Beeck, Maaike Op; Hayashi, Miho; Yaku, Hidenobu; Yamashita, Ichiro

    2012-04-01

    A sub-micro-liter single-nucleotide-polymorphism (SNP) detector for lab-on-a-chip applications is developed. This detector enables a fast, sensitive, and selective SNP detection directly from human blood. The detector is fabricated on a Si substrate by a standard complementary metal oxide semiconductor/micro electro mechanical systems (CMOS/MEMS) process and Polydimethylsiloxane (PDMS) molding. Stable and reproducible measurements are obtained by implementing an on-chip Ag/AgCl electrode and encapsulating the detector. The detector senses the presence of SNPs by measuring the concentration of pyrophosphoric acid generated during selective DNA amplification. A 0.5-µL-volume detector enabled the successful performance of the typing of a SNP within the ABO gene using human blood. The measured sensitivity is 566 pA/µM.

  11. A gold nanoparticles-based colorimetric test to detect single nucleotide polymorphisms for improvement of personalized therapy of psoriasis

    NASA Astrophysics Data System (ADS)

    Marsella, Alessandra; Valentini, Paola; Tarantino, Paolo; Congedo, Maurizio; Pompa, Pier Paolo

    2016-04-01

    We report a simple, rapid and low-cost test, based on gold nanoparticles, for the naked-eye colorimetric detection of a signature of single nucleotide polymorphisms (SNPs) relevant for the personalized medicine of psoriasis patients. We validated the colorimetric assay on real-world DNA samples from a cohort of 30 psoriasis patients and we compared the results, in double-blind, with those obtained with two state-of-the-art instrumental techniques, namely reverse dot blotting and direct sequencing, finding 100% agreement. We demonstrated high accuracy, sensitivity and specificity of the colorimetric test that can be easily adapted for the genotypization of different SNPs, important for the pharmacogenomics of various diseases, and in other fields, such as food traceability and population structure analysis.

  12. Quantifying the utility of single nucleotide polymorphisms to guide colorectal cancer screening

    PubMed Central

    Jenkins, Mark A; Makalic, Enes; Dowty, James G; Schmidt, Daniel F; Dite, Gillian S; MacInnis, Robert J; Ait Ouakrim, Driss; Clendenning, Mark; Flander, Louisa B; Stanesby, Oliver K; Hopper, John L; Win, Aung K; Buchanan, Daniel D

    2016-01-01

    Aim: To determine whether single nucleotide polymorphisms (SNPs) can be used to identify people who should be screened for colorectal cancer. Methods: We simulated one million people with and without colorectal cancer based on published SNP allele frequencies and strengths of colorectal cancer association. We estimated 5-year risks of colorectal cancer by number of risk alleles. Results: We identified 45 SNPs with an average 1.14-fold increase colorectal cancer risk per allele (range: 1.05–1.53). The colorectal cancer risk for people in the highest quintile of risk alleles was 1.81-times that for the average person. Conclusion: We have quantified the extent to which known susceptibility SNPs can stratify the population into clinically useful colorectal cancer risk categories. PMID:26846999

  13. The association of ghrelin polymorphisms with coronary artery disease and ischemic chronic heart failure in an elderly Chinese population.

    PubMed

    Zhang, Qin; Huang, Wei-Dong; Lv, Xue-Ying; Yang, Yun-Mei

    2011-04-01

    To investigate the association of coronary artery disease (CAD) and ischemic heart failure (IHF) with polymorphisms of the ghrelin gene in elderly Chinese patients. Fifty-six patients with ischemic heart failure, sixty patients with coronary artery disease without heart failure, and one hundred healthy control subjects participated in the study. The polymorphisms were evaluated by polymerase chain reaction, sequencing, and fragment length polymorphism analysis. Only one single nucleotide polymorphism (SNP), Leu72Met (408C/A), was observed across all samples. Gene frequencies of CC and allele frequencies of C were significantly greater in the CAD with IHF group than those in the CAD without IHF group (p=0.025, p=0.011). There was no significant association between the Leu72Met SNP with coronary artery disease risk factors. Our results suggest that a C allele at position 408 of the ghrelin gene is associated with genetic susceptibility to ischemic heart failure in Chinese elders. Copyright © 2010 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  14. Connecting Common Genetic Polymorphisms to Protein Function: A Modular Project Sequence for Lecture or Lab

    ERIC Educational Resources Information Center

    Berndsen, Christopher E.; Young, Byron H.; McCormick, Quinlin J.; Enke, Raymond A.

    2016-01-01

    Single nucleotide polymorphisms (SNPs) in DNA can result in phenotypes where the biochemical basis may not be clear due to the lack of protein structures. With the growing number of modeling and simulation software available on the internet, students can now participate in determining how small changes in genetic information impact cellular…

  15. The effects of ABCG5/G8 polymorphisms on plasma HDL cholesterol concentrations depend on smoking habit in the Boston Puerto Rican Health Study

    USDA-ARS?s Scientific Manuscript database

    Background-Low high-density lipoprotein cholesterol (HDL-C) is associated with an increased risk for atherosclerosis and concentrations are modulated by genetic and environmental factors such as smoking. Objective- To assess whether the association of common single nucleotide polymorphisms (SNPs...

  16. Using PCR-RFLP Technology to Teach Single Nucleotide Polymorphism for Undergraduates

    ERIC Educational Resources Information Center

    Zhang, Bo; Wang, Yan; Xu, Xiaofeng; Guan, Xingying; Bai, Yun

    2013-01-01

    Recent studies indicated that the aberrant gene expression of peroxiredoxin-6 (prdx6) was found in various kinds of cancers. Because of its biochemical function and gene expression pattern in cancer cells, the association between genetic polymorphism of Prdx6 and cancer onset is interesting. In this report, we have developed and implemented a…

  17. Genome-Wide Divergence and Linkage Disequilibrium Analyses for Capsicum baccatum Revealed by Genome-Anchored Single Nucleotide Polymorphisms

    PubMed Central

    Nimmakayala, Padma; Abburi, Venkata L.; Saminathan, Thangasamy; Almeida, Aldo; Davenport, Brittany; Davidson, Joshua; Reddy, C. V. Chandra Mohan; Hankins, Gerald; Ebert, Andreas; Choi, Doil; Stommel, John; Reddy, Umesh K.

    2016-01-01

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to characterize population structure and species domestication of these two important incompatible cultivated pepper species. Estimated mean nucleotide diversity (π) and Tajima's D across various chromosomes revealed biased distribution toward negative values on all chromosomes (except for chromosome 4) in cultivated C. baccatum, indicating a population bottleneck during domestication of C. baccatum. In contrast, C. annuum chromosomes showed positive π and Tajima's D on all chromosomes except chromosome 8, which may be because of domestication at multiple sites contributing to wider genetic diversity. For C. baccatum, 13,129 SNPs were available, with minor allele frequency (MAF) ≥0.05; PCA of the SNPs revealed 283 C. baccatum accessions grouped into 3 distinct clusters, for strong population structure. The fixation index (FST) between domesticated C. annuum and C. baccatum was 0.78, which indicates genome-wide divergence. We conducted extensive linkage disequilibrium (LD) analysis of C. baccatum var. pendulum cultivars on all adjacent SNP pairs within a chromosome to identify regions of high and low LD interspersed with a genome-wide average LD block size of 99.1 kb. We characterized 1742 haplotypes containing 4420 SNPs (range 9–2 SNPs per haplotype). Genome-wide association study (GWAS) of peduncle length, a trait that differentiates wild and domesticated C. baccatum types, revealed 36 significantly associated genome-wide SNPs. Population structure, identity by state (IBS) and LD patterns across the genome will be of potential use for future GWAS of economically important traits in C. baccatum peppers. PMID:27857720

  18. Genome-Wide Divergence and Linkage Disequilibrium Analyses for Capsicum baccatum Revealed by Genome-Anchored Single Nucleotide Polymorphisms.

    PubMed

    Nimmakayala, Padma; Abburi, Venkata L; Saminathan, Thangasamy; Almeida, Aldo; Davenport, Brittany; Davidson, Joshua; Reddy, C V Chandra Mohan; Hankins, Gerald; Ebert, Andreas; Choi, Doil; Stommel, John; Reddy, Umesh K

    2016-01-01

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to characterize population structure and species domestication of these two important incompatible cultivated pepper species. Estimated mean nucleotide diversity (π) and Tajima's D across various chromosomes revealed biased distribution toward negative values on all chromosomes (except for chromosome 4) in cultivated C. baccatum , indicating a population bottleneck during domestication of C. baccatum . In contrast, C. annuum chromosomes showed positive π and Tajima's D on all chromosomes except chromosome 8, which may be because of domestication at multiple sites contributing to wider genetic diversity. For C. baccatum , 13,129 SNPs were available, with minor allele frequency (MAF) ≥0.05; PCA of the SNPs revealed 283 C. baccatum accessions grouped into 3 distinct clusters, for strong population structure. The fixation index ( F ST ) between domesticated C. annuum and C. baccatum was 0.78, which indicates genome-wide divergence. We conducted extensive linkage disequilibrium (LD) analysis of C. baccatum var. pendulum cultivars on all adjacent SNP pairs within a chromosome to identify regions of high and low LD interspersed with a genome-wide average LD block size of 99.1 kb. We characterized 1742 haplotypes containing 4420 SNPs (range 9-2 SNPs per haplotype). Genome-wide association study (GWAS) of peduncle length, a trait that differentiates wild and domesticated C. baccatum types, revealed 36 significantly associated genome-wide SNPs. Population structure, identity by state (IBS) and LD patterns across the genome will be of potential use for future GWAS of economically important traits in C. baccatum peppers.

  19. Polymorphisms of the bovine DKK2 and their associations with body measurement traits and meat quality traits in Qinchuan cattle.

    PubMed

    Zhan, Xiaoli; Gao, Jianbin; Huangfu, Yifan; Fu, Changzhen; Zan, Linsen

    2013-12-01

    The objective of this research were to detect bovine Dickkopf 2 (DKK2) gene polymorphism and analyze their associations with body measurement traits (BMT) and meat quality traits (MQT) of animals. Blood samples were taken from a total of 541 Qinchuan cattle aged from 18 to 24 months. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) was employed to find out DKK2 single-polymorphism nucleotide (SNPs) and to explore their possible association with BMT and MQT. Sequence analysis of DKK2 gene revealed 2 SNPs (C29 T and A169C) in 5' untranslated region (5'UTR) of exon 1.C29T and A164T SNPs are both synonymous mutation, which showed 2 genotypes namely (CC, CT) and (AA and AC), respectively. Association analysis of polymorphism with body measurement and meat quality traits at the two locus showed that there were significant effects on CT, BL, RL, PBW, BFT, LMA, and IFC. These results suggest that the DKK2 gene might have potential effects on BMT and MQT in Qinchuan cattle population and could be used for marker-assisted selection.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fahrenkrog, Annette M.; Neves, Leandro G.; Resende, Jr., Marcio F. R.

    Genome-wide association studies (GWAS) have been used extensively to dissect the genetic regulation of complex traits in plants. These studies have focused largely on the analysis of common genetic variants despite the abundance of rare polymorphisms in several species, and their potential role in trait variation. Here, we conducted the first GWAS in Populus deltoides, a genetically diverse keystone forest species in North America and an important short rotation woody crop for the bioenergy industry. We searched for associations between eight growth and wood composition traits, and common and low-frequency single-nucleotide polymorphisms detected by targeted resequencing of 18 153 genesmore » in a population of 391 unrelated individuals. To increase power to detect associations with low-frequency variants, multiple-marker association tests were used in combination with single-marker association tests. Significant associations were discovered for all phenotypes and are indicative that low-frequency polymorphisms contribute to phenotypic variance of several bioenergy traits. Our results suggest that both common and low-frequency variants need to be considered for a comprehensive understanding of the genetic regulation of complex traits, particularly in species that carry large numbers of rare polymorphisms. Lastly, these polymorphisms may be critical for the development of specialized plant feedstocks for bioenergy.« less

  1. Potassium channel KCNH2 K897T polymorphism and cardiac repolarization during exercise test: The Finnish Cardiovascular Study.

    PubMed

    Koskela, J; Laiho, J; KäHönen, M; Rontu, R; Lehtinen, R; Viik, J; Niemi, M; Niemelä, K; Kööbi, T; Turjanmaa, V; Pörsti, I; Lehtimäki, T; Nieminen, T

    2008-01-01

    Cardiac repolarization is regulated, in part, by the KCNH2 gene, which encodes a rapidly activating component of the delayed rectifier potassium channel. The gene expresses a functional single nucleotide polymorphism, K897T, which changes the biophysical properties of the channel. The objective of this study was to evaluate whether this polymorphism influences two indices of repolarization--the QT interval and T-wave alternans (TWA)--during different phases of a physical exercise test. The cohort consisted of 1,975 patients undergoing an exercise test during which on-line electrocardiographic data were registered. Information on coronary risk factors and medication was recorded. The 2690A>C nucleotide variation in the KCNH2 gene corresponding to the K897T amino acid change was analysed after polymerase chain reaction with allele-specific TaqMan probes. Among all subjects, the QTc intervals did not differ between the three genotype groups (p> or =0.31, RANOVA). Women with the CC genotype tended to have longer QT intervals during the exercise test, but the difference was statistically significant only at rest (p = 0.011, ANOVA). This difference was also detected when the analysis was adjusted for several factors influencing the QT interval. No statistically significant effects of the K897T polymorphism on TWA were observed among all subjects (p = 0.16, RANOVA), nor in men and women separately. The K897T polymorphism of the KCNH2 gene may not be a major genetic determinant for the TWA, but the influence of the CC genotype on QT interval deserves further research among women.

  2. A TaqI PCR-RFLP detecting a novel SNP in exon 2 of the bovine POU1F1 gene.

    PubMed

    Pan, Chuanying; Lan, Xianyong; Chen, Hong; Guo, Yikun; Shu, Jianhong; Lei, Chuzhao; Wang, Xinzhuang

    2008-08-01

    PCR-SSCP and DNA sequencing methods were applied to reveal three novel single nucleotide polymorphisms (SNPs) in exon 2 of the POU1F1 gene in 963 Chinese cattle belonging to eight breeds. Among them, a silent SNP (NM_174579:c.545G > A) detected by TaqI endonuclease is described. Frequencies of the POU1F1-G allele varied from 0.685 to 1.000. The association of TaqI polymorphism with growth traits was analyzed in 251 Nanyang cattle. No significant associations of the TaqI polymorphism with body weight and average daily gain for different growth periods (6, 12, 18, and 24 months old) were observed (P > 0.05), as well as for body sizes (P > 0.05).

  3. Gallium plasmonic nanoparticles for label-free DNA and single nucleotide polymorphism sensing

    NASA Astrophysics Data System (ADS)

    Marín, Antonio García; García-Mendiola, Tania; Bernabeu, Cristina Navio; Hernández, María Jesús; Piqueras, Juan; Pau, Jose Luis; Pariente, Félix; Lorenzo, Encarnación

    2016-05-01

    A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells.A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr00926c

  4. Toll-like receptor 2 gene polymorphisms in Chinese Holstein cattle and their associations with bovine tuberculosis.

    PubMed

    Zhao, Zhanqin; Xue, Yun; Hu, Zhigang; Zhou, Feng; Ma, Beibei; Long, Ta; Xue, Qiao; Liu, Huisheng

    2017-04-01

    This study evaluated whether there was an association between polymorphisms within the Toll-like receptor 2 gene (TLR2) of Chinese Holstein cattle and susceptibility to bovine tuberculosis (BTB). In a case-control study including 210 BTB cases and 237 control cattle, we found only two common single-nucleotide polymorphisms (SNPs) within the entire coding region of the TLR2 gene, A631G (rs95214857) and T1707C (rs1388116488). Additionally, the allele and genotype distributions of A631G and T1707C were not different between case and control groups, indicated that these SNPs were not associated with susceptibility to BTB. These results suggested that polymorphisms in the TLR2 gene might not play a significant role in the BTB risk in Chinese Holstein cattle. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Bison PRNP genotyping and potential association with Brucella spp. seroprevalence

    USGS Publications Warehouse

    Seabury, C.M.; Halbert, N.D.; Gogan, P.J.P.; Templeton, J.W.; Derr, J.N.

    2005-01-01

    The implication that host cellular prion protein (PrPC) may function as a cell surface receptor and/or portal protein for Brucella abortus in mice prompted an evaluation of nucleotide and amino acid variation within exon 3 of the prion protein gene (PRNP) for six US bison populations. A non-synonymous single nucleotide polymorphism (T50C), resulting in the predicted amino acid replacement M17T (Met ??? Thr), was identified in each population. To date, no variation (T50: Met) has been detected at the corresponding exon 3 nucleotide and/or amino acid position for domestic cattle. Notably, 80% (20 of 25) of the Yellowstone National Park bison possessing the C/C genotype were Brucella spp. seropositive, representing a significant (P = 0.021) association between seropositivity and the C/C genotypic class. Moreover, significant differences in the distribution of PRNP exon 3 alleles and genotypes were detected between Yellowstone National Park bison and three bison populations that were either founded from seronegative stock or previously subjected to test-and-slaughter management to eradicate brucellosis. Unlike domestic cattle, no indel polymorphisms were detected within the corresponding regions of the putative bison PRNP promoter, intron 1, octapeptide repeat region or 3???-untranslated region for any population examined. This study provides the first evidence of a potential association between nucleotide variation within PRNP exon 3 and the presence of Brucella spp. antibodies in bison, implicating PrPC in the natural resistance of bison to brucellosis infection. ?? 2005 International Society for Animal Genetics.

  6. Prediction of Adulthood Obesity Using Genetic and Childhood Clinical Risk Factors in the Cardiovascular Risk in Young Finns Study.

    PubMed

    Seyednasrollah, Fatemeh; Mäkelä, Johanna; Pitkänen, Niina; Juonala, Markus; Hutri-Kähönen, Nina; Lehtimäki, Terho; Viikari, Jorma; Kelly, Tanika; Li, Changwei; Bazzano, Lydia; Elo, Laura L; Raitakari, Olli T

    2017-06-01

    Obesity is a known risk factor for cardiovascular disease. Early prediction of obesity is essential for prevention. The aim of this study is to assess the use of childhood clinical factors and the genetic risk factors in predicting adulthood obesity using machine learning methods. A total of 2262 participants from the Cardiovascular Risk in YFS (Young Finns Study) were followed up from childhood (age 3-18 years) to adulthood for 31 years. The data were divided into training (n=1625) and validation (n=637) set. The effect of known genetic risk factors (97 single-nucleotide polymorphisms) was investigated as a weighted genetic risk score of all 97 single-nucleotide polymorphisms (WGRS97) or a subset of 19 most significant single-nucleotide polymorphisms (WGRS19) using boosting machine learning technique. WGRS97 and WGRS19 were validated using external data (n=369) from BHS (Bogalusa Heart Study). WGRS19 improved the accuracy of predicting adulthood obesity in training (area under the curve [AUC=0.787 versus AUC=0.744, P <0.0001) and validation data (AUC=0.769 versus AUC=0.747, P =0.026). WGRS97 improved the accuracy in training (AUC=0.782 versus AUC=0.744, P <0.0001) but not in validation data (AUC=0.749 versus AUC=0.747, P =0.785). Higher WGRS19 associated with higher body mass index at 9 years and WGRS97 at 6 years. Replication in BHS confirmed our findings that WGRS19 and WGRS97 are associated with body mass index. WGRS19 improves prediction of adulthood obesity. Predictive accuracy is highest among young children (3-6 years), whereas among older children (9-18 years) the risk can be identified using childhood clinical factors. The model is helpful in screening children with high risk of developing obesity. © 2017 American Heart Association, Inc.

  7. Molecular Characterization of the Lipid Genome-Wide Association Study Signal on Chromosome 18q11.2 Implicates HNF4A-Mediated Regulation of the TMEM241 Gene.

    PubMed

    Rodríguez, Alejandra; Gonzalez, Luis; Ko, Arthur; Alvarez, Marcus; Miao, Zong; Bhagat, Yash; Nikkola, Elina; Cruz-Bautista, Ivette; Arellano-Campos, Olimpia; Muñoz-Hernández, Linda L; Ordóñez-Sánchez, Maria-Luisa; Rodriguez-Guillen, Rosario; Mohlke, Karen L; Laakso, Markku; Tusie-Luna, Teresa; Aguilar-Salinas, Carlos A; Pajukanta, Päivi

    2016-07-01

    We recently identified a locus on chromosome 18q11.2 for high serum triglycerides in Mexicans. We hypothesize that the lead genome-wide association study single-nucleotide polymorphism rs9949617, or its linkage disequilibrium proxies, regulates 1 of the 5 genes in the triglyceride-associated region. We performed a linkage disequilibrium analysis and found 9 additional variants in linkage disequilibrium (r(2)>0.7) with the lead single-nucleotide polymorphism. To select the variants for functional analyses, we annotated the 10 variants using DNase I hypersensitive sites, transcription factor and chromatin states and identified rs17259126 as the lead candidate variant for functional in vitro validation. Using luciferase transcriptional reporter assay in liver HepG2 cells, we found that the G allele exhibits a significantly lower effect on transcription (P<0.05). The electrophoretic mobility shift and ChIPqPCR (chromatin immunoprecipitation coupled with quantitative polymerase chain reaction) assays confirmed that the minor G allele of rs17259126 disrupts an hepatocyte nuclear factor 4 α-binding site. To find the regional candidate gene, we performed a local expression quantitative trait locus analysis and found that rs17259126 and its linkage disequilibrium proxies alter expression of the regional transmembrane protein 241 (TMEM241) gene in 795 adipose RNAs from the Metabolic Syndrome In Men (METSIM) cohort (P=6.11×10(-07)-5.80×10(-04)). These results were replicated in expression profiles of TMEM241 from the Multiple Tissue Human Expression Resource (MuTHER; n=856). The Mexican genome-wide association study signal for high serum triglycerides on chromosome 18q11.2 harbors a regulatory single-nucleotide polymorphism, rs17259126, which disrupts normal hepatocyte nuclear factor 4 α binding and decreases the expression of the regional TMEM241 gene. Our data suggest that decreased transcript levels of TMEM241 contribute to increased triglyceride levels in Mexicans. © 2016 American Heart Association, Inc.

  8. A Single Nucleotide Polymorphism in 3′-Untranslated Region Contributes to the Regulation of Toll-like Receptor 4 Translation*

    PubMed Central

    Sato, Kayo; Yoshimura, Atsutoshi; Kaneko, Takashi; Ukai, Takashi; Ozaki, Yukio; Nakamura, Hirotaka; Li, Xinyue; Matsumura, Hiroyoshi; Hara, Yoshitaka; Ogata, Yorimasa

    2012-01-01

    We have previously shown that a single nucleotide polymorphism rs11536889 in the 3′-untranslated region (UTR) of TLR4 was associated with periodontitis. In this study the effects of this single nucleotide polymorphism on Toll-like receptor (TLR) 4 expression were investigated. Monocytes from subjects with the C/C genotype expressed higher levels of TLR4 on their surfaces than those from subjects with the other genotypes. Peripheral blood mononuclear cells (PBMCs) from the C/C and G/C subjects secreted higher levels of IL-8 in response to lipopolysaccharide (LPS), a TLR4 ligand, than the cells from the G/G subjects. However, there was no significant difference in TLR4 mRNA levels in PBMCs from the subjects with each genotype. After stimulation with tripalmitoylated CSK4 (Pam3CSK4), TLR4 mRNA levels increased in PBMCs from both the C/C and G/G subjects, whereas TLR4 protein levels increased in PBMCs from the C/C but not G/G subjects. Transient transfection of a series of chimeric luciferase constructs revealed that a fragment of 3′-UTR containing rs11536889 G allele, but not C allele, suppressed luciferase activity induced by LPS or IL-6. Two microRNAs, hsa-miR-1236 and hsa-miR-642a, were predicted to bind to rs11536889 G allele. Inhibition of these microRNAs reversed the suppressed luciferase activity. These microRNA inhibitors also up-regulated endogenous TLR4 protein on THP-1 cells (the G/G genotype) after LPS stimulation. Furthermore, mutant microRNAs that bind to the C allele inhibited the luciferase activity of the construct containing the C allele. These results indicate that genetic variation of rs11536889 contributes to translational regulation of TLR4, possibly by binding to microRNAs. PMID:22661708

  9. Calcium Signaling Pathway Genes RUNX2 and CACNA1C Are Associated With Calcific Aortic Valve Disease

    PubMed Central

    Guauque-Olarte, Sandra; Messika-Zeitoun, David; Droit, Arnaud; Lamontagne, Maxime; Tremblay-Marchand, Joël; Lavoie-Charland, Emilie; Gaudreault, Nathalie; Arsenault, Benoit J.; Dubé, Marie-Pierre; Tardif, Jean-Claude; Body, Simon C.; Seidman, Jonathan G.; Boileau, Catherine; Mathieu, Patrick; Pibarot, Philippe; Bossé, Yohan

    2016-01-01

    Background Calcific aortic valve stenosis (AS) is a life-threatening disease with no medical therapy. The genetic architecture of AS remains elusive. This study combines genome-wide association studies, gene expression, and expression quantitative trait loci mapping in human valve tissues to identify susceptibility genes of AS. Methods and Results A meta-analysis was performed combining the results of 2 genome-wide association studies in 474 and 486 cases from Quebec City (Canada) and Paris (France), respectively. Corresponding controls consisted of 2988 and 1864 individuals with European ancestry from the database of genotypes and phenotypes. mRNA expression levels were evaluated in 9 calcified and 8 normal aortic valves by RNA sequencing. The results were integrated with valve expression quantitative trait loci data obtained from 22 AS patients. Twenty-five single-nucleotide polymorphisms had P<5×10−6 in the genome-wide association studies meta-analysis. The calcium signaling pathway was the top gene set enriched for genes mapped to moderately AS-associated single-nucleotide polymorphisms. Genes in this pathway were found differentially expressed in valves with and without AS. Two single-nucleotide polymorphisms located in RUNX2 (runt-related transcription factor 2), encoding an osteogenic transcription factor, demonstrated some association with AS (genome-wide association studies P=5.33×10−5). The mRNA expression levels of RUNX2 were upregulated in calcified valves and associated with eQTL-SNPs. CACNA1C encoding a subunit of a voltage-dependent calcium channel was upregulated in calcified valves. The eQTL-SNP with the most significant association with AS located in CACNA1C was associated with higher expression of the gene. Conclusions This integrative genomic study confirmed the role of RUNX2 as a potential driver of AS and identified a new AS susceptibility gene, CACNA1C, belonging to the calcium signaling pathway. PMID:26553695

  10. The origin of multiple clones in the parthenogenetic lizard species Darevskia rostombekowi.

    PubMed

    Ryskov, Alexey P; Osipov, Fedor A; Omelchenko, Andrey V; Semyenova, Seraphima K; Girnyk, Anastasiya E; Korchagin, Vitaly I; Vergun, Andrey A; Murphy, Robert W

    2017-01-01

    The all-female Caucasian rock lizard Darevskia rostombekowi and other unisexual species of this genus reproduce normally via true parthenogenesis. Typically, diploid parthenogenetic reptiles exhibit some amount of clonal diversity. However, allozyme data from D. rostombekowi have suggested that this species consists of a single clone. Herein, we test this hypothesis by evaluating variation at three variable microsatellite loci for 42 specimens of D. rostombekowi from four populations in Armenia. Analyses based on single nucleotide polymorphisms of each locus reveal five genotypes or presumptive clones in this species. All individuals are heterozygous at the loci. The major clone occurs in 24 individuals and involves three populations. Four rare clones involve one or several individuals from one or two populations. Most variation owes to parent-specific single nucleotide polymorphisms, which occur as heterozygotes. This result fails to reject the hypothesis of a single hybridization founder event that resulted in the initial formation of one major clone. The other clones appear to have originated via post-formation microsatellite mutations of the major clone.

  11. The Relationship Between Gene Polymorphism of Leptin and Leptin Receptor and Growth Hormone Deficiency.

    PubMed

    He, Jinshui; Fang, Yanling; Lin, Xinfu; Zhou, Huowang; Zhu, Shaobo; Zhang, Yugui; Yang, Huicong; Ye, Xiaoling

    2016-02-26

    BACKGROUND Growth hormone deficiency (GHD) is a major cause of congenital short stature. GHD patients have significantly decreased serum leptin levels, which are regulated by gene polymorphism of leptin and leptin receptor. This study thus investigated the relationship between gene polymorphism and susceptibility to GHD. MATERIAL AND METHODS A case-control study was performed using 180 GHD children in addition to 160 healthy controls. After the extraction of whole genomic DNA, the genotypes of leptin and leptin receptor gene loci were analyzed by sequencing for single-nucleotide polymorphism. RESULTS The frequency distribution of all alleles identified in leptin gene (loci rs7799039) and leptin receptor gene (loci rs1137100 and rs1137101) fit Hardy-Weinberg equilibrium. There was a significant difference in allele frequency at loci rs7799039 or rs1137101, as individuals with heterozygous GA allele had lower (rs7799039) or higher (rs1137101) GHD risk. No significant difference in allele frequency was discovered at loci rs1137100 (p>0.05), which was unrelated to GHD susceptibility. CONCLUSIONS Gene polymorphism of leptin (loci rs7799039) and leptin receptor (loci rs1137101) are correlated with GHD susceptibility.

  12. An Exploration of the Serotonin System in Antisocial Boys with High Levels of Callous-Unemotional Traits

    PubMed Central

    Moul, Caroline; Dobson-Stone, Carol; Brennan, John; Hawes, David; Dadds, Mark

    2013-01-01

    Background The serotonin system is thought to play a role in the aetiology of antisocial and aggressive behaviour in both adults and children however previous findings have been inconsistent. Recently, research has suggested that the function of the serotonin system may be specifically altered in a sub-set of antisocial populations – those with psychopathic (callous-unemotional) personality traits. We explored the relationships between callous-unemotional traits and functional polymorphisms of selected serotonin-system genes, and tested the association between callous-unemotional traits and serum serotonin levels independently of antisocial and aggressive behaviour. Method Participants were boys with antisocial behaviour problems aged 3–16 years referred to University of New South Wales Child Behaviour Research Clinics. Participants volunteered either a blood or saliva sample from which levels of serum serotonin (N = 66) and/or serotonin-system single nucleotide polymorphisms (N = 157) were assayed. Results Functional single nucleotide polymorphisms from the serotonin 1b receptor gene (HTR1B) and 2a receptor gene (HTR2A) were found to be associated with callous-unemotional traits. Serum serotonin level was a significant predictor of callous-unemotional traits; levels were significantly lower in boys with high callous-unemotional traits than in boys with low callous-unemotional traits. Conclusion Results provide support to the emerging literature that argues for a genetically-driven system-wide alteration in serotonin function in the aetiology of callous-unemotional traits. The findings should be interpreted as preliminary and future research that aims to replicate and further investigate these results is required. PMID:23457595

  13. Single Nucleotide Polymorphisms in the TP53 Region and Susceptibility to Invasive Epithelial Ovarian Cancer

    PubMed Central

    Schildkraut, Joellen M.; Goode, Ellen L; Clyde, Merlise A.; Iversen, Edwin S.; Moorman, Patricia G.; Berchuck, Andrew; Marks, Jeffrey R.; Lissowska, Jolanta; Brinton, Louise; Peplonska, Beata; Cunningham, Julie M.; Vierkant, Robert A.; Rider, David N.; Chenevix-Trench, Georgia; Webb, Penelope M.; Beesley, Jonathan; Chen, Xiaoqing; Phelan, Catherine; Sutphen, Rebecca; Sellers, Thomas A.; Pearce, Leigh; Wu, Anna H.; Van Den Berg, David; Conti, David; Elund, Christopher K.; Anderson, Rebecca; Goodman, Marc T.; Lurie, Galina; Carney, Michael E.; Thompson, Pamela J.; Gayther, Simon A.; Ramus, Susan J.; Jacobs, Ian; Kjaer, Susanne Krüger; Hogdall, Estrid; Blaakaer, Jan; Hogdall, Claus; Easton, Douglas F.; Song, Honglin; Pharoah, Paul D.P.; Whittemore, Alice S.; McGuire, Valerie; Quaye, Lydia; Anton-Culver, Hoda; Ziogas, Argyrios; Terry, Kathryn L.; Cramer, Daniel W.; Hankinson, Susan E.; Tworoger, Shelley S.; Calingaert, Brian; Chanock, Stephen; Sherman, Mark; Garcia-Closason, Montserrat

    2009-01-01

    The p53 protein is critical for multiple cellular functions including cell growth and DNA repair. We assessed whether polymorphisms in the region encoding TP53 were associated with risk of invasive ovarian cancer. The study population includes a total of 5,206 invasive ovarian cancer cases (2,829 of which were serous) and 8,790 controls from 13 case-control or nested case-control studies participating in the Ovarian Cancer Association Consortium (OCAC). Three of the studies performed independent discovery investigations involving genotyping of up to 23 single nucleotide polymorphisms (SNPs) in the TP53 region. Significant findings from this discovery phase were followed up for replication in the other OCAC studies. Mixed effects logistic regression was used to generate posterior median per allele odds ratios (ORs), 95% probability intervals (PIs) and Bayes factors (BFs) for genotype associations. Five SNPs showed significant associations with risk in one or more of the discovery investigations and were followed up by OCAC. Mixed effects analysis confirmed associations with serous invasive cancers for two correlated (r2 = 0.62) SNPs: rs2287498 (median per allele OR = 1.30; 95% PI = 1.07-1.57) and rs12951053 (median per allele OR = 1.19; 95% PI = 1.01 - 1.38). Analyses of other histological subtypes suggested similar associations with endometrioid but not with mucinous or clear cell cancers. This large study provides statistical evidence for a small increase in risk of ovarian cancer associated with common variants in the TP53 region. PMID:19276375

  14. An exploration of the serotonin system in antisocial boys with high levels of callous-unemotional traits.

    PubMed

    Moul, Caroline; Dobson-Stone, Carol; Brennan, John; Hawes, David; Dadds, Mark

    2013-01-01

    The serotonin system is thought to play a role in the aetiology of antisocial and aggressive behaviour in both adults and children however previous findings have been inconsistent. Recently, research has suggested that the function of the serotonin system may be specifically altered in a sub-set of antisocial populations - those with psychopathic (callous-unemotional) personality traits. We explored the relationships between callous-unemotional traits and functional polymorphisms of selected serotonin-system genes, and tested the association between callous-unemotional traits and serum serotonin levels independently of antisocial and aggressive behaviour. Participants were boys with antisocial behaviour problems aged 3-16 years referred to University of New South Wales Child Behaviour Research Clinics. Participants volunteered either a blood or saliva sample from which levels of serum serotonin (N = 66) and/or serotonin-system single nucleotide polymorphisms (N = 157) were assayed. Functional single nucleotide polymorphisms from the serotonin 1b receptor gene (HTR1B) and 2a receptor gene (HTR2A) were found to be associated with callous-unemotional traits. Serum serotonin level was a significant predictor of callous-unemotional traits; levels were significantly lower in boys with high callous-unemotional traits than in boys with low callous-unemotional traits. Results provide support to the emerging literature that argues for a genetically-driven system-wide alteration in serotonin function in the aetiology of callous-unemotional traits. The findings should be interpreted as preliminary and future research that aims to replicate and further investigate these results is required.

  15. Association of tumour necrosis factor-alpha G/A -238 and G/A -308 single nucleotide polymorphisms with juvenile idiopathic arthritis.

    PubMed

    Maddah, M; Harsini, S; Ziaee, V; Moradinejad, M H; Rezaei, A; Zoghi, S; Sadr, M; Aghighi, Y; Rezaei, N

    2016-12-01

    Juvenile idiopathic arthritis (JIA) is a heterogeneous autoimmune disorder of unknown origin. As proinflammatory cytokines are known to contribute towards the pathogenesis of JIA, this case-control study was performed to examine the associations of certain single nucleotide polymorphisms (SNPs) of tumour necrosis factor-α (TNF-α) gene. Fifty-three patients with JIA participated in this study as patients group and compared with 137 healthy unrelated controls. Genotyping was performed for TNF-α gene at positions -308 and -238, using polymerase chain reaction with sequence-specific primers method. Results of the analysed data revealed a significant positive association for TNF-α gene at positions -308 and -238 for A allele in patients group compared with controls (P < 0.01). At the genotypic level, the frequency of TNF-α gene at positions -308 and -238 for GG genotype was discovered to be higher in the patients with JIA compared to the healthy controls (P < 0.01), while GA genotype at the same positions was observed to be less frequent in the case group than the controls (P < 0.01). At the haplotypic level, a significant positive association for TNF-α GG haplotype (positions -308, -238) together with a notable negative association for TNF-α AG and GA haplotypes at the same positions were detected in the patients group in comparison with the healthy individuals (P < 0.01). Cytokine gene polymorphisms might affect the development of JIA. Particular TNF-α gene variants could render individuals more susceptible to JIA.. © 2016 John Wiley & Sons Ltd.

  16. Financial and Psychological Risk Attitudes Associated with Two Single Nucleotide Polymorphisms in the Nicotine Receptor (CHRNA4) Gene

    PubMed Central

    Roe, Brian E.; Tilley, Michael R.; Gu, Howard H.; Beversdorf, David Q.; Sadee, Wolfgang; Haab, Timothy C.; Papp, Audrey C.

    2009-01-01

    With recent advances in understanding of the neuroscience of risk taking, attention is now turning to genetic factors that may contribute to individual heterogeneity in risk attitudes. In this paper we test for genetic associations with risk attitude measures derived from both the psychology and economics literature. To develop a long-term prospective study, we first evaluate both types of risk attitudes and find that the economic and psychological measures are poorly correlated, suggesting that different genetic factors may underlie human response to risk faced in different behavioral domains. We then examine polymorphisms in a spectrum of candidate genes that affect neurotransmitter systems influencing dopamine regulation or are thought to be associated with risk attitudes or impulsive disorders. Analysis of the genotyping data identified two single nucleotide polymorphisms (SNPs) in the gene encoding the alpha 4 nicotine receptor (CHRNA4, rs4603829 and rs4522666) that are significantly associated with harm avoidance, a risk attitude measurement drawn from the psychology literature. Novelty seeking, another risk attitude measure from the psychology literature, is associated with several COMT (catechol-O-methyl transferase) SNPs while economic risk attitude measures are associated with several VMAT2 (vesicular monoamine transporter) SNPs, but the significance of these associations did not withstand statistical adjustment for multiple testing and requires larger cohorts. These exploratory results provide a starting point for understanding the genetic basis of risk attitudes by considering the range of methods available for measuring risk attitudes and by searching beyond the traditional direct focus on dopamine and serotonin receptor and transporter genes. PMID:19693267

  17. Single nucleotide polymorphism markers for low-dose aspirin-associated peptic ulcer and ulcer bleeding.

    PubMed

    Shiotani, Akiko; Murao, Takahisa; Fujita, Yoshihiko; Fujimura, Yoshinori; Sakakibara, Takashi; Nishio, Kazuto; Haruma, Ken

    2014-12-01

    In our previous study, the SLCO1B1 521TT genotype and the SLCO1B1*1b haplotype were significantly associated with the risk of peptic ulcer in patients taking low-dose aspirin (LDA). The aim of the present study was to investigate pharmacogenomic profile of LDA-induced peptic ulcer and ulcer bleeding. Patients taking 100 mg of enteric-coated aspirin for cardiovascular diseases and with a peptic ulcer or ulcer bleeding and patients who also participated in endoscopic surveillance were studied. Genome-wide analysis of single nucleotide polymorphisms (SNPs) was performed using the Affymetrix DME Plus Premier Pack. SLCO1B1*1b haplotype and candidate genotypes of genes associated with ulcer bleeding or small bowel bleeding identified by genome-wide analysis were determined using TaqMan SNP Genotyping Assay kits, polymerase chain reaction-restriction fragment length polymorphism, and direct sequencing. Of 593 patients enrolled, 111 patients had a peptic ulcer and 45 had ulcer bleeding. The frequencies of the SLCO1B1*1b haplotype and CHST2 2082 T allele were significantly greater in patients with peptic ulcer and ulcer bleeding compared to the controls. After adjustment for significant factors, the SLCO1B1*1b haplotype was associated with peptic ulcer (OR 2.20, 95% CI 1.24-3.89) and CHST2 2082 T allele with ulcer bleeding (2.57, 1.07-6.17). The CHST2 2082 T allele as well as SLCO1B1*1b haplotype may identify patients at increased risk for aspirin-induced peptic ulcer or ulcer bleeding. © 2014 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.

  18. Interaction of TLR-IFN and HLA polymorphisms on susceptibility of chronic HBV infection in Southwest Han Chinese.

    PubMed

    He, Dengming; Tao, Shiqi; Guo, Shimin; Li, Maoshi; Wu, Junqiu; Huang, Hongfei; Guo, Xinwu; Yan, Guohua; Zhu, Peng; Wang, Yuming

    2015-08-01

    The toll-like receptor-interferon (TLR-IFN) signalling pathway plays a crucial role in HBV infection. Human leucocyte antigen (HLA) polymorphisms are associated with chronic HBV infection by genome wide association study (GWAS). We aimed to explore interaction between TLR-IFN and HLA gene polymorphisms in susceptibility of chronic HBV infection. In the Chinese Southwest Han population, 1191 chronic HBV infection patients and 273 HBV clearance were selected. A total of 39 single nucleotide polymorphism loci in 23 genes of the TLR-IFN pathway and four HLA polymorphism loci associated with chronic HBV infection identified by GWAS were selected for genotyping. SNPStats, QVALUE, and multifactor dimensionality reduction were used for statistical analysis. A significant association was seen in several of the TLR-IFN pathway genes, TLR9 rs352140 (OR = 0.70, P = 0.0088), IL1B rs16944 (OR = 0.67, P = 0.016), IL12B rs3212227 (OR = 1.38, P = 0.021), IFNGR1 rs3799488 (OR = 1.48, P = 0.0048), IFNGR2 rs1059293 (OR = 0.27, P = 0.011), MX1 rs467960 (OR = 0.68, P = 0.022), as well as four loci in HLA, rs3077 (OR = 0.55, P < 0.0001), rs2856718 (OR = 0.60, P = 4e-04), rs9277535 (OR = 0.54, P < 0.0001) and rs7453920 (OR = 0.43, P < 0.0001). A synergistic relationship was seen between rs9277535 and rs16944 (0.13%), rs1143623 and rs6613 (0.10%). The combination of rs9277535 in HLA and rs16944 in IL1B was the best model to predict chronic HBV infection (testing accuracy = 0.6040, P = 0.0010, cross-validation consistency = 10/10). TLR-IFN pathway gene polymorphisms are associated with chronic HBV infection. Interactions with polymorphisms in these genes may be one mechanism by which HLA polymorphisms influence susceptibility to chronic HBV infection, as specific single nucleotide polymorphism combinations are highly predictive of chronic HBV infection. © 2014 The Authors. Liver International Published by John Wiley & Sons Ltd.

  19. From Single Nucleotide Polymorphisms to Constant Immunosuppression: Mesenchymal Stem Cell Therapy for Autoimmune Diseases

    PubMed Central

    Galipeau, Jacques; Nooka, Ajay K.

    2013-01-01

    The regenerative abilities and the immunosuppressive properties of mesenchymal stromal cells (MSCs) make them potentially the ideal cellular product of choice for treatment of autoimmune and other immune mediated disorders. Although the usefulness of MSCs for therapeutic applications is in early phases, their potential clinical use remains of great interest. Current clinical evidence of use of MSCs from both autologous and allogeneic sources to treat autoimmune disorders confers conflicting clinical benefit outcomes. These varied results may possibly be due to MSC use across wide range of autoimmune disorders with clinical heterogeneity or due to variability of the cellular product. In the light of recent genome wide association studies (GWAS), linking predisposition of autoimmune diseases to single nucleotide polymorphisms (SNPs) in the susceptible genetic loci, the clinical relevance of MSCs possessing SNPs in the critical effector molecules of immunosuppression is largely undiscussed. It is of further interest in the allogeneic setting, where SNPs in the target pathway of MSC's intervention may also modulate clinical outcome. In the present review, we have discussed the known critical SNPs predisposing to disease susceptibility in various autoimmune diseases and their significance in the immunomodulatory properties of MSCs. PMID:24350294

  20. Single Nucleotide Polymorphism Markers for Genetic Mapping in Drosophila melanogaster

    PubMed Central

    Hoskins, Roger A.; Phan, Alexander C.; Naeemuddin, Mohammed; Mapa, Felipa A.; Ruddy, David A.; Ryan, Jessica J.; Young, Lynn M.; Wells, Trent; Kopczynski, Casey; Ellis, Michael C.

    2001-01-01

    For nearly a century, genetic analysis in Drosophila melanogaster has been a powerful tool for analyzing gene function, yet Drosophila lacks the molecular genetic mapping tools that recently have revolutionized human, mouse, and plant genetics. Here, we describe the systematic characterization of a dense set of molecular markers in Drosophila by using a sequence tagged site-based physical map of the genome. We identify 474 biallelic markers in standard laboratory strains of Drosophila that span the genome. Most of these markers are single nucleotide polymorphisms and sequences for these variants are provided in an accessible format. The average density of the new markers is one per 225 kb on the autosomes and one per megabase on the X chromosome. We include in this survey a set of P-element strains that provide additional use for high-resolution mapping. We show one application of the new markers in a simple set of crosses to map a mutation in the hedgehog gene to an interval of <1 Mb. This new map resource significantly increases the efficiency and resolution of recombination mapping and will be of immediate value to the Drosophila research community. PMID:11381036

  1. Single Nucleotide Polymorphisms in Cellular Drug Transporters Are Associated with Intolerance to Antiretroviral Therapy in Brazilian HIV-1 Positive Individuals.

    PubMed

    Arruda, Mônica Barcellos; Campagnari, Francine; de Almeida, Tailah Bernardo; Couto-Fernandez, José Carlos; Tanuri, Amilcar; Cardoso, Cynthia Chester

    2016-01-01

    Adverse reactions are the main cause of treatment discontinuation among HIV+ individuals. Genes related to drug absorption, distribution, metabolism and excretion (ADME) influence drug bioavailability and treatment response. We have investigated the association between single nucleotide polymorphisms (SNPs) in 29 ADME genes and intolerance to therapy in a case-control study including 764 individuals. Results showed that 15 SNPs were associated with intolerance to nucleoside and 11 to non-nucleoside reverse transcriptase inhibitors (NRTIs and NNRTIs), and 8 to protease inhibitors (PIs) containing regimens under alpha = 0.05. After Bonferroni adjustment, two associations remained statistically significant. SNP rs2712816, at SLCO2B1 was associated to intolerance to NRTIs (ORGA/AA = 2.37; p = 0.0001), while rs4148396, at ABCC2, conferred risk of intolerance to PIs containing regimens (ORCT/TT = 2.64; p = 0.00009). Accordingly, haplotypes carrying rs2712816A and rs4148396T alleles were also associated to risk of intolerance to NRTIs and PIs, respectively. Our data reinforce the role of drug transporters in response to HIV therapy and may contribute to a future development of personalized therapies.

  2. Single-nucleotide polymorphism-gene intermixed networking reveals co-linkers connected to multiple gene expression phenotypes

    PubMed Central

    Gong, Bin-Sheng; Zhang, Qing-Pu; Zhang, Guang-Mei; Zhang, Shao-Jun; Zhang, Wei; Lv, Hong-Chao; Zhang, Fan; Lv, Sa-Li; Li, Chuan-Xing; Rao, Shao-Qi; Li, Xia

    2007-01-01

    Gene expression profiles and single-nucleotide polymorphism (SNP) profiles are modern data for genetic analysis. It is possible to use the two types of information to analyze the relationships among genes by some genetical genomics approaches. In this study, gene expression profiles were used as expression traits. And relationships among the genes, which were co-linked to a common SNP(s), were identified by integrating the two types of information. Further research on the co-expressions among the co-linked genes was carried out after the gene-SNP relationships were established using the Haseman-Elston sib-pair regression. The results showed that the co-expressions among the co-linked genes were significantly higher if the number of connections between the genes and a SNP(s) was more than six. Then, the genes were interconnected via one or more SNP co-linkers to construct a gene-SNP intermixed network. The genes sharing more SNPs tended to have a stronger correlation. Finally, a gene-gene network was constructed with their intensities of relationships (the number of SNP co-linkers shared) as the weights for the edges. PMID:18466544

  3. Single nucleotide polymorphism markers for genetic mapping in Drosophila melanogaster

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hoskins, Roger A.; Phan, Alexander C.; Naeemuddin, Mohammed

    2001-04-16

    For nearly a century, genetic analysis in Drosophila melanogaster has been a powerful tool for analyzing gene function, yet Drosophila lacks the molecular genetic mapping tools that have recently revolutionized human, mouse and plant genetics. Here, we describe the systematic characterization of a dense set of molecular markers in Drosophila using an STS-based physical map of the genome. We identify 474 biallelic markers in standard laboratory strains of Drosophila that the genome. The majority of these markers are single nucleotide polymorphisms (SNPs) and sequences for these variants are provided in an accessible format. The average density of the new markersmore » is 1 marker per 225 kb on the autosomes and 1 marker per 1 Mb on the X chromosome. We include in this survey a set of P-element strains that provide additional utility for high-resolution mapping. We demonstrate one application of the new markers in a simple set of crosses to map a mutation in the hedgehog gene to an interval of <1 Mb. This new map resource significantly increases the efficiency and resolution of recombination mapping and will be of immediate value to the Drosophila research community.« less

  4. Apolipoprotein E genotyping by multiplex tetra-primer amplification refractory mutation system PCR in single reaction tube.

    PubMed

    Yang, Young Geun; Kim, Jong Yeol; Park, Su Jeong; Kim, Suhng Wook; Jeon, Ok-Hee; Kim, Doo-Sik

    2007-08-31

    Apolipoprotein E (APOE) plays a critical role in lipoprotein metabolism by binding to both low-density lipoprotein and APOE receptors. The APOE gene has three allelic forms, epsilon2, epsilon3, and epsilon4, which encode different isoforms of the APOE protein. In this study, we have developed a new genotyping method for APOE. Our multiplex tetra-primer amplification refractory mutation system (multiplex T-ARMS) polymerase chain reaction (PCR) was performed in a single reaction tube with six primers consisting of two common primers and two specific primers for each of two single nucleotide polymorphism (SNP) sites. We obtained definitive electropherograms that showed three (epsilon2/epsilon2, epsilon3/epsilon3, and epsilon4/epsilon4), four (epsilon2/epsilon3 and epsilon3/epsilon4), and five (epsilon2/epsilon4) amplicons by multiplex T-ARMS PCR in a single reaction tube. Multiplex T-ARMS PCR for APOE genotyping is a simple and accurate method that requires only a single PCR reaction, without any another treatments or expensive instrumentation, to simultaneously identify two sites of single nucleotide polymorphisms.

  5. CLU rs9331888 Polymorphism Contributes to Alzheimer's Disease Susceptibility in Caucasian But Not East Asian Populations.

    PubMed

    Zhang, Shuyan; Li, Xuling; Ma, Guoda; Jiang, Yongshuai; Liao, Mingzhi; Feng, Rennan; Zhang, Liangcai; Liu, Jiafeng; Wang, Guangyu; Zhao, Bin; Jiang, Qinghua; Li, Keshen; Liu, Guiyou

    2016-04-01

    Large-scale genome-wide association studies (GWAS) identified three single nucleotide polymorphisms rs11136000, rs2279590, and rs9331888 in CLU gene to be significantly associated with Alzheimer's disease (AD) in Caucasian ancestry. Both rs11136000 and rs2279590 variants were successfully replicated in Asian population. However, previous studies reported either a weak association or no association between rs9331888 polymorphism and AD in Asian population. Here, we searched the PubMed, AlzGene, and Google Scholar databases. We selected 12 independent studies that evaluated the association between the rs9331888 polymorphism and AD using a case-control design. Using an additive model, we did not identify significant heterogeneity among these 12 studies. We observed significant association between rs9331888 polymorphism and AD in pooled populations (P = 2.26E - 07, odds ratio (OR) = 1.10, 95% confidence interval (CI) 1.06-1.14). In subgroup analysis, we did not identify significant heterogeneity in both Asian and Caucasian populations. We identified significant association in Caucasian population (P = 1.67E - 08, OR = 1.13, 95% CI 1.08-1.18) but not in East Asian population (P = 0.49, OR = 1.02, 95% CI 0.96-1.10).

  6. rs11613352 polymorphism (TT genotype) associates with a decrease of triglycerides and an increase of HDL in familial hypercholesterolemia patients.

    PubMed

    Aledo, Rosa; Padró, Teresa; Mata, Pedro; Alonso, Rodrigo; Badimon, Lina

    2015-04-01

    Recent genome-wide association studies have identified a locus on chromosome 12q13.3 associated with plasma levels of triglyceride and high-density lipoprotein cholesterol, with rs11613352 being the lead single nucleotide polymorphism in this genome-wide association study locus. The aim of the study is to investigate the involvement of rs11613352 in a population with high cardiovascular risk due to familial hypercholesterolemia. The single nucleotide polymorphism was genotyped by Taqman(®) assay in a cohort of 601 unrelated familial hypercholesterolemia patients and its association with plasma triglyceride and high-density lipoprotein cholesterol levels was analyzed by multivariate methods based on linear regression. Minimal allele frequency was 0.17 and genotype frequencies were 0.69, 0.27, and 0.04 for CC, CT, and TT genotypes, respectively. The polymorphism is associated in a recessive manner (TT genotype) with a decrease in triglyceride levels (P=.002) and with an increase in high-density lipoprotein cholesterol levels (P=.021) after adjusting by age and sex. The polymorphism rs11613352 may contribute to modulate the cardiovascular risk by modifying plasma lipid levels in familial hypercholesterolemia patients. Copyright © 2014 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All rights reserved.

  7. Association between RTEL1 gene polymorphisms and COPD susceptibility in a Chinese Han population.

    PubMed

    Ding, Yipeng; Xu, Heping; Yao, Jinjian; Xu, Dongchuan; He, Ping; Yi, Shengyang; Li, Quanni; Liu, Yuanshui; Wu, Cibing; Tian, Zhongjie

    2017-01-01

    We investigated the association between single-nucleotide polymorphisms in regulation of telomere elongation helicase 1 ( RTEL1 ), which has been associated with telomere length in several brain cancers and age-related diseases, and the risk of chronic obstructive pulmonary disease (COPD) in a Chinese Han population. In a case-control study that included 279 COPD cases and 290 healthy controls, five single-nucleotide polymorphisms in RTEL1 were selected and genotyped using the Sequenom MassARRAY platform. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated using unconditional logistic regression after adjusting for age and gender. In the genotype model analysis, we determined that rs4809324 polymorphism had a decreased effect on the risk of COPD (CC versus TT: OR =0.28; 95% CI =0.10-0.82; P =0.02). In the genetic model analysis, we found that the "C/C" genotype of rs4809324 was associated with a decreased risk of COPD based on the codominant model (OR =0.33; 95% CI =0.13-0.86; P =0.022) and recessive model (OR =0.32; 95% CI =0.12-0.80; P =0.009). Our data shed new light on the association between genetic polymorphisms of RTEL1 and COPD susceptibility in the Chinese Han population.

  8. Polymorphisms in the oxytocin receptor gene are associated with the development of psychopathy.

    PubMed

    Dadds, Mark R; Moul, Caroline; Cauchi, Avril; Dobson-Stone, Carol; Hawes, David J; Brennan, John; Urwin, Ruth; Ebstein, Richard E

    2014-02-01

    The co-occurrence of child conduct problems (CPs) and callous-unemotional (CU) traits confers risk for psychopathy. The oxytocin (OXT) system is a likely candidate for involvement in the development of psychopathy. We tested variations in the OXT receptor gene (OXTR) in CP children and adolescents with varying levels of CU traits. Two samples of Caucasian children, aged 4-16 years, who met DSM criteria for disruptive behavior problems and had no features of autism spectrum disorder, were stratified into low versus high CU traits. Measures were the frequencies of nine candidate OXTR polymorphisms (single nucleotide polymorphisms). In Sample 1, high CU traits were associated with single nucleotide polymorphism rs1042778 in the 3' untranslated region of OXTR and the CGCT haplotype of rs2268490, rs2254298, rs237889, and rs13316193. The association of rs1042778 was replicated in the second rural sample and held across gender and child versus adolescent age groups. We conclude that polymorphic variation of the OXTR characterizes children with high levels of CU traits and CPs. The results are consistent with a hypothesized role of OXT in the developmental antecedents of psychopathy, particularly the differential amygdala activation model of psychopathic traits, and add genetic evidence that high CU traits specify a distinct subgroup within CP children.

  9. Polymorphisms in TS, MTHFR and ERCC1 genes as predictive markers in first-line platinum and pemetrexed therapy in NSCLC patients.

    PubMed

    Krawczyk, Paweł; Kucharczyk, Tomasz; Kowalski, Dariusz M; Powrózek, Tomasz; Ramlau, Rodryg; Kalinka-Warzocha, Ewa; Winiarczyk, Kinga; Knetki-Wróblewska, Magdalena; Wojas-Krawczyk, Kamila; Kałakucka, Katarzyna; Dyszkiewicz, Wojciech; Krzakowski, Maciej; Milanowski, Janusz

    2014-12-01

    We presented retrospective analysis of up to five polymorphisms in TS, MTHFR and ERCC1 genes as molecular predictive markers for homogeneous Caucasian, non-squamous NSCLC patients treated with pemetrexed and platinum front-line chemotherapy. The following polymorphisms in DNA isolated from 115 patients were analyzed: various number of 28-bp tandem repeats in 5'-UTR region of TS gene, single nucleotide polymorphism (SNP) within the second tandem repeat of TS gene (G>C); 6-bp deletion in 3'-UTR region of the TS (1494del6); 677C>T SNP in MTHFR; 19007C>T SNP in ERCC1. Molecular examinations' results were correlated with disease control rate, progression-free survival (PFS) and overall survival. Polymorphic tandem repeat sequence (2R, 3R) in the enhancer region of TS gene and G>C SNP within the second repeat of 3R allele seem to be important for the effectiveness of platinum and pemetrexed in first-line chemotherapy. The insignificant shortening of PFS in 3R/3R homozygotes as compared to 2R/2R and 2R/3R genotypes were observed, while it was significantly shorter in patients carrying synchronous 3R allele and G nucleotide. The combined analysis of TS VNTR and MTHFR 677C>T SNP revealed shortening of PFS in synchronous carriers of 3R allele in TS and two C alleles in MTHFR. The strongest factors increased the risk of progression were poor PS, weight loss, anemia and synchronous presence of 3R allele and G nucleotide in the second repeat of 3R allele in TS. Moreover, lack of application of second-line chemotherapy, weight loss and poor performance status and above-mentioned genotype of TS gene increased risk of early mortality. The examined polymorphisms should be accounted as molecular predictor factors for pemetrexed- and platinum-based front-line chemotherapy in non-squamous NSCLC patients.

  10. Single Nucleotide Polymorphism in ATM Gene, Cooking Oil Fumes and Lung Adenocarcinoma Susceptibility in Chinese Female Non-Smokers: A Case-Control Study

    PubMed Central

    Shen, Li; Yin, Zhihua; Wu, Wei; Ren, Yangwu; Li, Xuelian; Zhou, Baosen

    2014-01-01

    Background The ataxia-telangiectasia mutated (ATM) gene plays an important role in the DNA double-strand breaks repair pathway. Single nucleotide polymorphisms (SNPs) of DNA repair genes are suspected to influence the risk of lung cancer. This study aimed to investigate the association between the ATM -111G>A (rs189037) polymorphism, environmental risk factors and the risk of lung adenocarcinoma in Chinese female non-smokers. Methods A hospital-based case-control study of 487 lung cancer patients and 516 matched cancer-free controls was conducted. Information concerning demographic and environmental risk factors was obtained for each case and control by a trained interviewer. After informed consent was obtained, 10 ml venous blood was collected from each subject for biomarker testing. Single nucleotide polymorphism was determined by using TaqMan method. Results This study showed that the individuals with ATM rs189037 AA genotype were at an increased risk for lung adenocarcinoma compared with those carrying the GA or GG genotype (adjusted odds ratios (OR) 1.44, 95% confidence interval (CI) 1.02–2.02, P = 0.039). The stratified analysis suggested that increased risk associated with ATM rs189037 AA genotype in individuals who never or seldom were exposed to cooking oil fumes (adjusted OR 1.89, 95%CI 1.03–3.49, P = 0.040). Conclusions ATM rs189037 might be associated with the risk of lung adenocarcinoma in Chinese non-smoking females. Furthermore, ATM rs189037 AA genotype might be a risk factor of lung adenocarcinoma among female non-smokers without cooking oil fume exposure. PMID:24819391

  11. Genome-Wide Association Study Identifies Risk Variants for Lichen Planus in Patients With Hepatitis C Virus Infection.

    PubMed

    Nagao, Yumiko; Nishida, Nao; Toyo-Oka, Licht; Kawaguchi, Atsushi; Amoroso, Antonio; Carrozzo, Marco; Sata, Michio; Mizokami, Masashi; Tokunaga, Katsushi; Tanaka, Yasuhito

    2017-06-01

    There is a close relationship between hepatitis C virus (HCV) infection and lichen planus, a chronic inflammatory mucocutaneous disease. We performed a genome-wide association study (GWAS) to identify genetic variants associated with HCV-related lichen planus. We conducted a GWAS of 261 patients with HCV infection treated at a tertiary medical center in Japan from October 2007 through January 2013; a total of 71 had lichen planus and 190 had normal oral mucosa. We validated our findings in a GWAS of 38 patients with HCV-associated lichen planus and 7 HCV-infected patients with normal oral mucosa treated at a medical center in Italy. Single-nucleotide polymorphisms in NRP2 (rs884000) and IGFBP4 (rs538399) were associated with risk of HCV-associated lichen planus (P < 1 × 10 -4 ). We also found an association between a single-nucleotide polymorphism in the HLA-DR/DQ genes (rs9461799) and susceptibility to HCV-associated lichen planus. The odds ratios for the minor alleles of rs884000, rs538399, and rs9461799 were 3.25 (95% confidence interval, 1.95-5.41), 0.40 (95% confidence interval, 0.25-0.63), and 2.15 (95% confidence interval, 1.41-3.28), respectively. In a GWAS of Japanese patients with HCV infection, we replicated associations between previously reported polymorphisms in HLA class II genes and risk for lichen planus. We also identified single-nucleotide polymorphisms in NRP2 and IGFBP4 loci that increase and reduce risk of lichen planus, respectively. These genetic variants might be used to identify patients with HCV infection who are at risk for lichen planus. Copyright © 2017 AGA Institute. Published by Elsevier Inc. All rights reserved.

  12. Single-Nucleotide Polymorphisms Associated with Skin Naphthyl–Keratin Adduct Levels in Workers Exposed to Naphthalene

    PubMed Central

    Jiang, Rong; French, John E.; Stober, Vandy P.; Kang-Sickel, Juei-Chuan C.; Zou, Fei

    2012-01-01

    Background: Individual genetic variation that results in differences in systemic response to xenobiotic exposure is not accounted for as a predictor of outcome in current exposure assessment models. Objective: We developed a strategy to investigate individual differences in single-nucleotide polymorphisms (SNPs) as genetic markers associated with naphthyl–keratin adduct (NKA) levels measured in the skin of workers exposed to naphthalene. Methods: The SNP-association analysis was conducted in PLINK using candidate-gene analysis and genome-wide analysis. We identified significant SNP–NKA associations and investigated the potential impact of these SNPs along with personal and workplace factors on NKA levels using a multiple linear regression model and the Pratt index. Results: In candidate-gene analysis, a SNP (rs4852279) located near the CYP26B1 gene contributed to the 2-naphthyl–keratin adduct (2NKA) level. In the multiple linear regression model, the SNP rs4852279, dermal exposure, exposure time, task replacing foam, age, and ethnicity all were significant predictors of 2NKA level. In genome-wide analysis, no single SNP reached genome-wide significance for NKA levels (all p ≥ 1.05 × 10–5). Pathway and network analyses of SNPs associated with NKA levels were predicted to be involved in the regulation of cellular processes and homeostasis. Conclusions: These results provide evidence that a quantitative biomarker can be used as an intermediate phenotype when investigating the association between genetic markers and exposure–dose relationship in a small, well-characterized exposed worker population. PMID:22391508

  13. Influence of CYP3A5 and ABCB1 gene polymorphisms and other factors on tacrolimus dosing in Caucasian liver and kidney transplant patients.

    PubMed

    Provenzani, Alessio; Notarbartolo, Monica; Labbozzetta, Manuela; Poma, Paola; Vizzini, Giovanni; Salis, Paola; Caccamo, Chiara; Bertani, Tullio; Palazzo, Ugo; Polidori, Piera; Gridelli, Bruno; D'Alessandro, Natale

    2011-12-01

    Tacrolimus is a substrate of cytochrome P4503A (CYP3A) enzymes as well as of the drug transporter ABCB1. We have investigated the possible influence of CYP3A5 and ABCB1 single nucleotide polymorphisms (SNPs) and other factors (e.g. albumin, hematocrit and steroids) on tacrolimus blood levels achieved in a population of Caucasian liver (n=51) and kidney (n=50) transplant recipients. At 1, 3 and 6 months after transplantation, tacrolimus doses (mg/kg/day) and trough blood levels (C0) were recorded and the weight-adjusted tacrolimus dosage (mg/kg/day) was calculated. Polymerase chain reaction followed by restriction fragment length polymorphism analysis was used for genotyping CYP3A5*1 and *3 [6986A>G] as well as ABCB1 at exons 21 [2677G>T/A] and 26 [3435C>T] in both liver transplant donors and recipients and in kidney transplant recipients. Of the 152 subjects studied, 84.9% showed a CYP3A5*3/*3 genotype. The total frequency of the allelic variant *3 was 93%. For the G2677T/A and C3435T polymorphisms the total frequencies of the allelic variants T/A and T were 44.7 and 46.7%, respectively. At 1, 3 and 6 months after transplantation the dose-adjusted C0 levels were significantly lower in patients with one copy of the *1 allele compared to those homozygous for the *3 allele. In the case of liver transplant patients the tacrolimus dose requirements were dominantly influenced by the polymorphisms of the CYP3A5 gene in the donors. With regard to the ABCB1 SNPs, in general they did not show any appreciable influence on tacrolimus dosing requirements; however, kidney transplant recipients carrying the 2677T/A allele required significantly higher daily tacrolimus doses than subjects homozygous for the wild-type allele. Identification of CYP3A5 single nucleotide polymorphisms prior to transplantation could contribute to evaluate the appropriate initial dosage of tacrolimus in the patients.

  14. Regionally clustered ABCC8 polymorphisms in a prospective cohort predict cerebral oedema and outcome in severe traumatic brain injury.

    PubMed

    Jha, Ruchira Menka; Koleck, Theresa A; Puccio, Ava M; Okonkwo, David O; Park, Seo-Young; Zusman, Benjamin E; Clark, Robert S B; Shutter, Lori A; Wallisch, Jessica S; Empey, Philip E; Kochanek, Patrick M; Conley, Yvette P

    2018-04-19

    ABCC8 encodes sulfonylurea receptor 1, a key regulatory protein of cerebral oedema in many neurological disorders including traumatic brain injury (TBI). Sulfonylurea-receptor-1 inhibition has been promising in ameliorating cerebral oedema in clinical trials. We evaluated whether ABCC8 tag single-nucleotide polymorphisms predicted oedema and outcome in TBI. DNA was extracted from 485 prospectively enrolled patients with severe TBI. 410 were analysed after quality control. ABCC8 tag single-nucleotide polymorphisms (SNPs) were identified (Hapmap, r 2 >0.8, minor-allele frequency >0.20) and sequenced (iPlex-Gold, MassArray). Outcomes included radiographic oedema, intracranial pressure (ICP) and 3-month Glasgow Outcome Scale (GOS) score. Proxy SNPs, spatial modelling, amino acid topology and functional predictions were determined using established software programs. Wild-type rs7105832 and rs2237982 alleles and genotypes were associated with lower average ICP (β=-2.91, p=0.001; β=-2.28, p=0.003) and decreased radiographic oedema (OR 0.42, p=0.012; OR 0.52, p=0.017). Wild-type rs2237982 also increased favourable 3-month GOS (OR 2.45, p=0.006); this was partially mediated by oedema (p=0.03). Different polymorphisms predicted 3-month outcome: variant rs11024286 increased (OR 1.84, p=0.006) and wild-type rs4148622 decreased (OR 0.40, p=0.01) the odds of favourable outcome. Significant tag and concordant proxy SNPs regionally span introns/exons 2-15 of the 39-exon gene. This study identifies four ABCC8 tag SNPs associated with cerebral oedema and/or outcome in TBI, tagging a region including 33 polymorphisms. In polymorphisms predictive of oedema, variant alleles/genotypes confer increased risk. Different variant polymorphisms were associated with favourable outcome, potentially suggesting distinct mechanisms. Significant polymorphisms spatially clustered flanking exons encoding the sulfonylurea receptor site and transmembrane domain 0/loop 0 (juxtaposing the channel pore/binding site). This, if validated, may help build a foundation for developing future strategies that may guide individualised care, treatment response, prognosis and patient selection for clinical trials. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  15. Association of the Serotonin Receptor 3E Gene as a Functional Variant in the MicroRNA-510 Target Site with Diarrhea Predominant Irritable Bowel Syndrome in Chinese Women

    PubMed Central

    Zhang, Yu; Li, Yaoyao; Hao, Zhenfeng; Li, Xiangming; Bo, Ping; Gong, Weijuan

    2016-01-01

    Background/Aims The functional variant (rs56109847) in the 3′-untranslated regions (3′-UTR) of the serotonin receptor 3E (HTR3E) gene is associated with female diarrhea predominant irritable bowel syndrome (IBS-D) in British populations. However, the relationship of the polymorphism both to HTR3E expression in the intestine and to the occurrence of Chinese functional gastrointestinal disorders has yet to be examined. Methods Polymerase chain reaction amplification and restriction fragment length polymorphism analyses were employed to detect polymorphisms among Chinese Han women, particularly 107 patients with IBS-D, 99 patients with functional dyspepsia (FD), 115 patients with mixed IBS and 69 patients with IBS-D + FD. We also assessed microRNA-510 (miR-510) and HTR3E expression in human colonic mucosal tissues with immunohistochemistry and other methods. Dual-luciferase reporter assays were conducted to examine the binding ability of miR-510 and HTR3E 3′-UTR. Results Genotyping data showed the variant rs56109847 was significantly associated with IBS-D, but not with FD, mixed-IBS, or FD + IBS-D. HTR3E was abundantly expressed around the colonic mucosal glands but less expressed in the stroma. miR-510 expression decreased, whereas HTR3E expression increased in the colonic mucosal tissue of patients with IBS-D compared with those in controls. HTR3E expression was significantly higher in patients with the GA genotype than that in patients with the GG genotype. The single-nucleotide polymorphisms disrupted the binding site of miR-510 and significantly upregulated luciferase expression in HEK293 and HT-29 cells. Conclusions The single-nucleotide polymorphisms rs56109847 led to reduced microRNA binding and overexpression of the target gene in intestinal cells, thereby increasing IBS-D risk in the Chinese Han population. The decreased expression of miR-510 might contribute to IBS-D. PMID:26787495

  16. Single nucleotide polymorphism (SNP) discovery in rainbow trout using restriction site associated DNA (RAD) sequencing of doubled haploids and assessment of polymorphism in a population survey

    USDA-ARS?s Scientific Manuscript database

    Background: Our goal is to produce a high-throughput SNP genotyping platform for genomic analyses in rainbow trout that will enable fine mapping of QTL, whole genome association studies, genomic selection for improved aquaculture production traits, and genetic analyses of wild populations that aid ...

  17. Identification of one polymorphism from the PAPP-A2 gene associated to fertility in Romosinuano beef heifers raised under a subtropical environment

    USDA-ARS?s Scientific Manuscript database

    The objective of this study was to identify single nucleotide polymorphisms (SNP) associated to fertility in female cows raised under a subtropical environment. Re-sequencing of 9 genes associated to GH-IGF endocrine pathway located in bovine chromosome 5, identified 75 SNP useful for associative ge...

  18. Protective Role of BST2 Polymorphisms in Mother-to-Child Transmission of HIV-1 and Adult AIDS Progression.

    PubMed

    Kamada, Anselmo J; Bianco, Anna M; Zupin, Luisa; Girardelli, Martina; Matte, Maria C C; Medeiros, Rúbia Marília de; Almeida, Sabrina Esteves de Matos; Rocha, Marineide M; Segat, Ludovica; Chies, José A B; Kuhn, Louise; Crovella, Sergio

    2016-07-01

    Bone marrow stromal cell antigen-2 (BST-2)/Tetherin is a restriction factor that prevents Human immunodeficiency virus type 1 (HIV-1) release from infected cells and mediates pro-inflammatory cytokine production. This study investigated the risk conferred by single nucleotide polymorphisms (rs919266, rs9192677, and rs9576) at BST-2 coding gene (BST2) in HIV-1 mother-to-child transmission and in disease progression. Initially, 101 HIV-1+ pregnant women and 331 neonates exposed to HIV-1 from Zambia were enrolled. Additional BST2 single nucleotide polymorphism analyses were performed in 2 cohorts with acquired immunodeficiency syndrome (AIDS) progression: an adult Brazilian cohort (37 rapid, 30 chronic and 21 long-term non-progressors) and an Italian pediatric cohort (21 rapid and 67 slow progressors). The rs9576A allele was nominally associated with protection during breastfeeding (P = 0.019) and individuals carrying rs919266 GA showed slower progression to AIDS (P = 0.033). Despite the influence of rs919266 and rs9576 on BST2 expression being still undetermined, a preventive role by BST2 polymorphisms was found during HIV-1 infection.

  19. Detection of the Single Nucleotide Polymorphism at Position rs2735940 in the Human Telomerase Reverse Transcriptase Gene by the Introduction of a New Restriction Enzyme Site for the PCR-RFLP Assay.

    PubMed

    Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei

    2017-09-01

    It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.

  20. Gene-Based Single Nucleotide Polymorphism Markers for Genetic and Association Mapping in Common Bean

    PubMed Central

    2012-01-01

    Background In common bean, expressed sequence tags (ESTs) are an underestimated source of gene-based markers such as insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). However, due to the nature of these conserved sequences, detection of markers is difficult and portrays low levels of polymorphism. Therefore, development of intron-spanning EST-SNP markers can be a valuable resource for genetic experiments such as genetic mapping and association studies. Results In this study, a total of 313 new gene-based markers were developed at target genes. Intronic variation was deeply explored in order to capture more polymorphism. Introns were putatively identified after comparing the common bean ESTs with the soybean genome, and the primers were designed over intron-flanking regions. The intronic regions were evaluated for parental polymorphisms using the single strand conformational polymorphism (SSCP) technique and Sequenom MassARRAY system. A total of 53 new marker loci were placed on an integrated molecular map in the DOR364 × G19833 recombinant inbred line (RIL) population. The new linkage map was used to build a consensus map, merging the linkage maps of the BAT93 × JALO EEP558 and DOR364 × BAT477 populations. A total of 1,060 markers were mapped, with a total map length of 2,041 cM across 11 linkage groups. As a second application of the generated resource, a diversity panel with 93 genotypes was evaluated with 173 SNP markers using the MassARRAY-platform and KASPar technology. These results were coupled with previous SSR evaluations and drought tolerance assays carried out on the same individuals. This agglomerative dataset was examined, in order to discover marker-trait associations, using general linear model (GLM) and mixed linear model (MLM). Some significant associations with yield components were identified, and were consistent with previous findings. Conclusions In short, this study illustrates the power of intron-based markers for linkage and association mapping in common bean. The utility of these markers is discussed in relation with the usefulness of microsatellites, the molecular markers by excellence in this crop. PMID:22734675

  1. Essentials of Conservation Biotechnology: A mini review

    NASA Astrophysics Data System (ADS)

    Merlyn Keziah, S.; Subathra Devi, C.

    2017-11-01

    Equilibrium of biodiversity is essential for the maintenance of the ecosystem as they are interdependent on each other. The decline in biodiversity is a global problem and an inevitable threat to the mankind. Major threats include unsustainable exploitation, habitat destruction, fragmentation, transformation, genetic pollution, invasive exotic species and degradation. This review covers the management strategies of biotechnology which include sin situ, ex situ conservation, computerized taxonomic analysis through construction of phylogenetic trees, calculating genetic distance, prioritizing the group for conservation, digital preservation of biodiversities within the coding and decoding keys, molecular approaches to asses biodiversity like polymerase chain reaction, real time, randomly amplified polymorphic DNA, restriction fragment length polymorphism, amplified fragment length polymorphism, single sequence repeats, DNA finger printing, single nucleotide polymorphism, cryopreservation and vitrification.

  2. Detecting and Removing Ascertainment Bias in Microsatellites from the HGDP-CEPH Panel

    PubMed Central

    Eriksson, Anders; Manica, Andrea

    2011-01-01

    Although ascertainment bias in single nucleotide polymorphisms is a well-known problem, it is generally accepted that microsatellites have mutation rates too high for bias to be a concern. Here, we analyze in detail the large set of microsatellites typed for the Human Genetic Diversity Panel (HGDP)-CEPH panel. We develop a novel framework based on rarefaction to compare heterozygosity across markers with different mutation rates. We find that, whereas di- and tri-nucleotides show similar patterns of within- and between-population heterozygosity, tetra-nucleotides are inconsistent with the other two motifs. In addition, di- and tri-nucleotides are consistent with 16 unbiased tetra-nucleotide markers, whereas the HPGP-CEPH tetra-nucleotides are significantly different. This discrepancy is due to the HGDP-CEPH tetra-nucleotides being too homogeneous across Eurasia, even after their slower mutation rate is taken into account by rarefying the other markers. The most likely explanation for this pattern is ascertainment bias. We strongly advocate the exclusion of tetra-nucleotides from future population genetics analysis of this dataset, and we argue that other microsatellite datasets should be investigated for the presence of bias using the approach outlined in this article. PMID:22384358

  3. Mismatch repair gene MSH3 polymorphism is associated with the risk of sporadic prostate cancer.

    PubMed

    Hirata, Hiroshi; Hinoda, Yuji; Kawamoto, Ken; Kikuno, Nobuyuki; Suehiro, Yutaka; Okayama, Naoko; Tanaka, Yuichiro; Dahiya, Rajvir

    2008-05-01

    The mismatch repair system is a DNA repair mechanism that corrects mispaired bases during DNA replication errors. Cancer cells deficient in MMR proteins have a 10(2) to 10(3)-fold increase in the mutation rate. Single nucleotide polymorphisms of mismatch repair genes have been shown to cause a decrease in DNA repair activity. We hypothesized that mismatch repair gene polymorphism could be a risk factor for prostate cancer and p53 Pro/Pro genotype carriers could influence MSH3 and MSH6 polymorphisms. DNA samples from 110 patients with prostate cancer and 110 healthy controls were analyzed by single strand conformational polymorphism and polymerase chain reaction-restriction fragment length polymorphism to determine the genotypic frequency of 5 polymorphic loci on 2 MMR genes (MSH3 and MSH6) and p53 codon72. The chi-square test was applied to compare genotype frequency between patients and controls. A significant increase in the G/A+A/A genotype of MSH3 Pro222Pro was observed in patients compared to controls (OR 1.87, 95% CI 1.0-3.5). The frequency of A/G + G/G genotypes of MSH3 exon23 Thr1036Ala also tended to increase in patients (OR 1.57, 95% CI 0.92-2.72). In p53 codon72 Arg/Pro + Pro/Pro carriers the frequency of the AG + GG genotype of MSH3 exon23 was significantly increased in patients compared to controls (OR 2.1, 95% CI 1.05-4.34). To our knowledge this is the first report of the association of MSH3 gene polymorphisms in prostate cancer. These results suggest that the MSH3 polymorphism may be a risk factor for prostate cancer.

  4. Genomic Epidemiology of Salmonella enterica Serotype Enteritidis based on Population Structure of Prevalent Lineages

    PubMed Central

    Desai, Prerak T.; den Bakker, Henk C.; Mikoleit, Matthew; Tolar, Beth; Trees, Eija; Hendriksen, Rene S.; Frye, Jonathan G.; Porwollik, Steffen; Weimer, Bart C.; Wiedmann, Martin; Weinstock, George M.; Fields, Patricia I.; McClelland, Michael

    2014-01-01

    Salmonella enterica serotype Enteritidis is one of the most commonly reported causes of human salmonellosis. Its low genetic diversity, measured by fingerprinting methods, has made subtyping a challenge. We used whole-genome sequencing to characterize 125 S. enterica Enteritidis and 3 S. enterica serotype Nitra strains. Single-nucleotide polymorphisms were filtered to identify 4,887 reliable loci that distinguished all isolates from each other. Our whole-genome single-nucleotide polymorphism typing approach was robust for S. enterica Enteritidis subtyping with combined data for different strains from 2 different sequencing platforms. Five major genetic lineages were recognized, which revealed possible patterns of geographic and epidemiologic distribution. Analyses on the population dynamics and evolutionary history estimated that major lineages emerged during the 17th–18th centuries and diversified during the 1920s and 1950s. PMID:25147968

  5. Group B Streptococcus Infections Caused by Improper Sourcing and Handling of Fish for Raw Consumption, Singapore, 2015-2016.

    PubMed

    Chau, Man L; Chen, Swaine L; Yap, Min; Hartantyo, Sri H P; Chiew, Paul K T; Fernandez, Charlene J; Wong, Wai K; Fong, Rockey K; Tan, Wei L; Tan, Brian Z Y; Ng, Youming; Aung, Kyaw T; Mehershahi, Kurosh S; Goh, Christopher; Kang, Joanne S L; Barkham, Timothy; Leong, Adeline O K; Gutiérrez, Ramona A; Ng, Lee C

    2017-12-01

    We assessed microbial safety and quality of raw fish sold in Singapore during 2015-2016 to complement epidemiologic findings for an outbreak of infection with group B Streptococcus serotype III sequence type (ST) 283 associated with raw fish consumption. Fish-associated group B Streptococcus ST283 strains included strains nearly identical (0-2 single-nucleotide polymorphisms) with the human outbreak strain, as well as strains in another distinct ST283 clade (57-71 single-nucleotide polymorphisms). Our investigations highlight the risk for contamination of freshwater fish (which are handled and distributed separately from saltwater fish sold as sashimi) and the need for improved hygienic handling of all fish for raw consumption. These results have led to updated policy and guidelines regarding the sale of ready-to-eat raw fish dishes in Singapore.

  6. New Mycobacterium tuberculosis Complex Sublineage, Brazzaville, Congo

    PubMed Central

    Malm, Sven; Linguissi, Laure S. Ghoma; Tekwu, Emmanuel M.; Vouvoungui, Jeannhey C.; Kohl, Thomas A.; Beckert, Patrick; Sidibe, Anissa; Rüsch-Gerdes, Sabine; Madzou-Laboum, Igor K.; Kwedi, Sylvie; Penlap Beng, Véronique; Frank, Matthias; Ntoumi, Francine

    2017-01-01

    Tuberculosis is a leading cause of illness and death in Congo. No data are available about the population structure and transmission dynamics of the Mycobacterium tuberculosis complex strains prevalent in this central Africa country. On the basis of single-nucleotide polymorphisms detected by whole-genome sequencing, we phylogenetically characterized 74 MTBC isolates from Brazzaville, the capital of Congo. The diversity of the study population was high; most strains belonged to the Euro-American lineage, which split into Latin American Mediterranean, Uganda I, Uganda II, Haarlem, X type, and a new dominant sublineage named Congo type (n = 26). Thirty strains were grouped in 5 clusters (each within 12 single-nucleotide polymorphisms), from which 23 belonged to the Congo type. High cluster rates and low genomic diversity indicate recent emergence and transmission of the Congo type, a new Euro-American sublineage of MTBC. PMID:28221129

  7. New Mycobacterium tuberculosis Complex Sublineage, Brazzaville, Congo.

    PubMed

    Malm, Sven; Linguissi, Laure S Ghoma; Tekwu, Emmanuel M; Vouvoungui, Jeannhey C; Kohl, Thomas A; Beckert, Patrick; Sidibe, Anissa; Rüsch-Gerdes, Sabine; Madzou-Laboum, Igor K; Kwedi, Sylvie; Penlap Beng, Véronique; Frank, Matthias; Ntoumi, Francine; Niemann, Stefan

    2017-03-01

    Tuberculosis is a leading cause of illness and death in Congo. No data are available about the population structure and transmission dynamics of the Mycobacterium tuberculosis complex strains prevalent in this central Africa country. On the basis of single-nucleotide polymorphisms detected by whole-genome sequencing, we phylogenetically characterized 74 MTBC isolates from Brazzaville, the capital of Congo. The diversity of the study population was high; most strains belonged to the Euro-American lineage, which split into Latin American Mediterranean, Uganda I, Uganda II, Haarlem, X type, and a new dominant sublineage named Congo type (n = 26). Thirty strains were grouped in 5 clusters (each within 12 single-nucleotide polymorphisms), from which 23 belonged to the Congo type. High cluster rates and low genomic diversity indicate recent emergence and transmission of the Congo type, a new Euro-American sublineage of MTBC.

  8. Minireview: Signal Bias, Allosterism, and Polymorphic Variation at the GLP-1R: Implications for Drug Discovery

    PubMed Central

    Koole, Cassandra; Savage, Emilia E.; Christopoulos, Arthur; Miller, Laurence J.

    2013-01-01

    The glucagon-like peptide-1 receptor (GLP-1R) controls the physiological responses to the incretin hormone glucagon-like peptide-1 and is a major therapeutic target for the treatment of type 2 diabetes, owing to the broad range of effects that are mediated upon its activation. These include the promotion of glucose-dependent insulin secretion, increased insulin biosynthesis, preservation of β-cell mass, improved peripheral insulin action, and promotion of weight loss. Regulation of GLP-1R function is complex, with multiple endogenous and exogenous peptides that interact with the receptor that result in the activation of numerous downstream signaling cascades. The current understanding of GLP-1R signaling and regulation is limited, with the desired spectrum of signaling required for the ideal therapeutic outcome still to be determined. In addition, there are several single-nucleotide polymorphisms (used in this review as defining a natural change of single nucleotide in the receptor sequence; clinically, this is viewed as a single-nucleotide polymorphism only if the frequency of the mutation occurs in 1% or more of the population) distributed within the coding sequence of the receptor protein that have the potential to produce differential responses for distinct ligands. In this review, we discuss the current understanding of GLP-1R function, in particular highlighting recent advances in the field on ligand-directed signal bias, allosteric modulation, and probe dependence and the implications of these behaviors for drug discovery and development. PMID:23864649

  9. Naked-eye fingerprinting of single nucleotide polymorphisms on psoriasis patients

    NASA Astrophysics Data System (ADS)

    Valentini, Paola; Marsella, Alessandra; Tarantino, Paolo; Mauro, Salvatore; Baglietto, Silvia; Congedo, Maurizio; Paolo Pompa, Pier

    2016-05-01

    We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics.We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr02200f

  10. Single Nucleotide Polymorphism Analysis of European Archaeological M. leprae DNA

    PubMed Central

    Watson, Claire L.; Lockwood, Diana N. J.

    2009-01-01

    Background Leprosy was common in Europe eight to twelve centuries ago but molecular confirmation of this has been lacking. We have extracted M. leprae ancient DNA (aDNA) from medieval bones and single nucleotide polymorphism (SNP) typed the DNA, this provides insight into the pattern of leprosy transmission in Europe and may assist in the understanding of M. leprae evolution. Methods and Findings Skeletons have been exhumed from 3 European countries (the United Kingdom, Denmark and Croatia) and are dated around the medieval period (476 to 1350 A.D.). we tested for the presence of 3 previously identified single nucleotide polymorphisms (SNPs) in 10 aDNA extractions. M. leprae aDNA was extracted from 6 of the 10 bone samples. SNP analysis of these 6 extractions were compared to previously analysed European SNP data using the same PCR assays and were found to be the same. Testing for the presence of SNPs in M. leprae DNA extracted from ancient bone samples is a novel approach to analysing European M. leprae DNA and the findings concur with the previously published data that European M. leprae strains fall in to one group (SNP group 3). Conclusions These findings support the suggestion that the M. leprae genome is extremely stable and show that archaeological M. leprae DNA can be analysed to gain detailed information about the genotypic make-up of European leprosy, which may assist in the understanding of leprosy transmission worldwide. PMID:19847306

  11. Differentiation of Erwinia amylovora and Erwinia pyrifoliae strains with single nucleotide polymorphisms and by synthesis of dihydrophenylalanine.

    PubMed

    Gehring, I; Geider, K

    2012-07-01

    Fire blight has spread from North America to New Zealand, Europe, and the Mediterranean region. We were able to differentiate strains from various origins with a novel PCR method. Three Single Nucleotide Polymorphisms (SNPs) in the Erwinia amylovora genome were characteristic of isolates from North America and could distinguish them from isolates from other parts of the world. They were derived from the galE, acrB, and hrpA genes of strains Ea273 and Ea1/79. These genes were analyzed by conventional PCR (cPCR) and quantitative PCR (qPCR) with differential primer annealing temperatures. North-American E. amylovora strains were further differentiated according to their production of L: -2,5-dihydrophenylalanine (DHP) as tested by growth inhibition of the yeast Rhodotorula glutinis. E. amylovora fruit tree (Maloideae) and raspberry (rubus) strains were also differentiated by Single Strand Conformational Polymorphism analysis. Strains from the related species Erwinia pyrifoliae isolated in Korea and Japan were all DHP positive, but were differentiated from each other by SNPs in the galE gene. Differential PCR is a rapid and simple method to distinguish E. amylovora as well as E. pyrifoliae strains according to their geographical origin.

  12. Evaluation and identification of damaged single nucleotide polymorphisms in COL1A1 gene involved in osteoporosis

    PubMed Central

    Alsaif, Mohammed A.; Al Shammari, Sulaiman A.; Alhamdan, Adel A.

    2012-01-01

    Introduction Single-nucleotide polymorphisms (SNPs) are biomarkers for exploring the genetic basis of many complex human diseases. The prediction of SNPs is promising in modern genetic analysis but it is still a great challenge to identify the functional SNPs in a disease-related gene. The computational approach has overcome this challenge and an increase in the successful rate of genetic association studies and reduced cost of genotyping have been achieved. The objective of this study is to identify deleterious non-synonymous SNPs (nsSNPs) associated with the COL1A1 gene. Material and methods The SNPs were retrieved from the Single Nucleotide Polymorphism Database (dbSNP). Using I-Mutant, protein stability change was calculated. The potentially functional nsSNPs and their effect on proteins were predicted by PolyPhen and SIFT respectively. FASTSNP was used for estimation of risk score. Results Our analysis revealed 247 SNPs as non-synonymous, out of which 5 nsSNPs were found to be least stable by I-Mutant 2.0 with a DDG value of > –1.0. Four nsSNPs, namely rs17853657, rs17857117, rs57377812 and rs1059454, showed a highly deleterious tolerance index score of 0.00 with a change in their physicochemical properties by the SIFT server. Seven nsSNPs, namely rs1059454, rs8179178, rs17853657, rs17857117, rs72656340, rs72656344 and rs72656351, were found to be probably damaging with a PSIC score difference between 2.0 and 3.5 by the PolyPhen server. Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, were found to be highly polymorphic with a risk score of 3-4 with a possible effect of non-conservative change and splicing regulation by FASTSNP. Conclusions Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, are potential functional polymorphisms that are likely to have a functional impact on the COL1A1 gene. PMID:24273577

  13. p16 gene silencing along with p53 single-nucleotide polymorphism and risk of esophageal cancer in Northeast India.

    PubMed

    Das, Mandakini; Sharma, Santanu Kumar; Sekhon, Gaganpreet Singh; Mahanta, Jagadish; Phukan, Rup Kumar; Jalan, Bimal Kumar

    2017-05-01

    The high incidence of esophageal cancer in Northeast India and the unique ethnic background and dietary habits provide a great opportunity to study the molecular genetics behind esophageal squamous cell carcinoma in this part of the region. We hypothesized that in addition to currently known environmental risk factors for esophageal cancer, genetic and epigenetic factors are also involved in esophageal carcinogenesis in Northeast India. Therefore, in this study, we explored the possible association between the two important G1 cell cycle regulatory genes p16 and p53 and environmental risk factors and risk of esophageal carcinogenesis. A total of 100 newly diagnosed esophageal cancer cases along with equal number of age-, sex-, and ethnicity-matched controls were included in this study. Methylation-specific polymerase chain reaction was used to determine the p16 promoter methylation status. Single-nucleotide polymorphism at codon 72 of p53 gene was assessed by the polymerase chain reaction-restriction fragment length polymorphism method. Aberrant methylation of p16 gene was seen in 81% of esophageal cancer cases. Hypermethylation of p16 gene was not found in healthy controls. p53 Pro/Pro genotype was found to be a risk genotype in Northeast India compared with Arg/Pro and Arg/Arg. p53 variant/polymorphism was significantly associated with esophageal cancer risk in the study population under all three genetic models, namely, dominant model (Arg/Pro + Pro/Pro vs Arg/Arg odds ratio = 2.25, confidence interval = 1.19-4.26; p = 0.012), recessive model (Arg/Arg + Arg/Pro vs Pro/Pro odds ratio = 2.35, confidence interval = 1.24-4.44; p = 0.008), and homozygous model (Pro/Pro vs Arg/Arg odds ratio = 3.33, confidence interval = 1.54-7.20; p = 0.002). However, p53 variant/polymorphism was not statistically associated with esophageal cancer risk under the heterozygous model (Pro/Pro vs Arg/Pro). In the case-only analysis based on p16 methylation, the p53 variant/polymorphism (Pro/Pro or Arg/Pro) showed significant association for esophageal cancer risk (odds ratio = 3.33, confidence interval = 1.54-7.20; p = 0.002). Gene-gene and gene-environment interaction using the case-only approach revealed a strong association between p16 methylation, p53 single-nucleotide polymorphism, and environmental factors and esophageal cancer risk. Cases with p16 methylation and p53 variant/polymorphism (Pro/Pro or Arg/Pro) along with both betel quid and tobacco chewing habit (odds ratio = 8.29, confidence interval = 1.14-60.23; p = 0.037) conferred eightfold increased risk toward esophageal cancer development. This study reveals a synergistic interaction between epigenetic, genetic, and environmental factors and risk of esophageal cancer in this high-incidence region of Northeast India. The inactivation of either p16 or p53 in a majority of esophageal cancer cases in this study suggests the possible crosstalk between the important cell cycle genes.

  14. Four Linked Genes Participate in Controlling Sporulation Efficiency in Budding Yeast

    PubMed Central

    Ben-Ari, Giora; Zenvirth, Drora; Sherman, Amir; David, Lior; Klutstein, Michael; Lavi, Uri; Hillel, Jossi; Simchen, Giora

    2006-01-01

    Quantitative traits are conditioned by several genetic determinants. Since such genes influence many important complex traits in various organisms, the identification of quantitative trait loci (QTLs) is of major interest, but still encounters serious difficulties. We detected four linked genes within one QTL, which participate in controlling sporulation efficiency in Saccharomyces cerevisiae. Following the identification of single nucleotide polymorphisms by comparing the sequences of 145 genes between the parental strains SK1 and S288c, we analyzed the segregating progeny of the cross between them. Through reciprocal hemizygosity analysis, four genes, RAS2, PMS1, SWS2, and FKH2, located in a region of 60 kilobases on Chromosome 14, were found to be associated with sporulation efficiency. Three of the four “high” sporulation alleles are derived from the “low” sporulating strain. Two of these sporulation-related genes were verified through allele replacements. For RAS2, the causative variation was suggested to be a single nucleotide difference in the upstream region of the gene. This quantitative trait nucleotide accounts for sporulation variability among a set of ten closely related winery yeast strains. Our results provide a detailed view of genetic complexity in one “QTL region” that controls a quantitative trait and reports a single nucleotide polymorphism-trait association in wild strains. Moreover, these findings have implications on QTL identification in higher eukaryotes. PMID:17112318

  15. The Impact of BDNF Polymorphisms on Suicidality in Treatment-Resistant Major Depressive Disorder: A European Multicenter Study.

    PubMed

    Schosser, Alexandra; Carlberg, Laura; Calati, Raffaella; Serretti, Alessandro; Massat, Isabel; Spindelegger, Christoph; Linotte, Sylvie; Mendlewicz, Julien; Souery, Daniel; Zohar, Joseph; Montgomery, Stuart; Kasper, Siegfried

    2017-10-01

    Numerous studies have reported associations between the brain-derived neurotrophic factor (BDNF) gene and psychiatric disorders, including suicidal behavior, although with conflicting results. A total of 250 major depressive disorder patients were collected in the context of a European multicenter resistant depression study and treated with antidepressants at adequate doses for at least 4 weeks. Suicidality was assessed using the Mini International Neuropsychiatric Interview and Hamilton Rating Scale for Depression, and treatment response using the HAM-D. Genotyping was performed for the functional Val66Met polymorphism (rs6265) and 7 additional tagging single nucleotide polymorphisms within the BDNF gene. Neither BDNF single markers nor haplotypes were found to be associated with suicide risk and lifetime history of suicide attempts. Gender-specific analyses revealed nonsignificant single marker (rs908867) and haplotypic association with suicide risk in males after multiple testing correction. Analyzing treatment response phenotypes, the functional Val66Met polymorphism as well as rs10501087 showed significant genotypic and haplotypic association with suicide risk in remitters (n=34, 13.6%). Considering the sample size, the present findings need to be replicated in larger samples to confirm or refute a role of BDNF in the investigated suicidal behavior phenotypes. © The Author 2017. Published by Oxford University Press on behalf of CINP.

  16. Partial AZFc duplications not deletions are associated with male infertility in the Yi population of Yunnan Province, China.

    PubMed

    Ye, Jun-jie; Ma, Li; Yang, Li-juan; Wang, Jin-huan; Wang, Yue-li; Guo, Hai; Gong, Ning; Nie, Wen-hui; Zhao, Shu-hua

    2013-09-01

    There are many reports on associations between spermatogenesis and partial azoospermia factor c (AZFc) deletions as well as duplications; however, results are conflicting, possibly due to differences in methodology and ethnic background. The purpose of this study is to investigate the association of AZFc polymorphisms and male infertility in the Yi ethnic population, residents within Yunnan Province, China. A total of 224 infertile patients and 153 fertile subjects were selected in the Yi ethnic population. The study was performed by sequence-tagged site plus/minus (STS+/-) analysis followed by gene dosage and gene copy definition analysis. Y haplotypes of 215 cases and 115 controls were defined by 12 binary markers using single nucleotide polymorphism on Y chromosome (Y-SNP) multiplex assays based on single base primer extension technology. The distribution of Y haplotypes was not significantly different between the case and control groups. The frequencies of both gr/gr (7.6% vs. 8.5%) and b2/b3 (6.3% vs. 8.5%) deletions do not show significant differences. Similarly, single nucleotide variant (SNV) analysis shows no significant difference of gene copy definition between the cases and controls. However, the frequency of partial duplications in the infertile group (4.0%) is significantly higher than that in the control group (0.7%). Further, we found a case with sY1206 deletion which had two CDY1 copies but removed half of DAZ genes. Our results show that male infertility is associated with partial AZFc duplications, but neither gr/gr nor b2/b3 deletions, suggesting that partial AZFc duplications rather than deletions are risk factors for male infertility in Chinese-Yi population.

  17. Using of methods of speckle optics for Chlamydia trachomatis typing

    NASA Astrophysics Data System (ADS)

    Ulyanov, Sergey S.; Zaytsev, Sergey S.; Ulianova, Onega V.; Saltykov, Yury V.; Feodorova, Valentina A.

    2017-03-01

    Specific method of transformation of nucleotide of gene into speckle pattern is suggested. Reference speckle pattern of omp1 gene of typical wild strains of Chlamydia trachomatis of genovars D, E, F, G, J and K and Chlamydia psittaci as well is generated. Perspectives of proposed technique in the gene identification and detection of natural genetic mutations as single nucleotide polymorphism (SNP) are demonstrated.

  18. High-resolution genetic map for understanding the effect of genome-wide recombination rate, selection sweep and linkage disequilibrium on nucleotide diversity in watermelon

    USDA-ARS?s Scientific Manuscript database

    Genotyping by sequencing (GBS) technology was used to identify a set of 9,933 single nucleotide polymorphism (SNP) markers for constructing a high-resolution genetic map of 1,087 cM for watermelon. The genome-wide variation of recombination rate (GWRR) across the map was evaluated and a positive co...

  19. Genetic associations of the INSIG2 rs7566605 polymorphism with obesity-related metabolic traits in Malaysian Malays.

    PubMed

    Apalasamy, Y D; Moy, F M; Rampal, S; Bulgiba, A; Mohamed, Z

    2014-07-04

    A genome-wide association study showed that the tagging single nucleotide polymorphism (SNP) rs7566605 in the insulin-induced gene 2 (INSIG2) was associated with obesity. Attempts to replicate this result in different populations have produced inconsistent findings. We aimed to study the association between the rs7566605 SNP with obesity and other metabolic parameters in Malaysian Malays. Anthropometric and obesity-related metabolic parameters and DNA samples were collected. We genotyped the rs7566605 polymorphism in 672 subjects using real-time polymerase chain reaction. No significant associations were found between the rs7566605 tagging SNP of INSIG2 with obesity or other metabolic parameters in the Malaysian Malay population. The INSIG2 rs7566605 SNP may not play a role in the development of obesity-related metabolic traits in Malaysian Malays.

  20. Association of PTPN22 with rheumatoid arthritis among South Asians in the UK.

    PubMed

    Mastana, Sarabjit; Gilmour, Ashley; Ghelani, Anant; Smith, Hannah; Samanta, Ash

    2007-10-01

    To compare the distribution and assess genetic associations of the PTPN22 R620W single-nucleotide polymorphism among South Asian (Asiatic Indian) patients with rheumatoid arthritis (RA) and ethnically matched controls. DNA samples from 133 rheumatoid factor-positive South Asian RA patients and 149 control subjects from the East Midlands of the UK were genotyped for PTPN22 R620W polymorphism. Genotyping was performed by the polymerase chain reaction-restriction fragment length polymorphism method. The PTPN22 *T allele frequency was lower than in the Caucasian populations, but the disease association was significant (odds ratio 5.87, 95% confidence interval 1.68-20.52). Similar association was observed for genotypes containing *T allele. Our results suggest that the T variant acts as a susceptibility allele for autoantibody-positive RA among South Asians.

  1. Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array

    PubMed Central

    Wang, Shichen; Wong, Debbie; Forrest, Kerrie; Allen, Alexandra; Chao, Shiaoman; Huang, Bevan E; Maccaferri, Marco; Salvi, Silvio; Milner, Sara G; Cattivelli, Luigi; Mastrangelo, Anna M; Whan, Alex; Stephen, Stuart; Barker, Gary; Wieseke, Ralf; Plieske, Joerg; International Wheat Genome Sequencing Consortium; Lillemo, Morten; Mather, Diane; Appels, Rudi; Dolferus, Rudy; Brown-Guedira, Gina; Korol, Abraham; Akhunova, Alina R; Feuillet, Catherine; Salse, Jerome; Morgante, Michele; Pozniak, Curtis; Luo, Ming-Cheng; Dvorak, Jan; Morell, Matthew; Dubcovsky, Jorge; Ganal, Martin; Tuberosa, Roberto; Lawley, Cindy; Mikoulitch, Ivan; Cavanagh, Colin; Edwards, Keith J; Hayden, Matthew; Akhunov, Eduard

    2014-01-01

    High-density single nucleotide polymorphism (SNP) genotyping arrays are a powerful tool for studying genomic patterns of diversity, inferring ancestral relationships between individuals in populations and studying marker–trait associations in mapping experiments. We developed a genotyping array including about 90 000 gene-associated SNPs and used it to characterize genetic variation in allohexaploid and allotetraploid wheat populations. The array includes a significant fraction of common genome-wide distributed SNPs that are represented in populations of diverse geographical origin. We used density-based spatial clustering algorithms to enable high-throughput genotype calling in complex data sets obtained for polyploid wheat. We show that these model-free clustering algorithms provide accurate genotype calling in the presence of multiple clusters including clusters with low signal intensity resulting from significant sequence divergence at the target SNP site or gene deletions. Assays that detect low-intensity clusters can provide insight into the distribution of presence–absence variation (PAV) in wheat populations. A total of 46 977 SNPs from the wheat 90K array were genetically mapped using a combination of eight mapping populations. The developed array and cluster identification algorithms provide an opportunity to infer detailed haplotype structure in polyploid wheat and will serve as an invaluable resource for diversity studies and investigating the genetic basis of trait variation in wheat. PMID:24646323

  2. [Association of single nucleotide polymorphisms of susceptibility genes of type 2 diabetes mellitus with liability to gout among ethnic Han Chinese males from coastal region of Shandong].

    PubMed

    Han, Lin; Xin, Ruosai; Sun, Jian; Hou, Feng; Li, Changgui; Hu, Xinlin; Liu, Zhen; Wang, Yao; Li, Xinde; Ren, Wei; Wang, Xuefeng; Jia, Zhaotong

    2015-10-01

    OBJECTIVE To assess the association of single nucleotide polymorphisms (SNPs) of susceptibility genes of type 2 diabetes mellitus (T2DM) with liability to gout among ethnic Han Chinese males from coastal region of Shandong province. METHODS Seven SNPs within the susceptibility genes of T2DM, including rs10773971(G/C) and rs4766398(G/C) of WNT5B gene, rs10225163(G/C) of JAZF1 gene, rs2069590(T/A) of BDKRB2 gene, rs5745709(G/A) of HGF gene, rs1991914(C/A) of OTOP1 gene and rs2236479(G/A) of COL18A1 gene, were typed with a custom-made Illumina GoldenGate Genotyping assay in 480 male patients with gout and 480 male controls. Potential association was assessed with the chi-square test. RESULTS No significant difference was detected for the 7 selected SNPs in terms of genotypic and allelic frequencies (P > 0.05). When age and body mass index (BMI) were adjusted, the 7 genetic variants still showed no significant association with gout. CONCLUSION The genotypes of the 7 selected SNPs are not associated with gout in ethnic Han Chinese male patients from the coastal region of Shandong province. However, the results need to be replicated in larger sets of patients collected from other regions and populations.

  3. Multiple thrombophilic single nucleotide polymorphisms lack a significant effect on outcomes in fresh IVF cycles: an analysis of 1717 patients.

    PubMed

    Patounakis, George; Bergh, Eric; Forman, Eric J; Tao, Xin; Lonczak, Agnieszka; Franasiak, Jason M; Treff, Nathan; Scott, Richard T

    2016-01-01

    The aim of the study is to determine if thrombophilic single nucleotide polymorphisms (SNPs) affect outcomes in fresh in vitro fertilization (IVF) cycles in a large general infertility population. A prospective cohort analysis was performed at a university-affiliated private IVF center of female patients undergoing fresh non-donor IVF cycles. The effect of the following thrombophilic SNPs on IVF outcomes were explored: factor V (Leiden and H1299R), prothrombin (G20210A), factor XIII (V34L), β-fibrinogen (-455G → A), plasminogen activator inhibitor-1 (4G/5G), human platelet antigen-1 (a/b9L33P), and methylenetetrahydrofolate reductase (C677T and A1298C). The main outcome measures included positive pregnancy test, clinical pregnancy, embryo implantation, live birth, and pregnancy loss. Patients (1717) were enrolled in the study, and a total of 4169 embryos were transferred. There were no statistically significant differences in positive pregnancy test, clinical pregnancy, embryo implantation, live birth, or pregnancy loss in the analysis of 1717 patients attempting their first cycle of IVF. Receiver operator characteristics and logistic regression analyses showed that outcomes cannot be predicted by the cumulative number of thrombophilic mutations present in the patient. Individual and cumulative thrombophilic SNPs do not affect IVF outcomes. Therefore, initial screening for these SNPs is not indicated.

  4. Genetic variation of the androgen receptor and risk of myocardial infarction and ischemic stroke in women.

    PubMed

    Rexrode, Kathryn M; Ridker, Paul M; Hegener, Hillary H; Buring, Julie E; Manson, JoAnn E; Zee, Robert Y L

    2008-05-01

    Androgen receptors (AR) are expressed in endothelial cells and vascular smooth-muscle cells. Some studies suggest an association between AR gene variation and risk of cardiovascular disease (CVD) in men; however, the relationship has not been examined in women. Six haplotype block-tagging single nucleotide polymorphisms (rs962458, rs6152, rs1204038, rs2361634, rs1337080, rs1337082), as well as the cysteine, adenine, guanine (CAG) microsatellite in exon 1, of the AR gene were evaluated among 300 white postmenopausal women who developed CVD (158 myocardial infarctions and 142 ischemic strokes) and an equal number of matched controls within the Women's Health Study. Genotype distributions were similar between cases and controls, and genotypes were not significantly related to risk of CVD, myocardial infarctions or ischemic stroke in conditional logistic regression models. Seven common haplotypes were observed, but distributions did not differ between cases and controls nor were significant associations observed in logistic regression analysis. The median CAG repeat length was 21. In conditional logistic regression, there was no association between the number of alleles with CAG repeat length >or=21 (or >or=22) and risk of CVD, myocardial infarctions or ischemic stroke. No association between AR genetic variation, as measured by haplotype-tagging single nucleotide polymorphisms and CAG repeat number, and risk of CVD was observed in women.

  5. Association between ASMT and autistic-like traits in children from a Swedish nationwide cohort.

    PubMed

    Jonsson, Lina; Anckarsäter, Henrik; Zettergren, Anna; Westberg, Lars; Walum, Hasse; Lundström, Sebastian; Larsson, Henrik; Lichtenstein, Paul; Melke, Jonas

    2014-02-01

    Individuals with autism spectrum disorders often show low levels of melatonin, and it has been suggested that this decrease may be because of the low activity of the acetylserotonin O-methyltransferase (ASMT), the last enzyme in the melatonin-synthesis pathway. Also, genetic variants in ASMT have been associated with autism, as well as with low ASMT activity and melatonin levels, suggesting that the low ASMT activity observed in autism may partly be because of variations within the ASMT gene. In this study, we present a symptom-based approach to investigate possible associations between ASMT and autistic-like traits in the general population. To this end, continuous measures of autistic-like traits were assessed in a nationally representative twin cohort (n=1771) from Sweden and six single nucleotide polymorphisms (SNPs), and a duplication of exons 2-8 in ASMT were genotyped. Our results show a nominally significant association, in girls, between one single nucleotide polymorphism (rs5949028) in the last intron of ASMT and social interaction impairments. No significant association, however, was observed with traits related to language impairment or restricted and repetitive behavior. In conclusion, our results support the possible involvement of the ASMT gene in autism spectrum disorders, and our finding that only one of the three traits shows association suggests that genetic research may benefit from adopting a symptom-specific approach to identify genes involved in autism psychopathology.

  6. Single-nucleotide polymorphisms and haplotypes of non-coding area in the CP gene are correlated with Parkinson's disease.

    PubMed

    Zhao, Na; Xiao, Jianqiu; Zheng, Zhiyong; Fei, Guoqiang; Zhang, Feng; Jin, Lirong; Zhong, Chunjiu

    2015-04-01

    Our previous studies have demonstrated that ceruloplasmin (CP) dysmetabolism is correlated with Parkinson's disease (PD). However, the causes of decreased serum CP levels in PD patients remain to be clarified. This study aimed to explore the potential association between genetic variants of the CP gene and PD. Clinical features, serum CP levels, and the CP gene (both promoter and coding regions) were analyzed in 60 PD patients and 50 controls. A luciferase reporter system was used to investigate the function of promoter single-nucleotide polymorphisms (SNPs). High-density comparative genomic hybridization microarrays were also used to detect large-scale copy-number variations in CP and an additional 47 genes involved in PD and/or copper/iron metabolism. The frequencies of eight SNPs (one intronic SNP and seven promoter SNPs of the CP gene) and their haplotypes were significantly different between PD patients, especially those with lowered serum CP levels, and controls. However, the luciferase reporter system revealed no significant effect of the risk haplotype on promoter activity of the CP gene. Neither these SNPs nor their haplotypes were correlated with the Hoehn and Yahr staging of PD. The results of this study suggest that common genetic variants of CP are associated with PD and further investigation is needed to explore their functions in PD.

  7. A Genome-Wide Association Study of Depressive Symptoms

    PubMed Central

    Cornelis, Marilyn C.; Amin, Najaf; Bakshis, Erin; Baumert, Jens; Ding, Jingzhong; Liu, Yongmei; Marciante, Kristin; Meirelles, Osorio; Nalls, Michael A.; Sun, Yan V.; Vogelzangs, Nicole; Yu, Lei; Bandinelli, Stefania; Benjamin, Emelia J.; Bennett, David A.; Boomsma, Dorret; Cannas, Alessandra; Coker, Laura H.; de Geus, Eco; De Jager, Philip L.; Diez-Roux, Ana V.; Purcell, Shaun; Hu, Frank B.; Rimma, Eric B.; Hunter, David J.; Jensen, Majken K.; Curhan, Gary; Rice, Kenneth; Penman, Alan D.; Rotter, Jerome I.; Sotoodehnia, Nona; Emeny, Rebecca; Eriksson, Johan G.; Evans, Denis A.; Ferrucci, Luigi; Fornage, Myriam; Gudnason, Vilmundur; Hofman, Albert; Illig, Thomas; Kardia, Sharon; Kelly-Hayes, Margaret; Koenen, Karestan; Kraft, Peter; Kuningas, Maris; Massaro, Joseph M.; Melzer, David; Mulas, Antonella; Mulder, Cornelis L.; Murray, Anna; Oostra, Ben A.; Palotie, Aarno; Penninx, Brenda; Petersmann, Astrid; Pilling, Luke C.; Psaty, Bruce; Rawal, Rajesh; Reiman, Eric M.; Schulz, Andrea; Shulman, Joshua M.; Singleton, Andrew B.; Smith, Albert V.; Sutin, Angelina R.; Uitterlinden, André G.; Völzke, Henry; Widen, Elisabeth; Yaffe, Kristine; Zonderman, Alan B.; Cucca, Francesco; Harris, Tamara; Ladwig, Karl-Heinz; Llewellyn, David J.; Räikkönen, Katri; Tanaka, Toshiko

    2013-01-01

    Background Depression is a heritable trait that exists on a continuum of varying severity and duration. Yet, the search for genetic variants associated with depression has had few successes. We exploit the entire continuum of depression to find common variants for depressive symptoms. Methods In this genome-wide association study, we combined the results of 17 population-based studies assessing depressive symptoms with the Center for Epidemiological Studies Depression Scale. Replication of the independent top hits (p < 1 × 10−5) was performed in five studies assessing depressive symptoms with other instruments. In addition, we performed a combined meta-analysis of all 22 discovery and replication studies. Results The discovery sample comprised 34,549 individuals (mean age of 66.5) and no loci reached genome-wide significance (lowest p = 1.05 × 10−7). Seven independent single nucleotide polymorphisms were considered for replication. In the replication set (n = 16,709), we found suggestive association of one single nucleotide polymorphism with depressive symptoms (rs161645, 5q21, p = 9.19 × 10−3). This 5q21 region reached genome-wide significance (p = 4.78 × 10−8) in the overall meta-analysis combining discovery and replication studies (n = 51,258). Conclusions The results suggest that only a large sample comprising more than 50,000 subjects may be sufficiently powered to detect genes for depressive symptoms. PMID:23290196

  8. Discovering genetic variants in Crohn's disease by exploring genomic regions enriched of weak association signals.

    PubMed

    D'Addabbo, Annarita; Palmieri, Orazio; Maglietta, Rosalia; Latiano, Anna; Mukherjee, Sayan; Annese, Vito; Ancona, Nicola

    2011-08-01

    A meta-analysis has re-analysed previous genome-wide association scanning definitively confirming eleven genes and further identifying 21 new loci. However, the identified genes/loci still explain only the minority of genetic predisposition of Crohn's disease. To identify genes weakly involved in disease predisposition by analysing chromosomal regions enriched of single nucleotide polymorphisms with modest statistical association. We utilized the WTCCC data set evaluating 1748 CD and 2938 controls. The identification of candidate genes/loci was performed by a two-step procedure: first of all chromosomal regions enriched of weak association signals were localized; subsequently, weak signals clustered in gene regions were identified. The statistical significance was assessed by non parametric permutation tests. The cytoband enrichment analysis highlighted 44 regions (P≤0.05) enriched with single nucleotide polymorphisms significantly associated with the trait including 23 out of 31 previously confirmed and replicated genes. Importantly, we highlight further 20 novel chromosomal regions carrying approximately one hundred genes/loci with modest association. Amongst these we find compelling functional candidate genes such as MAPT, GRB2 and CREM, LCT, and IL12RB2. Our study suggests a different statistical perspective to discover genes weakly associated with a given trait, although further confirmatory functional studies are needed. Copyright © 2011 Editrice Gastroenterologica Italiana S.r.l. All rights reserved.

  9. Lack of association of two chromosome 10q24 SNPs with Alzheimer’s disease

    PubMed Central

    Minster, Ryan L.; DeKosky, Steven T.; Kamboh, M. Ilyas

    2006-01-01

    Several groups have reported evidence of linkage on chromosome 10 to late-onset Alzheimer’s disease (LOAD). In a recent scan of single nucleotide polymorphisms (SNPs) on chromosome 10, significant associations between the rs498055 and rs4417206 SNPs and risk of LOAD were observed. We examined the association of these two SNPs with LOAD risk in a large Caucasian American cohort comprising about 2,000 cases and controls. Neither SNP revealed significant association with LOAD risk or age-at-onset. PMID:17000046

  10. Lack of association between ESR1 gene polymorphisms and premature ovarian failure in Serbian women.

    PubMed

    Li, J; Vujovic, S; Dalgleish, R; Thompson, J; Dragojevic-Dikic, S; Al-Azzawi, F

    2014-06-01

    It has previously been reported that estrogen receptor-alpha (ERα) gene (ESR1: estrogen receptor 1) polymorphisms are associated with premature ovarian failure (POF). The aim of this study was to investigate whether these genetic polymorphisms of ESR1 are associated with POF in Serbian women. A series of 197 POF cases matched with 547 fertile controls was recruited by the Institute for Endocrinology, Diabetes and Metabolic Disorders of Serbia between 2007 and 2010. Genomic DNA was extracted from saliva using Oragene® DNA sample collection kits. Two single-nucleotide polymorphisms (SNPs), PvuII and XbaI, in ESR1 were genotyped by dynamic allele-specific hybridization. Haplotype analyses were performed with the restriction fragment length polymorphism method. SNP and haplotype effects were analyzed by logistic regression models. No significant difference was found in the distribution of ESR1 PvuII and XbaI polymorphisms or haplotypes between the POF and control groups. The two ESR1 SNPs, PvuII and XbaI, are not commonly associated with POF in Serbian women and may not contribute to the genetic basis of the condition.

  11. Cytotoxic T-lymphocyte-associated protein 4 gene polymorphism is related to rheumatoid arthritis in Egyptian population.

    PubMed

    Fattah, Shaimaa A; Ghattas, Maivel H; Saleh, Samy M; Abo-Elmatty, Dina M

    2017-02-01

    Cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) is a CD28-family receptor expressed on T-cells which suppresses T cell proliferation. CTLA-4 -318C/T polymorphism is involved in regulation of CTLA-4 expression. The study aimed to investigate the genetic association of CTLA-4 -318C/T polymorphism with rheumatoid arthritis (RA) and the activity and severity of the disease in the Egyptian population. A single nucleotide polymorphism (rs5742909) in CTLA-4 was genotyped in 100 RA patients and 100 healthy controls using polymerase chain reaction-restriction fragment length polymorphism. Diagnostic tests were measured for RA patients. The frequency of T allele in RA patients was significantly higher than in the control subjects (p = 0.002). CT and TT genotypes had high C-reactive protein, erythrocyte sedimentation rate and disease activity score 28 while CC genotype had a high rheumatoid factor. A minor allele of CTLA-4 rs5742909 polymorphism was associated with RA and the activity but not the severity of the disease.

  12. Single Nucleotide Variations of the Human GR Gene Manifested as Pathologic Mutations or Polymorphisms.

    PubMed

    Kino, Tomoshige

    2018-05-11

    The human genome contains numerous single nucleotide variations (SNVs), and the human GR gene harbors ∼450 of these genetic changes. Among them, extremely rare non-synonymous variants known as pathologic GR gene mutations develop a characteristic pathologic condition, familial/sporadic generalized glucocorticoid resistance syndrome, by replacing the amino acids critical for GR protein structure and functions, whereas others known as pathologic polymorphisms develop mild manifestations recognized mainly at population bases by changing the GR activities slightly. Recent progress on the structural analysis to the GR protein and subsequent computer-based structural simulation revealed details of the molecular defects caused by such pathologic GR gene mutations, including their impact on the receptor interaction to ligands, nuclear receptor coactivators (NCoAs) or DNA glucocorticoid response elements (GREs). Indeed, those found in the GR ligand-binding domain significantly damage protein structure of the ligand-binding pocket and/or the activation function-2 transactivation domain and change their molecular interaction to glucocorticoids or the LxxLL signature motif of NCoAs. Two mutations found in GR DBD also affect interaction of the mutant receptors to GRE DNA by affecting the critical amino acid for the interaction or changing local hydrophobic circumstance. In this review, we discuss recent findings on the structural simulation of the pathologic GR mutants in connection to their functional and clinical impacts along with brief explanation to recent research achievement on the GR polymorphisms.

  13. Association Mapping of Disease Resistance Traits in Rainbow Trout Using Restriction Site Associated DNA Sequencing

    PubMed Central

    Campbell, Nathan R.; LaPatra, Scott E.; Overturf, Ken; Towner, Richard; Narum, Shawn R.

    2014-01-01

    Recent advances in genotyping-by-sequencing have enabled genome-wide association studies in nonmodel species including those in aquaculture programs. As with other aquaculture species, rainbow trout and steelhead (Oncorhynchus mykiss) are susceptible to disease and outbreaks can lead to significant losses. Fish culturists have therefore been pursuing strategies to prevent losses to common pathogens such as Flavobacterium psychrophilum (the etiological agent for bacterial cold water disease [CWD]) and infectious hematopoietic necrosis virus (IHNV) by adjusting feed formulations, vaccine development, and selective breeding. However, discovery of genetic markers linked to disease resistance offers the potential to use marker-assisted selection to increase resistance and reduce outbreaks. For this study we sampled juvenile fish from 40 families from 2-yr classes that either survived or died after controlled exposure to either CWD or IHNV. Restriction site−associated DNA sequencing produced 4661 polymorphic single-nucleotide polymorphism loci after strict filtering. Genotypes from individual survivors and mortalities were then used to test for association between disease resistance and genotype at each locus using the program TASSEL. After we accounted for kinship and stratification of the samples, tests revealed 12 single-nucleotide polymorphism markers that were highly associated with resistance to CWD and 19 markers associated with resistance to IHNV. These markers are candidates for further investigation and are expected to be useful for marker assisted selection in future broodstock selection for various aquaculture programs. PMID:25354781

  14. [Correlation between interleukin-10 polymorphisms and susceptibility to chronic periodontitis among Uygur adults in the Moyu area].

    PubMed

    Yuhui, Zhang; Ping, Huang; Jing, Lin; Jin, Zhao

    2017-10-01

    This study aims to investigate the association between interleukin (IL)-10-597 (C/A) single-nucleotide polymorphisms and chronic periodontitis of Moyu Uygur population in Xinjiang Uygur Autonomous Region of China. In accordance with the inclusion and exclusion criteria, the buccal swabs of 300 subjects were randomly selected from the epidemiological investigation of Uygur adults in Moyu county on April and May 2013. The study was conducted on a healthy control group, a mild chronic periodontitis group, and a moderate-to-severe chronic periodontitis group, with each comprising 100 samples. The IL-10-597(C/A) site in the promoter sequences was analyzed using the tetra-primer amplification refractory mutation system-polymerase chain reaction method to test the genotype and allele distributions. Statistical analysis was performed using Chi-squared test and ordinal classification Logistic regression analysis. The genotype and allele frequencies of the IL-10-597(C/A) site in the healthy control group, mild chronic periodontitis group, and moderate-to-severe chronic periodontitis group exhibited no significant difference (P>0.05). The age of all the samples was associated with chronic periodontitis. The risk of chronic periodontitis in the people of 55-65 years old was 25 times in the people under the age of 35 (OR=25.56, P<0.001). The IL-10-597 (C/A) single-nucleotide polymorphisms in the gene promoter are not associated with chronic periodontitis in Uygur adult population.

  15. Association between single nucleotide polymorphisms of the transforming growth factor β1 gene and the risk of severe radiation esophagitis in patients with lung cancer.

    PubMed

    Guerra, Jose Luis Lopez; Gomez, Daniel; Wei, Qingyi; Liu, Zhengshen; Wang, Li-E; Yuan, Xianglin; Zhuang, Yan; Komaki, Ritusko; Liao, Zhongxing

    2012-12-01

    We investigated the association between single nucleotide polymorphisms (SNPs) in the transforming growth factor β1 (TGFβ1) gene and the risk of radiation-induced esophageal toxicity (RE) in patients with non-small-cell lung cancer (NSCLC). Ninety-seven NSCLC patients with available genomic DNA samples and mostly treated with intensity modulated radio(chemo)therapy from 2003 to 2006 were used as a test dataset and 101 NSCLC patients treated with 3-dimensional conformal radio(chemo)therapy from 1998 to 2002 were used as a validation set. We genotyped three SNPs of the TGFβ1 gene (rs1800469:C-509T, rs1800471:G915C, and rs1982073:T869C) by the polymerase chain reaction restriction fragment length polymorphism method. In the test dataset, the CT/TT genotypes of TGFβ1 rs1800469:C-509T were associated with a statistically significant higher risk of RE grade⩾3 in univariate (P=0.026) and multivariate analysis (P=0.045) when compared with the CC genotype. These results were again observed in both univariate (P=0.045) and multivariate (P=0.023) analysis in the validation dataset. We found and validated that the TGFβ1 rs1800469:C-509T genotype is associated with severe RE. This response marker may be used for guiding therapy intensity in an individual patient, which would further the goal of individualized therapy. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  16. Cognitive Function in Adolescence: Testing for Interactions Between Breast-Feeding and "FADS2" Polymorphisms

    ERIC Educational Resources Information Center

    Martin, Nicolas W.; Benyamin, Beben; Hansell, Narelle K.; Montgomery, Grant W.; Martin, Nicholas G.; Wright, Margaret J.; Bates, Timothy C.

    2011-01-01

    Objectives: Breast-fed C-allele carriers of the rs single nucleotide polymorphism in the fatty acyl desaturase 2 ("FADS2") gene have been reported to show a 6.4 to 7 IQ point advantage over formula-fed C-allele carriers, with no effect of breast-feeding in GG carriers. An Australian sample was examined to determine if an interaction between…

  17. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA.

    PubMed

    Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V

    2015-03-04

    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

  18. Association between rs12045440 Polymorphism in the CAPZB Intron and Serum TSH Concentrations in Chinese Thyroid Tumor Patients

    PubMed Central

    Feng, Shouhao; Lin, Shengli; Zou, Jidong; Wang, Yulong; Ji, Qinghai; Lv, Zhenghua

    2015-01-01

    The aim of this study was to investigate the possible influence of different genotypes of the lead single nucleotide polymorphisms (SNPs) rs10917468 and rs12045440 in the CAPZB gene on the thyroid function in papillary thyroid carcinoma (PTC) and benign thyroid neoplasm (BN) patients. In the study, a significant association was detected between rs12045440 and serum TSH concentrations in thyroid tumor patients (p = 0.001). After the adjustment of relevant covariates, the difference between the mean serum TSH levels in different genotypes of rs12045440 was still significant in the BN group (p = 0.003) but was not significant in the PTC cases (p = 0.115). No significant association of rs10917468 with TSH levels was found. The SNP rs12045440 was associated with the serum TSH concentrations in Chinese thyroid tumor patients, especially in benign thyroid tumor cases. PMID:26273293

  19. Single nucleotide polymorphisms of DNA mismatch repair genes MSH2 and MLH1 confer susceptibility to esophageal cancer.

    PubMed

    Sun, Ming-Zhong; Ju, Hui-Xiang; Zhou, Zhong-Wei; Jin, Hao; Zhu, Rong

    2014-01-01

    Defects in DNA mismatch repair genes like MSH2 and MLH1 confer increased risk of cancers. Here, single nucleotide polymorphisms (SNPs) in MSH2 and MLH1 were investigated for their potential contribution to the risk of esophageal cancer. This study recruited 614 participants from Affiliated Yancheng Hospital, School of Medicine, Southeast University, of which 289 were patients with esophageal cancer, and the remainder was healthy individuals who served as a control group. Two SNPs, MSH2 c.2063T>G and MLH1 IVS14-19A>G, were genotyped using PCR-RFLP. Statistical analysis was performed using chi-square test and logistic regression analysis. Carriers of the MSH2 c.2063G allele were at significantly higher risk for esophageal cancer compared to individuals with the TT genotype [OR = 3.36, 95% confidence interval (CI): 1.18-11.03]. The MLH1 IVS14-19A>G allele also conferred significantly increased (1.70-fold) for esophageal cancer compared to the AA genotype (OR = 1.70, 95% CI: 1.13-5.06). Further, the variant alleles interacted such that individuals with the susceptible genotypes at both MSH2 and MLH1 had a significantly exacerbated risk for esophageal cancer (OR = 12.38, 95% CI: 3.09-63.11). In brief, SNPs in the DNA mismatch repair genes MSH2 and MLH1 increase the risk of esophageal cancer. Molecular investigations are needed to uncover the mechanism behind their interaction effect.

  20. Association between lower frequency of R381Q variant (rs11209026) in IL-23 receptor gene and increased risk of recurrent spontaneous abortion (RSA).

    PubMed

    Abdollahi, Elham; Tavasolian, Fataneh; Ghasemi, Nasrin; Mirghanizadeh, Seyed Ali; Azizi, Mohammdareza; Ghoryani, Mohsen; Samadi, Morteza

    2015-01-01

    Recurrent spontaneous abortion (RSA) is defined as three or more consecutive spontaneous abortions before the 20th week of gestation. The purpose of the present study was to investigate the association between a functional single nucleotide polymorphism (SNP) in the interleukin (IL)-23 receptor gene (IL-23R; rs11209026, 1142 G wild type → A reduced function, Arg381Gln, R381Q) and RSA. For the study, 200 RSA patients (confirmed using established diagnostic criteria) and 200 normal individuals in fertility and infertility centers in the cities of Yazd and Isfahan were recruited during a period from 2012-2013. Using PCR-RFLP, the R381Q variant was screened for in the IL-23R gene of the patients and controls. The results indicated there were significant differences in the frequency of this genetic variant in the patients versus the healthy controls, i.e. 2% and 7.5%, respectively (p value = 0.01; odds ratio = 0.25; CI = 95%). No significant difference was found for the G allelic frequency in patients with RSA and in the control group (p = 0.60). The A allelic frequency was significantly different between the two groups (p = 0.01). Based on these findings, it is concluded that the frequency of single nucleotide polymorphism in the IL-23 receptor (R381Q) in patients with recurrent spontaneous abortion (RSA) is less than that found in normal control women.

  1. Functional effects of single nucleotide polymorphisms in the coding region of human N-acetyltransferase 1

    PubMed Central

    Zhu, Yuanqi; Hein, David W.

    2007-01-01

    Genetic variants of human N-acetyltransferase 1 (NAT1) are associated with cancer and birth defects. N- and O-acetyltransferase catalytic activities, Michaelis-Menten kinetic constants (Km & Vmax), and steady state expression levels of NAT1-specific mRNA and protein were determined for the reference NAT1*4 and variant human NAT1 haplotypes possessing single nucleotide polymorphisms (SNPs) in the open reading frame. Although none of the SNPs caused a significant effect on steady state levels of NAT1-specific mRNA, C97T(R33stop), C190T(R64W), C559T (R187stop) and A752T(D251V) each reduced NAT1 protein level and/or N- and O-acetyltransferase catalytic activities to levels below detection. G560A(R187Q) substantially reduced NAT1 protein level and catalytic activities and increased substrate Km. The G445A(V149I), G459A(synonymous) and T640G(S214A) haplotype present in NAT1*11 significantly (p<0.05) increased NAT1 protein level and catalytic activity. Neither T21G(synonymous), T402C(synonymous), A613G(M205V), T777C(synonymous), G781A(E261K), or A787G(I263V) significantly affected Km, catalytic activity, mRNA or protein level. These results suggest heterogeneity among slow NAT1 acetylator phenotypes. PMID:17909564

  2. Associations of the single-nucleotide polymorphisms of the Mina gene with the development of asthma in Chinese Han children: a case-control study.

    PubMed

    Chen, Yun; Yang, Xiqiang; Huang, Ying; Liu, Enmei; Wang, Lijia

    2011-01-01

    The single-nucleotide polymorphisms (SNPs) of the Mina gene in animals are associated with the development of Th2-mediated diseases. However, there is no information whether the association occurs in humans. This case-control study aimed at examining the potential association of the SNP of the Mina gene with the development of asthma in Chinese Han children. The DNA genotypes and serum immunoglobulin E and interleukin-4 levels of 202 asthmatic patients and 191 nonasthmatic subjects were determined by matrix-assisted laser desorption ionization-time of flight mass spectrometry method and enzyme-linked immunosorbent assay, respectively. We found that the frequency of the T allele of rs4857304, but not rs832081, rs832078, rs9879532, and rs17374916, in the Mina gene in asthmatic patients was significantly higher than that of controls (p = 0.0199). Using a recessive model, we found that the percentage of patients with TT homozygous rs4857304 was significantly higher than that of controls (p = 0.0282, odds ratio=1.568, 95% confidence interval=1.048-2.346). Further, the mean levels of serum immunoglobulin E and interleukin-4 in the patients with TT genotype of rs4857304 were significantly higher than that of patients with the G allele (p = 0.000 and p = 0.03, respectively). Apparently, the T allele of rs4857304 of the Mina gene may be associated with increased risk for the development of asthma in Chinese Han children.

  3. Association Genetics of Wood Physical Traits in the Conifer White Spruce and Relationships With Gene Expression

    PubMed Central

    Beaulieu, Jean; Doerksen, Trevor; Boyle, Brian; Clément, Sébastien; Deslauriers, Marie; Beauseigle, Stéphanie; Blais, Sylvie; Poulin, Pier-Luc; Lenz, Patrick; Caron, Sébastien; Rigault, Philippe; Bicho, Paul; Bousquet, Jean; MacKay, John

    2011-01-01

    Marker-assisted selection holds promise for highly influencing tree breeding, especially for wood traits, by considerably reducing breeding cycles and increasing selection accuracy. In this study, we used a candidate gene approach to test for associations between 944 single-nucleotide polymorphism markers from 549 candidate genes and 25 wood quality traits in white spruce. A mixed-linear model approach, including a weak but nonsignificant population structure, was implemented for each marker–trait combination. Relatedness among individuals was controlled using a kinship matrix estimated either from the known half-sib structure or from the markers. Both additive and dominance effect models were tested. Between 8 and 21 single-nucleotide polymorphisms (SNPs) were found to be significantly associated (P ≤ 0.01) with each of earlywood, latewood, or total wood traits. After controlling for multiple testing (Q ≤ 0.10), 13 SNPs were still significant across as many genes belonging to different families, each accounting for between 3 and 5% of the phenotypic variance in 10 wood characters. Transcript accumulation was determined for genes containing SNPs associated with these traits. Significantly different transcript levels (P ≤ 0.05) were found among the SNP genotypes of a 1-aminocyclopropane-1-carboxylate oxidase, a β-tonoplast intrinsic protein, and a long-chain acyl-CoA synthetase 9. These results should contribute toward the development of efficient marker-assisted selection in an economically important tree species. PMID:21385726

  4. Hyperglycemia and a common variant of GCKR are associated with the levels of eight amino acids in 9,369 Finnish men.

    PubMed

    Stancáková, Alena; Civelek, Mete; Saleem, Niyas K; Soininen, Pasi; Kangas, Antti J; Cederberg, Henna; Paananen, Jussi; Pihlajamäki, Jussi; Bonnycastle, Lori L; Morken, Mario A; Boehnke, Michael; Pajukanta, Päivi; Lusis, Aldons J; Collins, Francis S; Kuusisto, Johanna; Ala-Korpela, Mika; Laakso, Markku

    2012-07-01

    We investigated the association of glycemia and 43 genetic risk variants for hyperglycemia/type 2 diabetes with amino acid levels in the population-based Metabolic Syndrome in Men (METSIM) Study, including 9,369 nondiabetic or newly diagnosed type 2 diabetic Finnish men. Plasma levels of eight amino acids were measured with proton nuclear magnetic resonance spectroscopy. Increasing fasting and 2-h plasma glucose levels were associated with increasing levels of several amino acids and decreasing levels of histidine and glutamine. Alanine, leucine, isoleucine, tyrosine, and glutamine predicted incident type 2 diabetes in a 4.7-year follow-up of the METSIM Study, and their effects were largely mediated by insulin resistance (except for glutamine). We also found significant correlations between insulin sensitivity (Matsuda insulin sensitivity index) and mRNA expression of genes regulating amino acid degradation in 200 subcutaneous adipose tissue samples. Only 1 of 43 risk single nucleotide polymorphisms for type 2 diabetes or hyperglycemia, the glucose-increasing major C allele of rs780094 of GCKR, was significantly associated with decreased levels of alanine and isoleucine and elevated levels of glutamine. In conclusion, the levels of branched-chain, aromatic amino acids and alanine increased and the levels of glutamine and histidine decreased with increasing glycemia, reflecting, at least in part, insulin resistance. Only one single nucleotide polymorphism regulating hyperglycemia was significantly associated with amino acid levels.

  5. Hyperglycemia and a Common Variant of GCKR Are Associated With the Levels of Eight Amino Acids in 9,369 Finnish Men

    PubMed Central

    Stančáková, Alena; Civelek, Mete; Saleem, Niyas K.; Soininen, Pasi; Kangas, Antti J.; Cederberg, Henna; Paananen, Jussi; Pihlajamäki, Jussi; Bonnycastle, Lori L.; Morken, Mario A.; Boehnke, Michael; Pajukanta, Päivi; Lusis, Aldons J.; Collins, Francis S.; Kuusisto, Johanna; Ala-Korpela, Mika; Laakso, Markku

    2012-01-01

    We investigated the association of glycemia and 43 genetic risk variants for hyperglycemia/type 2 diabetes with amino acid levels in the population-based Metabolic Syndrome in Men (METSIM) Study, including 9,369 nondiabetic or newly diagnosed type 2 diabetic Finnish men. Plasma levels of eight amino acids were measured with proton nuclear magnetic resonance spectroscopy. Increasing fasting and 2-h plasma glucose levels were associated with increasing levels of several amino acids and decreasing levels of histidine and glutamine. Alanine, leucine, isoleucine, tyrosine, and glutamine predicted incident type 2 diabetes in a 4.7-year follow-up of the METSIM Study, and their effects were largely mediated by insulin resistance (except for glutamine). We also found significant correlations between insulin sensitivity (Matsuda insulin sensitivity index) and mRNA expression of genes regulating amino acid degradation in 200 subcutaneous adipose tissue samples. Only 1 of 43 risk single nucleotide polymorphisms for type 2 diabetes or hyperglycemia, the glucose-increasing major C allele of rs780094 of GCKR, was significantly associated with decreased levels of alanine and isoleucine and elevated levels of glutamine. In conclusion, the levels of branched-chain, aromatic amino acids and alanine increased and the levels of glutamine and histidine decreased with increasing glycemia, reflecting, at least in part, insulin resistance. Only one single nucleotide polymorphism regulating hyperglycemia was significantly associated with amino acid levels. PMID:22553379

  6. Common variants of the EPDR1 gene and the risk of Dupuytren’s disease.

    PubMed

    Dębniak, T; Żyluk, A; Puchalski, P; Serrano-Fernandez, P

    2013-10-01

    The object of this study was the investigation of 3 common variants of single nucleotide polymorphisms of the ependymin-related gene 1 and its association with the occurrence of Dupuytren's disease. DNA samples were obtained from the peripheral blood of 508 consecutive patients. The control group comprised 515 healthy adults who were age-matched with the Dupuytren's patients. 3 common variants were analysed using TaqMan® genotyping assays and sequencing. The differences in the frequencies of variants of single nucleotide polymorphisms in patients and the control group were statistically tested. Additionally, haplotype frequency and linkage disequilibrium were analysed for these variants. A statistically significant association was noted between rs16879765_CT, rs16879765_TT and rs13240429_AA variants and Dupuytren's disease. 2 haplotypes: rs2722280_C+rs13240429_A+rs16879765_C and rs2722280_C+rs13240429_G+rs16879765_T were found to be statistically significantly associated with Dupuytren's disease. Moreover, we found that rs13240429 and rs16879765 variants were in strong linkage disequilibrium, while rs2722280 was only in moderate linkage disequilibrium. No significant differences were found in the frequencies of the variants of the gene between the groups with a positive and negative familial history of Dupuytren's disease. In conclusion, results of this study suggest that EPDR1 gene can be added to a growing list of genes associated with Dupuytren's disease development. © Georg Thieme Verlag KG Stuttgart · New York.

  7. Association of candidate genes with drought tolerance traits in diverse perennial ryegrass accessions

    PubMed Central

    Jiang, Yiwei

    2013-01-01

    Drought is a major environmental stress limiting growth of perennial grasses in temperate regions. Plant drought tolerance is a complex trait that is controlled by multiple genes. Candidate gene association mapping provides a powerful tool for dissection of complex traits. Candidate gene association mapping of drought tolerance traits was conducted in 192 diverse perennial ryegrass (Lolium perenne L.) accessions from 43 countries. The panel showed significant variations in leaf wilting, leaf water content, canopy and air temperature difference, and chlorophyll fluorescence under well-watered and drought conditions across six environments. Analysis of 109 simple sequence repeat markers revealed five population structures in the mapping panel. A total of 2520 expression-based sequence readings were obtained for a set of candidate genes involved in antioxidant metabolism, dehydration, water movement across membranes, and signal transduction, from which 346 single nucleotide polymorphisms were identified. Significant associations were identified between a putative LpLEA3 encoding late embryogenesis abundant group 3 protein and a putative LpFeSOD encoding iron superoxide dismutase and leaf water content, as well as between a putative LpCyt Cu-ZnSOD encoding cytosolic copper-zinc superoxide dismutase and chlorophyll fluorescence under drought conditions. Four of these identified significantly associated single nucleotide polymorphisms from these three genes were also translated to amino acid substitutions in different genotypes. These results indicate that allelic variation in these genes may affect whole-plant response to drought stress in perennial ryegrass. PMID:23386684

  8. Sniffing out significant “Pee values”: genome wide association study of asparagus anosmia

    PubMed Central

    Markt, Sarah C; Nuttall, Elizabeth; Turman, Constance; Sinnott, Jennifer; Rimm, Eric B; Ecsedy, Ethan; Unger, Robert H; Fall, Katja; Finn, Stephen; Jensen, Majken K; Rider, Jennifer R; Kraft, Peter

    2016-01-01

    Objective To determine the inherited factors associated with the ability to smell asparagus metabolites in urine. Design Genome wide association study. Setting Nurses’ Health Study and Health Professionals Follow-up Study cohorts. Participants 6909 men and women of European-American descent with available genetic data from genome wide association studies. Main outcome measure Participants were characterized as asparagus smellers if they strongly agreed with the prompt “after eating asparagus, you notice a strong characteristic odor in your urine,” and anosmic if otherwise. We calculated per-allele estimates of asparagus anosmia for about nine million single nucleotide polymorphisms using logistic regression. P values <5×10-8 were considered as genome wide significant. Results 58.0% of men (n=1449/2500) and 61.5% of women (n=2712/4409) had anosmia. 871 single nucleotide polymorphisms reached genome wide significance for asparagus anosmia, all in a region on chromosome 1 (1q44: 248139851-248595299) containing multiple genes in the olfactory receptor 2 (OR2) family. Conditional analyses revealed three independent markers associated with asparagus anosmia: rs13373863, rs71538191, and rs6689553. Conclusion A large proportion of people have asparagus anosmia. Genetic variation near multiple olfactory receptor genes is associated with the ability of an individual to smell the metabolites of asparagus in urine. Future replication studies are necessary before considering targeted therapies to help anosmic people discover what they are missing. PMID:27965198

  9. Association of the AA genotype of the BCL2 (-938C>A) promoter polymorphism with better survival in ovarian cancer.

    PubMed

    Heubner, Martin; Wimberger, Pauline; Otterbach, Friedrich; Kasimir-Bauer, Sabine; Siffert, Winfried; Kimmig, Rainer; Nückel, Holger

    2009-01-01

    Bcl-2 plays a key role in the regulation of apoptosis. Recently, a novel regulatory single nucleotide polymorphism (-938C>A) in the inhibitory P2 BCL2 promoter was described. In this study we investigated its potential association with survival in epithelial ovarian cancer. Patients (n=110) with primary epithelial ovarian cancer were retrospectively genotyped by pyrosequencing. Genotype distribution was not significantly different between 110 ovarian cancer patients and 120 healthy controls, suggesting that genotypes of this polymorphism do not increase the susceptibility to ovarian cancer. Kaplan-Meier curves showed a significant association of the AA genotype with increased survival (p=0.002). Multivariate analysis revealed that the BCL2-938AC/CC genotype (hazard ratio 4.5; p=0.003) was an independent prognostic factor compared to other prognostic factors such as age, histological grade or tumor stage. The results suggest a role for the BCL2-938C>A polymorphism as a marker for survival in patients with epithelial ovarian cancer.

  10. Polymorphisms in HLA-DPB1 Are Associated With Differences in Rubella Virus–Specific Humoral Immunity After Vaccination

    PubMed Central

    Lambert, Nathaniel D.; Haralambieva, Iana H.; Kennedy, Richard B.; Ovsyannikova, Inna G.; Pankratz, Vernon Shane; Poland, Gregory A.

    2015-01-01

    Vaccination with live attenuated rubella virus induces a strong immune response in most individuals. However, small numbers of subjects never reach or maintain protective antibody levels, and there is a high degree of variability in immune response. We have previously described genetic polymorphisms in HLA and other candidate genes that are associated with interindividual differences in humoral immunity to rubella virus. To expand our previous work, we performed a genome-wide association study (GWAS) to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus–specific neutralizing antibodies. We identified rs2064479 in the HLA-DPB1 genetic region as being significantly associated with humoral immune response variations after rubella vaccination (P = 8.62 × 10−8). All other significant SNPs in this GWAS were located near the HLA-DPB1 gene (P ≤ 1 × 10−7). These findings demonstrate that polymorphisms in HLA-DPB1 are strongly associated with interindividual differences in neutralizing antibody levels to rubella vaccination and represent a validation of our previous HLA work. PMID:25293367

  11. The effects of non-synonymous single nucleotide polymorphisms (nsSNPs) on protein-protein interactions.

    PubMed

    Yates, Christopher M; Sternberg, Michael J E

    2013-11-01

    Non-synonymous single nucleotide polymorphisms (nsSNPs) are single base changes leading to a change to the amino acid sequence of the encoded protein. Many of these variants are associated with disease, so nsSNPs have been well studied, with studies looking at the effects of nsSNPs on individual proteins, for example, on stability and enzyme active sites. In recent years, the impact of nsSNPs upon protein-protein interactions has also been investigated, giving a greater insight into the mechanisms by which nsSNPs can lead to disease. In this review, we summarize these studies, looking at the various mechanisms by which nsSNPs can affect protein-protein interactions. We focus on structural changes that can impair interaction, changes to disorder, gain of interaction, and post-translational modifications before looking at some examples of nsSNPs at human-pathogen protein-protein interfaces and the analysis of nsSNPs from a network perspective. © 2013.

  12. High-resolution single-nucleotide polymorphism array-profiling in myeloproliferative neoplasms identifies novel genomic aberrations

    PubMed Central

    Stegelmann, Frank; Bullinger, Lars; Griesshammer, Martin; Holzmann, Karlheinz; Habdank, Marianne; Kuhn, Susanne; Maile, Carmen; Schauer, Stefanie; Döhner, Hartmut; Döhner, Konstanze

    2010-01-01

    Single-nucleotide polymorphism arrays allow for genome-wide profiling of copy-number alterations and copy-neutral runs of homozygosity at high resolution. To identify novel genetic lesions in myeloproliferative neoplasms, a large series of 151 clinically well characterized patients was analyzed in our study. Copy-number alterations were rare in essential thrombocythemia and polycythemia vera. In contrast, approximately one third of myelofibrosis patients exhibited small genomic losses (less than 5 Mb). In 2 secondary myelofibrosis cases the tumor suppressor gene NF1 in 17q11.2 was affected. Sequencing analyses revealed a mutation in the remaining NF1 allele of one patient. In terms of copy-neutral aberrations, no chromosomes other than 9p were recurrently affected. In conclusion, novel genomic aberrations were identified in our study, in particular in patients with myelofibrosis. Further analyses on single-gene level are necessary to uncover the mechanisms that are involved in the pathogenesis of myeloproliferative neoplasms. PMID:20015882

  13. Evidence for association between Disrupted-in-schizophrenia 1 (DISC1) gene polymorphisms and autism in Chinese Han population: a family-based association study

    PubMed Central

    2011-01-01

    Background Disrupted-in-Schizophrenia 1 (DISC1) gene is one of the most promising candidate genes for major mental disorders. In a previous study, a Finnish group demonstrated that DISC1 polymorphisms were associated with autism and Asperger syndrome. However, the results were not replicated in Korean population. To determine whether DISC1 is associated with autism in Chinese Han population, we performed a family-based association study between DISC1 polymorphisms and autism. Methods We genotyped seven tag single nucleotide polymorphisms (SNPs) in DISC1, spanning 338 kb, in 367 autism trios (singleton and their biological parents) including 1,101 individuals. Single SNP association and haplotype association analysis were performed using the family-based association test (FBAT) and Haploview software. Results We found three SNPs showed significant associations with autism (rs4366301: G > C, Z = 2.872, p = 0.004; rs11585959: T > C, Z = 2.199, p = 0.028; rs6668845: A > G, Z = 2.326, p = 0.02). After the Bonferroni correction, SNP rs4366301, which located in the first intron of DISC1, remained significant. When haplotype were constructed with two-markers, three haplotypes displayed significant association with autism. These results were still significant after using the permutation method to obtain empirical p values. Conclusions Our study provided evidence that the DISC1 may be the susceptibility gene of autism. It suggested DISC1 might play a role in the pathogenesis of autism. PMID:21569632

  14. Provitamin A accumulation in cassava (Manihot esculenta) roots driven by a single nucleotide polymorphism in a phytoene synthase gene.

    PubMed

    Welsch, Ralf; Arango, Jacobo; Bär, Cornelia; Salazar, Bertha; Al-Babili, Salim; Beltrán, Jesús; Chavarriaga, Paul; Ceballos, Hernan; Tohme, Joe; Beyer, Peter

    2010-10-01

    Cassava (Manihot esculenta) is an important staple crop, especially in the arid tropics. Because roots of commercial cassava cultivars contain a limited amount of provitamin A carotenoids, both conventional breeding and genetic modification are being applied to increase their production and accumulation to fight vitamin A deficiency disorders. We show here that an allelic polymorphism in one of the two expressed phytoene synthase (PSY) genes is capable of enhancing the flux of carbon through carotenogenesis, thus leading to the accumulation of colored provitamin A carotenoids in storage roots. A single nucleotide polymorphism present only in yellow-rooted cultivars cosegregates with colored roots in a breeding pedigree. The resulting amino acid exchange in a highly conserved region of PSY provides increased catalytic activity in vitro and is able to increase carotenoid production in recombinant yeast and Escherichia coli cells. Consequently, cassava plants overexpressing a PSY transgene produce yellow-fleshed, high-carotenoid roots. This newly characterized PSY allele provides means to improve cassava provitamin A content in cassava roots through both breeding and genetic modification.

  15. Discovery and mapping of a new expressed sequence tag-single nucleotide polymorphism and simple sequence repeat panel for large-scale genetic studies and breeding of Theobroma cacao L.

    PubMed Central

    Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire

    2012-01-01

    Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr. PMID:22210604

  16. Provitamin A Accumulation in Cassava (Manihot esculenta) Roots Driven by a Single Nucleotide Polymorphism in a Phytoene Synthase Gene[W

    PubMed Central

    Welsch, Ralf; Arango, Jacobo; Bär, Cornelia; Salazar, Bertha; Al-Babili, Salim; Beltrán, Jesús; Chavarriaga, Paul; Ceballos, Hernan; Tohme, Joe; Beyer, Peter

    2010-01-01

    Cassava (Manihot esculenta) is an important staple crop, especially in the arid tropics. Because roots of commercial cassava cultivars contain a limited amount of provitamin A carotenoids, both conventional breeding and genetic modification are being applied to increase their production and accumulation to fight vitamin A deficiency disorders. We show here that an allelic polymorphism in one of the two expressed phytoene synthase (PSY) genes is capable of enhancing the flux of carbon through carotenogenesis, thus leading to the accumulation of colored provitamin A carotenoids in storage roots. A single nucleotide polymorphism present only in yellow-rooted cultivars cosegregates with colored roots in a breeding pedigree. The resulting amino acid exchange in a highly conserved region of PSY provides increased catalytic activity in vitro and is able to increase carotenoid production in recombinant yeast and Escherichia coli cells. Consequently, cassava plants overexpressing a PSY transgene produce yellow-fleshed, high-carotenoid roots. This newly characterized PSY allele provides means to improve cassava provitamin A content in cassava roots through both breeding and genetic modification. PMID:20889914

  17. Using PCR-RFLP technology to teach single nucleotide polymorphism for undergraduates.

    PubMed

    Zhang, Bo; Wang, Yan; Xu, Xiaofeng; Guan, Xingying; Bai, Yun

    2013-01-01

    Recent studies indicated that the aberrant gene expression of peroxiredoxin-6 (prdx6) was found in various kinds of cancers. Because of its biochemical function and gene expression pattern in cancer cells, the association between genetic polymorphism of Prdx6 and cancer onset is interesting. In this report, we have developed and implemented a serial experiment in molecular biology laboratory course to teach single nucleotide polymorphism (SNP) to undergraduate students majoring in molecular biology or genetics. The flanking sequence of rs4382766 was located in Prdx6 gene, which contained a restriction site of SspI, and was used as a target in this lab course. The students could mimic real research by integrating different techniques, such as database retrieving, genomic DNA isolation, PCR, and restriction enzyme assay. This serial experiment of PCR-RFLP helps students set up intact idea of molecular biology and understand the relation among individual experiments. Students were found to be more enthusiastic during the laboratory classes than those in the former curriculum. Copyright © 2013 Wiley Periodicals, Inc.

  18. Predicting the disease of Alzheimer with SNP biomarkers and clinical data using data mining classification approach: decision tree.

    PubMed

    Erdoğan, Onur; Aydin Son, Yeşim

    2014-01-01

    Single Nucleotide Polymorphisms (SNPs) are the most common genomic variations where only a single nucleotide differs between individuals. Individual SNPs and SNP profiles associated with diseases can be utilized as biological markers. But there is a need to determine the SNP subsets and patients' clinical data which is informative for the diagnosis. Data mining approaches have the highest potential for extracting the knowledge from genomic datasets and selecting the representative SNPs as well as most effective and informative clinical features for the clinical diagnosis of the diseases. In this study, we have applied one of the widely used data mining classification methodology: "decision tree" for associating the SNP biomarkers and significant clinical data with the Alzheimer's disease (AD), which is the most common form of "dementia". Different tree construction parameters have been compared for the optimization, and the most accurate tree for predicting the AD is presented.

  19. Single nucleotide polymorphism of CC chemokine ligand 5 promoter gene in recipients may predict the risk of chronic graft-versus-host disease and its severity after allogeneic transplantation.

    PubMed

    Kim, Dong Hwan; Jung, Hee Du; Lee, Nan Young; Sohn, Sang Kyun

    2007-10-15

    Leukocyte trafficking, regulated by chemokine ligands and their receptors, involves in the pathogenesis of graft-versus-host disease (GVHD) including CC ligand 5 (CCL5) or CC receptor 5 (CCR5). The current study analyzed the association of acute or chronic GVHD (cGVHD) with the CCR5/CCL5 gene single nucleotide polymorphisms (SNPs) of recipients and donors. We evaluated the SNPs of CCL5 promoter gene at position -28 (rs1800825)/-403 (rs2107538) and CCR5 gene at 59029 (rs1799987) in 72 recipients and donors using polymerase chain reaction/RFLP (Restriction Fragment Length Polymorphism) methods. With a median follow up of 924 days for survivors (range 48-2,360 days), the CG genotype of CCL5 gene at position -28 in recipients was significantly associated with a higher incidence of cGVHD (P=0.004), extensive cGVHD (P=0.038 by Seattle's criteria), and severe grade of cGVHD at presentation (P=0.017 by prognostic grading by Apkek et al.) compared to CC genotype. In terms of haplotype analysis, the recipients with AG haplotype of CCL5 gene also showed a higher incidence of cGVHD (P=0.003), extensive cGVHD (P=0.023), and more severe grade of cGVHD (P=0.020). However, there was no association of CCL5/CCR5 SNPs with acute GVHD. The donors' genotype of CCL5/CCR5 was not associated with the risk of cGVHD. The CCL5 promoter gene polymorphism of recipients was associated with the risk of cGVHD and its severity. The current study suggested an involvement of CCL5 in leukocyte trafficking for the development of cGVHD.

  20. CC Genotype Donors for the Interleukin-28B Single-Nucleotide Polymorphism are Associated with Better Outcomes in Hepatitis C after Liver Transplant

    PubMed Central

    Firpi, Roberto J.; Dong, Huijia; Clark, Virginia C.; Soldevila-Pico, Consuelo; Morelli, Giuseppe; Cabrera, Roniel; Norkina, Oxana; Shuster, Jonathan J.; Nelson, David R.; Liu, Chen

    2012-01-01

    Background/Aims Interleukin-28B (IL-28B) polymorphism is the strongest pretreatment predictor of viral clearance in the hepatitis C (HCV) population. Donor and recipient IL-28B genomic background may play an important role in post-transplant HCV recurrence. We sought to examine the role of IL-28B polymorphisms of donor and recipients in liver transplant patients with recurrent HCV and its impact on the response to interferon-based therapy. Methods The cohort study consisted of 135 adult liver transplant patients who received interferon-based therapy for recurrent HCV between 1996 and 2005 at the University of Florida. IL-28B single nucleotide polymorphism (rs. 12979860) was characterized using liver tissue from all donors and recipients. Results The CC genotype was observed in approximately 30% of donors and recipients. Sustained viral response (SVR) to HCV therapy was 100% if both recipient and donor were CC genotype, while the SVR was only 25% if neither donor nor recipient had a CC genotype. (Recipient, p=0.025, Donor, p<0.001). Recipients and donors with CC genotype had less fibrosis than recipients with genotypes CT and TT, but the difference was not statistically significant. IL-28B genotype did not seem to play a role in the overall survival in these patients. Conclusion In conclusion, recipient and donor CC genotype is associated with a better treatment response to interferon-based therapy after liver transplant. Our study suggests that using CC genotype donor livers for HCV patients may improve the overall clinical outcome after liver transplantation. PMID:23107586

  1. Genome-wide association study reveals putative regulators of bioenergy traits in Populus deltoides

    DOE PAGES

    Fahrenkrog, Annette M.; Neves, Leandro G.; Resende, Jr., Marcio F. R.; ...

    2016-09-06

    Genome-wide association studies (GWAS) have been used extensively to dissect the genetic regulation of complex traits in plants. These studies have focused largely on the analysis of common genetic variants despite the abundance of rare polymorphisms in several species, and their potential role in trait variation. Here, we conducted the first GWAS in Populus deltoides, a genetically diverse keystone forest species in North America and an important short rotation woody crop for the bioenergy industry. We searched for associations between eight growth and wood composition traits, and common and low-frequency single-nucleotide polymorphisms detected by targeted resequencing of 18 153 genesmore » in a population of 391 unrelated individuals. To increase power to detect associations with low-frequency variants, multiple-marker association tests were used in combination with single-marker association tests. Significant associations were discovered for all phenotypes and are indicative that low-frequency polymorphisms contribute to phenotypic variance of several bioenergy traits. Our results suggest that both common and low-frequency variants need to be considered for a comprehensive understanding of the genetic regulation of complex traits, particularly in species that carry large numbers of rare polymorphisms. Lastly, these polymorphisms may be critical for the development of specialized plant feedstocks for bioenergy.« less

  2. Association study of ghrelin receptor gene polymorphisms in rheumatoid arthritis.

    PubMed

    Robledo, G; Rueda, B; Gonzalez-Gay, M A; Fernández, B; Lamas, J R; Balsa, A; Pascual-Salcedo, D; García, A; Raya, E; Martín, J

    2010-01-01

    Ghrelin is a newly characterised growth hormone (GH) releasing peptide widely distributed that may play an important role in the regulation of metabolic balance in inflammatory diseases such as rheumatoid arthritis (RA) by decreasing the pro-inflammatory Th1 responses. In this study we investigated the possible contribution of several polymorphisms in the functional Ghrelin receptor to RA susceptibility. A screening of 3 single nucleotide polymorphisms (SNPs) was performed in a total of 950 RA patients and 990 healthy controls of Spanish Caucasian origin. Genotyping of all 3 SNPs was performed by real-time polymerase chain reaction technology, using the TaqMan 5'-allele discrimination assay. We observed no statistically significant deviation between RA patients and controls for the GHSR SNPs analysed. In addition, we performed a haplotype analysis that did not reveal an association with RA susceptibility. The stratification analysis for the presence of shared epitope (SE), rheumatoid factor (RF) or antibodies anti cyclic citrullinated peptide (anti-CCP) did not detect significant association of the GHSR polymorphisms with RA. These findings suggest that the GHSR gene polymorphisms do not appear to play a major role in RA genetic predisposition in our population.

  3. Association of adiponectin gene polymorphism (+T45G) with acute coronary syndrome and circulating adiponectin levels.

    PubMed

    Rizk, Nasser M; El-Menyar, Ayman; Marei, Isra; Sameer, Maha; Musad, Tasneem; Younis, Dima; Farag, Fathi; Basem, Nora; Al-Ali, Khalid; Al Suwaidi, Jassim

    2013-05-01

    We investigated the association of adiponectin gene polymorphisms (+T45G and +G276T) and adiponectin levels with acute coronary syndrome (ACS) among Arabs in Qatar. A case-control study was performed in 142 Arab patients with ACS and 122 controls. Genotypes were determined using TaqMan real-time polymerase chain reaction assay. The TT, TG, and GG genotype frequencies of the T45G variant were significantly different among cases and controls (P = .023) but not significant for G276T genotypic frequencies. It was found that only the +45G allele was significantly associated with 3-fold increased risk of ACS (odds ratio = 2.77; 1.03-6.96; P = .043) among patients, using the genetic recessive model. Carriers of GG alleles had significantly lower adiponectin levels compared to TT/TG carriers of T45G in patients with ACS. The present study suggests that only T45G single-nucleotide polymorphism in the adiponectin gene is associated with higher odds for ACS events and has an effect on serum adiponectin levels among Arab populations.

  4. Cloning of polymorphisms (COP): enrichment of polymorphic sequences from complex genomes

    PubMed Central

    Li, Jingfeng; Wang, Fuli; Zabarovska, Veronika; Wahlestedt, Claes; Zabarovsky, Eugene R.

    2000-01-01

    Here we describe a new procedure (cloning of polymorphisms, COP) for enrichment of single nucleotide polymorphisms (SNPs) that represent restriction fragment length polymorphisms (RFLPs). COP would be applicable to the isolation of SNPs from particular regions of the genome, e.g. CpG islands, chromosomal bands, YACs or PAC contigs. A combination of digestion with restriction enzymes, treatment with uracil-DNA glycosylase and mung bean nuclease, PCR amplification and purification with streptavidin magnetic beads was used to isolate polymorphic sequences from the genomes of two human samples. After only two cycles of enrichment, 80% of the isolated clones were found to contain RFLPs. A simple method for the PCR detection of these polymorphisms was also developed. PMID:10606669

  5. Inverse correlation between HPSE gene single nucleotide polymorphisms and heparanase expression: possibility of multiple levels of heparanase regulation

    PubMed Central

    Ostrovsky, Olga; Korostishevsky, Michael; Shafat, Itay; Mayorov, Margarita; Ilan, Neta; Vlodavsky, Israel; Nagler, Arnon

    2009-01-01

    Heparanase is an endo-β-glucuronidase that specifically cleaves the saccharide chains of heparan sulfate proteoglycans. Heparanase plays important roles in processes such as angiogenesis, tumor metastasis, tissue repair and remodeling, inflammation and autoimmunity. Genetic variations of the heparanase gene (HPSE) have been associated with heparanase transcription level. The present study was undertaken to identify haplotype or single nucleotide polymorphisms (SNPs) genotype combinations that correlate with heparanase expression both at the mRNA and protein levels. For this purpose, 11 HPSE gene SNPs were genotyped among 108 healthy individuals. Five out of the eleven polymorphisms revealed an association between the SNPs and heparanase expression. SNP rs4693608 exhibited a strong evidence of association. Analysis of haplotypes distribution revealed that the combination of two SNPs (rs4693608 and rs4364254) disclosed the most significant result. This approach allowed segregation of possible genotype combinations to three groups that correlate with low (LR: GG-CC, GG-CT, GG-TT, GA-CC), intermediate (MR: GA-CT, GA-TT) and high (HR: AA-TT, AA-CT) heparanase expression. Unexpectedly, LR genotype combinations were associated with low mRNA expressions level and high heparanase concentration in plasma, while HR genotype combinations were associated with high expression of mRNA and low plasma protein level. Because the main site of activity of secreted active heparanase is the extracellular matrix and cell surface, the origin and functional significance of plasma heparanase remain to be investigated. The current study indicates that rs4693608 and rs4364254 SNPs are involved in the regulation of heparanase expression and provides the basis for further studies on the association between HPSE gene SNPs and disease outcome. PMID:19406828

  6. Effects of IL1B single nucleotide polymorphisms on depressive and anxiety symptoms are determined by severity and type of life stress.

    PubMed

    Kovacs, David; Eszlari, Nora; Petschner, Peter; Pap, Dorottya; Vas, Szilvia; Kovacs, Peter; Gonda, Xenia; Juhasz, Gabriella; Bagdy, Gyorgy

    2016-08-01

    Interleukin-1β is one of the main mediators in the cross-talk between the immune system and the central nervous system. Higher interleukin-1β levels are found in mood spectrum disorders, and the stress-induced expression rate of the interleukin-1β gene (IL1B) is altered by polymorphisms in the region. Therefore we examined the effects of rs16944 and rs1143643 single nucleotide polymorphisms (SNPs) within the IL1B gene on depressive and anxiety symptoms, as measured by the Brief Symptom Inventory, in a Hungarian population sample of 1053 persons. Distal and proximal environmental stress factors were also included in our analysis, namely childhood adversity and recent negative life-events. We found that rs16944 minor (A) allele specifically interacted with childhood adversity increasing depressive and anxiety symptoms, while rs1143643's minor (A) allele showed protective effect against depressive symptoms after recent life stress. The genetic main effects of the two SNPs were not significant in the main analysis, but the interaction effects remained significant after correction for multiple testing. In addition, the effect of rs16944 A allele was reversed in a subsample with low-exposure to life stress, suggesting a protective effect against depressive symptoms, in the post hoc analysis. In summary, both of the two IL1B SNPs showed specific environmental stressor-dependent effects on mood disorder symptoms. We also demonstrated that the presence of exposure to childhood adversity changed the direction of the rs16944 effect on depression phenotype. Therefore our results suggest that it is advisable to include environmental factors in genetic association studies when examining the effect of the IL1B gene. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  7. Kaposi's Sarcoma-Associated Herpesvirus MicroRNA Single-Nucleotide Polymorphisms Identified in Clinical Samples Can Affect MicroRNA Processing, Level of Expression, and Silencing Activity

    PubMed Central

    Han, Soo-Jin; Marshall, Vickie; Barsov, Eugene; Quiñones, Octavio; Ray, Alex; Labo, Nazzarena; Trivett, Matthew; Ott, David; Renne, Rolf

    2013-01-01

    Kaposi's sarcoma-associated herpesvirus (KSHV) encodes 12 pre-microRNAs that can produce 25 KSHV mature microRNAs. We previously reported single-nucleotide polymorphisms (SNPs) in KSHV-encoded pre-microRNA and mature microRNA sequences from clinical samples (V. Marshall et al., J. Infect. Dis., 195:645–659, 2007). To determine whether microRNA SNPs affect pre-microRNA processing and, ultimately, mature microRNA expression levels, we performed a detailed comparative analysis of (i) mature microRNA expression levels, (ii) in vitro Drosha/Dicer processing, and (iii) RNA-induced silencing complex-dependent targeting of wild-type (wt) and variant microRNA genes. Expression of pairs of wt and variant pre-microRNAs from retroviral vectors and measurement of KSHV mature microRNA expression by real-time reverse transcription-PCR (RT-PCR) revealed differential expression levels that correlated with the presence of specific sequence polymorphisms. Measurement of KSHV mature microRNA expression in a panel of primary effusion lymphoma cell lines by real-time RT-PCR recapitulated some observed expression differences but suggested a more complex relationship between sequence differences and expression of mature microRNA. Furthermore, in vitro maturation assays demonstrated significant SNP-associated changes in Drosha/DGCR8 and/or Dicer processing. These data demonstrate that SNPs within KSHV-encoded pre-microRNAs are associated with differential microRNA expression levels. Given the multiple reports on the involvement of microRNAs in cancer, the biological significance of these phenotypic and genotypic variants merits further studies in patients with KSHV-associated malignancies. PMID:24006441

  8. ABCB1 genetic variability and methadone dosage requirements in opioid-dependent individuals.

    PubMed

    Coller, Janet K; Barratt, Daniel T; Dahlen, Karianne; Loennechen, Morten H; Somogyi, Andrew A

    2006-12-01

    The most common treatment for opioid dependence is substitution therapy with another opioid such as methadone. The methadone dosage is individualized but highly variable, and program retention rates are low due in part to nonoptimal dosing resulting in withdrawal symptoms and further heroin craving and use. Methadone is a substrate for the P-glycoprotein transporter, encoded by the ABCB1 gene, which regulates central nervous system exposure. This retrospective study aimed to investigate the influence of ABCB1 genetic variability on methadone dose requirements. Genomic deoxyribonucleic acid was isolated from opioid-dependent subjects (n = 60) and non-opioid-dependent control subjects (n = 60), and polymerase chain reaction-restriction fragment length polymorphism and allele-specific polymerase chain reaction were used to determine the presence of single nucleotide polymorphisms at positions 61, 1199, 1236, 2677, and 3435. ABCB1 haplotypes were inferred with PHASE software (version 2.1). There were no significant differences in the allele or genotype frequencies of the individual single nucleotide polymorphisms or haplotypes between the 2 populations. ABCB1 genetic variability influenced daily methadone dose requirements, such that subjects carrying 2 copies of the wild-type haplotype required higher doses compared with those with 1 copy and those with no copies (98.3 +/- 10.4, 58.6 +/- 20.9, and 55.4 +/- 26.1 mg/d, respectively; P = .029). In addition, carriers of the AGCTT haplotype required significantly lower doses than noncarriers (38.0 +/- 16.8 and 61.3 +/- 24.6 mg/d, respectively; P = .04). Although ABCB1 genetic variability is not related to the development of opioid dependence, identification of variant haplotypes may, after larger prospective studies have been performed, provide clinicians with a tool for methadone dosage individualization.

  9. Large-Scale Development of Cost-Effective Single-Nucleotide Polymorphism Marker Assays for Genetic Mapping in Pigeonpea and Comparative Mapping in Legumes

    PubMed Central

    Saxena, Rachit K.; Varma Penmetsa, R.; Upadhyaya, Hari D.; Kumar, Ashish; Carrasquilla-Garcia, Noelia; Schlueter, Jessica A.; Farmer, Andrew; Whaley, Adam M.; Sarma, Birinchi K.; May, Gregory D.; Cook, Douglas R.; Varshney, Rajeev K.

    2012-01-01

    Single-nucleotide polymorphisms (SNPs, >2000) were discovered by using RNA-seq and allele-specific sequencing approaches in pigeonpea (Cajanus cajan). For making the SNP genotyping cost-effective, successful competitive allele-specific polymerase chain reaction (KASPar) assays were developed for 1616 SNPs and referred to as PKAMs (pigeonpea KASPar assay markers). Screening of PKAMs on 24 genotypes [23 from cultivated species and 1 wild species (Cajanus scarabaeoides)] defined a set of 1154 polymorphic markers (77.4%) with a polymorphism information content (PIC) value from 0.04 to 0.38. One thousand and ninety-four PKAMs showed polymorphisms between parental lines of the reference mapping population (C. cajan ICP 28 × C. scarabaeoides ICPW 94). By using high-quality marker genotyping data on 167 F2 lines from the population, a comprehensive genetic map comprising 875 PKAMs with an average inter-marker distance of 1.11 cM was developed. Previously mapped 35 simple sequence repeat markers were integrated into the PKAM map and an integrated genetic map of 996.21 cM was constructed. Mapped PKAMs showed a higher degree of synteny with the genome of Glycine max followed by Medicago truncatula and Lotus japonicus and least with Vigna unguiculata. These PKAMs will be useful for genetics research and breeding applications in pigeonpea and for utilizing genome information from other legume species. PMID:23103470

  10. Association between RTEL1 gene polymorphisms and COPD susceptibility in a Chinese Han population

    PubMed Central

    Ding, Yipeng; Xu, Heping; Yao, Jinjian; Xu, Dongchuan; He, Ping; Yi, Shengyang; Li, Quanni; Liu, Yuanshui; Wu, Cibing; Tian, Zhongjie

    2017-01-01

    Objective We investigated the association between single-nucleotide polymorphisms in regulation of telomere elongation helicase 1 (RTEL1), which has been associated with telomere length in several brain cancers and age-related diseases, and the risk of chronic obstructive pulmonary disease (COPD) in a Chinese Han population. Methods In a case–control study that included 279 COPD cases and 290 healthy controls, five single-nucleotide polymorphisms in RTEL1 were selected and genotyped using the Sequenom MassARRAY platform. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated using unconditional logistic regression after adjusting for age and gender. Results In the genotype model analysis, we determined that rs4809324 polymorphism had a decreased effect on the risk of COPD (CC versus TT: OR =0.28; 95% CI =0.10–0.82; P=0.02). In the genetic model analysis, we found that the “C/C” genotype of rs4809324 was associated with a decreased risk of COPD based on the codominant model (OR =0.33; 95% CI =0.13–0.86; P=0.022) and recessive model (OR =0.32; 95% CI =0.12–0.80; P=0.009). Conclusion Our data shed new light on the association between genetic polymorphisms of RTEL1 and COPD susceptibility in the Chinese Han population. PMID:28360516

  11. The multivariate association between genomewide DNA methylation and climate across the range of Arabidopsis thaliana.

    PubMed

    Keller, Thomas E; Lasky, Jesse R; Yi, Soojin V

    2016-04-01

    Epigenetic changes can occur due to extracellular environmental conditions. Consequently, epigenetic mechanisms can play an intermediate role to translate environmental signals to intracellular changes. Such a role might be particularly important in plants, which often show strong local adaptation and have the potential for heritable epigenetic states. However, little is currently known about the role of epigenetic variation in the ecological mechanisms of adaptation. Here, we used multivariate redundancy analyses to examine genomewide associations between DNA methylation polymorphisms and climate variation in two independent panels of Arabidopsis accessions, including 122 Eurasian accessions as well as in a regional panel of 148 accessions in Sweden. At the single-nucleotide methylation level, climate and space (geographic spatial structure) explain small yet significant amount of variation in both panels. On the other hand, when viewed in a context of genomic clusters of methylated and unmethylated cytosines, climate and space variables explain much greater amounts of variation in DNA methylation than those explained by variation at the single-nucleotide level. We found that the single-nucleotide methylation polymorphisms with the strongest associations with climate were enriched in transposable elements and in potentially RNA-directed methylation contexts. When viewed in the context of genomic clusters, variation of DNA methylation at different sequence contexts exhibit distinctive segregation along different axes of variation in the redundancy analyses. Genomewide methylation showed much stronger associations with climate within the regional panel (Sweden) compared to the global (Eurasia). Together, these findings indicate that genetic and epigenetic variation across the genome may play a role in response to climate conditions and local adaptation. © 2016 John Wiley & Sons Ltd.

  12. [Intra- and interpopulation variability of southwestern Kamchatka sockeye salmon Oncorhynchus nerka inferred from the data on single nucleotide polymorphism].

    PubMed

    Khrustaleva, A M; Klovach, N V; Gritsenko, O F; Seeb, J E

    2014-07-01

    The variability of 45 single nucleotide polymorphism (SNP) loci was studied in nine samples of the sockeye salmon Oncorhynchus nerka from the rivers of southwestern Kamchatka. The Wahlund effect, gametic disequilibrium at some loci, and a decrease in interpopulation genetic diversity estimates observed in samples from the Bolshaya River outlet are explained in terms of the samples' heterogeneity. Partitioning of mixed samples using some biological characteristics of the individuals led to a noticeable decrease in the frequency of these phenomena. It was demonstrated that the allelic diversity between the populations within the river Plotnikovs accounted for the larger part of genetic variation, as compared to the differentiation between the basins. The SNP loci responsible for intra- and interpopulation differentiation of sockeye salmon from the rivers of southwestern Kamchatka were identified. Some recommendations for field population genetic studies of Asian sockeye salmon were formulated.

  13. L-RCA (ligation-rolling circle amplification): a general method for genotyping of single nucleotide polymorphisms (SNPs)

    PubMed Central

    Qi, Xiaoquan; Bakht, Saleha; Devos, Katrien M.; Gale, Mike D.; Osbourn, Anne

    2001-01-01

    A flexible, non-gel-based single nucleotide polymorphism (SNP) detection method is described. The method adopts thermostable ligation for allele discrimination and rolling circle amplification (RCA) for signal enhancement. Clear allelic discrimination was achieved after staining of the final reaction mixtures with Cybr-Gold and visualisation by UV illumination. The use of a compatible buffer system for all enzymes allows the reaction to be initiated and detected in the same tube or microplate well, so that the experiment can be scaled up easily for high-throughput detection. Only a small amount of DNA (i.e. 50 ng) is required per assay, and use of carefully designed short padlock probes coupled with generic primers and probes make the SNP detection cost effective. Biallelic assay by hybridisation of the RCA products with fluorescence dye-labelled probes is demonstrated, indicating that ligation-RCA (L-RCA) has potential for multiplexed assays. PMID:11713336

  14. A Simple Sequence Repeat- and Single-Nucleotide Polymorphism-Based Genetic Linkage Map of the Brown Planthopper, Nilaparvata lugens

    PubMed Central

    Jairin, Jirapong; Kobayashi, Tetsuya; Yamagata, Yoshiyuki; Sanada-Morimura, Sachiyo; Mori, Kazuki; Tashiro, Kosuke; Kuhara, Satoru; Kuwazaki, Seigo; Urio, Masahiro; Suetsugu, Yoshitaka; Yamamoto, Kimiko; Matsumura, Masaya; Yasui, Hideshi

    2013-01-01

    In this study, we developed the first genetic linkage map for the major rice insect pest, the brown planthopper (BPH, Nilaparvata lugens). The linkage map was constructed by integrating linkage data from two backcross populations derived from three inbred BPH strains. The consensus map consists of 474 simple sequence repeats, 43 single-nucleotide polymorphisms, and 1 sequence-tagged site, for a total of 518 markers at 472 unique positions in 17 linkage groups. The linkage groups cover 1093.9 cM, with an average distance of 2.3 cM between loci. The average number of marker loci per linkage group was 27.8. The sex-linkage group was identified by exploiting X-linked and Y-specific markers. Our linkage map and the newly developed markers used to create it constitute an essential resource and a useful framework for future genetic analyses in BPH. PMID:23204257

  15. Pneumonic Plague Outbreak, Northern Madagascar, 2011

    PubMed Central

    Richard, Vincent; Herindrainy, Perlinot; Soanandrasana, Rahelinirina; Ratsitoharina, Maherisoa; Rakotomanana, Fanjasoa; Andrianalimanana, Samuel; Scholz, Holger C.; Rajerison, Minoarisoa

    2015-01-01

    Yersinia pestis, the causative agent of plague, is endemic to Madagascar, particularly to the central highlands. Although plague has not been previously reported in northern Madagascar, an outbreak of pneumonic plague occurred in this remote area in 2011. Over a 27-day period, 17 suspected, 2 presumptive, and 3 confirmed human cases were identified, and all 15 untreated 20 patients died. Molecular typing of Y. pestis isolated from 2 survivors and 5 Rattus rattus rat samples identified the Madagascar-specific 1.ORI3-k single-nucleotide polymorphism genotype and 4 clustered regularly interspaced short palindromic repeat patterns. This outbreak had a case-fatality rate of 100% for nontreated patients. The Y. pestis 1.ORI3-k single-nucleotide polymorphism genotype might cause larger epidemics. Multidrug-resistant strains and persistence of the pathogen in natural foci near human settlements pose severe risks to populations in plague-endemic regions and require outbreak response strategies. PMID:25530466

  16. Group B Streptococcus Infections Caused by Improper Sourcing and Handling of Fish for Raw Consumption, Singapore, 2015–2016

    PubMed Central

    Chau, Man L.; Chen, Swaine L.; Yap, Min; Hartantyo, Sri H.P.; Chiew, Paul K.T.; Fernandez, Charlene J.; Wong, Wai K.; Fong, Rockey K.; Tan, Wei L.; Tan, Brian Z.Y.; Ng, Youming; Aung, Kyaw T.; Mehershahi, Kurosh S.; Goh, Christopher; Kang, Joanne S.L.; Barkham, Timothy; Leong, Adeline O.K.; Gutiérrez, Ramona A.

    2017-01-01

    We assessed microbial safety and quality of raw fish sold in Singapore during 2015–2016 to complement epidemiologic findings for an outbreak of infection with group B Streptococcus serotype III sequence type (ST) 283 associated with raw fish consumption. Fish-associated group B Streptococcus ST283 strains included strains nearly identical (0–2 single-nucleotide polymorphisms) with the human outbreak strain, as well as strains in another distinct ST283 clade (57–71 single-nucleotide polymorphisms). Our investigations highlight the risk for contamination of freshwater fish (which are handled and distributed separately from saltwater fish sold as sashimi) and the need for improved hygienic handling of all fish for raw consumption. These results have led to updated policy and guidelines regarding the sale of ready-to-eat raw fish dishes in Singapore. PMID:29148967

  17. Artemisinin Resistance-Associated Polymorphisms at the K13-Propeller Locus Are Absent in Plasmodium falciparum Isolates from Haiti

    PubMed Central

    Carter, Tamar E.; Boulter, Alexis; Existe, Alexandre; Romain, Jean R.; St. Victor, Jean Yves; Mulligan, Connie J.; Okech, Bernard A.

    2015-01-01

    Antimalarial drugs are a key tool in malaria elimination programs. With the emergence of artemisinin resistance in southeast Asia, an effort to identify molecular markers for surveillance of resistant malaria parasites is underway. Non-synonymous mutations in the kelch propeller domain (K13-propeller) in Plasmodium falciparum have been associated with artemisinin resistance in samples from southeast Asia, but additional studies are needed to characterize this locus in other P. falciparum populations with different levels of artemisinin use. Here, we sequenced the K13-propeller locus in 82 samples from Haiti, where limited government oversight of non-governmental organizations may have resulted in low-level use of artemisinin-based combination therapies. We detected a single-nucleotide polymorphism (SNP) at nucleotide 1,359 in a single isolate. Our results contribute to our understanding of the global genomic diversity of the K13-propeller locus in P. falciparum populations. PMID:25646258

  18. DNAzyme based gap-LCR detection of single-nucleotide polymorphism.

    PubMed

    Zhou, Li; Du, Feng; Zhao, Yongyun; Yameen, Afshan; Chen, Haodong; Tang, Zhuo

    2013-07-15

    Fast and accurate detection of single-nucleotide polymorphism (SNP) is thought more and more important for understanding of human physiology and elucidating the molecular based diseases. A great deal of effort has been devoted to developing accurate, rapid, and cost-effective technologies for SNP analysis. However most of those methods developed to date incorporate complicated probe labeling and depend on advanced equipment. The DNAzyme based Gap-LCR detection method averts any chemical modification on probes and circumvents those problems by incorporating a short functional DNA sequence into one of LCR primers. Two kinds of exonuclease are utilized in our strategy to digest all the unreacted probes and release the DNAzymes embedded in the LCR product. The DNAzyme applied in our method is a versatile tool to report the result of SNP detection in colorimetric or fluorometric ways for different detection purposes. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Detection of single-nucleotide polymorphisms using gold nanoparticles and single-strand-specific nucleases.

    PubMed

    Chen, Yen-Ting; Hsu, Chiao-Ling; Hou, Shao-Yi

    2008-04-15

    The current study reports an assay approach that can detect single-nucleotide polymorphisms (SNPs) and identify the position of the point mutation through a single-strand-specific nuclease reaction and a gold nanoparticle assembly. The assay can be implemented via three steps: a single-strand-specific nuclease reaction that allows the enzyme to truncate the mutant DNA; a purification step that uses capture probe-gold nanoparticles and centrifugation; and a hybridization reaction that induces detector probe-gold nanoparticles, capture probe-gold nanoparticles, and the target DNA to form large DNA-linked three-dimensional aggregates of gold nanoparticles. At high temperature (63 degrees C in the current case), the purple color of the perfect match solution would not change to red, whereas a mismatched solution becomes red as the assembled gold nanoparticles separate. Using melting analysis, the position of the point mutation could be identified. This assay provides a convenient colorimetric detection that enables point mutation identification without the need for expensive mass spectrometry. To our knowledge, this is the first report concerning SNP detection based on a single-strand-specific nuclease reaction and a gold nanoparticle assembly.

  20. TNF-alpha single nucleotide polymorphisms in atopic dermatitis.

    PubMed

    Behniafard, Nasrin; Gharagozlou, Mohammad; Farhadi, Elham; Khaledi, Mojdeh; Sotoudeh, Soheila; Darabi, Behzad; Fathi, Seid Mohammad; Gholizadeh Moghaddam, Zahra; Mahmoudi, Mahdi; Aghamohammadi, Asghar; Amirzargar, Ali Akbar; Rezaei, Nima

    2012-01-01

    Tumor necrosis factor-alpha (TNF-α) could be considered as potential biomarkers in atopic dermatitis (AD), while its level could be influenced by cytokine single gene polymorphisms (SNP). This study was performed in 89 pediatric patients with AD and 137 controls to assess polymorphisms of the TNF-α gene at positions -308 and -238, using the polymerase chain reaction and the sequence-specific primers method. The highest positive allelic association that made the patients susceptible to AD was seen for TNF-α -238/G (p<0.001) and TNF-α -308/G (p = 0.003). The GG genotypes at TNF-α -238 and TNF-α -308, were both significantly higher in the patients with AD, compared to the controls (p<0.01). The GG haplotype at TNF-α (-308,-238) was seen in 92.7% of the patients, which was significantly higher than the controls (p<0.001), while a negative haplotypic association with AD was seen for TNF-α (-308, -238) AG and GA (p<0.01). This study showed that the AG genotype of TNF-α -308, associated with a high production of cytokines, was significantly decreased in patients with AD, while the low-producing GG genotype, which could lead to low production of TNF-α, was over-expressed in the atopic patients.

  1. Selection and Management of DNA Markers for Use in Genomic Evaluation

    USDA-ARS?s Scientific Manuscript database

    A database was constructed to store genotypes for 50,972 single-nucleotide polymorphisms (SNP) from the Illumina BovineSNP50 BeadChip for over 30,000 animals. The database allows storage of multiple samples per animal and stores all SNP genotypes for a sample in a single row. An indicator specifies ...

  2. Association genetics in Pinus taeda L. I. wood property traits

    Treesearch

    Santiago C. Gonzalez-Martinez; Nicholas C. Wheeler; Elhan Ersoz; C. Dana Nelson; David B. Neale

    2007-01-01

    Genetic association is a powerful method for dissecting complex adaptive traits due to (i) fine-scale mapping resulting from historical recombination, (ii) wide coverage of phenotypic and genotypic variation within a single experiment, and (iii) the simultaneous discovery of loci and alleles. In this article, genetic association among single nucleotide polymorphisms (...

  3. Human leukocyte antigen class I region single-nucleotide polymorphisms are associated with leprosy susceptibility in Vietnam and India.

    PubMed

    Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre; Schurr, Erwin

    2011-05-01

    Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10⁻⁹)-rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10⁻⁷ and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis.

  4. Human Leukocyte Antigen Class I Region Single-Nucleotide Polymorphisms are Associated with Leprosy Susceptibility in Vietnam and India

    PubMed Central

    Alter, Andrea; Huong, Nguyen Thu; Singh, Meenakshi; Orlova, Marianna; Van Thuc, Nguyen; Katoch, Kiran; Gao, Xiaojiang; Thai, Vu Hong; Ba, Nguyen Ngoc; Carrington, Mary; Abel, Laurent; Mehra, Narinder; Alcaïs, Alexandre

    2011-01-01

    Experimental evidence suggested the existence of unidentified leprosy susceptibility loci in the human leukocyte antigen (HLA) complex. To identify such genetic risk factors, a high-density association scan of a 1.9-mega-base (Mb) region in the HLA complex was performed. Among 682 single-nucleotide polymorphisms (SNPs), 59 were associated with leprosy (P <.01) in 198 Vietnamese single-case leprosy families. Genotyping of these SNPs in an independent sample of 292 Vietnamese single-case leprosy families replicated the association of 12 SNPs (P <.01). Multivariate analysis of these 12 SNPs showed that the association information could be captured by 2 intergenic HLA class I region SNPs (P = 9.4 × 10−9)—rs2394885 and rs2922997 (marginal multivariate P = 2.1 × 10−7 and P = .0016, respectively). SNP rs2394885 tagged the HLA-C*15:05 allele in the Vietnamese population. The identical associations were validated in a third sample of 364 patients with leprosy and 371 control subjects from North India. These results implicated class I alleles in leprosy pathogenesis. PMID:21459816

  5. Association of ACE and MDR1 Gene Polymorphisms with Steroid Resistance in Children with Idiopathic Nephrotic Syndrome.

    PubMed

    Dhandapani, Mohanapriya Chinambedu; Venkatesan, Vettriselvi; Rengaswamy, Nammalwar Bollam; Gowrishankar, Kalpana; Nageswaran, Prahlad; Perumal, Venkatachalam

    2015-08-01

    The purpose of the study was to investigate the distribution of insertion/deletion (I/D) polymorphisms of the angiotensin-converting enzyme (ACE) gene and three exonic polymorphisms of the multidrug resistance 1 (MDR1) gene (C3435T, C1236T, and G2677T) in children diagnosed with idiopathic nephrotic syndrome (INS). The study group consisted of 100 healthy controls and 150 INS patients, of which 50 were steroid resistant. Genomic DNA from blood samples was isolated from both of these groups and genotyping of the ACE and MDR1 genes was performed by polymerase chain reaction (PCR) using specific primers. There was no significant difference observed in the genotypic distribution and D allele frequency of the ACE gene. The two single-nucleotide polymorphisms (SNPs), C1236T and C3435T, of the MDR1 gene showed no significance, whereas the SNP G2677T/A was significantly associated with the genotypes GT and GA of the MDR1 gene, indicating it may be a potential marker to detect drug resistance. Screening these polymorphisms will pave the way to better understand the molecular mechanisms of the disease, which may be useful in developing targeted therapies for INS patients.

  6. MicroRNAs-1614-3p gene seed region polymorphisms and association analysis with chicken production traits.

    PubMed

    Li, Hong; Sun, Gui-Rong; Tian, Ya-Dong; Han, Rui-Li; Li, Guo-Xi; Kang, Xiang-Tao

    2013-05-01

    In the present study, a total of 860 chickens from a Gushi-Anka F2 resource population were used to evaluate the genetic effect of the gga-miR-1614-3p gene. A novel, silent, single nucleotide polymorphism (SNP, +5 C>T) was detected in the gga-miR-1614-3p gene seed region through AvaII polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and PCR products sequencing methods. Associations between the SNP and chicken growth, meat quality and carcass traits were performed by association analysis. The results showed that the SNP was significantly associated with breast muscle shear force and leg muscle water loss rate, wing weight, liver weight and heart weight (p<0.05), and highly significantly associated with the weight of the abdominal fat (p<0.01). The secondary structure of gga-miR-1614 and the free energy were altered due to the variation predicted by the M-fold program.

  7. Molecular characterization of the vitamin D receptor (VDR) gene in Holstein cows.

    PubMed

    Ali, Mayar O; El-Adl, Mohamed A; Ibrahim, Hussam M M; Elseedy, Youssef Y; Rizk, Mohamed A; El-Khodery, Sabry A

    2018-06-01

    Vitamin D plays a vital role in calcium homeostasis, growth, and immunoregulation. Because little is known about the vitamin D receptor (VDR) gene in cattle, the aim of the present investigation was to present the molecular characterization of exons 5 and 6 of the VDR gene in Holstein cows. DNA extraction, genomic sequencing, phylogenetic analysis, synteny mapping and single nucleotide gene polymorphism analysis of the VDR gene were performed to assess blood samples collected from 50 clinically healthy Holstein cows. The results revealed the presence of a 450-base pair (bp) nucleotide sequence that resembled exons 5 and 6 with intron 5 enclosed between these exons. Sequence alignment and phylogenetic analysis revealed a close relationship between the sequenced VDR region and that found in Hereford cattle. A close association between this region and the corresponding region in small ruminants was also documented. Moreover, a single nucleotide polymorphism (SNP) that caused the replacement of a glutamate with an arginine in the deduced amino acid sequence was detected at position 7 of exon 5. In conclusion, Holstein and Hereford cattle differ with respect to exon 5 of the VDR gene. Phylogenetic analysis of the VDR gene based on nucleotide sequence produced different results from prior analyses based on amino acid sequence. Copyright © 2018 Elsevier Ltd. All rights reserved.

  8. Polymorphisms in the vitamin D receptor and their associations with risk of schizophrenia and selected anthropometric measures.

    PubMed

    Handoko, H Y; Nancarrow, D J; Mowry, B J; McGrath, J J

    2006-01-01

    The association between vitamin D levels and skeletal growth has long been recognized. However, exposure to low levels of vitamin D during early life is also known to alter brain development, and is a candidate risk factor for schizophrenia. This study examines the association between four polymorphisms in the vitamin D receptor (VDR) and 1) risk of schizophrenia, and 2) three anthropometric variables (height, head size, and head shape). Four single-nucleotide polymorphisms (SNPs; rs10735810/FokI, rs1544410/BsmI, rs7975232/ApaI, and rs731236/TaqI) in the VDR gene were genotyped in 179 individuals with schizophrenia and 189 healthy controls. No significant associations were detected between any of the four VDR SNPs and risk of schizophrenia. Patients were slightly but significantly shorter compared to controls. Of the four SNPs, only rs10735810/FokI was associated with any of the anthropometric measures: the M4 isoform of this SNP was significantly associated with larger head size (P = 0.002). In light of the evidence demonstrating a role for vitamin D during brain development, the association between polymorphisms in VDR and brain development warrants closer scrutiny.

  9. Candidate genes for COPD in two large data sets.

    PubMed

    Bakke, P S; Zhu, G; Gulsvik, A; Kong, X; Agusti, A G N; Calverley, P M A; Donner, C F; Levy, R D; Make, B J; Paré, P D; Rennard, S I; Vestbo, J; Wouters, E F M; Anderson, W; Lomas, D A; Silverman, E K; Pillai, S G

    2011-02-01

    Lack of reproducibility of findings has been a criticism of genetic association studies on complex diseases, such as chronic obstructive pulmonary disease (COPD). We selected 257 polymorphisms of 16 genes with reported or potential relationships to COPD and genotyped these variants in a case-control study that included 953 COPD cases and 956 control subjects. We explored the association of these polymorphisms to three COPD phenotypes: a COPD binary phenotype and two quantitative traits (post-bronchodilator forced expiratory volume in 1 s (FEV₁) % predicted and FEV₁/forced vital capacity (FVC)). The polymorphisms significantly associated to these phenotypes in this first study were tested in a second, family-based study that included 635 pedigrees with 1,910 individuals. Significant associations to the binary COPD phenotype in both populations were seen for STAT1 (rs13010343) and NFKBIB/SIRT2 (rs2241704) (p<0.05). Single-nucleotide polymorphisms rs17467825 and rs1155563 of the GC gene were significantly associated with FEV₁ % predicted and FEV₁/FVC, respectively, in both populations (p<0.05). This study has replicated associations to COPD phenotypes in the STAT1, NFKBIB/SIRT2 and GC genes in two independent populations, the associations of the former two genes representing novel findings.

  10. Muscle strength response to strength training is influenced by insulin-like growth factor 1 genotype in older adults.

    PubMed

    Kostek, Matthew C; Delmonico, Matthew J; Reichel, Jonathan B; Roth, Stephen M; Douglass, Larry; Ferrell, Robert E; Hurley, Ben F

    2005-06-01

    Strength training (ST) is considered an intervention of choice for the prevention and treatment of sarcopenia. Reports in the literature have suggested that the insulin-like growth factor I protein (IGF-I) plays a major role in ST-induced skeletal muscle hypertrophy and strength improvements. A microsatellite repeat in the promoter region of the IGF1 gene has been associated with IGF-I blood levels and phenotypes related to IGF-I in adult men and women. To examine the influence of this polymorphism on muscle hypertrophic and strength responses to ST, we studied 67 Caucasian men and women before and after a 10-wk single-leg knee-extension ST program. One repetition maximum strength, muscle volume via computed tomography, and muscle quality were assessed at baseline and after 10 wk of training. The IGF1 repeat promoter polymorphism and three single-nucleotide polymorphisms were genotyped. For the promoter polymorphism, subjects were grouped as homozygous for the 192 allele, heterozygous, or noncarriers of the 192 allele. After 10 wk of training, 1-repetition maximum, muscle volume, and muscle quality increased significantly for all groups combined (P < 0.001). However, carriers of the 192 allele gained significantly more strength with ST than noncarriers of the 192 allele (P = 0.02). There was also a nonsignificant trend for a greater increase in muscle volume in 192 carriers than noncarriers (P = 0.08). No significant associations were observed for the other polymorphisms studied. Thus these data suggest that the IGF1 promoter polymorphism may influence the strength response to ST. Larger sample sizes should be used in future studies to verify these results.

  11. No association of SORL1 SNPs with Alzheimer's disease.

    PubMed

    Minster, Ryan L; DeKosky, Steven T; Kamboh, M Ilyas

    2008-08-01

    SORL1 is an element of the amyloid precursor protein processing pathway and is therefore a good candidate for affecting Alzheimer's disease (AD) risk. Indeed, there have been reports of associations between variation in SORL1 and AD risk. We examined six statistically significant single-nucleotide polymorphisms from the initial observation in a large Caucasian American case-controls cohort (1000 late-onset AD [LOAD] cases and 1000 older controls). Analysis of allele, genotype and haplotype frequencies revealed no association with LOAD risk in our cohort.

  12. Single nucleotide polymorphisms associated with non-contact soft tissue injuries in elite professional soccer players: influence on degree of injury and recovery time

    PubMed Central

    2013-01-01

    Background The biological mechanisms involved in non-contact musculoskeletal soft tissue injuries (NCMSTI) are poorly understood. Genetic risk factors may be associated with susceptibility to injuries, and may exert marked influence on recovery times. Methods Data on type and degree of injury and recovery time were collected in 73 male professional soccer players (43 White, 11 Black Africans and 19 Hispanics) who suffered total of 242 injuries (203 muscle, 24 ligament, and 15 tendon injuries). One single nucleotide polymorphism (SNPs) in the following genes were analyzed: Elastin (ELN); Titin (TTN); SRY-related HMG-box (SOX15); Insulin-like growth factor 2 (IGF2); Chemokine, CC motif, ligand 2 (CCL2); Collagen type 1 alpha 1(COL1A1); Collagen type 5 alpha 1 (COL5A1), and Tenascin C (TNC). Results There was evidence of a statistically significant association between the degree of injury and the IGF2 genotype (P = 0.034). In addition, there was evidence of a statistically significant association between the degree of muscle injury and CCL2 (P = 0.026) Finally, there was evidence of a statistically significant association between ELN and degree of injury (p = 0.009) and recovery time (P = 0.043). There was no evidence of a statistically significant association between any of the genes studied and degree of injury or recovery time for tendon injuries. Conclusion SNPs in the IGF2, CCL2, and ELN genes may be associated to the degree and recovery time of NCMSTI. PMID:23890452

  13. Association of the IL4R single-nucleotide polymorphism I50V with recurrent spontaneous abortion (RSA).

    PubMed

    Tavasolian, Fataneh; Abdollahi, Elham; Samadi, Morteza

    2014-07-01

    Recurrent spontaneous abortion (RSA) is defined as three or more consecutive abortions before the 20th week of gestation. There is increasing evidence to support an immunological mechanism for the occurrence of RSA. The purpose of our study was to examine whether single-nucleotide polymorphisms (SNPs) of the interleukin-4 receptor gene IL4R influence susceptibility to, recurrent spontaneous abortion. This is a case-control study. We recruited 200 patients with RSA (case group) using established diagnostic criteria and 200, normal individuals (control group) at the fertility and infertility center in Yazd city and Isfahan city during 2012 to 2013. We screened the I50V variant in IL-4R in patients and controls by PCR-RFLF method, and we performed an association analysis between I50V variant and RSA.the data was analyzed by spss 16 software using Chi-square test. No differences in the genotype and allele frequencies of the I50V SNPs were identified between patients with RSA and healthy controls. The frequency of SNP in IL-4 receptor (I50V) in patients with recurrent spontaneous abortion did not differ significantly compared with the control group. Analysis of IL4R SNP haplotypes or complex alleles suggested no dominant protection in patients with RSA.

  14. Role of the DGAT gene C79T single-nucleotide polymorphism in French obese subjects.

    PubMed

    Coudreau, Sylvie Kipfer; Tounian, Patrick; Bonhomme, Geneviève; Froguel, Philippe; Girardet, Jean-Philippe; Guy-Grand, Bernard; Basdevant, Arnaud; Clément, Karine

    2003-10-01

    Acyl-coenzyme A, diacylglycerol acyltransferase (DGAT), is a key enzyme involved in adipose-cell triglyceride storage. A 79-bp T-to-C single-nucleotide polymorphism (SNP) on the 3' region of the DGAT transcriptional site has been reported to increase promoter activity and is associated with higher BMI in Turkish women. To validate the possible role of this genetic variant in obesity, as well as the variant's possible cellular-functional significance, we performed an association study between the T79C change and several obesity-related phenotypes in 1357 obese French adults and children. The prevalence of the T79C SNP was similar between obese adults and children when each group was compared with the controls. (CC genotype carrier frequencies were 0.25 to 0.29 in the obese groups and 0.21 in controls; p > 0.05.) In each of the obese adult and child groups studied, the T79C variant was not found to be associated with any of the obesity-related phenotypes tested. Although the T79C SNP of the DGAT gene was studied in several groups of white subjects, the association between this SNP and obesity-related phenotypes, previously described, was not confirmed in our population.

  15. Characterization of a mini core collection of Japanese wheat varieties using single-nucleotide polymorphisms generated by genotyping-by-sequencing.

    PubMed

    Kobayashi, Fuminori; Tanaka, Tsuyoshi; Kanamori, Hiroyuki; Wu, Jianzhong; Katayose, Yuichi; Handa, Hirokazu

    2016-03-01

    A core collection of Japanese wheat varieties (JWC) consisting of 96 accessions was established based on their passport data and breeding pedigrees. To clarify the molecular basis of the JWC collection, genome-wide single-nucleotide polymorphism (SNP) genotyping was performed using the genotyping-by-sequencing (GBS) approach. Phylogenetic tree and population structure analyses using these SNP data revealed the genetic diversity and relationships among the JWC accessions, classifying them into four groups; "varieties in the Hokkaido area", "modern varieties in the northeast part of Japan", "modern varieties in the southwest part of Japan" and "classical varieties including landraces". This clustering closely reflected the history of wheat breeding in Japan. Furthermore, to demonstrate the utility of the JWC collection, we performed a genome-wide association study (GWAS) for three traits, namely, "days to heading in autumn sowing", "days to heading in spring sowing" and "culm length". We found significantly associated SNP markers with each trait, and some of these were closely linked to known major genes for heading date or culm length on the genetic map. Our study indicates that this JWC collection is a useful set of germplasm for basic and applied research aimed at understanding and utilizing the genetic diversity among Japanese wheat varieties.

  16. Genomic Changes Associated with Reproductive and Migratory Ecotypes in Sockeye Salmon (Oncorhynchus nerka)

    PubMed Central

    Veale, Andrew J.

    2017-01-01

    Mechanisms underlying adaptive evolution can best be explored using paired populations displaying similar phenotypic divergence, illuminating the genomic changes associated with specific life history traits. Here, we used paired migratory [anadromous vs. resident (kokanee)] and reproductive [shore- vs. stream-spawning] ecotypes of sockeye salmon (Oncorhynchus nerka) sampled from seven lakes and two rivers spanning three catchments (Columbia, Fraser, and Skeena) in British Columbia, Canada to investigate the patterns and processes underlying their divergence. Restriction-site associated DNA sequencing was used to genotype this sampling at 7,347 single nucleotide polymorphisms, 334 of which were identified as outlier loci and candidates for divergent selection within at least one ecotype comparison. Sixty-eight of these outliers were present in two or more comparisons, with 33 detected across multiple catchments. Of particular note, one locus was detected as the most significant outlier between shore and stream-spawning ecotypes in multiple comparisons and across catchments (Columbia, Fraser, and Snake). We also detected several genomic islands of divergence, some shared among comparisons, potentially showing linked signals of differential selection. The single nucleotide polymorphisms and genomic regions identified in our study offer a range of mechanistic hypotheses associated with the genetic basis of O. nerka life history variation and provide novel tools for informing fisheries management. PMID:29045601

  17. Comparative genomics of the mimicry switch in Papilio dardanus.

    PubMed

    Timmermans, Martijn J T N; Baxter, Simon W; Clark, Rebecca; Heckel, David G; Vogel, Heiko; Collins, Steve; Papanicolaou, Alexie; Fukova, Iva; Joron, Mathieu; Thompson, Martin J; Jiggins, Chris D; ffrench-Constant, Richard H; Vogler, Alfried P

    2014-07-22

    The African Mocker Swallowtail, Papilio dardanus, is a textbook example in evolutionary genetics. Classical breeding experiments have shown that wing pattern variation in this polymorphic Batesian mimic is determined by the polyallelic H locus that controls a set of distinct mimetic phenotypes. Using bacterial artificial chromosome (BAC) sequencing, recombination analyses and comparative genomics, we show that H co-segregates with an interval of less than 500 kb that is collinear with two other Lepidoptera genomes and contains 24 genes, including the transcription factor genes engrailed (en) and invected (inv). H is located in a region of conserved gene order, which argues against any role for genomic translocations in the evolution of a hypothesized multi-gene mimicry locus. Natural populations of P. dardanus show significant associations of specific morphs with single nucleotide polymorphisms (SNPs), centred on en. In addition, SNP variation in the H region reveals evidence of non-neutral molecular evolution in the en gene alone. We find evidence for a duplication potentially driving physical constraints on recombination in the lamborni morph. Absence of perfect linkage disequilibrium between different genes in the other morphs suggests that H is limited to nucleotide positions in the regulatory and coding regions of en. Our results therefore support the hypothesis that a single gene underlies wing pattern variation in P. dardanus.

  18. Single Nucleotide Polymorphisms of Stemness Genes Predicted to Regulate RNA Splicing, microRNA and Oncogenic Signaling are Associated with Prostate Cancer Survival.

    PubMed

    Freedman, Jennifer A; Wang, Yanru; Li, Xuechan; Liu, Hongliang; Moorman, Patricia G; George, Daniel J; Lee, Norman H; Hyslop, Terry; Wei, Qingyi; Patierno, Steven R

    2018-05-03

    Prostate cancer is a clinically and molecularly heterogeneous disease, with variation in outcomes only partially predicted by grade and stage. Additional tools to distinguish indolent from aggressive disease are needed. Phenotypic characteristics of stemness correlate with poor cancer prognosis. Given this correlation, we identified single nucleotide polymorphisms (SNPs) of stemness-related genes and examined their associations with prostate cancer survival. SNPs within stemness-related genes were analyzed for association with overall survival of prostate cancer in the Prostate, Lung, Colorectal and Ovarian Cancer Screening Trial. Significant SNPs predicted to be functional were selected for linkage disequilibrium analysis and combined and stratified analyses. Identified SNPs were evaluated for association with gene expression. SNPs of CD44 (rs9666607), ABCC1 (rs35605 and rs212091) and GDF15 (rs1058587) were associated with prostate cancer survival and predicted to be functional. A role for rs9666607 of CD44 and rs35605 of ABCC1 in RNA splicing regulation, rs212091 of ABCC1 in miRNA binding site activity and rs1058587 of GDF15 in causing an amino acid change was predicted. These SNPs represent potential novel prognostic markers for overall survival of prostate cancer and support a contribution of the stemness pathway to prostate cancer patient outcome.

  19. Top single nucleotide polymorphisms affecting carbohydrate metabolism in metabolic syndrome: from the LIPGENE study.

    PubMed

    Delgado-Lista, Javier; Perez-Martinez, Pablo; Solivera, Juan; Garcia-Rios, Antonio; Perez-Caballero, A I; Lovegrove, Julie A; Drevon, Christian A; Defoort, Catherine; Blaak, Ellen E; Dembinska-Kieć, Aldona; Risérus, Ulf; Herruzo-Gomez, Ezequiel; Camargo, Antonio; Ordovas, Jose M; Roche, Helen; Lopez-Miranda, José

    2014-02-01

    Metabolic syndrome (MetS) is a high-prevalence condition characterized by altered energy metabolism, insulin resistance, and elevated cardiovascular risk. Although many individual single nucleotide polymorphisms (SNPs) have been linked to certain MetS features, there are few studies analyzing the influence of SNPs on carbohydrate metabolism in MetS. A total of 904 SNPs (tag SNPs and functional SNPs) were tested for influence on 8 fasting and dynamic markers of carbohydrate metabolism, by performance of an intravenous glucose tolerance test in 450 participants in the LIPGENE study. From 382 initial gene-phenotype associations between SNPs and any phenotypic variables, 61 (16% of the preselected variables) remained significant after bootstrapping. Top SNPs affecting glucose metabolism variables were as follows: fasting glucose, rs26125 (PPARGC1B); fasting insulin, rs4759277 (LRP1); C-peptide, rs4759277 (LRP1); homeostasis assessment of insulin resistance, rs4759277 (LRP1); quantitative insulin sensitivity check index, rs184003 (AGER); sensitivity index, rs7301876 (ABCC9), acute insulin response to glucose, rs290481 (TCF7L2); and disposition index, rs12691 (CEBPA). We describe here the top SNPs linked to phenotypic features in carbohydrate metabolism among approximately 1000 candidate gene variations in fasting and postprandial samples of 450 patients with MetS from the LIPGENE study.

  20. TP53 and MDM2 single nucleotide polymorphisms influence survival in non-del(5q) myelodysplastic syndromes

    PubMed Central

    Sallman, David A.; Basiorka, Ashley A.; Irvine, Brittany A.; Zhang, Ling; Epling-Burnette, P.K.; Rollison, Dana E.; Mallo, Mar; Sokol, Lubomir; Solé, Francesc; Maciejewski, Jaroslaw; List, Alan F.

    2015-01-01

    P53 is a key regulator of many cellular processes and is negatively regulated by the human homolog of murine double minute-2 (MDM2) E3 ubiquitin ligase. Single nucleotide polymorphisms (SNPs) of either gene alone, and in combination, are linked to cancer susceptibility, disease progression, and therapy response. We analyzed the interaction of TP53 R72P and MDM2 SNP309 SNPs in relationship to outcome in patients with myelodysplastic syndromes (MDS). Sanger sequencing was performed on DNA isolated from 208 MDS cases. Utilizing a novel functional SNP scoring system ranging from +2 to −2 based on predicted p53 activity, we found statistically significant differences in overall survival (OS) (p = 0.02) and progression-free survival (PFS) (p = 0.02) in non-del(5q) MDS patients with low functional scores. In univariate analysis, only IPSS and the functional SNP score predicted OS and PFS in non-del(5q) patients. In multivariate analysis, the functional SNP score was independent of IPSS for OS and PFS. These data underscore the importance of TP53 R72P and MDM2 SNP309 SNPs in MDS, and provide a novel scoring system independent of IPSS that is predictive for disease outcome. PMID:26416416

Top