Transferable tight-binding model for strained group IV and III-V materials and heterostructures
NASA Astrophysics Data System (ADS)
Tan, Yaohua; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy B.; Klimeck, Gerhard
2016-07-01
It is critical to capture the effect due to strain and material interface for device level transistor modeling. We introduce a transferable s p3d5s* tight-binding model with nearest-neighbor interactions for arbitrarily strained group IV and III-V materials. The tight-binding model is parametrized with respect to hybrid functional (HSE06) calculations for varieties of strained systems. The tight-binding calculations of ultrasmall superlattices formed by group IV and group III-V materials show good agreement with the corresponding HSE06 calculations. The application of the tight-binding model to superlattices demonstrates that the transferable tight-binding model with nearest-neighbor interactions can be obtained for group IV and III-V materials.
Quantum interference on electron scattering in graphene by carbon impurities in underlying h -BN
NASA Astrophysics Data System (ADS)
Kaneko, Tomoaki; Koshino, Mikito; Saito, Riichiro
2017-03-01
Electronic structures and transport properties of graphene on h -BN with carbon impurities are investigated by first-principles calculation and the tight-binding model. We show that the coupling between the impurity level and the graphene's Dirac cone sensitively depends on the impurity position, and in particular, it nearly vanishes when the impurity is located right below the center of the six membered ring of graphene. The Bloch phase factor at the Brillouin zone edge plays a decisive role in the cancellation of the hopping integrals. The impurity position dependence on the electronic structures of graphene on h -BN is investigated by the first-principles calculation, and its qualitative feature is well explained by a tight-binding model with graphene and a single impurity site. We also propose a simple one-dimensional chain-impurity model to analytically describe the role of the quantum interference in the position-dependent coupling.
Magnetic susceptibilities of actinide 3d-metal intermetallic compounds
DOE Office of Scientific and Technical Information (OSTI.GOV)
Muniz, R.B.; d'Albuquerque e Castro, J.; Troper, A.
1988-04-15
We have numerically calculated the magnetic susceptibilities which appear in the Hartree--Fock instability criterion for actinide 3d transition-metal intermetallic compounds. This calculation is based on a previous tight-binding description of these actinide-based compounds (A. Troper and A. A. Gomes, Phys. Rev. B 34, 6487 (1986)). The parameters of the calculation, which starts from simple tight-binding d and f bands are (i) occupation numbers, (ii) ratio of d-f hybridization to d bandwidth, and (iii) electron-electron Coulomb-type interactions.
Detecting sign-changing superconducting gap in LiFeAs using quasiparticle interference
NASA Astrophysics Data System (ADS)
Altenfeld, D.; Hirschfeld, P. J.; Mazin, I. I.; Eremin, I.
2018-02-01
Using a realistic ten-orbital tight-binding model Hamiltonian fitted to the angle-resolved photoemission spectroscopy data on LiFeAs, we analyze the temperature, frequency, and momentum dependencies of quasiparticle interference to identify gap sign changes in a qualitative way, following our original proposal [Phys. Rev. B 92, 184513 (2015), 10.1103/PhysRevB.92.184513]. We show that all features present for the simple two-band model for the sign-changing s+--wave superconducting gap employed previously are still present in the realistic tight-binding approximation and gap values observed experimentally. We discuss various superconducting gap structures proposed for LiFeAs and identify various features of these superconducting gap functions in the quasiparticle interference patterns. On the other hand, we show that it will be difficult to identify the more complicated possible sign structures of the hole pocket gaps in LiFeAs due to the smallness of the pockets and the near proximity of two of the gap energies.
Dielectric response of molecules in empirical tight-binding theory
NASA Astrophysics Data System (ADS)
Boykin, Timothy B.; Vogl, P.
2002-01-01
In this paper we generalize our previous approach to electromagnetic interactions within empirical tight-binding theory to encompass molecular solids and isolated molecules. In order to guarantee physically meaningful results, we rederive the expressions for relevant observables using commutation relations appropriate to the finite tight-binding Hilbert space. In carrying out this generalization, we examine in detail the consequences of various prescriptions for the position and momentum operators in tight binding. We show that attempting to fit parameters of the momentum matrix directly generally results in a momentum operator which is incompatible with the underlying tight-binding model, while adding extra position parameters results in numerous difficulties, including the loss of gauge invariance. We have applied our scheme, which we term the Peierls-coupling tight-binding method, to the optical dielectric function of the molecular solid PPP, showing that this approach successfully predicts its known optical properties even in the limit of isolated molecules.
OLIFE: Tight Binding Code for Transmission Coefficient Calculation
NASA Astrophysics Data System (ADS)
Mijbil, Zainelabideen Yousif
2018-05-01
A new and human friendly transport calculation code has been developed. It requires a simple tight binding Hamiltonian as the only input file and uses a convenient graphical user interface to control calculations. The effect of magnetic field on junction has also been included. Furthermore the transmission coefficient can be calculated between any two points on the scatterer which ensures high flexibility to check the system. Therefore Olife can highly be recommended as an essential tool for pretesting studying and teaching electron transport in molecular devices that saves a lot of time and effort.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Krishnapriyan, A.; Yang, P.; Niklasson, A. M. N.
New parametrizations for semiempirical density functional tight binding (DFTB) theory have been developed by the numerical optimization of adjustable parameters to minimize errors in the atomization energy and interatomic forces with respect to ab initio calculated data. Initial guesses for the radial dependences of the Slater- Koster bond integrals and overlap integrals were obtained from minimum basis density functional theory calculations. The radial dependences of the pair potentials and the bond and overlap integrals were represented by simple analytic functions. The adjustable parameters in these functions were optimized by simulated annealing and steepest descent algorithms to minimize the value ofmore » an objective function that quantifies the error between the DFTB model and ab initio calculated data. The accuracy and transferability of the resulting DFTB models for the C, H, N, and O system were assessed by comparing the predicted atomization energies and equilibrium molecular geometries of small molecules that were not included in the training data from DFTB to ab initio data. The DFTB models provide accurate predictions of the properties of hydrocarbons and more complex molecules containing C, H, N, and O.« less
Krishnapriyan, A.; Yang, P.; Niklasson, A. M. N.; ...
2017-10-17
New parametrizations for semiempirical density functional tight binding (DFTB) theory have been developed by the numerical optimization of adjustable parameters to minimize errors in the atomization energy and interatomic forces with respect to ab initio calculated data. Initial guesses for the radial dependences of the Slater- Koster bond integrals and overlap integrals were obtained from minimum basis density functional theory calculations. The radial dependences of the pair potentials and the bond and overlap integrals were represented by simple analytic functions. The adjustable parameters in these functions were optimized by simulated annealing and steepest descent algorithms to minimize the value ofmore » an objective function that quantifies the error between the DFTB model and ab initio calculated data. The accuracy and transferability of the resulting DFTB models for the C, H, N, and O system were assessed by comparing the predicted atomization energies and equilibrium molecular geometries of small molecules that were not included in the training data from DFTB to ab initio data. The DFTB models provide accurate predictions of the properties of hydrocarbons and more complex molecules containing C, H, N, and O.« less
Nonlocal torque operators in ab initio theory of the Gilbert damping in random ferromagnetic alloys
NASA Astrophysics Data System (ADS)
Turek, I.; Kudrnovský, J.; Drchal, V.
2015-12-01
We present an ab initio theory of the Gilbert damping in substitutionally disordered ferromagnetic alloys. The theory rests on introduced nonlocal torques which replace traditional local torque operators in the well-known torque-correlation formula and which can be formulated within the atomic-sphere approximation. The formalism is sketched in a simple tight-binding model and worked out in detail in the relativistic tight-binding linear muffin-tin orbital method and the coherent potential approximation (CPA). The resulting nonlocal torques are represented by nonrandom, non-site-diagonal, and spin-independent matrices, which simplifies the configuration averaging. The CPA-vertex corrections play a crucial role for the internal consistency of the theory and for its exact equivalence to other first-principles approaches based on the random local torques. This equivalence is also illustrated by the calculated Gilbert damping parameters for binary NiFe and FeCo random alloys, for pure iron with a model atomic-level disorder, and for stoichiometric FePt alloys with a varying degree of L 10 atomic long-range order.
Extended Lagrangian formulation of charge-constrained tight-binding molecular dynamics.
Cawkwell, M J; Coe, J D; Yadav, S K; Liu, X-Y; Niklasson, A M N
2015-06-09
The extended Lagrangian Born-Oppenheimer molecular dynamics formalism [Niklasson, Phys. Rev. Lett., 2008, 100, 123004] has been applied to a tight-binding model under the constraint of local charge neutrality to yield microcanonical trajectories with both precise, long-term energy conservation and a reduced number of self-consistent field optimizations at each time step. The extended Lagrangian molecular dynamics formalism restores time reversal symmetry in the propagation of the electronic degrees of freedom, and it enables the efficient and accurate self-consistent optimization of the chemical potential and atomwise potential energy shifts in the on-site elements of the tight-binding Hamiltonian that are required when enforcing local charge neutrality. These capabilities are illustrated with microcanonical molecular dynamics simulations of a small metallic cluster using an sd-valent tight-binding model for titanium. The effects of weak dissipation on the propagation of the auxiliary degrees of freedom for the chemical potential and on-site Hamiltonian matrix elements that is used to counteract the accumulation of numerical noise during trajectories was also investigated.
Visualization of atomic-scale phenomena in superconductors: application to FeSe
DOE Office of Scientific and Technical Information (OSTI.GOV)
Choubey, Peayush; Berlijn, Tom; Kreisel, Andreas
Here we propose a simple method of calculating inhomogeneous, atomic-scale phenomena in superconductors which makes use of the wave function information traditionally discarded in the construction of tight-binding models used in the Bogoliubov-de Gennes equations. The method uses symmetry- based first principles Wannier functions to visualize the effects of superconducting pairing on the distribution of electronic states over atoms within a crystal unit cell. Local symmetries lower than the global lattice symmetry can thus be exhibited as well, rendering theoretical comparisons with scanning tunneling spectroscopy data much more useful. As a simple example, we discuss the geometric dimer states observedmore » near defects in superconducting FeSe.« less
Visualization of atomic-scale phenomena in superconductors: application to FeSe
Choubey, Peayush; Berlijn, Tom; Kreisel, Andreas; ...
2014-10-31
Here we propose a simple method of calculating inhomogeneous, atomic-scale phenomena in superconductors which makes use of the wave function information traditionally discarded in the construction of tight-binding models used in the Bogoliubov-de Gennes equations. The method uses symmetry- based first principles Wannier functions to visualize the effects of superconducting pairing on the distribution of electronic states over atoms within a crystal unit cell. Local symmetries lower than the global lattice symmetry can thus be exhibited as well, rendering theoretical comparisons with scanning tunneling spectroscopy data much more useful. As a simple example, we discuss the geometric dimer states observedmore » near defects in superconducting FeSe.« less
Schematic baryon models, their tight binding description and their microwave realization
NASA Astrophysics Data System (ADS)
Sadurní, E.; Franco-Villafañe, J. A.; Kuhl, U.; Mortessagne, F.; Seligman, T. H.
2013-12-01
A schematic model for baryon excitations is presented in terms of a symmetric Dirac gyroscope, a relativistic model solvable in closed form, that reduces to a rotor in the non-relativistic limit. The model is then mapped on a nearest neighbour tight binding model. In its simplest one-dimensional form this model yields a finite equidistant spectrum. This is experimentally implemented as a chain of dielectric resonators under conditions where their coupling is evanescent and a good agreement with the prediction is achieved.
Larsen, Ross E.
2016-04-12
In this study, we introduce two simple tight-binding models, which we call fragment frontier orbital extrapolations (FFOE), to extrapolate important electronic properties to the polymer limit using electronic structure calculations on only a few small oligomers. In particular, we demonstrate by comparison to explicit density functional theory calculations that for long oligomers the energies of the highest occupied molecular orbital (HOMO), the lowest unoccupied molecular orbital (LUMO), and of the first electronic excited state are accurately described as a function of number of repeat units by a simple effective Hamiltonian parameterized from electronic structure calculations on monomers, dimers and, optionally,more » tetramers. For the alternating copolymer materials that currently comprise some of the most efficient polymer organic photovoltaic devices one can use these simple but rigorous models to extrapolate computed properties to the polymer limit based on calculations on a small number of low-molecular-weight oligomers.« less
NASA Astrophysics Data System (ADS)
Leleyter, M.; Olivi-Tran, N.
2008-12-01
We studied in tight-binding approximation involving spν hybridization (ν=2,3), some Si2Cn (n=3 to 42) microclusters. We then investigated, on one hand, fragments of fullerene-like structures (sp2), and on the other hand, nanodiamonds (sp3) of adamantane-type or a 44-atom nanodiamond (with 2 inner atoms which are assumed to play the role of bulk atoms). We compared the stabilities, i.e. the electronic energies of these clusters, according to the various positions of the 2 Si atoms. Results are very different in the two kinds of hybridization. Besides, they can be analysed according to two different points of view: either the clusters are considered as small particles with limited sizes, or they are assumed to be used as models in order to simulate the Si-atom behaviour in very larger systems. In sp2 hybridization (fullerene-like geometries), the most stable isomer is always encountered when the 2 Si atoms build a Si2 group, and this result holds for both viewpoints quoted above. Conversely, in sp3 hybridization (nanodiamonds), since Si atoms “prefer” sites having the minimum connectivity, they are never found in adjacent sites. We see that with a simple and fast computational method we can explain an experimental fact which is very interesting such as the relative position of two heteroatoms in the cluster. This enhances the generality and the fecondity in the tight binding approximation due essentially to the link between this model and the graph theory, link based on the topology of the clusters.
Multiple Weyl points and the sign change of their topological charges in woodpile photonic crystals
NASA Astrophysics Data System (ADS)
Chang, Ming-Li; Xiao, Meng; Chen, Wen-Jie; Chan, C. T.
2017-03-01
We show that Weyl points with topological charges 1 and 2 can be found in very simple chiral woodpile photonic crystals and the distribution of the charges can be changed by changing the material parameters without altering space-group symmetry. The underlying physics can be understood through a tight-binding model. Gapless surface states and their backscattering immune properties also are demonstrated in these systems. Obtaining Weyl points in these easily fabricated woodpile photonic crystals will facilitate the realization of Weyl point physics in optical and IR frequencies.
Perfect transmission at oblique incidence by trigonal warping in graphene P-N junctions
NASA Astrophysics Data System (ADS)
Zhang, Shu-Hui; Yang, Wen
2018-01-01
We develop an analytical mode-matching technique for the tight-binding model to describe electron transport across graphene P-N junctions. This method shares the simplicity of the conventional mode-matching technique for the low-energy continuum model and the accuracy of the tight-binding model over a wide range of energies. It further reveals an interesting phenomenon on a sharp P-N junction: the disappearance of the well-known Klein tunneling (i.e., perfect transmission) at normal incidence and the appearance of perfect transmission at oblique incidence due to trigonal warping at energies beyond the linear Dirac regime. We show that this phenomenon arises from the conservation of a generalized pseudospin in the tight-binding model. We expect this effect to be experimentally observable in graphene and other Dirac fermions systems, such as the surface of three-dimensional topological insulators.
Tight-Binding study of Boron structures
NASA Astrophysics Data System (ADS)
McGrady, Joseph W.; Papaconstantopoulos, Dimitrios A.; Mehl, Michael J.
2014-10-01
We have performed Linearized Augmented Plane Wave (LAPW) calculations for five crystal structures (alpha, dhcp, sc, fcc, bcc) of Boron which we then fitted to a non-orthogonal tight-binding model following the Naval Research Laboratory Tight-Binding (NRL-TB) method. The predictions of the NRL-TB approach for complicated Boron structures such as R105 (or β-rhombohedral) and T190 are in agreement with recent first-principles calculations. Fully utilizing the computational speed of the NRL-TB method we calculated the energy differences of various structures, including those containing vacancies using supercells with up to 5000 atoms.
Hidden order and unconventional superconductivity in URu2Si2
NASA Astrophysics Data System (ADS)
Rau, Jeffrey; Kee, Hae-Young
2012-02-01
The nature of the so-called hidden order in URu2Si2 and the subsequent superconducting phase have remained a puzzle for over two decades. Motivated by evidence for rotational symmetry breaking seen in recent magnetic torque measurements [Okazaki et al. Science 331, 439 (2011)], we derive a simple tight-binding model consistent with experimental Fermi surface probes and ab-initio calculations. From this model we use mean-field theory to examine the variety of hidden orders allowed by existing experimental results, including the torque measurements. We then construct a phase diagram in temperature and pressure and discuss relevant experimental consequences.
Tight-binding calculation of single-band and generalized Wannier functions of graphene
NASA Astrophysics Data System (ADS)
Ribeiro, Allan Victor; Bruno-Alfonso, Alexys
Recent work has shown that a tight-binding approach associated with Wannier functions (WFs) provides an intuitive physical image of the electronic structure of graphene. Regarding the case of graphene, Marzari et al. displayed the calculated WFs and presented a comparison between the Wannier-interpolated bands and the bands generated by using the density-functional code. Jung and MacDonald provided a tight-binding model for the π-bands of graphene that involves maximally localized Wannier functions (MLWFs). The mixing of the bands yields better localized WFs. In the present work, the MLWFs of graphene are calculated by combining the Quantum-ESPRESSO code and tight-binding approach. The MLWFs of graphene are calculated from the Bloch functions obtained through a tight binding approach that includes interactions and overlapping obtained by partially fitting the DFT bands. The phase of the Bloch functions of each band is appropriately chosen to produce MLWFs. The same thing applies to the coefficients of their linear combination in the generalized case. The method allows for an intuitive understanding of the maximally localized WFs of graphene and shows excellent agreement with the literature. Moreover, it provides accurate results at reduced computational cost.
Edge currents in frustrated Josephson junction ladders
NASA Astrophysics Data System (ADS)
Marques, A. M.; Santos, F. D. R.; Dias, R. G.
2016-09-01
We present a numerical study of quasi-1D frustrated Josephson junction ladders with diagonal couplings and open boundary conditions, in the large capacitance limit. We derive a correspondence between the energy of this Josephson junction ladder and the expectation value of the Hamiltonian of an analogous tight-binding model, and show how the overall superconducting state of the chain is equivalent to the minimum energy state of the tight-binding model in the subspace of one-particle states with uniform density. To satisfy the constraint of uniform density, the superconducting state of the ladder is written as a linear combination of the allowed k-states of the tight-binding model with open boundaries. Above a critical value of the parameter t (ratio between the intra-rung and inter-rung Josephson couplings) the ladder spontaneously develops currents at the edges, which spread to the bulk as t is increased until complete coverage is reached. Above a certain value of t, which varies with ladder size (t = 1 for an infinite-sized ladder), the edge currents are destroyed. The value t = 1 corresponds, in the tight-binding model, to the opening of a gap between two bands. We argue that the disappearance of the edge currents with this gap opening is not coincidental, and that this points to a topological origin for these edge current states.
Accurate modeling of defects in graphene transport calculations
NASA Astrophysics Data System (ADS)
Linhart, Lukas; Burgdörfer, Joachim; Libisch, Florian
2018-01-01
We present an approach for embedding defect structures modeled by density functional theory into large-scale tight-binding simulations. We extract local tight-binding parameters for the vicinity of the defect site using Wannier functions. In the transition region between the bulk lattice and the defect the tight-binding parameters are continuously adjusted to approach the bulk limit far away from the defect. This embedding approach allows for an accurate high-level treatment of the defect orbitals using as many as ten nearest neighbors while keeping a small number of nearest neighbors in the bulk to render the overall computational cost reasonable. As an example of our approach, we consider an extended graphene lattice decorated with Stone-Wales defects, flower defects, double vacancies, or silicon substitutes. We predict distinct scattering patterns mirroring the defect symmetries and magnitude that should be experimentally accessible.
Understanding the length dependence of molecular junction thermopower.
Karlström, Olov; Strange, Mikkel; Solomon, Gemma C
2014-01-28
Thermopower of molecular junctions is sensitive to details in the junction and may increase, decrease, or saturate with increasing chain length, depending on the system. Using McConnell's theory for exponentially suppressed transport together with a simple and easily interpretable tight binding model, we show how these different behaviors depend on the molecular backbone and its binding to the contacts. We distinguish between resonances from binding groups or undercoordinated electrode atoms, and those from the periodic backbone. It is demonstrated that while the former gives a length-independent contribution to the thermopower, possibly changing its sign, the latter determines its length dependence. This means that the question of which orbitals from the periodic chain that dominate the transport should not be inferred from the sign of the thermopower but from its length dependence. We find that the same molecular backbone can, in principle, show four qualitatively different thermopower trends depending on the binding group: It can be positive or negative for short chains, and it can either increase or decrease with length.
Band gap engineering in finite elongated graphene nanoribbon heterojunctions: Tight-binding model
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tayo, Benjamin O.
2015-08-15
A simple model based on the divide and conquer rule and tight-binding (TB) approximation is employed for studying the role of finite size effect on the electronic properties of elongated graphene nanoribbon (GNR) heterojunctions. In our model, the GNR heterojunction is divided into three parts: a left (L) part, middle (M) part, and right (R) part. The left part is a GNR of width W{sub L}, the middle part is a GNR of width W{sub M}, and the right part is a GNR of width W{sub R}. We assume that the left and right parts of the GNR heterojunction interactmore » with the middle part only. Under this approximation, the Hamiltonian of the system can be expressed as a block tridiagonal matrix. The matrix elements of the tridiagonal matrix are computed using real space nearest neighbor orthogonal TB approximation. The electronic structure of the GNR heterojunction is analyzed by computing the density of states. We demonstrate that for heterojunctions for which W{sub L} = W{sub R}, the band gap of the system can be tuned continuously by varying the length of the middle part, thus providing a new approach to band gap engineering in GNRs. Our TB results were compared with calculations employing divide and conquer rule in combination with density functional theory (DFT) and were found to agree nicely.« less
Tight-binding study of stacking fault energies and the Rice criterion of ductility in the fcc metals
NASA Astrophysics Data System (ADS)
Mehl, Michael J.; Papaconstantopoulos, Dimitrios A.; Kioussis, Nicholas; Herbranson, M.
2000-02-01
We have used the Naval Research Laboratory (NRL) tight-binding (TB) method to calculate the generalized stacking fault energy and the Rice ductility criterion in the fcc metals Al, Cu, Rh, Pd, Ag, Ir, Pt, Au, and Pb. The method works well for all classes of metals, i.e., simple metals, noble metals, and transition metals. We compared our results with full potential linear-muffin-tin orbital and embedded atom method (EAM) calculations, as well as experiment, and found good agreement. This is impressive, since the NRL-TB approach only fits to first-principles full-potential linearized augmented plane-wave equations of state and band structures for cubic systems. Comparable accuracy with EAM potentials can be achieved only by fitting to the stacking fault energy.
NASA Astrophysics Data System (ADS)
Panda, Saswati; Sahoo, D. D.; Rout, G. C.
2018-04-01
We report here a tight binding model for colossal magnetoresistive (CMR) manganites to study the pseudo gap (PG) behavior near Fermi level. In the Kubo-Ohata type DE model, we consider first and second nearest neighbor interactions for transverse spin fluctuations in core band and hopping integrals in conduction band, in the presence of static band Jahn-Teller distortion. The model Hamiltonian is solved using Zubarev's Green's function technique. The electron density of states (DOS) is found out from the Green's functions. We observe clear PG near Fermi level in the electron DOS.
Opening-assisted coherent transport in the semiclassical regime
NASA Astrophysics Data System (ADS)
Zhang, Yang; Celardo, G. Luca; Borgonovi, Fausto; Kaplan, Lev
2017-02-01
We study quantum enhancement of transport in open systems in the presence of disorder and dephasing. Quantum coherence effects may significantly enhance transport in open systems even in the semiclassical regime (where the decoherence rate is greater than the intersite hopping amplitude), as long as the disorder is sufficiently strong. When the strengths of disorder and dephasing are fixed, there is an optimal opening strength at which the coherent transport enhancement is optimized. Analytic results are obtained in two simple paradigmatic tight-binding models of large systems: the linear chain and the fully connected network. The physical behavior is also reflected in the Fenna-Matthews-Olson (FMO) photosynthetic complex, which may be viewed as intermediate between these paradigmatic models.
Transmission eigenchannels from nonequilibrium Green's functions
NASA Astrophysics Data System (ADS)
Paulsson, Magnus; Brandbyge, Mads
2007-09-01
The concept of transmission eigenchannels is described in a tight-binding nonequilibrium Green’s function (NEGF) framework. A simple procedure for calculating the eigenchannels is derived using only the properties of the device subspace and quantities normally available in a NEGF calculation. The method is exemplified by visualization in real space of the eigenchannels for three different molecular and atomic wires.
NASA Astrophysics Data System (ADS)
Shen, Ka
2018-04-01
We study magnon spectra at finite temperature in yttrium iron garnet using a tight-binding model with nearest-neighbor exchange interaction. The spin reduction due to thermal magnon excitation is taken into account via the mean field approximation to the local spin and is found to be different at two sets of iron atoms. The resulting temperature dependence of the spin wave gap shows good agreement with experiment. We find that only two magnon modes are relevant to the ferromagnetic resonance.
NASA Astrophysics Data System (ADS)
Nozaki, Daijiro; Avdoshenko, Stanislav M.; Sevinçli, Hâldun; Gutierrez, Rafael; Cuniberti, Gianaurelio
2013-03-01
Recently the interest in quantum interference (QI) phenomena in molecular devices (molecular junctions) has been growing due to the unique features observed in the transmission spectra. In order to design single molecular devices exploiting QI effects as desired, it is necessary to provide simple rules for predicting the appearance of QI effects such as anti-resonances or Fano line shapes and for controlling them. In this study, we derive a transmission function of a generic molecular junction with a side group (T-shaped molecular junction) using a minimal toy model. We developed a simple method to predict the appearance of quantum interference, Fano resonances or anti- resonances, and its position in the conductance spectrum by introducing a simple graphical representation (parabolic model). Using it we can easily visualize the relation between the key electronic parameters and the positions of normal resonant peaks and anti-resonant peaks induced by quantum interference in the conductance spectrum. We also demonstrate Fano and anti-resonance in T-shaped molecular junctions using a simple tight-binding model. This parabolic model enables one to infer on-site energies of T-shaped molecules and the coupling between side group and main conduction channel from transmission spectra.
The Biotin/Avidin complex adhesion force
NASA Astrophysics Data System (ADS)
Balsera, Manel A.; Izrailev, Sergei; Stepaniants, Sergey; Oono, Yoshitsugu; Schulten, Klaus
1997-03-01
The vitamin Biotin and the protein avidin form one of the strongest non-covalent bonds between biological molecules. We have performed molecular and stochastic dynamic modeling of the unbinding of this complex(Izrailev et al., Biophysical Journal, In press). These simulations provide insight into the effect of particular residues and water on the tight binding of the system. With the aid of simple phenomenological models we have related qualitatively our results to Atomic Force Microscopy adhesion force measurements (E.-L. Florin, V. T. Moy and H. E. Gaub Science) 264:415-417 and kinetic dissociation experiments( A. Chilcotti and P. S. Stayton, J. Am. Chem. Soc.) 117:10622-10628. We will discuss the difficulties preventing a more quantitative understanding of the unbinding force and kinetics.
NASA Astrophysics Data System (ADS)
Korol, Roman; Kilgour, Michael; Segal, Dvira
2018-03-01
We present our in-house quantum transport package, ProbeZT. This program provides linear response coefficients: electrical and electronic thermal conductances, as well as the thermopower of molecular junctions in which electrons interact with the surrounding thermal environment. Calculations are performed based on the Büttiker probe method, which introduces decoherence, energy exchange and dissipation effects phenomenologically using virtual electrode terminals called probes. The program can realize different types of probes, each introducing various environmental effects, including elastic and inelastic scattering of electrons. The molecular system is described by an arbitrary tight-binding Hamiltonian, allowing the study of different geometries beyond simple one-dimensional wires. Applications of the program to study the thermoelectric performance of molecular junctions are illustrated. The program also has a built-in functionality to simulate electron transport in double-stranded DNA molecules based on a tight-binding (ladder) description of the junction.
NASA Astrophysics Data System (ADS)
Panda, Rudrashish; Sahu, Sivabrata; Rout, G. C.
2017-05-01
We communicate here a tight binding theoretical model study of the band filling effect on the charge gap in graphene-on-substrate. The Hamiltonian consists of nearest neighbor electron hopping and substrate induced gap. Besides this the Coulomb interaction is considered here within mean-field approximation in the paramagnetic limit. The electron occupancies at two sublattices are calculated by Green's function technique and are solved self consistently. Finally the charge gap i.e. Δ ¯=U [ < na > -< nb > ] is calculated and computed numerically. The results are reported.
Tight-binding model for borophene and borophane
NASA Astrophysics Data System (ADS)
Nakhaee, M.; Ketabi, S. A.; Peeters, F. M.
2018-03-01
Starting from the simplified linear combination of atomic orbitals method in combination with first-principles calculations, we construct a tight-binding (TB) model in the two-centre approximation for borophene and hydrogenated borophene (borophane). The Slater and Koster approach is applied to calculate the TB Hamiltonian of these systems. We obtain expressions for the Hamiltonian and overlap matrix elements between different orbitals for the different atoms and present the SK coefficients in a nonorthogonal basis set. An anisotropic Dirac cone is found in the band structure of borophane. We derive a Dirac low-energy Hamiltonian and compare the Fermi velocities with that of graphene.
Disorder Problem In Diluted Magnetic Semiconductors
NASA Astrophysics Data System (ADS)
Nelson, Ryky; Ekuma, Chinedu; Terletska, Hanna; Sudhindra, Vidhyadhiraja; Moreno, Juana; Jarrell, Mark
2015-03-01
Motivated by experimental studies addressing the role of impurity disorder in diluted magnetic semiconductors (DMS), we investigate the effects of disorder using a simple tight-binding Hamiltonian with random impurity potential and spin-fermion exchange which is self-consistently solved using the typical medium theory. Adopting the typical density of states (TDoS) as the order parameter, we find that the TDoS vanishes below a critical concentration of the impurity, which indicates an Anderson localization transition in the system. Our results qualitatively explain why at concentrations lower than a critical value DMS are insulating and paramagnetic, while at larger concentrations are ferromagnetic. We also compare several simple models to explore the interplay between ferromagnetic order and disorder induced insulating behavior, and the role of the spin-orbit interaction on this competition. We apply our findings to (Ga,Mn)As and (Ga,Mn)N to compare and contrast their phase diagrams.
NASA Astrophysics Data System (ADS)
Gelzinis, Andrius; Valkunas, Leonas; Fuller, Franklin D.; Ogilvie, Jennifer P.; Mukamel, Shaul; Abramavicius, Darius
2013-07-01
We propose an optimized tight-binding electron-hole model of the photosystem II (PSII) reaction center (RC). Our model incorporates two charge separation pathways and spatial correlations of both static disorder and fast fluctuations of energy levels. It captures the main experimental features observed in time-resolved two-dimensional (2D) optical spectra at 77 K: peak pattern, lineshapes and time traces. Analysis of 2D spectra kinetics reveals that specific regions of the 2D spectra of the PSII RC are sensitive to the charge transfer states. We find that the energy disorder of two peripheral chlorophylls is four times larger than the other RC pigments.
Doherty, Orla; Conway, Thomas; Conway, Richard; Murray, Gerard; Casey, Vincent
2017-01-01
Noseband tightness is difficult to assess in horses participating in equestrian sports such as dressage, show jumping and three-day-eventing. There is growing concern that nosebands are commonly tightened to such an extent as to restrict normal equine behaviour and possibly cause injury. In the absence of a clear agreed definition of noseband tightness, a simple model of the equine nose-noseband interface environment was developed in order to guide further studies in this area. The normal force component of the noseband tensile force was identified as the key contributor to sub-noseband tissue compression. The model was used to inform the design of a digital tightness gauge which could reliably measure the normal force component of the noseband tensile force. A digital tightness gauge was developed to measure this parameter under nosebands fitted to bridled horses. Results are presented for field tests using two prototype designs. Prototype version three was used in field trial 1 (n = 15, frontal nasal plane sub-noseband site). Results of this trial were used to develop an ergonomically designed prototype, version 4, which was tested in a second field trial (n = 12, frontal nasal plane and lateral sub-noseband site). Nosebands were set to three tightness settings in each trial as judged by a single rater using an International Society for Equitation Science (ISES) taper gauge. Normal forces in the range 7-95 N were recorded at the frontal nasal plane while a lower range 1-28 N was found at the lateral site for the taper gauge range used in the trials. The digital tightness gauge was found to be simple to use, reliable, and safe and its use did not agitate the animals in any discernable way. A simple six point tightness scale is suggested to aid regulation implementation and the control of noseband tightness using normal force measurement as the objective tightness discriminant.
A Model for Predicting Thermoelectric Properties of Bi2Te3
NASA Technical Reports Server (NTRS)
Lee, Seungwon; VonAllmen, Paul
2009-01-01
A parameterized orthogonal tight-binding mathematical model of the quantum electronic structure of the bismuth telluride molecule has been devised for use in conjunction with a semiclassical transport model in predicting the thermoelectric properties of doped bismuth telluride. This model is expected to be useful in designing and analyzing Bi2Te3 thermoelectric devices, including ones that contain such nano - structures as quantum wells and wires. In addition, the understanding gained in the use of this model can be expected to lead to the development of better models that could be useful for developing other thermoelectric materials and devices having enhanced thermoelectric properties. Bi2Te3 is one of the best bulk thermoelectric materials and is widely used in commercial thermoelectric devices. Most prior theoretical studies of the thermoelectric properties of Bi2Te3 have involved either continuum models or ab-initio models. Continuum models are computationally very efficient, but do not account for atomic-level effects. Ab-initio models are atomistic by definition, but do not scale well in that computation times increase excessively with increasing numbers of atoms. The present tight-binding model bridges the gap between the well-scalable but non-atomistic continuum models and the atomistic but poorly scalable ab-initio models: The present tight-binding model is atomistic, yet also computationally efficient because of the reduced (relative to an ab-initio model) number of basis orbitals and flexible parameterization of the Hamiltonian.
Grain-Boundary Resistance in Copper Interconnects: From an Atomistic Model to a Neural Network
NASA Astrophysics Data System (ADS)
Valencia, Daniel; Wilson, Evan; Jiang, Zhengping; Valencia-Zapata, Gustavo A.; Wang, Kuang-Chung; Klimeck, Gerhard; Povolotskyi, Michael
2018-04-01
Orientation effects on the specific resistance of copper grain boundaries are studied systematically with two different atomistic tight-binding methods. A methodology is developed to model the specific resistance of grain boundaries in the ballistic limit using the embedded atom model, tight- binding methods, and nonequilibrium Green's functions. The methodology is validated against first-principles calculations for thin films with a single coincident grain boundary, with 6.4% deviation in the specific resistance. A statistical ensemble of 600 large, random structures with grains is studied. For structures with three grains, it is found that the distribution of specific resistances is close to normal. Finally, a compact model for grain-boundary-specific resistance is constructed based on a neural network.
Tight-binding modeling and low-energy behavior of the semi-Dirac point.
Banerjee, S; Singh, R R P; Pardo, V; Pickett, W E
2009-07-03
We develop a tight-binding model description of semi-Dirac electronic spectra, with highly anisotropic dispersion around point Fermi surfaces, recently discovered in electronic structure calculations of VO2-TiO2 nanoheterostructures. We contrast their spectral properties with the well-known Dirac points on the honeycomb lattice relevant to graphene layers and the spectra of bands touching each other in zero-gap semiconductors. We also consider the lowest order dispersion around one of the semi-Dirac points and calculate the resulting electronic energy levels in an external magnetic field. In spite of apparently similar electronic structures, Dirac and semi-Dirac systems support diverse low-energy physics.
Hybrid k .p tight-binding model for intersubband optics in atomically thin InSe films
NASA Astrophysics Data System (ADS)
Magorrian, S. J.; Ceferino, A.; Zólyomi, V.; Fal'ko, V. I.
2018-04-01
We propose atomic films of n -doped γ -InSe as a platform for intersubband optics in the infrared and far-infrared range, coupled to out-of-plane polarized light. Depending on the film thickness (number of layers) and the amount of n -doping of the InSe film, these transitions span from ˜0.7 eV for bilayer to ˜0.05 eV for 15-layer InSe. We use a hybrid k .p theory and tight-binding model, fully parametrized using density-functional theory, to predict their oscillator strengths and thermal linewidths at room temperature.
NASA Astrophysics Data System (ADS)
Kar, J. K.; Panda, Saswati; Rout, G. C.
2017-05-01
We propose here a tight binding model study of the interplay between charge and spin orderings in the CMR manganites taking anisotropic effect due to electron hoppings and spin exchanges. The Hamiltonian consists of the kinetic energies of eg and t2g electrons of manganese ion. It further includes double exchange and Heisenberg interactions. The charge density wave interaction (CDW) describes an extra mechanism for the insulating character of the system. The CDW gap and spin parameters are calculated using Zubarev's Green's function technique and computed self-consistently. The results are reported in this communication.
Modeling of full-Heusler alloys within tight-binding approximation: Case study of Fe2MnAl
NASA Astrophysics Data System (ADS)
Azhar, A.; Majidi, M. A.; Nanto, D.
2017-07-01
Heusler alloys have been known for about a century, and predictions of magnetic moment values using Slater-Pauling rule have been successful for many such materials. However, such a simple counting rule has been found not to always work for all Heusler alloys. For instance, Fe2CuAl has been found to have magnetic moment of 3.30 µB per formula unit although the Slater-Pauling rule suggests the value of 2 µB. On the other hand, a recent experiment shows that a non-stoichiometric Heusler compound Fe2Mn0.5Cu0.5Al possesses magnetic moment of 4 µB, closer to the Slater-Pauling prediction for the stoichiometric compound. Such discrepancies signify that the theory to predict the magnetic moment of Heusler alloys in general is still far from being complete. Motivated by this issue, we propose to do a theoretical study on a full-Heusler alloy Fe2MnAl to understand the formation of magnetic moment microscopically. We model the system by constructing a density-functional-theory-based tight-binding Hamiltonian and incorporating Hubbard repulsive as well as spin-spin interactions for the electrons occupying the d-orbitals. Then, we solve the model using Green's function approach, and treat the interaction terms within the mean-field approximation. At this stage, we aim to formulate the computational algorithm for the overall calculation process. Our final goal is to compute the total magnetic moment per unit cell of this system and compare it with the experimental data.
The tightly bound nuclei in the liquid drop model
NASA Astrophysics Data System (ADS)
Sree Harsha, N. R.
2018-05-01
In this paper, we shall maximise the binding energy per nucleon function in the semi-empirical mass formula of the liquid drop model of the atomic nuclei to analytically prove that the mean binding energy per nucleon curve has local extrema at A ≈ 58.6960, Z ≈ 26.3908 and at A ≈ 62.0178, Z ≈ 27.7506. The Lagrange method of multipliers is used to arrive at these results, while we have let the values of A and Z take continuous fractional values. The shell model that shows why 62Ni is the most tightly bound nucleus is outlined. A brief account on stellar nucleosynthesis is presented to show why 56Fe is more abundant than 62Ni and 58Fe. We believe that the analytical proof presented in this paper can be a useful tool to the instructors to introduce the nucleus with the highest mean binding energy per nucleon.
Pseudo-magnetic fields of strongly-curved graphene nanobubbles
NASA Astrophysics Data System (ADS)
Liu, Li-Chi
2018-04-01
We use the π-orbital axis vector (POAV) analysis to deal with large curvature effect of graphene in the tight-binding model. To test the validities of pseudo-magnetic fields (PMFs) derived from the tight-binding model and the model with Dirac equation coupled to a curved surface, we propose two types of spatially constant-field topographies for strongly-curved graphene nanobubbles, which correspond to these two models, respectively. It is shown from the latter model that the PMF induced by any spherical graphene nanobubble is always equivalent to the magnetic field caused by one magnetic monopole charge distributed on a complete spherical surface with the same radius. Such a PMF might be attributed to the isometry breaking of a graphene layer attached conformably to a spherical substrate with adhesion.
Dpb11 may function with RPA and DNA to initiate DNA replication.
Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P; Kaplan, Daniel L
2017-01-01
Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation.
Actinide electronic structure and atomic forces
NASA Astrophysics Data System (ADS)
Albers, R. C.; Rudin, Sven P.; Trinkle, Dallas R.; Jones, M. D.
2000-07-01
We have developed a new method[1] of fitting tight-binding parameterizations based on functional forms developed at the Naval Research Laboratory.[2] We have applied these methods to actinide metals and report our success using them (see below). The fitting procedure uses first-principles local-density-approximation (LDA) linear augmented plane-wave (LAPW) band structure techniques[3] to first calculate an electronic-structure band structure and total energy for fcc, bcc, and simple cubic crystal structures for the actinide of interest. The tight-binding parameterization is then chosen to fit the detailed energy eigenvalues of the bands along symmetry directions, and the symmetry of the parameterization is constrained to agree with the correct symmetry of the LDA band structure at each eigenvalue and k-vector that is fit to. By fitting to a range of different volumes and the three different crystal structures, we find that the resulting parameterization is robust and appears to accurately calculate other crystal structures and properties of interest.
Pang, Yuan-Ping; Dai, Haiming; Smith, Alyson; Meng, X. Wei; Schneider, Paula A.; Kaufmann, Scott H.
2012-01-01
Recently we reported that the BH3-only proteins Bim and Noxa bind tightly but transiently to the BH3-binding groove of Bak to initiate Bak homo-oligomerization. However, it is unclear how such tight binding can induce Bak homo-oligomerization. Here we report the ligand-induced Bak conformational changes observed in 3D models of Noxa·Bak and Bim·Bak refined by molecular dynamics simulations. In particular, upon binding to the BH3-binding groove, Bim and Noxa induce a large conformational change of the loop between helices 1 and 2 and in turn partially expose a remote groove between helices 1 and 6 in Bak. These observations, coupled with the reported experimental data, suggest formation of a pore-forming Bak octamer, in which the BH3-binding groove is at the interface on one side of each monomer and the groove between helices 1 and 6 is at the interface on the opposite side, initiated by ligand binding to the BH3-binding groove. PMID:22355769
Design principles for shift current photovoltaics
Cook, Ashley M.; M. Fregoso, Benjamin; de Juan, Fernando; ...
2017-01-25
While the basic principles of conventional solar cells are well understood, little attention has gone towards maximizing the efficiency of photovoltaic devices based on shift currents. Furthermore, by analysing effective models, here we outline simple design principles for the optimization of shift currents for frequencies near the band gap. This method allows us to express the band edge shift current in terms of a few model parameters and to show it depends explicitly on wavefunctions in addition to standard band structure. We use our approach to identify two classes of shift current photovoltaics, ferroelectric polymer films and single-layer orthorhombic monochalcogenidesmore » such as GeS, which display the largest band edge responsivities reported so far. Moreover, exploring the parameter space of the tight-binding models that describe them we find photoresponsivities that can exceed 100 mA W -1 . Our results illustrate the great potential of shift current photovoltaics to compete with conventional solar cells.« less
Design principles for shift current photovoltaics
Cook, Ashley M.; M. Fregoso, Benjamin; de Juan, Fernando; Coh, Sinisa; Moore, Joel E.
2017-01-01
While the basic principles of conventional solar cells are well understood, little attention has gone towards maximizing the efficiency of photovoltaic devices based on shift currents. By analysing effective models, here we outline simple design principles for the optimization of shift currents for frequencies near the band gap. Our method allows us to express the band edge shift current in terms of a few model parameters and to show it depends explicitly on wavefunctions in addition to standard band structure. We use our approach to identify two classes of shift current photovoltaics, ferroelectric polymer films and single-layer orthorhombic monochalcogenides such as GeS, which display the largest band edge responsivities reported so far. Moreover, exploring the parameter space of the tight-binding models that describe them we find photoresponsivities that can exceed 100 mA W−1. Our results illustrate the great potential of shift current photovoltaics to compete with conventional solar cells. PMID:28120823
Design principles for shift current photovoltaics
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cook, Ashley M.; M. Fregoso, Benjamin; de Juan, Fernando
While the basic principles of conventional solar cells are well understood, little attention has gone towards maximizing the efficiency of photovoltaic devices based on shift currents. Furthermore, by analysing effective models, here we outline simple design principles for the optimization of shift currents for frequencies near the band gap. This method allows us to express the band edge shift current in terms of a few model parameters and to show it depends explicitly on wavefunctions in addition to standard band structure. We use our approach to identify two classes of shift current photovoltaics, ferroelectric polymer films and single-layer orthorhombic monochalcogenidesmore » such as GeS, which display the largest band edge responsivities reported so far. Moreover, exploring the parameter space of the tight-binding models that describe them we find photoresponsivities that can exceed 100 mA W -1 . Our results illustrate the great potential of shift current photovoltaics to compete with conventional solar cells.« less
Wavepacket dynamics in one-dimensional system with long-range correlated disorder
NASA Astrophysics Data System (ADS)
Yamada, Hiroaki S.
2018-03-01
We numerically investigate dynamical property in the one-dimensional tight-binding model with long-range correlated disorder having power spectrum 1 /fα (α: spectrum exponent) generated by Fourier filtering method. For relatively small α <αc (=2) time-dependence of mean square displacement (MSD) of the initially localized wavepacket shows ballistic spread and localizes as time elapses. It is shown that α-dependence of the dynamical localization length determined by the MSD exhibits a simple scaling law in the localization regime for the relatively weak disorder strength W. Furthermore, scaled MSD by the dynamical localization length almost obeys an universal function from the ballistic to the localization regime in the various combinations of the parameters α and W.
NASA Technical Reports Server (NTRS)
Bates, Kevin R.; Scuseria, Gustavo E.
1998-01-01
Multi-layered round carbon particles (onions) containing tens to hundreds of thousands of atoms form during electron irradiation of graphite. However. theoretical models or large icosahedral fullerenes predict highly faceted shapes for molecules with more than a few hundred atoms. This discrepancy in shape may be explained by the presence of defects during the formation of carbon onions. Here, we use the semi-empirical tight-binding method for carbon to simulate the incorporation of pentagon-heptagon defects on to the surface of large icosahedral fullerenes. We show a simple mechanism that results in energetically competitive derivative structures and a global change in molecular shape from faceted to round. Our results provide a plausible explanation of the apparent discrepancy between experimental observations or round buckyonions and theoretical predictions of faceted icosahedral fullerenes.
Dpb11 may function with RPA and DNA to initiate DNA replication
Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P.
2017-01-01
Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation. PMID:28467467
Structural mechanism of the ATP-induced dissociation of rigor myosin from actin
Kühner, Sebastian; Fischer, Stefan
2011-01-01
Myosin is a true nanomachine, which produces mechanical force from ATP hydrolysis by cyclically interacting with actin filaments in a four-step cycle. The principle underlying each step is that structural changes in separate regions of the protein must be mechanically coupled. The step in which myosin dissociates from tightly bound actin (the rigor state) is triggered by the 30 Å distant binding of ATP. Large conformational differences between the crystal structures make it difficult to perceive the coupling mechanism. Energetically accessible transition pathways computed at atomic detail reveal a simple coupling mechanism for the reciprocal binding of ATP and actin. PMID:21518908
NASA Astrophysics Data System (ADS)
Esmaili, Esmat; Mardaani, Mohammad; Rabani, Hassan
2018-01-01
The electronic transport of a ladder-like graphene nanoribbon which the on-site or hopping energies of a small part of it can be random is modeled by using the Green's function technique within the nearest neighbor tight-binding approach. We employ a unitary transformation in order to convert the Hamiltonian of the nanoribbon to the Hamiltonian of a tight-binding ladder-like network. In this case, the disturbed part of the system includes the second neighbor hopping interactions. While, the converted Hamiltonian of each ideal part is equivalent to the Hamiltonian of two periodic on-site chains. Therefore, we can insert the self-energies of the alternative on-site tight-binding chains to the inverse of the Green's function matrix of the ladder-like part. In this viewpoint, the conductance is constructed from two trans and cis contributions. The results show that increasing the disorder strength causes the increase and decrease of the conductance of the trans and cis contributions, respectively.
Multi-orbit tight binding calculations for spin transfer torque in magnetic tunneling junctions
NASA Astrophysics Data System (ADS)
You, Chun-Yeol; Han, Jae-Ho; Lee, Hyun-Woo
2012-04-01
We investigate the spin transfer torque (STT) with multi-orbit tight binding model in the magnetic tunneling junctions (MTJs). So far, most of the theoretical works based on the non-equilibrium Keldysh Green's function method employ a single band model for the simplicity, except a few first principle studies. Even though the single band model captures main physics of STT in MTJ, multi-band calculation reveals new features of the STT that depend on band parameters, such as insulator bandgap, inter-band hopping energy of the ferromagnetic layer. We find that the sign change of perpendicular torkance with bandgap of the insulator layer, and when we allow the inter-band hopping, the bias dependences of perpendicular STT are dramatically changed, while no noticeable changes in parallel STT are found.
Universal tight binding model for chemical reactions in solution and at surfaces. II. Water.
Lozovoi, A Y; Sheppard, T J; Pashov, D L; Kohanoff, J J; Paxton, A T
2014-07-28
A revised water model intended for use in condensed phase simulations in the framework of the self consistent polarizable ion tight binding theory is constructed. The model is applied to water monomer, dimer, hexamers, ice, and liquid, where it demonstrates good agreement with theoretical results obtained by more accurate methods, such as DFT and CCSD(T), and with experiment. In particular, the temperature dependence of the self diffusion coefficient in liquid water predicted by the model, closely reproduces experimental curves in the temperature interval between 230 K and 350 K. In addition, and in contrast to standard DFT, the model properly orders the relative densities of liquid water and ice. A notable, but inevitable, shortcoming of the model is underestimation of the static dielectric constant by a factor of two. We demonstrate that the description of inter and intramolecular forces embodied in the tight binding approximation in quantum mechanics leads to a number of valuable insights which can be missing from ab initio quantum chemistry and classical force fields. These include a discussion of the origin of the enhanced molecular electric dipole moment in the condensed phases, and a detailed explanation for the increase of coordination number in liquid water as a function of temperature and compared with ice--leading to insights into the anomalous expansion on freezing. The theory holds out the prospect of an understanding of the currently unexplained density maximum of water near the freezing point.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morris, J.R.; Lu, Z.; Ring, D.M.
We have examined a variety of structures for the {l_brace}510{r_brace} symmetric tilt boundary in Si and Ge, using tight-binding and first-principles calculations. These calculations show that the observed structure in Si is the lowest-energy structure, despite the fact that it is more complicated than what is necessary to preserve fourfold coordination. Contrary to calculations using a Tersoff potential, first-principles calculations show that the energy depends strongly upon the structure. A recently developed tight-binding model for Si produces results in very good agreement with the first-principles calculations. Electronic density of states calculations based upon this model show no evidence of midgapmore » states and little evidence of electronic states localized to the grain boundary. {copyright} {ital 1998} {ital The American Physical Society}« less
Fullerene Derived Molecular Electronic Devices
NASA Technical Reports Server (NTRS)
Menon, Madhu; Srivastava, Deepak; Saini, Subbash
1998-01-01
The carbon Nanotube junctions have recently emerged as excellent candidates for use as the building blocks in the formation of nanoscale electronic devices. While the simple joint of two dissimilar tubes can be generated by the introduction of a pair of heptagon-pentagon defects in an otherwise perfect hexagonal grapheme sheet, more complex joints require other mechanisms. In this work we explore structural and electronic properties of complex 3-point junctions of carbon nanotubes using a generalized tight-binding molecular-dynamics scheme.
Modeling the coma of 2060 Chiron
NASA Technical Reports Server (NTRS)
Boice, D. C.; Konno, I.; Stern, S. Alan; Huebner, W. F.
1991-01-01
Observations of comet-like activity and a resolved coma have established that 2060 Chiron is a comet. Determinations of its radius range from 65 to 200 km. This unusually large size for a comet suggests that the atmosphere of Chiron is intermediate to the tightly bound, thin atmospheres typical of planets and satellite and the greatly extended atmospheres in free expansion typical of cometary comae. Under certain conditions it may gravitationally bind an atmosphere that is thick compared to its size, while a significant amount of gas escapes to an extensive exosphere. These attributes coupled with reports of sporadic outbursts at large heliocentric distances and the identification of CN in the coma make Chiron a challenging object to model. Simple models of gas production and the dusty coma were recently presented but a general concensus on many basic features has not emerged. Development was begun on a more complete coma model of Chiron. The objectives are to report progress on this model and give the preliminary results for understanding Chiron.
Tight binding simulation study on zigzag single-walled carbon nanotubes
NASA Astrophysics Data System (ADS)
Sharma, Deepa; Jaggi, Neena; Gupta, Vishu
2018-01-01
Tight binding simulation studies using the density functional tight binding (DFTB) model have been performed on various zigzag single-walled carbon-nanotubes (SWCNTs) to investigate their electronic properties using DFTB module of the Material Studio Software version 7.0. Various combinations of different eigen-solvers and charge mixing schemes available in the DFTB Module have been tried to chalk out the electronic structure. The analytically deduced values of the bandgap of (9, 0) SWCNT were compared with the experimentally determined value reported in the literature. On comparison, it was found that the tight binding approximations tend to drastically underestimate the bandgap values. However, the combination of Anderson charge mixing method with standard eigensolver when implemented using the smart algorithm was found to produce fairly close results. These optimized model parameters were then used to determine the band structures of various zigzag SWCNTs. (9, 0) Single-walled Nanotube which is extensively being used for sensing NH3, CH4 and NO2 has been picked up as a reference material since its experimental bandgap value has been reported in the literature. It has been found to exhibit a finite energy bandgap in contrast to its expected metallic nature. The study is of utmost significance as it not only probes and validates the simulation route for predicting suitable properties of nanomaterials but also throws light on the comparative efficacy of the different approximation and rationalization quantum mechanical techniques used in simulation studies. Such simulation studies if used intelligently prove to be immensely useful to the material scientists as they not only save time and effort but also pave the way to new experiments by making valuable predictions.
NASA Astrophysics Data System (ADS)
Lei, Jie
2011-03-01
In order to understand the electronic and transport properties of organic field-effect transistor (FET) materials, we theoretically studied the polarons in two-dimensional systems using a tight-binding model with the Holstein type and Su--Schrieffer--Heeger type electron--lattice couplings. By numerical calculations, it was found that a carrier accepts four kinds of localization, which are named the point polaron, two-dimensional polaron, one-dimensional polaron, and the extended state. The degree of localization is sensitive to the following parameters in the model: the strength and type of electron--lattice couplings, and the signs and relative magnitudes of transfer integrals. When a parameter set for a single-crystal phase of pentacene is applied within the Holstein model, a considerably delocalized hole polaron is found, consistent with the bandlike transport mechanism.
NASA Astrophysics Data System (ADS)
Dias, R. G.; Gouveia, J. D.
2015-11-01
We present a method of construction of exact localized many-body eigenstates of the Hubbard model in decorated lattices, both for U = 0 and U → ∞. These states are localized in what concerns both hole and particle movement. The starting point of the method is the construction of a plaquette or a set of plaquettes with a higher symmetry than that of the whole lattice. Using a simple set of rules, the tight-binding localized state in such a plaquette can be divided, folded and unfolded to new plaquette geometries. This set of rules is also valid for the construction of a localized state for one hole in the U → ∞ limit of the same plaquette, assuming a spin configuration which is a uniform linear combination of all possible permutations of the set of spins in the plaquette.
NASA Astrophysics Data System (ADS)
Yu, Jin; van Veen, Edo; Katsnelson, Mikhail I.; Yuan, Shengjun
2018-06-01
The electronic properties of monolayer tin dilsulfide (ML -Sn S2 ), a recently synthesized metal dichalcogenide, are studied by a combination of first-principles calculations and tight-binding (TB) approximation. An effective lattice Hamiltonian based on six hybrid s p -like orbitals with trigonal rotation symmetry are proposed to calculate the band structure and density of states for ML -Sn S2 , which demonstrates good quantitative agreement with relativistic density-functional-theory calculations in a wide energy range. We show that the proposed TB model can be easily applied to the case of an external electric field, yielding results consistent with those obtained from full Hamiltonian results. In the presence of a perpendicular magnetic field, highly degenerate equidistant Landau levels are obtained, showing typical two-dimensional electron gas behavior. Thus, the proposed TB model provides a simple way in describing properties in ML -Sn S2 .
Basic concepts of quantum interference and electron transport in single-molecule electronics.
Lambert, C J
2015-02-21
This tutorial outlines the basic theoretical concepts and tools which underpin the fundamentals of phase-coherent electron transport through single molecules. The key quantity of interest is the transmission coefficient T(E), which yields the electrical conductance, current-voltage relations, the thermopower S and the thermoelectric figure of merit ZT of single-molecule devices. Since T(E) is strongly affected by quantum interference (QI), three manifestations of QI in single-molecules are discussed, namely Mach-Zehnder interferometry, Breit-Wigner resonances and Fano resonances. A simple MATLAB code is provided, which allows the novice reader to explore QI in multi-branched structures described by a tight-binding (Hückel) Hamiltonian. More generally, the strengths and limitations of materials-specific transport modelling based on density functional theory are discussed.
NASA Technical Reports Server (NTRS)
Bates, Kevin R.; Scuseria, Gustavo E.
1997-01-01
Multi-layered round carbon particles (onions) containing tens to hundreds of thousands of atoms form during electron irradiation of graphite carbon. However, theoretical models of large icosahedral fullerenes predict highly faceted shapes for molecules with more than a few hundred atoms. This discrepancy in shape may be explained by the presence of defects during the formation of carbon onions. Here, we use the semi-empirical tight-binding method for carbon to simulate the incorporation of pentagon-heptagon defects on to the surface of large icosahedral fullerenes. We show a simple mechanism that results in energetically competitive derivative structures and a global change in molecular shape from faceted to round. Our results provide a plausible explanation of the apparent discrepancy between experimental observations of round buckyonions and theoretical predictions of faceted icosahedral fullerenes.
NASA Astrophysics Data System (ADS)
Shinozuka, Yuzo; Oda, Masato
2015-09-01
The interacting quasi-band model proposed for electronic states in simple alloys is extended for compound semiconductor alloys with general lattice structures containing several atoms per unit cell. Using a tight-binding model, a variational electronic wave function for quasi-Bloch states yields a non-Hermitian Hamiltonian matrix characterized by matrix elements of constituent crystals and concentration of constituents. Solving secular equations for each k-state yields the alloy’s energy spectrum for any type of randomness and arbitrary concentration. The theory is used to address III-V (II-VI) alloys with a zincblende lattice with crystal band structures well represented by the sp3s* model. Using the resulting 15 × 15 matrix, the concentration dependence of valence and conduction bands is calculated in a unified scheme for typical alloys: Al1-xGaxAs, GaAs1-xPx, and GaSb1-xPx. Results agree well with experiments and are discussed with respect to the concentration dependence, direct-indirect gap transition, and band-gap-bowing origin.
Rapid calculation method for Frenkel-type two-exciton states in one to three dimensions
NASA Astrophysics Data System (ADS)
Ajiki, Hiroshi
2014-07-01
Biexciton and two-exciton dissociated states of Frenkel-type excitons are well described by a tight-binding model with a nearest-neighbor approximation. Such two-exciton states in a finite-size lattice are usually calculated by numerical diagonalization of the Hamiltonian, which requires an increasing amount of computational time and memory as the lattice size increases. I develop here a rapid, memory-saving method to calculate the energies and wave functions of two-exciton states by employing a bisection method. In addition, an attractive interaction between two excitons in the tight-binding model can be obtained directly so that the biexciton energy agrees with the observed energy, without the need for the trial-and-error procedure implemented in the numerical diagonalization method.
Gaussian polarizable-ion tight binding.
Boleininger, Max; Guilbert, Anne Ay; Horsfield, Andrew P
2016-10-14
To interpret ultrafast dynamics experiments on large molecules, computer simulation is required due to the complex response to the laser field. We present a method capable of efficiently computing the static electronic response of large systems to external electric fields. This is achieved by extending the density-functional tight binding method to include larger basis sets and by multipole expansion of the charge density into electrostatically interacting Gaussian distributions. Polarizabilities for a range of hydrocarbon molecules are computed for a multipole expansion up to quadrupole order, giving excellent agreement with experimental values, with average errors similar to those from density functional theory, but at a small fraction of the cost. We apply the model in conjunction with the polarizable-point-dipoles model to estimate the internal fields in amorphous poly(3-hexylthiophene-2,5-diyl).
Gaussian polarizable-ion tight binding
NASA Astrophysics Data System (ADS)
Boleininger, Max; Guilbert, Anne AY; Horsfield, Andrew P.
2016-10-01
To interpret ultrafast dynamics experiments on large molecules, computer simulation is required due to the complex response to the laser field. We present a method capable of efficiently computing the static electronic response of large systems to external electric fields. This is achieved by extending the density-functional tight binding method to include larger basis sets and by multipole expansion of the charge density into electrostatically interacting Gaussian distributions. Polarizabilities for a range of hydrocarbon molecules are computed for a multipole expansion up to quadrupole order, giving excellent agreement with experimental values, with average errors similar to those from density functional theory, but at a small fraction of the cost. We apply the model in conjunction with the polarizable-point-dipoles model to estimate the internal fields in amorphous poly(3-hexylthiophene-2,5-diyl).
Morgan, Sarah V; Garwood, Claire J; Jennings, Luke; Simpson, Julie E; Castelli, Lydia M; Heath, Paul R; Mihaylov, Simeon R; Vaquéz-Villaseñor, Irina; Minshull, Thomas C; Ince, Paul G; Dickman, Mark J; Hautbergue, Guillaume M; Wharton, Stephen B
2018-05-08
Occludin is a component of tight junctions, which are essential structural components of the blood-brain barrier. However, occludin is expressed in cells without tight junctions, implying additional functions. We determined the expression and localisation of occludin in astrocytes in cell culture and in human brain tissue, and sought novel binding partners using a proteomic approach. Expression was investigated by immunocytochemistry and immunoblotting in the 1321N1 astrocytoma cell line and ScienCell human primary astrocytes, and by immunohistochemistry in human autopsy brain tissue. Recombinant N- and C-terminal occludin was used to pull-down proteins from 1321N1 cell lysates and protein-binding partners identified by mass spectrometry analysis. Occludin was expressed in both the cytoplasm and nucleus of astrocytes in vitro and in vivo. Mass spectrometry identified binding to nuclear and cytoplasmic proteins, particularly those related to RNA metabolism and nuclear function. Occludin is expressed in several subcellular compartments of brain cell-types that do not form tight junctions and the expression patterns in cell culture reflect those in human brain tissue, indicating they are suitable model systems. Proteomic analysis suggests that occludin has novel functions in neuroepithelial cells that are unrelated to tight junction formation. Further research will establish the roles of these functions in both cellular physiology and in disease states. © 2018 The Authors. European Journal of Neuroscience published by Federation of European Neuroscience Societies and John Wiley & Sons Ltd.
Salas-Sarduy, Emir; Guerra, Yasel; Covaleda Cortés, Giovanni; Avilés, Francesc Xavier; Chávez Planes, María A.
2017-01-01
Natural products from marine origin constitute a very promising and underexplored source of interesting compounds for modern biotechnological and pharmaceutical industries. However, their evaluation is quite challenging and requires specifically designed assays to reliably identify the compounds of interest in a highly heterogeneous and interfering context. In the present study, we describe a general strategy for the confident identification of tight-binding protease inhibitors in the aqueous extracts of 62 Cuban marine invertebrates, using Plasmodium falciparum hemoglobinases Plasmepsin II and Falcipain 2 as model enzymes. To this end, we first developed a screening strategy that combined enzymatic with interaction-based assays and then validated screening conditions using five reference extracts. Interferences were evaluated and minimized. The results from the massive screening of such extracts, the validation of several hits by a variety of interaction-based assays and the purification and functional characterization of PhPI, a multifunctional and reversible tight-binding inhibitor for Plasmepsin II and Falcipain 2 from the gorgonian Plexaura homomalla, are presented. PMID:28430158
NASA Astrophysics Data System (ADS)
Venkataraman, Vijay Shankar
The experimental and theoretical study of transition metal compounds have occupied condensed matter physicists for the best part of the last century. The rich variety of physical behaviour exhibited by these compounds owes its origin to the subtle balance of the energy scales at play for the d orbitals. In this thesis, we study three different systems comprised of transition metal atoms from the third, the fourth, and the fifth group of the periodic table using a combination of ab-initio density functional theory (DFT) computations and effective tight-binding models for the electronic properties. We first consider the electronic properties of artificially fabricated perovskite superlattices of the form [(SrIrO3)m / SrTiO3] with integer m denoting the number of layers of SrIrO3. After discussing the results of experiments undertaken by our collaborators, we present the results of our DFT calculations and build tight-binding models for the m = 1 and m = 2 superlattices. The active ingredient is found to be the 5d orbitals with significant spin-orbit coupling. We then study the energies of magnetic ground states within DFT and compare and contrast our results with those obtained for the bulk Ruddlesden-Popper iridates. Together with experimental measurements, our results suggest that these superlattices are an exciting venue to probe the magnetism and metal-insulator transitions that occur from the intricate balance of the spin-orbit coupling and electron interactions, as has been reported for their bulk counterparts. Next, we consider alpha-RuCl3, a honeycomb lattice compound. We first show using DFT calculations in conjunction with experiments performed by our collaborators, how spin-orbit coupling in the 4d orbitals of Ru is essential to understand the insulating state realized in this compound. Then, in the latter half of the chapter, we study the magnetic ground states of a two-dimensional analogue of alpha-RuCl3 in weak and strong-coupling regimes obtained from a tight-binding model for the 4d orbitals. We further compare these results with energies obtained from DFT calculations. We obtain a zig-zag magnetic ground state for this compound, in all the three approaches. Within DFT, we find that correlations enhance the spin-orbit coupling in this compound and that the anisotropic Kitaev interactions between the spins are dominant in a strong-coupling model. Then, we move on to study the electronic band structures of the higher manganese silicides, which are good thermoelectric materials. Using results from DFT calculations on Mn4Si7 and structural arguments, we construct an effective tight-binding model for the first three members of this series - Mn4Si7, Mn11Si19, and Mn15Si26.
Excitons in boron nitride single layer
NASA Astrophysics Data System (ADS)
Galvani, Thomas; Paleari, Fulvio; Miranda, Henrique P. C.; Molina-Sánchez, Alejandro; Wirtz, Ludger; Latil, Sylvain; Amara, Hakim; Ducastelle, François
2016-09-01
Boron nitride single layer belongs to the family of two-dimensional materials whose optical properties are currently receiving considerable attention. Strong excitonic effects have already been observed in the bulk and still stronger effects are predicted for single layers. We present here a detailed study of these properties by combining ab initio calculations and a tight-binding Wannier analysis in both real and reciprocal space. Due to the simplicity of the band structure with single valence (π ) and conduction (π*) bands the tight-binding analysis becomes quasiquantitative with only two adjustable parameters and provides tools for a detailed analysis of the exciton properties. Strong deviations from the usual hydrogenic model are evidenced. The ground-state exciton is not a genuine Frenkel exciton, but a very localized tightly bound one. The other ones are similar to those found in transition-metal dichalcogenides and, although more localized, can be described within a Wannier-Mott scheme.
Spin-density wave state in simple hexagonal graphite
NASA Astrophysics Data System (ADS)
Mosoyan, K. S.; Rozhkov, A. V.; Sboychakov, A. O.; Rakhmanov, A. L.
2018-02-01
Simple hexagonal graphite, also known as AA graphite, is a metastable configuration of graphite. Using tight-binding approximation, it is easy to show that AA graphite is a metal with well-defined Fermi surface. The Fermi surface consists of two sheets, each shaped like a rugby ball. One sheet corresponds to electron states, another corresponds to hole states. The Fermi surface demonstrates good nesting: a suitable translation in the reciprocal space superposes one sheet onto another. In the presence of the electron-electron repulsion, a nested Fermi surface is unstable with respect to spin-density-wave ordering. This instability is studied using the mean-field theory at zero temperature, and the spin-density-wave order parameter is evaluated.
Generalized virial theorem for massless electrons in graphene and other Dirac materials
NASA Astrophysics Data System (ADS)
Sokolik, A. A.; Zabolotskiy, A. D.; Lozovik, Yu. E.
2016-05-01
The virial theorem for a system of interacting electrons in a crystal, which is described within the framework of the tight-binding model, is derived. We show that, in the particular case of interacting massless electrons in graphene and other Dirac materials, the conventional virial theorem is violated. Starting from the tight-binding model, we derive the generalized virial theorem for Dirac electron systems, which contains an additional term associated with a momentum cutoff at the bottom of the energy band. Additionally, we derive the generalized virial theorem within the Dirac model using the minimization of the variational energy. The obtained theorem is illustrated by many-body calculations of the ground-state energy of an electron gas in graphene carried out in Hartree-Fock and self-consistent random-phase approximations. Experimental verification of the theorem in the case of graphene is discussed.
Modeling Magnetic Properties in EZTB
NASA Technical Reports Server (NTRS)
Lee, Seungwon; vonAllmen, Paul
2007-01-01
A software module that calculates magnetic properties of a semiconducting material has been written for incorporation into, and execution within, the Easy (Modular) Tight-Binding (EZTB) software infrastructure. [EZTB is designed to model the electronic structures of semiconductor devices ranging from bulk semiconductors, to quantum wells, quantum wires, and quantum dots. EZTB implements an empirical tight-binding mathematical model of the underlying physics.] This module can model the effect of a magnetic field applied along any direction and does not require any adjustment of model parameters. The module has thus far been applied to study the performances of silicon-based quantum computers in the presence of magnetic fields and of miscut angles in quantum wells. The module is expected to assist experimentalists in fabricating a spin qubit in a Si/SiGe quantum dot. This software can be executed in almost any Unix operating system, utilizes parallel computing, can be run as a Web-portal application program. The module has been validated by comparison of its predictions with experimental data available in the literature.
NASA Astrophysics Data System (ADS)
Aizawa, Hirohito; Kuroki, Kazuhiko
2018-03-01
We present a first-principles band calculation for the quasi-one-dimensional (Q1D) organic superconductor (TMTSF) 2ClO4 . An effective tight-binding model with the TMTSF molecule to be regarded as the site is derived from a calculation based on maximally localized Wannier orbitals. We apply a two-particle self-consistent (TPSC) analysis by using a four-site Hubbard model, which is composed of the tight-binding model and an onsite (intramolecular) repulsive interaction, which serves as a variable parameter. We assume that the pairing mechanism is mediated by the spin fluctuation, and the sign of the superconducting gap changes between the inner and outer Fermi surfaces, which correspond to a d -wave gap function in a simplified Q1D model. With the parameters we adopt, the critical temperature for superconductivity estimated by the TPSC approach is approximately 1 K, which is consistent with experiment.
Tunnel Field-Effect Transistors in 2-D Transition Metal Dichalcogenide Materials
NASA Astrophysics Data System (ADS)
Ilatikhameneh, Hesameddin; Tan, Yaohua; Novakovic, Bozidar; Klimeck, Gerhard; Rahman, Rajib; Appenzeller, Joerg
2015-12-01
In this work, the performance of Tunnel Field-Effect Transistors (TFETs) based on two-dimensional Transition Metal Dichalcogenide (TMD) materials is investigated by atomistic quantum transport simulations. One of the major challenges of TFETs is their low ON-currents. 2D material based TFETs can have tight gate control and high electric fields at the tunnel junction, and can in principle generate high ON-currents along with a sub-threshold swing smaller than 60 mV/dec. Our simulations reveal that high performance TMD TFETs, not only require good gate control, but also rely on the choice of the right channel material with optimum band gap, effective mass and source/drain doping level. Unlike previous works, a full band atomistic tight binding method is used self-consistently with 3D Poisson equation to simulate ballistic quantum transport in these devices. The effect of the choice of TMD material on the performance of the device and its transfer characteristics are discussed. Moreover, the criteria for high ON-currents are explained with a simple analytic model, showing the related fundamental factors. Finally, the subthreshold swing and energy-delay of these TFETs are compared with conventional CMOS devices.
FAST TRACK COMMUNICATION: Finite-temperature magnetism in bcc Fe under compression
NASA Astrophysics Data System (ADS)
Sha, Xianwei; Cohen, R. E.
2010-09-01
We investigate the contributions of finite-temperature magnetic fluctuations to the thermodynamic properties of bcc Fe as functions of pressure. First, we apply a tight-binding total-energy model parameterized to first-principles linearized augmented plane-wave computations to examine various ferromagnetic, anti-ferromagnetic, and noncollinear spin spiral states at zero temperature. The tight-binding data are fit to a generalized Heisenberg Hamiltonian to describe the magnetic energy functional based on local moments. We then use Monte Carlo simulations to compute the magnetic susceptibility, the Curie temperature, heat capacity, and magnetic free energy. Including the finite-temperature magnetism improves the agreement with experiment for the calculated thermal expansion coefficients.
Microwave emulations and tight-binding calculations of transport in polyacetylene
NASA Astrophysics Data System (ADS)
Stegmann, Thomas; Franco-Villafañe, John A.; Ortiz, Yenni P.; Kuhl, Ulrich; Mortessagne, Fabrice; Seligman, Thomas H.
2017-01-01
A novel approach to investigate the electron transport of cis- and trans-polyacetylene chains in the single-electron approximation is presented by using microwave emulation measurements and tight-binding calculations. In the emulation we take into account the different electronic couplings due to the double bonds leading to coupled dimer chains. The relative coupling constants are adjusted by DFT calculations. For sufficiently long chains a transport band gap is observed if the double bonds are present, whereas for identical couplings no band gap opens. The band gap can be observed also in relatively short chains, if additional edge atoms are absent, which cause strong resonance peaks within the band gap. The experimental results are in agreement with our tight-binding calculations using the nonequilibrium Green's function method. The tight-binding calculations show that it is crucial to include third nearest neighbor couplings to obtain the gap in the cis-polyacetylene.
The tight junction protein ZO-1 and an interacting transcription factor regulate ErbB-2 expression
Balda, Maria S.; Matter, Karl
2000-01-01
Epithelial tight junctions regulate paracellular diffusion and restrict the intermixing of apical and basolateral plasma membrane components. We now identify a Y-box transcription factor, ZONAB (ZO-1-associated nucleic acid-binding protein), that binds to the SH3 domain of ZO-1, a submembrane protein of tight junctions. ZONAB localizes to the nucleus and at tight junctions, and binds to sequences of specific promoters containing an inverted CCAAT box. In reporter assays, ZONAB and ZO-1 functionally interact in the regulation of the ErbB-2 promoter in a cell density-dependent manner. In stably transfected overexpressing cells, ZO-1 and ZONAB control expression of endogenous ErbB-2 and function in the regulation of paracellular permeability. These data indicate that tight junctions directly participate in the control of gene expression and suggest that they function in the regulation of epithelial cell differentiation. PMID:10790369
Transferable tight binding model for strained group IV and III-V heterostructures
NASA Astrophysics Data System (ADS)
Tan, Yaohua; Povolotskyi, Micheal; Kubis, Tillmann; Boykin, Timothy; Klimeck, Gerhard
Modern semiconductor devices have reached critical device dimensions in the range of several nanometers. For reliable prediction of device performance, it is critical to have a numerical efficient model that are transferable to material interfaces. In this work, we present an empirical tight binding (ETB) model with transferable parameters for strained IV and III-V group semiconductors. The ETB model is numerically highly efficient as it make use of an orthogonal sp3d5s* basis set with nearest neighbor inter-atomic interactions. The ETB parameters are generated from HSE06 hybrid functional calculations. Band structures of strained group IV and III-V materials by ETB model are in good agreement with corresponding HSE06 calculations. Furthermore, the ETB model is applied to strained superlattices which consist of group IV and III-V elements. The ETB model turns out to be transferable to nano-scale hetero-structure. The ETB band structures agree with the corresponding HSE06 results in the whole Brillouin zone. The ETB band gaps of superlattices with common cations or common anions have discrepancies within 0.05eV.
Development of tight-binding based GW algorithm and its computational implementation for graphene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Majidi, Muhammad Aziz; NUSNNI-NanoCore, Department of Physics, National University of Singapore; Singapore Synchrotron Light Source
Graphene has been a hot subject of research in the last decade as it holds a promise for various applications. One interesting issue is whether or not graphene should be classified into a strongly or weakly correlated system, as the optical properties may change upon several factors, such as the substrate, voltage bias, adatoms, etc. As the Coulomb repulsive interactions among electrons can generate the correlation effects that may modify the single-particle spectra (density of states) and the two-particle spectra (optical conductivity) of graphene, we aim to explore such interactions in this study. The understanding of such correlation effects ismore » important because eventually they play an important role in inducing the effective attractive interactions between electrons and holes that bind them into excitons. We do this study theoretically by developing a GW method implemented on the basis of the tight-binding (TB) model Hamiltonian. Unlike the well-known GW method developed within density functional theory (DFT) framework, our TB-based GW implementation may serve as an alternative technique suitable for systems which Hamiltonian is to be constructed through a tight-binding based or similar models. This study includes theoretical formulation of the Green’s function G, the renormalized interaction function W from random phase approximation (RPA), and the corresponding self energy derived from Feynman diagrams, as well as the development of the algorithm to compute those quantities. As an evaluation of the method, we perform calculations of the density of states and the optical conductivity of graphene, and analyze the results.« less
Three-Dimensional Structures Reveal Multiple ADP/ATP Binding Modes
DOE Office of Scientific and Technical Information (OSTI.GOV)
C Simmons; C Magee; D Smith
The creation of synthetic enzymes with predefined functions represents a major challenge in future synthetic biology applications. Here, we describe six structures of de novo proteins that have been determined using protein crystallography to address how simple enzymes perform catalysis. Three structures are of a protein, DX, selected for its stability and ability to tightly bind ATP. Despite the addition of ATP to the crystallization conditions, the presence of a bound but distorted ATP was found only under excess ATP conditions, with ADP being present under equimolar conditions or when crystallized for a prolonged period of time. A bound ADPmore » cofactor was evident when Asp was substituted for Val at residue 65, but ATP in a linear configuration is present when Phe was substituted for Tyr at residue 43. These new structures complement previously determined structures of DX and the protein with the Phe 43 to Tyr substitution [Simmons, C. R., et al. (2009) ACS Chem. Biol. 4, 649-658] and together demonstrate the multiple ADP/ATP binding modes from which a model emerges in which the DX protein binds ATP in a configuration that represents a transitional state for the catalysis of ATP to ADP through a slow, metal-free reaction capable of multiple turnovers. This unusual observation suggests that design-free methods can be used to generate novel protein scaffolds that are tailor-made for catalysis.« less
Spin fluctuations and superconductivity in a 3D tight-binding model for BaFe2As2
DOE Office of Scientific and Technical Information (OSTI.GOV)
Graser, Siegfried; Kemper, Alexander F; Maier, Thomas A
2010-01-01
Despite the wealth of experimental data on the Fe-pnictide compounds of the KFe2As2 type, K=Ba, Ca, or Sr, the main theoretical work based on multiorbital tight-binding models has been restricted so far to the study of the related 1111 compounds. This can be ascribed to the more three-dimensional electronic structure found by ab initio calculations for the 122 materials, making this system less amenable to model development. In addition, the more complicated Brillouin zone BZ of the body-centered tetragonal symmetry does not allow a straightforward unfolding of the electronic band structure into an effective 1Fe/unit cell BZ. Here we presentmore » an effective five-orbital tight-binding fit of the full density functional theory band structure for BaFe2As2 including the kz dispersions. We compare the five-orbital spin fluctuation model to one previously studied for LaOFeAs and calculate the random-phase approximation enhanced susceptibility. Using the fluctuation ex- change approximation to determine the leading pairing instability, we then examine the differences between a strictly two-dimensional model calculation over a single kz cut of the BZ and a completely three-dimensional approach. We find pairing states quite similar to the 1111 materials, with generic quasi-isotropic pairing on the hole sheets and nodal states on the electron sheets at kz=0, which however are gapped as the system is hole doped. On the other hand, a substantial kz dependence of the order parameter remains, with most of the pairing strength deriving from processes near kz=?. These states exhibit a tendency for an enhanced anisotropy on the hole sheets and a reduced anisotropy on the electron sheets near the top of the BZ.« less
NASA Astrophysics Data System (ADS)
Xie, Pinchen; Yang, Bingjia; Zhang, Zhongzhi; Andrade, Roberto F. S.
2018-07-01
A deterministic network with tree structure is considered, for which the spectrum of its adjacency matrix can be exactly evaluated by a recursive renormalization approach. It amounts to successively increasing number of contributions at any finite step of construction of the tree, resulting in a causal chain. The resulting eigenvalues can be related the full energy spectrum of a nearest-neighbor tight-binding model defined on this structure. Given this association, it turns out that further properties of the eigenvectors can be evaluated, like the degree of quantum localization of the tight-binding eigenstates, expressed by the inverse participation ratio (IPR). It happens that, for the current model, the IPR's are also suitable to be analytically expressed in terms in corresponding eigenvalue chain. The resulting IPR scaling behavior is expressed by the tails of eigenvalue chains as well.
NASA Astrophysics Data System (ADS)
Oliveira, Luiz F. L.; Fu, Christopher D.; Pfaendtner, Jim
2018-04-01
Infrequent metadynamics uses biased simulations to estimate the unbiased kinetics of a system, facilitating the calculation of rates and barriers. Here the method is applied to study intramolecular hydrogen transfer reactions involving peroxy radicals, a class of reactions that is challenging to model due to the entropic contributions of the formation of ring structures in the transition state. Using the self-consistent charge density-functional based tight-binding (DFTB) method, we applied infrequent metadynamics to the study of four intramolecular H-transfer reactions, demonstrating that the method can qualitatively reproduce these high entropic contributions, as observed in experiments and those predicted by transition state theory modeled by higher levels of theory. We also show that infrequent metadynamics and DFTB are successful in describing the relationship between transition state ring size and kinetic coefficients (e.g., activation energies and the pre-exponential factors).
NASA Astrophysics Data System (ADS)
Hegde, Ganesh; Povolotskyi, Michael; Kubis, Tillmann; Charles, James; Klimeck, Gerhard
2014-03-01
The Semi-Empirical tight binding model developed in Part I Hegde et al. [J. Appl. Phys. 115, 123703 (2014)] is applied to metal transport problems of current relevance in Part II. A systematic study of the effect of quantum confinement, transport orientation, and homogeneous strain on electronic transport properties of Cu is carried out. It is found that quantum confinement from bulk to nanowire boundary conditions leads to significant anisotropy in conductance of Cu along different transport orientations. Compressive homogeneous strain is found to reduce resistivity by increasing the density of conducting modes in Cu. The [110] transport orientation in Cu nanowires is found to be the most favorable for mitigating conductivity degradation since it shows least reduction in conductance with confinement and responds most favorably to compressive strain.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pourmatin, Hossein, E-mail: mpourmat@andrew.cmu.edu; Dayal, Kaushik, E-mail: kaushik@cmu.edu
2016-10-15
Graphical abstract: - Abstract: We consider the scattering of incident plane-wave electrons from a defect in a crystal modeled by the time-harmonic Schrödinger equation. While the defect potential is localized, the far-field potential is periodic, unlike standard free-space scattering problems. Previous work on the Schrödinger equation has been almost entirely in free-space conditions; a few works on crystals have been in one-dimension. We construct absorbing boundary conditions for this problem using perfectly matched layers in a tight-binding formulation. Using the example of a point defect in graphene, we examine the efficiency and convergence of the proposed absorbing boundary condition.
Ligand Binding to Macromolecules: Allosteric and Sequential Models of Cooperativity.
ERIC Educational Resources Information Center
Hess, V. L.; Szabo, Attila
1979-01-01
A simple model is described for the binding of ligands to macromolecules. The model is applied to the cooperative binding by hemoglobin and aspartate transcarbamylase. The sequential and allosteric models of cooperative binding are considered. (BB)
Salamon, Z; Wang, Y; Soulages, J L; Brown, M F; Tollin, G
1996-01-01
Surface plasmon resonance (SPR) spectroscopy can provide useful information regarding average structural properties of membrane films supported on planar solid substrates. Here we have used SPR spectroscopy for the first time to monitor the binding and activation of G-protein (transducin or Gt) by bovine rhodopsin incorporated into an egg phosphatidylcholine bilayer deposited on a silver film. Rhodopsin incorporation into the membrane, performed by dilution of a detergent solution of the protein, proceeds in a saturable manner. Before photolysis, the SPR data show that Gt binds tightly (Keq approximately equal to 60 nM) and with positive cooperativity to rhodopsin in the lipid layer to form a closely packed film. A simple multilayer model yields a calculated average thickness of about 57 A, in good agreement with the structure of Gt. The data also demonstrate that Gt binding saturates at a Gt/rhodopsin ratio of approximately 0.6. Moreover, upon visible light irradiation, characteristic changes occur in the SPR spectrum, which can be modeled by a 6 A increase in the average thickness of the lipid/protein film caused by formation of metarhodopsin II (MII). Upon subsequent addition of GTP, further SPR spectral changes are induced. These are interpreted as resulting from dissociation of the alpha-subunit of Gt, formation of new MII-Gt complexes, and possible conformational changes of Gt as a consequence of complex formation. The above results clearly demonstrate the ability of SPR spectroscopy to monitor interactions among the proteins associated with signal transduction in membrane-bound systems. Images FIGURE 1 PMID:8804611
Molecular recognition of pyr mRNA by the Bacillus subtilis attenuation regulatory protein PyrR
Bonner, Eric R.; D’Elia, John N.; Billips, Benjamin K.; Switzer, Robert L.
2001-01-01
The pyrimidine nucleotide biosynthesis (pyr) operon in Bacillus subtilis is regulated by transcriptional attenuation. The PyrR protein binds in a uridine nucleotide-dependent manner to three attenuation sites at the 5′-end of pyr mRNA. PyrR binds an RNA-binding loop, allowing a terminator hairpin to form and repressing the downstream genes. The binding of PyrR to defined RNA molecules was characterized by a gel mobility shift assay. Titration indicated that PyrR binds RNA in an equimolar ratio. PyrR bound more tightly to the binding loops from the second (BL2 RNA) and third (BL3 RNA) attenuation sites than to the binding loop from the first (BL1 RNA) attenuation site. PyrR bound BL2 RNA 4–5-fold tighter in the presence of saturating UMP or UDP and 150- fold tighter with saturating UTP, suggesting that UTP is the more important co-regulator. The minimal RNA that bound tightly to PyrR was 28 nt long. Thirty-one structural variants of BL2 RNA were tested for PyrR binding affinity. Two highly conserved regions of the RNA, the terminal loop and top of the upper stem and a purine-rich internal bulge and the base pairs below it, were crucial for tight binding. Conserved elements of RNA secondary structure were also required for tight binding. PyrR protected conserved areas of the binding loop in hydroxyl radical footprinting experiments. PyrR likely recognizes conserved RNA sequences, but only if they are properly positioned in the correct secondary structure. PMID:11726695
Application of Tight-Binding Method in Atomistic Simulation of Covalent Materials
NASA Astrophysics Data System (ADS)
Isik, Ahmet
1994-05-01
The primary goal of this thesis is to develop and apply molecular dynamics simulation methods to elemental and binary covalent materials (Si, C, SiC) based on the tight-binding (TB) model of atomic cohesion in studies of bulk and deformation properties far from equilibrium. A second purpose is to compare results with those obtained using empirical interatomic potential functions in order to elucidate the applicability of models of interatomic interactions which do not take into account explicitly electronic structure effects. We have calculated the former by using a basis set consisting of four atomic orbitals, one for the s state and three for the p states, constructing a TB Hamiltonian in the usual Slater-Koster parametrization, and diagonalizing the Hamiltonian matrix at the origin of the Brillouin zone. For the repulsive part of the energy we employ a function in the form of inverse power law with screening which is then fitted to the bulk modulus and lattice parameter of several stable polytypes, results calculated by ab initio methods in the literature. Three types of applications have been investigated to demonstrate the utility of the present TB models and their advantages relative to empirical potentials. In the case of Si we show the calculated cohesive energy agrees to within a few percent with the ab initio local-density approximation (LDA) results. In addition, for clusters up to 10 atoms we find most of the energies and equilibrium structures to be in good agreement with LDA results (the failure of the empirical potential of Stillinger and Weber (SW) is well known). In the case of C clusters our TB model gives ring and chain structures which have been found both experimentally and by LDA calculations. In the second application we have applied our TB model of Si to investigate the core structure and energetics of partial dislocations on the glide plane and reconstruction antiphase defect (APD). For the 90^circ partial we show that the TB description gives the correct asymetric reconstruction previously found by LDA. For the 30^circ partial, TB gives better bond angles in the dislocation core. For the APD we have obtained a binding energy and activation for migration which are somewhat larger than the SW values, but the conclusion remains that APD is a low-energy defect which should be quite mobile. In the third application we formulate a simple TB model for SiC where the coefficients of the two-center integrals in Si-C interactions are taken to be simple averages of Si-Si and C-C integrals. Fitting is done on two polytypes, zincblende and rocksalt structures, and a simulated annealing procedure is used. The TB results are found in good agreement with LDA and experimental results in the cohesive energy, acoustic phonon modes, and elastic constants. (Abstract shortened by UMI.).
Zelovich, Tamar; Hansen, Thorsten; Liu, Zhen-Fei; ...
2017-03-02
A parameter-free version of the recently developed driven Liouville-von Neumann equation [T. Zelovich et al., J. Chem. Theory Comput. 10(8), 2927-2941 (2014)] for electronic transport calculations in molecular junctions is presented. The single driving rate, appearing as a fitting parameter in the original methodology, is replaced by a set of state-dependent broadening factors applied to the different single-particle lead levels. These broadening factors are extracted explicitly from the self-energy of the corresponding electronic reservoir and are fully transferable to any junction incorporating the same lead model. Furthermore, the performance of the method is demonstrated via tight-binding and extended Hückel calculationsmore » of simple junction models. Our analytic considerations and numerical results indicate that the developed methodology constitutes a rigorous framework for the design of "black-box" algorithms to simulate electron dynamics in open quantum systems out of equilibrium.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zelovich, Tamar; Hansen, Thorsten; Liu, Zhen-Fei
A parameter-free version of the recently developed driven Liouville-von Neumann equation [T. Zelovich et al., J. Chem. Theory Comput. 10(8), 2927-2941 (2014)] for electronic transport calculations in molecular junctions is presented. The single driving rate, appearing as a fitting parameter in the original methodology, is replaced by a set of state-dependent broadening factors applied to the different single-particle lead levels. These broadening factors are extracted explicitly from the self-energy of the corresponding electronic reservoir and are fully transferable to any junction incorporating the same lead model. Furthermore, the performance of the method is demonstrated via tight-binding and extended Hückel calculationsmore » of simple junction models. Our analytic considerations and numerical results indicate that the developed methodology constitutes a rigorous framework for the design of "black-box" algorithms to simulate electron dynamics in open quantum systems out of equilibrium.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Desgranges, Caroline; Delhommelle, Jerome
We extend Expanded Wang-Landau (EWL) simulations beyond classical systems and develop the EWL method for systems modeled with a tight-binding Hamiltonian. We then apply the method to determine the partition function and thus all thermodynamic properties, including the Gibbs free energy and entropy, of the fluid phases of Si. We compare the results from quantum many-body (QMB) tight binding models, which explicitly calculate the overlap between the atomic orbitals of neighboring atoms, to those obtained with classical many-body (CMB) force fields, which allow to recover the tetrahedral organization in condensed phases of Si through, e.g., a repulsive 3-body term thatmore » favors the ideal tetrahedral angle. Along the vapor-liquid coexistence, between 3000 K and 6000 K, the densities for the two coexisting phases are found to vary significantly (by 5 orders of magnitude for the vapor and by up to 25% for the liquid) and to provide a stringent test of the models. Transitions from vapor to liquid are predicted to occur for chemical potentials that are 10%–15% higher for CMB models than for QMB models, and a ranking of the force fields is provided by comparing the predictions for the vapor pressure to the experimental data. QMB models also reveal the formation of a gap in the electronic density of states of the coexisting liquid at high temperatures. Subjecting Si to a nanoscopic confinement has a dramatic effect on the phase diagram with, e.g. at 6000 K, a decrease in liquid densities by about 50% for both CMB and QMB models and an increase in vapor densities between 90% (CMB) and 170% (QMB). The results presented here provide a full picture of the impact of the strategy (CMB or QMB) chosen to model many-body effects on the thermodynamic properties of the fluid phases of Si.« less
Qian, Yi-Wen; Li, Chuan; Jiang, Ai-Ping; Ge, Shengfang; Gu, Ping; Fan, Xianqun; Li, Tai-Sheng; Jin, Xia; Wang, Jian-Hua; Wang, Zhi-Liang
2016-10-28
Approximately 70% of HIV-1 infected patients acquire ocular opportunistic infections and manifest eye disorders during the course of their illness. The mechanisms by which pathogens invade the ocular site, however, are unclear. Under normal circumstances, vascular endothelium and retinal pigment epithelium (RPE), which possess a well developed tight junction complex, form the blood-retinal barrier (BRB) to prevent pathogen invasion. We hypothesize that disruption of the BRB allows pathogen entry into ocular sites. The hypothesis was tested using in vitro models. We discovered that human RPE cells could bind to either HIV-1 gp120 glycoproteins or HIV-1 viral particles. Furthermore, the binding was mediated by dendritic cell-specific intercellular adhesion molecule 3-grabbing non-integrin (DC-SIGN) expressed on RPE cells. Upon gp120 binding to DC-SIGN, cellular NF-κB signaling was triggered, leading to the induction of matrix metalloproteinases, which subsequently degraded tight junction proteins and disrupted the BRB integrity. DC-SIGN knockdown or prior blocking with a specific antibody abolished gp120-induced matrix metalloproteinase expression and reduced the degradation of tight junction proteins. This study elucidates a novel mechanism by which HIV, type 1 invades ocular tissues and provides additional insights into the translocation or invasion process of ocular complication-associated pathogens. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Accelerating atomistic calculations of quantum energy eigenstates on graphic cards
NASA Astrophysics Data System (ADS)
Rodrigues, Walter; Pecchia, A.; Lopez, M.; Auf der Maur, M.; Di Carlo, A.
2014-10-01
Electronic properties of nanoscale materials require the calculation of eigenvalues and eigenvectors of large matrices. This bottleneck can be overcome by parallel computing techniques or the introduction of faster algorithms. In this paper we report a custom implementation of the Lanczos algorithm with simple restart, optimized for graphical processing units (GPUs). The whole algorithm has been developed using CUDA and runs entirely on the GPU, with a specialized implementation that spares memory and reduces at most machine-to-device data transfers. Furthermore parallel distribution over several GPUs has been attained using the standard message passing interface (MPI). Benchmark calculations performed on a GaN/AlGaN wurtzite quantum dot with up to 600,000 atoms are presented. The empirical tight-binding (ETB) model with an sp3d5s∗+spin-orbit parametrization has been used to build the system Hamiltonian (H).
Three-dimensional graphdiyne as a topological nodal-line semimetal
NASA Astrophysics Data System (ADS)
Nomura, Takafumi; Habe, Tetsuro; Sakamoto, Ryota; Koshino, Mikito
2018-05-01
We study the electronic band structure of three-dimensional ABC-stacked (rhombohedral) graphdiyne, which is a new planar carbon allotrope recently fabricated. Using first-principles calculation, we show that the system is a nodal-line semimetal, in which the conduction band and valence band cross at a closed ring in the momentum space. We derive the minimum tight-binding model and the low-energy effective Hamiltonian in a 4 ×4 matrix form. The nodal line is protected by a nontrivial winding number, and it ensures the existence of the topological surface state in a finite-thickness slab. The Fermi surface of the doped system exhibits a peculiar, self-intersecting hourglass structure, which is quite different from the torus or pipe shape in the previously proposed nodal semimetals. Despite its simple configuration, three-dimensional graphdiyne offers unique electronic properties distinct from any other carbon allotropes.
Resonant scattering due to adatoms in graphene: Top, bridge, and hollow positions
NASA Astrophysics Data System (ADS)
Irmer, Susanne; Kochan, Denis; Lee, Jeongsu; Fabian, Jaroslav
2018-02-01
We present a theoretical study of resonance characteristics in graphene from adatoms with s or pz character binding in top, bridge, and hollow positions. The adatoms are described by two tight-binding parameters: on-site energy and hybridization strength. We explore a wide range of different magnitudes of these parameters by employing T -matrix calculations in the single adatom limit and by tight-binding supercell calculations for dilute adatom coverage. We calculate the density of states and the momentum relaxation rate and extract the resonance level and resonance width. The top position with a large hybridization strength or, equivalently, small on-site energy, induces resonances close to zero energy. The bridge position, compared to top, is more sensitive to variation in the orbital tight-binding parameters. Resonances within the experimentally relevant energy window are found mainly for bridge adatoms with negative on-site energies. The effect of resonances from the top and bridge positions on the density of states and momentum relaxation rate is comparable and both positions give rise to a power-law decay of the resonant state in graphene. The hollow position with s orbital character is affected from destructive interference, which is seen from the very narrow resonance peaks in the density of states and momentum relaxation rate. The resonant state shows no clear tendency to a power-law decay around the impurity and its magnitude decreases strongly with lowering the adatom content in the supercell calculations. This is in contrast to the top and bridge positions. We conclude our study with a comparison to models of pointlike vacancies and strong midgap scatterers. The latter model gives rise to significantly higher momentum relaxation rates than caused by single adatoms.
Tight-Binding Description of Impurity States in Semiconductors
ERIC Educational Resources Information Center
Dominguez-Adame, F.
2012-01-01
Introductory textbooks in solid state physics usually present the hydrogenic impurity model to calculate the energy of carriers bound to donors or acceptors in semiconductors. This model treats the pure semiconductor as a homogeneous medium and the impurity is represented as a fixed point charge. This approach is only valid for shallow impurities…
Development of a Multicenter Density Functional Tight Binding Model for Plutonium Surface Hydriding.
Goldman, Nir; Aradi, Bálint; Lindsey, Rebecca K; Fried, Laurence E
2018-05-08
We detail the creation of a multicenter density functional tight binding (DFTB) model for hydrogen on δ-plutonium, using a framework of new Slater-Koster interaction parameters and a repulsive energy based on the Chebyshev Interaction Model for Efficient Simulation (ChIMES), where two- and three-center atomic interactions are represented by linear combinations of Chebyshev polynomials. We find that our DFTB/ChIMES model yields a total electron density of states for bulk δ-Pu that compares well to that from Density Functional Theory, as well as to a grid of energy calculations representing approximate H 2 dissociation paths on the δ-Pu (100) surface. We then perform molecular dynamics simulations and minimum energy pathway calculations to determine the energetics of surface dissociation and subsurface diffusion on the (100) and (111) surfaces. Our approach allows for the efficient creation of multicenter repulsive energies with a relatively small investment in initial DFT calculations. Our efforts are particularly pertinent to studies that rely on quantum calculations for interpretation and validation, such as experimental determination of chemical reactivity both on surfaces and in condensed phases.
Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids.
Aradi, Bálint; Niklasson, Anders M N; Frauenheim, Thomas
2015-07-14
A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born-Oppenheimer molecular dynamics. For systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can be applied to a broad range of problems in materials science, chemistry, and biology.
NASA Astrophysics Data System (ADS)
Del Río-De Santiago, A.; Martínez-Orozco, J. C.; Rodríguez-Magdaleno, K. A.; Contreras-Solorio, D. A.; Rodríguez-Vargas, I.; Ungan, F.
2018-03-01
It is reported a numerical computation of the local density of states for a δ-doped like QW superlattices of AlxGa1-xAs, as a possible heterostructure that, being integrated into a solar cell device design, can provide an intermediate band of allowed states to assist the absorption of photons with lower energies than that of the energy gap of the solar-cell constituent materials. This work was performed using the nearest neighbors sp3s* tight-binding model including spin. The confining potential caused by the ionized donor impurities in δ-doped impurities seeding that was obtained analytically within the lines of the Thomas-Fermi approximation was reproduced here by the Al concentration x variation. This potential is considered as an external perturbation in the tight-binding methodology and it is included in the diagonal terms of the tight-binding Hamiltonian. Special attention is paid to the width of the intermediate band caused by the change in the considered aluminium concentration x, the inter-well distance between δ-doped like QW wells and the number of them in the superlattice. In general we can conclude that this kind of superlattices can be suitable for intermediate band formation for possible intermediate-band solar cell design.
Rashba quantum wire: exact solution and ballistic transport.
Perroni, C A; Bercioux, D; Ramaglia, V Marigliano; Cataudella, V
2007-05-08
The effect of Rashba spin-orbit interaction in quantum wires with hard-wall boundaries is discussed. The exact wavefunction and eigenvalue equation are worked out, pointing out the mixing between the spin and spatial parts. The spectral properties are also studied within perturbation theory with respect to the strength of the spin-orbit interaction and diagonalization procedure. A comparison is made with the results of a simple model, the two-band model, that takes account only of the first two sub-bands of the wire. Finally, the transport properties within the ballistic regime are analytically calculated for the two-band model and through a tight-binding Green function for the entire system. Single and double interfaces separating regions with different strengths of spin-orbit interaction are analysed by injecting carriers into the first and the second sub-band. It is shown that in the case of a single interface the spin polarization in the Rashba region is different from zero, and in the case of two interfaces the spin polarization shows oscillations due to spin-selective bound states.
NASA Astrophysics Data System (ADS)
Hegde, Ganesh; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy; Klimeck, Gerhard
2014-03-01
Semi-empirical Tight Binding (TB) is known to be a scalable and accurate atomistic representation for electron transport for realistically extended nano-scaled semiconductor devices that might contain millions of atoms. In this paper, an environment-aware and transferable TB model suitable for electronic structure and transport simulations in technologically relevant metals, metallic alloys, metal nanostructures, and metallic interface systems are described. Part I of this paper describes the development and validation of the new TB model. The new model incorporates intra-atomic diagonal and off-diagonal elements for implicit self-consistency and greater transferability across bonding environments. The dependence of the on-site energies on strain has been obtained by appealing to the Moments Theorem that links closed electron paths in the system to energy moments of angular momentum resolved local density of states obtained ab initio. The model matches self-consistent density functional theory electronic structure results for bulk face centered cubic metals with and without strain, metallic alloys, metallic interfaces, and metallic nanostructures with high accuracy and can be used in predictive electronic structure and transport problems in metallic systems at realistically extended length scales.
Designing ligands to bind proteins
Whitesides, George M.; Krishnamurthy, Vijay M.
2009-01-01
The ability to design drugs (so-called ‘rational drug design’) has been one of the long-term objectives of chemistry for 50 years. It is an exceptionally difficult problem, and many of its parts lie outside the expertise of chemistry. The much more limited problem – how to design tight-binding ligands (rational ligand design) – would seem to be one that chemistry could solve, but has also proved remarkably recalcitrant. The question is ‘Why is it so difficult?’ and the answer is ‘We still don't entirely know’. This perspective discusses some of the technical issues – potential functions, protein plasticity, enthalpy/entropy compensation, and others – that contribute, and suggests areas where fundamental understanding of protein–ligand interactions falls short of what is needed. It surveys recent technological developments (in particular, isothermal titration calorimetry) that will, hopefully, make now the time for serious progress in this area. It concludes with the calorimetric examination of the association of a series of systematically varied ligands with a model protein. The counterintuitive thermodynamic results observed serve to illustrate that, even in relatively simple systems, understanding protein–ligand association is challenging. PMID:16817982
Multi-scale predictive modeling of nano-material and realistic electron devices
NASA Astrophysics Data System (ADS)
Palaria, Amritanshu
Among the challenges faced in further miniaturization of electronic devices, heavy influence of the detailed atomic configuration of the material(s) involved, which often differs significantly from that of the bulk material(s), is prominent. Device design has therefore become highly interrelated with material engineering at the atomic level. This thesis aims at outlining, with examples, a multi-scale simulation procedure that allows one to integrate material and device aspects of nano-electronic design to predict behavior of novel devices with novel material. This is followed in four parts: (1) An approach that combines a higher time scale reactive force field analysis with density functional theory to predict structure of new material is demonstrated for the first time for nanowires. Novel stable structures for very small diameter silicon nanowires are predicted. (2) Density functional theory is used to show that the new nanowire structures derived in 1 above have properties different from diamond core wires even though the surface bonds in some may be similar to the surface of bulk silicon. (3) Electronic structure of relatively large-scale germanium sections of realistically strained Si/strained Ge/ strained Si nanowire heterostructures is computed using empirical tight binding and it is shown that the average non-homogeneous strain in these structures drives their interesting non-conventional electronic characteristics such as hole effective masses which decrease as the wire cross-section is reduced. (4) It is shown that tight binding, though empirical in nature, is not necessarily limited to the material and atomic structure for which the parameters have been empirically derived, but that simple changes may adapt the derived parameters to new bond environments. Si (100) surface electronic structure is obtained from bulk Si parameters.
Conformation-controlled binding kinetics of antibodies
NASA Astrophysics Data System (ADS)
Galanti, Marta; Fanelli, Duccio; Piazza, Francesco
2016-01-01
Antibodies are large, extremely flexible molecules, whose internal dynamics is certainly key to their astounding ability to bind antigens of all sizes, from small hormones to giant viruses. In this paper, we build a shape-based coarse-grained model of IgG molecules and show that it can be used to generate 3D conformations in agreement with single-molecule Cryo-Electron Tomography data. Furthermore, we elaborate a theoretical model that can be solved exactly to compute the binding rate constant of a small antigen to an IgG in a prescribed 3D conformation. Our model shows that the antigen binding process is tightly related to the internal dynamics of the IgG. Our findings pave the way for further investigation of the subtle connection between the dynamics and the function of large, flexible multi-valent molecular machines.
Tight-binding calculation studies of vacancy and adatom defects in graphene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Wei; Lu, Wen-Cai; Zhang, Hong-Xing
2016-02-19
Computational studies of complex defects in graphene usually need to deal with a larger number of atoms than the current first-principles methods can handle. We show a recently developed three-center tight-binding potential for carbon is very efficient for large scale atomistic simulations and can accurately describe the structures and energies of various defects in graphene. Using the three-center tight-binding potential, we have systematically studied the stable structures and formation energies of vacancy and embedded-atom defects of various sizes up to 4 vacancies and 4 embedded atoms in graphene. In conclusion, our calculations reveal low-energy defect structures and provide a moremore » comprehensive understanding of the structures and stability of defects in graphene.« less
Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aradi, Bálint; Niklasson, Anders M. N.; Frauenheim, Thomas
A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born–Oppenheimer molecular dynamics. Furthermore, for systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can also be applied to a broad range of problems in materialsmore » science, chemistry, and biology.« less
Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids
Aradi, Bálint; Niklasson, Anders M. N.; Frauenheim, Thomas
2015-06-26
A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born–Oppenheimer molecular dynamics. Furthermore, for systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can also be applied to a broad range of problems in materialsmore » science, chemistry, and biology.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ramírez-Morales, A.; Martínez-Orozco, J. C.; Rodríguez-Vargas, I.
The main characteristics of the quantum confined Stark effect (QCSE) are studied theoretically in quantum wells of Gaussian profile. The semi-empirical tight-binding model and the Green function formalism are applied in the numerical calculations. A comparison of the QCSE in quantum wells with different kinds of confining potential is presented.
Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P
2005-04-01
Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.
Tight-binding model for materials at mesoscale
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tai, Yuan-Yen; Choi, Hongchul; Zhu, Wei
2016-12-21
TBM3 is an open source package for computational simulations of quantum materials at multiple scales in length and time. The project originated to investigate the multiferroic behavior in transition-metal oxide heterostructures. The framework has also been designed to study emergent phemona in other quantum materials like 2-dimensional transition-metal dichalcogenides, graphene, topological insulators, and skyrmion in materials, etc. In the long term, we will enable the package for transport and time-resolved phenomena. TBM3 is currently a C++ based numerical tool package and framework for the design and construction of any kind of lattice structures with multi-orbital and spin degrees of freedom.more » The fortran based portion of the package will be added in the near future. The design of TBM3 is in a highly flexible and reusable framework and the tight-binding parameters can be modeled or informed by DFT calculations. It is currently GPU enabled and feature of CPU enabled MPI will be added in the future.« less
Model many-body Stoner Hamiltonian for binary FeCr alloys
NASA Astrophysics Data System (ADS)
Nguyen-Manh, D.; Dudarev, S. L.
2009-09-01
We derive a model tight-binding many-body d -electron Stoner Hamiltonian for FeCr binary alloys and investigate the sensitivity of its mean-field solutions to the choice of hopping integrals and the Stoner exchange parameters. By applying the local charge-neutrality condition within a self-consistent treatment we show that the negative enthalpy-of-mixing anomaly characterizing the alloy in the low chromium concentration limit is due entirely to the presence of the on-site exchange Stoner terms and that the occurrence of this anomaly is not specifically related to the choice of hopping integrals describing conventional chemical bonding between atoms in the alloy. The Bain transformation pathway computed, using the proposed model Hamiltonian, for the Fe15Cr alloy configuration is in excellent agreement with ab initio total-energy calculations. Our investigation also shows how the parameters of a tight-binding many-body model Hamiltonian for a magnetic alloy can be derived from the comparison of its mean-field solutions with other, more accurate, mean-field approximations (e.g., density-functional calculations), hence stimulating the development of large-scale computational algorithms for modeling radiation damage effects in magnetic alloys and steels.
Grain boundaries in bcc-Fe: a density-functional theory and tight-binding study
NASA Astrophysics Data System (ADS)
Wang, Jingliang; Madsen, Georg K. H.; Drautz, Ralf
2018-02-01
Grain boundaries (GBs) have a significant influence on material properties. In the present paper, we calculate the energies of eleven low-Σ ({{Σ }}≤slant 13) symmetrical tilt GBs and two twist GBs in ferromagnetic bcc iron using first-principles density functional theory (DFT) calculations. The results demonstrate the importance of a sufficient sampling of initial rigid body translations in all three directions. We show that the relative GB energies can be explained by the miscoordination of atoms at the GB region. While the main features of the studied GB structures were captured by previous empirical interatomic potential calculations, it is shown that the absolute values of GB energies calculated were substantially underestimated. Based on DFT-calculated GB structures and energies, we construct a new d-band orthogonal tight-binding (TB) model for bcc iron. The TB model is validated by its predictive power on all the studied GBs. We apply the TB model to block boundaries in lath martensite and demonstrate that the experimentally observed GB character distribution can be explained from the viewpoint of interface energy.
How actin binds and assembles onto plasma membranes from Dictyostelium discoideum
1988-01-01
We have shown previously (Schwartz, M. A., and E. J. Luna. 1986. J. Cell Biol. 102: 2067-2075) that actin binds with positive cooperativity to plasma membranes from Dictyostelium discoideum. Actin is polymerized at the membrane surface even at concentrations well below the critical concentration for polymerization in solution. Low salt buffer that blocks actin polymerization in solution also prevents actin binding to membranes. To further explore the relationship between actin polymerization and binding to membranes, we prepared four chemically modified actins that appear to be incapable of polymerizing in solution. Three of these derivatives also lost their ability to bind to membranes. The fourth derivative (EF actin), in which histidine-40 is labeled with ethoxyformic anhydride, binds to membranes with reduced affinity. Binding curves exhibit positive cooperativity, and cross- linking experiments show that membrane-bound actin is multimeric. Thus, binding and polymerization are tightly coupled, and the ability of these membranes to polymerize actin is dramatically demonstrated. EF actin coassembles weakly with untreated actin in solution, but coassembles well on membranes. Binding by untreated actin and EF actin are mutually competitive, indicating that they bind to the same membrane sites. Hill plots indicate that an actin trimer is the minimum assembly state required for tight binding to membranes. The best explanation for our data is a model in which actin oligomers assemble by binding to clustered membrane sites with successive monomers on one side of the actin filament bound to the membrane. Individual binding affinities are expected to be low, but the overall actin-membrane avidity is high, due to multivalency. Our results imply that extracellular factors that cluster membrane proteins may create sites for the formation of actin nuclei and thus trigger actin polymerization in the cell. PMID:3392099
A VARIABLE REACTIVITY MODEL FOR ION BINDING TO ENVIRONMENTAL SORBENTS
The conceptual and mathematical basis for a new general-composite modeling approach for ion binding to environmental sorbents is presented. The work extends the Simple Metal Sorption (SiMS) model previously presented for metal and proton binding to humic substances. A surface com...
Carbon Nanotubes: Molecular Electronic Components
NASA Technical Reports Server (NTRS)
Srivastava, Deepak; Saini, Subhash; Menon, Madhu
1997-01-01
The carbon Nanotube junctions have recently emerged as excellent candidates for use as the building blocks in the formation of nanoscale molecular electronic networks. While the simple joint of two dissimilar tubes can be generated by the introduction of a pair of heptagon-pentagon defects in an otherwise perfect hexagonal graphene sheet, more complex joints require other mechanisms. In this work we explore structural characteristics of complex 3-point junctions of carbon nanotubes using a generalized tight-binding molecular-dynamics scheme. The study of pi-electron local densities of states (LDOS) of these junctions reveal many interesting features, most prominent among them being the defect-induced states in the gap.
Weisser, K; Schloos, J
1991-10-09
The relationship between serum angiotensin converting enzyme (ACE) activity and concentration of the ACE inhibitor enalaprilat was determined in vitro in the presence of different concentrations (S = 4-200 mM) of the substrate Hip-Gly-Gly. From Henderson plots, a competitive tight-binding relationship between enalaprilat and serum ACE was found yielding a value of approximately 5 nM for serum ACE concentration (Et) and an inhibition constant (Ki) for enalaprilat of approximately 0.1 nM. A plot of reaction velocity (Vi) versus total inhibitor concentration (It) exhibited a non-parallel shift of the inhibition curve to the right with increasing S. This was reflected by apparent Hill coefficients greater than 1 when the commonly used inhibitory sigmoid concentration-effect model (Emax model) was applied to the data. Slopes greater than 1 were obviously due to discrepancies between the free inhibitor concentration (If) present in the assay and It plotted on the abscissa and could, therefore, be indicators of tight-binding conditions. Thus, the sigmoid Emax model leads to an overestimation of Ki. Therefore, a modification of the inhibitory sigmoid Emax model (called "Emax tight model") was applied, which accounts for the depletion of If by binding, refers to It and allows estimation of the parameters Et and IC50f (free concentration of inhibitor when 50% inhibition occurs) using non-linear regression analysis. This model could describe the non-symmetrical shape of the inhibition curves and the results for Ki and Et correlated very well with those derived from the Henderson plots. The latter findings confirm that the degree of ACE inhibition measured in vitro is, in fact, dependent on the concentration of substrate and enzyme present in the assay. This is of importance not only for the correct evaluation of Ki but also for the interpretation of the time course of serum ACE inhibition measured ex vivo. The non-linear model has some advantages over the linear Henderson equation: it is directly applicable without conversion of the data and avoids the stochastic dependency of the variables, allowing non-linear regression of all data points contributing with the same weight.
2010-06-01
for solubility (Figure 5). We call this protein Trx -ERA241-320. We also produced a similar protein construct, but with only residues 241-273 of...ERa, as a “control” (Figure 5). We call this protein Trx -ERA241-273. Because CaM binds tightly to the N-terminal extended ligand binding domain of...ERa (residues 286- 552, see above), we hypothesized that Trx - ERA241-320 would bind tightly to CaM, but that Trx -ERA241-273 would not. The genetic
Tsapara, Anna; Matter, Karl; Balda, Maria S
2006-03-01
The tight junction adaptor protein ZO-1 regulates intracellular signaling and cell proliferation. Its Src homology 3 (SH3) domain is required for the regulation of proliferation and binds to the Y-box transcription factor ZO-1-associated nucleic acid binding protein (ZONAB). Binding of ZO-1 to ZONAB results in cytoplasmic sequestration and hence inhibition of ZONAB's transcriptional activity. Here, we identify a new binding partner of the SH3 domain that modulates ZO-1-ZONAB signaling. Expression screening of a cDNA library with a fusion protein containing the SH3 domain yielded a cDNA coding for Apg-2, a member of the heat-shock protein 110 (Hsp 110) subfamily of Hsp70 heat-shock proteins, which is overexpressed in carcinomas. Regulated depletion of Apg-2 in Madin-Darby canine kidney cells inhibits G(1)/S phase progression. Apg-2 coimmunoprecipitates with ZO-1 and partially localizes to intercellular junctions. Junctional recruitment and coimmunoprecipitation with ZO-1 are stimulated by heat shock. Apg-2 competes with ZONAB for binding to the SH3 domain in vitro and regulates ZONAB's transcriptional activity in reporter gene assays. Our data hence support a model in which Apg-2 regulates ZONAB function by competing for binding to the SH3 domain of ZO-1 and suggest that Apg-2 functions as a regulator of ZO-1-ZONAB signaling in epithelial cells in response to cellular stress.
Tsapara, Anna; Matter, Karl; Balda, Maria S.
2006-01-01
The tight junction adaptor protein ZO-1 regulates intracellular signaling and cell proliferation. Its Src homology 3 (SH3) domain is required for the regulation of proliferation and binds to the Y-box transcription factor ZO-1-associated nucleic acid binding protein (ZONAB). Binding of ZO-1 to ZONAB results in cytoplasmic sequestration and hence inhibition of ZONAB's transcriptional activity. Here, we identify a new binding partner of the SH3 domain that modulates ZO-1–ZONAB signaling. Expression screening of a cDNA library with a fusion protein containing the SH3 domain yielded a cDNA coding for Apg-2, a member of the heat-shock protein 110 (Hsp 110) subfamily of Hsp70 heat-shock proteins, which is overexpressed in carcinomas. Regulated depletion of Apg-2 in Madin-Darby canine kidney cells inhibits G1/S phase progression. Apg-2 coimmunoprecipitates with ZO-1 and partially localizes to intercellular junctions. Junctional recruitment and coimmunoprecipitation with ZO-1 are stimulated by heat shock. Apg-2 competes with ZONAB for binding to the SH3 domain in vitro and regulates ZONAB's transcriptional activity in reporter gene assays. Our data hence support a model in which Apg-2 regulates ZONAB function by competing for binding to the SH3 domain of ZO-1 and suggest that Apg-2 functions as a regulator of ZO-1–ZONAB signaling in epithelial cells in response to cellular stress. PMID:16407410
Majorana-Hubbard model on the square lattice
NASA Astrophysics Data System (ADS)
Affleck, Ian; Rahmani, Armin; Pikulin, Dmitry
2017-09-01
We study a tight-binding model of interacting Majorana (Hermitian) modes on a square lattice. The model may have an experimental realization in a superconducting-film-topological-insulator heterostructure in a magnetic field. We find a rich phase diagram, as a function of interaction strength, including an emergent superfluid phase with spontaneous breaking of an emergent U (1 ) symmetry, separated by a supersymmetric transition from a gapless normal phase.
Magnetic quantization in monolayer bismuthene
NASA Astrophysics Data System (ADS)
Chen, Szu-Chao; Chiu, Chih-Wei; Lin, Hui-Chi; Lin, Ming-Fa
The magnetic quantization in monolayer bismuthene is investigated by the generalized tight-binding model. The quite large Hamiltonian matrix is built from the tight-binding functions of the various sublattices, atomic orbitals and spin states. Due to the strong spin orbital coupling and sp3 bonding, monolayer bismuthene has the diverse low-lying energy bands such as the parabolic, linear and oscillating energy bands. The main features of band structures are further reflected in the rich magnetic quantization. Under a uniform perpendicular magnetic field (Bz) , three groups of Landau levels (LLs) with distinct features are revealed near the Fermi level. Their Bz-dependent energy spectra display the linear, square-root and non-monotonous dependences, respectively. These LLs are dominated by the combinations of the 6pz orbital and (6px,6py) orbitals as a result of strong sp3 bonding. Specifically, the LL anti-crossings only occur between LLs originating from the oscillating energy band.
NASA Astrophysics Data System (ADS)
Chegel, Raad; Behzad, Somayeh
2014-02-01
We have studied the electronic structure and dipole matrix element, D, of carbon nanotubes (CNTs) under magnetic field, using the third nearest neighbor tight binding model. It is shown that the 1NN and 3NN-TB band structures show differences such as the spacing and mixing of neighbor subbands. Applying the magnetic field leads to breaking the degeneracy behavior in the D transitions and creates new allowed transitions corresponding to the band modifications. It is found that |D| is proportional to the inverse tube radius and chiral angle. Our numerical results show that amount of filed induced splitting for the first optical peak is proportional to the magnetic field by the splitting rate ν11. It is shown that ν11 changes linearly and parabolicly with the chiral angle and radius, respectively.
Chen, Junjie; van Dongen, Mallory A; Merzel, Rachel L; Dougherty, Casey A; Orr, Bradford G; Kanduluru, Ananda Kumar; Low, Philip S; Marsh, E Neil G; Banaszak Holl, Mark M
2016-03-14
Polymer-ligand conjugates are designed to bind proteins for applications as drugs, imaging agents, and transport scaffolds. In this work, we demonstrate a folic acid (FA)-triggered exosite binding of a generation five poly(amidoamine) (G5 PAMAM) dendrimer scaffold to bovine folate binding protein (bFBP). The protein exosite is a secondary binding site on the protein surface, separate from the FA binding pocket, to which the dendrimer binds. Exosite binding is required to achieve the greatly enhanced binding constants and protein structural change observed in this study. The G5Ac-COG-FA1.0 conjugate bound tightly to bFBP, was not displaced by a 28-fold excess of FA, and quenched roughly 80% of the initial fluorescence. Two-step binding kinetics were measured using the intrinsic fluorescence of the FBP tryptophan residues to give a KD in the low nanomolar range for formation of the initial G5Ac-COG-FA1.0/FBP* complex, and a slow conversion to the tight complex formed between the dendrimer and the FBP exosite. The extent of quenching was sensitive to the choice of FA-dendrimer linker chemistry. Direct amide conjugation of FA to G5-PAMAM resulted in roughly 50% fluorescence quenching of the FBP. The G5Ac-COG-FA, which has a longer linker containing a 1,2,3-triazole ring, exhibited an ∼80% fluorescence quenching. The binding of the G5Ac-COG-FA1.0 conjugate was compared to poly(ethylene glycol) (PEG) conjugates of FA (PEGn-FA). PEG2k-FA had a binding strength similar to that of FA, whereas other PEG conjugates with higher molecular weight showed weaker binding. However, no PEG conjugates gave an increased degree of total fluorescence quenching.
NASA Astrophysics Data System (ADS)
Fujiwara, Takeo; Nishino, Shinya; Yamamoto, Susumu; Suzuki, Takashi; Ikeda, Minoru; Ohtani, Yasuaki
2018-06-01
A novel tight-binding method is developed, based on the extended Hückel approximation and charge self-consistency, with referring the band structure and the total energy of the local density approximation of the density functional theory. The parameters are so adjusted by computer that the result reproduces the band structure and the total energy, and the algorithm for determining parameters is established. The set of determined parameters is applicable to a variety of crystalline compounds and change of lattice constants, and, in other words, it is transferable. Examples are demonstrated for Si crystals of several crystalline structures varying lattice constants. Since the set of parameters is transferable, the present tight-binding method may be applicable also to molecular dynamics simulations of large-scale systems and long-time dynamical processes.
NASA Astrophysics Data System (ADS)
Humeniuk, Alexander; Mitrić, Roland
2017-12-01
A software package, called DFTBaby, is published, which provides the electronic structure needed for running non-adiabatic molecular dynamics simulations at the level of tight-binding DFT. A long-range correction is incorporated to avoid spurious charge transfer states. Excited state energies, their analytic gradients and scalar non-adiabatic couplings are computed using tight-binding TD-DFT. These quantities are fed into a molecular dynamics code, which integrates Newton's equations of motion for the nuclei together with the electronic Schrödinger equation. Non-adiabatic effects are included by surface hopping. As an example, the program is applied to the optimization of excited states and non-adiabatic dynamics of polyfluorene. The python and Fortran source code is available at http://www.dftbaby.chemie.uni-wuerzburg.de.
NASA Astrophysics Data System (ADS)
Dinh Hoi, Bui; Yarmohammadi, Mohsen
2018-04-01
We address control of electronic phase transition in charged impurity-infected armchair-edged boron-nitride nanoribbons (ABNNRs) with the local variation of Fermi energy. In particular, the density of states of disordered ribbons produces the main features in the context of pretty simple tight-binding model and Green's functions approach. To this end, the Born approximation has been implemented to find the effect of π-band electron-impurity interactions. A modulation of the π-band depending on the impurity concentrations and scattering potentials leads to the phase transition from insulator to semimetallic. We present here a detailed physical meaning of this transition by studying the treatment of massive Dirac fermions. From our findings, it is found that the ribbon width plays a crucial role in determining the electronic phase of disordered ABNNRs. The obtained results in controllable gap engineering are useful for future experiments. Also, the observations in this study have also fueled interest in the electronic properties of other 2D materials.
A maximally particle-hole asymmetric spectrum emanating from a semi-Dirac point.
Quan, Yundi; Pickett, Warren E
2018-02-21
Tight binding models have proven an effective means of revealing Dirac (massless) dispersion, flat bands (infinite mass), and intermediate cases such as the semi-Dirac (sD) dispersion. This approach is extended to a three band model that yields, with chosen parameters in a two-band limit, a closed line with maximally asymmetric particle-hole dispersion: infinite mass holes, zero mass particles. The model retains the sD points for a general set of parameters. Adjacent to this limiting case, hole Fermi surfaces are tiny and needle-like. A pair of large electron Fermi surfaces at low doping merge and collapse at half filling to a flat (zero energy) closed contour with infinite mass along the contour and enclosing no carriers on either side, while the hole Fermi surface has shrunk to a point at zero energy, also containing no carriers. The tight binding model is used to study several characteristics of the dispersion and density of states. The model inspired generalization of sD dispersion to a general ±[Formula: see text] form, for which analysis reveals that both n and m must be odd to provide a diabolical point with topological character. Evolution of the Hofstadter spectrum of this three band system with interband coupling strength is presented and discussed.
A maximally particle-hole asymmetric spectrum emanating from a semi-Dirac point
NASA Astrophysics Data System (ADS)
Quan, Yundi; Pickett, Warren E.
2018-02-01
Tight binding models have proven an effective means of revealing Dirac (massless) dispersion, flat bands (infinite mass), and intermediate cases such as the semi-Dirac (sD) dispersion. This approach is extended to a three band model that yields, with chosen parameters in a two-band limit, a closed line with maximally asymmetric particle-hole dispersion: infinite mass holes, zero mass particles. The model retains the sD points for a general set of parameters. Adjacent to this limiting case, hole Fermi surfaces are tiny and needle-like. A pair of large electron Fermi surfaces at low doping merge and collapse at half filling to a flat (zero energy) closed contour with infinite mass along the contour and enclosing no carriers on either side, while the hole Fermi surface has shrunk to a point at zero energy, also containing no carriers. The tight binding model is used to study several characteristics of the dispersion and density of states. The model inspired generalization of sD dispersion to a general ± \\sqrt{k_x2n +k_y2m} form, for which analysis reveals that both n and m must be odd to provide a diabolical point with topological character. Evolution of the Hofstadter spectrum of this three band system with interband coupling strength is presented and discussed.
NASA Astrophysics Data System (ADS)
Kováčik, Roman; Murthy, Sowmya Sathyanarayana; Quiroga, Carmen E.; Ederer, Claude; Franchini, Cesare
2016-02-01
We merge advanced ab initio schemes (standard density functional theory, hybrid functionals, and the G W approximation) with model Hamiltonian approaches (tight-binding and Heisenberg Hamiltonian) to study the evolution of the electronic, magnetic, and dielectric properties of the manganite family R MnO3 (R =La,Pr,Nd,Sm,Eu, and Gd) . The link between first principles and tight binding is established by downfolding the physically relevant subset of 3 d bands with eg character by means of maximally localized Wannier functions (MLWFs) using the VASP2WANNIER90 interface. The MLWFs are then used to construct a general tight-binding Hamiltonian written as a sum of the kinetic term, the Hund's rule coupling, the JT coupling, and the electron-electron interaction. The dispersion of the tight-binding (TB) eg bands at all levels are found to match closely the MLWFs. We provide a complete set of TB parameters which can serve as guidance for the interpretation of future studies based on many-body Hamiltonian approaches. In particular, we find that the Hund's rule coupling strength, the Jahn-Teller coupling strength, and the Hubbard interaction parameter U remain nearly constant for all the members of the R MnO3 series, whereas the nearest-neighbor hopping amplitudes show a monotonic attenuation as expected from the trend of the tolerance factor. Magnetic exchange interactions, computed by mapping a large set of hybrid functional total energies onto an Heisenberg Hamiltonian, clarify the origin of the A-type magnetic ordering observed in the early rare-earth manganite series as arising from a net negative out-of-plane interaction energy. The obtained exchange parameters are used to estimate the Néel temperature by means of Monte Carlo simulations. The resulting data capture well the monotonic decrease of the ordering temperature down the series from R =La to Gd, in agreement with experiments. This trend correlates well with the modulation of structural properties, in particular with the progressive reduction of the Mn-O-Mn bond angle which is associated with the quenching of the volume and the decrease of the tolerance factor due to the shrinkage of the ionic radii of R going from La to Gd.
Electric-field-induced plasmon in AA-stacked bilayer graphene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chuang, Y.C., E-mail: yingchih.chuang@gmail.com; Wu, J.Y., E-mail: yarst5@gmail.com; Lin, M.F., E-mail: mflin@mail.ncku.edu.tw
2013-12-15
The collective excitations in AA-stacked bilayer graphene for a perpendicular electric field are investigated analytically within the tight-binding model and the random-phase approximation. Such a field destroys the uniform probability distribution of the four sublattices. This drives a symmetry breaking between the intralayer and interlayer polarization intensities from the intrapair band excitations. A field-induced acoustic plasmon thus emerges in addition to the strongly field-tunable intrinsic acoustic and optical plasmons. At long wavelengths, the three modes show different dispersions and field dependence. The definite physical mechanism of the electrically inducible and tunable mode can be expected to also be present inmore » other AA-stacked few-layer graphenes. -- Highlights: •The analytical derivations are performed by the tight-binding model. •An electric field drives the non-uniformity of the charge distribution. •A symmetry breaking between the intralayer and interlayer polarizations is illustrated. •An extra plasmon emerges besides two intrinsic modes in AA-stacked bilayer graphene. •The mechanism of a field-induced mode is present in AA-stacked few-layer graphenes.« less
NASA Astrophysics Data System (ADS)
Henke, Paul S.; Mak, Chi H.
2014-08-01
The thermodynamic stability of a folded RNA is intricately tied to the counterions and the free energy of this interaction must be accounted for in any realistic RNA simulations. Extending a tight-binding model published previously, in this paper we investigate the fundamental structure of charges arising from the interaction between small functional RNA molecules and divalent ions such as Mg2+ that are especially conducive to stabilizing folded conformations. The characteristic nature of these charges is utilized to construct a discretely connected energy landscape that is then traversed via a novel application of a deterministic graph search technique. This search method can be incorporated into larger simulations of small RNA molecules and provides a fast and accurate way to calculate the free energy arising from the interactions between an RNA and divalent counterions. The utility of this algorithm is demonstrated within a fully atomistic Monte Carlo simulation of the P4-P6 domain of the Tetrahymena group I intron, in which it is shown that the counterion-mediated free energy conclusively directs folding into a compact structure.
Spin textures on general surfaces of the correlated topological insulator SmB6
NASA Astrophysics Data System (ADS)
Baruselli, Pier Paolo; Vojta, Matthias
2016-05-01
Employing the k .p expansion for a family of tight-binding models for SmB6, we analytically compute topological surface states on a generic (l m n ) surface. We show how the Dirac-cone spin structure depends on model ingredients and on the angle θ between the surface normal and the main crystal axes. We apply the general theory to (001), (110), (111), and (210) surfaces, for which we provide concrete predictions for the spin pattern of surface states which we also compare with tight-binding results. As shown in previous work, the spin pattern on a (001 ) surface can be related to the value of mirror Chern numbers, and we explore the possibility of topological phase transitions between states with different mirror Chern numbers and the associated change of the spin structure of surface states. Such transitions may be accessed by varying either the hybridization between conduction and f electrons or the crystal-field splitting of the low-energy f multiplets, and we compute corresponding phase diagrams. Experimentally, chemical doping is a promising route to realize such transitions.
Henke, Paul S; Mak, Chi H
2014-08-14
The thermodynamic stability of a folded RNA is intricately tied to the counterions and the free energy of this interaction must be accounted for in any realistic RNA simulations. Extending a tight-binding model published previously, in this paper we investigate the fundamental structure of charges arising from the interaction between small functional RNA molecules and divalent ions such as Mg(2+) that are especially conducive to stabilizing folded conformations. The characteristic nature of these charges is utilized to construct a discretely connected energy landscape that is then traversed via a novel application of a deterministic graph search technique. This search method can be incorporated into larger simulations of small RNA molecules and provides a fast and accurate way to calculate the free energy arising from the interactions between an RNA and divalent counterions. The utility of this algorithm is demonstrated within a fully atomistic Monte Carlo simulation of the P4-P6 domain of the Tetrahymena group I intron, in which it is shown that the counterion-mediated free energy conclusively directs folding into a compact structure.
Tight-binding analysis of Si and GaAs ultrathin bodies with subatomic wave-function resolution
NASA Astrophysics Data System (ADS)
Tan, Yaohua P.; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy B.; Klimeck, Gerhard
2015-08-01
Empirical tight-binding (ETB) methods are widely used in atomistic device simulations. Traditional ways of generating the ETB parameters rely on direct fitting to bulk experiments or theoretical electronic bands. However, ETB calculations based on existing parameters lead to unphysical results in ultrasmall structures like the As-terminated GaAs ultrathin bodies (UTBs). In this work, it is shown that more transferable ETB parameters with a short interaction range can be obtained by a process of mapping ab initio bands and wave functions to ETB models. This process enables the calibration of not only the ETB energy bands but also the ETB wave functions with corresponding ab initio calculations. Based on the mapping process, ETB models of Si and GaAs are parameterized with respect to hybrid functional calculations. Highly localized ETB basis functions are obtained. Both the ETB energy bands and wave functions with subatomic resolution of UTBs show good agreement with the corresponding hybrid functional calculations. The ETB methods can then be used to explain realistically extended devices in nonequilibrium that cannot be tackled with ab initio methods.
Newcombe, David A; Crawford, Ronald L
2007-12-01
Energetic compounds have been used in a variety of industrial and military applications worldwide leading to widespread environmental contamination. Many of these compounds are toxic and resist degradation by oxidative enzymes resulting in a need for alternative remediation methods. It has been shown that trinitrotoluene (TNT)-contaminated soil subjected to treatment in strictly anaerobic bioreactors results in tight binding of TNT transformation products to soil organic matter. The research presented here examined the fate of TNT and its metabolites in bioreactors under three different aeration regimes. In all treatment regimes, the typical metabolites of aminodinitrotoluenes and diaminonitrotoluenes were observed prior to irreversible binding into the soil fraction of the slurry. Significant transformation of TNT into organic acids or simple diols, as others report in prior work, was not observed in any of the treatments and is an unlikely fate of TNT in anaerobic soil slurries. These results indicate that aeration does not dramatically affect transformation or fate of TNT in reactor systems that receive a rich carbon source but does affect the rate at which metabolites become tightly bound to the soil. The most rapid transformations and lowest redox potentials were observed in reactors in which an aerobic headspace was maintained suggesting that aerobes play a role in establishing conditions that are most conducive to TNT reduction.
Symmetry and optical selection rules in graphene quantum dots
NASA Astrophysics Data System (ADS)
Pohle, Rico; Kavousanaki, Eleftheria G.; Dani, Keshav M.; Shannon, Nic
2018-03-01
Graphene quantum dots (GQD's) have optical properties which are very different from those of an extended graphene sheet. In this paper, we explore how the size, shape, and edge structure of a GQD affect its optical conductivity. Using representation theory, we derive optical selection rules for regular-shaped dots, starting from the symmetry properties of the current operator. We find that, where the x and y components of the current operator transform with the same irreducible representation (irrep) of the point group (for example in triangular or hexagonal GQD's), the optical conductivity is independent of the polarization of the light. On the other hand, where these components transform with different irreps (for example in rectangular GQD's), the optical conductivity depends on the polarization of light. We carry out explicit calculations of the optical conductivity of GQD's described by a simple tight-binding model and, for dots of intermediate size, find an absorption peak in the low-frequency range of the spectrum which allows us to distinguish between dots with zigzag and armchair edges. We also clarify the one-dimensional nature of states at the Van Hove singularity in graphene, providing a possible explanation for very high exciton-binding energies. Finally, we discuss the role of atomic vacancies and shape asymmetry.
Electronic Structure and Properties of Deformed Carbon Nanotubes
NASA Technical Reports Server (NTRS)
Yang, Liu; Arnold, Jim (Technical Monitor)
2001-01-01
A theoretical framework based on Huckel tight-binding model has been formulated to analyze the electronic structure of carbon nanotubes under uniform deformation. The model successfully quantifies the dispersion relation, density of states and bandgap change of nanotubes under uniform stretching, compression, torsion and bending. Our analysis shows that the shifting of the Fermi point away from the Brillouin zone vertices is the key reason for these changes. As a result of this shifting, the electronic structure of deformed carbon nanotubes varies dramatically depending on their chirality and deformation mode. Treating the Fermi point as a function of strain and tube chirality, the analytical solution preserves the concise form of undeformed carbon nanotubes. It predicts the shifting, merging and splitting of the Van Hove singularities in the density of states and the zigzag pattern of bandgap change under strains. Four orbital tight-binding simulations of carbon nanotubes under uniform stretching, compression, torsion and bending have been performed to verify the analytical solution. Extension to more complex systems are being performed to relate this analytical solution to the spectroscopic characterization, device performance and proposed quantum structures induced by the deformation. The limitations of this model will also be discussed.
NASA Astrophysics Data System (ADS)
Jahangiri, Soran; Mosey, Nicholas J.
2018-01-01
Nickel hydroxide is a material composed of two-dimensional layers that can be rolled up to form cylindrical nanotubes belonging to a class of inorganic metal hydroxide nanotubes that are candidates for applications in catalysis, energy storage, and microelectronics. The stabilities and other properties of this class of inorganic nanotubes have not yet been investigated in detail. The present study uses self-consistent-charge density-functional tight-binding calculations to examine the stabilities, mechanical properties, and electronic properties of nickel hydroxide nanotubes along with the energetics associated with the adsorption of water by these systems. The tight-binding model was parametrized for this system based on the results of first-principles calculations. The stabilities of the nanotubes were examined by calculating strain energies and performing molecular dynamics simulations. The results indicate that single-walled nickel hydroxide nanotubes are stable at room temperature, which is consistent with experimental investigations. The nanotubes possess size-dependent mechanical properties that are similar in magnitude to those of other inorganic nanotubes. The electronic properties of the nanotubes were also found to be size-dependent and small nickel oxyhydroxide nanotubes are predicted to be semiconductors. Despite this size-dependence, both the mechanical and electronic properties were found to be almost independent of the helical structure of the nanotubes. The calculations also show that water molecules have higher adsorption energies when binding to the interior of the nickel hydroxide nanotubes when compared to adsorption in nanotubes formed from other two-dimensional materials such as graphene. The increased adsorption energy is due to the hydrophilic nature of nickel hydroxide. Due to the broad applications of nickel hydroxide, the nanotubes investigated here are also expected to be used in catalysis, electronics, and clean energy production.
Glover, N R; Tracey, A S
1999-04-20
The epidermal growth factor-derived (EGFR988) fluorophosphonate peptide, DADE(F2Pmp)L, is a potent (30 pM) inhibitor of the protein tyrosine phosphatase PTP1B. Nuclear magnetic resonance (NMR) transferred nuclear Overhauser effect (nOe) experiments have been used to determine the conformation of DADE(F2Pmp)L while bound in the active site of PTP1B. When bound, the peptide adopts an extended beta-strand conformation. Molecular modeling and molecular dynamics simulations allowed the elucidation of the sources of many of the interactions leading to binding of this inhibitor. Electrostatic, hydrophobic, and hydrogen-bonding interactions were all found to contribute significantly to its binding. However, despite the overall tight binding of this inhibitor, the N-terminal and adjacent residue of the peptide were virtually unrestrained in their motion. The major contributions to binding arose from hydrophobic interactions at the leucine and at the aromatic center, hydrogen bonding to the pro-R fluorine of the fluorophosphonomethyl group, and electrostatic interactions involving the carboxylate functionalities of the aspartate and glutamate residues. These latter two residues were found to form tight contacts with surface recognition elements (arginine and lysine) situated near the active-site cleft.
NASA Astrophysics Data System (ADS)
Ryu, Hoon; Jeong, Yosang; Kang, Ji-Hoon; Cho, Kyu Nam
2016-12-01
Modelling of multi-million atomic semiconductor structures is important as it not only predicts properties of physically realizable novel materials, but can accelerate advanced device designs. This work elaborates a new Technology-Computer-Aided-Design (TCAD) tool for nanoelectronics modelling, which uses a sp3d5s∗ tight-binding approach to describe multi-million atomic structures, and simulate electronic structures with high performance computing (HPC), including atomic effects such as alloy and dopant disorders. Being named as Quantum simulation tool for Advanced Nanoscale Devices (Q-AND), the tool shows nice scalability on traditional multi-core HPC clusters implying the strong capability of large-scale electronic structure simulations, particularly with remarkable performance enhancement on latest clusters of Intel Xeon PhiTM coprocessors. A review of the recent modelling study conducted to understand an experimental work of highly phosphorus-doped silicon nanowires, is presented to demonstrate the utility of Q-AND. Having been developed via Intel Parallel Computing Center project, Q-AND will be open to public to establish a sound framework of nanoelectronics modelling with advanced HPC clusters of a many-core base. With details of the development methodology and exemplary study of dopant electronics, this work will present a practical guideline for TCAD development to researchers in the field of computational nanoelectronics.
Colloidal nanocrystals as LEGO® bricks for building electronic band structure models.
Tadjine, Athmane; Delerue, Christophe
2018-03-28
The synthesis of self-assembled semiconductor nanocrystal (NC) superlattices using oriented attachment recently became a flourishing research topic. This technique already produced remarkable forms of NC superlattices, such as linear chains, mono and multilayer square lattices, and silicene-like honeycomb lattices. In the case of lead chalcogenide semiconductors where NCs are in the form of truncated nanocubes, the attachment mostly occurs via (100) facets. In this work, we show that all these structures can be seen as sub-structures of a simple cubic lattice. From this, we investigate a rich variety of one-dimensional or two-dimensional superlattices that could be built as few lines or few layers taken from the same cubic system following different crystallographic orientations. Each NC can be therefore considered as a LEGO® brick, and any superlattice can be obtained from another one by rearranging the bricks. Moreover, we show that this concept of LEGO® bricks can be extended to the calculation of the electronic band structure of the superlattices. This leads to a simple yet powerful way to build analytical Hamiltonians that present band structures in excellent agreement with more elaborate atomistic tight-binding calculations. This LEGO® concept could guide the synthesis of superlattices and LEGO® Hamiltonians should greatly simplify further studies on the (opto-)electronic properties of such structures.
Gruden, Maja; Andjeklović, Ljubica; Jissy, Akkarapattiakal Kuriappan; Stepanović, Stepan; Zlatar, Matija; Cui, Qiang; Elstner, Marcus
2017-09-30
Density Functional Tight Binding (DFTB) models are two to three orders of magnitude faster than ab initio and Density Functional Theory (DFT) methods and therefore are particularly attractive in applications to large molecules and condensed phase systems. To establish the applicability of DFTB models to general chemical reactions, we conduct benchmark calculations for barrier heights and reaction energetics of organic molecules using existing databases and several new ones compiled in this study. Structures for the transition states and stable species have been fully optimized at the DFTB level, making it possible to characterize the reliability of DFTB models in a more thorough fashion compared to conducting single point energy calculations as done in previous benchmark studies. The encouraging results for the diverse sets of reactions studied here suggest that DFTB models, especially the most recent third-order version (DFTB3/3OB augmented with dispersion correction), in most cases provide satisfactory description of organic chemical reactions with accuracy almost comparable to popular DFT methods with large basis sets, although larger errors are also seen for certain cases. Therefore, DFTB models can be effective for mechanistic analysis (e.g., transition state search) of large (bio)molecules, especially when coupled with single point energy calculations at higher levels of theory. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Lonberg-Holm, K; Whiteley, N M
1976-01-01
Attachment, ""tight binding'' and eclipse of radioactive poliovirus 2 (P2) and human rhinovirus 2 (HRV 2) were investigated. The activation energy for attachment of both HRV2 and P2 was about 13 kcal/mol. HRV2 differed from P2 in two respects: the Arrhenius plot for attachment of HRV2 showed a break at 15 to 19 degrees C when the cells were first treated several hours at 0 degrees C, and attachment of HRV2 was inhibited by treatment of cells with metabolic poisons able to reduce cellular ATP by more than 90%. Tight binding was determined by isolation of a specific P2-membrane complex or by loss of EDTA dissociability of HRV2. Tight binding of both viruses was slowed by 0.01 M iodoacetamide but not by 0.02 M F-; F- plus 0.002 M CN- slowed tight binding of HRV2 but not of P2. Eclipse, the irreversible alteration of parental virions, was detected by isolation of cell-associated subviral particles or by loss of cell-associated infectious virus. Eclipse of both viruses is slowed by iodoacetamide or F-. It seems likely that the early steps of infection with picornaviruses may be sensitive to alterations in the cell membrane produced by metabolic inhibitors or by treatment at low temperature. PMID:184301
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morris, J.R.; Lu, Z.Y.; Xiang, J.B.
We have examined a variety of structures for the (510) symmetric tilt boundary in Si, using first-principles calculations. These calculations show that the observed structure in Si is the lowest energy structure. This structure is more complicated than what is necessary to preserve four-fold coordination. We compare the results to classical and tight-binding models, in order to test these empirical problems.
Jones, Kayleigh E; Batchler, Kathleen L; Zalouk, Célia; Valentine, Ann M
2017-02-06
The siderophore desferrioxamine B (DFOB) binds Ti(IV) tightly and precludes its hydrolytic precipitation under biologically and environmentally relevant conditions. This interaction of DFOB with Ti(IV) is investigated by using spectro-potentiometric and spectro-photometric titrations, mass spectrometry, isothermal titration calorimetry (ITC), and computational modeling. The data from pH 2-10 suggest two one-proton equilibria among three species, with one species predominating below pH 3.5, a second from pH 3.5 to 8, and a third above pH 8. The latter species is prone to slow hydrolytic precipitation. Electrospray mass spectrometry allowed the detection of [Ti(IV) (HDFOB)] 2+ and [Ti(DFOB)] + ; these species were assigned as the pH < 3.5 and the 3.5 < pH < 8 species, respectively. The stability constant for Ti(IV)-DFOB was determined by using UV/vis-monitored competition with ethylenediaminetetraacetic acid (EDTA). Taking into consideration the available binding constant of Ti(IV) and EDTA, the data reveal values of log β 111 = 41.7, log β 110 = 38.1, and log β 11-1 = 30.1. The former value was supported by ITC, with the transfer of Ti(IV) from EDTA to DFOB determined to be both enthalpically and entropically favorable. Computational methods yielded a model of Ti-DFOB. The physiological and environmental implications of this tight interaction and the potential role of DFOB in solubilizing Ti(IV) are discussed.
Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela
2016-03-18
The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Li, Yun-Mei; Zhou, Xiaoying; Zhang, Yan-Yang; Zhang, Dong; Chang, Kai
2017-07-01
We investigate theoretically the electronic properties of two-dimensional electron gases (2DEGs) with regular and distorted triangular antidot lattices. We show that the triangular antidot lattices embedded in 2DEGs behave like artificial graphene and host Dirac fermions. By introducing the Wannier representation, we obtain a tight-binding Hamiltonian including the second-nearest-neighboring hopping, which agrees well with the numerically exact solutions. Based on the tight-binding model, we find that spatially nonuniform distortions of the antidot lattices strongly modify the electronic structures, generate pseudomagnetic fields and the well-defined Landau levels. In contrast to graphene, we can design the nonuniform distortions to generate various configurations of pseudomagnetic fields. We show that the snake orbital states arise by designing the ±B pseudomagnetic field configuration. We find that the disorders of antidot lattices during fabrication would not affect the basic feature of the Dirac electrons, but they lead to a reduction in conductance in strong disorder cases.
Quantitative analysis on electric dipole energy in Rashba band splitting.
Hong, Jisook; Rhim, Jun-Won; Kim, Changyoung; Ryong Park, Seung; Hoon Shim, Ji
2015-09-01
We report on quantitative comparison between the electric dipole energy and the Rashba band splitting in model systems of Bi and Sb triangular monolayers under a perpendicular electric field. We used both first-principles and tight binding calculations on p-orbitals with spin-orbit coupling. First-principles calculation shows Rashba band splitting in both systems. It also shows asymmetric charge distributions in the Rashba split bands which are induced by the orbital angular momentum. We calculated the electric dipole energies from coupling of the asymmetric charge distribution and external electric field, and compared it to the Rashba splitting. Remarkably, the total split energy is found to come mostly from the difference in the electric dipole energy for both Bi and Sb systems. A perturbative approach for long wave length limit starting from tight binding calculation also supports that the Rashba band splitting originates mostly from the electric dipole energy difference in the strong atomic spin-orbit coupling regime.
Quantitative analysis on electric dipole energy in Rashba band splitting
Hong, Jisook; Rhim, Jun-Won; Kim, Changyoung; Ryong Park, Seung; Hoon Shim, Ji
2015-01-01
We report on quantitative comparison between the electric dipole energy and the Rashba band splitting in model systems of Bi and Sb triangular monolayers under a perpendicular electric field. We used both first-principles and tight binding calculations on p-orbitals with spin-orbit coupling. First-principles calculation shows Rashba band splitting in both systems. It also shows asymmetric charge distributions in the Rashba split bands which are induced by the orbital angular momentum. We calculated the electric dipole energies from coupling of the asymmetric charge distribution and external electric field, and compared it to the Rashba splitting. Remarkably, the total split energy is found to come mostly from the difference in the electric dipole energy for both Bi and Sb systems. A perturbative approach for long wave length limit starting from tight binding calculation also supports that the Rashba band splitting originates mostly from the electric dipole energy difference in the strong atomic spin-orbit coupling regime. PMID:26323493
Mortazavi, Majid; Brandenburg, Jan Gerit; Maurer, Reinhard J; Tkatchenko, Alexandre
2018-01-18
Accurate prediction of structure and stability of molecular crystals is crucial in materials science and requires reliable modeling of long-range dispersion interactions. Semiempirical electronic structure methods are computationally more efficient than their ab initio counterparts, allowing structure sampling with significant speedups. We combine the Tkatchenko-Scheffler van der Waals method (TS) and the many-body dispersion method (MBD) with third-order density functional tight-binding (DFTB3) via a charge population-based method. We find an overall good performance for the X23 benchmark database of molecular crystals, despite an underestimation of crystal volume that can be traced to the DFTB parametrization. We achieve accurate lattice energy predictions with DFT+MBD energetics on top of vdW-inclusive DFTB3 structures, resulting in a speedup of up to 3000 times compared with a full DFT treatment. This suggests that vdW-inclusive DFTB3 can serve as a viable structural prescreening tool in crystal structure prediction.
Forest, Elodie; Logeay, Rémi; Géminard, Charles; Kantar, Diala; Frayssinoux, Florence; Heron-Milhavet, Lisa; Djiane, Alexandre
2018-03-05
During development, cell numbers are tightly regulated, ensuring that tissues and organs reach their correct size and shape. Recent evidence has highlighted the intricate connections between the cytoskeleton and the regulation of the key growth control Hippo pathway. Looking for apical scaffolds regulating tissue growth, we describe that Drosophila melanogaster big bang (Bbg), a poorly characterized multi-PDZ scaffold, controls epithelial tissue growth without affecting epithelial polarity and architecture. bbg -mutant tissues are smaller, with fewer cells that are less apically constricted than normal. We show that Bbg binds to and colocalizes tightly with the β-heavy-Spectrin/Kst subunit at the apical cortex and promotes Yki activity, F-actin enrichment, and the phosphorylation of the myosin II regulatory light chain Spaghetti squash. We propose a model in which the spectrin cytoskeleton recruits Bbg to the cortex, where Bbg promotes actomyosin contractility to regulate epithelial tissue growth. © 2018 Forest et al.
Crumbs3 Is Essential for Proper Epithelial Development and Viability
Whiteman, Eileen L.; Fan, Shuling; Harder, Jennifer L.; Walton, Katherine D.; Liu, Chia-Jen; Soofi, Abdul; Fogg, Vanessa C.; Hershenson, Marc B.; Dressler, Gregory R.; Deutsch, Gail H.; Gumucio, Deborah L.
2014-01-01
First identified in Drosophila, the Crumbs (Crb) proteins are important in epithelial polarity, apical membrane formation, and tight junction (TJ) assembly. The conserved Crb intracellular region includes a FERM (band 4.1/ezrin/radixin/moesin) binding domain (FBD) whose mammalian binding partners are not well understood and a PDZ binding motif that interacts with mammalian Pals1 (protein associated with lin seven) (also known as MPP5). Pals1 binds Patj (Pals1-associated tight-junction protein), a multi-PDZ-domain protein that associates with many tight junction proteins. The Crb complex also binds the conserved Par3/Par6/atypical protein kinase C (aPKC) polarity cassette that restricts migration of basolateral proteins through phosphorylation. Here, we describe a Crb3 knockout mouse that demonstrates extensive defects in epithelial morphogenesis. The mice die shortly after birth, with cystic kidneys and proteinaceous debris throughout the lungs. The intestines display villus fusion, apical membrane blebs, and disrupted microvilli. These intestinal defects phenocopy those of Ezrin knockout mice, and we demonstrate an interaction between Crumbs3 and ezrin. Taken together, our data indicate that Crumbs3 is crucial for epithelial morphogenesis and plays a role in linking the apical membrane to the underlying ezrin-containing cytoskeleton. PMID:24164893
Specificity in Transition State Binding: The Pauling Model Revisited
Amyes, Tina L.; Richard, John P.
2013-01-01
Linus Pauling proposed that the large rate accelerations for enzymes are due to the high specificity of the protein catalyst for binding the reaction transition state. The observation that stable analogs of the transition states for enzymatic reactions often act as tight-binding binding inhibitors provided early support for this simple and elegant proposal. We review experimental results which support the proposal that Pauling’s model provides a satisfactory explanation for the rate accelerations for many heterolytic enzymatic reactions through high energy reaction intermediates, such as proton transfer and decarboxylation. Specificity in transition state binding is obtained when the total intrinsic binding energy of the substrate is significantly larger than the binding energy observed at the Michaelis complex. The results of recent studies to characterize the specificity in binding of the enolate oxygen at the transition state for the 1,3-isomerization reaction catalyzed by ketosteroid isomerase are reviewed. Interactions between pig heart succinyl-CoA:3-oxoacid coenzyme A transferase (SCOT) and the nonreacting portions of CoA are responsible for a rate increase of 3 × 1012-fold, which is close to the estimated total 5 × 1013-fold enzymatic rate acceleration. Studies that partition the interactions between SCOT and CoA into their contributing parts are reviewed. Interactions of the protein with the substrate phosphodianion group provide a ca. 12 kcal/mol stabilization of the transition state for the reactions catalyzed by triosephosphate isomerase, orotidine 5′-monophosphate decarboxylase and α-glycerol phosphate dehydrogenase. The interactions of these enzymes with the substrate piece phosphite dianion provide a 6 – 8 kcal/mol stabilization of the transition state for reaction of the appropriate truncated substrate. Enzyme activation by phosphite dianion reflects the higher dianion affinity for binding to the enzyme-transition state complex compared with the free enzyme. Evidence is presented that supports a model in which the binding energy of the phosphite dianion piece, or the phosphodianion group of the whole substrate, is utilized to drive an enzyme conformational change from an inactive open form EO to an active closed form EC, by closure of a phosphodianion gripper loop. Members of the enolase and haloalkanoic acid dehalogenase superfamilies use variable capping domains to interact with nonreacting portions of the substrate and sequester the substrate from interaction with bulk solvent. Interactions of this capping domain with the phenyl group of mandelate have been shown to activate mandelate racemase for catalysis of deprotonation of α-carbonyl carbon. We propose that an important function of these capping domains is to utilize the binding interactions with nonreacting portions of the substrate to activate the enzyme for catalysis. PMID:23327224
Oh, Kenneth J; Cash, Kevin J; Plaxco, Kevin W
2006-11-01
While protein-polypeptide and nucleic acid-polypeptide interactions are of significant experimental interest, quantitative methods for the characterization of such interactions are often cumbersome. Here we described a relatively simple means of optically monitoring such interactions using excimer-based peptide beacons (PBs). The design of PBs is based on the observation that, whereas short peptides are almost invariably unfolded and highly dynamic, they become rigid when complexed with macromolecular targets. Using this binding-induced folding to segregate two pyrene moieties and therefore inhibit excimer formation, we have produced PBs directed against both anti-HIV antibodies and the retroviral transactive response (TAR) RNA hairpin. For both polypeptides, target recognition is accompanied by a roughly 2-fold decrease in excimer emission, thus allowing the detection of their respective targets at concentrations of a few nanomolar. Because excimer emission requires the formation of a tight, precisely oriented pyrene dimer, even relatively trivial binding-induced segregation reduces fluorescence significantly. This suggests that the PB approach will be suitable for monitoring a wide range of peptide-macromolecule recognition events. Moreover, the synthesis of excimer-based PBs utilizes commercially available modified pyrenes in a simple and well-established protocol, making the approach well suited for routine laboratory applications.
Efficient self-consistency for magnetic tight binding
NASA Astrophysics Data System (ADS)
Soin, Preetma; Horsfield, A. P.; Nguyen-Manh, D.
2011-06-01
Tight binding can be extended to magnetic systems by including an exchange interaction on an atomic site that favours net spin polarisation. We have used a published model, extended to include long-ranged Coulomb interactions, to study defects in iron. We have found that achieving self-consistency using conventional techniques was either unstable or very slow. By formulating the problem of achieving charge and spin self-consistency as a search for stationary points of a Harris-Foulkes functional, extended to include spin, we have derived a much more efficient scheme based on a Newton-Raphson procedure. We demonstrate the capabilities of our method by looking at vacancies and self-interstitials in iron. Self-consistency can indeed be achieved in a more efficient and stable manner, but care needs to be taken to manage this. The algorithm is implemented in the code PLATO. Program summaryProgram title:PLATO Catalogue identifier: AEFC_v2_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEFC_v2_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 228 747 No. of bytes in distributed program, including test data, etc.: 1 880 369 Distribution format: tar.gz Programming language: C and PERL Computer: Apple Macintosh, PC, Unix machines Operating system: Unix, Linux, Mac OS X, Windows XP Has the code been vectorised or parallelised?: Yes. Up to 256 processors tested RAM: Up to 2 Gbytes per processor Classification: 7.3 External routines: LAPACK, BLAS and optionally ScaLAPACK, BLACS, PBLAS, FFTW Catalogue identifier of previous version: AEFC_v1_0 Journal reference of previous version: Comput. Phys. Comm. 180 (2009) 2616 Does the new version supersede the previous version?: Yes Nature of problem: Achieving charge and spin self-consistency in magnetic tight binding can be very difficult. Our existing schemes failed altogether, or were very slow. Solution method: A new scheme for achieving self-consistency in orthogonal tight binding has been introduced that explicitly evaluates the first and second derivatives of the energy with respect to input charge and spin, and then uses these to search for stationary values of the energy. Reasons for new version: Bug fixes and new functionality. Summary of revisions: New charge and spin mixing scheme for orthogonal tight binding. Numerous small bug fixes. Restrictions: The new mixing scheme scales poorly with system size. In particular the memory usage scales as number of atoms to the power 4. It is restricted to systems with about 200 atoms or less. Running time: Test cases will run in a few minutes, large calculations may run for several days.
Dirac topological insulator in the dz2 manifold of a honeycomb oxide
NASA Astrophysics Data System (ADS)
Lado, J. L.; Pardo, V.
2016-09-01
We show by means of ab initio calculations and tight-binding modeling that an oxide system based on a honeycomb lattice can sustain topologically nontrivial states if a single orbital dominates the spectrum close to the Fermi level. In such a situation, the low-energy spectrum is described by two Dirac equations that become nontrivially gapped when spin-orbit coupling (SOC) is switched on. We provide one specific example but the recipe is general. We discuss a realization of this starting from a conventional spin-1/2 honeycomb antiferromagnet whose states close to the Fermi energy are dz2 orbitals. Switching off magnetism by atomic substitution and ensuring that the electronic structure becomes two-dimensional is sufficient for topologicality to arise in such a system. By deriving a tight-binding Wannier Hamiltonian, we find that the gap in such a model scales linearly with SOC, opposed to other oxide-based topological insulators, where smaller gaps tend to appear by construction of the lattice. We show that the quantum spin Hall state in this system survives in the presence of off-plane magnetism and the orbital magnetic field and we discuss its Landau level spectra, showing that our recipe provides a dz2 realization of the Kane-Mele model.
Mobile spin impurity in an optical lattice
NASA Astrophysics Data System (ADS)
Duncan, C. W.; Bellotti, F. F.; Öhberg, P.; Zinner, N. T.; Valiente, M.
2017-07-01
We investigate the Fermi polaron problem in a spin-1/2 Fermi gas in an optical lattice for the limit of both strong repulsive contact interactions and one dimension. In this limit, a polaronic-like behaviour is not expected, and the physics is that of a magnon or impurity. While the charge degrees of freedom of the system are frozen, the resulting tight-binding Hamiltonian for the impurity’s spin exhibits an intriguing structure that strongly depends on the filling factor of the lattice potential. This filling dependency also transfers to the nature of the interactions for the case of two magnons and the important spin balanced case. At low filling, and up until near unit filling, the single impurity Hamiltonian faithfully reproduces a single-band, quasi-homogeneous tight-binding problem. As the filling is increased and the second band of the single particle spectrum of the periodic potential is progressively filled, the impurity Hamiltonian, at low energies, describes a single particle trapped in a multi-well potential. Interestingly, once the first two bands are fully filled, the impurity Hamiltonian is a near-perfect realisation of the Su-Schrieffer-Heeger model. Our studies, which go well beyond the single-band approximation, that is, the Hubbard model, pave the way for the realisation of interacting one-dimensional models of condensed matter physics.
Phononic crystals of spherical particles: A tight binding approach
NASA Astrophysics Data System (ADS)
Mattarelli, M.; Secchi, M.; Montagna, M.
2013-11-01
The vibrational dynamics of a fcc phononic crystal of spheres is studied and compared with that of a single free sphere, modelled either by a continuous homogeneous medium or by a finite cluster of atoms. For weak interaction among the spheres, the vibrational dynamics of the phononic crystal is described by shallow bands, with low degree of dispersion, corresponding to the acoustic spheroidal and torsional modes of the single sphere. The phonon displacements are therefore related to the vibrations of a sphere, as the electron wave functions in a crystal are related to the atomic wave functions in a tight binding model. Important dispersion is found for the two lowest phonon bands, which correspond to zero frequency free translation and rotation of a free sphere. Brillouin scattering spectra are calculated at some values of the exchanged wavevectors of the light, and compared with those of a single sphere. With weak interaction between particles, given the high acoustic impedance mismatch in dry systems, the density of phonon states consist of sharp bands separated by large gaps, which can be well accounted for by a single particle model. Based on the width of the frequency gaps, tunable with the particle size, and on the small number of dispersive acoustic phonons, such systems may provide excellent materials for application as sound or heat filters.
NASA Astrophysics Data System (ADS)
Menezes, Marcos; Capaz, Rodrigo
Black Phosphorus (BP) is a promising material for applications in electronics, especially due to the tuning of its band gap by increasing the number of layers. In single-layer BP, also called Phosphorene, the P atoms form two staggered chains bonded by sp3 hybridization, while neighboring layers are bonded by Van-der-Waals interactions. In this work, we present a Tight-Binding (TB) parametrization of the electronic structure of single and few-layer BP, based on the Slater-Koster model within the two-center approximation. Our model includes all 3s and 3p orbitals, which makes this problem more complex than that of graphene, where only 2pz orbitals are needed for most purposes. The TB parameters are obtained from a least-squares fit of DFT calculations carried on the SIESTA code. We compare the results for different basis-sets used to expand the ab-initio wavefunctions and discuss their applicability. Our model can fit a larger number of bands than previously reported calculations based on Wannier functions. Moreover, our parameters have a clear physical interpretation based on chemical bonding. As such, we expect our results to be useful in a further understanding of multilayer BP and other 2D-materials characterized by strong sp3 hybridization. CNPq, FAPERJ, INCT-Nanomateriais de Carbono.
Electronic properties of one-dimensional nanostructures of the Bi2Se3 topological insulator
NASA Astrophysics Data System (ADS)
Virk, Naunidh; Autès, Gabriel; Yazyev, Oleg V.
2018-04-01
We theoretically study the electronic structure and spin properties of one-dimensional nanostructures of the prototypical bulk topological insulator Bi2Se3 . Realistic models of experimentally observed Bi2Se3 nanowires and nanoribbons are considered using the tight-binding method. At low energies, the band structures are composed of a series of evenly spaced degenerate subbands resulting from circumferential confinement of the topological surface states. The direct band gaps due to the nontrivial π Berry phase show a clear dependence on the circumference. The spin-momentum locking of the topological surface states results in a pronounced 2 π spin rotation around the circumference with the degree of spin polarization dependent on the momentum along the nanostructure. Overall, the band structures and spin textures are more complicated for nanoribbons, which expose two distinct facets. The effects of reduced dimensionality are rationalized with the help of a simple model that considers circumferential quantization of the topological surface states. Furthermore, the surface spin density induced by an electric current along the nanostructure shows a pronounced oscillatory dependence on the charge-carrier energy, which can be exploited in spintronics applications.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morris, J.R.; Lu, Z.Y.; Ring, D.M.
The authors have examined a variety of structures for the {l_brace}510{r_brace} symmetric tilt boundary in Si, using first-principles calculations. These calculations show that the observed structure in Si is the lowest energy structure. This structure is more complicated than what is necessary to preserve four-fold coordination. They compare the results to classical and tight-binding models, in order to test these empirical approaches.
A general intermolecular force field based on tight-binding quantum chemical calculations
NASA Astrophysics Data System (ADS)
Grimme, Stefan; Bannwarth, Christoph; Caldeweyher, Eike; Pisarek, Jana; Hansen, Andreas
2017-10-01
A black-box type procedure is presented for the generation of a molecule-specific, intermolecular potential energy function. The method uses quantum chemical (QC) information from our recently published extended tight-binding semi-empirical scheme (GFN-xTB) and can treat non-covalently bound complexes and aggregates with almost arbitrary chemical structure. The necessary QC information consists of the equilibrium structure, Mulliken atomic charges, charge centers of localized molecular orbitals, and also of frontier orbitals and orbital energies. The molecular pair potential includes model density dependent Pauli repulsion, penetration, as well as point charge electrostatics, the newly developed D4 dispersion energy model, Drude oscillators for polarization, and a charge-transfer term. Only one element-specific and about 20 global empirical parameters are needed to cover systems with nuclear charges up to radon (Z = 86). The method is tested for standard small molecule interaction energy benchmark sets where it provides accurate intermolecular energies and equilibrium distances. Examples for structures with a few hundred atoms including charged systems demonstrate the versatility of the approach. The method is implemented in a stand-alone computer code which enables rigid-body, global minimum energy searches for molecular aggregation or alignment.
Inhibition of ATP Synthase by Chlorinated Adenosine Analogue
Chen, Lisa S.; Nowak, Billie J.; Ayres, Mary L.; Krett, Nancy L.; Rosen, Steven T.; Zhang, Shuxing; Gandhi, Varsha
2009-01-01
8-Chloroadenosine (8-Cl-Ado) is a ribonucleoside analogue that is currently in clinical trial for chronic lymphocytic leukemia. Based on the decline in cellular ATP pool following 8-Cl-Ado treatment, we hypothesized that 8-Cl-ADP and 8-Cl-ATP may interfere with ATP synthase, a key enzyme in ATP production. Mitochondrial ATP synthase is composed of two major parts; FO intermembrane base and F1 domain, containing α and β subunits. Crystal structures of both α and β subunits that bind to the substrate, ADP, are known in tight binding (αdpβdp) and loose binding (αtpβtp) states. Molecular docking demonstrated that 8-Cl-ADP/8-Cl-ATP occupied similar binding modes as ADP/ATP in the tight and loose binding sites of ATP synthase, respectively, suggesting that the chlorinated nucleotide metabolites may be functional substrates and inhibitors of the enzyme. The computational predictions were consistent with our whole cell biochemical results. Oligomycin, an established pharmacological inhibitor of ATP synthase, decreased both ATP and 8-Cl-ATP formation from exogenous substrates, however, did not affect pyrimidine nucleoside analogue triphosphate accumulation. Synthesis of ATP from ADP was inhibited in cells loaded with 8-Cl-ATP. These biochemical studies are in consent with the computational modeling; in the αtpβtp state 8-Cl-ATP occupies similar binding as ANP, a non-hydrolyzable ATP mimic that is a known inhibitor. Similarly, in the substrate binding site (αdpβdp) 8-Cl-ATP occupies a similar position as ATP mimic ADP-BeF3 −. Collectively, our current work suggests that 8-Cl-ADP may serve as a substrate and the 8-Cl-ATP may be an inhibitor of ATP synthase. PMID:19477165
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nakata, Hiroya, E-mail: hiroya.nakata.gt@kyocera.jp; Nishimoto, Yoshio; Fedorov, Dmitri G.
2016-07-28
The analytic second derivative of the energy is developed for the fragment molecular orbital (FMO) method combined with density-functional tight-binding (DFTB), enabling simulations of infrared and Raman spectra of large molecular systems. The accuracy of the method is established in comparison to full DFTB without fragmentation for a set of representative systems. The performance of the FMO-DFTB Hessian is discussed for molecular systems containing up to 10 041 atoms. The method is applied to the study of the binding of α-cyclodextrin to polyethylene glycol, and the calculated IR spectrum of an epoxy amine oligomer reproduces experiment reasonably well.
The Mismetallation of Enzymes during Oxidative Stress*
Imlay, James A.
2014-01-01
Mononuclear iron enzymes can tightly bind non-activating metals. How do cells avoid mismetallation? The model bacterium Escherichia coli may control its metal pools so that thermodynamics favor the correct metallation of each enzyme. This system is disrupted, however, by superoxide and hydrogen peroxide. These species oxidize ferrous iron and thereby displace it from many iron-dependent mononuclear enzymes. Ultimately, zinc binds in its place, confers little activity, and imposes metabolic bottlenecks. Data suggest that E. coli compensates by using thiols to extract the zinc and by importing manganese to replace the catalytic iron atom. Manganese resists oxidants and provides substantial activity. PMID:25160623
Selection Shapes Transcriptional Logic and Regulatory Specialization in Genetic Networks.
Fogelmark, Karl; Peterson, Carsten; Troein, Carl
2016-01-01
Living organisms need to regulate their gene expression in response to environmental signals and internal cues. This is a computational task where genes act as logic gates that connect to form transcriptional networks, which are shaped at all scales by evolution. Large-scale mutations such as gene duplications and deletions add and remove network components, whereas smaller mutations alter the connections between them. Selection determines what mutations are accepted, but its importance for shaping the resulting networks has been debated. To investigate the effects of selection in the shaping of transcriptional networks, we derive transcriptional logic from a combinatorially powerful yet tractable model of the binding between DNA and transcription factors. By evolving the resulting networks based on their ability to function as either a simple decision system or a circadian clock, we obtain information on the regulation and logic rules encoded in functional transcriptional networks. Comparisons are made between networks evolved for different functions, as well as with structurally equivalent but non-functional (neutrally evolved) networks, and predictions are validated against the transcriptional network of E. coli. We find that the logic rules governing gene expression depend on the function performed by the network. Unlike the decision systems, the circadian clocks show strong cooperative binding and negative regulation, which achieves tight temporal control of gene expression. Furthermore, we find that transcription factors act preferentially as either activators or repressors, both when binding multiple sites for a single target gene and globally in the transcriptional networks. This separation into positive and negative regulators requires gene duplications, which highlights the interplay between mutation and selection in shaping the transcriptional networks.
Specificity in transition state binding: the Pauling model revisited.
Amyes, Tina L; Richard, John P
2013-03-26
Linus Pauling proposed that the large rate accelerations for enzymes are caused by the high specificity of the protein catalyst for binding the reaction transition state. The observation that stable analogues of the transition states for enzymatic reactions often act as tight-binding inhibitors provided early support for this simple and elegant proposal. We review experimental results that support the proposal that Pauling's model provides a satisfactory explanation for the rate accelerations for many heterolytic enzymatic reactions through high-energy reaction intermediates, such as proton transfer and decarboxylation. Specificity in transition state binding is obtained when the total intrinsic binding energy of the substrate is significantly larger than the binding energy observed at the Michaelis complex. The results of recent studies that aimed to characterize the specificity in binding of the enolate oxygen at the transition state for the 1,3-isomerization reaction catalyzed by ketosteroid isomerase are reviewed. Interactions between pig heart succinyl-coenzyme A:3-oxoacid coenzyme A transferase (SCOT) and the nonreacting portions of coenzyme A (CoA) are responsible for a rate increase of 3 × 10(12)-fold, which is close to the estimated total 5 × 10(13)-fold enzymatic rate acceleration. Studies that partition the interactions between SCOT and CoA into their contributing parts are reviewed. Interactions of the protein with the substrate phosphodianion group provide an ~12 kcal/mol stabilization of the transition state for the reactions catalyzed by triosephosphate isomerase, orotidine 5'-monophosphate decarboxylase, and α-glycerol phosphate dehydrogenase. The interactions of these enzymes with the substrate piece phosphite dianion provide a 6-8 kcal/mol stabilization of the transition state for reaction of the appropriate truncated substrate. Enzyme activation by phosphite dianion reflects the higher dianion affinity for binding to the enzyme-transition state complex compared with that of the free enzyme. Evidence is presented that supports a model in which the binding energy of the phosphite dianion piece, or the phosphodianion group of the whole substrate, is utilized to drive an enzyme conformational change from an inactive open form E(O) to an active closed form E(C), by closure of a phosphodianion gripper loop. Members of the enolase and haloalkanoic acid dehalogenase superfamilies use variable capping domains to interact with nonreacting portions of the substrate and sequester the substrate from interaction with bulk solvent. Interactions of this capping domain with the phenyl group of mandelate have been shown to activate mandelate racemase for catalysis of deprotonation of α-carbonyl carbon. We propose that an important function of these capping domains is to utilize the binding interactions with nonreacting portions of the substrate to activate the enzyme for catalysis.
A combined representation method for use in band structure calculations. 1: Method
NASA Technical Reports Server (NTRS)
Friedli, C.; Ashcroft, N. W.
1975-01-01
A representation was described whose basis levels combine the important physical aspects of a finite set of plane waves with those of a set of Bloch tight-binding levels. The chosen combination has a particularly simple dependence on the wave vector within the Brillouin Zone, and its use in reducing the standard one-electron band structure problem to the usual secular equation has the advantage that the lattice sums involved in the calculation of the matrix elements are actually independent of the wave vector. For systems with complicated crystal structures, for which the Korringa-Kohn-Rostoker (KKR), Augmented-Plane Wave (APW) and Orthogonalized-Plane Wave (OPW) methods are difficult to apply, the present method leads to results with satisfactory accuracy and convergence.
Tight-binding calculation of radiation loss in photonic crystal CROW.
Ma, Jing; Martínez, Luis Javier; Fan, Shanhui; Povinelli, Michelle L
2013-01-28
The tight binding approximation (TBA) is used to relate the intrinsic, radiation loss of a coupled resonator optical waveguide (CROW) to that of a single constituent resonator within a light cone picture. We verify the validity of the TBA via direct, full-field simulation of CROWs based on the L2 photonic crystal cavity. The TBA predicts that the quality factor of the CROW increases with that of the isolated cavity. Moreover, our results provide a method to design CROWs with low intrinsic loss across the entire waveguide band.
1977-01-01
An s extended summary of the theoretical and ex- perimental work on Si02 is to be found in that paper. The tight-binding basis con- sists of the four... theoretical and experimental works contained therein. 4. B. Fischer, R. A. Pollak, T. H. Distefano and W. D. Grobman, "Electronic Structure of SiO 2, SixGe 1 x...and GeO 2 from Photoemission Spectroscopy," Phys. Rev. BI5, 3193 (1977), and references to earlier works therein. 5. J. H. Scofield , "Hartree-Slater
Experience of agency and sense of responsibility.
Moretto, Giovanna; Walsh, Eamonn; Haggard, Patrick
2011-12-01
The experience of agency refers to the feeling that we control our own actions, and through them the outside world. In many contexts, sense of agency has strong implications for moral responsibility. For example, a sense of agency may allow people to choose between right and wrong actions, either immediately, or on subsequent occasions through learning about the moral consequences of their actions. In this study we investigate the relation between the experience of operant action, and responsibility for action outcomes using the intentional binding effect (Haggard, Clark, & Kalogeras, 2002) as an implicit, quantitative measure related to sense of agency. We studied the time at which people perceived simple manual actions and their effects, when these actions were embedded in scenarios where their actions had unpredictable consequences that could be either moral or merely economic. We found an enhanced binding of effects back towards the actions that caused them, implying an enhanced sense of agency, in moral compared to non-moral contexts. We also found stronger binding for effects with severely negative, compared to moderately negative, values. A tight temporal association between action and effect may be a low-level phenomenal marker of the sense of responsibility. Copyright © 2011 Elsevier Inc. All rights reserved.
Meneses, Erick; Mittermaier, Anthony
2014-01-01
Much of our knowledge of protein binding pathways is derived from extremely stable complexes that interact very tightly, with lifetimes of hours to days. Much less is known about weaker interactions and transient complexes because these are challenging to characterize experimentally. Nevertheless, these types of interactions are ubiquitous in living systems. The combination of NMR relaxation dispersion Carr–Purcell–Meiboom–Gill (CPMG) experiments and isothermal titration calorimetry allows the quantification of rapid binding kinetics for complexes with submillisecond lifetimes that are difficult to study using conventional techniques. We have used this approach to investigate the binding pathway of the Src homology 3 (SH3) domain from the Fyn tyrosine kinase, which forms complexes with peptide targets whose lifetimes are on the order of about a millisecond. Long range electrostatic interactions have been shown to play a critical role in the binding pathways of tightly binding complexes. The role of electrostatics in the binding pathways of transient complexes is less well understood. Similarly to previously studied tight complexes, we find that SH3 domain association rates are enhanced by long range electrostatics, whereas short range interactions are formed late in the docking process. However, the extent of electrostatic association rate enhancement is several orders of magnitudes less, whereas the electrostatic-free basal association rate is significantly greater. Thus, the SH3 domain is far less reliant on electrostatic enhancement to achieve rapid association kinetics than are previously studied systems. This suggests that there may be overall differences in the role played by electrostatics in the binding pathways of extremely stable versus transient complexes. PMID:25122758
Real-Time Quantum Dynamics of Long-Range Electronic Excitation Transfer in Plasmonic Nanoantennas.
Ilawe, Niranjan V; Oviedo, M Belén; Wong, Bryan M
2017-08-08
Using large-scale, real-time, quantum dynamics calculations, we present a detailed analysis of electronic excitation transfer (EET) mechanisms in a multiparticle plasmonic nanoantenna system. Specifically, we utilize real-time, time-dependent, density functional tight binding (RT-TDDFTB) to provide a quantum-mechanical description (at an electronic/atomistic level of detail) for characterizing and analyzing these systems, without recourse to classical approximations. We also demonstrate highly long-range electronic couplings in these complex systems and find that the range of these couplings is more than twice the conventional cutoff limit considered by Förster resonance energy transfer (FRET)-based approaches. Furthermore, we attribute these unusually long-ranged electronic couplings to the coherent oscillations of conduction electrons in plasmonic nanoparticles. This long-range nature of plasmonic interactions has important ramifications for EET; in particular, we show that the commonly used "nearest-neighbor" FRET model is inadequate for accurately characterizing EET even in simple plasmonic antenna systems. These findings provide a real-time, quantum-mechanical perspective for understanding EET mechanisms and provide guidance in enhancing plasmonic properties in artificial light-harvesting systems.
Non-Hermitian bidirectional robust transport
NASA Astrophysics Data System (ADS)
Longhi, Stefano
2017-01-01
Transport of quantum or classical waves in open systems is known to be strongly affected by non-Hermitian terms that arise from an effective description of system-environment interaction. A simple and paradigmatic example of non-Hermitian transport, originally introduced by Hatano and Nelson two decades ago [N. Hatano and D. R. Nelson, Phys. Rev. Lett. 77, 570 (1996), 10.1103/PhysRevLett.77.570], is the hopping dynamics of a quantum particle on a one-dimensional tight-binding lattice in the presence of an imaginary vectorial potential. The imaginary gauge field can prevent Anderson localization via non-Hermitian delocalization, opening up a mobility region and realizing robust transport immune to disorder and backscattering. Like for robust transport of topologically protected edge states in quantum Hall and topological insulator systems, non-Hermitian robust transport in the Hatano-Nelson model is unidirectional. However, there is not any physical impediment to observe robust bidirectional non-Hermitian transport. Here it is shown that in a quasi-one-dimensional zigzag lattice, with non-Hermitian (imaginary) hopping amplitudes and a synthetic gauge field, robust transport immune to backscattering can occur bidirectionally along the lattice.
Hidden and antiferromagnetic order as a rank-5 superspin in URu2Si2
NASA Astrophysics Data System (ADS)
Rau, Jeffrey G.; Kee, Hae-Young
2012-06-01
We propose a candidate for the hidden order in URu2Si2: a rank-5 E type spin-density wave between uranium 5f crystal-field doublets Γ7(1) and Γ7(2), breaking time-reversal and lattice tetragonal symmetry in a manner consistent with recent torque measurements [Okazaki , ScienceSCIEAS0036-807510.1126/science.1197358 331, 439 (2011)]. We argue that coupling of this order parameter to magnetic probes can be hidden by crystal-field effects, while still having significant effects on transport, thermodynamics, and magnetic susceptibilities. In a simple tight-binding model for the heavy quasiparticles, we show the connection between the hidden order and antiferromagnetic phases arises since they form different components of this single rank-5 pseudospin vector. Using a phenomenological theory, we show that the experimental pressure-temperature phase diagram can be qualitatively reproduced by tuning terms which break pseudospin rotational symmetry. As a test of our proposal, we predict the presence of small magnetic moments in the basal plane oriented in the [110] direction ordered at the wave vector (0,0,1).
Wojciechowski, Michał; Różycki, Bartosz; Huy, Pham Dinh Quoc; Li, Mai Suan; Bayer, Edward A; Cieplak, Marek
2018-03-22
The assembly of the polysaccharide degradating cellulosome machinery is mediated by tight binding between cohesin and dockerin domains. We have used an empirical model known as FoldX as well as molecular mechanics methods to determine the free energy of binding between a cohesin and a dockerin from Clostridium thermocellum in two possible modes that differ by an approximately 180° rotation. Our studies suggest that the full-length wild-type complex exhibits dual binding at room temperature, i.e., the two modes of binding have comparable probabilities at equilibrium. The ability to bind in the two modes persists at elevated temperatures. However, single-point mutations or truncations of terminal segments in the dockerin result in shifting the equilibrium towards one of the binding modes. Our molecular dynamics simulations of mechanical stretching of the full-length wild-type cohesin-dockerin complex indicate that each mode of binding leads to two kinds of stretching pathways, which may be mistakenly taken as evidence of dual binding.
Shenoy, Siddharth S.; Nanda, Hirsh; Lösche, Mathias
2012-01-01
The phosphatidylinositolphosphate phosphatase PTEN is the second most frequently mutated protein in human tumors. Its membrane association, allosteric activation and membrane dissociation are poorly understood. We recently reported PTEN binding affinities to membranes of different compositions and a preliminary investigation of the protein-membrane complex with neutron reflectometry (NR). Here we use NR to validate molecular dynamics (MD) simulations of the protein and study conformational differences of the protein in solution and on anionic membranes. NR shows that full-length PTEN binds to such membranes roughly in the conformation and orientation suggested by the crystal structure of a truncated PTEN protein, in contrast with a recently presented model which suggested that membrane binding depends critically on the SUMOylation of the CBR3 loop of PTEN’s C2 domain. Our MD simulations confirm that PTEN is peripherally bound to the bilayer surface and show slight differences of the protein structure in solution and in the membrane-bound state, where the protein body flattens against the bilayer surface. PTEN’s C2 domain binds phosphatidylserine (PS) tightly through its CBR3 loop, and its phosphatase domain also forms electrostatic interactions with PS. NR and MD results show consistently that PTEN’s unstructured, anionic C-terminal tail is repelled from the bilayer surface. In contrast, this tail is tightly tugged against the C2 domain in solution, partially obstructing the membrane-binding interface of the protein. Arresting the C-terminal tail in this conformation by phosphorylation may provide a control mechanism for PTEN’s membrane binding and activity. PMID:23073177
Shenoy, Siddharth S; Nanda, Hirsh; Lösche, Mathias
2012-12-01
The phosphatidylinositolphosphate phosphatase PTEN is the second most frequently mutated protein in human tumors. Its membrane association, allosteric activation and membrane dissociation are poorly understood. We recently reported PTEN binding affinities to membranes of different compositions (Shenoy et al., 2012, PLoS ONE 7, e32591) and a preliminary investigation of the protein-membrane complex with neutron reflectometry (NR). Here we use NR to validate molecular dynamics (MD) simulations of the protein and study conformational differences of the protein in solution and on anionic membranes. NR shows that full-length PTEN binds to such membranes roughly in the conformation and orientation suggested by the crystal structure of a truncated PTEN protein, in contrast with a recently presented model which suggested that membrane binding depends critically on the SUMOylation of the CBR3 loop of PTEN's C2 domain. Our MD simulations confirm that PTEN is peripherally bound to the bilayer surface and show slight differences of the protein structure in solution and in the membrane-bound state, where the protein body flattens against the bilayer surface. PTEN's C2 domain binds phosphatidylserine (PS) tightly through its CBR3 loop, and its phosphatase domain also forms electrostatic interactions with PS. NR and MD results show consistently that PTEN's unstructured, anionic C-terminal tail is repelled from the bilayer surface. In contrast, this tail is tightly tugged against the C2 domain in solution, partially obstructing the membrane-binding interface of the protein. Arresting the C-terminal tail in this conformation by phosphorylation may provide a control mechanism for PTEN's membrane binding and activity. Copyright © 2012 Elsevier Inc. All rights reserved.
Quantum simulation of disordered systems with cold atoms
NASA Astrophysics Data System (ADS)
Garreau, Jean-Claude
2017-01-01
This paper reviews the physics of quantum disorder in relation with a series of experiments using laser-cooled atoms exposed to "kicks" of a standing wave, realizing a paradigmatic model of quantum chaos, the kicked rotor. This dynamical system can be mapped onto a tight-binding Hamiltonian with pseudo-disorder, formally equivalent to the Anderson model of quantum disorder, with quantum chaos playing the role of disorder. This provides a very good quantum simulator for the Anderson physics. xml:lang="fr"
Model of gas adsorption on magnetic surfaces
NASA Astrophysics Data System (ADS)
Pick, S.˛te˛´n.; D´, Hugues
1997-12-01
The semi-empirical self-consistent tight-binding model of gas (C, N, O) chemisorption is suggested to study its influence on surface magnetism. For the strongly ferromagnetic Fe(001), we find that the adsorbates are not effective in magnetism reduction. For the hypothetical magnetic V(001) surface, the magnetization is very sensitive to the vanadium d-band occupation used in the calculation. Supposing that the magnetization is weak, it can be essentially suppressed by the gas contamination. The effect is explained by the Stoner criterion.
Correspondence between a shaken honeycomb lattice and the Haldane model
NASA Astrophysics Data System (ADS)
Modugno, Michele; Pettini, Giulio
2017-11-01
We investigate the correspondence between the tight-binding Floquet Hamiltonian of a periodically modulated honeycomb lattice and the Haldane model. We show that—though the two systems share the same topological phase diagram, as reported in a breakthrough experiment with ultracold atoms in a stretched honeycomb lattice [G. Jotzu et al., Nature (London) 515, 237 (2014), 10.1038/nature13915]—the corresponding Hamiltonians are not equivalent, the one of the shaken lattice presenting a much richer structure.
A Computational Analysis of ATP Binding of SV40 Large Tumor Antigen Helicase Motor
Shi, Yemin; Liu, Hanbin; Gai, Dahai; Ma, Jianpeng; Chen, Xiaojiang S.
2009-01-01
Simian Virus 40 Large Tumor Antigen (LTag) is an efficient helicase motor that unwinds and translocates DNA. The DNA unwinding and translocation of LTag is powered by ATP binding and hydrolysis at the nucleotide pocket between two adjacent subunits of an LTag hexamer. Based on the set of high-resolution hexameric structures of LTag helicase in different nucleotide binding states, we simulated a conformational transition pathway of the ATP binding process using the targeted molecular dynamics method and calculated the corresponding energy profile using the linear response approximation (LRA) version of the semi-macroscopic Protein Dipoles Langevin Dipoles method (PDLD/S). The simulation results suggest a three-step process for the ATP binding from the initial interaction to the final tight binding at the nucleotide pocket, in which ATP is eventually “locked” by three pairs of charge-charge interactions across the pocket. Such a “cross-locking” ATP binding process is similar to the binding zipper model reported for the F1-ATPase hexameric motor. The simulation also shows a transition mechanism of Mg2+ coordination to form the Mg-ATP complex during ATP binding, which is accompanied by the large conformational changes of LTag. This simulation study of the ATP binding process to an LTag and the accompanying conformational changes in the context of a hexamer leads to a refined cooperative iris model that has been proposed previously. PMID:19779548
Tight-binding tunneling amplitude of an optical lattice
NASA Astrophysics Data System (ADS)
Arzamasovs, Maksims; Liu, Bo
2017-11-01
The particle in a periodic potential is an important topic in an undergraduate quantum mechanics curriculum and a stepping stone on the way to more advanced topics, such as courses on interacting electrons in crystalline solids, and graduate-level research in solid-state and condensed matter physics. The interacting many-body phenomena are usually described in terms of the second quantized lattice Hamiltonians which treat single-particle physics on the level of tight-binding approximation and add interactions on top of it. The aim of this paper is to show how the tight-binding tunneling amplitude can be related to the strength of the periodic potential for the case of a cosine potential used in the burgeoning field of ultracold atoms. We show how to approach the problem of computing the tunneling amplitude of a deep lattice using the JWKB (Jeffreys-Wentzel-Kramers-Brillouin, also known as semiclassical) approximation. We also point out that care should be taken when applying the method of the linear combination of atomic orbitals (LCAO) in an optical lattice context. A summary of the exact solution in terms of Mathieu functions is also given.
Statistical Mechanics of the US Supreme Court
NASA Astrophysics Data System (ADS)
Lee, Edward D.; Broedersz, Chase P.; Bialek, William
2015-07-01
We build simple models for the distribution of voting patterns in a group, using the Supreme Court of the United States as an example. The maximum entropy model consistent with the observed pairwise correlations among justices' votes, an Ising spin glass, agrees quantitatively with the data. While all correlations (perhaps surprisingly) are positive, the effective pairwise interactions in the spin glass model have both signs, recovering the intuition that ideologically opposite justices negatively influence each another. Despite the competing interactions, a strong tendency toward unanimity emerges from the model, organizing the voting patterns in a relatively simple "energy landscape." Besides unanimity, other energy minima in this landscape, or maxima in probability, correspond to prototypical voting states, such as the ideological split or a tightly correlated, conservative core. The model correctly predicts the correlation of justices with the majority and gives us a measure of their influence on the majority decision. These results suggest that simple models, grounded in statistical physics, can capture essential features of collective decision making quantitatively, even in a complex political context.
De Benedetti, Pier G; Fanelli, Francesca
2018-03-21
Simple comparative correlation analyses and quantitative structure-kinetics relationship (QSKR) models highlight the interplay of kinetic rates and binding affinity as an essential feature in drug design and discovery. The choice of the molecular series, and their structural variations, used in QSKR modeling is fundamental to understanding the mechanistic implications of ligand and/or drug-target binding and/or unbinding processes. Here, we discuss the implications of linear correlations between kinetic rates and binding affinity constants and the relevance of the computational approaches to QSKR modeling. Copyright © 2018 Elsevier Ltd. All rights reserved.
Current's Fluctuations through Molecular Wires Composed of Thiophene Rings.
Ojeda Silva, Judith Helena; Cortés Peñaranda, Juan Camilo; Gómez Castaño, Jovanny A; Duque, Carlos Alberto
2018-04-11
We study theoretically the electronic transport and quantum fluctuations in single-molecule systems using thiophene rings as integrated elementary functions, as well as the dependence of these properties with the increase of the coupled rings, i.e., as a quantum wire. In order to analyze the current flow through these molecular systems, the thiophene rings are considered to be connected to metal contacts, which, in general terms, will be related to the application of voltages (bias voltages or gate voltages) to generate non-equilibrium behavior between the contacts. Due to the nonlinear behavior that is generated when said voltages are applied, it is possible to observe quantum fluctuations in the transport properties of these molecular wires. For the calculation of the transport properties, we applied a tight-binding approach using the Landauer-Büttiker formalism and the Fischer-Lee relationship, by means of a semi-analytic Green's function method within a real-space renormalization (decimation procedure). Our results showed an excellent agreement with results using a tight-binding model with a minimal number of parameters reported so far for these molecular systems.
Landau level splitting due to graphene superlattices
NASA Astrophysics Data System (ADS)
Pal, G.; Apel, W.; Schweitzer, L.
2012-06-01
The Landau level spectrum of graphene superlattices is studied using a tight-binding approach. We consider noninteracting particles moving on a hexagonal lattice with an additional one-dimensional superlattice made up of periodic square potential barriers, which are oriented along the zigzag or along the armchair directions of graphene. In the presence of a perpendicular magnetic field, such systems can be described by a set of one-dimensional tight-binding equations, the Harper equations. The qualitative behavior of the energy spectrum with respect to the strength of the superlattice potential depends on the relation between the superlattice period and the magnetic length. When the potential barriers are oriented along the armchair direction of graphene, we find for strong magnetic fields that the zeroth Landau level of graphene splits into two well-separated sublevels, if the width of the barriers is smaller than the magnetic length. In this situation, which persists even in the presence of disorder, a plateau with zero Hall conductivity can be observed around the Dirac point. This Landau level splitting is a true lattice effect that cannot be obtained from the generally used continuum Dirac-fermion model.
Diffraction catastrophes and semiclassical quantum mechanics for Veselago lensing in graphene
NASA Astrophysics Data System (ADS)
Reijnders, K. J. A.; Katsnelson, M. I.
2017-07-01
We study the effect of trigonal warping on the focusing of electrons by n-p junctions in graphene. We find that perfect focusing, which was predicted for massless Dirac fermions, is only preserved for one specific lattice orientation. In the general case, trigonal warping leads to the formation of cusp caustics, with a different position of the focus for graphene's two valleys. We develop a semiclassical theory to compute these positions and find very good agreement with tight-binding simulations. Considering the transmission as a function of potential strength, we find that trigonal warping splits the single Dirac peak into two distinct peaks, leading to valley polarization. We obtain the transmission curves from tight-binding simulations and find that they are in very good agreement with the results of a billiard model that incorporates trigonal warping. Furthermore, the positions of the transmission maxima and the scaling of the peak width are accurately predicted by our semiclassical theory. Our semiclassical analysis can easily be carried over to other Dirac materials, which generally have different Fermi surface distortions.
Topological states in a two-dimensional metal alloy in Si surface: BiAg/Si(111)-4 ×4 surface
NASA Astrophysics Data System (ADS)
Zhang, Xiaoming; Cui, Bin; Zhao, Mingwen; Liu, Feng
2018-02-01
A bridging topological state with a conventional semiconductor platform offers an attractive route towards future spintronics and quantum device applications. Here, based on first-principles and tight-binding calculations, we demonstrate the existence of topological states hosted by a two-dimensional (2D) metal alloy in a Si surface, the BiAg/Si(111)-4 ×4 surface, which has already been synthesized experimentally. It exhibits a topological insulating state with an energy gap of 71 meV (˜819 K ) above the Fermi level and a topological metallic state with quasiquantized conductance below the Fermi level. The underlying mechanism leading to the formation of such nontrivial states is revealed by analysis of the "charge-transfer" and "orbital-filtering" effect of the Si substrate. A minimal effective tight-binding model is employed to reveal the formation mechanism of the topological states. Our finding opens opportunities to detect topological states and measure its quantized conductance in a large family of 2D surface metal alloys, which have been or are to be grown on semiconductor substrates.
First-principles simulation and low-energy effective modeling of three-dimensional skyrmion in MnGe
NASA Astrophysics Data System (ADS)
Choi, Hongchul; Tai, Yuan-Yen; Zhu, Jian-Xin; T-4 Team
The skyrmion spin textures are mostly observed in two-dimensional (2D) space, which can be topologically mapped onto the surface of the sphere with an integer multiple of topological winding number. Recently, MnGe has been reported as a candidate of 3D skyrmion crystal, showing the variation of the skyrmion size along the z-direction. We have performed the first-principles simulation and constructed a tight-binding model with calculated electronic-structure information to investigate the 3D skyrmion phase in MnGe. Our first-principles study within density functional theory shows that the calculated magnetic moment is larger than that for MnSi (with different lattice constant), implying the possibility of a multiple magnetic transition under pressure. We have also found that the small-sized skyrmion could be stabilized in a 2D structure. Such a high density of the skyrmion is in good agreement with the experimental finding of large topological Hall effect. Finally, we will extend our study to consider the 3D skyrmion structure based on the constructed tight-binding model. This work was carried out under the auspices of the National Nuclear Security Administration of the U.S. Department of Energy at Los Alamos National Laboratory (LANL) under Contract No. DE-AC52-06NA25396, and was supported by the LANL LDRD Program.
Dynamic docking and electron transfer between Zn-myoglobin and cytochrome b(5).
Liang, Zhao-Xun; Nocek, Judith M; Huang, Kai; Hayes, Ryan T; Kurnikov, Igor V; Beratan, David N; Hoffman, Brian M
2002-06-19
We present a broad study of the effect of neutralizing the two negative charges of the Mb propionates on the interaction and electron transfer (ET) between horse Mb and bovine cyt b(5), through use of Zn-substituted Mb (ZnMb, 1) to study the photoinitiated reaction, ((3)ZnP)Mb + Fe(3+)cyt b(5) --> (ZnP)(+)Mb + Fe(2+)cyt b(5). The charge neutralization has been carried out both by replacing the Mb heme with zinc-deuteroporphyrin dimethylester (ZnMb(dme), 2), which replaces the charges by small neutral hydrophobic patches, and also by replacement with the newly prepared zinc-deuteroporphyrin diamide (ZnMb(diamide), 3), which converts the charged groups to neutral, hydrophilic ones. The effect of propionate neutralization on the conformation of the zinc-porphyrin in the Mb heme pocket has been studied by multinuclear NMR with an (15)N labeled zinc porphyrin derivative (ZnMb((15)N-diamide), 4). The rates of photoinitiated ET between the Mb's (1-3) and cyt b(5) have been measured over a range of pH values and ionic strengths. Isothermal titration calorimetry (ITC) and NMR methods have been used to independently investigate the effect of charge neutralization on Mb/b(5) binding. The neutralization of the two heme propionates of ZnMb by formation of the heme diester or, for the first time, the diamide increases the second-order rate constant of the ET reaction between ZnMb and cyt b(5) by as much as several 100-fold, depending on pH and ionic strength, while causing negligible changes in binding affinity. Brownian dynamic (BD) simulations and ET pathway calculations provide insight into the protein docking and ET process. The results support a new "dynamic docking" paradigm for protein-protein reactions in which numerous weakly bound conformations of the docked complex contribute to the binding of cyt b(5) to Mb and Hb, but only a very small subset of these are ET active, and this subset does not include the conformations most favorable for binding; the Mb surface is a large "target" with a small "bullseye" for the cyt b(5) "arrow". This paradigm differs sharply from the more familiar, "simple" docking within a single, or narrow range of conformations, where binding strength and ET reactivity increase in parallel. Likewise, it is distinct from, although complementary to, the well-known picture of conformational control of ET through "gating", or a related picture of "conformational coupling". The new model describes situations in which tight binding does not correlate with efficient ET reactivity, and explains how it is possible to modulate reactivity without changing affinity. Such "decoupling" of reactivity from binding clearly is of physiological relevance for the reduction of met-Mb in muscle and of met-Hb in a red cell, where tight binding of cyt b(5) to the high concentration of ferrous-Mb/Hb would prevent the cytochrome from finding and reducing the oxidized proteins; it likely is of physiological relevance in other situations, as well.
A small cellulose binding domain protein (CBD1) is highly variable in the nonbinding amino terminus
USDA-ARS?s Scientific Manuscript database
The small cellulose binding domain protein CBD1 is tightly bound to the cellulosic cell wall of the plant pathogenic stramenophile Phytophthora infestans. Transgene expression of the protein in plants has also demonstrated binding to plant cell walls. A study was undertaken using 47 isolates of P. ...
Rationalizing Tight Ligand Binding through Cooperative Interaction Networks
2011-01-01
Small modifications of the molecular structure of a ligand sometimes cause strong gains in binding affinity to a protein target, rendering a weakly active chemical series suddenly attractive for further optimization. Our goal in this study is to better rationalize and predict the occurrence of such interaction hot-spots in receptor binding sites. To this end, we introduce two new concepts into the computational description of molecular recognition. First, we take a broader view of noncovalent interactions and describe protein–ligand binding with a comprehensive set of favorable and unfavorable contact types, including for example halogen bonding and orthogonal multipolar interactions. Second, we go beyond the commonly used pairwise additive treatment of atomic interactions and use a small world network approach to describe how interactions are modulated by their environment. This approach allows us to capture local cooperativity effects and considerably improves the performance of a newly derived empirical scoring function, ScorpionScore. More importantly, however, we demonstrate how an intuitive visualization of key intermolecular interactions, interaction networks, and binding hot-spots supports the identification and rationalization of tight ligand binding. PMID:22087588
First Experimental Realization of the Dirac Oscillator
NASA Astrophysics Data System (ADS)
Franco-Villafañe, J. A.; Sadurní, E.; Barkhofen, S.; Kuhl, U.; Mortessagne, F.; Seligman, T. H.
2013-10-01
We present the first experimental microwave realization of the one-dimensional Dirac oscillator, a paradigm in exactly solvable relativistic systems. The experiment relies on a relation of the Dirac oscillator to a corresponding tight-binding system. This tight-binding system is implemented as a microwave system by a chain of coupled dielectric disks, where the coupling is evanescent and can be adjusted appropriately. The resonances of the finite microwave system yield the spectrum of the one-dimensional Dirac oscillator with and without a mass term. The flexibility of the experimental setup allows the implementation of other one-dimensional Dirac-type equations.
NASA Astrophysics Data System (ADS)
Hourahine, B.; Aradi, B.; Frauenheim, T.
2010-07-01
DFTB+ is a recent general purpose implementation of density-functional based tight binding. One of the early motivators to develop this code was to investigate lanthanide impurities in nitride semiconductors, leading to a series of successful studies into structure and electrical properties of these systems. Here we describe our general framework to treat the physical effects needed for these problematic impurities within a tight-binding formalism, additionally discussing forces and stresses in DFTB. We also present an approach to evaluate the general case of Slater-Koster transforms and all of their derivatives in Cartesian coordinates. These developments are illustrated by simulating isolated Gd impurities in GaN.
NASA Astrophysics Data System (ADS)
Dumitrica, Traian; Hourahine, Ben; Aradi, Balint; Frauenheim, Thomas
We discus the coupling of the objective boundary conditions into the SCC density functional-based tight binding code DFTB+. The implementation is enabled by a generalization to the helical case of the classical Ewald method, specifically by Ewald-like formulas that do not rely on a unit cell with translational symmetry. The robustness of the method in addressing complex hetero-nuclear nano- and bio-fibrous systems is demonstrated with illustrative simulations on a helical boron nitride nanotube, a screw dislocated zinc oxide nanowire, and an ideal double-strand DNA. Work supported by NSF CMMI 1332228.
Scattering matrix of arbitrary tight-binding Hamiltonians
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ramírez, C., E-mail: carlos@ciencias.unam.mx; Medina-Amayo, L.A.
2017-03-15
A novel efficient method to calculate the scattering matrix (SM) of arbitrary tight-binding Hamiltonians is proposed, including cases with multiterminal structures. In particular, the SM of two kinds of fundamental structures is given, which can be used to obtain the SM of bigger systems iteratively. Also, a procedure to obtain the SM of layer-composed periodic leads is described. This method allows renormalization approaches, which permits computations over macroscopic length systems without introducing additional approximations. Finally, the transmission coefficient of a ring-shaped multiterminal system and the transmission function of a square-lattice nanoribbon with a reduced width region are calculated.
Slaughter, Brian D.; Bieber Urbauer, Ramona J.; Urbauer, Jeffrey L.; Johnson, Carey K.
2008-01-01
Calmodulin (CaM) binds to a domain near the C-terminus of the plasma-membrane Ca2+-ATPase (PMCA), causing the release of this domain and relief of its autoinhibitory function. We investigated the kinetics of dissociation and binding of Ca2+-CaM with a 28-residue peptide (C28W(1b)) corresponding to the CaM binding domain of isoform 1b of PMCA. CaM was labeled with a fluorescent probe on either the N-terminal domain at residue 34 or on the C-terminal domain at residue 110. Formation of complexes of CaM with C28W(1b) results in a decrease in the fluorescence yield of the fluorophore, allowing the kinetics of dissociation or binding to be detected. Using a maximum entropy method, we determined the minimum number and magnitudes of rate constants required to fit the data. Comparison of the fluorescence changes for CaM labeled on the C-terminal or N-terminal domain suggests sequential and ordered binding of the C-terminal and N-terminal domains of CaM with C28W(1b). For dissociation of C28W(1b) from CaM labeled on the N-terminal domain, we observed three time constants, indicating the presence of two intermediate states in the dissociation pathway. However, for CaM labeled on the C-terminal domain, we observed only two time constants, suggesting that the fluorescence label on the C-terminal domain was not sensitive to one of the kinetic steps. The results were modeled by a kinetic mechanism where an initial complex forms upon binding of the C-terminal domain of CaM to C28W(1b), followed by binding of the N-terminal domain, and then formation of a tight binding complex. Oxidation of methionine residues in CaM resulted in significant perturbations to the binding kinetics. The rate of formation of a tight binding complex was reduced, consistent with the lower effectiveness of oxidized CaM in activating the Ca2+ pump. PMID:17343368
Carbon Nanotube Field Emission Arrays
2011-06-01
K , and M [14]. Using the tight binding energy model, the energy dispersion relations for graphene can be calculated for the triangle formed from...The corresponding reciprocal lattice vectors, b1 and b2, and Brillouin zone of graphene [14]. 19 graphene band structure is the six K ...points where the two bands are degenerate and the Fermi level passes. It has been shown through thorough calculations that at T = 0 K , the density
Various Stone-Wales defects in phagraphene
NASA Astrophysics Data System (ADS)
Openov, L. A.; Podlivaev, A. I.
2016-08-01
Various Stone-Wales defects in phagraphene, which is a graphene allotrope, predicted recently are studied in terms of the nonorthogonal tight-binding model. The energies of the defect formation and the heights of energy barriers preventing the formation and annealing of the defects are found. Corresponding frequency factors in the Arrhenius formula are calculated. The evolution of the defect structure is studied in the real-time mode using the molecular dynamics method.
Franchini, C; Kováčik, R; Marsman, M; Murthy, S Sathyanarayana; He, J; Ederer, C; Kresse, G
2012-06-13
Using the newly developed VASP2WANNIER90 interface we have constructed maximally localized Wannier functions (MLWFs) for the e(g) states of the prototypical Jahn-Teller magnetic perovskite LaMnO(3) at different levels of approximation for the exchange-correlation kernel. These include conventional density functional theory (DFT) with and without the additional on-site Hubbard U term, hybrid DFT and partially self-consistent GW. By suitably mapping the MLWFs onto an effective e(g) tight-binding (TB) Hamiltonian we have computed a complete set of TB parameters which should serve as guidance for more elaborate treatments of correlation effects in effective Hamiltonian-based approaches. The method-dependent changes of the calculated TB parameters and their interplay with the electron-electron (el-el) interaction term are discussed and interpreted. We discuss two alternative model parameterizations: one in which the effects of the el-el interaction are implicitly incorporated in the otherwise 'noninteracting' TB parameters and a second where we include an explicit mean-field el-el interaction term in the TB Hamiltonian. Both models yield a set of tabulated TB parameters which provide the band dispersion in excellent agreement with the underlying ab initio and MLWF bands.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hussain, Zahid; Brouet, Veronique; Yang, Wanli
2008-01-16
We present a detailed angle-resolved photoemission spectroscopy (ARPES) investigation of the RTe3 family, which sets this system as an ideal"textbook" example for the formation of a nesting driven charge density wave (CDW). This family indeed exhibits the full range of phenomena that can be associated to CDWinstabilities, from the opening of large gaps on the best nested parts of Fermi surface (up to 0.4 eV), to the existence of residual metallic pockets. ARPES is the best suited technique to characterize these features, thanks to its unique ability to resolve the electronic structure in k space. An additional advantage of RTe3more » is that theband structure can be very accurately described by a simple two dimensional tight-binding (TB) model, which allows one to understand and easily reproduce many characteristics of the CDW. In this paper, we first establish the main features of the electronic structure by comparing our ARPES measurements with the linear muffin-tinorbital band calculations. We use this to define the validity and limits of the TB model. We then present a complete description of the CDW properties and of their strong evolution as a function of R. Using simple models, we are able to reproduce perfectly the evolution of gaps in k space, the evolution of the CDW wave vector with R, and the shape of the residual metallic pockets. Finally, we give an estimation of the CDWinteraction parameters and find that the change in the electronic density of states n (EF), due to lattice expansion when different R ions are inserted, has the correct order of magnitude to explain the evolution of the CDW properties.« less
Kumar, Rakesh; Maurya, Ranjana; Saran, Shweta
2018-02-23
Prostate cancer (PC) is one of the leading cancers in men, raising a serious health issue worldwide. Due to lack of suitable biomarker, their inhibitors and the platform for testing those inhibitors result in poor prognosis of PC. AMP-activated protein kinase (AMPK) is a highly conserved protein kinase found in eukaryotes that is involved in growth and development, and also acts as a therapeutic target for PC. The aim of the present study is to identify novel potent inhibitors of AMPK and propose a simple cellular model system for understanding its biology. Structural modelling and MD simulations were performed to construct and refine the 3D models of Dictyostelium and human AMPK. Binding mechanisms of different drug compounds were studied by performing molecular docking, molecular dynamics and MM-PBSA methods. Two novel drugs were isolated having higher binding affinity over the known drugs and hydrophobic forces that played a key role during protein-ligand interactions. The study also explored the simple cellular model system for drug screening and understanding the biology of a therapeutic target by performing in vitro experiments.
Lee, Wonbae; Gillies, John P.; Jose, Davis; Israels, Brett A.; von Hippel, Peter H.; Marcus, Andrew H.
2016-01-01
Gene 32 protein (gp32) is the single-stranded (ss) DNA binding protein of the bacteriophage T4. It binds transiently and cooperatively to ssDNA sequences exposed during the DNA replication process and regulates the interactions of the other sub-assemblies of the replication complex during the replication cycle. We here use single-molecule FRET techniques to build on previous thermodynamic studies of gp32 binding to initiate studies of the dynamics of the isolated and cooperative binding of gp32 molecules within the replication complex. DNA primer/template (p/t) constructs are used as models to determine the effects of ssDNA lattice length, gp32 concentration, salt concentration, binding cooperativity and binding polarity at p/t junctions. Hidden Markov models (HMMs) and transition density plots (TDPs) are used to characterize the dynamics of the multi-step assembly pathway of gp32 at p/t junctions of differing polarity, and show that isolated gp32 molecules bind to their ssDNA targets weakly and dissociate quickly, while cooperatively bound dimeric or trimeric clusters of gp32 bind much more tightly, can ‘slide’ on ssDNA sequences, and exhibit binding dynamics that depend on p/t junction polarities. The potential relationships of these binding dynamics to interactions with other components of the T4 DNA replication complex are discussed. PMID:27694621
NASA Astrophysics Data System (ADS)
Aizawa, H.; Kuroki, K.; Yasuzuka, S.; Yamada, J.
2012-11-01
We perform a first-principles band calculation for a group of quasi-two-dimensional organic conductors β-(BDA-TTP)2MF6 (M = P, As, Sb and Ta). The ab-initio calculation shows that the density of states is correlated with the bandwidth of the singly occupied (highest) molecular orbital, while it is not necessarily correlated with the unit-cell volume. The direction of the major axis of the cross section of the Fermi surface lies in the Γ-B-direction, which differs from that obtained by the extended Hückel calculation. Then, we construct a tight-binding model which accurately reproduces the ab-initio band structure. The obtained transfer energies give a smaller dimerization than in the extended Hückel band. As to the difference in the anisotropy of the Fermi surface, the transfer energies along the inter-stacking direction are smaller than those obtained in the extended Hückel calculation. Assuming spin-fluctuation-mediated superconductivity, we apply random phase approximation to a two-band Hubbard model. This two-band Hubbard model is composed of the tight-binding model derived from the first-principles band structure and an on-site (intra-molecule) repulsive interaction taken as a variable parameter. The obtained superconducting gap changes sign four times along the Fermi surface like in a d-wave gap, and the nodal direction is different from that obtained in the extended Hückel model. Anion dependence of Tc is qualitatively consistent with the experimental observation.
Interface Schottky barrier engineering via strain in metal-semiconductor composites
NASA Astrophysics Data System (ADS)
Ma, Xiangchao; Dai, Ying; Yu, Lin; Huang, Baibiao
2016-01-01
The interfacial carrier transfer property, which is dominated by the interface Schottky barrier height (SBH), plays a crucial role in determining the performance of metal-semiconductor heterostructures in a variety of applications. Therefore, artificially controlling the interface SBH is of great importance for their industrial applications. As a model system, the Au/TiO2 (001) heterostructure is studied using first-principles calculations and the tight-binding method in the present study. Our investigation demonstrates that strain can be an effective way to decrease the interface SBH and that the n-type SBH can be more effectively decreased than the p-type SBH. Astonishingly, strain affects the interface SBH mainly by changing the intrinsic properties of Au and TiO2, whereas the interfacial potential alignment is almost independent of strain due to two opposite effects, which are induced by strain at the interfacial region. These observed trends can be understood on the basis of the general free-electron gas model of typical metals, the tight-binding theory and the crystal-field theory, which suggest that similar trends may be generalized for many other metal-semiconductor heterostructures. Given the commonness and tunability of strain in typical heterostructures, we anticipate that the tunability of the interface SBH with strain described here can provide an alternative effective way for realizing more efficient applications of relevant heterostructures.The interfacial carrier transfer property, which is dominated by the interface Schottky barrier height (SBH), plays a crucial role in determining the performance of metal-semiconductor heterostructures in a variety of applications. Therefore, artificially controlling the interface SBH is of great importance for their industrial applications. As a model system, the Au/TiO2 (001) heterostructure is studied using first-principles calculations and the tight-binding method in the present study. Our investigation demonstrates that strain can be an effective way to decrease the interface SBH and that the n-type SBH can be more effectively decreased than the p-type SBH. Astonishingly, strain affects the interface SBH mainly by changing the intrinsic properties of Au and TiO2, whereas the interfacial potential alignment is almost independent of strain due to two opposite effects, which are induced by strain at the interfacial region. These observed trends can be understood on the basis of the general free-electron gas model of typical metals, the tight-binding theory and the crystal-field theory, which suggest that similar trends may be generalized for many other metal-semiconductor heterostructures. Given the commonness and tunability of strain in typical heterostructures, we anticipate that the tunability of the interface SBH with strain described here can provide an alternative effective way for realizing more efficient applications of relevant heterostructures. Electronic supplementary information (ESI) available: The changes of Au 5d DOS, valence bands of TiO2, the interfacial bond length and interfacial energy with strain, and the local DOS results for the change of SBH with strain. See DOI: 10.1039/c5nr05583k
A Comprehensive Numerical Model for Simulating Fluid Transport in Nanopores
Zhang, Yuan; Yu, Wei; Sepehrnoori, Kamy; Di, Yuan
2017-01-01
Since a large amount of nanopores exist in tight oil reservoirs, fluid transport in nanopores is complex due to large capillary pressure. Recent studies only focus on the effect of nanopore confinement on single-well performance with simple planar fractures in tight oil reservoirs. Its impacts on multi-well performance with complex fracture geometries have not been reported. In this study, a numerical model was developed to investigate the effect of confined phase behavior on cumulative oil and gas production of four horizontal wells with different fracture geometries. Its pore sizes were divided into five regions based on nanopore size distribution. Then, fluid properties were evaluated under different levels of capillary pressure using Peng-Robinson equation of state. Afterwards, an efficient approach of Embedded Discrete Fracture Model (EDFM) was applied to explicitly model hydraulic and natural fractures in the reservoirs. Finally, three fracture geometries, i.e. non-planar hydraulic fractures, non-planar hydraulic fractures with one set natural fractures, and non-planar hydraulic fractures with two sets natural fractures, are evaluated. The multi-well performance with confined phase behavior is analyzed with permeabilities of 0.01 md and 0.1 md. This work improves the analysis of capillarity effect on multi-well performance with complex fracture geometries in tight oil reservoirs. PMID:28091599
A Comprehensive Numerical Model for Simulating Fluid Transport in Nanopores
NASA Astrophysics Data System (ADS)
Zhang, Yuan; Yu, Wei; Sepehrnoori, Kamy; di, Yuan
2017-01-01
Since a large amount of nanopores exist in tight oil reservoirs, fluid transport in nanopores is complex due to large capillary pressure. Recent studies only focus on the effect of nanopore confinement on single-well performance with simple planar fractures in tight oil reservoirs. Its impacts on multi-well performance with complex fracture geometries have not been reported. In this study, a numerical model was developed to investigate the effect of confined phase behavior on cumulative oil and gas production of four horizontal wells with different fracture geometries. Its pore sizes were divided into five regions based on nanopore size distribution. Then, fluid properties were evaluated under different levels of capillary pressure using Peng-Robinson equation of state. Afterwards, an efficient approach of Embedded Discrete Fracture Model (EDFM) was applied to explicitly model hydraulic and natural fractures in the reservoirs. Finally, three fracture geometries, i.e. non-planar hydraulic fractures, non-planar hydraulic fractures with one set natural fractures, and non-planar hydraulic fractures with two sets natural fractures, are evaluated. The multi-well performance with confined phase behavior is analyzed with permeabilities of 0.01 md and 0.1 md. This work improves the analysis of capillarity effect on multi-well performance with complex fracture geometries in tight oil reservoirs.
Design of graphene nanoparticle undergoing axial compression: quantum study
NASA Astrophysics Data System (ADS)
Glukhova, O. E.; Kirillova, I. V.; Saliy, I. N.; Kolesnikova, A. S.; Slepchenkov, M. M.
2011-03-01
We report the results of quantum mechanical investigations of the atomic structure and deformations of graphene nanoparticle undergoing axial compression. We applied the tight-binding (TB) method. Our transferable tightbinding potential correctly reproduced tight-binding changes in the electronic configuration as a function of the local bonding geometry around each carbon atom. The tight-binding method applied provided the consideration and calculation of the rehybridization between σ- and π-orbitals. To research nanoribbons using tight-binding potential our own program was used. We adapted TB method to be able to run the algorithm on a parallel computing machine (computer cluster). To simulate axial compression of graphene nanoparticles the atoms on the ends were fixed on the plates. The plates were moved towards each other to decrease the length at some percent. Plane atomic network undergoing axial compression became wave-like. The amplitude of wave and its period were not constant and changed along axis. This is a phase transition. The strain energy collapse occurs at the value of axial compression 0.03-0.04. The strain energy increased up to the quantity compression 0.03, then collapsed sharply and decreased. So according to our theoretical investigation, the elasticity of graphene nanoparticles is more than the elasticity of nanotubes the same width and length. The curvature of the atomic network because of compression will decrease the reactivity of graphene nanoparticles. We have calculated the atomic structure and electronic structure of the compression graphene nanopaticle at each step of strain of axial compression. We have come to the conclusion that the wave-like graphenes adsorbing protein and nucleic acid are the effective nanosensors and bionanosensors.
Selection Shapes Transcriptional Logic and Regulatory Specialization in Genetic Networks
Fogelmark, Karl; Peterson, Carsten; Troein, Carl
2016-01-01
Background Living organisms need to regulate their gene expression in response to environmental signals and internal cues. This is a computational task where genes act as logic gates that connect to form transcriptional networks, which are shaped at all scales by evolution. Large-scale mutations such as gene duplications and deletions add and remove network components, whereas smaller mutations alter the connections between them. Selection determines what mutations are accepted, but its importance for shaping the resulting networks has been debated. Methodology To investigate the effects of selection in the shaping of transcriptional networks, we derive transcriptional logic from a combinatorially powerful yet tractable model of the binding between DNA and transcription factors. By evolving the resulting networks based on their ability to function as either a simple decision system or a circadian clock, we obtain information on the regulation and logic rules encoded in functional transcriptional networks. Comparisons are made between networks evolved for different functions, as well as with structurally equivalent but non-functional (neutrally evolved) networks, and predictions are validated against the transcriptional network of E. coli. Principal Findings We find that the logic rules governing gene expression depend on the function performed by the network. Unlike the decision systems, the circadian clocks show strong cooperative binding and negative regulation, which achieves tight temporal control of gene expression. Furthermore, we find that transcription factors act preferentially as either activators or repressors, both when binding multiple sites for a single target gene and globally in the transcriptional networks. This separation into positive and negative regulators requires gene duplications, which highlights the interplay between mutation and selection in shaping the transcriptional networks. PMID:26927540
Functionalized Fullerene Targeting Human Voltage-Gated Sodium Channel, hNav1.7.
Hilder, Tamsyn A; Robinson, Anna; Chung, Shin-Ho
2017-08-16
Mutations of hNa v 1.7 that cause its activities to be enhanced contribute to severe neuropathic pain. Only a small number of hNa v 1.7 specific inhibitors have been identified, most of which interact with the voltage-sensing domain of the voltage-activated sodium ion channel. In our previous computational study, we demonstrated that a [Lys 6 ]-C 84 fullerene binds tightly (affinity of 46 nM) to Na v Ab, the voltage-gated sodium channel from the bacterium Arcobacter butzleri. Here, we extend this work and, using molecular dynamics simulations, demonstrate that the same [Lys 6 ]-C 84 fullerene binds strongly (2.7 nM) to the pore of a modeled human sodium ion channel hNa v 1.7. In contrast, the fullerene binds only weakly to a mutated model of hNa v 1.7 (I1399D) (14.5 mM) and a model of the skeletal muscle hNa v 1.4 (3.7 mM). Comparison of one representative sequence from each of the nine human sodium channel isoforms shows that only hNa v 1.7 possesses residues that are critical for binding the fullerene derivative and blocking the channel pore.
How the Mott and pseudogap states coalesce beneath the superconductor Dome
NASA Astrophysics Data System (ADS)
Cabo Montes de Oca, Alejandro; Cabo-Bizet, Alejandro; Martinez, Victor; Vielza, Yoandri; Collaboration Team Team
Former results of a Tight-Binding (TB) model of CuO planes in La2CuO4 are reviewed to underline their wider implications. It is noted that physical systems being appropriately described by the TB model can exhibit the main strongly correlated electron system (SCES) properties, when they are solved in the HF approximation, by also allowing crystal symmetry breaking effects and non-collinear spin orientations of the HF orbitals. In particular, it is argued how a simple 2D square lattice system of Coulomb interacting electrons can exhibit insulator gaps and pseudogap states, and quantum phase transitions as illustrated by the mentioned former works. These results allow to understand the nature of the observed quantum phase transition laying ``beneath'' the superconducting Dome. It corresponds to coalescence under hole doping increase, of an insulator ground state (with a highly degenerated spin order) with an excited pseudogap state, showing a lattice order symmetry breaking. The evolution of the band structure and Fermi surface with doping are determined. This abstract is associated to an invited talk of the March Meeting after being accepted. If it is not accepted as talk, we request to be considered as an oral presentation. The argue for it is in the invited talk application (Session Ctrl #:97854).
Botulinum neurotoxin: a marvel of protein design.
Montal, Mauricio
2010-01-01
Botulinum neurotoxin (BoNT), the causative agent of botulism, is acknowledged to be the most poisonous protein known. BoNT proteases disable synaptic vesicle exocytosis by cleaving their cytosolic SNARE (soluble NSF attachment protein receptor) substrates. BoNT is a modular nanomachine: an N-terminal Zn(2+)-metalloprotease, which cleaves the SNAREs; a central helical protein-conducting channel, which chaperones the protease across endosomes; and a C-terminal receptor-binding module, consisting of two subdomains that determine target specificity by binding to a ganglioside and a protein receptor on the cell surface and triggering endocytosis. For BoNT, functional complexity emerges from its modular design and the tight interplay between its component modules--a partnership with consequences that surpass the simple sum of the individual component's action. BoNTs exploit this design at each step of the intoxication process, thereby achieving an exquisite toxicity. This review summarizes current knowledge on the structure of individual modules and presents mechanistic insights into how this protein machine evolved to this level of sophistication. Understanding the design principles underpinning the function of such a dynamic modular protein remains a challenging task.
Loose coupling in the bacterial flagellar motor
Boschert, Ryan; Adler, Frederick R.; Blair, David F.
2015-01-01
Physiological properties of the flagellar rotary motor have been taken to indicate a tightly coupled mechanism in which each revolution is driven by a fixed number of energizing ions. Measurements that would directly test the tight-coupling hypothesis have not been made. Energizing ions flow through membrane-bound complexes formed from the proteins MotA and MotB, which are anchored to the cell wall and constitute the stator. Genetic and biochemical evidence points to a “power stroke” mechanism in which the ions interact with an aspartate residue of MotB to drive conformational changes in MotA that are transmitted to the rotor protein FliG. Each stator complex contains two separate ion-binding sites, raising the question of whether the power stroke is driven by one, two, or either number of ions. Here, we describe simulations of a model in which the conformational change can be driven by either one or two ions. This loosely coupled model can account for the observed physiological properties of the motor, including those that have been taken to indicate tight coupling; it also accords with recent measurements of motor torque at high load that are harder to explain in tight-coupling models. Under loads relevant to a swimming cell, the loosely coupled motor would perform about as well as a two-proton motor and significantly better than a one-proton motor. The loosely coupled motor is predicted to be especially advantageous under conditions of diminished energy supply, or of reduced temperature, turning faster than an obligatorily two-proton motor while using fewer ions. PMID:25825730
NASA Astrophysics Data System (ADS)
Drechsler, S. L.; Heiner, E.; Osipov, V. A.
1986-11-01
The influence of additional non-nearest neighbour hopping processes is investigated in a SSH-like model. The enhanced splitting of absorption peaks due to Π-Π ∗ interband transitions (deduced from new electron loss data of Fink and Leising /17/) can be explained by a reasonable value of the next-nearest neighbour hopping integral |t 2| ≈0.05 t 0.
Electronic transport in methylated fragments of DNA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.
2015-11-16
We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.
Electronic transport in methylated fragments of DNA
NASA Astrophysics Data System (ADS)
de Almeida, M. L.; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; de Moura, F. A. B. F.; Lyra, M. L.
2015-11-01
We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.
Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.
2013-01-01
Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283
Powell, B J; Kenny, E P; Merino, J
2017-08-25
We show that the anisotropy of the effective spin model for the dimer Mott insulator phase of κ-(BEDT-TTF)_{2}X salts is dramatically different from that of the underlying tight-binding model. Intradimer quantum interference results in a model of coupled spin chains, where frustrated interchain interactions suppress long-range magnetic order. Thus, we argue, the "spin liquid" phase observed in some of these materials is a remnant of the Tomonaga-Luttinger physics of a single chain. This is consistent with previous experiments and resolves some outstanding puzzles.
A computational study of the open and closed forms of the N-lobe human serum transferrin apoprotein.
Rinaldo, David; Field, Martin J
2003-12-01
Human serum transferrin tightly binds ferric ions in the blood stream but is able to release them in cells by a process involving receptor-mediated endocytosis and decrease in pH. Iron binding and release are accompanied by a large conformation change. In this study, we investigate theoretically the open and closed forms of the N-lobe human serum transferrin apoprotein by performing pKa calculations and molecular dynamics and free-energy simulations. In agreement with the hypothesis based on the x-ray crystal structures, our calculations show that there is a shift in the pKa values of the lysines forming the dilysine trigger when the conformation changes. We argue, however, that simple electrostatic repulsion between the lysines is not sufficient to trigger domain opening and, instead, propose an alternative explanation for the dilysine-trigger effect. Analysis of the molecular dynamics and free-energy results indicate that the open form is more mobile than the closed form and is much more stable at pH 5.3, in large part due to entropic effects. Despite a lower free energy, the dynamics simulation of the open form shows that it is flexible enough to sample conformations that are consistent with iron binding.
Monti, Maria C; Hernández-Arriaga, Ana M; Kamphuis, Monique B; López-Villarejo, Juan; Heck, Albert J R; Boelens, Rolf; Díaz-Orejas, Ramón; van den Heuvel, Robert H H
2007-01-01
The parD operon of Escherichia coli plasmid R1 encodes a toxin-antitoxin system, which is involved in plasmid stabilization. The toxin Kid inhibits cell growth by RNA degradation and its action is neutralized by the formation of a tight complex with the antitoxin Kis. A fascinating but poorly understood aspect of the kid-kis system is its autoregulation at the transcriptional level. Using macromolecular (tandem) mass spectrometry and DNA binding assays, we here demonstrate that Kis pilots the interaction of the Kid-Kis complex in the parD regulatory region and that two discrete Kis-binding regions are present on parD. The data clearly show that only when the Kis concentration equals or exceeds the Kid concentration a strong cooperative effect exists between strong DNA binding and Kid2-Kis2-Kid2-Kis2 complex formation. We propose a model in which transcriptional repression of the parD operon is tuned by the relative molar ratio of the antitoxin and toxin proteins in solution. When the concentration of the toxin exceeds that of the antitoxin tight Kid2-Kis2-Kid2 complexes are formed, which only neutralize the lethal activity of Kid. Upon increasing the Kis concentration, (Kid2-Kis2)n complexes repress the kid-kis operon.
NASA Astrophysics Data System (ADS)
Fauzi, A. D.; Majidi, M. A.; Rusydi, A.
2017-04-01
We propose a simple tight-binding based model for Fe3O4 that captures the preference of ferrimagnetic over ferromagnetic spin configuration of the system. Our model is consistent with previous theoretical and experimental studies suggesting that the system is half metallic, in which spin polarized electrons hop only among the Fe B sites. To address the metal-insulator transition (MIT) we propose that the strong correlation among electrons, which may also be influenced by the electron-phonon interactions, manifest as the temperature-dependence of the O-p-Fe-d hybridization parameter, particularly Fe-d belonging to one of the Fe B sites (denoted as {t}{{FeB}-{{O}}}(2)). By proposing that this parameter increases as the temperature decreases, our density-of-states calculation successfully captures a gap opening at the Fermi level, transforming the system from half metal to insulator. Within this model along with the corresponding choice of parameters and a certain profile of the temperature dependence of {t}{{FeB}-{{O}}}(2), we calculate the resistivity of the system as a function of temperature. Our calculation result reveals the drastic uprising trend of the resistivity profile as the temperature decreases, with the MIT transition temperature located around 100 K, which is in agreement with experimental data.
DFTB3: Extension of the self-consistent-charge density-functional tight-binding method (SCC-DFTB).
Gaus, Michael; Cui, Qiang; Elstner, Marcus
2012-04-10
The self-consistent-charge density-functional tight-binding method (SCC-DFTB) is an approximate quantum chemical method derived from density functional theory (DFT) based on a second-order expansion of the DFT total energy around a reference density. In the present study we combine earlier extensions and improve them consistently with, first, an improved Coulomb interaction between atomic partial charges, and second, the complete third-order expansion of the DFT total energy. These modifications lead us to the next generation of the DFTB methodology called DFTB3, which substantially improves the description of charged systems containing elements C, H, N, O, and P, especially regarding hydrogen binding energies and proton affinities. As a result, DFTB3 is particularly applicable to biomolecular systems. Remaining challenges and possible solutions are also briefly discussed.
Band structure and orbital character of monolayer MoS2 with eleven-band tight-binding model
NASA Astrophysics Data System (ADS)
Shahriari, Majid; Ghalambor Dezfuli, Abdolmohammad; Sabaeian, Mohammad
2018-02-01
In this paper, based on a tight-binding (TB) model, first we present the calculations of eigenvalues as band structure and then present the eigenvectors as probability amplitude for finding electron in atomic orbitals for monolayer MoS2 in the first Brillouin zone. In these calculations we are considering hopping processes between the nearest-neighbor Mo-S, the next nearest-neighbor in-plan Mo-Mo, and the next nearest-neighbor in-plan and out-of-plan S-S atoms in a three-atom based unit cell of two-dimensional rhombic MoS2. The hopping integrals have been solved in terms of Slater-Koster and crystal field parameters. These parameters are calculated by comparing TB model with the density function theory (DFT) in the high-symmetry k-points (i.e. the K- and Γ-points). In our TB model all the 4d Mo orbitals and the 3p S orbitals are considered and detailed analysis of the orbital character of each energy level at the main high-symmetry points of the Brillouin zone is described. In comparison with DFT calculations, our results of TB model show a very good agreement for bands near the Fermi level. However for other bands which are far from the Fermi level, some discrepancies between our TB model and DFT calculations are observed. Upon the accuracy of Slater-Koster and crystal field parameters, on the contrary of DFT, our model provide enough accuracy to calculate all allowed transitions between energy bands that are very crucial for investigating the linear and nonlinear optical properties of monolayer MoS2.
Edwards, Marcus J; Williams, Mark A; Maxwell, Anthony; McKay, Adam R
2011-05-03
DNA topoisomerases are enzymes that control DNA topology and are vital targets for antimicrobial and anticancer drugs. Here we present a mass spectrometry study of complexes formed between the A subunit of the topoisomerase DNA gyrase and the bifunctional inhibitor simocyclinone D8 (SD8), an antibiotic isolated from Streptomyces. These studies show that, in an alternative mode of interaction to that found by X-ray crystallography, each subunit binds a single bifunctional inhibitor with separate binding pockets for the two ends of SD8. The gyrase subunits form constitutive dimers, and fractional occupancies of inhibitor-bound states show that there is strong allosteric cooperativity in the binding of two bifunctional ligands to the dimer. We show that the mass spectrometry data can be fitted to a general model of cooperative binding via an extension of the "tight-binding" approach, providing a rigorous determination of the dissociation constants and degree of cooperativity. This general approach will be applicable to other systems with multiple binding sites and highlights mass spectrometry's role as a powerful emerging tool for unraveling the complexities of biomolecular interactions.
Guo, Zuojun; Li, Bo; Cheng, Li-Tien; Zhou, Shenggao; McCammon, J Andrew; Che, Jianwei
2015-02-10
Protein–ligand binding is a key biological process at the molecular level. The identification and characterization of small-molecule binding sites on therapeutically relevant proteins have tremendous implications for target evaluation and rational drug design. In this work, we used the recently developed level-set variational implicit-solvent model (VISM) with the Coulomb field approximation (CFA) to locate and characterize potential protein–small-molecule binding sites. We applied our method to a data set of 515 protein–ligand complexes and found that 96.9% of the cocrystallized ligands bind to the VISM-CFA-identified pockets and that 71.8% of the identified pockets are occupied by cocrystallized ligands. For 228 tight-binding protein–ligand complexes (i.e, complexes with experimental pKd values larger than 6), 99.1% of the cocrystallized ligands are in the VISM-CFA-identified pockets. In addition, it was found that the ligand binding orientations are consistent with the hydrophilic and hydrophobic descriptions provided by VISM. Quantitative characterization of binding pockets with topological and physicochemical parameters was used to assess the “ligandability” of the pockets. The results illustrate the key interactions between ligands and receptors and can be very informative for rational drug design.
Effect of Fermi surface nesting on resonant spin excitations in Ba{<_1-x}K{<_x}Fe{<_2}As{<_2}.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Castellan, J.-P.; Rosenkranz, S.; Goremychkin, E.A.
2011-01-01
We report inelastic neutron scattering measurements of the resonant spin excitations in Ba{sub 1-x}K{sub x}Fe{sub 2}As{sub 2} over a broad range of electron band filling. The fall in the superconducting transition temperature with hole doping coincides with the magnetic excitations splitting into two incommensurate peaks because of the growing mismatch in the hole and electron Fermi surface volumes, as confirmed by a tight-binding model with s{sub {+-}}-symmetry pairing. The reduction in Fermi surface nesting is accompanied by a collapse of the resonance binding energy and its spectral weight, caused by the weakening of electron-electron correlations.
NASA Technical Reports Server (NTRS)
Durian, Douglas J.; Gopal, Anthony D.; Vera, Moin U.; Langer, Stephen A.
1996-01-01
Diffusing-wave spectroscopy measurements show that ordinarily solid aqueous foams flow by a series of stick-slip avalanche-like rearrangements of neighboring bubbles from one tight packing configuration to another. Contrary to a recent prediction, the distribution of avalanche sizes do not obey a power-law distribution characteristic of self-organized criticality. This can be understood from a simple model of foam mechanics based on bubble-bubble interactions.
NASA Astrophysics Data System (ADS)
Tretiak, Sergei
2014-03-01
The exciton scattering (ES) technique is a multiscale approach developed for efficient calculations of excited-state electronic structure and optical spectra in low-dimensional conjugated macromolecules. Within the ES method, the electronic excitations in the molecular structure are attributed to standing waves representing quantum quasi-particles (excitons), which reside on the graph. The exciton propagation on the linear segments is characterized by the exciton dispersion, whereas the exciton scattering on the branching centers is determined by the energy-dependent scattering matrices. Using these ES energetic parameters, the excitation energies are then found by solving a set of generalized ``particle in a box'' problems on the graph that represents the molecule. All parameters can be extracted from quantum-chemical computations of small molecular fragments and tabulated in the ES library for further applications. Subsequently, spectroscopic modeling for any macrostructure within considered molecular family could be performed with negligible numerical effort. The exciton scattering properties of molecular vertices can be further described by tight-binding or equivalently lattice models. The on-site energies and hopping constants are obtained from the exciton dispersion and scattering matrices. Such tight-binding model approach is particularly useful to describe the exciton-phonon coupling, energetic disorder and incoherent energy transfer in large branched conjugated molecules. Overall the ES applications accurately reproduce the optical spectra compared to the reference quantum chemistry results, and make possible to predict spectra of complex macromolecules, where conventional electronic structure calculations are unfeasible.
NASA Astrophysics Data System (ADS)
Nandy, Atanu; Pal, Biplab; Chakrabarti, Arunava
2016-08-01
It is shown that an entire class of off-diagonally disordered linear lattices composed of two basic building blocks and described within a tight-binding model can be tailored to generate absolutely continuous energy bands. It can be achieved if linear atomic clusters of an appropriate size are side-coupled to a suitable subset of sites in the backbone, and if the nearest-neighbor hopping integrals, in the backbone and in the side-coupled cluster, bear a certain ratio. We work out the precise relationship between the number of atoms in one of the building blocks in the backbone and that in the side attachment. In addition, we also evaluate the definite correlation between the numerical values of the hopping integrals at different subsections of the chain, that can convert an otherwise point spectrum (or a singular continuous one for deterministically disordered lattices) with exponentially (or power law) localized eigenfunctions to an absolutely continuous spectrum comprising one or more bands (subbands) populated by extended, totally transparent eigenstates. The results, which are analytically exact, put forward a non-trivial variation of the Anderson localization (Anderson P. W., Phys. Rev., 109 (1958) 1492), pointing towards its unusual sensitivity to the numerical values of the system parameters and, go well beyond the other related models such as the Random Dimer Model (RDM) (Dunlap D. H. et al., Phys. Rev. Lett., 65 (1990) 88).
NASA Astrophysics Data System (ADS)
Bieniek, Maciej; Korkusiński, Marek; Szulakowska, Ludmiła; Potasz, Paweł; Ozfidan, Isil; Hawrylak, Paweł
2018-02-01
We present here the minimal tight-binding model for a single layer of transition metal dichalcogenides (TMDCs) MX 2(M , metal; X , chalcogen) which illuminates the physics and captures band nesting, massive Dirac fermions, and valley Landé and Zeeman magnetic field effects. TMDCs share the hexagonal lattice with graphene but their electronic bands require much more complex atomic orbitals. Using symmetry arguments, a minimal basis consisting of three metal d orbitals and three chalcogen dimer p orbitals is constructed. The tunneling matrix elements between nearest-neighbor metal and chalcogen orbitals are explicitly derived at K ,-K , and Γ points of the Brillouin zone. The nearest-neighbor tunneling matrix elements connect specific metal and sulfur orbitals yielding an effective 6 ×6 Hamiltonian giving correct composition of metal and chalcogen orbitals but not the direct gap at K points. The direct gap at K , correct masses, and conduction band minima at Q points responsible for band nesting are obtained by inclusion of next-neighbor Mo-Mo tunneling. The parameters of the next-nearest-neighbor model are successfully fitted to MX 2(M =Mo ; X =S ) density functional ab initio calculations of the highest valence and lowest conduction band dispersion along K -Γ line in the Brillouin zone. The effective two-band massive Dirac Hamiltonian for MoS2, Landé g factors, and valley Zeeman splitting are obtained.
Simple and tight monogamy relations for a class of Bell inequalities
NASA Astrophysics Data System (ADS)
Augusiak, Remigiusz
2017-01-01
Physical principles constrain the way nonlocal correlations can be distributed among distant parties in a Bell-type experiment. These constraints are usually expressed by monogamy relations that bound the amount of Bell inequality violation observed by a set of parties by the violation observed by a different set of parties. Here we show that the no-signaling principle yields simple and tight monogamy relations for an important class of bipartite and multipartite Bell inequalities. We also link these trade-offs to the guessing probability—a key quantity in device-independent information processing.
Relative entropy as a universal metric for multiscale errors
NASA Astrophysics Data System (ADS)
Chaimovich, Aviel; Shell, M. Scott
2010-06-01
We show that the relative entropy, Srel , suggests a fundamental indicator of the success of multiscale studies, in which coarse-grained (CG) models are linked to first-principles (FP) ones. We demonstrate that Srel inherently measures fluctuations in the differences between CG and FP potential energy landscapes, and develop a theory that tightly and generally links it to errors associated with coarse graining. We consider two simple case studies substantiating these results, and suggest that Srel has important ramifications for evaluating and designing coarse-grained models.
Relative entropy as a universal metric for multiscale errors.
Chaimovich, Aviel; Shell, M Scott
2010-06-01
We show that the relative entropy, Srel, suggests a fundamental indicator of the success of multiscale studies, in which coarse-grained (CG) models are linked to first-principles (FP) ones. We demonstrate that Srel inherently measures fluctuations in the differences between CG and FP potential energy landscapes, and develop a theory that tightly and generally links it to errors associated with coarse graining. We consider two simple case studies substantiating these results, and suggest that Srel has important ramifications for evaluating and designing coarse-grained models.
Rashba spin-orbit coupling and orbital chirality in magnetic bilayers
NASA Astrophysics Data System (ADS)
Lee, Hyun-Woo
2013-03-01
The phenomenon of the Rashba spin-orbit coupling is examined theoretically for an ultrathin magnetic layer in contact with a non-magnetic heavy metal layer. From first-principles calculation, large Rashba parameter of order 1 eV .Å is obtained, which is strong enough to generate large spin transfer torque of spin-orbit coupling origin. Large Rashba parameter is attributed to the orbital mixing of 3 d magnetic atoms and non-magnetic heavy elements with significant atomic spin-orbit coupling. Interestingly the magnitude and sign of the parameter vary from energy bands to bands, which we attribute to band-specific chiral ordering of orbital angular momentum. Through a simple tight-binding model analysis, we demonstrate that d-orbital hybridization allowed by the breaking of structural inversion symmetry generates band-specific chiral ordering of orbital angular momentum, which combines with atomic spin-orbit coupling to give rise to band-specific Rashba parameter. The band-dependence of the Rashba parameter is discussed in connection with recent experiments and we argue that the dependence may be utilized to enhance device application potentials. This work is supported by NRF grant (2010-0008529, 2011-0015631, 2010-0014109, 2011-0030789).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rout, G. C., E-mail: siva1987@iopb.res.in, E-mail: skp@iopb.res.in, E-mail: gcr@iopb.res.in; Sahu, Sivabrata; Panda, S. K.
2016-04-13
We report here a microscopic tight-binding model calculation for AB-stacked bilayer graphene in presence of biasing potential between the two layers and the impurity effects to study the evolution of the total density of states with special emphasis on opening of band gap near Dirac point. We have calculated the electron Green’s functions for both the A and B sub-lattices by Zubarev technique. The imaginary part of the Green’s function gives the partial and total density of states of electrons. The density of states are computed numerically for 1000 × 1000 grid points of the electron momentum. The evolution ofmore » the opening of band gap near van-Hove singularities as well as near Dirac point is investigated by varying the different interlayer hoppings and the biasing potentials. The inter layer hopping splits the density of states at van-Hove singularities and produces a V-shaped gap near Dirac point. Further the biasing potential introduces a U shaped gap near Dirac point with a density minimum at the applied potential(i.e. at V/2).« less
Proton transfer along water bridges in biological systems with density-functional tight-binding
NASA Astrophysics Data System (ADS)
Reiss, Krystle; Wise, Abigail; Mazzuca, James
2015-03-01
When examining the dynamics of charge transfer in high dimensional enzymatic systems, the cost of quantum mechanical treatment of electrons increases exponentially with the size of the system. As a semi-empirical method, density-functional tight-binding aids in shortening these calculation times, but can be inaccurate in the regime where bonds are being formed and broken. To address these inaccuracies with respect to proton transfer in an enzymatic system, DFTB is being used to calculate small model systems containing only a single amino acid residue donor, represented by an imidazole molecule, and a water acceptor. When DFTB calculations are compared to B3LYP geometry calculations of the donor molecule, we observe a bond angle error on the order of 1.2 degrees and a bond length error on the order of 0.011 Å. As we move forward with small donor-acceptor systems, comparisons between DFTB and B3LYP energy profiles will provide a better clue as to what extent improvements need to be made. To improve the accuracy of the DFTB calculations, the internuclear repulsion term may be altered. This would result in energy profiles that closely resemble those produced by higher-level theory. Alma College Provost's Office.
Studying the hopping parameters of half-Heusler NaAuS using maximally localized Wannier function
NASA Astrophysics Data System (ADS)
Sihi, Antik; Lal, Sohan; Pandey, Sudhir K.
2018-04-01
Here, the electronic behavior of half-Heusler NaAuS is studied using PBEsol exchange correlation functional by plotting the band structure curve. These bands are reproduced using maximally localized Wannier function using WANNIER90. Tight-binding bands are nicely matched with density functional theory bands. By fitting the tight-binding model, hopping parameter for NaAuS is obtained by including Na 2s, 2p, Au 6s, 5p, 5d and S 3s, 3p orbitals within the energy interval of -5 to 16 eV around the Fermi level. In present study, hopping integrals for NaAuS are computed for the first primitive unit cell atoms as well as the first nearest neighbor primitive unit cell. The most dominating hopping integrals are found for Na (3s) - S (3s), Na (2px) - S (2px), Au (6s) - S (3px), Au (6s) - S (3py) and Au (6s) - S (3pz) orbitals. The hopping integrals for the first nearest neighbor primitive unit cell are also discussed in this manuscript. In future, these hopping integrals are very important to find the topological invariant for NaAuS compound.
Effect of disorder on the optical properties of short period superlattices
NASA Technical Reports Server (NTRS)
Strozier, J. A.; Zhang, Y. A.; Horton, C.; Ignatiev, A.; Shih, H. D.
1993-01-01
The optical properties of disordered short period superlattices are studied using a one-dimensional tight-binding model. A difference vector and disorder structure factor are proposed to characterize the disordered superlattice. The density of states, participation number, and optical absorption coefficients for both ordered and disordered superlattices are calculated as a function of energy. The results show that introduction of disorder into an indirect band gap material enhances the optical transition near the indirect band edge.
Quasi-bound states in strained graphene
NASA Astrophysics Data System (ADS)
Bahamon, Dario; Qi, Zenan; Park, Harold; Pareira, Vitor; Campbell, David
In this work, we explore the possibility of manipulating electronic states in graphene nanostructures by mechanical means. Specifically, we use molecular dynamics and tight-binding models to access the electronic and transport properties of strained graphene nanobubbles and graphene kirigami. We establish that low energy electrons can be confined in the arms of the kirigami and within the nanobubbles; under different load conditions the coupling between confined states and continuous states is modified creating different conductance line-shapes.
NASA Astrophysics Data System (ADS)
Mousavi, Hamze; Jalilvand, Samira; Kurdestany, Jamshid Moradi; Grabowski, Marek
2017-10-01
The Kubo formula is used to extract the electrical conductivity (EC) of different diameters of doped zigzag carbon nanotubes and their corresponding unzipped armchair graphene nanoribbons, as a function of temperature and chemical potential, within the tight-binding Hamiltonian model and Green's functions approach. The results reveal more sensitivity to temperature for semiconducting systems in addition to a decrease in EC of all systems with increasing cross-sections.
Sattonnay, G; Tétot, R
2014-02-05
Atomistic simulations with new interatomic potentials derived from a tight-binding variable-charge model were performed in order to investigate the lattice properties and the defect formation energies in Gd2Ti2O7 and Gd2Zr2O7 pyrochlores. The main objective was to determine the role played by the defect stability on the radiation tolerance of these compounds. Calculations show that the titanate has a more covalent character than the zirconate. Moreover, the properties of oxygen Frenkel pairs, cation antisite defects and cation Frenkel pairs were studied. In Gd2Ti2O7 the cation antisite defect and the Ti-Frenkel pair are not stable: they evolve towards more stable defect configurations during the atomic relaxation process. This phenomenon is driven by a decrease of the Ti coordination number down to five which leads to a local atomic reorganization and strong structural distortions around the defects. These kinds of atomic rearrangements are not observed around defects in Gd2Zr2O7. Therefore, the defect stability in A2B2O7 depends on the ability of B atoms to accommodate high coordination number (higher than six seems impossible for Ti). The accumulation of structural distortions around Ti-defects due to this phenomenon could drive the Gd2Ti2O7 amorphization induced by irradiation.
Inherent limitations of probabilistic models for protein-DNA binding specificity
Ruan, Shuxiang
2017-01-01
The specificities of transcription factors are most commonly represented with probabilistic models. These models provide a probability for each base occurring at each position within the binding site and the positions are assumed to contribute independently. The model is simple and intuitive and is the basis for many motif discovery algorithms. However, the model also has inherent limitations that prevent it from accurately representing true binding probabilities, especially for the highest affinity sites under conditions of high protein concentration. The limitations are not due to the assumption of independence between positions but rather are caused by the non-linear relationship between binding affinity and binding probability and the fact that independent normalization at each position skews the site probabilities. Generally probabilistic models are reasonably good approximations, but new high-throughput methods allow for biophysical models with increased accuracy that should be used whenever possible. PMID:28686588
The relationship between water binding and desiccation tolerance in tissues
NASA Technical Reports Server (NTRS)
Vertucci, C. W.; Leopold, A. C.
1987-01-01
In an effort to define the nature of desiccation tolerance, a comparison of the water sorption characteristics was made between tissues that were resistant and tissues that were sensitive to desiccation. Water sorption isotherms were constructed for germinated and ungerminated soybean axes and also for fronds of several species of Polypodium with varying tolerance to dehydration. The strength of water binding was determined by van't Hoff as well as D'Arcy/Watt analyses of the isotherms at 5, 15, and/or 25 degrees C. Tissues which were sensitive to desiccation had a poor capacity to bind water tightly. Tightly bound water can be removed from soybean and pea seeds by equilibration at 35 degrees C over very low relative humidities; this results in a reduction in the viability of the seed. We suggest that region 1 water (i.e. water bound with very negative enthalpy values) is an important component of desiccation tolerance.
Swanson, Jon; Audie, Joseph
2018-01-01
A fundamental and unsolved problem in biophysical chemistry is the development of a computationally simple, physically intuitive, and generally applicable method for accurately predicting and physically explaining protein-protein binding affinities from protein-protein interaction (PPI) complex coordinates. Here, we propose that the simplification of a previously described six-term PPI scoring function to a four term function results in a simple expression of all physically and statistically meaningful terms that can be used to accurately predict and explain binding affinities for a well-defined subset of PPIs that are characterized by (1) crystallographic coordinates, (2) rigid-body association, (3) normal interface size, and hydrophobicity and hydrophilicity, and (4) high quality experimental binding affinity measurements. We further propose that the four-term scoring function could be regarded as a core expression for future development into a more general PPI scoring function. Our work has clear implications for PPI modeling and structure-based drug design.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Akabayov, B.; Akabayov, S; Lee , S
Gene 5 of bacteriophage T7 encodes a DNA polymerase (gp5) responsible for the replication of the phage DNA. Gp5 polymerizes nucleotides with low processivity, dissociating after the incorporation of 1 to 50 nucleotides. Thioredoxin (trx) of Escherichia coli binds tightly (Kd = 5 nM) to a unique segment in the thumb subdomain of gp5 and increases processivity. We have probed the molecular basis for the increase in processivity. A single-molecule experiment reveals differences in rates of enzymatic activity and processivity between gp5 and gp5/trx. Small angle X-ray scattering studies combined with nuclease footprinting reveal two conformations of gp5, one inmore » the free state and one upon binding to trx. Comparative analysis of the DNA binding clefts of DNA polymerases and DNA binding proteins show that the binding surface contains more hydrophobic residues than other DNA binding proteins. The balanced composition between hydrophobic and charged residues of the binding site allows for efficient sliding of gp5/trx on the DNA. We propose a model for trx-induced conformational changes in gp5 that enhance the processivity by increasing the interaction of gp5 with DNA.« less
Cherny, Vladimir V.; DeCoursey, Thomas E.
1999-01-01
Inhibition by polyvalent cations is a defining characteristic of voltage-gated proton channels. The mechanism of this inhibition was studied in rat alveolar epithelial cells using tight-seal voltage clamp techniques. Metal concentrations were corrected for measured binding to buffers. Externally applied ZnCl2 reduced the H+ current, shifted the voltage-activation curve toward positive potentials, and slowed the turn-on of H+ current upon depolarization more than could be accounted for by a simple voltage shift, with minimal effects on the closing rate. The effects of Zn2+ were inconsistent with classical voltage-dependent block in which Zn2+ binds within the membrane voltage field. Instead, Zn2+ binds to superficial sites on the channel and modulates gating. The effects of extracellular Zn2+ were strongly pHo dependent but were insensitive to pHi, suggesting that protons and Zn2+ compete for external sites on H+ channels. The apparent potency of Zn2+ in slowing activation was ∼10× greater at pHo 7 than at pHo 6, and ∼100× greater at pHo 6 than at pHo 5. The pHo dependence suggests that Zn2+, not ZnOH+, is the active species. Evidently, the Zn2+ receptor is formed by multiple groups, protonation of any of which inhibits Zn2+ binding. The external receptor bound H+ and Zn2+ with pK a 6.2–6.6 and pK M 6.5, as described by several models. Zn2+ effects on the proton chord conductance–voltage (g H–V) relationship indicated higher affinities, pK a 7 and pK M 8. CdCl2 had similar effects as ZnCl2 and competed with H+, but had lower affinity. Zn2+ applied internally via the pipette solution or to inside-out patches had comparatively small effects, but at high concentrations reduced H+ currents and slowed channel closing. Thus, external and internal zinc-binding sites are different. The external Zn2+ receptor may be the same modulatory protonation site(s) at which pHo regulates H+ channel gating. PMID:10578017
Dynamics and molecular determinants of cytoplasmic lipid droplet clustering and dispersion.
Orlicky, David J; Monks, Jenifer; Stefanski, Adrianne L; McManaman, James L
2013-01-01
Perilipin-1 (Plin1), a prominent cytoplasmic lipid droplet (CLD) binding phosphoprotein and key physiological regulator of triglyceride storage and lipolysis in adipocytes, is thought to regulate the fragmentation and dispersion of CLD that occurs in response to β-adrenergic activation of adenylate cyclase. Here we investigate the dynamics and molecular determinants of these processes using cell lines stably expressing recombinant forms of Plin1 and/or other members of the perilipin family. Plin1 and a C-terminal CLD-binding fragment of Plin1 (Plin1CT) induced formation of single dense CLD clusters near the microtubule organizing center, whereas neither an N-terminal CLD-binding fragment of Plin1, nor Plin2 or Plin3 induced clustering. Clustered CLD coated by Plin1, or Plin1CT, dispersed in response to isoproterenol, or other agents that activate adenylate cyclase, in a process inhibited by the protein kinase A inhibitor, H89, and blocked by microtubule disruption. Isoproterenol-stimulated phosphorylation of CLD-associated Plin1 on serine 492 preceded their dispersion, and live cell imaging showed that cluster dispersion involved initial fragmentation of tight clusters into multiple smaller clusters, which then fragmented into well-dispersed individual CLD. siRNA knockdown of the cortical actin binding protein, moesin, induced disaggregation of tight clusters into multiple smaller clusters, and inhibited the reaggregation of dispersed CLD into tight clusters. Together these data suggest that the clustering and dispersion processes involve a complex orchestration of phosphorylation-dependent, microtubule-dependent and independent, and microfilament dependent steps.
Single-particle trajectories reveal two-state diffusion-kinetics of hOGG1 proteins on DNA.
Vestergaard, Christian L; Blainey, Paul C; Flyvbjerg, Henrik
2018-03-16
We reanalyze trajectories of hOGG1 repair proteins diffusing on DNA. A previous analysis of these trajectories with the popular mean-squared-displacement approach revealed only simple diffusion. Here, a new optimal estimator of diffusion coefficients reveals two-state kinetics of the protein. A simple, solvable model, in which the protein randomly switches between a loosely bound, highly mobile state and a tightly bound, less mobile state is the simplest possible dynamic model consistent with the data. It yields accurate estimates of hOGG1's (i) diffusivity in each state, uncorrupted by experimental errors arising from shot noise, motion blur and thermal fluctuations of the DNA; (ii) rates of switching between states and (iii) rate of detachment from the DNA. The protein spends roughly equal time in each state. It detaches only from the loosely bound state, with a rate that depends on pH and the salt concentration in solution, while its rates for switching between states are insensitive to both. The diffusivity in the loosely bound state depends primarily on pH and is three to ten times higher than in the tightly bound state. We propose and discuss some new experiments that take full advantage of the new tools of analysis presented here.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nishimoto, Yoshio, E-mail: nishimoto.yoshio@fukui.kyoto-u.ac.jp
2015-09-07
We develop a formalism for the calculation of excitation energies and excited state gradients for the self-consistent-charge density-functional tight-binding method with the third-order contributions of a Taylor series of the density functional theory energy with respect to the fluctuation of electron density (time-dependent density-functional tight-binding (TD-DFTB3)). The formulation of the excitation energy is based on the existing time-dependent density functional theory and the older TD-DFTB2 formulae. The analytical gradient is computed by solving Z-vector equations, and it requires one to calculate the third-order derivative of the total energy with respect to density matrix elements due to the inclusion of themore » third-order contributions. The comparison of adiabatic excitation energies for selected small and medium-size molecules using the TD-DFTB2 and TD-DFTB3 methods shows that the inclusion of the third-order contributions does not affect excitation energies significantly. A different set of parameters, which are optimized for DFTB3, slightly improves the prediction of adiabatic excitation energies statistically. The application of TD-DFTB for the prediction of absorption and fluorescence energies of cresyl violet demonstrates that TD-DFTB3 reproduced the experimental fluorescence energy quite well.« less
Nishimoto, Yoshio
2015-09-07
We develop a formalism for the calculation of excitation energies and excited state gradients for the self-consistent-charge density-functional tight-binding method with the third-order contributions of a Taylor series of the density functional theory energy with respect to the fluctuation of electron density (time-dependent density-functional tight-binding (TD-DFTB3)). The formulation of the excitation energy is based on the existing time-dependent density functional theory and the older TD-DFTB2 formulae. The analytical gradient is computed by solving Z-vector equations, and it requires one to calculate the third-order derivative of the total energy with respect to density matrix elements due to the inclusion of the third-order contributions. The comparison of adiabatic excitation energies for selected small and medium-size molecules using the TD-DFTB2 and TD-DFTB3 methods shows that the inclusion of the third-order contributions does not affect excitation energies significantly. A different set of parameters, which are optimized for DFTB3, slightly improves the prediction of adiabatic excitation energies statistically. The application of TD-DFTB for the prediction of absorption and fluorescence energies of cresyl violet demonstrates that TD-DFTB3 reproduced the experimental fluorescence energy quite well.
Weak partitioning chromatography for anion exchange purification of monoclonal antibodies.
Kelley, Brian D; Tobler, Scott A; Brown, Paul; Coffman, Jonathan L; Godavarti, Ranga; Iskra, Timothy; Switzer, Mary; Vunnum, Suresh
2008-10-15
Weak partitioning chromatography (WPC) is an isocratic chromatographic protein separation method performed under mobile phase conditions where a significant amount of the product protein binds to the resin, well in excess of typical flowthrough operations. The more stringent load and wash conditions lead to improved removal of more tightly binding impurities, although at the cost of a reduction in step yield. The step yield can be restored by extending the column load and incorporating a short wash at the end of the load stage. The use of WPC with anion exchange resins enables a two-column cGMP purification platform to be used for many different mAbs. The operating window for WPC can be easily established using high throughput batch-binding screens. Under conditions that favor very strong product binding, competitive effects from product binding can give rise to a reduction in column loading capacity. Robust performance of WPC anion exchange chromatography has been demonstrated in multiple cGMP mAb purification processes. Excellent clearance of host cell proteins, leached Protein A, DNA, high molecular weight species, and model virus has been achieved. (c) 2008 Wiley Periodicals, Inc.
Capillarity theory for the fly-casting mechanism
Trizac, Emmanuel; Levy, Yaakov; Wolynes, Peter G.
2010-01-01
Biomolecular folding and function are often coupled. During molecular recognition events, one of the binding partners may transiently or partially unfold, allowing more rapid access to a binding site. We describe a simple model for this fly-casting mechanism based on the capillarity approximation and polymer chain statistics. The model shows that fly casting is most effective when the protein unfolding barrier is small and the part of the chain which extends toward the target is relatively rigid. These features are often seen in known examples of fly casting in protein–DNA binding. Simulations of protein–DNA binding based on well-funneled native-topology models with electrostatic forces confirm the trends of the analytical theory. PMID:20133683
Modeling direct interband tunneling. II. Lower-dimensional structures
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pan, Andrew, E-mail: pandrew@ucla.edu; Chui, Chi On; California NanoSystems Institute, University of California, Los Angeles, Los Angeles, California 90095
We investigate the applicability of the two-band Hamiltonian and the widely used Kane analytical formula to interband tunneling along unconfined directions in nanostructures. Through comparisons with k·p and tight-binding calculations and quantum transport simulations, we find that the primary correction is the change in effective band gap. For both constant fields and realistic tunnel field-effect transistors, dimensionally consistent band gap scaling of the Kane formula allows analytical and numerical device simulations to approximate non-equilibrium Green's function current characteristics without arbitrary fitting. This allows efficient first-order calibration of semiclassical models for interband tunneling in nanodevices.
Superresolution imaging of transcription units on newt lampbrush chromosomes
Kaufmann, Rainer; Cremer, Christoph; Gall, Joseph G.
2013-01-01
We have examined transcription loops on lampbrush chromosomes of the newt Notophthalmus by superresolution microscopy. Because of the favorable, essentially two-dimensional morphology of these loops, an average optical resolution in the x-y plane of about 50 nm was achieved. We analyzed the distribution of the multifunctional RNA-binding protein CELF1 on specific loops. CELF1 distribution is consistent with a model in which individual transcripts are tightly folded and hence closely packed against the loop axis. PMID:22892678
Chemically Doped Double-Walled Carbon Nanotubes: Cylindrical Molecular Capacitors
NASA Astrophysics Data System (ADS)
Chen, Gugang; Bandow, S.; Margine, E. R.; Nisoli, C.; Kolmogorov, A. N.; Crespi, Vincent H.; Gupta, R.; Sumanasekera, G. U.; Iijima, S.; Eklund, P. C.
2003-06-01
A double-walled carbon nanotube is used to study the radial charge distribution on the positive inner electrode of a cylindrical molecular capacitor. The outer electrode is a shell of bromine anions. Resonant Raman scattering from phonons on each carbon shell reveals the radial charge distribution. A self-consistent tight-binding model confirms the observed molecular Faraday cage effect, i.e., most of the charge resides on the outer wall, even when this wall was originally semiconducting and the inner wall was metallic.
Chemically doped double-walled carbon nanotubes: cylindrical molecular capacitors.
Chen, Gugang; Bandow, S; Margine, E R; Nisoli, C; Kolmogorov, A N; Crespi, Vincent H; Gupta, R; Sumanasekera, G U; Iijima, S; Eklund, P C
2003-06-27
A double-walled carbon nanotube is used to study the radial charge distribution on the positive inner electrode of a cylindrical molecular capacitor. The outer electrode is a shell of bromine anions. Resonant Raman scattering from phonons on each carbon shell reveals the radial charge distribution. A self-consistent tight-binding model confirms the observed molecular Faraday cage effect, i.e., most of the charge resides on the outer wall, even when this wall was originally semiconducting and the inner wall was metallic.
Complex absorbing potential based Lorentzian fitting scheme and time dependent quantum transport.
Xie, Hang; Kwok, Yanho; Jiang, Feng; Zheng, Xiao; Chen, GuanHua
2014-10-28
Based on the complex absorbing potential (CAP) method, a Lorentzian expansion scheme is developed to express the self-energy. The CAP-based Lorentzian expansion of self-energy is employed to solve efficiently the Liouville-von Neumann equation of one-electron density matrix. The resulting method is applicable for both tight-binding and first-principles models and is used to simulate the transient currents through graphene nanoribbons and a benzene molecule sandwiched between two carbon-atom chains.
Methylation effect on the ohmic resistance of a poly-GC DNA-like chain
NASA Astrophysics Data System (ADS)
de Moura, F. A. B. F.; Lyra, M. L.; de Almeida, M. L.; Ourique, G. S.; Fulco, U. L.; Albuquerque, E. L.
2016-10-01
We determine, by using a tight-binding model Hamiltonian, the characteristic current-voltage (IxV) curves of a 5-methylated cytosine single strand poly-GC DNA-like finite segment, considering the methyl groups attached laterally to a random fraction of the cytosine basis. Striking, we found that the methylation significantly impacts the ohmic resistance (R) of the DNA-like segments, indicating that measurements of R can be used as a biosensor tool to probe the presence of anomalous methylation.
Monti, Maria C.; Hernández-Arriaga, Ana M.; Kamphuis, Monique B.; López-Villarejo, Juan; Heck, Albert J. R.; Boelens, Rolf; Díaz-Orejas, Ramón; van den Heuvel, Robert H. H.
2007-01-01
The parD operon of Escherichia coli plasmid R1 encodes a toxin–antitoxin system, which is involved in plasmid stabilization. The toxin Kid inhibits cell growth by RNA degradation and its action is neutralized by the formation of a tight complex with the antitoxin Kis. A fascinating but poorly understood aspect of the kid–kis system is its autoregulation at the transcriptional level. Using macromolecular (tandem) mass spectrometry and DNA binding assays, we here demonstrate that Kis pilots the interaction of the Kid–Kis complex in the parD regulatory region and that two discrete Kis-binding regions are present on parD. The data clearly show that only when the Kis concentration equals or exceeds the Kid concentration a strong cooperative effect exists between strong DNA binding and Kid2–Kis2–Kid2–Kis2 complex formation. We propose a model in which transcriptional repression of the parD operon is tuned by the relative molar ratio of the antitoxin and toxin proteins in solution. When the concentration of the toxin exceeds that of the antitoxin tight Kid2–Kis2–Kid2 complexes are formed, which only neutralize the lethal activity of Kid. Upon increasing the Kis concentration, (Kid2–Kis2)n complexes repress the kid–kis operon. PMID:17317682
Marutaphan, Ampaiwan; Seekaew, Yotsarayuth; Wongchoosuk, Chatchawal
2017-12-01
Geometric and electronic properties of 3,4-ethylenedioxythiophene (EDOT), styrene sulfonate (SS), and EDOT: SS oligomers up to 10 repeating units were studied by the self-consistent charge density functional tight-binding (SCC-DFTB) method. An application of PEDOT:PSS for ammonia (NH 3 ) detection was highlighted and investigated both experimentally and theoretically. The results showed an important role of H-bonds in EDOT:SS oligomers complex conformation. Electrical conductivity of EDOT increased with increasing oligomers and doping SS due to enhancement of π conjugation. Printed PEDOT:PSS gas sensor exhibited relatively high response and selectivity to NH 3 . The SCC-DFTB calculation suggested domination of direct charge transfer process in changing of PEDOT:PSS conductivity upon NH 3 exposure at room temperature. The NH 3 molecules preferred to bind with PEDOT:PSS via physisorption. The most favorable adsorption site for PEDOT:PSS-NH 3 interaction was found to be at the nitrogen atom of NH 3 and hydrogen atoms of SS with an average optimal binding distance of 2.00 Å.
Three-Dimensional Blood-Brain Barrier Model for in vitro Studies of Neurovascular Pathology
NASA Astrophysics Data System (ADS)
Cho, Hansang; Seo, Ji Hae; Wong, Keith H. K.; Terasaki, Yasukazu; Park, Joseph; Bong, Kiwan; Arai, Ken; Lo, Eng H.; Irimia, Daniel
2015-10-01
Blood-brain barrier (BBB) pathology leads to neurovascular disorders and is an important target for therapies. However, the study of BBB pathology is difficult in the absence of models that are simple and relevant. In vivo animal models are highly relevant, however they are hampered by complex, multi-cellular interactions that are difficult to decouple. In vitro models of BBB are simpler, however they have limited functionality and relevance to disease processes. To address these limitations, we developed a 3-dimensional (3D) model of BBB on a microfluidic platform. We verified the tightness of the BBB by showing its ability to reduce the leakage of dyes and to block the transmigration of immune cells towards chemoattractants. Moreover, we verified the localization at endothelial cell boundaries of ZO-1 and VE-Cadherin, two components of tight and adherens junctions. To validate the functionality of the BBB model, we probed its disruption by neuro-inflammation mediators and ischemic conditions and measured the protective function of antioxidant and ROCK-inhibitor treatments. Overall, our 3D BBB model provides a robust platform, adequate for detailed functional studies of BBB and for the screening of BBB-targeting drugs in neurological diseases.
Vector fields in a tight laser focus: comparison of models.
Peatross, Justin; Berrondo, Manuel; Smith, Dallas; Ware, Michael
2017-06-26
We assess several widely used vector models of a Gaussian laser beam in the context of more accurate vector diffraction integration. For the analysis, we present a streamlined derivation of the vector fields of a uniformly polarized beam reflected from an ideal parabolic mirror, both inside and outside of the resulting focus. This exact solution to Maxwell's equations, first developed in 1920 by V. S. Ignatovsky, is highly relevant to high-intensity laser experiments since the boundary conditions at a focusing optic dictate the form of the focus in a manner analogous to a physical experiment. In contrast, many models simply assume a field profile near the focus and develop the surrounding vector fields consistent with Maxwell's equations. In comparing the Ignatovsky result with popular closed-form analytic vector models of a Gaussian beam, we find that the relatively simple model developed by Erikson and Singh in 1994 provides good agreement in the paraxial limit. Models involving a Lax expansion introduce a divergences outside of the focus while providing little if any improvement in the focal region. Extremely tight focusing produces a somewhat complicated structure in the focus, and requires the Ignatovsky model for accurate representation.
Modeling chain folding in protein-constrained circular DNA.
Martino, J A; Olson, W K
1998-01-01
An efficient method for sampling equilibrium configurations of DNA chains binding one or more DNA-bending proteins is presented. The technique is applied to obtain the tertiary structures of minimal bending energy for a selection of dinucleosomal minichromosomes that differ in degree of protein-DNA interaction, protein spacing along the DNA chain contour, and ring size. The protein-bound portions of the DNA chains are represented by tight, left-handed supercoils of fixed geometry. The protein-free regions are modeled individually as elastic rods. For each random spatial arrangement of the two nucleosomes assumed during a stochastic search for the global minimum, the paths of the flexible connecting DNA segments are determined through a numerical solution of the equations of equilibrium for torsionally relaxed elastic rods. The minimal energy forms reveal how protein binding and spacing and plasmid size differentially affect folding and offer new insights into experimental minichromosome systems. PMID:9591675
Pascale, Lise; Azoulay, Stéphane; Di Giorgio, Audrey; Zenacker, Laura; Gaysinski, Marc; Clayette, Pascal; Patino, Nadia
2013-01-01
RNA is a major drug target, but the design of small molecules that modulate RNA function remains a great challenge. In this context, a series of structurally homologous ‘polyamide amino acids’ (PAA) was studied as HIV-1 trans-activating response (TAR) RNA ligands. An extensive thermodynamic study revealed the occurence of an enthalpy–entropy compensation phenomenon resulting in very close TAR affinities for all PAA. However, their binding modes and their ability to compete with the Tat fragment strongly differ according to their structure. Surprisingly, PAA that form loose complexes with TAR were shown to be stronger Tat competitors than those forming tight ones, and thermal denaturation studies demonstrated that loose complexes are more stable than tight ones. This could be correlated to the fact that loose and tight ligands induce distinct RNA conformational changes as revealed by circular dichroism experiments, although nuclear magnetic resonance (NMR) experiments showed that the TAR binding site is the same in all cases. Finally, some loose PAA also display promising inhibitory activities on HIV-infected cells. Altogether, these results lead to a better understanding of RNA interaction modes that could be very useful for devising new ligands of relevant RNA targets. PMID:23605042
Pascale, Lise; Azoulay, Stéphane; Di Giorgio, Audrey; Zenacker, Laura; Gaysinski, Marc; Clayette, Pascal; Patino, Nadia
2013-06-01
RNA is a major drug target, but the design of small molecules that modulate RNA function remains a great challenge. In this context, a series of structurally homologous 'polyamide amino acids' (PAA) was studied as HIV-1 trans-activating response (TAR) RNA ligands. An extensive thermodynamic study revealed the occurence of an enthalpy-entropy compensation phenomenon resulting in very close TAR affinities for all PAA. However, their binding modes and their ability to compete with the Tat fragment strongly differ according to their structure. Surprisingly, PAA that form loose complexes with TAR were shown to be stronger Tat competitors than those forming tight ones, and thermal denaturation studies demonstrated that loose complexes are more stable than tight ones. This could be correlated to the fact that loose and tight ligands induce distinct RNA conformational changes as revealed by circular dichroism experiments, although nuclear magnetic resonance (NMR) experiments showed that the TAR binding site is the same in all cases. Finally, some loose PAA also display promising inhibitory activities on HIV-infected cells. Altogether, these results lead to a better understanding of RNA interaction modes that could be very useful for devising new ligands of relevant RNA targets.
Predicting permanent and transient protein-protein interfaces.
La, David; Kong, Misun; Hoffman, William; Choi, Youn Im; Kihara, Daisuke
2013-05-01
Protein-protein interactions (PPIs) are involved in diverse functions in a cell. To optimize functional roles of interactions, proteins interact with a spectrum of binding affinities. Interactions are conventionally classified into permanent and transient, where the former denotes tight binding between proteins that result in strong complexes, whereas the latter compose of relatively weak interactions that can dissociate after binding to regulate functional activity at specific time point. Knowing the type of interactions has significant implications for understanding the nature and function of PPIs. In this study, we constructed amino acid substitution models that capture mutation patterns at permanent and transient type of protein interfaces, which were found to be different with statistical significance. Using the substitution models, we developed a novel computational method that predicts permanent and transient protein binding interfaces (PBIs) in protein surfaces. Without knowledge of the interacting partner, the method uses a single query protein structure and a multiple sequence alignment of the sequence family. Using a large dataset of permanent and transient proteins, we show that our method, BindML+, performs very well in protein interface classification. A very high area under the curve (AUC) value of 0.957 was observed when predicted protein binding sites were classified. Remarkably, near prefect accuracy was achieved with an AUC of 0.991 when actual binding sites were classified. The developed method will be also useful for protein design of permanent and transient PBIs. Copyright © 2013 Wiley Periodicals, Inc.
Chen, Chunhong; Newell, Kim; Lawrence, Gregory J.; Ellis, Jeffrey G.; Anderson, Peter A.; Dodds, Peter N.
2016-01-01
NOD-like receptors (NLRs) are central components of the plant immune system. L6 is a Toll/interleukin-1 receptor (TIR) domain-containing NLR from flax (Linum usitatissimum) conferring immunity to the flax rust fungus. Comparison of L6 to the weaker allele L7 identified two polymorphic regions in the TIR and the nucleotide binding (NB) domains that regulate both effector ligand-dependent and -independent cell death signaling as well as nucleotide binding to the receptor. This suggests that a negative functional interaction between the TIR and NB domains holds L7 in an inactive/ADP-bound state more tightly than L6, hence decreasing its capacity to adopt the active/ATP-bound state and explaining its weaker activity in planta. L6 and L7 variants with a more stable ADP-bound state failed to bind to AvrL567 in yeast two-hybrid assays, while binding was detected to the signaling active variants. This contrasts with current models predicting that effectors bind to inactive receptors to trigger activation. Based on the correlation between nucleotide binding, effector interaction, and immune signaling properties of L6/L7 variants, we propose that NLRs exist in an equilibrium between ON and OFF states and that effector binding to the ON state stabilizes this conformation, thereby shifting the equilibrium toward the active form of the receptor to trigger defense signaling. PMID:26744216
Maximizing the information learned from finite data selects a simple model
NASA Astrophysics Data System (ADS)
Mattingly, Henry H.; Transtrum, Mark K.; Abbott, Michael C.; Machta, Benjamin B.
2018-02-01
We use the language of uninformative Bayesian prior choice to study the selection of appropriately simple effective models. We advocate for the prior which maximizes the mutual information between parameters and predictions, learning as much as possible from limited data. When many parameters are poorly constrained by the available data, we find that this prior puts weight only on boundaries of the parameter space. Thus, it selects a lower-dimensional effective theory in a principled way, ignoring irrelevant parameter directions. In the limit where there are sufficient data to tightly constrain any number of parameters, this reduces to the Jeffreys prior. However, we argue that this limit is pathological when applied to the hyperribbon parameter manifolds generic in science, because it leads to dramatic dependence on effects invisible to experiment.
Universal Sign Control of Coupling in Tight-Binding Lattices
NASA Astrophysics Data System (ADS)
Keil, Robert; Poli, Charles; Heinrich, Matthias; Arkinstall, Jake; Weihs, Gregor; Schomerus, Henning; Szameit, Alexander
2016-05-01
We present a method of locally inverting the sign of the coupling term in tight-binding systems, by means of inserting a judiciously designed ancillary site and eigenmode matching of the resulting vertex triplet. Our technique can be universally applied to all lattice configurations, as long as the individual sites can be detuned. We experimentally verify this method in laser-written photonic lattices and confirm both the magnitude and the sign of the coupling by interferometric measurements. Based on these findings, we demonstrate how such universal sign-flipped coupling links can be embedded into extended lattice structures to impose a Z2-gauge transformation. This opens a new avenue for investigations on topological effects arising from magnetic fields with aperiodic flux patterns or in disordered systems.
Assessment of the Density Functional Tight Binding Method for Protic Ionic Liquids
2015-01-01
Density functional tight binding (DFTB), which is ∼100–1000 times faster than full density functional theory (DFT), has been used to simulate the structure and properties of protic ionic liquid (IL) ions, clusters of ions and the bulk liquid. Proton affinities for a wide range of IL cations and anions determined using DFTB generally reproduce G3B3 values to within 5–10 kcal/mol. The structures and thermodynamic stabilities of n-alkyl ammonium nitrate clusters (up to 450 quantum chemical atoms) predicted with DFTB are in excellent agreement with those determined using DFT. The IL bulk structure simulated using DFTB with periodic boundary conditions is in excellent agreement with published neutron diffraction data. PMID:25328497
Modeling Tight Junction Dynamics and Oscillations
Kassab, Fuad; Marques, Ricardo Paulino; Lacaz-Vieira, Francisco
2002-01-01
Tight junction (TJ) permeability responds to changes of extracellular Ca2+ concentration. This can be gauged through changes of the transepithelial electrical conductance (G) determined in the absence of apical Na+. The early events of TJ dynamics were evaluated by the fast Ca2+ switch assay (FCSA) (Lacaz-Vieira, 2000), which consists of opening the TJs by removing basal calcium (Ca2+ bl) and closing by returning Ca2+ bl to normal values. Oscillations of TJ permeability were observed when Ca2+ bl is removed in the presence of apical calcium (Ca2+ ap) and were interpreted as resulting from oscillations of a feedback control loop which involves: (a) a sensor (the Ca2+ binding sites of zonula adhaerens), (b) a control unit (the cell signaling machinery), and (c) an effector (the TJs). A mathematical model to explain the dynamical behavior of the TJs and oscillations was developed. The extracellular route (ER), which comprises the paracellular space in series with the submucosal interstitial fluid, was modeled as a continuous aqueous medium having the TJ as a controlled barrier located at its apical end. The ER was approximated as a linear array of cells. The most apical cell is separated from the apical solution by the TJ and this cell bears the Ca2+ binding sites of zonula adhaerens that control the TJs. According to the model, the control unit receives information from the Ca2+ binding sites and delivers a signal that regulates the TJ barrier. Ca2+ moves along the ER according to one-dimensional diffusion following Fick's second law. Across the TJ, Ca2+ diffusion follows Fick's first law. Our first approach was to simulate the experimental results in a semiquantitative way. The model tested against experiment results performed in the frog urinary bladder adequately predicts the responses obtained in different experimental conditions, such as: (a) TJ opening and closing in a FCSA, (b) opening by the presence of apical Ca2+ and attainment of a new steady-state, (c) the escape phase which follows the halt of TJ opening induced by apical Ca2+, (d) the oscillations of TJ permeability, and (e) the effect of Ca2+ ap concentration on the frequency of oscillations. PMID:12149284
Acevedo-Luna, Natalia; Mariño-Ramírez, Leonardo; Halbert, Armand; Hansen, Ulla; Landsman, David; Spouge, John L
2016-11-21
Transcription factors (TFs) form complexes that bind regulatory modules (RMs) within DNA, to control specific sets of genes. Some transcription factor binding sites (TFBSs) near the transcription start site (TSS) display tight positional preferences relative to the TSS. Furthermore, near the TSS, RMs can co-localize TFBSs with each other and the TSS. The proportion of TFBS positional preferences due to TFBS co-localization within RMs is unknown, however. ChIP experiments confirm co-localization of some TFBSs genome-wide, including near the TSS, but they typically examine only a few TFs at a time, using non-physiological conditions that can vary from lab to lab. In contrast, sequence analysis can examine many TFs uniformly and methodically, broadly surveying the co-localization of TFBSs with tight positional preferences relative to the TSS. Our statistics found 43 significant sets of human motifs in the JASPAR TF Database with positional preferences relative to the TSS, with 38 preferences tight (±5 bp). Each set of motifs corresponded to a gene group of 135 to 3304 genes, with 42/43 (98%) gene groups independently validated by DAVID, a gene ontology database, with FDR < 0.05. Motifs corresponding to two TFBSs in a RM should co-occur more than by chance alone, enriching the intersection of the gene groups corresponding to the two TFs. Thus, a gene-group intersection systematically enriched beyond chance alone provides evidence that the two TFs participate in an RM. Of the 903 = 43*42/2 intersections of the 43 significant gene groups, we found 768/903 (85%) pairs of gene groups with significantly enriched intersections, with 564/768 (73%) intersections independently validated by DAVID with FDR < 0.05. A user-friendly web site at http://go.usa.gov/3kjsH permits biologists to explore the interaction network of our TFBSs to identify candidate subunit RMs. Gene duplication and convergent evolution within a genome provide obvious biological mechanisms for replicating an RM near the TSS that binds a particular TF subunit. Of all intersections of our 43 significant gene groups, 85% were significantly enriched, with 73% of the significant enrichments independently validated by gene ontology. The co-localization of TFBSs within RMs therefore likely explains much of the tight TFBS positional preferences near the TSS.
NASA Astrophysics Data System (ADS)
Cortes-Huerto, R.; Sondon, T.; Saúl, A.
2013-12-01
The effect of temperature on the formation and growth of monoatomic chains is investigated by extensive molecular dynamics simulations using a semiempirical potential based on the second-moment approximation to the tight-binding Hamiltonian. Gold nanowires, with an aspect ratio of ˜13 and a cross section of ˜1 nm2, are stretched at a rate of 3 m /s in the range of temperatures 5-600 K with 50 initial configurations per temperature. A detailed study on the probability to form monoatomic chains (MACs) is presented. Two domains are apparent in our simulations: one at T <100 K, where MACs develop from crystalline disorder at the constriction, and the other at T >100 K, where MACs form as a consequence of plastic deformation of the nanowire. Our results show that the average length of the formed MACs maximizes at T =150 K, which is supported by simple energy arguments.
Dynamics and Molecular Determinants of Cytoplasmic Lipid Droplet Clustering and Dispersion
Stefanski, Adrianne L.; McManaman, James L.
2013-01-01
Perilipin-1 (Plin1), a prominent cytoplasmic lipid droplet (CLD) binding phosphoprotein and key physiological regulator of triglyceride storage and lipolysis in adipocytes, is thought to regulate the fragmentation and dispersion of CLD that occurs in response to β-adrenergic activation of adenylate cyclase. Here we investigate the dynamics and molecular determinants of these processes using cell lines stably expressing recombinant forms of Plin1 and/or other members of the perilipin family. Plin1 and a C-terminal CLD-binding fragment of Plin1 (Plin1CT) induced formation of single dense CLD clusters near the microtubule organizing center, whereas neither an N-terminal CLD-binding fragment of Plin1, nor Plin2 or Plin3 induced clustering. Clustered CLD coated by Plin1, or Plin1CT, dispersed in response to isoproterenol, or other agents that activate adenylate cyclase, in a process inhibited by the protein kinase A inhibitor, H89, and blocked by microtubule disruption. Isoproterenol-stimulated phosphorylation of CLD-associated Plin1 on serine 492 preceded their dispersion, and live cell imaging showed that cluster dispersion involved initial fragmentation of tight clusters into multiple smaller clusters, which then fragmented into well-dispersed individual CLD. siRNA knockdown of the cortical actin binding protein, moesin, induced disaggregation of tight clusters into multiple smaller clusters, and inhibited the reaggregation of dispersed CLD into tight clusters. Together these data suggest that the clustering and dispersion processes involve a complex orchestration of phosphorylation-dependent, microtubule-dependent and independent, and microfilament dependent steps. PMID:23825572
Suetomi, Takeshi; Yano, Masafumi; Uchinoumi, Hitoshi; Fukuda, Masakazu; Hino, Akihiro; Ono, Makoto; Xu, Xiaojuan; Tateishi, Hiroki; Okuda, Shinichi; Doi, Masahiro; Kobayashi, Shigeki; Ikeda, Yasuhiho; Yamamoto, Takeshi; Ikemoto, Noriaki; Matsuzaki, Masunori
2011-01-01
Background The molecular mechanism by which catecholaminergic polymorphic ventricular tachycardia (CPVT) is induced by single amino acid mutations within the cardiac ryanodine receptor (RyR2) remains elusive. Here, we investigated mutation-induced conformational defects of RyR2 using a knock-in (KI) mouse model expressing the human CPVT-associated RyR2 mutant (S2246L; Serine to Leucine mutation at the residue 2246). Methods and Results All KI mice we examined produced VT after exercise on a treadmill. cAMP-dependent increase in the frequency of Ca2+ sparks was more pronounced in saponin-permeabilized KI cardiomyocytes than in WT cardiomyocytes. Site-directed fluorescent labeling and quartz microbalance assays of the specific binding of DP2246 (a peptide corresponding to the 2232–2266 region: the 2246 domain) showed that DP2246 binds with the K201-binding sequence of RyR2 (1741– 2270). Introduction of S2246L mutation into the DP2246 increased the affinity of peptide binding. Fluorescence quench assays of inter-domain interactions within RyR2 showed that tight interaction of the 2246 domain/K201-binding domain is coupled with domain unzipping of the N-terminal (1-600)/central (2000–2500) domain pair in an allosteric manner. Dantrolene corrected the mutation-caused domain unzipping of the domain switch, and stopped the exercise-induced ventricular tachycardia. Conclusions The CPVT-linked mutation of RyR2, S2246L, causes an abnormally tight local sub-domain/sub-domain interaction within the central domain involving the mutation site, which induces defective interaction between the N-terminal and central domains. This results in an erroneous activation of Ca2+ channel in a diastolic state reflecting on the increased Ca2+ spark frequency, which then leads to lethal arrhythmia. PMID:21768539
Suetomi, Takeshi; Yano, Masafumi; Uchinoumi, Hitoshi; Fukuda, Masakazu; Hino, Akihiro; Ono, Makoto; Xu, Xiaojuan; Tateishi, Hiroki; Okuda, Shinichi; Doi, Masahiro; Kobayashi, Shigeki; Ikeda, Yasuhiro; Yamamoto, Takeshi; Ikemoto, Noriaki; Matsuzaki, Masunori
2011-08-09
The molecular mechanism by which catecholaminergic polymorphic ventricular tachycardia is induced by single amino acid mutations within the cardiac ryanodine receptor (RyR2) remains elusive. In the present study, we investigated mutation-induced conformational defects of RyR2 using a knockin mouse model expressing the human catecholaminergic polymorphic ventricular tachycardia-associated RyR2 mutant (S2246L; serine to leucine mutation at the residue 2246). All knockin mice we examined produced ventricular tachycardia after exercise on a treadmill. cAMP-dependent increase in the frequency of Ca²⁺ sparks was more pronounced in saponin-permeabilized knockin cardiomyocytes than in wild-type cardiomyocytes. Site-directed fluorescent labeling and quartz microbalance assays of the specific binding of DP2246 (a peptide corresponding to the 2232 to 2266 region: the 2246 domain) showed that DP2246 binds with the K201-binding sequence of RyR2 (1741 to 2270). Introduction of S2246L mutation into the DP2246 increased the affinity of peptide binding. Fluorescence quench assays of interdomain interactions within RyR2 showed that tight interaction of the 2246 domain/K201-binding domain is coupled with domain unzipping of the N-terminal (1 to 600)/central (2000 to 2500) domain pair in an allosteric manner. Dantrolene corrected the mutation-caused domain unzipping of the domain switch and stopped the exercise-induced ventricular tachycardia. The catecholaminergic polymorphic ventricular tachycardia-linked mutation of RyR2, S2246L, causes an abnormally tight local subdomain-subdomain interaction within the central domain involving the mutation site, which induces defective interaction between the N-terminal and central domains. This results in an erroneous activation of Ca²⁺ channel in a diastolic state reflecting on the increased Ca²⁺ spark frequency, which then leads to lethal arrhythmia.
Surface passivation for tight-binding calculations of covalent solids.
Bernstein, N
2007-07-04
Simulation of a cluster representing a finite portion of a larger covalently bonded system requires the passivation of the cluster surface. We compute the effects of an explicit hybrid orbital passivation (EHOP) on the atomic structure in a model bulk, three-dimensional, narrow gap semiconductor, which is very different from the wide gap, quasi-one-dimensional organic molecules where most passivation schemes have been studied in detail. The EHOP approach is directly applicable to minimal atomic orbital basis methods such as tight-binding. Each broken bond is passivated by a hybrid created from an explicitly expressed linear combination of basis orbitals, chosen to represent the contribution of the missing neighbour, e.g. a sp(3) hybrid for a single bond. The method is tested by computing the forces on atoms near a point defect as a function of cluster geometry. We show that, compared to alternatives such as pseudo-hydrogen passivation, the force on an atom converges to the correct bulk limit more quickly as a function of cluster radius, and that the force is more stable with respect to perturbations in the position of the cluster centre. The EHOP method also obviates the need for parameterizing the interactions between the system atoms and the passivating atoms. The method is useful for cluster calculations of non-periodic defects in large systems and for hybrid schemes that simulate large systems by treating finite regions with a quantum-mechanical model, coupled to an interatomic potential description of the rest of the system.
Surface passivation for tight-binding calculations of covalent solids
NASA Astrophysics Data System (ADS)
Bernstein, N.
2007-07-01
Simulation of a cluster representing a finite portion of a larger covalently bonded system requires the passivation of the cluster surface. We compute the effects of an explicit hybrid orbital passivation (EHOP) on the atomic structure in a model bulk, three-dimensional, narrow gap semiconductor, which is very different from the wide gap, quasi-one-dimensional organic molecules where most passivation schemes have been studied in detail. The EHOP approach is directly applicable to minimal atomic orbital basis methods such as tight-binding. Each broken bond is passivated by a hybrid created from an explicitly expressed linear combination of basis orbitals, chosen to represent the contribution of the missing neighbour, e.g. a sp3 hybrid for a single bond. The method is tested by computing the forces on atoms near a point defect as a function of cluster geometry. We show that, compared to alternatives such as pseudo-hydrogen passivation, the force on an atom converges to the correct bulk limit more quickly as a function of cluster radius, and that the force is more stable with respect to perturbations in the position of the cluster centre. The EHOP method also obviates the need for parameterizing the interactions between the system atoms and the passivating atoms. The method is useful for cluster calculations of non-periodic defects in large systems and for hybrid schemes that simulate large systems by treating finite regions with a quantum-mechanical model, coupled to an interatomic potential description of the rest of the system.
NASA Astrophysics Data System (ADS)
Dwivedi, Vatsal
This thesis presents some work on two quite disparate kinds of dynamical systems described by Hamiltonian dynamics. The first part describes a computation of gauge anomalies and their macroscopic effects in a semiclassical picture. The geometric (symplectic) formulation of classical mechanics is used to describe the dynamics of Weyl fermions in even spacetime dimensions, the only quantum input to the symplectic form being the Berry curvature that encodes the spin-momentum locking. The (semi-)classical equations of motion are used in a kinetic theory setup to compute the gauge and singlet currents, whose conservation laws reproduce the nonabelian gauge and singlet anomalies. Anomalous contributions to the hydrodynamic currents for a gas of Weyl fermions at a finite temperature and chemical potential are also calculated, and are in agreement with similar results in literature which were obtained using thermodynamic and/or quantum field theoretical arguments. The second part describes a generalized transfer matrix formalism for noninteracting tight-binding models. The formalism is used to study the bulk and edge spectra, both of which are encoded in the spectrum of the transfer matrices, for some of the common tight-binding models for noninteracting electronic topological phases of matter. The topological invariants associated with the boundary states are interpreted as winding numbers for windings around noncontractible loops on a Riemann sheet constructed using the algebraic structure of the transfer matrices, as well as with a Maslov index on a symplectic group manifold, which is the space of transfer matrices.
Simulation studies of carbon nanotube field-effect transistors
NASA Astrophysics Data System (ADS)
John, David Llewellyn
Simulation studies of carbon nanotube field-effect transistors (CNFETs) are presented using models of increasing rigour and versatility that have been systematically developed. Firstly, it is demonstrated how one may compute the standard tight-binding band structure. From this foundation, a self-consistent solution for computing the equilibrium energy band diagram of devices with Schottky-barrier source and drain contacts is developed. While this does provide insight into the likely behaviour of CNFETs, a non-equilibrium model is required in order to predict the current-voltage relation. To this end, the effective-mass approximation is utilized, where a parabolic fit to the band structure is used in order to develop a Schrodinger-Poisson solver. This model is employed to predict both DC behaviour and switching times for CNFETs, and was one of the first models that captured quantum effects, such as tunneling and resonance, in these devices. In addition, this model has been used in order to validate compact models that incorporated tunneling via the WKB approximation. A modified WKB derivation is provided in order to account for the non-zero reflection of carriers above a potential energy step. In order to allow for greater flexibility in the CNFET geometries, and to lift the effective-mass approximation, a non-equilibrium Green's function method is finally developed, which uses an atomistic tight-binding Hamiltonian to model doped-contact, as opposed to Schottky-barrier-contact, devices. This approach benefits by being able to account for both inter- and intra-band tunneling, and by utilizing a quadratic matrix equation in order to improve the computation time for the required self-energy matrices. Within this technique, an expression for the local inter-atomic current is derived in order to provide more detailed information than the usual compact expression for the terminal current. With this final model, an investigation is presented into the effects of geometrical variations, contact thicknesses, and azimuthal variation in the surface potential of the nanotube.
Simulation optimization of spherical non-polar guest recognition by deep-cavity cavitands
Wanjari, Piyush P.; Gibb, Bruce C.; Ashbaugh, Henry S.
2013-01-01
Biomimetic deep-cavity cavitand hosts possess unique recognition and encapsulation properties that make them capable of selectively binding a range of non-polar guests within their hydrophobic pocket. Adamantane based derivatives which snuggly fit within the pocket of octa-acid deep cavity cavitands exhibit some of the strongest host binding. Here we explore the roles of guest size and attractiveness on optimizing guest binding to form 1:1 complexes with octa-acid cavitands in water. Specifically we simulate the water-mediated interactions of the cavitand with adamantane and a range of simple Lennard-Jones guests of varying diameter and attractive well-depth. Initial simulations performed with methane indicate hydrated methanes preferentially reside within the host pocket, although these guests frequently trade places with water and other methanes in bulk solution. The interaction strength of hydrophobic guests increases with increasing size from sizes slightly smaller than methane to Lennard-Jones guests comparable in size to adamantane. Over this guest size range the preferential guest binding location migrates from the bottom of the host pocket upwards. For guests larger than adamantane, however, binding becomes less favorable as the minimum in the potential-of-mean force shifts to the cavitand face around the portal. For a fixed guest diameter, the Lennard-Jones well-depth is found to systematically shift the guest-host potential-of-mean force to lower free energies, however, the optimal guest size is found to be insensitive to increasing well-depth. Ultimately our simulations show that adamantane lies within the optimal range of guest sizes with significant attractive interactions to match the most tightly bound Lennard-Jones guests studied. PMID:24359375
Dislocation Onset and Glide in Carbon Nanotubes under Torsion
NASA Astrophysics Data System (ADS)
Dumitrica, Traian; Zhang, Dong-Bo; James, Richard
2009-03-01
The torsional plastic response of carbon nanotubes is comprehensively described in the objective molecular dynamics framework [1-3]. It is shown that an (n,m) tube is prone to slip along a nearly-axial helical path, which introduces a distinct (+1,-1) change in the wrapping index. The low energy realization occurs without loss of mass, via nucleation of a 5-7-7-5 dislocation dipole, followed by a nearly-axial glide of the 5-7 dislocation. The onset of plasticity depends not only on chirality but also on handedness. For a given handedness of the applied twist, chiral tubes of opposed handedness are most susceptible to yield. A right-handed applied twist on an armchair (zig-zag) tube leads to a right- (left-) handed tube. [4pt] [1] T. Dumitrica and R.D. James, Objective Molecular Dynamics, Journal of the Mechanics and Physics of Solids 55, 2206 (2007). [0pt] [2] D.-B. Zhang, M. Hua, and T. Dumitrica, Stability of Polycrystalline and Wurtzite Si Nanowires via Symmetry-Adapted Tight-Binding Objective Molecular Dynamics, Journal of Chemical Physics 128, 084104 (2008). [0pt] [3] D.-B. Zhang and T. Dumitrica, Elasticity of Ideal Single-Walled Carbon Nanotubes via Symmetry-Adapted Tight-Binding Objective Modeling, Applied Physics Letters 93, 031919 (2008).
Afzalian, A; Vasen, T; Ramvall, P; Shen, T-M; Wu, J; Passlack, M
2018-06-27
We report the capability to simulate in a quantum-mechanical atomistic fashion record-large nanowire devices, featuring several hundred to millions of atoms and a diameter up to 18.2 nm. We have employed a tight-binding mode-space NEGF technique demonstrating by far the fastest (up to 10 000 × faster) but accurate (error < 1%) atomistic simulations to date. Such technique and capability opens new avenues to explore and understand the physics of nanoscale and mesoscopic devices dominated by quantum effects. In particular, our method addresses in an unprecedented way the technologically-relevant case of band-to-band tunneling (BTBT) in III-V nanowire broken-gap heterojunction tunnel-FETs (HTFETs). We demonstrate an accurate match of simulated BTBT currents to experimental measurements in a 12 nm diameter InAs NW and in an InAs/GaSb Esaki tunneling diode. We apply our TB MS simulations and report the first in-depth atomistic study of the scaling potential of III-V GAA nanowire HTFETs including the effect of electron-phonon scattering and discrete dopant impurity band tails, quantifying the benefits of this technology for low-power low-voltage CMOS applications.
Quantum Hall effect in ac driven graphene: From the half-integer to the integer case
NASA Astrophysics Data System (ADS)
Ding, Kai-He; Lim, Lih-King; Su, Gang; Weng, Zheng-Yu
2018-01-01
We theoretically study the quantum Hall effect (QHE) in graphene with an ac electric field. Based on the tight-binding model, the structure of the half-integer Hall plateaus at σxy=±(n +1 /2 ) 4 e2/h (n is an integer) gets qualitatively changed with the addition of new integer Hall plateaus at σxy=±n (4 e2/h ) starting from the edges of the band center regime towards the band center with an increasing ac field. Beyond a critical field strength, a Hall plateau with σxy=0 can be realized at the band center, hence fully restoring a conventional integer QHE with particle-hole symmetry. Within a low-energy Hamiltonian for Dirac cones merging, we show a very good agreement with the tight-binding calculations for the Hall plateau transitions. We also obtain the band structure for driven graphene ribbons to provide a further understanding on the appearance of the new Hall plateaus, showing a trivial insulator behavior for the σxy=0 state. In the presence of disorder, we numerically study the disorder-induced destruction of the quantum Hall states in a finite driven sample and find that qualitative features known in the undriven disordered case are maintained.
NASA Astrophysics Data System (ADS)
Afzalian, A.; Vasen, T.; Ramvall, P.; Shen, T.-M.; Wu, J.; Passlack, M.
2018-06-01
We report the capability to simulate in a quantum-mechanical atomistic fashion record-large nanowire devices, featuring several hundred to millions of atoms and a diameter up to 18.2 nm. We have employed a tight-binding mode-space NEGF technique demonstrating by far the fastest (up to 10 000 × faster) but accurate (error < 1%) atomistic simulations to date. Such technique and capability opens new avenues to explore and understand the physics of nanoscale and mesoscopic devices dominated by quantum effects. In particular, our method addresses in an unprecedented way the technologically-relevant case of band-to-band tunneling (BTBT) in III–V nanowire broken-gap heterojunction tunnel-FETs (HTFETs). We demonstrate an accurate match of simulated BTBT currents to experimental measurements in a 12 nm diameter InAs NW and in an InAs/GaSb Esaki tunneling diode. We apply our TB MS simulations and report the first in-depth atomistic study of the scaling potential of III–V GAA nanowire HTFETs including the effect of electron–phonon scattering and discrete dopant impurity band tails, quantifying the benefits of this technology for low-power low-voltage CMOS applications.
Regulation of tight junction assembly and epithelial morphogenesis by the heat shock protein Apg-2
Aijaz, Saima; Sanchez-Heras, Elena; Balda, Maria S; Matter, Karl
2007-01-01
Background Tight junctions are required for epithelial barrier formation and participate in the regulation of signalling mechanisms that control proliferation and differentiation. ZO-1 is a tight junction-associated adaptor protein that regulates gene expression, junction assembly and epithelial morphogenesis. We have previously demonstrated that the heat shock protein Apg-2 binds ZO-1 and thereby regulates its role in cell proliferation. Here, we addressed the question whether Apg-2 is also important for junction formation and epithelial morphogenesis. Results We demonstrate that depletion of Apg-2 by RNAi in MDCK cells did not prevent formation of functional tight junctions. Similar to ZO-1, however, reduced expression of Apg-2 retarded de novo junction assembly if analysed in a Ca-switch model. Formation of functional junctions, as monitored by measuring transepithelial electrical resistance, and recruitment of tight and adherens junction markers were retarded. If cultured in three dimensional extracellular matrix gels, Apg-2 depleted cells, as previously shown for ZO-1 depleted cells, did not form hollow polarised cysts but poorly organised, irregular structures. Conclusion Our data indicate that Apg-2 regulates junction assembly and is required for normal epithelial morphogenesis in a three-dimensional culture system, suggesting that Apg-2 is an important regulator of epithelial differentiation. As the observed phenotypes are similar to those previously described for ZO-1 depleted cells and depletion of Apg-2 retards junctional recruitment of ZO-1, regulation of ZO-1 is likely to be an important functional role for Apg-2 during epithelial differentiation. PMID:18028534
Regulation of tight junction assembly and epithelial morphogenesis by the heat shock protein Apg-2.
Aijaz, Saima; Sanchez-Heras, Elena; Balda, Maria S; Matter, Karl
2007-11-20
Tight junctions are required for epithelial barrier formation and participate in the regulation of signalling mechanisms that control proliferation and differentiation. ZO-1 is a tight junction-associated adaptor protein that regulates gene expression, junction assembly and epithelial morphogenesis. We have previously demonstrated that the heat shock protein Apg-2 binds ZO-1 and thereby regulates its role in cell proliferation. Here, we addressed the question whether Apg-2 is also important for junction formation and epithelial morphogenesis. We demonstrate that depletion of Apg-2 by RNAi in MDCK cells did not prevent formation of functional tight junctions. Similar to ZO-1, however, reduced expression of Apg-2 retarded de novo junction assembly if analysed in a Ca-switch model. Formation of functional junctions, as monitored by measuring transepithelial electrical resistance, and recruitment of tight and adherens junction markers were retarded. If cultured in three dimensional extracellular matrix gels, Apg-2 depleted cells, as previously shown for ZO-1 depleted cells, did not form hollow polarised cysts but poorly organised, irregular structures. Our data indicate that Apg-2 regulates junction assembly and is required for normal epithelial morphogenesis in a three-dimensional culture system, suggesting that Apg-2 is an important regulator of epithelial differentiation. As the observed phenotypes are similar to those previously described for ZO-1 depleted cells and depletion of Apg-2 retards junctional recruitment of ZO-1, regulation of ZO-1 is likely to be an important functional role for Apg-2 during epithelial differentiation.
Structure and Ligand Binding Properties of the Epoxidase Component of Styrene Monooxygenase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ukaegbu, Uchechi E.; Kantz, Auric; Beaton, Michelle
2010-07-23
Styrene monooxygenase (SMO) is a two-component flavoprotein monooxygenase that transforms styrene to styrene oxide in the first step of the styrene catabolic and detoxification pathway of Pseudomonas putida S12. The crystal structure of the N-terminally histidine-tagged epoxidase component of this system, NSMOA, determined to 2.3 {angstrom} resolution, indicates the enzyme exists as a homodimer in which each monomer forms two distinct domains. The overall architecture is most similar to that of p-hydroxybenzoate hydroxylase (PHBH), although there are some significant differences in secondary structure. Structural comparisons suggest that a large cavity open to the surface forms the FAD binding site. Atmore » the base of this pocket is another cavity that likely represents the styrene binding site. Flavin binding and redox equilibria are tightly coupled such that reduced FAD binds apo NSMOA {approx}8000 times more tightly than the oxidized coenzyme. Equilibrium fluorescence and isothermal titration calorimetry data using benzene as a substrate analogue indicate that the oxidized flavin and substrate analogue binding equilibria of NSMOA are linked such that the binding affinity of each is increased by 60-fold when the enzyme is saturated with the other. A much weaker {approx}2-fold positive cooperative interaction is observed for the linked binding equilibria of benzene and reduced FAD. The low affinity of the substrate analogue for the reduced FAD complex of NSMOA is consistent with a preferred reaction order in which flavin reduction and reaction with oxygen precede the binding of styrene, identifying the apoenzyme structure as the key catalytic resting state of NSMOA poised to bind reduced FAD and initiate the oxygen reaction.« less
The Role of Competitive Inhibition and Top-Down Feedback in Binding during Object Recognition
Wyatte, Dean; Herd, Seth; Mingus, Brian; O’Reilly, Randall
2012-01-01
How does the brain bind together visual features that are processed concurrently by different neurons into a unified percept suitable for processes such as object recognition? Here, we describe how simple, commonly accepted principles of neural processing can interact over time to solve the brain’s binding problem. We focus on mechanisms of neural inhibition and top-down feedback. Specifically, we describe how inhibition creates competition among neural populations that code different features, effectively suppressing irrelevant information, and thus minimizing illusory conjunctions. Top-down feedback contributes to binding in a similar manner, but by reinforcing relevant features. Together, inhibition and top-down feedback contribute to a competitive environment that ensures only the most appropriate features are bound together. We demonstrate this overall proposal using a biologically realistic neural model of vision that processes features across a hierarchy of interconnected brain areas. Finally, we argue that temporal synchrony plays only a limited role in binding – it does not simultaneously bind multiple objects, but does aid in creating additional contrast between relevant and irrelevant features. Thus, our overall theory constitutes a solution to the binding problem that relies only on simple neural principles without any binding-specific processes. PMID:22719733
Surface Passivation in Empirical Tight Binding
NASA Astrophysics Data System (ADS)
He, Yu; Tan, Yaohua; Jiang, Zhengping; Povolotskyi, Michael; Klimeck, Gerhard; Kubis, Tillmann
2016-03-01
Empirical Tight Binding (TB) methods are widely used in atomistic device simulations. Existing TB methods to passivate dangling bonds fall into two categories: 1) Method that explicitly includes passivation atoms is limited to passivation with atoms and small molecules only. 2) Method that implicitly incorporates passivation does not distinguish passivation atom types. This work introduces an implicit passivation method that is applicable to any passivation scenario with appropriate parameters. This method is applied to a Si quantum well and a Si ultra-thin body transistor oxidized with SiO2 in several oxidation configurations. Comparison with ab-initio results and experiments verifies the presented method. Oxidation configurations that severely hamper the transistor performance are identified. It is also shown that the commonly used implicit H atom passivation overestimates the transistor performance.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rüger, Robert, E-mail: rueger@scm.com; Department of Theoretical Chemistry, Vrije Universiteit Amsterdam, De Boelelaan 1083, 1081 HV Amsterdam; Wilhelm-Ostwald-Institut für Physikalische und Theoretische Chemie, Linnéstr. 2, 04103 Leipzig
2016-05-14
We propose a new method of calculating electronically excited states that combines a density functional theory based ground state calculation with a linear response treatment that employs approximations used in the time-dependent density functional based tight binding (TD-DFTB) approach. The new method termed time-dependent density functional theory TD-DFT+TB does not rely on the DFTB parametrization and is therefore applicable to systems involving all combinations of elements. We show that the new method yields UV/Vis absorption spectra that are in excellent agreement with computationally much more expensive TD-DFT calculations. Errors in vertical excitation energies are reduced by a factor of twomore » compared to TD-DFTB.« less
Non-collinear magnetism with analytic Bond-Order Potentials
NASA Astrophysics Data System (ADS)
Ford, Michael E.; Pettifor, D. G.; Drautz, Ralf
2015-03-01
The theory of analytic Bond-Order Potentials as applied to non-collinear magnetic structures of transition metals is extended to take into account explicit rotations of Hamiltonian and local moment matrix elements between locally and globally defined spin-coordinate systems. Expressions for the gradients of the energy with respect to the Hamiltonian matrix elements, the interatomic forces and the magnetic torques are derived. The method is applied to simulations of the rotation of magnetic moments in α iron, as well as α and β manganese, based on d-valent orthogonal tight-binding parametrizations of the electronic structure. A new weighted-average terminator is introduced to improve the convergence of the Bond-Order Potential energies and torques with respect to tight-binding reference values, although the general behavior is qualitatively correct for low-moment expansions.
NASA Astrophysics Data System (ADS)
Yahagi, Y.; Miura, D.; Sakuma, A.
2018-05-01
We investigated the anisotropic magnetoresistance (AMR) effects in ferromagnetic-metal multi-layers stacked on non-magnetic insulators in the context of microscopic theory. We represented this situation with tight-binding models that included the exchange and Rashba fields, where the Rashba field was assumed to originate from spin-orbit interactions as junction effects with the insulator. To describe the AMR ratios, the DC conductivity was calculated based on the Kubo formula. As a result, we showed that the Rashba field induced both perpendicular and in-plane AMR effects and that the perpendicular AMR effect rapidly decayed with increasing film thickness.
Marinsky, J.A.; Reddy, M.M.
1984-01-01
We summarize here experimental studies of proton and metal ion binding to a peat and a humic acid. Data analysis is based on a unified physico-chemical model for reaction of simple ions with polyelectrolytes employing a modified Henderson-Hasselbalch equation. Peat exhibited an apparent intrinsic acid dissociation constant of 10-4.05, and an apparent intrinsic metal ion binding constant of: 400 for cadmium ion; 600 for zinc ion; 4000 for copper ion; 20000 for lead ion. A humic acid was found to have an apparent intrinsic proton binding constant of 10-2.6. Copper ion binding to this humic acid sample occurred at two types of sites. The first site exhibited reaction characteristics which were independent of solution pH and required the interaction of two ligands on the humic acid matrix to simultaneously complex with each copper ion. The second complex species is assumed to be a simple monodentate copper ion-carboxylate species with a stability constant of 18. ?? 1984.
A simple and efficient method to enhance audiovisual binding tendencies
Wozny, David R.; Shams, Ladan
2017-01-01
Individuals vary in their tendency to bind signals from multiple senses. For the same set of sights and sounds, one individual may frequently integrate multisensory signals and experience a unified percept, whereas another individual may rarely bind them and often experience two distinct sensations. Thus, while this binding/integration tendency is specific to each individual, it is not clear how plastic this tendency is in adulthood, and how sensory experiences may cause it to change. Here, we conducted an exploratory investigation which provides evidence that (1) the brain’s tendency to bind in spatial perception is plastic, (2) that it can change following brief exposure to simple audiovisual stimuli, and (3) that exposure to temporally synchronous, spatially discrepant stimuli provides the most effective method to modify it. These results can inform current theories about how the brain updates its internal model of the surrounding sensory world, as well as future investigations seeking to increase integration tendencies. PMID:28462016
Stochastic Model of Supercoiling-Dependent Transcription
NASA Astrophysics Data System (ADS)
Brackley, C. A.; Johnson, J.; Bentivoglio, A.; Corless, S.; Gilbert, N.; Gonnella, G.; Marenduzzo, D.
2016-07-01
We propose a stochastic model for gene transcription coupled to DNA supercoiling, where we incorporate the experimental observation that polymerases create supercoiling as they unwind the DNA helix and that these enzymes bind more favorably to regions where the genome is unwound. Within this model, we show that when the transcriptionally induced flux of supercoiling increases, there is a sharp crossover from a regime where torsional stresses relax quickly and gene transcription is random, to one where gene expression is highly correlated and tightly regulated by supercoiling. In the latter regime, the model displays transcriptional bursts, waves of supercoiling, and up regulation of divergent or bidirectional genes. It also predicts that topological enzymes which relax twist and writhe should provide a pathway to down regulate transcription.
Effect of an ADP analog on isometric force and ATPase activity of active muscle fibers.
Karatzaferi, Christina; Myburgh, Kathryn H; Chinn, Marc K; Franks-Skiba, Kathleen; Cooke, Roger
2003-04-01
The role played by ADP in modulating cross-bridge function has been difficult to study, because it is hard to buffer ADP concentration in skinned muscle preparations. To solve this, we used an analog of ADP, spin-labeled ADP (SL-ADP). SL-ADP binds tightly to myosin but is a very poor substrate for creatine kinase or pyruvate kinase. Thus ATP can be regenerated, allowing well-defined concentrations of both ATP and SL-ADP. We measured isometric ATPase rate and isometric tension as a function of both [SL-ADP], 0.1-2 mM, and [ATP], 0.05-0.5 mM, in skinned rabbit psoas muscle, simulating fresh or fatigued states. Saturating levels of SL-ADP increased isometric tension (by P'), the absolute value of P' being nearly constant, approximately 0.04 N/mm(2), in variable ATP levels, pH 7. Tension decreased (50-60%) at pH 6, but upon addition of SL-ADP, P' was still approximately 0.04 N/mm(2). The ATPase was inhibited competitively by SL-ADP with an inhibition constant, K(i), of approximately 240 and 280 microM at pH 7 and 6, respectively. Isometric force and ATPase activity could both be fit by a simple model of cross-bridge kinetics.
2008-06-01
Ciencia e Ingenieria de los Materiales , Universidad de Costa Rica, San Jose, Costa Rica. We have developed a new unifying tight-binding theory that...Fisico Matem6ticas, Universidad Aut6noma de Nuevo Le6n, San Nicolas de los Garza, Nuevo LeAfA3n, Mexico; 2Chemical Engineering Department and Texas...ORNL), Oak Ridge, Tennessee; 2Departamento de Ciencia de los Materiales e IM y QI, Universidad de Cadiz, Puerto Real, Cadiz, Spain; 3Departamento de
Green's function calculations for semi-infinite carbon nanotubes
NASA Astrophysics Data System (ADS)
John, D. L.; Pulfrey, D. L.
2006-02-01
In the modeling of nanoscale electronic devices, the non-equilibrium Green's function technique is gaining increasing popularity. One complication in this method is the need for computation of the self-energy functions that account for the interactions between the active portion of a device and its leads. In the one-dimensional case, these functions may be computed analytically. In higher dimensions, a numerical approach is required. In this work, we generalize earlier methods that were developed for tight-binding Hamiltonians, and present results for the case of a carbon nanotube.
Polarizable atomistic calculation of site energy disorder in amorphous Alq3.
Nagata, Yuki
2010-02-01
A polarizable molecular dynamics simulation and calculation scheme for site energy disorder is presented in amorphous tris(8-hydroxyquinolinato)aluminum (Alq(3)) by means of the charge response kernel (CRK) method. The CRK fit to the electrostatic potential and the tight-binding approximation are introduced, which enables modeling of the polarizable electrostatic interaction for a large molecule systematically from an ab initio calculation. The site energy disorder for electron and hole transfers is calculated in amorphous Alq(3) and the effect of the polarization on the site energy disorder is discussed.
Lattice distortion and electron charge redistribution induced by defects in graphene
Zhang, Wei; Lu, Wen -Cai; Zhang, Hong -Xing; ...
2016-09-14
Lattice distortion and electronic charge localization induced by vacancy and embedded-atom defects in graphene were studied by tight-binding (TB) calculations using the recently developed three-center TB potential model. We showed that the formation energies of the defects are strongly correlated with the number of dangling bonds and number of embedded atoms, as well as the magnitude of the graphene lattice distortion induced by the defects. Lastly, we also showed that the defects introduce localized electronic states in the graphene which would affect the electron transport properties of graphene.
Nonlinear susceptibilities of finite conjugated organic polymers
NASA Technical Reports Server (NTRS)
Beratan, David N.; Onuchic, Jose Nelson; Perry, Joseph W.
1987-01-01
Tight-binding calculations of the length dependence of the third-order molecular hyperpolarizability for polyenes and polyynes are reported. The pi-electron wave functions were determined by exploiting the limited translational symmetry of the molecules. Perturbation theory was used to calculate the longitudinal component of the electronic nonresonant hyperpolarizability. This is the first two-'band' calculation of third-order hyperpolarizabilities on finite pi-electron systems of varying length. In contrast to the results of the one-'band' models, the hyperpolarizability densities increase rapidly and then, after about 10-15 repeating units, approach an asymptotic value.
Many-body instabilities and mass generation in slow Dirac materials
NASA Astrophysics Data System (ADS)
Triola, Christopher; Zhu, Jian-Xin; Migliori, Albert; Balatsky, Alexander V.
2015-07-01
Some Kondo insulators are expected to possess topologically protected surface states with linear Dirac spectrum: the topological Kondo insulators. Because the bulk states of these systems typically have heavy effective electron masses, the surface states may exhibit extraordinarily small Fermi velocities that could force the effective fine structure constant of the surface states into the strong coupling regime. Using a tight-binding model, we study the many-body instabilities of these systems and identify regions of parameter space in which the system exhibits spin density wave and charge density wave order.
Molecular dynamics simulations of dense plasmas
DOE Office of Scientific and Technical Information (OSTI.GOV)
Collins, L.A.; Kress, J.D.; Kwon, I.
1993-12-31
We have performed quantum molecular dynamics simulations of hot, dense plasmas of hydrogen over a range of temperatures(0.1-5eV) and densities(0.0625-5g/cc). We determine the forces quantum mechanically from density functional, extended Huckel, and tight binding techniques and move the nuclei according to the classical equations of motion. We determine pair-correlation functions, diffusion coefficients, and electrical conductivities. We find that many-body effects predominate in this regime. We begin to obtain agreement with the OCP and Thomas-Fermi models only at the higher temperatures and densities.
Spin-polarized transport in multiterminal silicene nanodevices
NASA Astrophysics Data System (ADS)
Xu, Ning
2018-01-01
The spin-polarized transport properties of multiterminal silicene nanodevices are studied using the tight binding model and Landauer-Buttier approach. We propose a four-terminal †-shaped junction device and two types of three-terminal T-shaped junction devices, which are made of the crossing of a zigzag and an armchair silicene nanoribbon. If the electrons are injected into the metallic lead, the near-perfect spin polarization with 100% around the Fermi energy can be achieved easily at the other semiconducting leads. Thus the multiterminal silicene nanodevices can act as controllable spin filters.
Khatri, Bhavin S.; Goldstein, Richard A.
2015-01-01
Speciation is fundamental to understanding the huge diversity of life on Earth. Although still controversial, empirical evidence suggests that the rate of speciation is larger for smaller populations. Here, we explore a biophysical model of speciation by developing a simple coarse-grained theory of transcription factor-DNA binding and how their co-evolution in two geographically isolated lineages leads to incompatibilities. To develop a tractable analytical theory, we derive a Smoluchowski equation for the dynamics of binding energy evolution that accounts for the fact that natural selection acts on phenotypes, but variation arises from mutations in sequences; the Smoluchowski equation includes selection due to both gradients in fitness and gradients in sequence entropy, which is the logarithm of the number of sequences that correspond to a particular binding energy. This simple consideration predicts that smaller populations develop incompatibilities more quickly in the weak mutation regime; this trend arises as sequence entropy poises smaller populations closer to incompatible regions of phenotype space. These results suggest a generic coarse-grained approach to evolutionary stochastic dynamics, allowing realistic modelling at the phenotypic level. PMID:25936759
Ding, Junjie; Wang, Yi; Lin, Weiwei; Wang, Changlian; Zhao, Limei; Li, Xingang; Zhao, Zhigang; Miao, Liyan; Jiao, Zheng
2015-03-01
Valproic acid (VPA) follows a non-linear pharmacokinetic profile in terms of protein-binding saturation. The total daily dose regarding VPA clearance is a simple power function, which may partially explain the non-linearity of the pharmacokinetic profile; however, it may be confounded by the therapeutic drug monitoring effect. The aim of this study was to develop a population pharmacokinetic model for VPA based on protein-binding saturation in pediatric patients with epilepsy. A total of 1,107 VPA serum trough concentrations at steady state were collected from 902 epileptic pediatric patients aged from 3 weeks to 14 years at three hospitals. The population pharmacokinetic model was developed using NONMEM(®) software. The ability of three candidate models (the simple power exponent model, the dose-dependent maximum effect [DDE] model, and the protein-binding model) to describe the non-linear pharmacokinetic profile of VPA was investigated, and potential covariates were screened using a stepwise approach. Bootstrap, normalized prediction distribution errors and external evaluations from two independent studies were performed to determine the stability and predictive performance of the candidate models. The age-dependent exponent model described the effects of body weight and age on the clearance well. Co-medication with carbamazepine was identified as a significant covariate. The DDE model best fitted the aim of this study, although there were no obvious differences in the predictive performances. The condition number was less than 500, and the precision of the parameter estimates was less than 30 %, indicating stability and validity of the final model. The DDE model successfully described the non-linear pharmacokinetics of VPA. Furthermore, the proposed population pharmacokinetic model of VPA can be used to design rational dosage regimens to achieve desirable serum concentrations.
Clavería-Gimeno, Rafael; Velazquez-Campoy, Adrian; Pey, Angel Luis
2017-12-15
The stability of human flavoproteins strongly depends on flavin levels, although the structural and energetic basis of this relationship is poorly understood. Here, we report an in-depth analysis on the thermodynamics of FAD binding to one of the most representative examples of such relationship, NAD(P)H:quinone oxidoreductase 1 (NQO1). NQO1 is a dimeric enzyme that tightly binds FAD, which triggers large structural changes upon binding. A common cancer-associated polymorphism (P187S) severely compromises FAD binding. We show that FAD binding is described well by a thermodynamic model explicitly incorporating binding cooperativity when applied to different sets of calorimetric analyses and NQO1 variants, thus providing insight on the effects in vitro and in cells of cancer-associated P187S, its suppressor mutation H80R and the role of NQO1 C-terminal domain to modulate binding cooperativity and energetics. Furthermore, we show that FAD binding to NQO1 is very sensitive to physiologically relevant environmental conditions, such as the presence of phosphate buffer and salts. Overall, our results contribute to understanding at the molecular level the link between NQO1 stability and fluctuations of FAD levels intracellularly, and supports the notion that FAD binding energetics and cooperativity are fundamentally linked with the dynamic nature of apo-NQO1 conformational ensemble. Copyright © 2017 Elsevier Inc. All rights reserved.
Singh, Jasmeet; Ranganathan, Radha; Hajdu, Joseph
2008-12-25
Activity at micellar interfaces of bacterial phospholipase C from Bacillus cereus on phospholipids solubilized in micelles was investigated with the goal of elucidating the role of the interface microstructure and developing further an existing kinetic model. Enzyme kinetics and physicochemical characterization of model substrate aggregates were combined, thus enabling the interpretation of kinetics in the context of the interface. Substrates were diacylphosphatidylcholine of different acyl chain lengths in the form of mixed micelles with dodecyldimethylammoniopropanesulfonate. An early kinetic model, reformulated to reflect the interfacial nature of the kinetics, was applied to the kinetic data. A better method of data treatment is proposed, use of which makes the presence of microstructure effects quite transparent. Models for enzyme-micelle binding and enzyme-lipid binding are developed, and expressions incorporating the microstructural properties are derived for the enzyme-micelle dissociation constant K(s) and the interface Michaelis-Menten constant, K(M). Use of these expressions in the interface kinetic model brings excellent agreement between the kinetic data and the model. Numerical values for the thermodynamic and kinetic parameters are determined. Enzyme-lipid binding is found to be an activated process with an acyl chain length dependent free energy of activation that decreases with micelle lipid molar fraction with a coefficient of about -15RT and correlates with the tightness of molecular packing in the substrate aggregate. Thus, the physical insight obtained includes a model for the kinetic parameters that shows that these parameters depend on the substrate concentration and acyl chain length of the lipid. Enzyme-micelle binding is indicated to be hydrophobic and solvent mediated with a dissociation constant of 1.2 mM.
Insight into nuclear body formation of phytochromes through stochastic modelling and experiment.
Grima, Ramon; Sonntag, Sebastian; Venezia, Filippo; Kircher, Stefan; Smith, Robert W; Fleck, Christian
2018-05-01
Spatial relocalization of proteins is crucial for the correct functioning of living cells. An interesting example of spatial ordering is the light-induced clustering of plant photoreceptor proteins. Upon irradiation by white or red light, the red light-active phytochrome, phytochrome B, enters the nucleus and accumulates in large nuclear bodies. The underlying physical process of nuclear body formation remains unclear, but phytochrome B is thought to coagulate via a simple protein-protein binding process. We measure, for the first time, the distribution of the number of phytochrome B-containing nuclear bodies as well as their volume distribution. We show that the experimental data cannot be explained by a stochastic model of nuclear body formation via simple protein-protein binding processes using physically meaningful parameter values. Rather modelling suggests that the data is consistent with a two step process: a fast nucleation step leading to macroparticles followed by a subsequent slow step in which the macroparticles bind to form the nuclear body. An alternative explanation for the observed nuclear body distribution is that the phytochromes bind to a so far unknown molecular structure. We believe it is likely this result holds more generally for other nuclear body-forming plant photoreceptors and proteins. Creative Commons Attribution license.
Tight-binding molecular-dynamics study of point defects in GaAs
NASA Astrophysics Data System (ADS)
Seong, Hyangsuk; Lewis, Laurent J.
1995-08-01
Tight-binding molecular-dynamics simulations at 0 K have been performed in order to study the effect of defects (vacancies and antisites) in different states of charge on the electronic and structural properties of GaAs. Relaxations are fully included in the model, and for each defect we calculate the local atomic structure, the volume change upon relaxing, the formation energy (including chemical potential contributions), and the ionization levels. We find Ga vacancies to relax by an amount which is independent of the state of charge, consistent with positron lifetime measurements. Our calculations also predict Ga vacancies to exhibit a negative-U effect, and to assume a triply negative charge state for most values of the electron chemical potential. The relaxation of As vacancies, on the contrary, depends sensitively on the state of charge. The model confirms the two experimentally observed ionization levels for this defect, just below the conduction-band minimum. Likewise, Ga antisites exhibit large relaxations. In fact, in the neutral state, relaxation is so large that it leads to a ``broken-bond'' configuration, in excellent accord with the first-principles calculations of Zhang and Chadi [Phys. Rev. Lett. 64, 1789 (1990)]. This system also exhibits a negative-U effect, for values of the electron chemical potential near midgap. For As antisites, we find only a weak relaxation, independent of the charge. The model predicts the neutral state of the defect to be the ground state for values of the electron chemical potential near and above midgap, which supports the view that the EL2 defect is a neutral As antisite. Upon comparing the formation energies of the various defects we finally find that, for all values of the atomic chemical potentials, antisites are most likely to occur than vacancies.
Communication: Photoinduced carbon dioxide binding with surface-functionalized silicon quantum dots.
Douglas-Gallardo, Oscar A; Sánchez, Cristián Gabriel; Vöhringer-Martinez, Esteban
2018-04-14
Nowadays, the search for efficient methods able to reduce the high atmospheric carbon dioxide concentration has turned into a very dynamic research area. Several environmental problems have been closely associated with the high atmospheric level of this greenhouse gas. Here, a novel system based on the use of surface-functionalized silicon quantum dots (sf-SiQDs) is theoretically proposed as a versatile device to bind carbon dioxide. Within this approach, carbon dioxide trapping is modulated by a photoinduced charge redistribution between the capping molecule and the silicon quantum dots (SiQDs). The chemical and electronic properties of the proposed SiQDs have been studied with a Density Functional Theory and Density Functional Tight-Binding (DFTB) approach along with a time-dependent model based on the DFTB framework. To the best of our knowledge, this is the first report that proposes and explores the potential application of a versatile and friendly device based on the use of sf-SiQDs for photochemically activated carbon dioxide fixation.
Kinetics and Mechanism of Mammalian Mitochondrial Ribosome Assembly.
Bogenhagen, Daniel F; Ostermeyer-Fay, Anne G; Haley, John D; Garcia-Diaz, Miguel
2018-02-13
Mammalian mtDNA encodes only 13 proteins, all essential components of respiratory complexes, synthesized by mitochondrial ribosomes. Mitoribosomes contain greatly truncated RNAs transcribed from mtDNA, including a structural tRNA in place of 5S RNA as a scaffold for binding 82 nucleus-encoded proteins, mitoribosomal proteins (MRPs). Cryoelectron microscopy (cryo-EM) studies have determined the structure of the mitoribosome, but its mechanism of assembly is unknown. Our SILAC pulse-labeling experiments determine the rates of mitochondrial import of MRPs and their assembly into intact mitoribosomes, providing a basis for distinguishing MRPs that bind at early and late stages in mitoribosome assembly to generate a working model for mitoribosome assembly. Mitoribosome assembly is a slow process initiated at the mtDNA nucleoid driven by excess synthesis of individual MRPs. MRPs that are tightly associated in the structure frequently join the complex in a coordinated manner. Clinically significant MRP mutations reported to date affect proteins that bind early on during assembly. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Communication: Photoinduced carbon dioxide binding with surface-functionalized silicon quantum dots
NASA Astrophysics Data System (ADS)
Douglas-Gallardo, Oscar A.; Sánchez, Cristián Gabriel; Vöhringer-Martinez, Esteban
2018-04-01
Nowadays, the search for efficient methods able to reduce the high atmospheric carbon dioxide concentration has turned into a very dynamic research area. Several environmental problems have been closely associated with the high atmospheric level of this greenhouse gas. Here, a novel system based on the use of surface-functionalized silicon quantum dots (sf-SiQDs) is theoretically proposed as a versatile device to bind carbon dioxide. Within this approach, carbon dioxide trapping is modulated by a photoinduced charge redistribution between the capping molecule and the silicon quantum dots (SiQDs). The chemical and electronic properties of the proposed SiQDs have been studied with a Density Functional Theory and Density Functional Tight-Binding (DFTB) approach along with a time-dependent model based on the DFTB framework. To the best of our knowledge, this is the first report that proposes and explores the potential application of a versatile and friendly device based on the use of sf-SiQDs for photochemically activated carbon dioxide fixation.
Bao, Yongbo; Liu, Xiao; Zhang, Weiwei; Cao, Jianping; Li, Wei; Li, Chenghua; Lin, Zhihua
2016-01-01
Clam, a filter-feeding lamellibranch mollusk, is capable to accumulate high levels of trace metals and has therefore become a model for investigation the mechanism of heavy metal toxification. In this study, the effects of cadmium were characterized in the gills of Tegillarca granosa during a 96-hour exposure course using integrated metabolomic and proteomic approaches. Neurotoxicity and disturbances in energy metabolism were implicated according to the metabolic responses after Cd exposure, and eventually affected the osmotic function of gill tissue. Proteomic analysis showed that oxidative stress, calcium-binding and sulfur-compound metabolism proteins were key factors responding to Cd challenge. A knowledge-based network regulation model was constructed with both metabolic and proteomic data. The model suggests that Cd stimulation mainly inhibits a core regulation network that is associated with histone function, ribosome processing and tight junctions, with the hub proteins actin, gamma 1 and Calmodulin 1. Moreover, myosin complex inhibition causes abnormal tight junctions and is linked to the irregular synthesis of amino acids. For the first time, this study provides insight into the proteomic and metabolomic changes caused by Cd in the blood clam T. granosa and suggests a potential toxicological pathway for Cd. PMID:27760991
Anisotropy of fluctuation dynamics of proteins with an elastic network model.
Atilgan, A R; Durell, S R; Jernigan, R L; Demirel, M C; Keskin, O; Bahar, I
2001-01-01
Fluctuations about the native conformation of proteins have proven to be suitably reproduced with a simple elastic network model, which has shown excellent agreement with a number of different properties for a wide variety of proteins. This scalar model simply investigates the magnitudes of motion of individual residues in the structure. To use the elastic model approach further for developing the details of protein mechanisms, it becomes essential to expand this model to include the added details of the directions of individual residue fluctuations. In this paper a new tool is presented for this purpose and applied to the retinol-binding protein, which indicates enhanced flexibility in the region of entry to the ligand binding site and for the portion of the protein binding to its carrier protein. PMID:11159421
NASA Astrophysics Data System (ADS)
Stegmann, Thomas; Franco-Villafañe, John A.; Kuhl, Ulrich; Mortessagne, Fabrice; Seligman, Thomas H.
2017-01-01
Electron transport in small graphene nanoribbons is studied by microwave emulation experiments and tight-binding calculations. In particular, it is investigated under which conditions a transport gap can be observed. Our experiments provide evidence that armchair ribbons of width 3 m +2 with integer m are metallic and otherwise semiconducting, whereas zigzag ribbons are metallic independent of their width. The contact geometry, defining to which atoms at the ribbon edges the source and drain leads are attached, has strong effects on the transport. If leads are attached only to the inner atoms of zigzag edges, broad transport gaps can be observed in all armchair ribbons as well as in rhomboid-shaped zigzag ribbons. All experimental results agree qualitatively with tight-binding calculations using the nonequilibrium Green's function method.
NASA Astrophysics Data System (ADS)
Chegel, Raad; Behzad, Somayeh
2014-02-01
We investigated the electronic properties of silicon nanotubes (SiNTs) under external transverse electric fields and axial magnetic fields using the tight-binding approximation. It was found that, after switching on the electric and magnetic fields, band modifications such as distortion of degeneracy, change in energy dispersion and subband spacing, and bandgap size reduction occur. The bandgap of silicon gear-like nanotubes (Si g-NTs) decreases linearly with increasing electric field strength, but the bandgap for silicon hexagonal nanotubes (Si h-NTs) first increases and then decreases (metallic) or first remains constant and then decreases (semiconducting). Our results show that the bandgap of Si h-NTs is very sensitive to both electric and magnetic fields, unlike Si g-NTs, which are more sensitive to electric than magnetic fields.
Conductance of three-terminal molecular bridge based on tight-binding theory
NASA Astrophysics Data System (ADS)
Wang, Li-Guang; Li, Yong; Yu, Ding-Wen; Katsunori, Tagami; Masaru, Tsukada
2005-05-01
The quantum transmission characteristic of three-benzene ring nano-molecular bridge is investigated theoretically by using Green's function approach based on tight-binding theory with only a π orbital per carbon atom at the site. The transmission probabilities that electrons transport through the molecular bridge from one terminal to the other two terminals are obtained. The electronic current distributions inside the molecular bridge are calculated and shown in graphical analogy by the current density method based on Fisher-Lee formula at the energy points E = ±0.42, ±1.06 and ±1.5, respectively, where the transmission spectra appear peaks. We find that the transmission spectra are related to the incident electronic energy and the molecular levels strongly and the current distributions agree well with Kirchhoff quantum current momentum conservation law.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ordejon, P.; Lebedenko, D.; Menon, M.
1994-08-15
We present an improvement over the nonorthogonal tight-binding molecular-dynamics scheme recently proposed by Menon and Subbaswamy [Phys. Rev. B 47, 12 754 (1993)]. The proper treatment of the nonorthogonality and its effect on the Hamiltonian matrix elements has been found to obviate the need for a bond-counting term, leaving only two adjustable parameters in the formalism. With the improved parametrization we obtain values of the energies and bonding distances which are in better agreement with the available [ital ab] [ital initio] results for clusters of size up to [ital N]=10. Additionally, we have identified a lowest energy structure for themore » Si[sub 9] cluster, which to our knowledge has not been considered to date. We show that this structure (a distorted tricapped trigonal prism with [ital C][sub 2[ital v
NASA Astrophysics Data System (ADS)
Flechsig, Holger
2016-02-01
ATP-binding cassette (ABC) transporters are integral membrane proteins which mediate the exchange of diverse substrates across membranes powered by ATP molecules. Our understanding of their activity is still hampered since the conformational dynamics underlying the operation of such proteins cannot yet be resolved in detailed molecular dynamics studies. Here a coarse grained model which allows to mimic binding of nucleotides and follow subsequent conformational motions of full-length transporter structures in computer simulations is proposed and implemented. To justify its explanatory quality, the model is first applied to the maltose transporter system for which multiple conformations are known and we find that the model predictions agree remarkably well with the experimental data. For the MalK subunit the switching from open to the closed dimer configuration upon ATP binding is reproduced and, moreover, for the full-length maltose transporter, progression from inward-facing to the outward-facing state is correctly obtained. For the heme transporter HmuUV, for which only the free structure could yet be determined, the model was then applied to predict nucleotide-induced conformational motions. Upon binding of ATP-mimicking ligands the structure changed from a conformation in which the nucleotide-binding domains formed an open shape, to a conformation in which they were found in tight contact, while, at the same time, a pronounced rotation of the transmembrane domains was observed. This finding is supported by normal mode analysis, and, comparison with structural data of the homologous vitamin B12 transporter BtuCD suggests that the observed rotation mechanism may contribute a common functional aspect for this class of ABC transporters. Although in HmuuV noticeable rearrangement of essential transmembrane helices was detected, there are no indications from our simulations that ATP binding alone may facilitate propagation of substrate molecules in this transporter. Possible explanations are discussed in the light of currently debated transport scenarios of ABC transporters.
Kinetic rate constant prediction supports the conformational selection mechanism of protein binding.
Moal, Iain H; Bates, Paul A
2012-01-01
The prediction of protein-protein kinetic rate constants provides a fundamental test of our understanding of molecular recognition, and will play an important role in the modeling of complex biological systems. In this paper, a feature selection and regression algorithm is applied to mine a large set of molecular descriptors and construct simple models for association and dissociation rate constants using empirical data. Using separate test data for validation, the predicted rate constants can be combined to calculate binding affinity with accuracy matching that of state of the art empirical free energy functions. The models show that the rate of association is linearly related to the proportion of unbound proteins in the bound conformational ensemble relative to the unbound conformational ensemble, indicating that the binding partners must adopt a geometry near to that of the bound prior to binding. Mirroring the conformational selection and population shift mechanism of protein binding, the models provide a strong separate line of evidence for the preponderance of this mechanism in protein-protein binding, complementing structural and theoretical studies.
Yoshida, Hisashi; Kawai, Fumihiro; Obayashi, Eiji; Akashi, Satoko; Roper, David I; Tame, Jeremy R H; Park, Sam-Yong
2012-10-26
Staphylococcus aureus is a widespread Gram-positive opportunistic pathogen, and a methicillin-resistant form (MRSA) is particularly difficult to treat clinically. We have solved two crystal structures of penicillin-binding protein (PBP) 3 (PBP3) from MRSA, the apo form and a complex with the β-lactam antibiotic cefotaxime, and used electrospray mass spectrometry to measure its sensitivity to a variety of penicillin derivatives. PBP3 is a class B PBP, possessing an N-terminal non-penicillin-binding domain, sometimes called a dimerization domain, and a C-terminal transpeptidase domain. The model shows a different orientation of its two domains compared to earlier models of other class B PBPs and a novel, larger N-domain. Consistent with the nomenclature of "dimerization domain", the N-terminal region forms an apparently tight interaction with a neighboring molecule related by a 2-fold symmetry axis in the crystal structure. This dimer form is predicted to be highly stable in solution by the PISA server, but mass spectrometry and analytical ultracentrifugation provide unequivocal evidence that the protein is a monomer in solution. Copyright © 2012 Elsevier Ltd. All rights reserved.
Hysteresis in DNA compaction by Dps is described by an Ising model
Vtyurina, Natalia N.; Dulin, David; Docter, Margreet W.; Meyer, Anne S.; Dekker, Nynke H.; Abbondanzieri, Elio A.
2016-01-01
In all organisms, DNA molecules are tightly compacted into a dynamic 3D nucleoprotein complex. In bacteria, this compaction is governed by the family of nucleoid-associated proteins (NAPs). Under conditions of stress and starvation, an NAP called Dps (DNA-binding protein from starved cells) becomes highly up-regulated and can massively reorganize the bacterial chromosome. Although static structures of Dps–DNA complexes have been documented, little is known about the dynamics of their assembly. Here, we use fluorescence microscopy and magnetic-tweezers measurements to resolve the process of DNA compaction by Dps. Real-time in vitro studies demonstrated a highly cooperative process of Dps binding characterized by an abrupt collapse of the DNA extension, even under applied tension. Surprisingly, we also discovered a reproducible hysteresis in the process of compaction and decompaction of the Dps–DNA complex. This hysteresis is extremely stable over hour-long timescales despite the rapid binding and dissociation rates of Dps. A modified Ising model is successfully applied to fit these kinetic features. We find that long-lived hysteresis arises naturally as a consequence of protein cooperativity in large complexes and provides a useful mechanism for cells to adopt unique epigenetic states. PMID:27091987
Epithelial Integrity Is Maintained by a Matriptase-Dependent Proteolytic Pathway
List, Karin; Kosa, Peter; Szabo, Roman; Bey, Alexandra L.; Wang, Chao Becky; Molinolo, Alfredo; Bugge, Thomas H.
2009-01-01
A pericellular proteolytic pathway initiated by the transmembrane serine protease matriptase plays a critical role in the terminal differentiation of epidermal tissues. Matriptase is constitutively expressed in multiple other epithelia, suggesting a putative role of this membrane serine protease in general epithelial homeostasis. Here we generated mice with conditional deletion of the St14 gene, encoding matriptase, and show that matriptase indeed is essential for the maintenance of multiple types of epithelia in the mouse. Thus, embryonic or postnatal ablation of St14 in epithelial tissues of diverse origin and function caused severe organ dysfunction, which was often associated with increased permeability, loss of tight junction function, mislocation of tight junction-associated proteins, and generalized epithelial demise. The study reveals that the homeostasis of multiple simple and stratified epithelia is matriptase-dependent, and provides an important animal model for the exploration of this membrane serine protease in a range of physiological and pathological processes. PMID:19717635
Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai
2010-01-01
DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705
NASA Astrophysics Data System (ADS)
Privalov, Timofei; Gel'mukhanov, Faris; Ågren, Hans
2001-10-01
We have developed a formulation of resonant x-ray Raman scattering of molecules and solids based on the Mahan-Nozières-De Dominicis model. A key step in the formulation is given by a reduction of the Keldysh-Dyson equations for the Green's function to a set of linear algebraic equations. This gave way for a tractable scheme that can be used to analyze the resonant x-ray scattering in the whole time domain. The formalism is used to investigate the role of core-hole relaxation, interference, band filling, detuning, and size of the scattering target. Numerical applications are performed with a one-dimensional tight-binding model.
Ni2C surface carbide to catalyze low-temperature graphene growth
NASA Astrophysics Data System (ADS)
Martinez-Gordillo, Rafael; Varvenne, Céline; Amara, Hakim; Bichara, Christophe
2018-05-01
The possibility to grow a graphene layer using the chemical-vapor-deposition technique over a Ni2C /Ni (111 ) substrate has been identified experimentally, with the advantage of having a lower processing temperature (T <500 ∘C ), compared to standard growth over a Ni (111 ) surface. To understand the role of the metal carbide/metal catalyst, we first perform a static study of the Ni2C /Ni (111 ) structure and of the binding and removal of a carbon atom at the surface, using both a tight-binding (TB) energetic model and ab initio calculations. Grand-canonical Monte Carlo TB simulations then allow us (i) to determine the thermodynamic conditions to grow graphene and (ii) to separate key reaction steps in the growth mechanism explaining how the Ni2C /Ni (111 ) substrate catalyzes graphene formation at low temperature.
Receptor Surface Models in the Classroom: Introducing Molecular Modeling to Students in a 3-D World
ERIC Educational Resources Information Center
Geldenhuys, Werner J.; Hayes, Michael; Van der Schyf, Cornelis J.; Allen, David D.; Malan, Sarel F.
2007-01-01
A simple, novel and generally applicable method to demonstrate structure-activity associations of a group of biologically interesting compounds in relation to receptor binding is described. This method is useful for undergraduates and graduate students in medicinal chemistry and computer modeling programs.
Exploring the limits of the self-consistent Born approximation for inelastic electronic transport
NASA Astrophysics Data System (ADS)
Lee, William; Jean, Nicola; Sanvito, Stefano
2009-02-01
The nonequilibrium Green’s function formalism is today the standard computational method for describing elastic transport in molecular devices. This can be extended to include inelastic scattering by the so-called self-consistent Born approximation (SCBA), where the interaction of the electrons with the vibrations of the molecule is assumed to be weak and it is treated perturbatively. The validity of such assumption and therefore of the SCBA is difficult to establish with certainty. In this work we explore the limitations of the SCBA by using a simple tight-binding model with the electron-phonon coupling strength α chosen as a free parameter. As model devices we consider Au monatomic chains and a H2 molecule sandwiched between Pt electrodes. In both cases, our self-consistent calculations demonstrate a breakdown of the SCBA for large α and we identify a weak and a strong-coupling regime. For weak coupling our SCBA results compare closely with those obtained with exact scattering theory. However in the strong-coupling regime large deviations are found. In particular we demonstrate that there is a critical coupling strength, characteristic of the materials system, beyond which multiple self-consistent solutions can be found depending on the initial conditions in the simulation. These are entirely due to the large contribution of the Hartree self-energy and completely disappear when this is neglected. We attribute this feature to the breakdown of the perturbative expansion leading to the SCBA.
Energy economy in the actomyosin interaction: lessons from simple models.
Lehman, Steven L
2010-01-01
The energy economy of the actomyosin interaction in skeletal muscle is both scientifically fascinating and practically important. This chapter demonstrates how simple cross-bridge models have guided research regarding the energy economy of skeletal muscle. Parameter variation on a very simple two-state strain-dependent model shows that early events in the actomyosin interaction strongly influence energy efficiency, and late events determine maximum shortening velocity. Addition of a weakly-bound state preceding force production allows weak coupling of cross-bridge mechanics and ATP turnover, so that a simple three-state model can simulate the velocity-dependence of ATP turnover. Consideration of the limitations of this model leads to a review of recent evidence regarding the relationship between ligand binding states, conformational states, and macromolecular structures of myosin cross-bridges. Investigation of the fine structure of the actomyosin interaction during the working stroke continues to inform fundamental research regarding the energy economy of striated muscle.
NASA Astrophysics Data System (ADS)
Kroonblawd, Matthew; Goldman, Nir
2017-06-01
First principles molecular dynamics using highly accurate density functional theory (DFT) is a common tool for predicting chemistry, but the accessible time and space scales are often orders of magnitude beyond the resolution of experiments. Semi-empirical methods such as density functional tight binding (DFTB) offer up to a thousand-fold reduction in required CPU hours and can approach experimental scales. However, standard DFTB parameter sets lack good transferability and calibration for a particular system is usually necessary. Force matching the pairwise repulsive energy term in DFTB to short DFT trajectories can improve the former's accuracy for reactions that are fast relative to DFT simulation times (<10 ps), but the effects on slow reactions and the free energy surface are not well-known. We present a force matching approach to improve the chemical accuracy of DFTB. Accelerated sampling techniques are combined with path collective variables to generate the reference DFT data set and validate fitted DFTB potentials. Accuracy of force-matched DFTB free energy surfaces is assessed for slow peptide-forming reactions by direct comparison to DFT for particular paths. Extensions to model prebiotic chemistry under shock conditions are discussed. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.
NASA Astrophysics Data System (ADS)
Kroonblawd, Matthew; Goldman, Nir
First principles molecular dynamics using highly accurate density functional theory (DFT) is a common tool for predicting chemistry, but the accessible time and space scales are often orders of magnitude beyond the resolution of experiments. Semi-empirical methods such as density functional tight binding (DFTB) offer up to a thousand-fold reduction in required CPU hours and can approach experimental scales. However, standard DFTB parameter sets lack good transferability and calibration for a particular system is usually necessary. Force matching the pairwise repulsive energy term in DFTB to short DFT trajectories can improve the former's accuracy for chemistry that is fast relative to DFT simulation times (<10 ps), but the effects on slow chemistry and the free energy surface are not well-known. We present a force matching approach to increase the accuracy of DFTB predictions for free energy surfaces. Accelerated sampling techniques are combined with path collective variables to generate the reference DFT data set and validate fitted DFTB potentials without a priori knowledge of transition states. Accuracy of force-matched DFTB free energy surfaces is assessed for slow peptide-forming reactions by direct comparison to DFT results for particular paths. Extensions to model prebiotic chemistry under shock conditions are discussed. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.
Silva, F W N; Costa, A L M T; Liu, Lei; Barros, E B
2016-11-04
The effects of edge vacancies on the electron transport properties of zigzag MoS2/WSe2 nanoribbons are studied using a density functional theory (DFT)-based tight-binding model with a sp(3)d(5) basis set for the electronic structure calculation and applying the Landauer-Büttiker approach for the electronic transport. Our results show that the presence of a single edge vacancy, with a missing MoS2/WSe2 triplet, is enough to suppress the conductance of the system by almost one half for most energies around the Fermi level. Furthermore, the presence of other single defects along the same edge has little effect on the overall conductance, indicating that the conductance of that particular edge has been strongly suppressed by the first defect. The presence of another defect on the opposite edge further suppresses the quantum conductance, independently of the relative position between the two defects in opposite edges. The introduction of other defects cause the suppression to be energy dependent, leading to conductance peaks which depend on the geometry of the edges. The strong conductance dependence on the presence of edge defects is corroborated by DFT calculations using SIESTA, which show that the electronic bands near the Fermi energy are strongly localized at the edge.
NASA Astrophysics Data System (ADS)
Kurkcuoglu, Zeynep; Koukos, Panagiotis I.; Citro, Nevia; Trellet, Mikael E.; Rodrigues, J. P. G. L. M.; Moreira, Irina S.; Roel-Touris, Jorge; Melquiond, Adrien S. J.; Geng, Cunliang; Schaarschmidt, Jörg; Xue, Li C.; Vangone, Anna; Bonvin, A. M. J. J.
2018-01-01
We present the performance of HADDOCK, our information-driven docking software, in the second edition of the D3R Grand Challenge. In this blind experiment, participants were requested to predict the structures and binding affinities of complexes between the Farnesoid X nuclear receptor and 102 different ligands. The models obtained in Stage1 with HADDOCK and ligand-specific protocol show an average ligand RMSD of 5.1 Å from the crystal structure. Only 6/35 targets were within 2.5 Å RMSD from the reference, which prompted us to investigate the limiting factors and revise our protocol for Stage2. The choice of the receptor conformation appeared to have the strongest influence on the results. Our Stage2 models were of higher quality (13 out of 35 were within 2.5 Å), with an average RMSD of 4.1 Å. The docking protocol was applied to all 102 ligands to generate poses for binding affinity prediction. We developed a modified version of our contact-based binding affinity predictor PRODIGY, using the number of interatomic contacts classified by their type and the intermolecular electrostatic energy. This simple structure-based binding affinity predictor shows a Kendall's Tau correlation of 0.37 in ranking the ligands (7th best out of 77 methods, 5th/25 groups). Those results were obtained from the average prediction over the top10 poses, irrespective of their similarity/correctness, underscoring the robustness of our simple predictor. This results in an enrichment factor of 2.5 compared to a random predictor for ranking ligands within the top 25%, making it a promising approach to identify lead compounds in virtual screening.
The role of JAM-A in inflammatory bowel disease: unrevealing the ties that bind.
Vetrano, Stefania; Danese, Silvio
2009-05-01
Tight junctions (TJ) are junctional proteins whose function is to maintain an intact intestinal epithelial barrier and regulate the paracellular movement of water and solutes. Altered TJ structure and epithelial permeability are observed in inflammatory bowel disease and seem to have an important role in the pathogenesis of these diseases. Junctional adhesion molecule-A (JAM-A) is a protein expressed at tight junctions of epithelial and endothelial cells, as well as on circulating leukocytes. Its function at tight junctions appears to be crucial as an extracellular adhesive molecule in the direct regulation of intestinal barrier function. This review focuses on the role of JAM-A in controlling mucosal homeostasis by regulating the integrity and permeability of epithelial barrier function.
Hopton, Suzanne R; Thompson, Andrew S
2011-05-17
Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.
Medhi, Amal; Shenoy, Vijay B
2012-09-05
We develop a continuum theory to model low energy excitations of a generic four-band time reversal invariant electronic system with boundaries. We propose a variational energy functional for the wavefunctions which allows us to derive natural boundary conditions valid for such systems. Our formulation is particularly suited for developing a continuum theory of the protected edge/surface excitations of topological insulators both in two and three dimensions. By a detailed comparison of our analytical formulation with tight binding calculations of ribbons of topological insulators modelled by the Bernevig-Hughes-Zhang (BHZ) Hamiltonian, we show that the continuum theory with a natural boundary condition provides an appropriate description of the low energy physics.
NASA Astrophysics Data System (ADS)
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
NASA Astrophysics Data System (ADS)
Faúndez, J.; Jorge, T. N.; Craco, L.
2018-03-01
Using the tight-binding treatment for the spin-asymmetric Hubbard model we explore the effect of electronic interactions in the ferromagnetic, partially filled Lieb lattice. As a key result we demonstrate the formation of correlation satellites in the minority spin channel. In addition, we consider the role played by transverse-field spin fluctuations in metallic ferromagnets. We quantify the degree of electronic demagnetization, showing that the half-metallic state is rather robust to local spin flips. Not being restricted to the case of a partially filled Lieb lattice, our findings are expected to advance the general understanding of spin-selective electronic reconstruction in strongly correlated quantum ferromagnets.
Theory of nanotube faraday cage
NASA Astrophysics Data System (ADS)
Roxana Margine, Elena; Nisoli, Cristiano; Kolmogorov, Aleksey; Crespi, Vincent H.
2003-03-01
Charge transfer between dopants and double-wall carbon nanotubes is examined theoretically. We model the system as a triple cylindrical capacitor with the dopants forming a shell around the outer wall of the nanotube. The total energy of the system contains three terms: the band structure energies of the inner and outer tube, calculated in a tight-binding model with rigid bands, and the electrostatic energy of the tri-layer distribution. Even for metallic inner and outer tube walls, wherein the diameter dependence of the bandgap does not favor the outer wall, nearly all of the dopant charge resides on the outer layer, a nanometer-scale Faraday cage. The calculated charge distribution is in agreement with recent experimental measurements.
Weisshart, Klaus; Chow, Connie S.; Coen, Donald M.
1999-01-01
Herpes simplex virus DNA polymerase consists of a catalytic subunit, Pol, and a processivity subunit, UL42, that, unlike other established processivity factors, binds DNA directly. We used gel retardation and filter-binding assays to investigate how UL42 affects the polymerase-DNA interaction. The Pol/UL42 heterodimer bound more tightly to DNA in a primer-template configuration than to single-stranded DNA (ssDNA), while Pol alone bound more tightly to ssDNA than to DNA in a primer-template configuration. The affinity of Pol/UL42 for ssDNA was reduced severalfold relative to that of Pol, while the affinity of Pol/UL42 for primer-template DNA was increased ∼15-fold relative to that of Pol. The affinity of Pol/UL42 for circular double-stranded DNA (dsDNA) was reduced drastically relative to that of UL42, but the affinity of Pol/UL42 for short primer-templates was increased modestly relative to that of UL42. Pol/UL42 associated with primer-template DNA ∼2-fold faster than did Pol and dissociated ∼10-fold more slowly, resulting in a half-life of 2 h and a subnanomolar Kd. Despite such stable binding, rapid-quench analysis revealed that the rates of elongation of Pol/UL42 and Pol were essentially the same, ∼30 nucleotides/s. Taken together, these studies indicate that (i) Pol/UL42 is more likely than its subunits to associate with DNA in a primer-template configuration rather than nonspecifically to either ssDNA or dsDNA, and (ii) UL42 reduces the rate of dissociation from primer-template DNA but not the rate of elongation. Two models of polymerase-DNA interactions during replication that may explain these findings are presented. PMID:9847307
Nishimura, Shigehiko; Yamamoto, Takeshi; Nakamura, Yoshihide; Kohno, Michiaki; Hamada, Yoriomi; Sufu, Yoko; Fukui, Go; Nanno, Takuma; Ishiguchi, Hironori; Kato, Takayoshi; Xu, Xiaojuan; Ono, Makoto; Oda, Tetsuro; Okuda, Shinichi; Kobayashi, Shigeki; Yano, Masafumi
2018-06-01
Ryanodine receptor (RyR2) is known to be a causal gene of catecholaminergic polymorphic ventricular tachycardia (CPVT), an important inherited disease. Some of the human CPVT-associated mutations have been found in a domain (4026-4172) that has EF hand motifs, the so-called calmodulin (CaM)-like domain (CaMLD). The purpose of this study was to investigate the underlying mechanism by which CPVT is induced by a mutation at CaMLD. A new N4103K/+ knock-in (KI) mice model was generated. Sustained ventricular tachycardia was frequently observed after infusion of caffeine plus epinephrine in KI mice. Endogenous CaM bound to RyR2 decreased even at baseline in isolated KI cardiomyocytes. Ca 2+ spark frequency (CaSpF) was much higher in KI cells than in wild-type cells. Addition of GSH-CaM (higher affinity CaM to RyR2) significantly decreased CaSpF. In response to isoproterenol, spontaneous Ca 2+ transient (SCaT) was frequently observed in intact KI cells. Incorporation of GSH-CaM into intact KI cells using a protein delivery kit decreased SCaT significantly. An assay using a quartz crystal microbalance technique revealed that mutated CaMLD peptide showed higher binding affinity to CaM binding domain (CaMBD) peptide. In the N4103K mutant, CaM binding affinity to RyR2 was significantly reduced regardless of beta-adrenergic stimulation. We found that this was caused by an abnormally tight interaction between CaMBD and mutated CaM-like domain (N4103K-CaMBD). Thus, CaMBD-CaMLD interaction may be a novel therapeutic target for treatment of lethal arrhythmia. Copyright © 2018 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.
Mukhopadhyay, Abhijit; Yang, Chun-Song; Weiner, Henry
2006-12-01
Previous studies pointed to the importance of leucine residues in the binding of mitochondrial leader sequences to Tom20, an outer membrane protein translocator that initially binds the leader during import. A bacteria two-hybrid assay was here employed to determine if this could be an alternative way to investigate the binding of leader to the receptor. Leucine to alanine and arginine to glutamine mutations were made in the leader sequence from rat liver aldehyde dehydrogenase (pALDH). The leucine residues in the C-terminal of pALDH leader were found to be essential for TOM20 binding. The hydrophobic residues of another mitochondrial leader F1beta-ATPase that were important for Tom20 binding were found at the C-terminus of the leader. In contrast, it was the leucines in the N-terminus of the leader of ornithine transcarbamylase that were essential for binding. Modeling the peptides to the structure of Tom20 showed that the hydrophobic residues from the three proteins could all fit into the hydrophobic binding pocket. The mutants of pALDH that did not bind to Tom20 were still imported in vivo in transformed HeLa cells or in vitro into isolated mitochondria. In contrast, the mutant from pOTC was imported less well ( approximately 50%) while the mutant from F1beta-ATPase was not imported to any measurable extent. Binding to Tom20 might not be a prerequisite for import; however, it also is possible that import can occur even if binding to a receptor component is poor, so long as the leader binds tightly to another component of the translocator.
White, Thomas E; Rojas, Bibiana; Mappes, Johanna; Rautiala, Petri; Kemp, Darrell J
2017-09-01
Much of what we know about human colour perception has come from psychophysical studies conducted in tightly-controlled laboratory settings. An enduring challenge, however, lies in extrapolating this knowledge to the noisy conditions that characterize our actual visual experience. Here we combine statistical models of visual perception with empirical data to explore how chromatic (hue/saturation) and achromatic (luminant) information underpins the detection and classification of stimuli in a complex forest environment. The data best support a simple linear model of stimulus detection as an additive function of both luminance and saturation contrast. The strength of each predictor is modest yet consistent across gross variation in viewing conditions, which accords with expectation based upon general primate psychophysics. Our findings implicate simple visual cues in the guidance of perception amidst natural noise, and highlight the potential for informing human vision via a fusion between psychophysical modelling and real-world behaviour. © 2017 The Author(s).
Deng, Ge; Dyroff, Samantha L; Lockart, Molly; Bowman, Michael K; Vincent, John B
2016-11-01
Chromium (III) has been shown to act as a pharmacological agent improving insulin sensitivity in rodent models of obesity, insulin resistance, and diabetes. To act in beneficial fashion, chromium must reach insulin-sensitive tissues. Chromium is transported from the bloodstream to the tissues by the iron-transport protein transferrin. When blood concentrations of glucose are high (as in a diabetic subject), transferrin can be glycated, modifying its ability to bind and transport iron. However, the effects of glycation of transferrin on its ability to bind and transport Cr have not been examined previously. Storage of transferrin at 37°C in the presence and absence of glucose has significant effects on the binding of Cr. Transferrin stored in the absence of glucose only binds one equivalent of Cr tightly, compared to the normal binding of two equivalents of Cr by transferrin. Glycated transferrin (stored in the presence of glucose) binds two equivalents of Cr but the changes in its extinction coefficient at 245nm that accompany binding suggest that the Cr-bound transferrin possesses a conformation that deviates appreciably from untreated transferrin. These changes have dramatic effects, greatly reducing the ability of transferrin to transport Cr in vivo in rats. The results suggest that glycation of transferrin in subjects with high blood glucose concentrations should reduce the ability of Cr from pharmacological agents to enter tissues. Copyright © 2016 Elsevier Inc. All rights reserved.
Optical properties of drug metabolites in latent fingermarks
Shen, Yao; Ai, Qing
2016-01-01
Drug metabolites usually have structures of split-ring resonators (SRRs), which might lead to negative permittivity and permeability in electromagnetic field. As a result, in the UV-vis region, the latent fingermarks images of drug addicts and non drug users are inverse. The optical properties of latent fingermarks are quite different between drug addicts and non-drug users. This is a technic superiority for crime scene investigation to distinguish them. In this paper, we calculate the permittivity and permeability of drug metabolites using tight-binding model. The latent fingermarks of smokers and non-smokers are given as an example. PMID:26838730
Bipolaron assisted Bloch-like oscillations in organic lattices
NASA Astrophysics Data System (ADS)
Ribeiro, Luiz Antonio; Ferreira da Cunha, Wiliam; Magela e Silva, Geraldo
2017-06-01
The transport of a dissociated bipolaron in organic one-dimensional lattices is theoretically investigated in the scope of a tight-binding model that includes electron-lattice interactions and an external electric field. Remarkably, the results point to a physical picture in which the dissociated bipolaron propagates as a combined state of two free-like electrons that coherently perform spatial Bloch oscillations (BO) above a critical field strength. It was also obtained that the BO's trajectory presents a net forward motion in the direction of the applied electric field. The impact of dynamical disorder in the formation of electronic BOs is determined.
Electronic properties of long DNA nanowires in dry and wet conditions
NASA Astrophysics Data System (ADS)
Mousavi, Hamze; Khodadadi, Jabbar; Grabowski, Marek
2015-11-01
The electronic behavior of the long disordered DNA nanowires in both dry and wet conditions is investigated through the band structure and density of states of a tight-binding Hamiltonian model for π-electrons of the backbone, using Green's functions approach. For a chosen set of parameters in the dry case, semiconducting behavior is reproduced. It is also shown that for sufficiently long strands, the order of the base pairs has no noticeable effect on the energy band-gap. Moreover, this semiconducting duplex shows metallic tendencies when interacting with the environment of polar molecules.
Effect of Hydrogen Adsorption on the Stone-Wales Transformation in Small-Diameter Carbon Nanotubes
NASA Astrophysics Data System (ADS)
Openov, L. A.; Podlivaev, A. I.
2018-04-01
The effect of hydrogenation of (4, 0) and (3, 0) carbon nanotubes on the Stone-Wales transformation is studied in the framework of the nonorthogonal tight-binding model. It is shown that the atomic hydrogen adsorption can lead to both a decrease and an increase in the barriers for the direct and inverse transformations depending on the orientation of a rotating C-C bond with respect to the nanotube axis. The characteristic times of formation and annealing the Stone-Wales defects have been estimated. The Young's moduli have been calculated.
d +i d chiral superconductivity in a triangular lattice from trigonal bipyramidal complexes
NASA Astrophysics Data System (ADS)
Lu, Chen; Zhang, Li-Da; Wu, Xianxin; Yang, Fan; Hu, Jiangping
2018-04-01
We model the newly predicted high-Tc superconducting candidates constructed by corner-shared trigonal bipyramidal complexes with an effective three-orbital tight-binding Hamiltonian and investigate the pairing symmetry of their superconducting states driven by electron-electron interactions. Our combined weak- and strong-coupling-based calculations consistently identify the chiral d +i d superconductivity as the leading pairing symmetry in a wide doping range with realistic interaction parameters. This pairing state has a nontrivial topological Chern number and can host gapless chiral edge modes, and the vortex cores under magnetic field can carry Majorana zero modes.
Anisotropic Nanomechanics of Boron Nitride Nanotubes: Nanostructured "Skin" Effect
NASA Technical Reports Server (NTRS)
Srivastava, Deepak; Menon, Madhu; Cho, KyeongJae
2000-01-01
The stiffness and plasticity of boron nitride nanotubes are investigated using generalized tight-binding molecular dynamics and ab-initio total energy methods. Due to boron-nitride BN bond buckling effects, compressed zigzag BN nanotubes are found to undergo novel anisotropic strain release followed by anisotropic plastic buckling. The strain is preferentially released towards N atoms in the rotated BN bonds. The tubes buckle anisotropically towards only one end when uniaxially compressed from both. A "skin-effect" model of smart nanocomposite materials is proposed which will localize the structural damage towards the 'skin' or surface side of the material.
Observation of interface carrier states in no-common-atom heterostructures ZnSe/BeTe.
Gurevich, A S; Kochereshko, V P; Bleuse, J; Mariette, H; Waag, A; Akimoto, R
2011-09-07
The existence of intrinsic carrier interface states in heterostructures with no common atom at the interface (such as ZnSe/BeTe) is shown experimentally by ellipsometry and photoluminescence spectroscopy. These states are located on interfaces and lie inside the effective bandgap of the structure; they are characterized by a high density and a long lifetime. A tight binding model confirms theoretically the existence of these states in ZnSe/BeTe heterostructures for a ZnTe-type interface, in contrast to the case of the BeSe-type interface for which they do not exist.
Observation of interface carrier states in no-common-atom heterostructures ZnSe/BeTe
NASA Astrophysics Data System (ADS)
Gurevich, A. S.; Kochereshko, V. P.; Bleuse, J.; Mariette, H.; Waag, A.; Akimoto, R.
2011-09-01
The existence of intrinsic carrier interface states in heterostructures with no common atom at the interface (such as ZnSe/BeTe) is shown experimentally by ellipsometry and photoluminescence spectroscopy. These states are located on interfaces and lie inside the effective bandgap of the structure; they are characterized by a high density and a long lifetime. A tight binding model confirms theoretically the existence of these states in ZnSe/BeTe heterostructures for a ZnTe-type interface, in contrast to the case of the BeSe-type interface for which they do not exist.
Many-body instabilities and mass generation in slow Dirac materials
NASA Astrophysics Data System (ADS)
Triola, Christopher; Zhu, Jianxin; Migliori, Albert; Balatsky, Alexander
2015-03-01
Some Kondo insulators are expected to possess topologically protected surface states with linear Dirac spectrum, the topological Kondo insulators. Because the bulk states of these systems typically have heavy effective electron masses, the surface states may exhibit extraordinarily small Fermi velocities that could force the effective fine structure constant of the surface states into the strong coupling regime. Using a tight-binding model we study the many-body instabilities of these systems and identify regions of parameter space for which antiferromagnetic, ferromagnetic and charge density wave instabilities occur. Work Supported by USDOE BES E304.
Thermally induced charge current through long molecules
NASA Astrophysics Data System (ADS)
Zimbovskaya, Natalya A.; Nitzan, Abraham
2018-01-01
In this work, we theoretically study steady state thermoelectric transport through a single-molecule junction with a long chain-like bridge. Electron transmission through the system is computed using a tight-binding model for the bridge. We analyze dependences of thermocurrent on the bridge length in unbiased and biased systems operating within and beyond the linear response regime. It is shown that the length-dependent thermocurrent is controlled by the lineshape of electron transmission in the interval corresponding to the HOMO/LUMO transport channel. Also, it is demonstrated that electron interactions with molecular vibrations may significantly affect the length-dependent thermocurrent.
Structural basis of kynurenine 3-monooxygenase inhibition.
Amaral, Marta; Levy, Colin; Heyes, Derren J; Lafite, Pierre; Outeiro, Tiago F; Giorgini, Flaviano; Leys, David; Scrutton, Nigel S
2013-04-18
Inhibition of kynurenine 3-monooxygenase (KMO), an enzyme in the eukaryotic tryptophan catabolic pathway (that is, kynurenine pathway), leads to amelioration of Huntington's-disease-relevant phenotypes in yeast, fruitfly and mouse models, as well as in a mouse model of Alzheimer's disease. KMO is a flavin adenine dinucleotide (FAD)-dependent monooxygenase and is located in the outer mitochondrial membrane where it converts l-kynurenine to 3-hydroxykynurenine. Perturbations in the levels of kynurenine pathway metabolites have been linked to the pathogenesis of a spectrum of brain disorders, as well as cancer and several peripheral inflammatory conditions. Despite the importance of KMO as a target for neurodegenerative disease, the molecular basis of KMO inhibition by available lead compounds has remained unknown. Here we report the first crystal structure of Saccharomyces cerevisiae KMO, in the free form and in complex with the tight-binding inhibitor UPF 648. UPF 648 binds close to the FAD cofactor and perturbs the local active-site structure, preventing productive binding of the substrate l-kynurenine. Functional assays and targeted mutagenesis reveal that the active-site architecture and UPF 648 binding are essentially identical in human KMO, validating the yeast KMO-UPF 648 structure as a template for structure-based drug design. This will inform the search for new KMO inhibitors that are able to cross the blood-brain barrier in targeted therapies against neurodegenerative diseases such as Huntington's, Alzheimer's and Parkinson's diseases.
Tight-binding calculation of the magnetic moment of CrAs under pressure
NASA Astrophysics Data System (ADS)
Autieri, Carmine; Cuono, Giuseppe; Forte, Filomena; Noce, Canio
2018-03-01
We analyze the evolution of the local magnetic moment of the newly discovered pressure-induced superconductor CrAs, as a function of the applied pressure. Our theoretical method is based on a combination of the tight-binding approximation and the Löwdin down-folding procedure, which enables us to derive a low-energy effective Hamiltonian projected onto the Cr-subsector. We set up our calculations by considering several sets of ab initio derived hopping parameters, corresponding to different volumes of the unit cell, and use them to obtain the simulated pressure-dependence of the Cr magnetic moment, which is evaluated within a mean-field treatment of the Coulomb repulsion between the electrons at the Cr sites. Our calculations show good agreement with available experimental data, both for the normal phase measured 1.7 µB for Cr magnetic moment, and concerning the observed reduction of its amplitude for values that exceed the characteristic critical pressure.
NASA Astrophysics Data System (ADS)
Chegel, Raad; Behzad, Somayeh
2012-02-01
The electro-optical properties of zigzag and armchair BNNTs in a uniform transverse electric field are investigated within tight binding approximation. It is found that the electric field modifies the band structure and splits band degeneracy where these effects reflect in the DOS and JDOS spectra. A decrease in the band gap, as a function of the electric field, is observed. This gap reduction increases with the diameter and it is independent of chirality. An analytic function to estimate the electric field needed for band gap closing is proposed which is in good agreement with DFT results. In additional, we show that the larger diameter tubes are more sensitive than small ones. Number and position of peaks in DOS and JDOS spectra for armchair and zigzag tubes with similar radius are dependent on electric field strength.
Quasiclassical analysis of Bloch oscillations in non-Hermitian tight-binding lattices
NASA Astrophysics Data System (ADS)
Graefe, E. M.; Korsch, H. J.; Rush, A.
2016-07-01
Many features of Bloch oscillations in one-dimensional quantum lattices with a static force can be described by quasiclassical considerations for example by means of the acceleration theorem, at least for Hermitian systems. Here the quasiclassical approach is extended to non-Hermitian lattices, which are of increasing interest. The analysis is based on a generalised non-Hermitian phase space dynamics developed recently. Applications to a single-band tight-binding system demonstrate that many features of the quantum dynamics can be understood from this classical description qualitatively and even quantitatively. Two non-Hermitian and PT-symmetric examples are studied, a Hatano-Nelson lattice with real coupling constants and a system with purely imaginary couplings, both for initially localised states in space or in momentum. It is shown that the time-evolution of the norm of the wave packet and the expectation values of position and momentum can be described in a classical picture.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cuevas, F.A.; Curilef, S., E-mail: scurilef@ucn.cl; Plastino, A.R., E-mail: arplastino@ugr.es
The spread of a wave-packet (or its deformation) is a very important topic in quantum mechanics. Understanding this phenomenon is relevant in connection with the study of diverse physical systems. In this paper we apply various 'spreading measures' to characterize the evolution of an initially localized wave-packet in a tight-binding lattice, with special emphasis on information-theoretical measures. We investigate the behavior of both the probability distribution associated with the wave packet and the concomitant probability current. Complexity measures based upon Renyi entropies appear to be particularly good descriptors of the details of the delocalization process. - Highlights: > Spread ofmore » highly localized wave-packet in the tight-binding lattice. > Entropic and information-theoretical characterization is used to understand the delocalization. > The behavior of both the probability distribution and the concomitant probability current is investigated. > Renyi entropies appear to be good descriptors of the details of the delocalization process.« less
Communication: Charge-population based dispersion interactions for molecules and materials
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stöhr, Martin; Department Chemie, Technische Universität München, Lichtenbergstr. 4, D-85748 Garching; Michelitsch, Georg S.
2016-04-21
We introduce a system-independent method to derive effective atomic C{sub 6} coefficients and polarizabilities in molecules and materials purely from charge population analysis. This enables the use of dispersion-correction schemes in electronic structure calculations without recourse to electron-density partitioning schemes and expands their applicability to semi-empirical methods and tight-binding Hamiltonians. We show that the accuracy of our method is en par with established electron-density partitioning based approaches in describing intermolecular C{sub 6} coefficients as well as dispersion energies of weakly bound molecular dimers, organic crystals, and supramolecular complexes. We showcase the utility of our approach by incorporation of the recentlymore » developed many-body dispersion method [Tkatchenko et al., Phys. Rev. Lett. 108, 236402 (2012)] into the semi-empirical density functional tight-binding method and propose the latter as a viable technique to study hybrid organic-inorganic interfaces.« less
Reusable Component Model Development Approach for Parallel and Distributed Simulation
Zhu, Feng; Yao, Yiping; Chen, Huilong; Yao, Feng
2014-01-01
Model reuse is a key issue to be resolved in parallel and distributed simulation at present. However, component models built by different domain experts usually have diversiform interfaces, couple tightly, and bind with simulation platforms closely. As a result, they are difficult to be reused across different simulation platforms and applications. To address the problem, this paper first proposed a reusable component model framework. Based on this framework, then our reusable model development approach is elaborated, which contains two phases: (1) domain experts create simulation computational modules observing three principles to achieve their independence; (2) model developer encapsulates these simulation computational modules with six standard service interfaces to improve their reusability. The case study of a radar model indicates that the model developed using our approach has good reusability and it is easy to be used in different simulation platforms and applications. PMID:24729751
Interactions of 2’-O-methyl oligoribonucleotides with the RNA models of the 30S subunit A-site
Jasiński, Maciej; Kulik, Marta; Wojciechowska, Monika; Stolarski, Ryszard
2018-01-01
Synthetic oligonucleotides targeting functional regions of the prokaryotic rRNA could be promising antimicrobial agents. Indeed, such oligonucleotides were proven to inhibit bacterial growth. 2’-O-methylated (2’-O-Me) oligoribonucleotides with a sequence complementary to the decoding site in 16S rRNA were reported as inhibitors of bacterial translation. However, the binding mode and structures of the formed complexes, as well as the level of selectivity of the oligonucleotides between the prokaryotic and eukaryotic target, were not determined. We have analyzed three 2’-O-Me oligoribonucleotides designed to hybridize with the models of the prokaryotic rRNA containing two neighboring aminoglycoside binding pockets. One pocket is the paromomycin/kanamycin binding site corresponding to the decoding site in the small ribosomal subunit and the other one is the close-by hygromycin B binding site whose dynamics has not been previously reported. Molecular dynamics (MD) simulations, as well as isothermal titration calorimetry, gel electrophoresis and spectroscopic studies have shown that the eukaryotic rRNA model is less conformationally stable (in terms of hydrogen bonds and stacking interactions) than the corresponding prokaryotic one. In MD simulations of the eukaryotic construct, the nucleotide U1498, which plays an important role in correct positioning of mRNA during translation, is flexible and spontaneously flips out into the solvent. In solution studies, the 2’-O-Me oligoribonucleotides did not interact with the double stranded rRNA models but all formed stable complexes with the single-stranded prokaryotic target. 2’-O-Me oligoribonucleotides with one and two mismatches bound less tightly to the eukaryotic target. This shows that at least three mismatches between the 2’-O-Me oligoribonucleotide and eukaryotic rRNA are required to ensure target selectivity. The results also suggest that, in the ribosome environment, the strand invasion is the preferred binding mode of 2’-O-Me oligoribonucleotides targeting the aminoglycoside binding sites in 16S rRNA. PMID:29351348
An Inductive Logic Programming Approach to Validate Hexose Binding Biochemical Knowledge.
Nassif, Houssam; Al-Ali, Hassan; Khuri, Sawsan; Keirouz, Walid; Page, David
2010-01-01
Hexoses are simple sugars that play a key role in many cellular pathways, and in the regulation of development and disease mechanisms. Current protein-sugar computational models are based, at least partially, on prior biochemical findings and knowledge. They incorporate different parts of these findings in predictive black-box models. We investigate the empirical support for biochemical findings by comparing Inductive Logic Programming (ILP) induced rules to actual biochemical results. We mine the Protein Data Bank for a representative data set of hexose binding sites, non-hexose binding sites and surface grooves. We build an ILP model of hexose-binding sites and evaluate our results against several baseline machine learning classifiers. Our method achieves an accuracy similar to that of other black-box classifiers while providing insight into the discriminating process. In addition, it confirms wet-lab findings and reveals a previously unreported Trp-Glu amino acids dependency.
Cao, Yanli; Zheng, Fanglin; Wang, Lei; Zhao, Guolei; Chen, Guanjun; Zhang, Weixin; Liu, Weifeng
2017-07-01
Cellulase gene expression in the model cellulolytic fungus Trichoderma reesei is supposed to be controlled by an intricate regulatory network involving multiple transcription factors. Here, we identified a novel transcriptional repressor of cellulase gene expression, Rce1. Disruption of the rce1 gene not only facilitated the induced expression of cellulase genes but also led to a significant delay in terminating the induction process. However, Rce1 did not participate in Cre1-mediated catabolite repression. Electrophoretic mobility shift (EMSA) and DNase I footprinting assays in combination with chromatin immunoprecipitation (ChIP) demonstrated that Rce1 could bind directly to a cbh1 (cellobiohydrolase 1-encoding) gene promoter region containing a cluster of Xyr1 binding sites. Furthermore, competitive binding assays revealed that Rce1 antagonized Xyr1 from binding to the cbh1 promoter. These results indicate that intricate interactions exist between a variety of transcription factors to ensure tight and energy-efficient regulation of cellulase gene expression in T. reesei. This study also provides important clues regarding increased cellulase production in T. reesei. © 2017 John Wiley & Sons Ltd.
Stewart, Sarah E; D'Angelo, Michael E; Paintavigna, Stefania; Tabor, Rico F; Martin, Lisandra L; Bird, Phillip I
2015-01-01
Streptolysin O (SLO) is a bacterial pore forming protein that is part of the cholesterol dependent cytolysin (CDC) family. We have used quartz crystal microbalance with dissipation monitoring (QCM-D) to examine SLO membrane binding and pore formation. In this system, SLO binds tightly to cholesterol-containing membranes, and assembles into partial and complete pores confirmed by atomic force microscopy. SLO binds to the lipid bilayer at a single rate consistent with the Langmuir isotherm model of adsorption. Changes in dissipation illustrate that SLO alters the viscoelastic properties of the bilayer during pore formation, but there is no loss of material from the bilayer as reported for small membrane-penetrating peptides. SLO mutants were used to further dissect the assembly and insertion processes by QCM-D. This shows the signature of SLO in QCM-D changes when pore formation is inhibited, and that bound and inserted SLO forms can be distinguished. Furthermore a pre-pore locked SLO mutant binds reversibly to lipid, suggesting that the partially complete wtSLO forms observed by AFM are anchored to the membrane. Copyright © 2014 Elsevier B.V. All rights reserved.
Efficient electron open boundaries for simulating electrochemical cells
NASA Astrophysics Data System (ADS)
Zauchner, Mario G.; Horsfield, Andrew P.; Todorov, Tchavdar N.
2018-01-01
Nonequilibrium electrochemistry raises new challenges for atomistic simulation: we need to perform molecular dynamics for the nuclear degrees of freedom with an explicit description of the electrons, which in turn must be free to enter and leave the computational cell. Here we present a limiting form for electron open boundaries that we expect to apply when the magnitude of the electric current is determined by the drift and diffusion of ions in a solution and which is sufficiently computationally efficient to be used with molecular dynamics. We present tight-binding simulations of a parallel-plate capacitor with nothing, a dimer, or an atomic wire situated in the space between the plates. These simulations demonstrate that this scheme can be used to perform molecular dynamics simulations when there is an applied bias between two metal plates with, at most, weak electronic coupling between them. This simple system captures some of the essential features of an electrochemical cell, suggesting this approach might be suitable for simulations of electrochemical cells out of equilibrium.
On the intra- and interband plasmon modes in doped armchair graphene nanoribbons
NASA Astrophysics Data System (ADS)
Hoi, Bui Dinh; Davoudiniya, Masoumeh; Yarmohammadi, Mohsen
2018-01-01
With the help of the simple tight-binding Hamiltonian and Green's function technique, we study how intraband and interband plasmon modes of both semiconducting and metallic armchair graphene nanoribbons are influenced by the width, chemical doping, and incident momentum direction. In particular, we investigate the behavior of the frequency-dependent susceptibility when the system is exposed to photons or electrons. Injecting electrons by doping creates a new collective mode due to new states between the valence and conduction bands corresponding to intraband transition for which the effect of ribbon width on these transitions in the semiconducting case is much more sensitive than metallic ones. Furthermore, some critical chemical potential and momentum values for both intraband and interband modes lead to different behaviors for resonant peaks. Another remarkable point is the high sensitivity of intraband plasmons to the direction of incident momentum. In particular, the susceptibility of doped nanoribbons vanishes at perpendicular directions, i.e., the intraband plasmons disappear.
NASA Astrophysics Data System (ADS)
Gavrichkov, Vladimir A.; Pchelkina, Zlata V.; Nekrasov, Igor A.; Ovchinnikov, Sergey G.
2016-09-01
We studied the pressure dependences of the electronic structure and superexchange interaction J(P) = JA - JB (where JA and JB are antiferromagnetic (AFM) and ferromagnetic (FM) contributions) in antiferromagnetic La214 under hydrostatic, uniaxial (along c-axial) 3% compressions and 1% in-plane compressions by the local density approximation with generalized tight-binding method (LDA + GTB cell approach). The changes in J(P) correlated with the experimentally known TC(P) dependence are in accordance with the relation dTC/dP = (∂TC/∂J)(∂J/∂P), where ∂TC/∂J ˜ 0.1. The in-plane pressure more effectively stabilizes the ground singlet two-hole state A1 than the simple hydrostatic pressure, its effect on J and TC is the largest. Within the same cell approach together with the superexchange interaction J(P), the valence band structure was calculated. Its changes with pressure clearly reproduce the k-distribution of the singlet and triplet quasi-particles over the Brillouin zone (BZ).
Transition States and transition state analogue interactions with enzymes.
Schramm, Vern L
2015-04-21
Enzymatic transition states have lifetimes of a few femtoseconds (fs). Computational analysis of enzyme motions leading to transition state formation suggests that local catalytic site motions on the fs time scale provide the mechanism to locate transition states. An experimental test of protein fs motion and its relation to transition state formation can be provided by isotopically heavy proteins. Heavy enzymes have predictable mass-altered bond vibration states without altered electrostatic properties, according to the Born-Oppenheimer approximation. On-enzyme chemistry is slowed in most heavy proteins, consistent with altered protein bond frequencies slowing the search for the transition state. In other heavy enzymes, structural changes involved in reactant binding and release are also influenced. Slow protein motions associated with substrate binding and catalytic site preorganization are essential to allow the subsequent fs motions to locate the transition state and to facilitate the efficient release of products. In the catalytically competent geometry, local groups move in stochastic atomic motion on the fs time scale, within transition state-accessible conformations created by slower protein motions. The fs time scale for the transition state motions does not permit thermodynamic equilibrium between the transition state and stable enzyme states. Isotopically heavy enzymes provide a diagnostic tool for fast coupled protein motions to transition state formation and mass-dependent conformational changes. The binding of transition state analogue inhibitors is the opposite in catalytic time scale to formation of the transition state but is related by similar geometries of the enzyme-transition state and enzyme-inhibitor interactions. While enzymatic transition states have lifetimes as short as 10(-15) s, transition state analogues can bind tightly to enzymes with release rates greater than 10(3) s. Tight-binding transition state analogues stabilize the rare but evolved enzymatic geometry to form the transition state. Evolution to efficient catalysis optimized this geometry and its stabilization by a transition state mimic results in tight binding. Release rates of transition state analogues are orders of magnitude slower than product release in normal catalytic function. During catalysis, product release is facilitated by altered chemistry. Compared to the weak associations found in Michaelis complexes, transition state analogues involve strong interactions related to those in the transition state. Optimum binding of transition state analogues occurs when the complex retains the system motions intrinsic to transition state formation. Conserved dynamic motion retains the entropic components of inhibitor complexes, improving the thermodynamics of analogue binding.
Rational and Modular Design of Potent Ligands Targeting the RNA that Causes Myotonic Dystrophy 2
Lee, Melissa M.; Pushechnikov, Alexei; Disney, Matthew D.
2009-01-01
Most ligands targeting RNA are identified through screening a therapeutic target for binding members of a ligand library. A potential alternative way to construct RNA binders is through rational design using information about the RNA motifs ligands prefer to bind. Herein, we describe such an approach to design modularly assembled ligands targeting the RNA that causes myotonic dystrophy type 2 (DM2), a currently untreatable disease. A previous study identified that 6′-N-5-hexynoate kanamycin A (1) prefers to bind 2×2 nucleotide, pyrimidine-rich RNA internal loops. Multiple copies of such loops were found in the RNA hairpin that causes DM2. The 1 ligand was then modularly displayed on a peptoid scaffold with varied number and spacing to target several internal loops simultaneously. Modularly assembled ligands were tested for binding to a series of RNAs and for inhibiting the formation of the toxic DM2 RNA-muscleblind protein (MBNL-1) interaction. The most potent ligand displays three 1 modules, each separated by four spacing submonomers, and inhibits the formation of the RNA-protein complex with an IC50 of 25 nM. This ligand is higher affinity and more specific for binding DM2 RNA than MBNL-1. It binds the DM2 RNA at least 20-times more tightly than related RNAs and 15-fold more tightly than MBNL-1. A related control peptoid displaying 6′-N-5-hexynoate neamine (2) is >100-fold less potent at inhibiting the RNA-protein interaction and binds to DM2 RNA >125-fold more weakly. Uptake studies into a mouse myoblast cell line also show that the most potent ligand is cell permeable. PMID:19348464
Mutti, Elena; Hunger, Miriam; Fedosov, Sergey; Nexo, Ebba; Kräutler, Bernhard
2017-11-16
The synthesis and structural characterization of Co-(dN) 25 -Cbl (Cbl: cobalamin; dN: deoxynucleotide) and Co-(dN) 39 -Cbl, which are organometallic DNA-B 12 conjugates with single DNA strands consisting of 25 and 39 deoxynucleotides, respectively, and binding studies of these two DNA-Cbl conjugates to three homologous human Cbl transporting proteins, transcobalamin (TC), intrinsic factor (IF), and haptocorrin (HC), are reported. This investigation tests the suitability of such DNA-Cbls for the task of eventual in vivo oligonucleotide delivery. The binding of DNA-Cbl to TC, IF, and HC was investigated in competition with either a fluorescent Cbl derivative and Co-(dN) 25 -Cbl, or radiolabeled vitamin B 12 ( 57 Co-CNCbl) and Co-(dN) 25 -Cbl or Co-(dN) 39 -Cbl. Binding of the new DNA-Cbl conjugates was fast and tight with TC, but poorer with HC and IF, which extends a similar original finding with the simpler DNA-Cbl, Co-(dN) 18 -Cbl. The contrasting affinities of TC versus IF and HC for the DNA-Cbl conjugates are rationalized herein by a stepwise mechanism of Cbl binding. Critical contributions to overall affinity result from gradual conformational adaptations of the Cbl-binding proteins to the DNA-Cbl, which is first bound to the respective β domains. This transition is fast with TC, but slow with IF and HC, with which weaker binding results. The invariably tight interaction of the DNA-Cbl conjugates with TC makes the Cbl moiety a potential natural vector for the specific delivery of oligonucleotide loads from the blood into cells. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Quantifying the Effect of DNA Packaging on Gene Expression Level
NASA Astrophysics Data System (ADS)
Kim, Harold
2010-10-01
Gene expression, the process by which the genetic code comes alive in the form of proteins, is one of the most important biological processes in living cells, and begins when transcription factors bind to specific DNA sequences in the promoter region upstream of a gene. The relationship between gene expression output and transcription factor input which is termed the gene regulation function is specific to each promoter, and predicting this gene regulation function from the locations of transcription factor binding sites is one of the challenges in biology. In eukaryotic organisms (for example, animals, plants, fungi etc), DNA is highly compacted into nucleosomes, 147-bp segments of DNA tightly wrapped around histone protein core, and therefore, the accessibility of transcription factor binding sites depends on their locations with respect to nucleosomes - sites inside nucleosomes are less accessible than those outside nucleosomes. To understand how transcription factor binding sites contribute to gene expression in a quantitative manner, we obtain gene regulation functions of promoters with various configurations of transcription factor binding sites by using fluorescent protein reporters to measure transcription factor input and gene expression output in single yeast cells. In this talk, I will show that the affinity of a transcription factor binding site inside and outside the nucleosome controls different aspects of the gene regulation function, and explain this finding based on a mass-action kinetic model that includes competition between nucleosomes and transcription factors.
Antifreeze Protein Binds Irreversibly to Ice
NASA Astrophysics Data System (ADS)
Braslavsky, I.; Pertaya, N.; di Prinzio, C. L.; Wilen, L.; Thomson, E.; Wettlaufer, J. S.; Marshall, C. B.; Davies, P. L.
2006-03-01
Many organisms are protected from freezing by antifreeze proteins (AFPs), which bind to ice and prevent its growth by a mechanism not completely understood. Although it has been postulated that AFPs would have to bind irreversibly to arrest the growth of an ice crystal bathed in excess liquid water, the binding forces seem insufficient to support such a tight interaction. By putting a fluorescent tag on a fish AFP, we were able to visualize AFP binding to ice and demonstrate, by lack of recovery after photo-bleaching, that it is indeed irreversible. Because even the most avid protein/ligand interactions exhibit reversibility, this finding is key to understanding the mechanism of antifreeze proteins, which are becoming increasingly valuable in cryopreservation and improving the frost tolerance of crops.
Quantitative analyses of bifunctional molecules.
Braun, Patrick D; Wandless, Thomas J
2004-05-11
Small molecules can be discovered or engineered to bind tightly to biologically relevant proteins, and these molecules have proven to be powerful tools for both basic research and therapeutic applications. In many cases, detailed biophysical analyses of the intermolecular binding events are essential for improving the activity of the small molecules. These interactions can often be characterized as straightforward bimolecular binding events, and a variety of experimental and analytical techniques have been developed and refined to facilitate these analyses. Several investigators have recently synthesized heterodimeric molecules that are designed to bind simultaneously with two different proteins to form ternary complexes. These heterodimeric molecules often display compelling biological activity; however, they are difficult to characterize. The bimolecular interaction between one protein and the heterodimeric ligand (primary dissociation constant) can be determined by a number of methods. However, the interaction between that protein-ligand complex and the second protein (secondary dissociation constant) is more difficult to measure due to the noncovalent nature of the original protein-ligand complex. Consequently, these heterodimeric compounds are often characterized in terms of their activity, which is an experimentally dependent metric. We have developed a general quantitative mathematical model that can be used to measure both the primary (protein + ligand) and secondary (protein-ligand + protein) dissociation constants for heterodimeric small molecules. These values are largely independent of the experimental technique used and furthermore provide a direct measure of the thermodynamic stability of the ternary complexes that are formed. Fluorescence polarization and this model were used to characterize the heterodimeric molecule, SLFpYEEI, which binds to both FKBP12 and the Fyn SH2 domain, demonstrating that the model is useful for both predictive as well as ex post facto analytical applications.
Viral RNAi suppressor reversibly binds siRNA to outcompete Dicer and RISC via multiple-turnover
Rawlings, Renata A.; Krishnan, Vishalakshi; Walter, Nils G.
2011-01-01
RNA interference (RNAi) is a conserved gene regulatory mechanism employed by most eukaryotes as a key component of their innate immune response against viruses and retrotransposons. During viral infection, the RNase III-type endonuclease Dicer cleaves viral double-stranded RNA into small interfering RNAs (siRNAs), 21–24 nucleotides in length, and helps load them into the RNA-induced silencing complex (RISC) to guide cleavage of complementary viral RNA. As a countermeasure, many viruses have evolved viral RNA silencing suppressor (RSS) proteins that tightly, and presumably quantitatively, bind siRNAs to thwart RNAi-mediated degradation. Viral RSS proteins also act across kingdoms as potential immunosuppressors in gene therapeutic applications. Here we report fluorescence quenching and electrophoretic mobility shift assays that probe siRNA binding by the dimeric RSS p19 from Carnation Italian Ringspot Virus (CIRV), as well as by human Dicer and RISC assembly complexes. We find that the siRNA:p19 interaction is readily reversible, characterized by rapid binding ((1.69 ± 0.07)×108 M−1s−1) and marked dissociation (koff = 0.062 ± 0.002 s−1). We also observe that p19 efficiently competes with recombinant Dicer and inhibits formation of RISC-related assembly complexes found in human cell extract. Computational modeling based on these results provides evidence for the transient formation of a ternary complex between siRNA, human Dicer, and p19. An expanded model of RNA silencing indicates that multiple-turnover by reversible binding of siRNAs potentiates the efficiency of the suppressor protein. Our predictive model is expected to be applicable to the dosing of p19 as a silencing suppressor in viral gene therapy. PMID:21354178
Viral RNAi suppressor reversibly binds siRNA to outcompete Dicer and RISC via multiple turnover.
Rawlings, Renata A; Krishnan, Vishalakshi; Walter, Nils G
2011-04-29
RNA interference is a conserved gene regulatory mechanism employed by most eukaryotes as a key component of their innate immune response to viruses and retrotransposons. During viral infection, the RNase-III-type endonuclease Dicer cleaves viral double-stranded RNA into small interfering RNAs (siRNAs) 21-24 nucleotides in length and helps load them into the RNA-induced silencing complex (RISC) to guide the cleavage of complementary viral RNA. As a countermeasure, many viruses have evolved viral RNA silencing suppressors (RSS) that tightly, and presumably quantitatively, bind siRNAs to thwart RNA-interference-mediated degradation. Viral RSS proteins also act across kingdoms as potential immunosuppressors in gene therapeutic applications. Here we report fluorescence quenching and electrophoretic mobility shift assays that probe siRNA binding by the dimeric RSS p19 from Carnation Italian Ringspot Virus, as well as by human Dicer and RISC assembly complexes. We find that the siRNA:p19 interaction is readily reversible, characterized by rapid binding [(1.69 ± 0.07) × 10(8) M(-)(1) s(-1)] and marked dissociation (k(off)=0.062 ± 0.002 s(-1)). We also observe that p19 efficiently competes with recombinant Dicer and inhibits the formation of RISC-related assembly complexes found in human cell extract. Computational modeling based on these results provides evidence for the transient formation of a ternary complex between siRNA, human Dicer, and p19. An expanded model of RNA silencing indicates that multiple turnover by reversible binding of siRNAs potentiates the efficiency of the suppressor protein. Our predictive model is expected to be applicable to the dosing of p19 as a silencing suppressor in viral gene therapy. Copyright © 2011 Elsevier Ltd. All rights reserved.
Engineering Encodable Lanthanide-Binding Tags (LBTs) into Loop Regions of Proteins
Barthelmes, Katja; Reynolds, Anne M.; Peisach, Ezra; Jonker, Hendrik R. A.; DeNunzio, Nicholas J.; Allen, Karen N.; Imperiali, Barbara; Schwalbe, Harald
2011-01-01
Lanthanide-binding-tags (LBTs) are valuable tools for investigation of protein structure, function, and dynamics by NMR spectroscopy, X-ray crystallography and luminescence studies. We have inserted LBTs into three different loop positions (denoted L, R, and S) of the model protein interleukin-1β and varied the length of the spacer between the LBT and the protein (denoted 1-3). Luminescence studies demonstrate that all nine constructs bind Tb3+ tightly in the low nanomolar range. No significant change in the fusion protein occurs from insertion of the LBT, as shown by two X-ray crystallographic structures of the IL1β-S1 and IL1β-L3 constructs and for the remaining constructs by comparing 1H-15N-HSQC NMR spectra with wild-type IL1β. Additionally, binding of LBT-loop IL1β proteins to their native binding partner in vitro remains unaltered. X-ray crystallographic phasing was successful using only the signal from the bound lanthanide. Large residual dipolar couplings (RDCs) could be determined by NMR spectroscopy for all LBT-loop-constructs and revealed that the LBT-2 series were rigidly incorporated into the interleukin-1β structure. The paramagnetic NMR spectra of loop-LBT mutant IL1β-R2 were assigned and the Δχ tensor components were calculated based on RDCs and pseudocontact shifts (PCSs). A structural model of the IL1β-R2 construct was calculated using the paramagnetic restraints. The current data provide support that encodable LBTs serve as versatile biophysical tags when inserted into loop regions of proteins of known structure or predicted via homology modelling. PMID:21182275
AFRRI Reports, Second Quarter 1994
1994-08-01
the antrum wete immediately placed in sterile 0.9% NaCl, kept on ice, coded, and then prepared for culture, smears, and urease assay by homogeniza...high urease specific activity (>1 |J.mol- min-1 ■ mg protein-1) plus high-affinity substrate binding (Mi- chaelis constant [K^\\ < 1 mmol/L),27 in at...031, respectively), and the characteristic bacterial growth with high-activity product.on of a urease with tight substrate binding " was found in
Triazole biotin: a tight-binding biotinidase-resistant conjugate.
Germeroth, Anne I; Hanna, Jill R; Karim, Rehana; Kundel, Franziska; Lowther, Jonathan; Neate, Peter G N; Blackburn, Elizabeth A; Wear, Martin A; Campopiano, Dominic J; Hulme, Alison N
2013-11-28
The natural amide bond found in all biotinylated proteins has been replaced with a triazole through CuAAC reaction of an alkynyl biotin derivative. The resultant triazole-linked adducts are shown to be highly resistant to the ubiquitous hydrolytic enzyme biotinidase and to bind avidin with dissociation constants in the low pM range. Application of this strategy to the production of a series of biotinidase-resistant biotin-Gd-DOTA contrast agents is demonstrated.
NASA Astrophysics Data System (ADS)
Thelen, Brian J.; Xique, Ismael J.; Burns, Joseph W.; Goley, G. Steven; Nolan, Adam R.; Benson, Jonathan W.
2017-04-01
In Bayesian decision theory, there has been a great amount of research into theoretical frameworks and information- theoretic quantities that can be used to provide lower and upper bounds for the Bayes error. These include well-known bounds such as Chernoff, Battacharrya, and J-divergence. Part of the challenge of utilizing these various metrics in practice is (i) whether they are "loose" or "tight" bounds, (ii) how they might be estimated via either parametric or non-parametric methods, and (iii) how accurate the estimates are for limited amounts of data. In general what is desired is a methodology for generating relatively tight lower and upper bounds, and then an approach to estimate these bounds efficiently from data. In this paper, we explore the so-called triangle divergence which has been around for a while, but was recently made more prominent in some recent research on non-parametric estimation of information metrics. Part of this work is motivated by applications for quantifying fundamental information content in SAR/LIDAR data, and to help in this, we have developed a flexible multivariate modeling framework based on multivariate Gaussian copula models which can be combined with the triangle divergence framework to quantify this information, and provide approximate bounds on Bayes error. In this paper we present an overview of the bounds, including those based on triangle divergence and verify that under a number of multivariate models, the upper and lower bounds derived from triangle divergence are significantly tighter than the other common bounds, and often times, dramatically so. We also propose some simple but effective means for computing the triangle divergence using Monte Carlo methods, and then discuss estimation of the triangle divergence from empirical data based on Gaussian Copula models.
ERIC Educational Resources Information Center
Entrikin, Jerry; Griffiths, David
1983-01-01
The main problem in constructing functioning electric motors from simple parts is the mounting of the axle (which is too flimsy to maintain good electrical contacts or too tight, imposing excessive friction at the supports). This problem is solved by using a pencil sharpened at both ends as the axle. (JN)
Regulation of transcriptional activators by DNA-binding domain ubiquitination
Landré, Vivien; Revi, Bhindu; Mir, Maria Gil; Verma, Chandra; Hupp, Ted R; Gilbert, Nick; Ball, Kathryn L
2017-01-01
Ubiquitin is a key component of the regulatory network that maintains gene expression in eukaryotes, yet the molecular mechanism(s) by which non-degradative ubiquitination modulates transcriptional activator (TA) function is unknown. Here endogenous p53, a stress-activated transcription factor required to maintain health, is stably monoubiquitinated, following pathway activation by IR or Nutlin-3 and localized to the nucleus where it becomes tightly associated with chromatin. Comparative structure–function analysis and in silico modelling demonstrate a direct role for DNA-binding domain (DBD) monoubiquitination in TA activation. When attached to the DBD of either p53, or a second TA IRF-1, ubiquitin is orientated towards, and makes contact with, the DNA. The contact is made between a predominantly cationic surface on ubiquitin and the anionic DNA. Our data demonstrate an unexpected role for ubiquitin in the mechanism of TA-activity enhancement and provides insight into a new level of transcriptional regulation. PMID:28362432
Heuristic Modeling for TRMM Lifetime Predictions
NASA Technical Reports Server (NTRS)
Jordan, P. S.; Sharer, P. J.; DeFazio, R. L.
1996-01-01
Analysis time for computing the expected mission lifetimes of proposed frequently maneuvering, tightly altitude constrained, Earth orbiting spacecraft have been significantly reduced by means of a heuristic modeling method implemented in a commercial-off-the-shelf spreadsheet product (QuattroPro) running on a personal computer (PC). The method uses a look-up table to estimate the maneuver frequency per month as a function of the spacecraft ballistic coefficient and the solar flux index, then computes the associated fuel use by a simple engine model. Maneuver frequency data points are produced by means of a single 1-month run of traditional mission analysis software for each of the 12 to 25 data points required for the table. As the data point computations are required only a mission design start-up and on the occasion of significant mission redesigns, the dependence on time consuming traditional modeling methods is dramatically reduced. Results to date have agreed with traditional methods to within 1 to 1.5 percent. The spreadsheet approach is applicable to a wide variety of Earth orbiting spacecraft with tight altitude constraints. It will be particularly useful to such missions as the Tropical Rainfall Measurement Mission scheduled for launch in 1997, whose mission lifetime calculations are heavily dependent on frequently revised solar flux predictions.
An insect-inspired model for visual binding II: functional analysis and visual attention.
Northcutt, Brandon D; Higgins, Charles M
2017-04-01
We have developed a neural network model capable of performing visual binding inspired by neuronal circuitry in the optic glomeruli of flies: a brain area that lies just downstream of the optic lobes where early visual processing is performed. This visual binding model is able to detect objects in dynamic image sequences and bind together their respective characteristic visual features-such as color, motion, and orientation-by taking advantage of their common temporal fluctuations. Visual binding is represented in the form of an inhibitory weight matrix which learns over time which features originate from a given visual object. In the present work, we show that information represented implicitly in this weight matrix can be used to explicitly count the number of objects present in the visual image, to enumerate their specific visual characteristics, and even to create an enhanced image in which one particular object is emphasized over others, thus implementing a simple form of visual attention. Further, we present a detailed analysis which reveals the function and theoretical limitations of the visual binding network and in this context describe a novel network learning rule which is optimized for visual binding.
Kuan, Hui-Shun; Betterton, Meredith D.
2016-01-01
Motor protein motion on biopolymers can be described by models related to the totally asymmetric simple exclusion process (TASEP). Inspired by experiments on the motion of kinesin-4 motors on antiparallel microtubule overlaps, we analyze a model incorporating the TASEP on two antiparallel lanes with binding kinetics and lane switching. We determine the steady-state motor density profiles using phase-plane analysis of the steady-state mean field equations and kinetic Monte Carlo simulations. We focus on the density-density phase plane, where we find an analytic solution to the mean field model. By studying the phase-space flows, we determine the model’s fixed points and their changes with parameters. Phases previously identified for the single-lane model occur for low switching rate between lanes. We predict a multiple coexistence phase due to additional fixed points that appear as the switching rate increases: switching moves motors from the higher-density to the lower-density lane, causing local jamming and creating multiple domain walls. We determine the phase diagram of the model for both symmetric and general boundary conditions. PMID:27627345
Krishnamurthy, Shruthi; Deng, Bin; del Rio, Roxana; Buchholz, Kerry R.; Treeck, Moritz; Urban, Siniša; Boothroyd, John; Lam, Ying-Wai
2016-01-01
ABSTRACT Apical membrane antigen 1 (AMA1) is a receptor protein on the surface of Toxoplasma gondii that plays a critical role in host cell invasion. The ligand to which T. gondii AMA1 (TgAMA1) binds, TgRON2, is secreted into the host cell membrane by the parasite during the early stages of invasion. The TgAMA1-TgRON2 complex forms the core of the “moving junction,” a ring-shaped zone of tight contact between the parasite and host cell membranes, through which the parasite pushes itself during invasion. Paradoxically, the parasite also expresses rhomboid proteases that constitutively cleave the TgAMA1 transmembrane domain. How can TgAMA1 function effectively in host cell binding if its extracellular domain is constantly shed from the parasite surface? We show here that when TgAMA1 binds the domain 3 (D3) peptide of TgRON2, its susceptibility to cleavage by rhomboid protease(s) is greatly reduced. This likely serves to maintain parasite-host cell binding at the moving junction, a hypothesis supported by data showing that parasites expressing a hypercleavable version of TgAMA1 invade less efficiently than wild-type parasites do. Treatment of parasites with the D3 peptide was also found to reduce phosphorylation of S527 on the cytoplasmic tail of TgAMA1, and parasites expressing a phosphomimetic S527D allele of TgAMA1 showed an invasion defect. Taken together, these data suggest that TgAMA1-TgRON2 interaction at the moving junction protects TgAMA1 molecules that are actively engaged in host cell penetration from rhomboid-mediated cleavage and generates an outside-in signal that leads to dephosphorylation of the TgAMA1 cytosolic tail. Both of these effects are required for maximally efficient host cell invasion. PMID:27624124
Gul, Ahmet; Erman, Burak
2018-01-16
Prediction of peptide binding on specific human leukocyte antigens (HLA) has long been studied with successful results. We herein describe the effects of entropy and dynamics by investigating the binding stabilities of 10 nanopeptides on various HLA Class I alleles using a theoretical model based on molecular dynamics simulations. The fluctuational entropies of the peptides are estimated over a temperature range of 310-460 K. The estimated entropies correlate well with experimental binding affinities of the peptides: peptides that have higher binding affinities have lower entropies compared to non-binders, which have significantly larger entropies. The computation of the entropies is based on a simple model that requires short molecular dynamics trajectories and allows for approximate but rapid determination. The paper draws attention to the long neglected dynamic aspects of peptide binding, and provides a fast computation scheme that allows for rapid scanning of large numbers of peptides on selected HLA antigens, which may be useful in defining the right peptides for personal immunotherapy.
NASA Astrophysics Data System (ADS)
Gul, Ahmet; Erman, Burak
2018-03-01
Prediction of peptide binding on specific human leukocyte antigens (HLA) has long been studied with successful results. We herein describe the effects of entropy and dynamics by investigating the binding stabilities of 10 nanopeptides on various HLA Class I alleles using a theoretical model based on molecular dynamics simulations. The fluctuational entropies of the peptides are estimated over a temperature range of 310-460 K. The estimated entropies correlate well with experimental binding affinities of the peptides: peptides that have higher binding affinities have lower entropies compared to non-binders, which have significantly larger entropies. The computation of the entropies is based on a simple model that requires short molecular dynamics trajectories and allows for approximate but rapid determination. The paper draws attention to the long neglected dynamic aspects of peptide binding, and provides a fast computation scheme that allows for rapid scanning of large numbers of peptides on selected HLA antigens, which may be useful in defining the right peptides for personal immunotherapy.
Wu, Sau-Ching; Wong, Sui-Lam
2013-01-01
Development of a high-affinity streptavidin-binding peptide (SBP) tag allows the tagged recombinant proteins to be affinity purified using the streptavidin matrix without the need of biotinylation. The major limitation of this powerful technology is the requirement to use biotin to elute the SBP-tagged proteins from the streptavidin matrix. Tight biotin binding by streptavidin essentially allows the matrix to be used only once. To address this problem, differences in interactions of biotin and SBP with streptavidin were explored. Loop3-4 which serves as a mobile lid for the biotin binding pocket in streptavidin is in the closed state with biotin binding. In contrast, this loop is in the open state with SBP binding. Replacement of glycine-48 with a bulkier residue (threonine) in this loop selectively reduces the biotin binding affinity (Kd) from 4 × 10(-14) M to 4.45 × 10(-10) M without affecting the SBP binding affinity. Introduction of a second mutation (S27A) to the first mutein (G48T) results in the development of a novel engineered streptavidin SAVSBPM18 which could be recombinantly produced in the functional form from Bacillus subtilis via secretion. To form an intact binding pocket for tight binding of SBP, two diagonally oriented subunits in a tetrameric streptavidin are required. It is vital for SAVSBPM18 to be stably in the tetrameric state in solution. This was confirmed using an HPLC/Laser light scattering system. SAVSBPM18 retains high binding affinity to SBP but has reversible biotin binding capability. The SAVSBPM18 matrix can be applied to affinity purify SBP-tagged proteins or biotinylated molecules to homogeneity with high recovery in a reusable manner. A mild washing step is sufficient to regenerate the matrix which can be reused for multiple rounds. Other applications including development of automated protein purification systems, lab-on-a-chip micro-devices, reusable biosensors, bioreactors and microarrays, and strippable detection agents for various blots are possible.
Wu, Sau-Ching; Wong, Sui-Lam
2013-01-01
Development of a high-affinity streptavidin-binding peptide (SBP) tag allows the tagged recombinant proteins to be affinity purified using the streptavidin matrix without the need of biotinylation. The major limitation of this powerful technology is the requirement to use biotin to elute the SBP-tagged proteins from the streptavidin matrix. Tight biotin binding by streptavidin essentially allows the matrix to be used only once. To address this problem, differences in interactions of biotin and SBP with streptavidin were explored. Loop3–4 which serves as a mobile lid for the biotin binding pocket in streptavidin is in the closed state with biotin binding. In contrast, this loop is in the open state with SBP binding. Replacement of glycine-48 with a bulkier residue (threonine) in this loop selectively reduces the biotin binding affinity (Kd) from 4×10−14 M to 4.45×10−10 M without affecting the SBP binding affinity. Introduction of a second mutation (S27A) to the first mutein (G48T) results in the development of a novel engineered streptavidin SAVSBPM18 which could be recombinantly produced in the functional form from Bacillus subtilis via secretion. To form an intact binding pocket for tight binding of SBP, two diagonally oriented subunits in a tetrameric streptavidin are required. It is vital for SAVSBPM18 to be stably in the tetrameric state in solution. This was confirmed using an HPLC/Laser light scattering system. SAVSBPM18 retains high binding affinity to SBP but has reversible biotin binding capability. The SAVSBPM18 matrix can be applied to affinity purify SBP-tagged proteins or biotinylated molecules to homogeneity with high recovery in a reusable manner. A mild washing step is sufficient to regenerate the matrix which can be reused for multiple rounds. Other applications including development of automated protein purification systems, lab-on-a-chip micro-devices, reusable biosensors, bioreactors and microarrays, and strippable detection agents for various blots are possible. PMID:23874971
NASA Astrophysics Data System (ADS)
Mir, Raja N.; Frensley, William R.
2013-10-01
InAs-Sb/GaSb type-II strain compensated superlattices (SLS) are currently being used in mid-wave and long-wave infrared photodetectors. The electronic bandstructure of InSb and GaSb shows very strong anisotropy and non-parabolicity close to the Γ-point for the conduction band (CB) minimum and the valence band (VB) maximum. Particularly around the energy range of 45-80 meV from band-edge we observe strong non-parabolicity in the CB and light hole VB. The band-edge dispersion determines the electrical properties of a material. When the bulk materials are combined to form a superlattice we need a model of bandstructure which takes into account the full bandstructure details of the constituents and also the strong interaction between the conduction band of InAs and valence bands of GaSb. There can also be contact potentials near the interface between two dissimilar superlattices which will not be captured unless a full bandstructure calculation is done. In this study, we have done a calculation using second nearest neighbor tight binding model in order to accurately reproduce the effective masses. The calculation of mini-band structure is done by finding the wavefunctions within one SL period subject to Bloch boundary conditions ψ(L)=ψ(0)eikL. We demonstrate in this paper how a calculation of carrier concentration as a function of the position of the Fermi level (EF) within bandgap(Eg) should be done in order to take into account the full bandstructure of broken-bandgap material systems. This calculation is key for determining electron transport particularly when we have an interface between two dissimilar superlattices.
Playing relativistic billiards beyond graphene
NASA Astrophysics Data System (ADS)
Sadurní, E.; Seligman, T. H.; Mortessagne, F.
2010-05-01
The possibility of using hexagonal structures in general, and graphene in particular, to emulate the Dirac equation is the topic under consideration here. We show that Dirac oscillators with or without rest mass can be emulated by distorting a tight-binding model on a hexagonal structure. In the quest to make a toy model for such relativistic equations, we first show that a hexagonal lattice of attractive potential wells would be a good candidate. Firstly, we consider the corresponding one-dimensional (1D) model giving rise to a 1D Dirac oscillator and then construct explicitly the deformations needed in the 2D case. Finally, we discuss how such a model can be implemented as an electromagnetic billiard using arrays of dielectric resonators between two conducting plates that ensure evanescent modes outside the resonators for transversal electric modes, and we describe a feasible experimental setup.
Voltage dependency of transmission probability of aperiodic DNA molecule
NASA Astrophysics Data System (ADS)
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Natural electroweak breaking from a mirror symmetry.
Chacko, Z; Goh, Hock-Seng; Harnik, Roni
2006-06-16
We present "twin Higgs models," simple realizations of the Higgs boson as a pseudo Goldstone boson that protect the weak scale from radiative corrections up to scales of order 5-10 TeV. In the ultraviolet these theories have a discrete symmetry which interchanges each standard model particle with a corresponding particle which transforms under a twin or a mirror standard model gauge group. In addition, the Higgs sector respects an approximate global symmetry. When this global symmetry is broken, the discrete symmetry tightly constrains the form of corrections to the pseudo Goldstone Higgs potential, allowing natural electroweak symmetry breaking. Precision electroweak constraints are satisfied by construction. These models demonstrate that, contrary to the conventional wisdom, stabilizing the weak scale does not require new light particles charged under the standard model gauge groups.
Brown, KA; Mays, T; Romoser, A; Marroquin-Cardona, A; Mitchell, NJ; Elmore, SE; Phillips, TD
2013-01-01
Food shortages and lack of food supply regulation in developing countries often leads to chronic exposure of vulnerable populations to hazardous mixtures of mycotoxins, including aflatoxin B1 (AFB1) and fumonisin B1 (FB1). A refined calcium montmorillonite clay (i.e. UPSN) has been reported to tightly bind these toxins, thereby decreasing bioavailability in humans and animals. Hence, our objectives in the present work were to examine the ability of UPSN to bind mixtures of AFB1 and FB1at gastrointestinally relevant pH in vitro, and to utilize a rapid in vivo bioassay to evaluate AFB1 and FB1 toxicity and UPSN efficacy. Isothermal sorption data indicated tight AFB1 binding to UPSN surfaces at both pH 2.0 and 6.5, but substantially more FB1 bound at pH 2.0 than 6.5. Site-specific competition occurred between the toxins when exposed to UPSN in combination. Importantly, treatment with UPSN resulted in significant protection to mycotoxin-exposed hydra maintained at pH 6.9-7.0. Hydra were exposed to FB1, AFB1 and FB1/AFB1 combinations with and without UPSN. Toxic response over 92 hours was rated based on morphology and mortality. Hydra assay results indicated a minimum effective concentration (MEC) of 20 μg/mLfor AFB1, while the MEC for FB1 was not reached. The MEC for co-exposure was 400 μg/mL FB1 + 10 μg/mL AFB1. This study demonstrates that UPSN sorbs both mycotoxins tightly at physiologically relevant pH levels, resulting in decreased bioavailability, and that a modified hydra bioassay can be used as an initial screen in vivo to predict efficacy of toxin binding agents. PMID:23047854
Brown, K A; Mays, T; Romoser, A; Marroquin-Cardona, A; Mitchell, N J; Elmore, S E; Phillips, T D
2014-01-01
Food shortages and a lack of food supply regulation in developing countries often leads to chronic exposure of vulnerable populations to hazardous mixtures of mycotoxins, including aflatoxin B(1) (AFB(1)) and fumonisin B(1) (FB(1)). A refined calcium montmorillonite clay [i.e. uniform particle size NovaSil (UPSN)] has been reported to tightly bind these toxins, thereby decreasing bioavailability in humans and animals. Hence, our objectives in the present study were to examine the ability of UPSN to bind mixtures of AFB(1) and FB(1) at gastrointestinally relevant pH in vitro, and to utilize a rapid in vivo bioassay to evaluate AFB(1) and FB(1) toxicity and UPSN efficacy. Isothermal sorption data indicated tight AFB(1) binding to UPSN surfaces at both pH 2.0 and 6.5, but substantially more FB(1) bound at pH 2.0 than 6.5. Site-specific competition occurred between the toxins when exposed to UPSN in combination. Importantly, treatment with UPSN resulted in significant protection to mycotoxin-exposed hydra maintained at pH 6.9-7.0. Hydra were exposed to FB(1), AFB(1) and FB(1) /AFB(1) combinations with and without UPSN. A toxic response over 92 h was rated based on morphology and mortality. Hydra assay results indicated a minimum effective concentration (MEC) of 20 µg ml(-1) for AFB(1), whereas the MEC for FB(1) was not reached. The MEC for co-exposure was 400 µg ml(-1) FB(1) + 10 µg ml(-1) AFB(1). This study demonstrates that UPSN sorbs both mycotoxins tightly at physiologically relevant pH levels, resulting in decreased bioavailability, and that a modified hydra bioassay can be used as an initial screen in vivo to predict efficacy of toxin-binding agents. Copyright © 2012 John Wiley & Sons, Ltd.
Structural basis of control of inward rectifier Kir2 channel gating by bulk anionic phospholipids
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Sun-Joo; Ren, Feifei; Zangerl-Plessl, Eva-Maria
2016-08-15
Inward rectifier potassium (Kir) channel activity is controlled by plasma membrane lipids. Phosphatidylinositol-4,5-bisphosphate (PIP 2) binding to a primary site is required for opening of classic inward rectifier Kir2.1 and Kir2.2 channels, but interaction of bulk anionic phospholipid (PL -) with a distinct second site is required for high PIP 2sensitivity. Here we show that introduction of a lipid-partitioning tryptophan at the second site (K62W) generates high PIP 2sensitivity, even in the absence of PL -. Furthermore, high-resolution x-ray crystal structures of Kir2.2[K62W], with or without added PIP 2(2.8- and 2.0-Å resolution, respectively), reveal tight tethering of the C-terminal domainmore » (CTD) to the transmembrane domain (TMD) in each condition. Our results suggest a refined model for phospholipid gating in which PL -binding at the second site pulls the CTD toward the membrane, inducing the formation of the high-affinity primary PIP 2site and explaining the positive allostery between PL -binding and PIP 2sensitivity.« less
Watkinson, Allan; Soliakov, Andrei; Ganesan, Ashok; Hirst, Karie; Lebutt, Chris; Fleetwood, Kelly; Fusco, Peter C; Fuerst, Thomas R; Lakey, Jeremy H
2013-11-01
Aluminum salts are the most widely used vaccine adjuvants, and phosphate is known to modulate antigen-adjuvant interactions. Here we report an unexpected role for phosphate buffer in an anthrax vaccine (SparVax) containing recombinant protective antigen (rPA) and aluminum oxyhydroxide (AlOH) adjuvant (Alhydrogel). Phosphate ions bind to AlOH to produce an aluminum phosphate surface with a reduced rPA adsorption coefficient and binding capacity. However, these effects continued to increase as the free phosphate concentration increased, and the binding of rPA changed from endothermic to exothermic. Crucially, phosphate restored the thermostability of bound rPA so that it resembled the soluble form, even though it remained tightly bound to the surface. Batches of vaccine with either 0.25 mM (subsaturated) or 4 mM (saturated) phosphate were tested in a disease model at batch release, which showed that the latter was significantly more potent. Both formulations retained their potency for 3 years. The strongest aluminum adjuvant effects are thus likely to be via weakly attached or easily released native-state antigen proteins.
Ubiquitin-like domains can target to the proteasome but proteolysis requires a disordered region.
Yu, Houqing; Kago, Grace; Yellman, Christopher M; Matouschek, Andreas
2016-07-15
Ubiquitin and some of its homologues target proteins to the proteasome for degradation. Other ubiquitin-like domains are involved in cellular processes unrelated to the proteasome, and proteins containing these domains remain stable in the cell. We find that the 10 yeast ubiquitin-like domains tested bind to the proteasome, and that all 11 identified domains can target proteins for degradation. Their apparent proteasome affinities are not directly related to their stabilities or functions. That is, ubiquitin-like domains in proteins not part of the ubiquitin proteasome system may bind the proteasome more tightly than domains in proteins that are bona fide components. We propose that proteins with ubiquitin-like domains have properties other than proteasome binding that confer stability. We show that one of these properties is the absence of accessible disordered regions that allow the proteasome to initiate degradation. In support of this model, we find that Mdy2 is degraded in yeast when a disordered region in the protein becomes exposed and that the attachment of a disordered region to Ubp6 leads to its degradation. © 2016 The Authors.
Structural basis of control of inward rectifier Kir2 channel gating by bulk anionic phospholipids.
Lee, Sun-Joo; Ren, Feifei; Zangerl-Plessl, Eva-Maria; Heyman, Sarah; Stary-Weinzinger, Anna; Yuan, Peng; Nichols, Colin G
2016-09-01
Inward rectifier potassium (Kir) channel activity is controlled by plasma membrane lipids. Phosphatidylinositol-4,5-bisphosphate (PIP2) binding to a primary site is required for opening of classic inward rectifier Kir2.1 and Kir2.2 channels, but interaction of bulk anionic phospholipid (PL(-)) with a distinct second site is required for high PIP2 sensitivity. Here we show that introduction of a lipid-partitioning tryptophan at the second site (K62W) generates high PIP2 sensitivity, even in the absence of PL(-) Furthermore, high-resolution x-ray crystal structures of Kir2.2[K62W], with or without added PIP2 (2.8- and 2.0-Å resolution, respectively), reveal tight tethering of the C-terminal domain (CTD) to the transmembrane domain (TMD) in each condition. Our results suggest a refined model for phospholipid gating in which PL(-) binding at the second site pulls the CTD toward the membrane, inducing the formation of the high-affinity primary PIP2 site and explaining the positive allostery between PL(-) binding and PIP2 sensitivity. © 2016 Lee et al.
Slow-binding inhibition of sialidase from influenza virus.
Pegg, M S; von Itzstein, M
1994-04-01
Sialidase from influenza virus A (Tokyo/3/67, N2) is inhibited in slow-binding fashion by 2,3-didehydro-2,4-dideoxy-4-guanidino-N-acetyl-D-neuraminic acid. The Ki observed for the tightly-bound form at steady-state is 3 x 10(-11) M. Slow-binding, which is a consequence of the guanidinyl moiety of the inhibitor, is observed only for influenza virus A sialidase and not for influenza virus B or any other viral, bacterial, or mammalian sialidase investigated. The different results obtained for sialidases from influenza virus A and B, whose active sites are conserved, point to the involvement of the expulsion of a structural water molecule in the slow-binding mechanism.
Marinsky, J.A.; Baldwin, Robert F.; Reddy, M.M.
1985-01-01
It has been shown that the apparent enhancement of divalent metal ion binding to polyions such as polystyrenesulfonate (PSS) and dextran sulfate (DS) by decreasing the ionic strength of these mixed counterion systems (M2+, M+, X-, polyion) can be anticipated with the Donnan-based model developed by one of us (J.A.M.). Ion-exchange distribution methods have been employed to measure the removal by the polyion of trace divalent metal ion from simple salt (NaClO4)-polyion (NaPSS) mixtures. These data and polyion interaction data published earlier by Mattai and Kwak for the mixed counterion systems MgCl2-LiCl-DS and MgCl2-CsCl-DS have been shown to be amenable to rather precise analysis by this model. ?? 1985 American Chemical Society.
Implementing the SU(2) Symmetry for the DMRG
NASA Astrophysics Data System (ADS)
Alvarez, Gonzalo
2010-03-01
In the Density Matrix Renormalization Group (DMRG) algorithm (White, 1992), Hamiltonian symmetries play an important role. Using symmetries, the matrix representation of the Hamiltonian can be blocked. Diagonalizing each matrix block is more efficient than diagonalizing the original matrix. This talk will explain how the DMRG++ codefootnotetextarXiv:0902.3185 or Computer Physics Communications 180 (2009) 1572-1578. has been extended to handle the non-local SU(2) symmetry in a model independent way. Improvements in CPU times compared to runs with only local symmetries will be discussed for typical tight-binding models of strongly correlated electronic systems. The computational bottleneck of the algorithm, and the use of shared memory parallelization will also be addressed. Finally, a roadmap for future work on DMRG++ will be presented.
Basu, Koli; Wasserman, Samantha S; Jeronimo, Paul S; Graham, Laurie A; Davies, Peter L
2016-04-01
An antifreeze protein (AFP) from a midge (Chironomidae) was recently discovered and modelled as a tightly wound disulfide-braced solenoid with a surface-exposed rank of stacked tyrosines. New isoforms of the midge AFP have been identified from RT-PCR and are fully consistent with the model. Although they differ in the number of 10-residue coils, the row of tyrosines that form the putative ice-binding site is conserved. Recombinant midge AFP has been produced, and the properly folded form purified by ice affinity. This monomeric AFP has a distinct circular dichroism spectrum, a melting temperature between 35 and 50 °C and is fully renaturable on cooling. Mutagenesis of the middle tyrosine in the rank of seven eliminates antifreeze activity, whereas mutation of a tyrosine off this predicted ice-binding face had no such effect. This AFP has unusual properties compared to other known AFPs. First, its freezing-point depression activity is intermediate between that of the hyperactive and moderately active AFPs. As with hyperactive AFPs, when midge AFP-bound ice crystals exceed their freezing-point depression, ice grows explosively perpendicular to the c-axis. However, midge AFP does not bind to the basal plane of ice as do hyperactive AFPs, but rather to a pyramidal plane that is at a shallower angle relative to the basal plane than binding planes of moderate AFPs. These properties distinguish midge AFP from all other ice-binding proteins and the intermediate activity level fits well to the modest challenge of protecting newly emerged adult insects from late spring frosts. Nucleotide sequences of new midge AFP isoforms are available in the GenBank database under accession numbers KU094814-8. Sequences will be released after publication. © 2016 Federation of European Biochemical Societies.
Reis, Joana; Manzella, Nicola; Cagide, Fernando; Mialet-Perez, Jeanne; Uriarte, Eugenio; Parini, Angelo; Borges, Fernanda; Binda, Claudia
2018-05-10
Monoamine oxidase B (MAO-B) is a validated drug target for Parkinson's disease. Chromone derivatives were identified as novel potent and reversible MAO-B inhibitors, and herewith we report on a crystallographic and biochemical analysis to investigate their inhibition mechanism. The crystal structures of human MAO-B in complex with three chromone analogs bearing different substituents on the exocyclic aromatic ring (determined at 1.6-1.8 Å resolution) showed that they all bind in the active site cavity of the protein with the chromone moiety located in front of the FAD cofactor. These inhibitors form two hydrogen bonds with Tyr435 and Cys172 and perfectly fit the hydrophobic flat active site of human MAO-B. This is reflected in their tight-binding mechanism of inhibition with K i values of 55, 17, and 31 nM for N-(3',4'-dimethylphenyl)-4-oxo-4 H-chromene-3-carboxamide (1), N-(3'-chlorophenyl)-4-oxo-4 H-chromene-3-carboxamide (2), and N-(3'-fluorophenyl)-4-oxo-4 H-chromene-3-carboxamide (3), respectively. These compounds were also 1000-fold more effective than l-deprenyl in reducing the cellular levels of reactive oxygen species (ROS).
NASA Astrophysics Data System (ADS)
Ali, Farman; Ibrahim, Muhammad; Khan, Fawad; Bibi, Iram; Shah, Syed W. H.
2018-03-01
Binding preferences of cationic dyes malachite green and methylene blue in a mixed charcoal-sodium dodecyl sulfate system have been investigated using UV-visible absorption spectroscopy. The dye adsorption shows surfactant-dependent patterns, indicating diverse modes of interactions. At low surfactant concentration, a direct binding to charcoal is preferred. Comparatively greater quantities of surfactant lead to attachment of dye-surfactant complex to charcoal through hydrophobic interactions. A simple model was employed for determination of equilibrium constant K eq and concentration of dye-surfactant ion pair N DS for both dyes. The values of binding parameters revealed that malachite green was directly adsorbed onto charcoal, whereas methylene blue was bound through surfactant monomers. The model is valid for low surfactant concentrations in the premicellar region. These findings have significance for material and environmental sciences.
A dynamic traction splint for the management of extrinsic tendon tightness.
Dovelle, S; Heeter, P K; Phillips, P D
1987-02-01
The dynamic traction splint designed by therapists at Walter Reed Army Medical Center is used for the management of extrinsic extensor tendon tightness commonly seen in brachial plexus injuries and traumatic soft tissue injuries of the upper extremity. The two components of the splint allow for simultaneous maximum flexion of the MCP and IP joints. This simple and economical splint provides an additional modality to any occupational therapy service involved in the management of upper extremity disorders.
The K-turn motif in riboswitches and other RNA species☆
Lilley, David M.J.
2014-01-01
The kink turn is a widespread structure motif that introduces a tight bend into the axis of duplex RNA. This generally functions to mediate tertiary interactions, and to serve as a specific protein binding site. K-turns or closely related structures are found in at least seven different riboswitch structures, where they function as key architectural elements that help generate the ligand binding pocket. This article is part of a Special Issue entitled: Riboswitches. PMID:24798078
lee, Lee-Peng; Tidor, Bruce
2001-01-01
Theoretical and experimental studies have shown that the large desolvation penalty required for polar and charged groups frequently precludes their involvement in electrostatic interactions that contribute strongly to net stability in the folding or binding of proteins in aqueous solution near room temperature. We have previously developed a theoretical framework for computing optimized electrostatic interactions and illustrated use of the algorithm with simplified geometries. Given a receptor and model assumptions, the method computes the ligand-charge distribution that provides the most favorable balance of desolvation and interaction effects on binding. In this paper the method has been extended to treat complexes using actual molecular shapes. The barnase-barstar protein complex was investigated with barnase treated as a target receptor. The atomic point charges of barstar were varied to optimize the electrostatic binding free energy. Barnase and natural barstar form a tight complex (Kd ∼ 10−14 M) with many charged and polar groups near the interface that make this a particularly relevant system for investigating the role of electrostatic effects on binding. The results show that sets of barstar charges (resulting from optimization with different constraints) can be found that give rise to relatively large predicted improvements in electrostatic binding free energy. Principles for enhancing the effect of electrostatic interactions in molecular binding in aqueous environments are discussed in light of the optima. Our findings suggest that, in general, the enhancements in electrostatic binding free energy resulting from modification of polar and charged groups can be substantial. Moreover, a recently proposed definition of electrostatic complementarity is shown to be a useful tool for examining binding interfaces. Finally, calculational results suggest that wild-type barstar is closer to being affinity optimized than is barnase for their mutual binding, consistent with the known roles of these proteins. PMID:11266622
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.
Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome
Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274
Increasing the affinity of selective bZIP-binding peptides through surface residue redesign.
Kaplan, Jenifer B; Reinke, Aaron W; Keating, Amy E
2014-07-01
The coiled-coil dimer is a prevalent protein interaction motif that is important for many cellular processes. The basic leucine-zipper (bZIP) transcription factors are one family of proteins for which coiled-coil mediated dimerization is essential for function, and misregulation of bZIPs can lead to disease states including cancer. This makes coiled coils attractive protein-protein interaction targets to disrupt using engineered molecules. Previous work designing peptides to compete with native coiled-coil interactions focused primarily on designing the core residues of the interface to achieve affinity and specificity. However, folding studies on the model bZIP GCN4 show that coiled-coil surface residues also contribute to binding affinity. Here we extend a prior study in which peptides were designed to bind tightly and specifically to representative members of each of 20 human bZIP families. These "anti-bZIP" peptides were designed with an emphasis on target-binding specificity, with contributions to design-target specificity and affinity engineered considering only the coiled-coil core residues. High-throughput testing using peptide arrays indicated many successes. We have now measured the binding affinities and specificities of anti-bZIPs that bind to FOS, XBP1, ATF6, and CREBZF in solution and tested whether redesigning the surface residues can increase design-target affinity. Incorporating residues that favor helix formation into the designs increased binding affinities in all cases, providing low-nanomolar binders of each target. However, changes in surface electrostatic interactions sometimes changed the binding specificity of the designed peptides. © 2014 The Protein Society.
Ward, Logan; Steel, James; Le Compte, Aaron; Evans, Alicia; Tan, Chia-Siong; Penning, Sophie; Shaw, Geoffrey M; Desaive, Thomas; Chase, J Geoffrey
2012-01-01
Tight glycemic control (TGC) has shown benefits but has been difficult to implement. Model-based methods and computerized protocols offer the opportunity to improve TGC quality and compliance. This research presents an interface design to maximize compliance, minimize real and perceived clinical effort, and minimize error based on simple human factors and end user input. The graphical user interface (GUI) design is presented by construction based on a series of simple, short design criteria based on fundamental human factors engineering and includes the use of user feedback and focus groups comprising nursing staff at Christchurch Hospital. The overall design maximizes ease of use and minimizes (unnecessary) interaction and use. It is coupled to a protocol that allows nurse staff to select measurement intervals and thus self-manage workload. The overall GUI design is presented and requires only one data entry point per intervention cycle. The design and main interface are heavily focused on the nurse end users who are the predominant users, while additional detailed and longitudinal data, which are of interest to doctors guiding overall patient care, are available via tabs. This dichotomy of needs and interests based on the end user's immediate focus and goals shows how interfaces must adapt to offer different information to multiple types of users. The interface is designed to minimize real and perceived clinical effort, and ongoing pilot trials have reported high levels of acceptance. The overall design principles, approach, and testing methods are based on fundamental human factors principles designed to reduce user effort and error and are readily generalizable. © 2012 Diabetes Technology Society.
Ward, Logan; Steel, James; Le Compte, Aaron; Evans, Alicia; Tan, Chia-Siong; Penning, Sophie; Shaw, Geoffrey M; Desaive, Thomas; Chase, J Geoffrey
2012-01-01
Introduction Tight glycemic control (TGC) has shown benefits but has been difficult to implement. Model-based methods and computerized protocols offer the opportunity to improve TGC quality and compliance. This research presents an interface design to maximize compliance, minimize real and perceived clinical effort, and minimize error based on simple human factors and end user input. Method The graphical user interface (GUI) design is presented by construction based on a series of simple, short design criteria based on fundamental human factors engineering and includes the use of user feedback and focus groups comprising nursing staff at Christchurch Hospital. The overall design maximizes ease of use and minimizes (unnecessary) interaction and use. It is coupled to a protocol that allows nurse staff to select measurement intervals and thus self-manage workload. Results The overall GUI design is presented and requires only one data entry point per intervention cycle. The design and main interface are heavily focused on the nurse end users who are the predominant users, while additional detailed and longitudinal data, which are of interest to doctors guiding overall patient care, are available via tabs. This dichotomy of needs and interests based on the end user's immediate focus and goals shows how interfaces must adapt to offer different information to multiple types of users. Conclusions The interface is designed to minimize real and perceived clinical effort, and ongoing pilot trials have reported high levels of acceptance. The overall design principles, approach, and testing methods are based on fundamental human factors principles designed to reduce user effort and error and are readily generalizable. PMID:22401330
Conductance of AFM Deformed Carbon Nanotubes
NASA Technical Reports Server (NTRS)
Svizhenko, Alexei; Maiti, Amitesh; Anatram, M. P.; Biegel, Bryan (Technical Monitor)
2002-01-01
This viewgraph presentation provides information on the electrical conductivity of carbon nanotubes upon deformation by atomic force microscopy (AFM). The density of states and conductance were computed using four orbital tight-binding method with various parameterizations. Different chiralities develop bandgap that varies with chirality.
B-spline tight frame based force matching method
NASA Astrophysics Data System (ADS)
Yang, Jianbin; Zhu, Guanhua; Tong, Dudu; Lu, Lanyuan; Shen, Zuowei
2018-06-01
In molecular dynamics simulations, compared with popular all-atom force field approaches, coarse-grained (CG) methods are frequently used for the rapid investigations of long time- and length-scale processes in many important biological and soft matter studies. The typical task in coarse-graining is to derive interaction force functions between different CG site types in terms of their distance, bond angle or dihedral angle. In this paper, an ℓ1-regularized least squares model is applied to form the force functions, which makes additional use of the B-spline wavelet frame transform in order to preserve the important features of force functions. The B-spline tight frames system has a simple explicit expression which is useful for representing our force functions. Moreover, the redundancy of the system offers more resilience to the effects of noise and is useful in the case of lossy data. Numerical results for molecular systems involving pairwise non-bonded, three and four-body bonded interactions are obtained to demonstrate the effectiveness of our approach.
New lessons from the H I size-mass relation of galaxies
NASA Astrophysics Data System (ADS)
Wang, Jing; Koribalski, Bärbel S.; Serra, Paolo; van der Hulst, Thijs; Roychowdhury, Sambit; Kamphuis, Peter; Chengalur, Jayaram N.
2016-08-01
We revisit the H I size-mass (D_{H I}-MH I) relation of galaxies with a sample of more than 500 nearby galaxies covering over five orders of magnitude in H I mass and more than 10 B-band magnitudes. The relation is remarkably tight with a scatter σ ˜ 0.06 dex, or 14 per cent. The scatter does not change as a function of galaxy luminosity, H I richness or morphological type. The relation is linked to the fact that dwarf and spiral galaxies have a homogeneous radial profile of H I surface density in the outer regions when the radius is normalized by DH I. The early-type disc galaxies typically have shallower H I radial profiles, indicating a different gas accretion history. We argue that the process of atomic-to-molecular gas conversion or star formation cannot explain the tightness of the DH I-MH I relation. This simple relation puts strong constraints on simulation models for galaxy formation.
Gikanga, Benson; Eisner, Devon Roshan; Ovadia, Robert; Day, Eric S; Stauch, Oliver B; Maa, Yuh-Fun
2017-01-01
Subvisible particle formation in monoclonal antibody drug product resulting from mixing and filling operations represents a significant processing risk that can lead to filter fouling and thereby lead to process delays or failures. Several previous studies from our lab and others demonstrated the formation of subvisible particulates in mAb formulations resulting from mixing operations using some bottom-mounted mixers or stirrer bars. It was hypothesized that the stress (e.g., shear/cavitation) derived from tight clearance and/or close contact between the impeller and shaft was responsible for protein subvisible particulate generation. These studies, however, could not distinguish between the two surfaces without contact (tight clearance) or between two contacting surfaces (close contact). In the present study we expand on those findings and utilize small-scale mixing models that are able to, for the first time, distinguish between tight clearances and tight contact. In this study we evaluated different mixer types including a top-mounted mixer, several impeller-based bottom-mounted mixers, and a rotary piston pump. The impact of tight clearance/close contact on subvisible particle formation in at-scale mixing platforms was demonstrated in the gap between the impeller and drive unit as well as between the piston and the housing of the pump. Furthermore, small-scale mixing models based on different designs of magnetic stir bars that mimic the tight clearance/close contact of the manufacturing-scale mixers also induced subvisible particles in mAb formulations. Additional small-scale models that feature tight clearance but no close contact (grinding) suggested that it is the repeated grinding/contacting of the moving parts and not the presence of tight clearance in the processing equipment that is the root cause of protein subvisible particulate formation. When multiple mAbs, Fabs (fragment antigen binding), or non-antibody related proteins were mixed in the small-scale mixing model, for molecules investigated, it was observed that mAbs and Fabs appear to be more susceptible to particle formation than non-antibody-related proteins. In the grinding zone, mAb/Fab molecules aggregated into insoluble particles with neither detectable soluble aggregates nor fragmented species. This investigation represents a step closer to the understanding of the underlying stress mechanism leading to mAb subvisible particulate formation as the result of drug product processing. LAY ABSTRACT: Mixing and fill finish are important unit operations in drug product manufacturing for compounding (dilution, pooling, homogenization, etc.) and filling into primary packaging containers (vials, pre-filled syringes, etc.), respectively. The current trend in adopting bottom-mounted mixers as well as low fill-volume filling systems has raised concerns about their impact on drug product quality and process performance. However, investigations into the effects of their use for biopharmaceutical products, particularly monoclonal antibody formulations, are rarely published. The purpose of this study is three-fold: (1) to revisit the impact of bottom-mounted mixer design on monoclonal antibody subvisible particle formation; (2) to identify the root cause for subvisible particle formation; and (3) to fully utilize available particle analysis tools to demonstrate the correlation between particle count in the solution and filter fouling during sterile filtration. The outcomes of this study will benefit scientists and engineers who develop biologic product manufacturing processes by providing a better understanding of drug product process challenges. © PDA, Inc. 2017.
Polyethyleneimine grafted short halloysite nanotubes for gene delivery.
Long, Zheru; Zhang, Jun; Shen, Yan; Zhou, Changren; Liu, Mingxian
2017-12-01
Inorganic nanoparticles have attracted much attentions in gene delivery because of their desirable characteristics including low toxicity, well-controlled characteristics, high gene delivery efficiency, and multi-functionalities. Here, natural occurred halloysite nanotubes (HNTs) were developed as a novel non-viral gene vector. To increase the efficiency of endocytosis, HNTs were firstly shortened into an appropriate size (~200nm). Then polyethyleneimine (PEI) was grafted onto HNTs to bind green fluorescence protein (GFP) labeled pDNA. The structure and physical-chemical properties of PEI grafted HNTs (PEI-g-HNTs) were characterized by various methods. PEI-g-HNTs show lower cytotoxicity than PEI. PEI-g-HNTs are positively charged and can bind DNA tightly at designed N/P ratio from 5:1 to 40:1. PEI-g-HNTs/pDNA complexes show much higher transfection efficiency towards both 293T and HeLa cells compared with PEI/pDNA complexes at the equivalent N/P ratio. The transfection efficiencies of PEI-g-HNTs/pDNA complex towards HeLa cell can reach to 44.4% at N/P ratio of 20. PEI-g-HNTs/pDNA complexes possess a higher GFP protein expression than PEI/pDNA from simple western immunoblots. So, PEI-g-HNTs are potential gene vectors with good biocompatibility and high transfection efficiency, which have promising applications in cancer gene therapy. Copyright © 2017 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sahu, Sivabrata, E-mail: siva1987@iopb.res.in; Parashar, S. K. S., E-mail: sksparashar@yahoo.com; Rout, G. C., E-mail: gcr@iopb.res.in
We address here a tight-binding theoretical model calculation for AA-stacked bi-layer graphene taking into account of a biased potential between two layers to study the density of states and the band dispersion within the total Brillouin zone. We have calculated the electronic Green’s function for electron operator corresponding to A and B sub lattices by Zubarev’s Green’s function technique from which the electronic density of states and the electron band energy dispersion are calculated. The numerically computed density of states and band energy dispersions are investigated by tuning the biased potential to exhibit the band gap by varying the differentmore » physical parameters.« less
Mahdavifar, Maryam; Khoeini, Farhad
2018-08-10
We report peculiar charge and spin transport properties in S-shaped silicene junctions with the Kane-Mele tight-binding model. In this work, we investigate the effects of electric and exchange fields on the charge and spin transport properties. Our results show that by applying a perpendicular electric field, metal-semiconductor and also semimetal-semiconductor phase transitions occur in our systems. Furthermore, full spin current can be obtained in the structures, so the half-metallic states are observable. Our results enable us to control charge and spin currents and provide new opportunities and applications in silicene-based electronics, optoelectronics, and spintronics.
Gate-Controllable Magneto-optic Kerr Effect in Layered Collinear Antiferromagnets
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sivadas, Nikhil; Okamoto, Satoshi; Xiao, Di
2016-12-23
In this paper, using symmetry arguments and a tight-binding model, we show that for layered collinear antiferromagnets, magneto-optic effects can be generated and manipulated by controlling crystal symmetries through a gate voltage. This provides a promising route for electric field manipulation of the magneto-optic effects without modifying the underlying magnetic structure. We further demonstrate the gate control of the magneto-optic Kerr effect (MOKE) in bilayer MnPSe 3 using first-principles calculations. Finally, the field-induced inversion symmetry breaking effect leads to gate-controllable MOKE, whose direction of rotation can be switched by the reversal of the gate voltage.
Conductance of single microRNAs chains related to the autism spectrum disorder
NASA Astrophysics Data System (ADS)
Oliveira, J. I. N.; Albuquerque, E. L.; Fulco, U. L.; Mauriz, P. W.; Sarmento, R. G.; Caetano, E. W. S.; Freire, V. N.
2014-09-01
The charge transport properties of single-stranded microRNAs (miRNAs) chains associated to autism disorder were investigated. The computations were performed within a tight-binding model, together with a transfer matrix technique, with ionization energies and hopping parameters obtained by quantum chemistry method. Current-voltage (I× V) curves of twelve miRNA chains related to the autism spectrum disorders were calculated and analysed. We have obtained both semiconductor and insulator behavior, and a relationship between the current intensity and the autism-related miRNA bases sequencies, suggesting that a kind of electronic biosensor can be developed to distinguish different profiles of autism disorders.
Twisting dirac fermions: circular dichroism in bilayer graphene
NASA Astrophysics Data System (ADS)
Suárez Morell, E.; Chico, Leonor; Brey, Luis
2017-09-01
Twisted bilayer graphene is a chiral system which has been recently shown to present circular dichroism. In this work we show that the origin of this optical activity is the rotation of the Dirac fermions’ helicities in the top and bottom layer. Starting from the Kubo formula, we obtain a compact expression for the Hall conductivity that takes into account the dephasing of the electromagnetic field between the top and bottom layers and gathers all the symmetries of the system. Our results are based in both a continuum and a tight-binding model, and they can be generalized to any two-dimensional Dirac material with a chiral stacking between layers.
NASA Technical Reports Server (NTRS)
Beratan, David N.
1989-01-01
The presence of conjugation and substitution defects introduces gap states in finite polyenes that are shown to influence the size and sign of the second molecular hyperpolarizability (SMH). Using a one-electron tight-binding model, the dependence of SMH on the defect-state occupancy and energy in finite polyenes is calculated. Defects can cause a significant decrease or enhancement of SMH by impeding charge delocalization or by creating partly filled bands (mimicking the one-band limit), respectively. Concomitant sign changes in SMH are predicted. Calculation results suggest strategies for designing molecules that can be either photochemically or electrochemically switched between states with considerably different SMHs.
NASA Technical Reports Server (NTRS)
Lee, Seungwon; vonAllmen, Paul; Oyafuso, Fabiano; Klimeck, Gerhard; Whale, K. Birgitta
2004-01-01
Electron spin dephasing and decoherence by its interaction with nuclear spins in self-assembled quantum dots are investigated in the framework of the empirical tight-binding model. Electron spin dephasing in an ensemble of dots is induced by the inhomogeneous precession frequencies of the electron among dots, while electron spin decoherence in a single dot arises from the inhomogeneous precession frequencies of nuclear spins in the dot. For In(x)Ga(1-x) As self-assembled dots containing 30000 nuclei, the dephasing and decoherence times are predicted to be on the order of 100 ps and 1 (micro)s.
Exciton intrachain transport induced by interchain packing configurations in conjugated polymers.
Meng, Ruixuan; Gao, Kun; Zhang, Gaiyan; Han, Shixuan; Yang, Fujiang; Li, Yuan; Xie, Shijie
2015-07-28
Based on a tight binding model combined with a nonadiabatic dynamics approach, we theoretically investigate the exciton intrachain transport in conjugated polymers with different interchain packing configurations. We construct two different interchain packing configurations, i.e. linear and exponential forms, and simulate the dynamical processes of the exciton transport in these systems. We find that, in both cases, there exists a distribution of driving force for exciton transport, which stems from the gradient of the exciton creation energy along the chains. This finding enriches the picture of exciton transport in polymers and provides a new idea to improve the exciton transport length in polymeric photovoltaic devices.
Transparent lattices and their solitary waves.
Sadurní, E
2014-09-01
We provide a family of transparent tight-binding models with nontrivial potentials and site-dependent hopping parameters. Their feasibility is discussed in electromagnetic resonators, dielectric slabs, and quantum-mechanical traps. In the second part of the paper, the arrays are obtained through a generalization of supersymmetric quantum mechanics in discrete variables. The formalism includes a finite-difference Darboux transformation applied to the scattering matrix of a periodic array. A procedure for constructing a hierarchy of discrete Hamiltonians is indicated and a particular biparametric family is given. The corresponding potentials and hopping functions are identified as solitary waves, pointing to a discrete spinorial generalization of the Korteweg-deVries family.
Pressure Effects on the Magnetic Phase Transition of Mn3SnC1-xNx (x = 0, 0.5)
NASA Astrophysics Data System (ADS)
Hu, Jing-Yu; Wen, Yong-Chun; Yao, Yuan; Wang, Cong; Zhao, Qing; Jin, Chang-Qing; Yu, Ri-Cheng
2012-08-01
The electronic transport properties of Mn3SnC and Mn3SnC0.5N0.5 were measured under pressures up to 1.8 GPa. At ambient pressure, an abrupt increase of resistance occurs around the temperature of magnetic phase transition in both samples. The transition temperature Tc from paramagnetic to ferrimagnetic state decreases linearly at rates of 12.6 and 6.3K/GPa with pressure for Mn3SnC and Mn3SnC0.5N0.5, respectively. This phenomenon could be understood by the Labbe-Jardin tight binding approximation model.
Kastritis, Panagiotis L; Rodrigues, João P G L M; Folkers, Gert E; Boelens, Rolf; Bonvin, Alexandre M J J
2014-07-15
Protein-protein complexes orchestrate most cellular processes such as transcription, signal transduction and apoptosis. The factors governing their affinity remain elusive however, especially when it comes to describing dissociation rates (koff). Here we demonstrate that, next to direct contributions from the interface, the non-interacting surface (NIS) also plays an important role in binding affinity, especially polar and charged residues. Their percentage on the NIS is conserved over orthologous complexes indicating an evolutionary selection pressure. Their effect on binding affinity can be explained by long-range electrostatic contributions and surface-solvent interactions that are known to determine the local frustration of the protein complex surface. Including these in a simple model significantly improves the affinity prediction of protein complexes from structural models. The impact of mutations outside the interacting surface on binding affinity is supported by experimental alanine scanning mutagenesis data. These results enable the development of more sophisticated and integrated biophysical models of binding affinity and open new directions in experimental control and modulation of biomolecular interactions. Copyright © 2014. Published by Elsevier Ltd.
Gillet, Natacha; Berstis, Laura; Wu, Xiaojing; ...
2016-09-09
In this paper, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesizedmore » by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated p-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. Finally, these four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gillet, Natacha; Berstis, Laura; Wu, Xiaojing
In this paper, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesizedmore » by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated p-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. Finally, these four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.« less
Gillet, Natacha; Berstis, Laura; Wu, Xiaojing; Gajdos, Fruzsina; Heck, Alexander; de la Lande, Aurélien; Blumberger, Jochen; Elstner, Marcus
2016-10-11
In this article, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesized by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated π-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. These four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.
Structural basis of kynurenine 3-monooxygenase inhibition
Amaral, Marta; Levy, Colin; Heyes, Derren J.; Lafite, Pierre; Outeiro, Tiago F.; Giorgini, Flaviano; Leys, David; Scrutton, Nigel S.
2013-01-01
Inhibition of kynurenine 3-monooxygenase (KMO), an enzyme in the eukaryotic tryptophan catabolic pathway (i.e. kynurenine pathway), leads to amelioration of Huntington’s disease-relevant phenotypes in yeast, fruit fly, and mouse models1–5, as well as a mouse model of Alzheimer’s disease3. KMO is a FAD-dependent monooxygenase, and is located in the outer mitochondrial membrane where it converts L-kynurenine to 3-hydroxykynurenine. Perturbations in the levels of kynurenine pathway metabolites have been linked to the pathogenesis of a spectrum of brain disorders6, as well as cancer7,8, and several peripheral inflammatory conditions9. Despite the importance of KMO as a target for neurodegenerative disease, the molecular basis of KMO inhibition by available lead compounds has remained hitherto unknown. Here we report the first crystal structure of KMO, in the free form and in complex with the tight-binding inhibitor UPF 648. UPF 648 binds close to the FAD cofactor and perturbs the local active site structure, preventing productive binding of the substrate kynurenine. Functional assays and targeted mutagenesis revealed that the active site architecture and UPF 648 binding are essentially identical in human KMO, validating the yeast KMO:UPF 648 structure as a template for structure-based drug design. This will inform the search for new KMO inhibitors that are able to cross the blood-brain barrier in targeted therapies against neurodegenerative diseases such as Huntington’s, Alzheimer’s, and Parkinson’s diseases. PMID:23575632
Rapid surface-biostructure interaction analysis using strong metal-based nanomagnets.
Rotzetter, Aline C C; Schumacher, Christoph M; Zako, Tamotsu; Stark, Wendelin J; Maeda, Mizuo
2013-11-19
Nanomaterials are increasingly suggested for the selective adsorption and extraction of complex compounds in biomedicine. Binding of the latter requires specific surface modifications of the nanostructures. However, even complicated macromolecules such as proteins can afford affinities toward basic surface characteristics such as hydrophobicity, topology, and electrostatic charge. In this study, we address these more basic physical interactions. In a model system, the interaction of bovine serum albumin and amyloid β 42 fibrillar aggregates with carbon-coated cobalt nanoparticles, functionalized with various polymers differing in character, was studied. The possibility of rapid magnetic separation upon binding to the surface represents a valuable tool for studying surface interactions and selectivities. We find that the surface interaction of Aβ 42 fibrillar aggregates is mostly hydrophobic in nature. Because bovine serum albumin (BSA) is conformationally adaptive, it is known to bind surfaces with widely differing properties (charge, topology, and hydrophobicity). However, the rate of tight binding (no desorption upon washing) can vary largely depending on the extent of necessary conformational changes for a specific surface. We found that BSA can only bind slowly to polyethylenimine-coated nanomagnets. Under competitive conditions (high excess BSA compared to that for β 42 fibrillar aggregates), this effect is beneficial for targeting the fibrillar species. These findings highlight the possibility of selective extractions from complex media when advantageous basic physical surface properties are chosen.
The iron uptake repressor Fep1 in the fission yeast binds Fe-S cluster through conserved cysteines.
Kim, Hyo-Jin; Lee, Kang-Lok; Kim, Kyoung-Dong; Roe, Jung-Hye
2016-09-09
Iron homeostasis is tightly regulated since iron is an essential but toxic element in the cell. The GATA-type transcription factor Fep1 and its orthologs contribute to iron homeostasis in many fungi by repressing genes for iron uptake when intracellular iron is high. Even though the function and interaction partners of Fep1 have been elucidated extensively In Schizosaccharomyces pombe, the mechanism behind iron-sensing by Fep1 remains elusive. It has been reported that Fep1 interacts with Fe-S-containing monothiol glutaredoxin Grx4 and Grx4-Fra2 complex. In this study, we demonstrate that Fep1 also binds iron, in the form of Fe-S cluster. Spectroscopic and biochemical analyses of as isolated and reconstituted Fep1 suggest that the dimeric Fep1 binds Fe-S clusters. The mutation study revealed that the cluster-binding depended on the conserved cysteines located between the two zinc fingers in the DNA binding domain. EPR analyses revealed [Fe-S]-specific peaks indicative of mixed presence of [2Fe-2S], [3Fe-4S], or [4Fe-4S]. The finding that Fep1 is an Fe-S protein fits nicely with the model that the Fe-S-trafficking Grx4 senses intracellular iron environment and modulates the activity of Fep1. Copyright © 2016 Elsevier Inc. All rights reserved.
Protein Binding: Do We Ever Learn?▿
Zeitlinger, Markus A.; Derendorf, Hartmut; Mouton, Johan W.; Cars, Otto; Craig, William A.; Andes, David; Theuretzbacher, Ursula
2011-01-01
Although the influence of protein binding (PB) on antibacterial activity has been reported for many antibiotics and over many years, there is currently no standardization for pharmacodynamic models that account for the impact of protein binding of antimicrobial agents in vitro. This might explain the somewhat contradictory results obtained from different studies. Simple in vitro models which compare the MIC obtained in protein-free standard medium versus a protein-rich medium are prone to methodological pitfalls and may lead to flawed conclusions. Within in vitro test systems, a range of test conditions, including source of protein, concentration of the tested antibiotic, temperature, pH, electrolytes, and supplements may influence the impact of protein binding. As new antibiotics with a high degree of protein binding are in clinical development, attention and action directed toward the optimization and standardization of testing the impact of protein binding on the activity of antibiotics in vitro become even more urgent. In addition, the quantitative relationship between the effects of protein binding in vitro and in vivo needs to be established, since the physiological conditions differ. General recommendations for testing the impact of protein binding in vitro are suggested. PMID:21537013
Beyer, K; Nuscher, B
1996-12-10
The interaction of cardiolipin with the isolated ADP/ATP carrier protein from beef heart mitochondria has been studied by means of the unmasking of a single cysteinyl residue, Cys56, which accompanies the conformational transition of the protein [Leblanc, P., & Clauser, H, (1972) FEBS Lett. 23, 107-113]. The unmasking was monitored by using the static fluorescence of the sulfhydryl reagent N-(1-pyrenyl)maleimide (PYM). The rate of PYM binding that was observed after initiation of the conformational transition by ADP was drastically reduced in the presence of cardiolipin (CL). Phospholipids other than CL were much less effective. It can be shown that the conformational transition and the binding reaction are both affected by CL, although to varying extents. An enhancement of the rate of the ADP-dependent PYM binding was observed upon digestion of the protein bound phospholipid by phospholipase A2. The phospholipase treatment also led to an increased ADP-independent PYM binding, thus indicating that the ADP control of the carrier transition was gradually lost. The ADP control could be fully restored through the addition of CL, provided that the phospholipase incubation had been terminated after approximately 1 h. These results will be discussed in relation to an earlier report of tight cardiolipin binding [Beyer, K., & Klingenberg, M. (1985) Biochemistry 24, 3821-3826] and to current structural models of the ADP/ATP carrier protein.
Automodification of PARP-1 mediates its tight binding to the nuclear matrix
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zaalishvili, Giorgi, E-mail: giozaal@gmail.com; Margiani, Dina; Kutalia, Ketevan
2010-02-26
Poly(ADP-ribose) polymerase-1 (PARP-1), a nuclear enzyme that catalyzes the NAD{sup +}-dependent addition of ADP-ribose polymers on a variety of nuclear proteins, has been shown to be associated with the nuclear matrix. As yet, the properties and conditions of this association are unclear. Here, we show the existence of two PARP-1 pools associated with the nuclear matrix of rat liver and the ability of PARP-1 automodification to facilitate its binding to the nuclear matrix.
Data key to quest for quality.
Chang, Florence S; Nielsen, Jon; Macias, Charles
2013-11-01
Late-binding data warehousing reduces the time it takes to obtain data needed to make crucial decisions. Late binding refers to when and how tightly data from the source applications are bound to the rules and vocabularies that make it useful. In some cases, data can be seen in real time. In historically paper-driven environments where data-driven decisions may be a new concept, buy-in from clinicians, physicians, and hospital leaders is key to success in using data to improve outcomes.
Nishizawa, Hiroaki; Nishimura, Yoshifumi; Kobayashi, Masato; Irle, Stephan; Nakai, Hiromi
2016-08-05
The linear-scaling divide-and-conquer (DC) quantum chemical methodology is applied to the density-functional tight-binding (DFTB) theory to develop a massively parallel program that achieves on-the-fly molecular reaction dynamics simulations of huge systems from scratch. The functions to perform large scale geometry optimization and molecular dynamics with DC-DFTB potential energy surface are implemented to the program called DC-DFTB-K. A novel interpolation-based algorithm is developed for parallelizing the determination of the Fermi level in the DC method. The performance of the DC-DFTB-K program is assessed using a laboratory computer and the K computer. Numerical tests show the high efficiency of the DC-DFTB-K program, a single-point energy gradient calculation of a one-million-atom system is completed within 60 s using 7290 nodes of the K computer. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
NASA Astrophysics Data System (ADS)
Chegel, Raad; Behzad, Somayeh
2013-11-01
We have investigated the electronic properties of SiNTs, under the external electric field, using Tight Binding (TB) approximation. It was found that the energy levels, energy gaps, and density of states (DOS) strongly depend on the electric field strength. The large electric strength leads to coupling the neighbor subbands and induce destruction of subband degeneracy, increase of low-energy states, and strong modulation of energy gap which these effects reflect in the DOS spectrum. It has been shown that, the band gap reduction of Si g-NTs is linearly proportional to the electric field strength. The band gap variation for Si h-NTs increases first and later decreases (Metallic) or first remains constant and then decreases (semiconductor). Also we show that the larger diameter tubes are more sensitive to the field strength than smaller ones. The semiconducting metallic transition or vice versa can be achieved through an increasing of applied fields. Number and position of peaks in DOS spectrum are dependent on electric field strength.
NASA Astrophysics Data System (ADS)
Giro, R.; Caldas, M. J.; Galvão, D. S.
The interest in poly(p-phenylene) (PPP) and poly(p-phenylene vinylene) (PPV) copolymers stems from the fact that these homopolymers present interesting optical and electronic properties that allow a great variety of technological applications. Combining different numbers of PPP and PPV units it is possible, in principle, to obtain new structures presenting intermediate gap values (2.8 eV and 2.4 eV for PPP and PPV, respectively). For this study we used a Hückel Hamiltonian tight-binding coupled to the negative factor counting (NFC) technique. We carried out a systematic search to determine optimum relative concentrations for disordered binary polymeric alloys with predefined gap values. Once these structures were obtained, we used the semiempirical methods AM1/PM3 and ZINDO/S-CI for geometrical and optical studies, respectively. Our theoretical results show that it is possible to obtain copolymers of PPP and PPV with intermediate gap values of their parent structures.
Zhang, Hong; Zapol, Peter; Dixon, David A.; ...
2015-11-17
The Shift-and-invert parallel spectral transformations (SIPs), a computational approach to solve sparse eigenvalue problems, is developed for massively parallel architectures with exceptional parallel scalability and robustness. The capabilities of SIPs are demonstrated by diagonalization of density-functional based tight-binding (DFTB) Hamiltonian and overlap matrices for single-wall metallic carbon nanotubes, diamond nanowires, and bulk diamond crystals. The largest (smallest) example studied is a 128,000 (2000) atom nanotube for which ~330,000 (~5600) eigenvalues and eigenfunctions are obtained in ~190 (~5) seconds when parallelized over 266,144 (16,384) Blue Gene/Q cores. Weak scaling and strong scaling of SIPs are analyzed and the performance of SIPsmore » is compared with other novel methods. Different matrix ordering methods are investigated to reduce the cost of the factorization step, which dominates the time-to-solution at the strong scaling limit. As a result, a parallel implementation of assembling the density matrix from the distributed eigenvectors is demonstrated.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Hong; Zapol, Peter; Dixon, David A.
The Shift-and-invert parallel spectral transformations (SIPs), a computational approach to solve sparse eigenvalue problems, is developed for massively parallel architectures with exceptional parallel scalability and robustness. The capabilities of SIPs are demonstrated by diagonalization of density-functional based tight-binding (DFTB) Hamiltonian and overlap matrices for single-wall metallic carbon nanotubes, diamond nanowires, and bulk diamond crystals. The largest (smallest) example studied is a 128,000 (2000) atom nanotube for which ~330,000 (~5600) eigenvalues and eigenfunctions are obtained in ~190 (~5) seconds when parallelized over 266,144 (16,384) Blue Gene/Q cores. Weak scaling and strong scaling of SIPs are analyzed and the performance of SIPsmore » is compared with other novel methods. Different matrix ordering methods are investigated to reduce the cost of the factorization step, which dominates the time-to-solution at the strong scaling limit. As a result, a parallel implementation of assembling the density matrix from the distributed eigenvectors is demonstrated.« less
NASA Astrophysics Data System (ADS)
Nishimoto, Yoshio; Fedorov, Dmitri G.
2018-02-01
The exactly analytic gradient is derived and implemented for the fragment molecular orbital (FMO) method combined with density-functional tight-binding (DFTB) using adaptive frozen orbitals. The response contributions which arise from freezing detached molecular orbitals on the border between fragments are computed by solving Z-vector equations. The accuracy of the energy, its gradient, and optimized structures is verified on a set of representative inorganic materials and polypeptides. FMO-DFTB is applied to optimize the structure of a silicon nano-wire, and the results are compared to those of density functional theory and experiment. FMO accelerates the DFTB calculation of a boron nitride nano-ring with 7872 atoms by a factor of 406. Molecular dynamics simulations using FMO-DFTB applied to a 10.7 μm chain of boron nitride nano-rings, consisting of about 1.2 × 106 atoms, reveal the rippling and twisting of nano-rings at room temperature.
NASA Astrophysics Data System (ADS)
Bhakat, Soumendranath; Åberg, Emil; Söderhjelm, Pär
2018-01-01
Advanced molecular docking methods often aim at capturing the flexibility of the protein upon binding to the ligand. In this study, we investigate whether instead a simple rigid docking method can be applied, if combined with multiple target structures to model the backbone flexibility and molecular dynamics simulations to model the sidechain and ligand flexibility. The methods are tested for the binding of 35 ligands to FXR as part of the first stage of the Drug Design Data Resource (D3R) Grand Challenge 2 blind challenge. The results show that the multiple-target docking protocol performs surprisingly well, with correct poses found for 21 of the ligands. MD simulations started on the docked structures are remarkably stable, but show almost no tendency of refining the structure closer to the experimentally found binding pose. Reconnaissance metadynamics enhances the exploration of new binding poses, but additional collective variables involving the protein are needed to exploit the full potential of the method.
Bhakat, Soumendranath; Åberg, Emil; Söderhjelm, Pär
2018-01-01
Advanced molecular docking methods often aim at capturing the flexibility of the protein upon binding to the ligand. In this study, we investigate whether instead a simple rigid docking method can be applied, if combined with multiple target structures to model the backbone flexibility and molecular dynamics simulations to model the sidechain and ligand flexibility. The methods are tested for the binding of 35 ligands to FXR as part of the first stage of the Drug Design Data Resource (D3R) Grand Challenge 2 blind challenge. The results show that the multiple-target docking protocol performs surprisingly well, with correct poses found for 21 of the ligands. MD simulations started on the docked structures are remarkably stable, but show almost no tendency of refining the structure closer to the experimentally found binding pose. Reconnaissance metadynamics enhances the exploration of new binding poses, but additional collective variables involving the protein are needed to exploit the full potential of the method.
Quantitative proteomic analysis reveals a simple strategy of global resource allocation in bacteria
Hui, Sheng; Silverman, Josh M; Chen, Stephen S; Erickson, David W; Basan, Markus; Wang, Jilong; Hwa, Terence; Williamson, James R
2015-01-01
A central aim of cell biology was to understand the strategy of gene expression in response to the environment. Here, we study gene expression response to metabolic challenges in exponentially growing Escherichia coli using mass spectrometry. Despite enormous complexity in the details of the underlying regulatory network, we find that the proteome partitions into several coarse-grained sectors, with each sector's total mass abundance exhibiting positive or negative linear relations with the growth rate. The growth rate-dependent components of the proteome fractions comprise about half of the proteome by mass, and their mutual dependencies can be characterized by a simple flux model involving only two effective parameters. The success and apparent generality of this model arises from tight coordination between proteome partition and metabolism, suggesting a principle for resource allocation in proteome economy of the cell. This strategy of global gene regulation should serve as a basis for future studies on gene expression and constructing synthetic biological circuits. Coarse graining may be an effective approach to derive predictive phenomenological models for other ‘omics’ studies. PMID:25678603
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mahan, G. D.
We calculate the binding energy of an electron bound to a donor in a semiconductor inverse opal. Inverse opals have two kinds of cavities, which we call octahedral and tetrahedral, according to their group symmetry. We put the donor in the center of each of these two cavities and obtain the binding energy. The binding energies become very large when the inverse opal is made from templates with small spheres. For spheres less than 50 nm in diameter, the donor binding can increase to several times its unconfined value. Then electrons become tightly bound to the donor and are unlikelymore » to be thermally activated to the semiconductor conduction band. This conclusion suggests that inverse opals will be poor conductors.« less
Affinity modulation of small-molecule ligands by borrowing endogenous protein surfaces
Briesewitz, Roger; Ray, Gregory T.; Wandless, Thomas J.; Crabtree, Gerald R.
1999-01-01
A general strategy is described for improving the binding properties of small-molecule ligands to protein targets. A bifunctional molecule is created by chemically linking a ligand of interest to another small molecule that binds tightly to a second protein. When the ligand of interest is presented to the target protein by the second protein, additional protein–protein interactions outside of the ligand-binding sites serve either to increase or decrease the affinity of the binding event. We have applied this approach to an intractable target, the SH2 domain, and demonstrate a 3-fold enhancement over the natural peptide. This approach provides a way to modulate the potency and specificity of biologically active compounds. PMID:10051576
Competitive folding of RNA structures at a termination–antitermination site
Ait-Bara, Soraya; Clerté, Caroline; Declerck, Nathalie; Margeat, Emmanuel
2017-01-01
Antitermination is a regulatory process based on the competitive folding of terminator–antiterminator structures that can form in the leader region of nascent transcripts. In the case of the Bacillus subtilis licS gene involved in β-glucosides utilization, the binding of the antitermination protein LicT to a short RNA hairpin (RAT) prevents the formation of an overlapping terminator and thereby allows transcription to proceed. Here, we monitored in vitro the competition between termination and antitermination by combining bulk and single-molecule fluorescence-based assays using labeled RNA oligonucleotide constructs of increasing length that mimic the progressive transcription of the terminator invading the antiterminator hairpin. Although high affinity binding is abolished as soon as the antiterminator basal stem is disrupted by the invading terminator, LicT can still bind and promote closing of the partially unfolded RAT hairpin. However, binding no longer occurs once the antiterminator structure has been disrupted by the full-length terminator. Based on these findings, we propose a kinetic competition model for the sequential events taking place at the termination–antitermination site, where LicT needs to capture its RAT target before completion of the terminator to remain tightly bound during RNAP pausing, before finally dissociating irreversibly from the elongated licS transcript. PMID:28235843
Soluble Aβ aggregates can inhibit prion propagation.
Sarell, Claire J; Quarterman, Emma; Yip, Daniel C-M; Terry, Cassandra; Nicoll, Andrew J; Wadsworth, Jonathan D F; Farrow, Mark A; Walsh, Dominic M; Collinge, John
2017-11-01
Mammalian prions cause lethal neurodegenerative diseases such as Creutzfeldt-Jakob disease (CJD) and consist of multi-chain assemblies of misfolded cellular prion protein (PrP C ). Ligands that bind to PrP C can inhibit prion propagation and neurotoxicity. Extensive prior work established that certain soluble assemblies of the Alzheimer's disease (AD)-associated amyloid β-protein (Aβ) can tightly bind to PrP C , and that this interaction may be relevant to their toxicity in AD. Here, we investigated whether such soluble Aβ assemblies might, conversely, have an inhibitory effect on prion propagation. Using cellular models of prion infection and propagation and distinct Aβ preparations, we found that the form of Aβ assemblies which most avidly bound to PrP in vitro also inhibited prion infection and propagation. By contrast, forms of Aβ which exhibit little or no binding to PrP were unable to attenuate prion propagation. These data suggest that soluble aggregates of Aβ can compete with prions for binding to PrP C and emphasize the bidirectional nature of the interplay between Aβ and PrP C in Alzheimer's and prion diseases. Such inhibitory effects of Aβ on prion propagation may contribute to the apparent fall-off in the incidence of sporadic CJD at advanced age where cerebral Aβ deposition is common. © 2017 The Authors.
A phosphoinositide-binding cluster in cavin1 acts as a molecular sensor for cavin1 degradation
Tillu, Vikas A.; Kovtun, Oleksiy; McMahon, Kerrie-Ann; Collins, Brett M.; Parton, Robert G.
2015-01-01
Caveolae are abundant surface organelles implicated in a range of cellular processes. Two classes of proteins work together to generate caveolae: integral membrane proteins termed caveolins and cytoplasmic coat proteins called cavins. Caveolae respond to membrane stress by releasing cavins into the cytosol. A crucial aspect of this model is tight regulation of cytosolic pools of cavin under resting conditions. We now show that a recently identified region of cavin1 that can bind phosphoinositide (PI) lipids is also a major site of ubiquitylation. Ubiquitylation of lysines within this site leads to rapid proteasomal degradation. In cells that lack caveolins and caveolae, cavin1 is cytosolic and rapidly degraded as compared with cells in which cavin1 is associated with caveolae. Membrane stretching causes caveolar disassembly, release of cavin complexes into the cytosol, and increased proteasomal degradation of wild-type cavin1 but not mutant cavin1 lacking the major ubiquitylation site. Release of cavin1 from caveolae thus leads to exposure of key lysine residues in the PI-binding region, acting as a trigger for cavin1 ubiquitylation and down-regulation. This mutually exclusive PI-binding/ubiquitylation mechanism may help maintain low levels of cytosolic cavin1 in resting cells, a prerequisite for cavins acting as signaling modules following release from caveolae. PMID:26269585
Takahama, Sachiko; Saiki, Jun
2014-01-01
Information on an object's features bound to its location is very important for maintaining object representations in visual working memory. Interactions with dynamic multi-dimensional objects in an external environment require complex cognitive control, including the selective maintenance of feature-location binding. Here, we used event-related functional magnetic resonance imaging to investigate brain activity and functional connectivity related to the maintenance of complex feature-location binding. Participants were required to detect task-relevant changes in feature-location binding between objects defined by color, orientation, and location. We compared a complex binding task requiring complex feature-location binding (color-orientation-location) with a simple binding task in which simple feature-location binding, such as color-location, was task-relevant and the other feature was task-irrelevant. Univariate analyses showed that the dorsolateral prefrontal cortex (DLPFC), hippocampus, and frontoparietal network were activated during the maintenance of complex feature-location binding. Functional connectivity analyses indicated cooperation between the inferior precentral sulcus (infPreCS), DLPFC, and hippocampus during the maintenance of complex feature-location binding. In contrast, the connectivity for the spatial updating of simple feature-location binding determined by reanalyzing the data from Takahama et al. (2010) demonstrated that the superior parietal lobule (SPL) cooperated with the DLPFC and hippocampus. These results suggest that the connectivity for complex feature-location binding does not simply reflect general memory load and that the DLPFC and hippocampus flexibly modulate the dorsal frontoparietal network, depending on the task requirements, with the infPreCS involved in the maintenance of complex feature-location binding and the SPL involved in the spatial updating of simple feature-location binding. PMID:24917833
Takahama, Sachiko; Saiki, Jun
2014-01-01
Information on an object's features bound to its location is very important for maintaining object representations in visual working memory. Interactions with dynamic multi-dimensional objects in an external environment require complex cognitive control, including the selective maintenance of feature-location binding. Here, we used event-related functional magnetic resonance imaging to investigate brain activity and functional connectivity related to the maintenance of complex feature-location binding. Participants were required to detect task-relevant changes in feature-location binding between objects defined by color, orientation, and location. We compared a complex binding task requiring complex feature-location binding (color-orientation-location) with a simple binding task in which simple feature-location binding, such as color-location, was task-relevant and the other feature was task-irrelevant. Univariate analyses showed that the dorsolateral prefrontal cortex (DLPFC), hippocampus, and frontoparietal network were activated during the maintenance of complex feature-location binding. Functional connectivity analyses indicated cooperation between the inferior precentral sulcus (infPreCS), DLPFC, and hippocampus during the maintenance of complex feature-location binding. In contrast, the connectivity for the spatial updating of simple feature-location binding determined by reanalyzing the data from Takahama et al. (2010) demonstrated that the superior parietal lobule (SPL) cooperated with the DLPFC and hippocampus. These results suggest that the connectivity for complex feature-location binding does not simply reflect general memory load and that the DLPFC and hippocampus flexibly modulate the dorsal frontoparietal network, depending on the task requirements, with the infPreCS involved in the maintenance of complex feature-location binding and the SPL involved in the spatial updating of simple feature-location binding.
[Effect of self-microemulsifying system on cell tight junctions].
Sha, Xian-Yi; Fang, Xiao-Ling
2006-01-01
To study the effect of negatively charged and positively charged self-microemulsifying systems (SMES) on the cellular tight junction complex was to be investigated at molecular cell level. Human intestinal epithelial Caco-2 cell model was established. Effect of formulations on the transepithelial electrical resistance (TEER) and permeability of the paracellular transport marker mannitol were measured to evaluate the cell integrity. Changes in subcellular localization of the tight junction protein zona occludens 1 (ZO-1) and cytoskeleton protein actin by immunofluorescence were also assessed after treatment of two SMESs in different dilutions. The TEER of cell monolayers was not markedly affected by negatively charged SMES in different dilutions. The positively charged SMES could significantly decrease the TEER (P < 0.05) in three dilutions. The full recovery of TEER was found after the treatment of lower dilution for 2 h, then cultured for 48 h, while the recovery of TEER was 81.3% of control in 1 : 50 dilution. Two SMESs could enhance the apparent permeability coefficient of mannitol (2.9 - 64.6 folds), which depended on the dilution times. The immunofluorescent results indicated that the distribution of ZO-1 and actin were discrete in cell membrane after the treatment of formulation. Since the positively charged microemulsion could bind to the epithelial cell membrane by electrostatic interaction, the actin of the cells undergone some kind of stress stimulated by the higher concentration of microemulsion was more markedly affected than the negatively charged SMES. Effect of formulations on ZO-1 and actin relied on the dilution. SMES is able to enhance the paracellular transport marker mannitol. The mechanism of opening of tight junctions by SMES might be the change of distribution of ZO-1 and actin.
Valley density-wave (VDW) and Superconductivity in Iron-Pnictides
NASA Astrophysics Data System (ADS)
Cvetkovic, Vladimir; Tesanovic, Zlatko
2009-03-01
One of the experimentally observed features of iron-pnictide superconductors is the structural transition and SDW ordering occurring at almost the same temperature. Starting from a tight-binding model [1], we construct an effective theory for iron-pnictides with the distinctive two hole and two electron Fermi surfaces. This theory is then mapped onto a negative-U Hubbard model with additional orbital and spin flavors [2]. We demonstrate that the superconducting instability of the attractive Hubbard model --- valley density-wave (VDW) --- corresponds to the observed structural and SDW orders. The deviations from perfect nesting between the hole and electron Fermi surfaces are mapped onto the Zeeman field which causes portions of Fermi surface to remain ungapped. The origin of pnictide superconductivity in this model, and its ties to the VDW are discussed. [1] V. Cvetkovic and Z. Tesanovic, http://arxiv.org/abs/0804.4678. [2] V. Cvetkovic and Z. Tesanovic, http://arxiv.org/abs/0808.3742.
Identification of a ZP3-binding protein on acrosome-intact mouse sperm by photoaffinity crosslinking
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bleil, J.D.; Wassarman, P.M.
1990-07-01
During the process of fertilization in mammals, sperm bind in a relatively species-specific manner to the zona pellucida (ZP) of ovulated eggs. ZP3, a glycoprotein found in the mouse egg zona pellucida, serves as receptor for sperm during gamete adhesion. We report here that a Mr 56,000 protein found on mouse sperm has properties expected for a sperm component that recognizes and binds to ZP3. This sperm protein is radiolabeled preferentially by a photoactivatable heterobifunctional crosslinker (Denny-Jaffee reagent) covalently linked to purified ZP3, binds very tightly to ZP3-affinity columns, and is localized to heads of acrosome-intact but not acrosome-reacted sperm.more » These and other findings suggest that this protein may be a ZP3-binding protein that, together with the sperm receptor, supports species-specific binding of mouse sperm to unfertilized eggs.« less
Rock deformation models and fluid leak-off in hydraulic fracturing
NASA Astrophysics Data System (ADS)
Yarushina, Viktoriya M.; Bercovici, David; Oristaglio, Michael L.
2013-09-01
Fluid loss into reservoir rocks during hydraulic fracturing is modelled via a poro-elastoplastic pressure diffusion equation in which the total compressibility is a sum of fluid, rock and pore space compressibilities. Inclusion of pore compressibility and porosity-dependent permeability in the model leads to a strong pressure dependence of leak-off (i.e. drainage rate). Dilation of the matrix due to fluid invasion causes higher rates of fluid leak-off. The present model is appropriate for naturally fractured and tight gas reservoirs as well as for soft and poorly consolidated formations whose mechanical behaviour departs from simple elastic laws. Enhancement of the leak-off coefficient by dilation, predicted by the new model, may help explain the low percentage recovery of fracturing fluid (usually between 5 and 50 per cent) in shale gas stimulation by hydraulic fracturing.
Gilad, Yoav; Pritchard, Jonathan K.; Stephens, Matthew
2015-01-01
Understanding global gene regulation depends critically on accurate annotation of regulatory elements that are functional in a given cell type. CENTIPEDE, a powerful, probabilistic framework for identifying transcription factor binding sites from tissue-specific DNase I cleavage patterns and genomic sequence content, leverages the hypersensitivity of factor-bound chromatin and the information in the DNase I spatial cleavage profile characteristic of each DNA binding protein to accurately infer functional factor binding sites. However, the model for the spatial profile in this framework fails to account for the substantial variation in the DNase I cleavage profiles across different binding sites. Neither does it account for variation in the profiles at the same binding site across multiple replicate DNase I experiments, which are increasingly available. In this work, we introduce new methods, based on multi-scale models for inhomogeneous Poisson processes, to account for such variation in DNase I cleavage patterns both within and across binding sites. These models account for the spatial structure in the heterogeneity in DNase I cleavage patterns for each factor. Using DNase-seq measurements assayed in a lymphoblastoid cell line, we demonstrate the improved performance of this model for several transcription factors by comparing against the Chip-seq peaks for those factors. Finally, we explore the effects of DNase I sequence bias on inference of factor binding using a simple extension to our framework that allows for a more flexible background model. The proposed model can also be easily applied to paired-end ATAC-seq and DNase-seq data. msCentipede, a Python implementation of our algorithm, is available at http://rajanil.github.io/msCentipede. PMID:26406244
Raj, Anil; Shim, Heejung; Gilad, Yoav; Pritchard, Jonathan K; Stephens, Matthew
2015-01-01
Understanding global gene regulation depends critically on accurate annotation of regulatory elements that are functional in a given cell type. CENTIPEDE, a powerful, probabilistic framework for identifying transcription factor binding sites from tissue-specific DNase I cleavage patterns and genomic sequence content, leverages the hypersensitivity of factor-bound chromatin and the information in the DNase I spatial cleavage profile characteristic of each DNA binding protein to accurately infer functional factor binding sites. However, the model for the spatial profile in this framework fails to account for the substantial variation in the DNase I cleavage profiles across different binding sites. Neither does it account for variation in the profiles at the same binding site across multiple replicate DNase I experiments, which are increasingly available. In this work, we introduce new methods, based on multi-scale models for inhomogeneous Poisson processes, to account for such variation in DNase I cleavage patterns both within and across binding sites. These models account for the spatial structure in the heterogeneity in DNase I cleavage patterns for each factor. Using DNase-seq measurements assayed in a lymphoblastoid cell line, we demonstrate the improved performance of this model for several transcription factors by comparing against the Chip-seq peaks for those factors. Finally, we explore the effects of DNase I sequence bias on inference of factor binding using a simple extension to our framework that allows for a more flexible background model. The proposed model can also be easily applied to paired-end ATAC-seq and DNase-seq data. msCentipede, a Python implementation of our algorithm, is available at http://rajanil.github.io/msCentipede.
The ZO-1–associated Y-box factor ZONAB regulates epithelial cell proliferation and cell density
Balda, Maria S.; Garrett, Michelle D.; Matter, Karl
2003-01-01
Epithelial tight junctions regulate paracellular permeability, restrict apical/basolateral intramembrane diffusion of lipids, and have been proposed to participate in the control of epithelial cell proliferation and differentiation. Previously, we have identified ZO-1–associated nucleic acid binding proteins (ZONAB), a Y-box transcription factor whose nuclear localization and transcriptional activity is regulated by the tight junction–associated candidate tumor suppressor ZO-1. Now, we found that reduction of ZONAB expression using an antisense approach or by RNA interference strongly reduced proliferation of MDCK cells. Transfection of wild-type or ZONAB-binding fragments of ZO-1 reduced proliferation as well as nuclear ZONAB pools, indicating that promotion of proliferation by ZONAB requires its nuclear accumulation. Overexpression of ZONAB resulted in increased cell density in mature monolayers, and depletion of ZONAB or overexpression of ZO-1 reduced cell density. ZONAB was found to associate with cell division kinase (CDK) 4, and reduction of nuclear ZONAB levels resulted in reduced nuclear CDK4. Thus, our data indicate that tight junctions can regulate epithelial cell proliferation and cell density via a ZONAB/ZO-1–based pathway. Although this regulatory process may also involve regulation of transcription by ZONAB, our data suggest that one mechanism by which ZONAB and ZO-1 influence proliferation is by regulating the nuclear accumulation of CDK4. PMID:12566432
Receptor binding kinetics equations: Derivation using the Laplace transform method.
Hoare, Sam R J
Measuring unlabeled ligand receptor binding kinetics is valuable in optimizing and understanding drug action. Unfortunately, deriving equations for estimating kinetic parameters is challenging because it involves calculus; integration can be a frustrating barrier to the pharmacologist seeking to measure simple rate parameters. Here, a well-known tool for simplifying the derivation, the Laplace transform, is applied to models of receptor-ligand interaction. The method transforms differential equations to a form in which simple algebra can be applied to solve for the variable of interest, for example the concentration of ligand-bound receptor. The goal is to provide instruction using familiar examples, to enable investigators familiar with handling equilibrium binding equations to derive kinetic equations for receptor-ligand interaction. First, the Laplace transform is used to derive the equations for association and dissociation of labeled ligand binding. Next, its use for unlabeled ligand kinetic equations is exemplified by a full derivation of the kinetics of competitive binding equation. Finally, new unlabeled ligand equations are derived using the Laplace transform. These equations incorporate a pre-incubation step with unlabeled or labeled ligand. Four equations for measuring unlabeled ligand kinetics were compared and the two new equations verified by comparison with numerical solution. Importantly, the equations have not been verified with experimental data because no such experiments are evident in the literature. Equations were formatted for use in the curve-fitting program GraphPad Prism 6.0 and fitted to simulated data. This description of the Laplace transform method will enable pharmacologists to derive kinetic equations for their model or experimental paradigm under study. Application of the transform will expand the set of equations available for the pharmacologist to measure unlabeled ligand binding kinetics, and for other time-dependent pharmacological activities. Copyright © 2017 Elsevier Inc. All rights reserved.
Binding of an adatom to a simple metal surface
NASA Technical Reports Server (NTRS)
Huntington, H. B.; Turk, L. A.; White, W. W., III
1975-01-01
The density functional formalism of Hohenberg and Kohn is used to investigate the energies, charge densities and forces which hold an adatom on the surface of a simple metal. The valence wavefunction of the adatom is fitted to the Herman-Skillman solutions at large distance and is simplified somewhat in the core region. The field of the ion is represented by the Ashcroft pseudopotential. For the metal the jellium model is used. Detailed calculations are carried out for a sodium adatom on a sodium surface. Simply juxtaposing adatom and surface gives a binding energy of about 1/3 eV. This value is approximately twice the surface energy per atom in the close-packed plane. Charge redistributions as determined variationally increase the binding energy by about 10%. The equilibrium distance for the adatom turns out to be 1.66 A from the surface, as compared with 1.52 A, the observed value for one-half the distance between the close-packed planes.
Analytical solutions of the two-dimensional Dirac equation for a topological channel intersection
NASA Astrophysics Data System (ADS)
Anglin, J. R.; Schulz, A.
2017-01-01
Numerical simulations in a tight-binding model have shown that an intersection of topologically protected one-dimensional chiral channels can function as a beam splitter for noninteracting fermions on a two-dimensional lattice [Qiao, Jung, and MacDonald, Nano Lett. 11, 3453 (2011), 10.1021/nl201941f; Qiao et al., Phys. Rev. Lett. 112, 206601 (2014), 10.1103/PhysRevLett.112.206601]. Here we confirm this result analytically in the corresponding continuum k .p model, by solving the associated two-dimensional Dirac equation, in the presence of a "checkerboard" potential that provides a right-angled intersection between two zero-line modes. The method by which we obtain our analytical solutions is systematic and potentially generalizable to similar problems involving intersections of one-dimensional systems.
Descriptions of carbon isotopes within the energy density functional theory
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ismail, Atef; Cheong, Lee Yen; Yahya, Noorhana
2014-10-24
Within the energy density functional (EDF) theory, the structure properties of Carbon isotopes are systematically studied. The shell model calculations are done for both even-A and odd-A nuclei, to study the structure of rich-neutron Carbon isotopes. The EDF theory indicates the single-neutron halo structures in {sup 15}C, {sup 17}C and {sup 19}C, and the two-neutron halo structures in {sup 16}C and {sup 22}C nuclei. It is also found that close to the neutron drip-line, there exist amazing increase in the neutron radii and decrease on the binding energies BE, which are tightly related with the blocking effect and correspondingly themore » blocking effect plays a significant role in the shell model configurations.« less
Howell, Bonnie; Larsson, Niklas; Gullberg, Martin; Cassimeris, Lynne
1999-01-01
Oncoprotein 18/stathmin (Op18) has been identified recently as a protein that destabilizes microtubules, but the mechanism of destabilization is currently controversial. Based on in vitro microtubule assembly assays, evidence has been presented supporting conflicting destabilization models of either tubulin sequestration or promotion of microtubule catastrophes. We found that Op18 can destabilize microtubules by both of these mechanisms and that these activities can be dissociated by changing pH. At pH 6.8, Op18 slowed microtubule elongation and increased catastrophes at both plus and minus ends, consistent with a tubulin-sequestering activity. In contrast, at pH 7.5, Op18 promoted microtubule catastrophes, particularly at plus ends, with little effect on elongation rates at either microtubule end. Dissociation of tubulin-sequestering and catastrophe-promoting activities of Op18 was further demonstrated by analysis of truncated Op18 derivatives. Lack of a C-terminal region of Op18 (aa 100–147) resulted in a truncated protein that lost sequestering activity at pH 6.8 but retained catastrophe-promoting activity. In contrast, lack of an N-terminal region of Op18 (aa 5–25) resulted in a truncated protein that still sequestered tubulin at pH 6.8 but was unable to promote catastrophes at pH 7.5. At pH 6.8, both the full length and the N-terminal–truncated Op18 bound tubulin, whereas truncation at the C-terminus resulted in a pronounced decrease in tubulin binding. Based on these results, and a previous study documenting a pH-dependent change in binding affinity between Op18 and tubulin, it is likely that tubulin sequestering observed at lower pH resulted from the relatively tight interaction between Op18 and tubulin and that this tight binding requires the C-terminus of Op18; however, under conditions in which Op18 binds weakly to tubulin (pH 7.5), Op18 stimulated catastrophes without altering tubulin subunit association or dissociation rates, and Op18 did not depolymerize microtubules capped with guanylyl (α, β)-methylene diphosphonate–tubulin subunits. We hypothesize that weak binding between Op18 and tubulin results in free Op18, which is available to interact with microtubule ends and thereby promote catastrophes by a mechanism that likely involves GTP hydrolysis. PMID:9880330
Cording, Jimmi; Berg, Johanna; Käding, Nadja; Bellmann, Christian; Tscheik, Christian; Westphal, Julie K; Milatz, Susanne; Günzel, Dorothee; Wolburg, Hartwig; Piontek, Jörg; Huber, Otmar; Blasig, Ingolf Ernst
2013-01-15
Tight junctions seal the paracellular cleft of epithelia and endothelia, form vital barriers between tissue compartments and consist of tight-junction-associated marvel proteins (TAMPs) and claudins. The function of TAMPs and the interaction with claudins are not understood. We therefore investigated the binding between the TAMPs occludin, tricellulin, and marvelD3 and their interaction with claudins in living tight-junction-free human embryonic kidney-293 cells. In contrast to claudins and occludin, tricellulin and marvelD3 showed no enrichment at cell-cell contacts indicating lack of homophilic trans-interaction between two opposing cell membranes. However, occludin, marvelD3 and tricellulin exhibited homophilic cis-interactions, along one plasma membrane, as measured by fluorescence resonance energy transfer. MarvelD3 also cis-interacted with occludin and tricellulin heterophilically. Classic claudins, such as claudin-1 to -5 may show cis-oligomerization with TAMPs, whereas the non-classic claudin-11 did not. Claudin-1 and -5 improved enrichment of occludin and tricellulin at cell-cell contacts. The low mobile claudin-1 reduced the membrane mobility of the highly mobile occludin and tricellulin, as studied by fluorescence recovery after photobleaching. Co-transfection of claudin-1 with TAMPs led to changes of the tight junction strand network of this claudin to a more physiological morphology, depicted by freeze-fracture electron microscopy. The results demonstrate multilateral interactions between the tight junction proteins, in which claudins determine the function of TAMPs and vice versa, and provide deeper insights into the tight junction assembly.
Development of acetophenone ligands as potential neuroimaging agents for cholinesterases.
Jollymore-Hughes, Courtney T; Pottie, Ian R; Martin, Earl; Rosenberry, Terrone L; Darvesh, Sultan
2016-11-01
Association of cholinesterase with β-amyloid plaques and tau neurofibrillary tangles in Alzheimer's disease offers an opportunity to detect disease pathology during life. Achieving this requires development of radiolabelled cholinesterase ligands with high enzyme affinity. Various fluorinated acetophenone derivatives bind to acetylcholinesterase with high affinity, including 2,2,2-trifluoro-1-(3-dimethylaminophenyl)ethanone (1) and 1-(3-tert-butylphenyl)-2,2,2-trifluoroethanone (2). Such compounds also offer potential for incorporation of radioactive fluorine ( 18 F) for Positron Emission Tomography (PET) imaging of cholinesterases in association with Alzheimer's disease pathology in the living brain. Here we describe the synthesis of two meta-substituted chlorodifluoroacetophenones using a Weinreb amide strategy and their rapid conversion to the corresponding trifluoro derivatives through nucleophilic substitution by fluoride ion, in a reaction amenable to incorporating 18 F for PET imaging. In vitro kinetic analysis indicates tight binding of the trifluoro derivatives to cholinesterases. Compound 1 has a K i value of 7nM for acetylcholinesterase and 1300nM for butyrylcholinesterase while for compound 2 these values are 0.4nM and 26nM, respectively. Tight binding of these compounds to cholinesterase encourages their development for PET imaging detection of cholinesterase associated with Alzheimer's disease pathology. Copyright © 2016 Elsevier Ltd. All rights reserved.
Structural basis for the inhibition of bacterial multidrug exporters.
Nakashima, Ryosuke; Sakurai, Keisuke; Yamasaki, Seiji; Hayashi, Katsuhiko; Nagata, Chikahiro; Hoshino, Kazuki; Onodera, Yoshikuni; Nishino, Kunihiko; Yamaguchi, Akihito
2013-08-01
The multidrug efflux transporter AcrB and its homologues are important in the multidrug resistance of Gram-negative pathogens. However, despite efforts to develop efflux inhibitors, clinically useful inhibitors are not available at present. Pyridopyrimidine derivatives are AcrB- and MexB-specific inhibitors that do not inhibit MexY; MexB and MexY are principal multidrug exporters in Pseudomonas aeruginosa. We have previously determined the crystal structure of AcrB in the absence and presence of antibiotics. Drugs were shown to be exported by a functionally rotating mechanism through tandem proximal and distal multisite drug-binding pockets. Here we describe the first inhibitor-bound structures of AcrB and MexB, in which these proteins are bound by a pyridopyrimidine derivative. The pyridopyrimidine derivative binds tightly to a narrow pit composed of a phenylalanine cluster located in the distal pocket and sterically hinders the functional rotation. This pit is a hydrophobic trap that branches off from the substrate-translocation channel. Phe 178 is located at the edge of this trap in AcrB and MexB and contributes to the tight binding of the inhibitor molecule through a π-π interaction with the pyridopyrimidine ring. The voluminous side chain of Trp 177 located at the corresponding position in MexY prevents inhibitor binding. The structure of the hydrophobic trap described in this study will contribute to the development of universal inhibitors of MexB and MexY in P. aeruginosa.
NASA Astrophysics Data System (ADS)
Yang, Zaixing; Wang, Zhigang; Tian, Xingling; Xiu, Peng; Zhou, Ruhong
2012-01-01
Understanding the interaction between carbon nanotubes (CNTs) and biomolecules is essential to the CNT-based nanotechnology and biotechnology. Some recent experiments have suggested that the π-π stacking interactions between protein's aromatic residues and CNTs might play a key role in their binding, which raises interest in large scale modeling of protein-CNT complexes and associated π-π interactions at atomic detail. However, there is concern on the accuracy of classical fixed-charge molecular force fields due to their classical treatments and lack of polarizability. Here, we study the binding of three aromatic residue analogues (mimicking phenylalanine, tyrosine, and tryptophan) and benzene to a single-walled CNT, and compare the molecular mechanical (MM) calculations using three popular fixed-charge force fields (OPLSAA, AMBER, and CHARMM), with quantum mechanical (QM) calculations using the density-functional tight-binding method with the inclusion of dispersion correction (DFTB-D). Two typical configurations commonly found in π-π interactions are used, one with the aromatic rings parallel to the CNT surface (flat), and the other perpendicular (edge). Our calculations reveal that compared to the QM results the MM approaches can appropriately reproduce the strength of π-π interactions for both configurations, and more importantly, the energy difference between them, indicating that the various contributions to π-π interactions have been implicitly included in the van der Waals parameters of the standard MM force fields. Meanwhile, these MM models are less accurate in predicting the exact structural binding patterns (matching surface), meaning there are still rooms to be improved. In addition, we have provided a comprehensive and reliable QM picture for the π-π interactions of aromatic molecules with CNTs in gas phase, which might be used as a benchmark for future force field developments.
Yang, Zaixing; Wang, Zhigang; Tian, Xingling; Xiu, Peng; Zhou, Ruhong
2012-01-14
Understanding the interaction between carbon nanotubes (CNTs) and biomolecules is essential to the CNT-based nanotechnology and biotechnology. Some recent experiments have suggested that the π-π stacking interactions between protein's aromatic residues and CNTs might play a key role in their binding, which raises interest in large scale modeling of protein-CNT complexes and associated π-π interactions at atomic detail. However, there is concern on the accuracy of classical fixed-charge molecular force fields due to their classical treatments and lack of polarizability. Here, we study the binding of three aromatic residue analogues (mimicking phenylalanine, tyrosine, and tryptophan) and benzene to a single-walled CNT, and compare the molecular mechanical (MM) calculations using three popular fixed-charge force fields (OPLSAA, AMBER, and CHARMM), with quantum mechanical (QM) calculations using the density-functional tight-binding method with the inclusion of dispersion correction (DFTB-D). Two typical configurations commonly found in π-π interactions are used, one with the aromatic rings parallel to the CNT surface (flat), and the other perpendicular (edge). Our calculations reveal that compared to the QM results the MM approaches can appropriately reproduce the strength of π-π interactions for both configurations, and more importantly, the energy difference between them, indicating that the various contributions to π-π interactions have been implicitly included in the van der Waals parameters of the standard MM force fields. Meanwhile, these MM models are less accurate in predicting the exact structural binding patterns (matching surface), meaning there are still rooms to be improved. In addition, we have provided a comprehensive and reliable QM picture for the π-π interactions of aromatic molecules with CNTs in gas phase, which might be used as a benchmark for future force field developments.
Airtightness the simple(CS) way
DOE Office of Scientific and Technical Information (OSTI.GOV)
Andrews, S.
Builders who might buck against such time consuming air sealing methods as polyethylene wrap and the airtight drywall approach (ADA) may respond better to current strategies. One such method, called SimpleCS, has proven especially effective. SimpleCS, pronounced simplex, stands for simple caulk and seal. A modification of the ADA, SimpleCS is an air-sealing management tool, a simplified systems approach to building tight homes. The system address the crucial question of when and by whom various air sealing steps should be done. It avoids the problems that often occur when later contractors cut open polyethylene wrap to drill holes in themore » drywall. The author describes how SimpleCS works, and the cost and training involved.« less
Context influences on TALE–DNA binding revealed by quantitative profiling
Rogers, Julia M.; Barrera, Luis A.; Reyon, Deepak; Sander, Jeffry D.; Kellis, Manolis; Joung, J Keith; Bulyk, Martha L.
2015-01-01
Transcription activator-like effector (TALE) proteins recognize DNA using a seemingly simple DNA-binding code, which makes them attractive for use in genome engineering technologies that require precise targeting. Although this code is used successfully to design TALEs to target specific sequences, off-target binding has been observed and is difficult to predict. Here we explore TALE–DNA interactions comprehensively by quantitatively assaying the DNA-binding specificities of 21 representative TALEs to ∼5,000–20,000 unique DNA sequences per protein using custom-designed protein-binding microarrays (PBMs). We find that protein context features exert significant influences on binding. Thus, the canonical recognition code does not fully capture the complexity of TALE–DNA binding. We used the PBM data to develop a computational model, Specificity Inference For TAL-Effector Design (SIFTED), to predict the DNA-binding specificity of any TALE. We provide SIFTED as a publicly available web tool that predicts potential genomic off-target sites for improved TALE design. PMID:26067805
Context influences on TALE-DNA binding revealed by quantitative profiling.
Rogers, Julia M; Barrera, Luis A; Reyon, Deepak; Sander, Jeffry D; Kellis, Manolis; Joung, J Keith; Bulyk, Martha L
2015-06-11
Transcription activator-like effector (TALE) proteins recognize DNA using a seemingly simple DNA-binding code, which makes them attractive for use in genome engineering technologies that require precise targeting. Although this code is used successfully to design TALEs to target specific sequences, off-target binding has been observed and is difficult to predict. Here we explore TALE-DNA interactions comprehensively by quantitatively assaying the DNA-binding specificities of 21 representative TALEs to ∼5,000-20,000 unique DNA sequences per protein using custom-designed protein-binding microarrays (PBMs). We find that protein context features exert significant influences on binding. Thus, the canonical recognition code does not fully capture the complexity of TALE-DNA binding. We used the PBM data to develop a computational model, Specificity Inference For TAL-Effector Design (SIFTED), to predict the DNA-binding specificity of any TALE. We provide SIFTED as a publicly available web tool that predicts potential genomic off-target sites for improved TALE design.
Atomistic simulations of the optical absorption of type-II CdSe/ZnTe superlattices
2012-01-01
We perform accurate tight binding simulations to design type-II short-period CdSe/ZnTe superlattices suited for photovoltaic applications. Absorption calculations demonstrate a very good agreement with optical results with threshold strongly depending on the chemical species near interfaces. PMID:23031315
The Receptor Binding Domain of Botulinum Neurotoxin Stereotype C Binds Phosphoinositides
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Yanfeng; Varnum, Susan M.
2012-03-01
Botulinum neurotoxins (BoNTs) are the most toxic proteins known for humans and animals with an extremely low LD50 of {approx} 1 ng/kg. BoNTs generally require a protein and a ganglioside on the cell membrane surface for binding, which is known as a 'dual receptor' mechanism for host intoxication. Recent studies have suggested that in addition to gangliosides, other membrane lipids such as phosphoinositides may be involved in the interactions with the receptor binding domain (HCR) of BoNTs for better membrane penetration. Here, using two independent lipid-binding assays, we tested the interactions of BoNT/C-HCR with lipids in vitro. BoNT/C-HCR was foundmore » to bind negatively charged phospholipids, preferentially phosphoinositides. Additional interactions to phosphoinositides may help BoNT/C bind membrane more tightly and transduct signals for subsequent steps of intoxication. Our results provide new insights into the mechanisms of host cell membrane recognition by BoNTs.« less
Surface-Bound Casein Modulates the Adsorption and Activity of Kinesin on SiO2 Surfaces
Ozeki, Tomomitsu; Verma, Vivek; Uppalapati, Maruti; Suzuki, Yukiko; Nakamura, Mikihiko; Catchmark, Jeffrey M.; Hancock, William O.
2009-01-01
Abstract Conventional kinesin is routinely adsorbed to hydrophilic surfaces such as SiO2. Pretreatment of surfaces with casein has become the standard protocol for achieving optimal kinesin activity, but the mechanism by which casein enhances kinesin surface adsorption and function is poorly understood. We used quartz crystal microbalance measurements and microtubule gliding assays to uncover the role that casein plays in enhancing the activity of surface-adsorbed kinesin. On SiO2 surfaces, casein adsorbs as both a tightly bound monolayer and a reversibly bound second layer that has a dissociation constant of 500 nM and can be desorbed by washing with casein-free buffer. Experiments using truncated kinesins demonstrate that in the presence of soluble casein, kinesin tails bind well to the surface, whereas kinesin head binding is blocked. Removing soluble casein reverses these binding profiles. Surprisingly, reversibly bound casein plays only a moderate role during kinesin adsorption, but it significantly enhances kinesin activity when surface-adsorbed motors are interacting with microtubules. These results point to a model in which a dynamic casein bilayer prevents reversible association of the heads with the surface and enhances association of the kinesin tail with the surface. Understanding protein-surface interactions in this model system should provide a framework for engineering surfaces for functional adsorption of other motor proteins and surface-active enzymes. PMID:19383474
Determination of binding-dioxygen in dioxygen complexes by headspace gas chromatography.
Wang, Wei; Feng, Shun; Li, Ya-ni; Wu, Meiying; Wang, Jide
2008-06-06
Dioxygen complexes play important roles in organisms' bodies, so the determination of binding-dioxygen has practical significance. A simple and robust method based on headspace gas chromatography was proposed to determine the binding-dioxygen in dioxygen complexes. By measuring the content change of nitrogen gas in a vial, the amount of oxygen released from dixoygen complexes can be determined. The method was validated using potassium chlorate as model sample, and the results exhibited good recoveries (90-99%) with the relative standard deviation less than 8%. It was also used to analyze dioxygen complex of cobalt bis(salicylaldehyde) ethylenediimine and polyamine cobalt complexes prepared by solid-phase reaction.
Multifunctional semiconductor micro-Hall devices for magnetic, electric, and photo-detection
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gilbertson, A. M.; Cohen, L. F.; Sadeghi, Hatef
2015-12-07
We report the real-space voltage response of InSb/AlInSb micro-Hall devices to local photo-excitation, electric, and magnetic fields at room temperature using scanning probe microscopy. We show that the ultrafast generation of localised photocarriers results in conductance perturbations analogous to those produced by local electric fields. Experimental results are in good agreement with tight-binding transport calculations in the diffusive regime. The magnetic, photo, and charge sensitivity of a 2 μm wide probe are evaluated at a 10 μA bias current in the Johnson noise limit (valid at measurement frequencies > 10 kHz) to be, respectively, 500 nT/√Hz; 20 pW/√Hz (λ = 635 nm) comparable to commercial photoconductive detectors;more » and 0.05 e/√Hz comparable to that of single electron transistors. These results demonstrate the remarkably versatile sensing attributes of simple semiconductor micro-Hall devices that can be applied to a host of imaging and sensing applications.« less
First Detected Arrival of a Quantum Walker on an Infinite Line
NASA Astrophysics Data System (ADS)
Thiel, Felix; Barkai, Eli; Kessler, David A.
2018-01-01
The first detection of a quantum particle on a graph is shown to depend sensitively on the distance ξ between the detector and initial location of the particle, and on the sampling time τ . Here, we use the recently introduced quantum renewal equation to investigate the statistics of first detection on an infinite line, using a tight-binding lattice Hamiltonian with nearest-neighbor hops. Universal features of the first detection probability are uncovered and simple limiting cases are analyzed. These include the large ξ limit, the small τ limit, and the power law decay with the attempt number of the detection probability over which quantum oscillations are superimposed. For large ξ the first detection probability assumes a scaling form and when the sampling time is equal to the inverse of the energy band width nonanalytical behaviors arise, accompanied by a transition in the statistics. The maximum total detection probability is found to occur for τ close to this transition point. When the initial location of the particle is far from the detection node we find that the total detection probability attains a finite value that is distance independent.
Predicted trends of core-shell preferences for 132 late transition-metal binary-alloy nanoparticles.
Wang, Lin-Lin; Johnson, Duane D
2009-10-07
Transition-metal alloyed nanoparticles with core-shell features (shell enrichment by one of the metals) are becoming ubiquitous, from (electro-)catalysis to biomedical applications, due to their size control, performance, biocompatibility, and cost. We investigate 132 binary-alloyed nanoparticle systems (groups 8 to 11 in the Periodic Table) using density functional theory (DFT) and systematically explore their segregation energies to determine core-shell preferences. We find that core-shell preferences are generally described by two independent factors: (1) cohesive energy (related to vapor pressure) and (2) atomic size (quantified by the Wigner-Seitz radius), and the interplay between them. These independent factors are shown to provide general trends for the surface segregation preference for atoms in nanoparticles, as well as semi-infinite surfaces, and give a simple correlation (a "design map") for the alloying and catalytic behavior. Finally, we provide a universal description of core-shell preference via tight-binding theory (band-energy differences) that (i) quantitatively reproduces the DFT segregation energies and (ii) confirms the electronic origins and correlations for core-shell behavior.
NASA Astrophysics Data System (ADS)
Wang, Ya-Ting; Zhao, Yu-Jun; Liao, Ji-Hai; Yang, Xiao-Bao
2018-01-01
Combining the congruence check and the first-principles calculations, we have systematically investigated the structural stabilities and gap distributions of possible diamondoids (CnHm) with the carbon numbers (n) from 10 to 41. A simple method for the nomenclature is proposed, which can be used to distinguish and screen the candidates with high efficiency. Different from previous theoretical studies, the possible diamondoids can be enumerated according to our nomenclature, without any pre-determination from experiments. The structural stabilities and electronic properties have been studied by density functional based tight binding and first-principles methods, where a nearly linear correlation is found between the energy gaps obtained by these two methods. According to the formation energy of structures, we have determined the stable configurations as a function of chemical potential. The maximum and minimum energy gaps are found to be dominated by the shape of diamondoids for clusters with a given number of carbon atoms, while the gap decreases in general as the size increases due to the quantum confinement.
Multiply Reduced Oligofluorenes: Their Nature and Pairing with THF-Solvated Sodium Ions
Wu, Qin; Zaikowski, Lori; Kaur, Parmeet; ...
2016-07-01
Conjugated oligofluorenes are chemically reduced up to five charges in tetrahydrofuran solvent and confirmed with clear spectroscopic evidence. Stimulated by these experimental results, we have conducted a comprehensive computational study of the electronic structure and the solvation structure of representative oligofluorene anions with a focus on the pairing between sodium ions and these multianions. In addition, using density functional theory (DFT) methods and a solvation model of both explicit solvent molecules and implicit polarizable continuum, we first elucidate the structure of tightly solvated free sodium ions, and then explore the pairing of sodium ions either in contact with reduced oligofluorenesmore » or as solvent-separated ion pairs. Computed time-dependent-DFT absorption spectra are compared with experiments to assign the dominant ion pairing structure for each multianion. Computed ion pair binding energies further support our assignment. Lastly, the availability of different length and reducing level of oligofluorenes enables us to investigate the effects of total charge and charge density on the binding with sodium ions, and our results suggest both factors play important roles in ion pairing for small molecules. However, as the oligofluorene size grows, its charge density determines the binding strength with the sodium ion.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Qin; Zaikowski, Lori; Kaur, Parmeet
Conjugated oligofluorenes are chemically reduced up to five charges in tetrahydrofuran solvent and confirmed with clear spectroscopic evidence. Stimulated by these experimental results, we have conducted a comprehensive computational study of the electronic structure and the solvation structure of representative oligofluorene anions with a focus on the pairing between sodium ions and these multianions. In addition, using density functional theory (DFT) methods and a solvation model of both explicit solvent molecules and implicit polarizable continuum, we first elucidate the structure of tightly solvated free sodium ions, and then explore the pairing of sodium ions either in contact with reduced oligofluorenesmore » or as solvent-separated ion pairs. Computed time-dependent-DFT absorption spectra are compared with experiments to assign the dominant ion pairing structure for each multianion. Computed ion pair binding energies further support our assignment. Lastly, the availability of different length and reducing level of oligofluorenes enables us to investigate the effects of total charge and charge density on the binding with sodium ions, and our results suggest both factors play important roles in ion pairing for small molecules. However, as the oligofluorene size grows, its charge density determines the binding strength with the sodium ion.« less
Schellman, J A
1990-08-31
The properties of a simple model for solvation in mixed solvents are explored in this paper. The model is based on the supposition that solvent replacement is a simple one-for-one substitution reaction at macromolecular sites which are independent of one another. This leads to a new form for the binding polynomial in which all terms are associated with ligand interchange rather than ligand addition. The principal solvent acts as one of the ligands. Thermodynamic analysis then shows that thermodynamic binding (i.e., selective interaction) depends on the properties of K'-1, whereas stoichiometric binding (site occupation) depends on K'. K' is a 'practical' interchange equilibrium constant given by (f3/f1)K, where K is the true equilibrium constant for the interchange of components 3 and 1 on the site and f3 and f4 denote their respective activity coefficients on the mole fraction scale. Values of K' less than unity lead to negative selective interaction. It is selective interaction and not occupation number which determines the thermodynamic effects of solvation. When K' greater than 100 on the mole fraction scale or K' greater than 2 on the molality scale (in water), the differences between stoichiometric binding and selective interaction become less than 1%. The theory of this paper is therefore necessary only for very weak binding constants. When K'-1 is small, large concentrations of the added solvent component are required to produce a thermodynamic effect. Under these circumstances the isotherms for the selective interaction and for the excess (or transfer) free energy are strongly dependent on the behavior of the activity coefficients of both solvent components. Two classes of behavior are described depending on whether the components display positive or negative deviations from Raoult's law. Examples which are discussed are aqueous solutions of urea and guanidinium chloride for positive deviations and of sucrose and glucose for negative deviations. Examination of the few studies which have been reported in the literature shows that most of the qualitative features of the stabilization of proteins by sugars and their destabilization by urea and guanidinium chloride are faithfully represented with the model. This includes maxima in the free energy of stabilization and destabilization, decreased and zero selective interaction at high concentrations, etc. These phenomena had no prior explanation. Deficiencies in the model as a representation of solvation in aqueous solution are discussed in the appendix.
Wu, Jiawen; Peng, Dungeng; Zhang, Yang; Lu, Zhenwei; Voehler, Markus; Sanders, Charles R; Li, Jun
2015-03-27
Our recent study has shown that cellular junctions in myelin and in the epi-/perineruium that encase nerve fibers regulate the permeability of the peripheral nerves. This permeability may affect propagation of the action potential. Direct interactions between the PDZ₁ domain of zonula occludens (ZO₁ or ZO₂) and the C-termini of claudins are known to be crucial for the formation of tight junctions. Using the purified PDZ₁ domain of ZO₂ and a variety of C-terminal mutants of peripheral nerve claudins (claudin-1, claudin-2, claudin-3, claudin-5 in epi-/perineurium; claudin-19 in myelin), we have utilized NMR spectroscopy to determine specific roles of the 3 C-terminal claudin residues (position -2, -1, 0) for their interactions with PDZ₁ of ZO₂. In contrast to the canonical model that emphasizes the importance of residues at the -2 and 0 positions, our results demonstrate that, for peripheral nerve claudins, the residue at position -1 plays a critical role in association with PDZ₁, while the side-chain of residue 0 plays a significant but lesser role. Surprisingly, claudin-19, the most abundant claudin in myelin, exhibited no binding to ZO₂. These findings reveal that the binding mechanism of claudin/ZO in epi-/perineurium is distinct from the canonical interactions between non-ZO PDZ-containing proteins with their ligands. This observation provides the molecular basis for a strategy to develop drugs that target tight junctions in the epi-/perineurium of peripheral nerves. Published by Elsevier Inc.
NASA Astrophysics Data System (ADS)
Sharma, Basant Lal
2018-05-01
Based on the well known nearest-neighbor tight-binding approximation for graphene, an exact expression for the electronic conductance across a zigzag nanoribbon/armchair nanotube junction is presented for non-interacting electrons. The junction results from the removal of a half-row of zigzag dimers in armchair nanotube, or equivalently by partial rolling of zigzag nanoribbon and insertion of a half-row of zigzag dimers in between. From the former point of view, a discrete form of Dirichlet condition is imposed on a zigzag half-line of dimers assuming the vanishing of wave function outside the physical structure. A closed form expression is provided for the reflection and transmission moduli for the outgoing wave modes for each given electronic wave mode incident from either side of the junction. It is demonstrated that such a contact junction between the nanotube and nanoribbon exhibits negligible backscattering, and the transmission has been found to be nearly ballistic. In contrast to the previously reported studies for partially unzipped carbon nanotubes (CNTs), using the same tight binding model, it is found that due to the "defect" there is certain amount of mixing between the electronic wave modes with even and odd reflection symmetries. But the junction remains a perfect valley filter for CNTs at certain energy ranges. Applications aside from the electronic case, include wave propagation in quasi-one-dimensional honeycomb structures of graphene-like constitution. The paper includes several numerical calculations, analytical derivations, and graphical results, which complement the provision of succinct closed form expressions.
Simon, Cécile; Barathieu, Karine; Laguerre, Michel; Schmitter, Jean-Marie; Fouquet, Eric; Pianet, Isabelle; Dufourc, Erick J
2003-09-09
The interactions between the B3 (catechin-4alpha,8-catechin) red wine tannin and the human salivary protein fragment IB7(14) (SPPGKPQGPPPQGG) were monitored by (1)H magic angle spinning NMR, circular dichroism, electrospray ionization mass spectrometry, and molecular modeling. It is found that the secondary structure of IB7(14) is made of a type II helix (collagen helix) and random coil. The central glycine 8 appears to act as a flexible rotula separating two helix II regions. Three tannin molecules tightly complex the peptide, without modifying its secondary structure, but seem to reduce its conformational dynamics. The binding dissociation constant is in the millimolar range. B3 tannins with a "tweezers" conformation bind to the hydrophilic side of the saliva peptide, suggesting that the principal driving forces toward association are governed by hydrogen bonding between the carbonyl functions of proline residues and both the phenol and catechol OH groups. These findings are further discussed in the frame of an astringency phenomenon.