Chen, Xianfeng; Johnson, Stephen; Jeraldo, Patricio; Wang, Junwen; Chia, Nicholas; Kocher, Jean-Pierre A; Chen, Jun
2018-03-01
Illumina paired-end sequencing has been increasingly popular for 16S rRNA gene-based microbiota profiling. It provides higher phylogenetic resolution than single-end reads due to a longer read length. However, the reverse read (R2) often has significant low base quality, and a large proportion of R2s will be discarded after quality control, resulting in a mixture of paired-end and single-end reads. A typical 16S analysis pipeline usually processes either paired-end or single-end reads but not a mixture. Thus, the quantification accuracy and statistical power will be reduced due to the loss of a large amount of reads. As a result, rare taxa may not be detectable with the paired-end approach, or low taxonomic resolution will result in a single-end approach. To have both the higher phylogenetic resolution provided by paired-end reads and the higher sequence coverage by single-end reads, we propose a novel OTU-picking pipeline, hybrid-denovo, that can process a hybrid of single-end and paired-end reads. Using high-quality paired-end reads as a gold standard, we show that hybrid-denovo achieved the highest correlation with the gold standard and performed better than the approaches based on paired-end or single-end reads in terms of quantifying the microbial diversity and taxonomic abundances. By applying our method to a rheumatoid arthritis (RA) data set, we demonstrated that hybrid-denovo captured more microbial diversity and identified more RA-associated taxa than a paired-end or single-end approach. Hybrid-denovo utilizes both paired-end and single-end 16S sequencing reads and is recommended for 16S rRNA gene targeted paired-end sequencing data.
Sequence-dependent base pair stepping dynamics in XPD helicase unwinding
Qi, Zhi; Pugh, Robert A; Spies, Maria; Chemla, Yann R
2013-01-01
Helicases couple the chemical energy of ATP hydrolysis to directional translocation along nucleic acids and transient duplex separation. Understanding helicase mechanism requires that the basic physicochemical process of base pair separation be understood. This necessitates monitoring helicase activity directly, at high spatio-temporal resolution. Using optical tweezers with single base pair (bp) resolution, we analyzed DNA unwinding by XPD helicase, a Superfamily 2 (SF2) DNA helicase involved in DNA repair and transcription initiation. We show that monomeric XPD unwinds duplex DNA in 1-bp steps, yet exhibits frequent backsteps and undergoes conformational transitions manifested in 5-bp backward and forward steps. Quantifying the sequence dependence of XPD stepping dynamics with near base pair resolution, we provide the strongest and most direct evidence thus far that forward, single-base pair stepping of a helicase utilizes the spontaneous opening of the duplex. The proposed unwinding mechanism may be a universal feature of DNA helicases that move along DNA phosphodiester backbones. DOI: http://dx.doi.org/10.7554/eLife.00334.001 PMID:23741615
NASA Astrophysics Data System (ADS)
Lee, Min Sun; Kim, Kyeong Yun; Ko, Guen Bae; Lee, Jae Sung
2017-05-01
In this study, we developed a proof-of-concept prototype PET system using a pair of depth-of-interaction (DOI) PET detectors based on the proposed DOI-encoding method and digital silicon photomultiplier (dSiPM). Our novel cost-effective DOI measurement method is based on a triangular-shaped reflector that requires only a single-layer pixelated crystal and single-ended signal readout. The DOI detector consisted of an 18 × 18 array of unpolished LYSO crystal (1.47 × 1.47 × 15 mm3) wrapped with triangular-shaped reflectors. The DOI information was encoded by depth-dependent light distribution tailored by the reflector geometry and DOI correction was performed using four-step depth calibration data and maximum-likelihood (ML) estimation. The detector pair and the object were placed on two motorized rotation stages to demonstrate 12-block ring PET geometry with 11.15 cm diameter. Spatial resolution was measured and phantom and animal imaging studies were performed to investigate imaging performance. All images were reconstructed with and without the DOI correction to examine the impact of our DOI measurement. The pair of dSiPM-based DOI PET detectors showed good physical performances respectively: 2.82 and 3.09 peak-to-valley ratios, 14.30% and 18.95% energy resolution, and 4.28 and 4.24 mm DOI resolution averaged over all crystals and all depths. A sub-millimeter spatial resolution was achieved at the center of the field of view (FOV). After applying ML-based DOI correction, maximum 36.92% improvement was achieved in the radial spatial resolution and a uniform resolution was observed within 5 cm of transverse PET FOV. We successfully acquired phantom and animal images with improved spatial resolution and contrast by using the DOI measurement. The proposed DOI-encoding method was successfully demonstrated in the system level and exhibited good performance, showing its feasibility for animal PET applications with high spatial resolution and sensitivity.
Database of non-canonical base pairs found in known RNA structures
NASA Technical Reports Server (NTRS)
Nagaswamy, U.; Voss, N.; Zhang, Z.; Fox, G. E.
2000-01-01
Atomic resolution RNA structures are being published at an increasing rate. It is common to find a modest number of non-canonical base pairs in these structures in addition to the usual Watson-Crick pairs. This database summarizes the occurrence of these rare base pairs in accordance with standard nomenclature. The database, http://prion.bchs.uh.edu/, contains information such as sequence context, sugar pucker conformation, anti / syn base conformations, chemical shift, p K (a)values, melting temperature and free energy. Of the 29 anticipated pairs with two or more hydrogen bonds, 20 have been encountered to date. In addition, four unexpected pairs with two hydrogen bonds have been reported bringing the total to 24. Single hydrogen bond versions of five of the expected geometries have been encountered among the single hydrogen bond interactions. In addition, 18 different types of base triplets have been encountered, each of which involves three to six hydrogen bonds. The vast majority of the rare base pairs are antiparallel with the bases in the anti configuration relative to the ribose. The most common are the GU wobble, the Sheared GA pair, the Reverse Hoogsteen pair and the GA imino pair.
Super-Chelators for Advanced Protein Labeling in Living Cells.
Gatterdam, Karl; Joest, Eike F; Dietz, Marina S; Heilemann, Mike; Tampé, Robert
2018-05-14
Live-cell labeling, super-resolution microscopy, single-molecule applications, protein localization, or chemically induced assembly are emerging approaches, which require specific and very small interaction pairs. The minimal disturbance of protein function is essential to derive unbiased insights into cellular processes. Herein, we define a new class of hexavalent N-nitrilotriacetic acid (hexaNTA) chelators, displaying the highest affinity and stability of all NTA-based small interaction pairs described so far. Coupled to bright organic fluorophores with fine-tuned photophysical properties, the super-chelator probes were delivered into human cells by chemically gated nanopores. These super-chelators permit kinetic profiling, multiplexed labeling of His 6 - and His 12 -tagged proteins as well as single-molecule-based super-resolution imaging. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Base pairing and base mis-pairing in nucleic acids
NASA Technical Reports Server (NTRS)
Wang, A. H. J.; Rich, A.
1986-01-01
In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.
Helicase Stepping Investigated with One-Nucleotide Resolution Fluorescence Resonance Energy Transfer
NASA Astrophysics Data System (ADS)
Lin, Wenxia; Ma, Jianbing; Nong, Daguan; Xu, Chunhua; Zhang, Bo; Li, Jinghua; Jia, Qi; Dou, Shuoxing; Ye, Fangfu; Xi, Xuguang; Lu, Ying; Li, Ming
2017-09-01
Single-molecule Förster resonance energy transfer is widely applied to study helicases by detecting distance changes between a pair of dyes anchored to overhangs of a forked DNA. However, it has been lacking single-base pair (1-bp) resolution required for revealing stepping kinetics of helicases. We designed a nanotensioner in which a short DNA is bent to exert force on the overhangs, just as in optical or magnetic tweezers. The strategy improved the resolution of Förster resonance energy transfer to 0.5 bp, high enough to uncover differences in DNA unwinding by yeast Pif1 and E. coli RecQ whose unwinding behaviors cannot be differentiated by currently practiced methods. We found that Pif1 exhibits 1-bp-stepping kinetics, while RecQ breaks 1 bp at a time but sequesters the nascent nucleotides and releases them randomly. The high-resolution data allowed us to propose a three-parameter model to quantitatively interpret the apparently different unwinding behaviors of the two helicases which belong to two superfamilies.
Recent advances in 193-nm single-layer photoresists based on alternating copolymers of cycloolefins
NASA Astrophysics Data System (ADS)
Houlihan, Francis M.; Wallow, Thomas I.; Timko, Allen G.; Neria, E.; Hutton, Richard S.; Cirelli, Raymond A.; Nalamasu, Omkaram; Reichmanis, Elsa
1997-07-01
We report on our recent investigations on the formulation and processing of 193 nm single layer photoresists based on alternating copolymers of cycloolefins with maleic anhydride. Resists formulated with cycloolefin copolymers are compatible with 0.262 N tetramethylammonium developers, have excellent adhesion, sensitivity, etch resistance and thermal flow properties. The effect of polymer structure and composition, dissolution inhibitor structure and loading as well as the effect of the photoacid generator on the resist dissolution properties was investigated. Based on the results high contrast formulations were evaluated on a GCA XLS (NA equals 0.53, 4X reduction optics) deep-UV stepper to exhibit 0.27 micrometer L/S pair resolution with excellent photosensitivity. Based on the dissolution properties and a spectroscopic examination of the resist, we have designed materials that show less than 0.17 micrometer L/S pair resolution with 193 nm exposures. In this paper, the formulation methodology is detailed and the most recent results upon both with 248 and 193 nm irradiation are described.
NASA Astrophysics Data System (ADS)
Liu, Zhen; Xing, Dong; Su, Qian Peter; Zhu, Yun; Zhang, Jiamei; Kong, Xinyu; Xue, Boxin; Wang, Sheng; Sun, Hao; Tao, Yile; Sun, Yujie
2014-07-01
Imaging the location and dynamics of individual interacting protein pairs is essential but often difficult because of the fluorescent background from other paired and non-paired molecules, particularly in the sub-diffraction cellular space. Here we develop a new method combining bimolecular fluorescence complementation and photoactivated localization microscopy for super-resolution imaging and single-molecule tracking of specific protein-protein interactions. The method is used to study the interaction of two abundant proteins, MreB and EF-Tu, in Escherichia coli cells. The super-resolution imaging shows interesting distribution and domain sizes of interacting MreB-EF-Tu pairs as a subpopulation of total EF-Tu. The single-molecule tracking of MreB, EF-Tu and MreB-EF-Tu pairs reveals intriguing localization-dependent heterogonous dynamics and provides valuable insights to understanding the roles of MreB-EF-Tu interactions.
Liu, Zhen; Xing, Dong; Su, Qian Peter; Zhu, Yun; Zhang, Jiamei; Kong, Xinyu; Xue, Boxin; Wang, Sheng; Sun, Hao; Tao, Yile; Sun, Yujie
2014-01-01
Imaging the location and dynamics of individual interacting protein pairs is essential but often difficult because of the fluorescent background from other paired and non-paired molecules, particularly in the sub-diffraction cellular space. Here we develop a new method combining bimolecular fluorescence complementation and photoactivated localization microscopy for super-resolution imaging and single-molecule tracking of specific protein–protein interactions. The method is used to study the interaction of two abundant proteins, MreB and EF-Tu, in Escherichia coli cells. The super-resolution imaging shows interesting distribution and domain sizes of interacting MreB–EF-Tu pairs as a subpopulation of total EF-Tu. The single-molecule tracking of MreB, EF-Tu and MreB–EF-Tu pairs reveals intriguing localization-dependent heterogonous dynamics and provides valuable insights to understanding the roles of MreB–EF-Tu interactions. PMID:25030837
Image super-resolution via sparse representation.
Yang, Jianchao; Wright, John; Huang, Thomas S; Ma, Yi
2010-11-01
This paper presents a new approach to single-image super-resolution, based on sparse signal representation. Research on image statistics suggests that image patches can be well-represented as a sparse linear combination of elements from an appropriately chosen over-complete dictionary. Inspired by this observation, we seek a sparse representation for each patch of the low-resolution input, and then use the coefficients of this representation to generate the high-resolution output. Theoretical results from compressed sensing suggest that under mild conditions, the sparse representation can be correctly recovered from the downsampled signals. By jointly training two dictionaries for the low- and high-resolution image patches, we can enforce the similarity of sparse representations between the low resolution and high resolution image patch pair with respect to their own dictionaries. Therefore, the sparse representation of a low resolution image patch can be applied with the high resolution image patch dictionary to generate a high resolution image patch. The learned dictionary pair is a more compact representation of the patch pairs, compared to previous approaches, which simply sample a large amount of image patch pairs, reducing the computational cost substantially. The effectiveness of such a sparsity prior is demonstrated for both general image super-resolution and the special case of face hallucination. In both cases, our algorithm generates high-resolution images that are competitive or even superior in quality to images produced by other similar SR methods. In addition, the local sparse modeling of our approach is naturally robust to noise, and therefore the proposed algorithm can handle super-resolution with noisy inputs in a more unified framework.
Distinguishing Individual DNA Bases in a Network by Non-Resonant Tip-Enhanced Raman Scattering.
Zhang, Rui; Zhang, Xianbiao; Wang, Huifang; Zhang, Yao; Jiang, Song; Hu, Chunrui; Zhang, Yang; Luo, Yi; Dong, Zhenchao
2017-05-08
The importance of identifying DNA bases at the single-molecule level is well recognized for many biological applications. Although such identification can be achieved by electrical measurements using special setups, it is still not possible to identify single bases in real space by optical means owing to the diffraction limit. Herein, we demonstrate the outstanding ability of scanning tunneling microscope (STM)-controlled non-resonant tip-enhanced Raman scattering (TERS) to unambiguously distinguish two individual complementary DNA bases (adenine and thymine) with a spatial resolution down to 0.9 nm. The distinct Raman fingerprints identified for the two molecules allow to differentiate in real space individual DNA bases in coupled base pairs. The demonstrated ability of non-resonant Raman scattering with super-high spatial resolution will significantly extend the applicability of TERS, opening up new routes for single-molecule DNA sequencing. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
“Ultra-high resolution optical trap with single fluorophore sensitivity”
Comstock, Matthew J; Ha, Taekjip; Chemla, Yann R
2013-01-01
We present a single-molecule instrument that combines a timeshared ultra-high resolution dual optical trap interlaced with a confocal fluorescence microscope. In a demonstration experiment, individual single-fluorophore labeled DNA oligonucleotides were observed to bind and unbind to complementary DNA suspended between two trapped beads. Simultaneous with the single-fluorophore detection, coincident angstrom-scale changes in tether extension could be clearly observed. Fluorescence readout allowed us to determine the duplex melting rate as a function of force. The new instrument will enable the simultaneous measurement of angstrom-scale mechanical motion of individual DNA-binding proteins (e.g., single base pair stepping of DNA translocases) along with the detection of fluorescently labeled protein properties (e.g., internal configuration). PMID:21336286
Koh, Hye Ran; Roy, Rahul; Sorokina, Maria; Tang, Guo-Qing; Nandakumar, Divya; Patel, Smita S; Ha, Taekjip
2018-05-17
We provide a comprehensive analysis of transcription in real time by T7 RNA Polymerase (RNAP) using single-molecule fluorescence resonance energy transfer by monitoring the entire life history of transcription initiation, including stepwise RNA synthesis with near base-pair resolution, abortive cycling, and transition into elongation. Kinetically branching pathways were observed for abortive initiation with an RNAP either recycling on the same promoter or exchanging with another RNAP from solution. We detected fast and slow populations of RNAP in their transition into elongation, consistent with the efficient and delayed promoter release, respectively, observed in ensemble studies. Real-time monitoring of abortive cycling using three-probe analysis showed that the initiation events are stochastically branched into productive and failed transcription. The abortive products are generated primarily from initiation events that fail to progress to elongation, and a majority of the productive events transit to elongation without making abortive products. Copyright © 2018 Elsevier Inc. All rights reserved.
A DNA methylation map of human cancer at single base-pair resolution.
Vidal, E; Sayols, S; Moran, S; Guillaumet-Adkins, A; Schroeder, M P; Royo, R; Orozco, M; Gut, M; Gut, I; Lopez-Bigas, N; Heyn, H; Esteller, M
2017-10-05
Although single base-pair resolution DNA methylation landscapes for embryonic and different somatic cell types provided important insights into epigenetic dynamics and cell-type specificity, such comprehensive profiling is incomplete across human cancer types. This prompted us to perform genome-wide DNA methylation profiling of 22 samples derived from normal tissues and associated neoplasms, including primary tumors and cancer cell lines. Unlike their invariant normal counterparts, cancer samples exhibited highly variable CpG methylation levels in a large proportion of the genome, involving progressive changes during tumor evolution. The whole-genome sequencing results from selected samples were replicated in a large cohort of 1112 primary tumors of various cancer types using genome-scale DNA methylation analysis. Specifically, we determined DNA hypermethylation of promoters and enhancers regulating tumor-suppressor genes, with potential cancer-driving effects. DNA hypermethylation events showed evidence of positive selection, mutual exclusivity and tissue specificity, suggesting their active participation in neoplastic transformation. Our data highlight the extensive changes in DNA methylation that occur in cancer onset, progression and dissemination.
A versatile genome-scale PCR-based pipeline for high-definition DNA FISH.
Bienko, Magda; Crosetto, Nicola; Teytelman, Leonid; Klemm, Sandy; Itzkovitz, Shalev; van Oudenaarden, Alexander
2013-02-01
We developed a cost-effective genome-scale PCR-based method for high-definition DNA FISH (HD-FISH). We visualized gene loci with diffraction-limited resolution, chromosomes as spot clusters and single genes together with transcripts by combining HD-FISH with single-molecule RNA FISH. We provide a database of over 4.3 million primer pairs targeting the human and mouse genomes that is readily usable for rapid and flexible generation of probes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Weina; Hellinga, Homme W.; Beese, Lorena S.
Even though high-fidelity polymerases copy DNA with remarkable accuracy, some base-pair mismatches are incorporated at low frequency, leading to spontaneous mutagenesis. Using high-resolution X-ray crystallographic analysis of a DNA polymerase that catalyzes replication in crystals, we observe that a C {center_dot} A mismatch can mimic the shape of cognate base pairs at the site of incorporation. This shape mimicry enables the mismatch to evade the error detection mechanisms of the polymerase, which would normally either prevent mismatch incorporation or promote its nucleolytic excision. Movement of a single proton on one of the mismatched bases alters the hydrogen-bonding pattern such thatmore » a base pair forms with an overall shape that is virtually indistinguishable from a canonical, Watson-Crick base pair in double-stranded DNA. These observations provide structural evidence for the rare tautomer hypothesis of spontaneous mutagenesis, a long-standing concept that has been difficult to demonstrate directly.« less
Optimized multiple linear mappings for single image super-resolution
NASA Astrophysics Data System (ADS)
Zhang, Kaibing; Li, Jie; Xiong, Zenggang; Liu, Xiuping; Gao, Xinbo
2017-12-01
Learning piecewise linear regression has been recognized as an effective way for example learning-based single image super-resolution (SR) in literature. In this paper, we employ an expectation-maximization (EM) algorithm to further improve the SR performance of our previous multiple linear mappings (MLM) based SR method. In the training stage, the proposed method starts with a set of linear regressors obtained by the MLM-based method, and then jointly optimizes the clustering results and the low- and high-resolution subdictionary pairs for regression functions by using the metric of the reconstruction errors. In the test stage, we select the optimal regressor for SR reconstruction by accumulating the reconstruction errors of m-nearest neighbors in the training set. Thorough experimental results carried on six publicly available datasets demonstrate that the proposed SR method can yield high-quality images with finer details and sharper edges in terms of both quantitative and perceptual image quality assessments.
Belaghzal, Houda; Dekker, Job; Gibcus, Johan H
2017-07-01
Chromosome conformation capture-based methods such as Hi-C have become mainstream techniques for the study of the 3D organization of genomes. These methods convert chromatin interactions reflecting topological chromatin structures into digital information (counts of pair-wise interactions). Here, we describe an updated protocol for Hi-C (Hi-C 2.0) that integrates recent improvements into a single protocol for efficient and high-resolution capture of chromatin interactions. This protocol combines chromatin digestion and frequently cutting enzymes to obtain kilobase (kb) resolution. It also includes steps to reduce random ligation and the generation of uninformative molecules, such as unligated ends, to improve the amount of valid intra-chromosomal read pairs. This protocol allows for obtaining information on conformational structures such as compartment and topologically associating domains, as well as high-resolution conformational features such as DNA loops. Copyright © 2017 Elsevier Inc. All rights reserved.
Resolution enhancement using simultaneous couple illumination
NASA Astrophysics Data System (ADS)
Hussain, Anwar; Martínez Fuentes, José Luis
2016-10-01
A super-resolution technique based on structured illumination created by a liquid crystal on silicon spatial light modulator (LCOS-SLM) is presented. Single and simultaneous pairs of tilted beams are generated to illuminate a target object. Resolution enhancement of an optical 4f system is demonstrated by using numerical simulations. The resulting intensity images are recorded at a charged couple device (CCD) and stored in the computer memory for further processing. One dimension enhancement can be performed with only 15 images. Two dimensional complete improvement requires 153 different images. The resolution of the optical system is extended three times compared to the band limited system.
Diakaridia, Sanogo; Pan, Yue; Xu, Pengbai; Zhou, Dengwang; Wang, Benzhang; Teng, Lei; Lu, Zhiwei; Ba, Dexin; Dong, Yongkang
2017-07-24
In distributed Brillouin optical fiber sensor when the length of the perturbation to be detected is much smaller than the spatial resolution that is defined by the pulse width, the measured Brillouin gain spectrum (BGS) experiences two or multiple peaks. In this work, we propose and demonstrate a technique using differential pulse pair Brillouin optical time-domain analysis (DPP-BOTDA) based on double-peak BGS to enhance small-scale events detection capability, where two types of single mode fiber (main fiber and secondary fiber) with 116 MHz Brillouin frequency shift (BFS) difference have been used. We have realized detection of a 5-cm hot spot at the far end of 24-km single mode fiber by employing a 50-cm spatial resolution DPP-BOTDA with only 1GS/s sampling rate (corresponding to 10 cm/point). The BFS at the far end of 24-km sensing fiber has been measured with 0.54 MHz standard deviation which corresponds to a 0.5°C temperature accuracy. This technique is simple and cost effective because it is implemented using the similar experimental setup of the standard BOTDA, however, it should be noted that the consecutive small-scale events have to be separated by a minimum length corresponding to the spatial resolution defined by the pulse width difference.
Wysoczynski, Christina L.; Roemer, Sarah C.; Dostal, Vishantie; Barkley, Robert M.; Churchill, Mair E. A.; Malarkey, Christopher S.
2013-01-01
Obtaining quantities of highly pure duplex DNA is a bottleneck in the biophysical analysis of protein–DNA complexes. In traditional DNA purification methods, the individual cognate DNA strands are purified separately before annealing to form DNA duplexes. This approach works well for palindromic sequences, in which top and bottom strands are identical and duplex formation is typically complete. However, in cases where the DNA is non-palindromic, excess of single-stranded DNA must be removed through additional purification steps to prevent it from interfering in further experiments. Here we describe and apply a novel reversed-phase ion-pair liquid chromatography purification method for double-stranded DNA ranging in lengths from 17 to 51 bp. Both palindromic and non-palindromic DNA can be readily purified. This method has the unique ability to separate blunt double-stranded DNA from pre-attenuated (n-1, n-2, etc) synthesis products, and from DNA duplexes with single base pair overhangs. Additionally, palindromic DNA sequences with only minor differences in the central spacer sequence of the DNA can be separated, and the purified DNA is suitable for co-crystallization of protein–DNA complexes. Thus, double-stranded ion-pair liquid chromatography is a useful approach for duplex DNA purification for many applications. PMID:24013567
A DNA methylation map of human cancer at single base-pair resolution
Vidal, E; Sayols, S; Moran, S; Guillaumet-Adkins, A; Schroeder, M P; Royo, R; Orozco, M; Gut, M; Gut, I; Lopez-Bigas, N; Heyn, H; Esteller, M
2017-01-01
Although single base-pair resolution DNA methylation landscapes for embryonic and different somatic cell types provided important insights into epigenetic dynamics and cell-type specificity, such comprehensive profiling is incomplete across human cancer types. This prompted us to perform genome-wide DNA methylation profiling of 22 samples derived from normal tissues and associated neoplasms, including primary tumors and cancer cell lines. Unlike their invariant normal counterparts, cancer samples exhibited highly variable CpG methylation levels in a large proportion of the genome, involving progressive changes during tumor evolution. The whole-genome sequencing results from selected samples were replicated in a large cohort of 1112 primary tumors of various cancer types using genome-scale DNA methylation analysis. Specifically, we determined DNA hypermethylation of promoters and enhancers regulating tumor-suppressor genes, with potential cancer-driving effects. DNA hypermethylation events showed evidence of positive selection, mutual exclusivity and tissue specificity, suggesting their active participation in neoplastic transformation. Our data highlight the extensive changes in DNA methylation that occur in cancer onset, progression and dissemination. PMID:28581523
Single-shot spiral imaging at 7 T.
Engel, Maria; Kasper, Lars; Barmet, Christoph; Schmid, Thomas; Vionnet, Laetitia; Wilm, Bertram; Pruessmann, Klaas P
2018-03-25
The purpose of this work is to explore the feasibility and performance of single-shot spiral MRI at 7 T, using an expanded signal model for reconstruction. Gradient-echo brain imaging is performed on a 7 T system using high-resolution single-shot spiral readouts and half-shot spirals that perform dual-image acquisition after a single excitation. Image reconstruction is based on an expanded signal model including the encoding effects of coil sensitivity, static off-resonance, and magnetic field dynamics. The latter are recorded concurrently with image acquisition, using NMR field probes. The resulting image resolution is assessed by point spread function analysis. Single-shot spiral imaging is achieved at a nominal resolution of 0.8 mm, using spiral-out readouts of 53-ms duration. High depiction fidelity is achieved without conspicuous blurring or distortion. Effective resolutions are assessed as 0.8, 0.94, and 0.98 mm in CSF, gray matter and white matter, respectively. High image quality is also achieved with half-shot acquisition yielding image pairs at 1.5-mm resolution. Use of an expanded signal model enables single-shot spiral imaging at 7 T with unprecedented image quality. Single-shot and half-shot spiral readouts deploy the sensitivity benefit of high field for rapid high-resolution imaging, particularly for functional MRI and arterial spin labeling. © 2018 International Society for Magnetic Resonance in Medicine.
Guo, Xiurong; Seela, Frank
2017-09-04
α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
van Reenen, Alexander; Gao, Yang; Bos, Arjen H.; de Jong, Arthur M.; Hulsen, Martien A.; den Toonder, Jaap M. J.; Prins, Menno W. J.
2013-07-01
The application of magnetic particles in biomedical research and in-vitro diagnostics requires accurate characterization of their magnetic properties, with single-particle resolution and good statistics. Here, we report intra-pair magnetophoresis as a method to accurately quantify the field-dependent magnetic moments of magnetic particles and to rapidly generate histograms of the magnetic moments with good statistics. We demonstrate our method with particles of different sizes and from different sources, with a measurement precision of a few percent. We expect that intra-pair magnetophoresis will be a powerful tool for the characterization and improvement of particles for the upcoming field of particle-based nanobiotechnology.
In Situ Detection of MicroRNA Expression with RNAscope Probes.
Yin, Viravuth P
2018-01-01
Elucidating the spatial resolution of gene transcripts provides important insight into potential gene function. MicroRNAs are short, singled-stranded noncoding RNAs that control gene expression through base-pair complementarity with target mRNAs in the 3' untranslated region (UTR) and inhibiting protein expression. However, given their small size of ~22- to 24-nt and low expression levels, standard in situ hybridization detection methods are not amendable for microRNA spatial resolution. Here, I describe a technique that employs RNAscope probe design and propriety amplification technology that provides simultaneous single molecule detection of individual microRNA and its target gene. This method allows for rapid and sensitive detection of noncoding RNA transcripts in frozen tissue sections.
Osathanunkul, Maslin; Dheeranupattana, Srisulak; Rotarayanont, Siriphron; Sookkhee, Siriwoot; Osathanunkul, Khukrit; Madesis, Panagiotis
2017-12-02
DNA barcoding coupled high resolution melting (Bar-HRM) is an emerging method for species discrimination based on DNA dissociation kinetics. The aim of this work was to evaluate the suitability of different primer sets, derived from selected DNA regions, for Bar-HRM analysis of species in Kaempferia (Zingiberaceae). Four primer pairs were evaluated (rbcL, rpoC, trnL and ITS1). It was observed that the ITS1 barcode was the most useful DNA barcoding region overall for species discrimination out of all of the regions and primers assessed. Thus, the primer pair derived from the ITS1 region was the single most effective region for the identification of the tested species, whereas the rbcL primer pair gave the lowest resolution. Our Bar-HRM developed here would not only be useful for identification of Kaempferia plant specimens lacking essential parts for morphological identification but will be useful for authenticating products in powdered form of a high value medicinal species Kaempferia parviflora, in particular.
NASA Astrophysics Data System (ADS)
Li, Zhengji; Teng, Qizhi; He, Xiaohai; Yue, Guihua; Wang, Zhengyong
2017-09-01
The parameter evaluation of reservoir rocks can help us to identify components and calculate the permeability and other parameters, and it plays an important role in the petroleum industry. Until now, computed tomography (CT) has remained an irreplaceable way to acquire the microstructure of reservoir rocks. During the evaluation and analysis, large samples and high-resolution images are required in order to obtain accurate results. Owing to the inherent limitations of CT, however, a large field of view results in low-resolution images, and high-resolution images entail a smaller field of view. Our method is a promising solution to these data collection limitations. In this study, a framework for sparse representation-based 3D volumetric super-resolution is proposed to enhance the resolution of 3D voxel images of reservoirs scanned with CT. A single reservoir structure and its downgraded model are divided into a large number of 3D cubes of voxel pairs and these cube pairs are used to calculate two overcomplete dictionaries and the sparse-representation coefficients in order to estimate the high frequency component. Future more, to better result, a new feature extract method with combine BM4D together with Laplacian filter are introduced. In addition, we conducted a visual evaluation of the method, and used the PSNR and FSIM to evaluate it qualitatively.
Kaufmann, Anton; Widmer, Mirjam; Maden, Kathryn; Butcher, Patrick; Walker, Stephan
2018-03-05
A reversed-phase ion-pairing chromatographic method was developed for the detection and quantification of inorganic and organic anionic food additives. A single-stage high-resolution mass spectrometer (orbitrap ion trap, Orbitrap) was used to detect the accurate masses of the unfragmented analyte ions. The developed ion-pairing chromatography method was based on a dibutylamine/hexafluoro-2-propanol buffer. Dibutylamine can be charged to serve as a chromatographic ion-pairing agent. This ensures sufficient retention of inorganic and organic anions. Yet, unlike quaternary amines, it can be de-charged in the electrospray to prevent the formation of neutral analyte ion-pairing agent adducts. This process is significantly facilitated by the added hexafluoro-2-propanol. This approach permits the sensitive detection and quantification of additives like nitrate and mono-, di-, and triphosphate as well as citric acid, a number of artificial sweeteners like cyclamate and aspartame, flavor enhancers like glutamate, and preservatives like sorbic acid. This is a major advantage, since the currently used analytical methods as utilized in food safety laboratories are only capable in monitoring a few compounds or a particular category of food additives. Graphical abstract Deptotonation of ion pair agent in the electrospray interface.
Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira
2015-11-02
Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sordaria, a model system to uncover links between meiotic pairing and recombination
Zickler, Denise; Espagne, Eric
2017-01-01
The mycelial fungus Sordaria macrospora was first used as experimental system for meiotic recombination. This review shows that it provides also a powerful cytological system for dissecting chromosome dynamics in wild-type and mutant meioses. Fundamental cytogenetic findings include: (1) The identification of presynaptic alignment as a key step in pairing of homologous chromosomes. (2) The discovery that biochemical complexes that mediate recombination at the DNA level concomitantly mediate pairing of homologs. (3) This pairing process involves not only resolution but also avoidance of chromosomal entanglements and the resolution system includes dissolution of constraining DNA recombination interactions, achieved by a unique role of Mlh1. (4) Discovery that the central components of the synaptonemal complex directly mediate the re-localization of the recombination proteins from on-axis to in-between homologue axis positions. (5) Identification of putative STUbL protein Hei10 as a structure-based signal transduction molecule that coordinates progression and differentiation of recombinational interactions at multiple stages. (6) Discovery that a single interference process mediates both nucleation of the SC and designation of crossover sites, thereby ensuring even spacing of both features. (7) Discovery of local modulation of sister-chromatid cohesion at sites of crossover recombination. PMID:26877138
Multiplexed single-molecule force spectroscopy using a centrifuge.
Yang, Darren; Ward, Andrew; Halvorsen, Ken; Wong, Wesley P
2016-03-17
We present a miniature centrifuge force microscope (CFM) that repurposes a benchtop centrifuge for high-throughput single-molecule experiments with high-resolution particle tracking, a large force range, temperature control and simple push-button operation. Incorporating DNA nanoswitches to enable repeated interrogation by force of single molecular pairs, we demonstrate increased throughput, reliability and the ability to characterize population heterogeneity. We perform spatiotemporally multiplexed experiments to collect 1,863 bond rupture statistics from 538 traceable molecular pairs in a single experiment, and show that 2 populations of DNA zippers can be distinguished using per-molecule statistics to reduce noise.
Multiplexed single-molecule force spectroscopy using a centrifuge
Yang, Darren; Ward, Andrew; Halvorsen, Ken; Wong, Wesley P.
2016-01-01
We present a miniature centrifuge force microscope (CFM) that repurposes a benchtop centrifuge for high-throughput single-molecule experiments with high-resolution particle tracking, a large force range, temperature control and simple push-button operation. Incorporating DNA nanoswitches to enable repeated interrogation by force of single molecular pairs, we demonstrate increased throughput, reliability and the ability to characterize population heterogeneity. We perform spatiotemporally multiplexed experiments to collect 1,863 bond rupture statistics from 538 traceable molecular pairs in a single experiment, and show that 2 populations of DNA zippers can be distinguished using per-molecule statistics to reduce noise. PMID:26984516
Studying Spatial Resolution of CZT Detectors Using Sub-Pixel Positioning for SPECT
NASA Astrophysics Data System (ADS)
Montémont, Guillaume; Lux, Silvère; Monnet, Olivier; Stanchina, Sylvain; Verger, Loïck
2014-10-01
CZT detectors are the basic building block of a variety of new SPECT systems. Their modularity allows adapting system architecture to specific applications such as cardiac, breast, brain or small animal imaging. In semiconductors, a high number of electron-hole pairs is produced by a single interaction. This direct conversion process allows better energy and spatial resolutions than usual scintillation detectors based on NaI(Tl). However, it remains often unclear if SPECT imaging can really benefit of that performance gain. We investigate the system performance of a detection module, which is based on 5 mm thick CZT with a segmented anode having a 2.5 mm pitch by simulation and experimentation. This pitch allows an easy assembly of the crystal on the readout board and limits the space occupied by electronics without significantly degrading energy and spatial resolution.
Ravì, Daniele; Szczotka, Agnieszka Barbara; Shakir, Dzhoshkun Ismail; Pereira, Stephen P; Vercauteren, Tom
2018-06-01
Probe-based confocal laser endomicroscopy (pCLE) is a recent imaging modality that allows performing in vivo optical biopsies. The design of pCLE hardware, and its reliance on an optical fibre bundle, fundamentally limits the image quality with a few tens of thousands fibres, each acting as the equivalent of a single-pixel detector, assembled into a single fibre bundle. Video registration techniques can be used to estimate high-resolution (HR) images by exploiting the temporal information contained in a sequence of low-resolution (LR) images. However, the alignment of LR frames, required for the fusion, is computationally demanding and prone to artefacts. In this work, we propose a novel synthetic data generation approach to train exemplar-based Deep Neural Networks (DNNs). HR pCLE images with enhanced quality are recovered by the models trained on pairs of estimated HR images (generated by the video registration algorithm) and realistic synthetic LR images. Performance of three different state-of-the-art DNNs techniques were analysed on a Smart Atlas database of 8806 images from 238 pCLE video sequences. The results were validated through an extensive image quality assessment that takes into account different quality scores, including a Mean Opinion Score (MOS). Results indicate that the proposed solution produces an effective improvement in the quality of the obtained reconstructed image. The proposed training strategy and associated DNNs allows us to perform convincing super-resolution of pCLE images.
Single-image super-resolution based on Markov random field and contourlet transform
NASA Astrophysics Data System (ADS)
Wu, Wei; Liu, Zheng; Gueaieb, Wail; He, Xiaohai
2011-04-01
Learning-based methods are well adopted in image super-resolution. In this paper, we propose a new learning-based approach using contourlet transform and Markov random field. The proposed algorithm employs contourlet transform rather than the conventional wavelet to represent image features and takes into account the correlation between adjacent pixels or image patches through the Markov random field (MRF) model. The input low-resolution (LR) image is decomposed with the contourlet transform and fed to the MRF model together with the contourlet transform coefficients from the low- and high-resolution image pairs in the training set. The unknown high-frequency components/coefficients for the input low-resolution image are inferred by a belief propagation algorithm. Finally, the inverse contourlet transform converts the LR input and the inferred high-frequency coefficients into the super-resolved image. The effectiveness of the proposed method is demonstrated with the experiments on facial, vehicle plate, and real scene images. A better visual quality is achieved in terms of peak signal to noise ratio and the image structural similarity measurement.
Uchida, H; Sakai, T; Yamauchi, H; Hakamata, K; Shimizu, K; Yamashita, T
2016-09-21
We propose a novel scintillation detector design for positron emission tomography (PET), which has depth of interaction (DOI) capability and uses a single-ended readout scheme. The DOI detector contains a pair of crystal bars segmented using sub-surface laser engraving (SSLE). The two crystal bars are optically coupled to each other at their top segments and are coupled to two photo-sensors at their bottom segments. Initially, we evaluated the performance of different designs of single crystal bars coupled to photomultiplier tubes at both ends. We found that segmentation by SSLE results in superior performance compared to the conventional method. As the next step, we constructed a crystal unit composed of a 3 × 3 × 20 mm 3 crystal bar pair, with each bar containing four layers segmented using the SSLE. We measured the DOI performance by changing the optical conditions for the crystal unit. Based on the experimental results, we then assessed the detector performance in terms of the DOI capability by evaluating the position error, energy resolution, and light collection efficiency for various crystal unit designs with different bar sizes and a different number of layers (four to seven layers). DOI encoding with small position error was achieved for crystal units composed of a 3 × 3 × 20 mm 3 LYSO bar pair having up to seven layers, and with those composed of a 2 × 2 × 20 mm 3 LYSO bar pair having up to six layers. The energy resolution of the segment in the seven-layer 3 × 3 × 20 mm 3 crystal bar pair was 9.3%-15.5% for 662 keV gamma-rays, where the segments closer to the photo-sensors provided better energy resolution. SSLE provides high geometrical accuracy at low production cost due to the simplicity of the crystal assembly. Therefore, the proposed DOI detector is expected to be an attractive choice for practical small-bore PET systems dedicated to imaging of the brain, breast, and small animals.
Atomic-scale imaging of DNA using scanning tunnelling microscopy.
Driscoll, R J; Youngquist, M G; Baldeschwieler, J D
1990-07-19
The scanning tunnelling microscope (STM) has been used to visualize DNA under water, under oil and in air. Images of single-stranded DNA have shown that submolecular resolution is possible. Here we describe atomic-resolution imaging of duplex DNA. Topographic STM images of uncoated duplex DNA on a graphite substrate obtained in ultra-high vacuum are presented that show double-helical structure, base pairs, and atomic-scale substructure. Experimental STM profiles show excellent correlation with atomic contours of the van der Waals surface of A-form DNA derived from X-ray crystallography. A comparison of variations in the barrier to quantum mechanical tunnelling (barrier-height) with atomic-scale topography shows correlation over the phosphate-sugar backbone but anticorrelation over the base pairs. This relationship may be due to the different chemical characteristics of parts of the molecule. Further investigation of this phenomenon should lead to a better understanding of the physics of imaging adsorbates with the STM and may prove useful in sequencing DNA. The improved resolution compared with previously published STM images of DNA may be attributable to ultra-high vacuum, high data-pixel density, slow scan rate, a fortuitously clean and sharp tip and/or a relatively dilute and extremely clean sample solution. This work demonstrates the potential of the STM for characterization of large biomolecular structures, but additional development will be required to make such high resolution imaging of DNA and other large molecules routine.
Conflict Probability Estimation for Free Flight
NASA Technical Reports Server (NTRS)
Paielli, Russell A.; Erzberger, Heinz
1996-01-01
The safety and efficiency of free flight will benefit from automated conflict prediction and resolution advisories. Conflict prediction is based on trajectory prediction and is less certain the farther in advance the prediction, however. An estimate is therefore needed of the probability that a conflict will occur, given a pair of predicted trajectories and their levels of uncertainty. A method is developed in this paper to estimate that conflict probability. The trajectory prediction errors are modeled as normally distributed, and the two error covariances for an aircraft pair are combined into a single equivalent covariance of the relative position. A coordinate transformation is then used to derive an analytical solution. Numerical examples and Monte Carlo validation are presented.
Sordaria, a model system to uncover links between meiotic pairing and recombination.
Zickler, Denise; Espagne, Eric
2016-06-01
The mycelial fungus Sordaria macrospora was first used as experimental system for meiotic recombination. This review shows that it provides also a powerful cytological system for dissecting chromosome dynamics in wild-type and mutant meioses. Fundamental cytogenetic findings include: (1) the identification of presynaptic alignment as a key step in pairing of homologous chromosomes. (2) The discovery that biochemical complexes that mediate recombination at the DNA level concomitantly mediate pairing of homologs. (3) This pairing process involves not only resolution but also avoidance of chromosomal entanglements and the resolution system includes dissolution of constraining DNA recombination interactions, achieved by a unique role of Mlh1. (4) Discovery that the central components of the synaptonemal complex directly mediate the re-localization of the recombination proteins from on-axis to in-between homologue axis positions. (5) Identification of putative STUbL protein Hei10 as a structure-based signal transduction molecule that coordinates progression and differentiation of recombinational interactions at multiple stages. (6) Discovery that a single interference process mediates both nucleation of the SC and designation of crossover sites, thereby ensuring even spacing of both features. (7) Discovery of local modulation of sister-chromatid cohesion at sites of crossover recombination. Copyright © 2016 Elsevier Ltd. All rights reserved.
Gül, O. Tolga; Pugliese, Kaitlin M.; Choi, Yongki; Sims, Patrick C.; Pan, Deng; Rajapakse, Arith J.; Weiss, Gregory A.; Collins, Philip G.
2016-01-01
As biosensing devices shrink smaller and smaller, they approach a scale in which single molecule electronic sensing becomes possible. Here, we review the operation of single-enzyme transistors made using single-walled carbon nanotubes. These novel hybrid devices transduce the motions and catalytic activity of a single protein into an electronic signal for real-time monitoring of the protein’s activity. Analysis of these electronic signals reveals new insights into enzyme function and proves the electronic technique to be complementary to other single-molecule methods based on fluorescence. As one example of the nanocircuit technique, we have studied the Klenow Fragment (KF) of DNA polymerase I as it catalytically processes single-stranded DNA templates. The fidelity of DNA polymerases makes them a key component in many DNA sequencing techniques, and here we demonstrate that KF nanocircuits readily resolve DNA polymerization with single-base sensitivity. Consequently, template lengths can be directly counted from electronic recordings of KF’s base-by-base activity. After measuring as few as 20 copies, the template length can be determined with <1 base pair resolution, and different template lengths can be identified and enumerated in solutions containing template mixtures. PMID:27348011
Gül, O Tolga; Pugliese, Kaitlin M; Choi, Yongki; Sims, Patrick C; Pan, Deng; Rajapakse, Arith J; Weiss, Gregory A; Collins, Philip G
2016-06-24
As biosensing devices shrink smaller and smaller, they approach a scale in which single molecule electronic sensing becomes possible. Here, we review the operation of single-enzyme transistors made using single-walled carbon nanotubes. These novel hybrid devices transduce the motions and catalytic activity of a single protein into an electronic signal for real-time monitoring of the protein's activity. Analysis of these electronic signals reveals new insights into enzyme function and proves the electronic technique to be complementary to other single-molecule methods based on fluorescence. As one example of the nanocircuit technique, we have studied the Klenow Fragment (KF) of DNA polymerase I as it catalytically processes single-stranded DNA templates. The fidelity of DNA polymerases makes them a key component in many DNA sequencing techniques, and here we demonstrate that KF nanocircuits readily resolve DNA polymerization with single-base sensitivity. Consequently, template lengths can be directly counted from electronic recordings of KF's base-by-base activity. After measuring as few as 20 copies, the template length can be determined with <1 base pair resolution, and different template lengths can be identified and enumerated in solutions containing template mixtures.
Henderson, Richard; Chen, Shaoxia; Chen, James Z.; Grigorieff, Nikolaus; Passmore, Lori A.; Ciccarelli, Luciano; Rubinstein, John L.; Crowther, R. Anthony; Stewart, Phoebe L.; Rosenthal, Peter B.
2011-01-01
The comparison of a pair of electron microscope images recorded at different specimen tilt angles provides a powerful approach for evaluating the quality of images, image-processing procedures, or three-dimensional structures. Here, we analyze tilt-pair images recorded from a range of specimens with different symmetries and molecular masses and show how the analysis can produce valuable information not easily obtained otherwise. We show that the accuracy of orientation determination of individual single particles depends on molecular mass, as expected theoretically since the information in each particle image increases with molecular mass. The angular uncertainty is less than 1° for particles of high molecular mass (∼ 50 MDa), several degrees for particles in the range 1–5 MDa, and tens of degrees for particles below 1 MDa. Orientational uncertainty may be the major contributor to the effective temperature factor (B-factor) describing contrast loss and therefore the maximum resolution of a structure determination. We also made two unexpected observations. Single particles that are known to be flexible showed a wider spread in orientation accuracy, and the orientations of the largest particles examined changed by several degrees during typical low-dose exposures. Smaller particles presumably also reorient during the exposure; hence, specimen movement is a second major factor that limits resolution. Tilt pairs thus enable assessment of orientation accuracy, map quality, specimen motion, and conformational heterogeneity. A convincing tilt-pair parameter plot, where 60% of the particles show a single cluster around the expected tilt axis and tilt angle, provides confidence in a structure determined using electron cryomicroscopy. PMID:21939668
Development of a Diagnostic Tool to Detect DNA Methylation Biomarkers for Early-Stage Lung Cancer
2015-02-01
include: 1) a DNA recognition domain that recognizes the specific DNA sequence of interest and 2) one half of the leucine zipper pair. The second...piece will include 1) the second half of the leucine zipper pair, 2) a flexible linker flanked by a FRET pair that determines the local (within 30 bp...each other to determine the resolution of our probes. All DNA fragments are methylated using bacterial methyltransferase. Since only a single CG
MCORES: a system for noun phrase coreference resolution for clinical records.
Bodnari, Andreea; Szolovits, Peter; Uzuner, Özlem
2012-01-01
Narratives of electronic medical records contain information that can be useful for clinical practice and multi-purpose research. This information needs to be put into a structured form before it can be used by automated systems. Coreference resolution is a step in the transformation of narratives into a structured form. This study presents a medical coreference resolution system (MCORES) for noun phrases in four frequently used clinical semantic categories: persons, problems, treatments, and tests. MCORES treats coreference resolution as a binary classification task. Given a pair of concepts from a semantic category, it determines coreferent pairs and clusters them into chains. MCORES uses an enhanced set of lexical, syntactic, and semantic features. Some MCORES features measure the distance between various representations of the concepts in a pair and can be asymmetric. MCORES was compared with an in-house baseline that uses only single-perspective 'token overlap' and 'number agreement' features. MCORES was shown to outperform the baseline; its enhanced features contribute significantly to performance. In addition to the baseline, MCORES was compared against two available third-party, open-domain systems, RECONCILE(ACL09) and the Beautiful Anaphora Resolution Toolkit (BART). MCORES was shown to outperform both of these systems on clinical records.
Highly multiplexed targeted DNA sequencing from single nuclei.
Leung, Marco L; Wang, Yong; Kim, Charissa; Gao, Ruli; Jiang, Jerry; Sei, Emi; Navin, Nicholas E
2016-02-01
Single-cell DNA sequencing methods are challenged by poor physical coverage, high technical error rates and low throughput. To address these issues, we developed a single-cell DNA sequencing protocol that combines flow-sorting of single nuclei, time-limited multiple-displacement amplification (MDA), low-input library preparation, DNA barcoding, targeted capture and next-generation sequencing (NGS). This approach represents a major improvement over our previous single nucleus sequencing (SNS) Nature Protocols paper in terms of generating higher-coverage data (>90%), thereby enabling the detection of genome-wide variants in single mammalian cells at base-pair resolution. Furthermore, by pooling 48-96 single-cell libraries together for targeted capture, this approach can be used to sequence many single-cell libraries in parallel in a single reaction. This protocol greatly reduces the cost of single-cell DNA sequencing, and it can be completed in 5-6 d by advanced users. This single-cell DNA sequencing protocol has broad applications for studying rare cells and complex populations in diverse fields of biological research and medicine.
Reducible dictionaries for single image super-resolution based on patch matching and mean shifting
NASA Astrophysics Data System (ADS)
Rasti, Pejman; Nasrollahi, Kamal; Orlova, Olga; Tamberg, Gert; Moeslund, Thomas B.; Anbarjafari, Gholamreza
2017-03-01
A single-image super-resolution (SR) method is proposed. The proposed method uses a generated dictionary from pairs of high resolution (HR) images and their corresponding low resolution (LR) representations. First, HR images and the corresponding LR ones are divided into patches of HR and LR, respectively, and then they are collected into separate dictionaries. Afterward, when performing SR, the distance between every patch of the input LR image and those of available LR patches in the LR dictionary is calculated. The minimum distance between the input LR patch and those in the LR dictionary is taken, and its counterpart from the HR dictionary is passed through an illumination enhancement process. By this technique, the noticeable change of illumination between neighbor patches in the super-resolved image is significantly reduced. The enhanced HR patch represents the HR patch of the super-resolved image. Finally, to remove the blocking effect caused by merging the patches, an average of the obtained HR image and the interpolated image obtained using bicubic interpolation is calculated. The quantitative and qualitative analyses show the superiority of the proposed technique over the conventional and state-of-art methods.
Detecting reciprocity at a global scale
Frank, Morgan R.; Obradovich, Nick; Sun, Lijun; Woon, Wei Lee; LeVeck, Brad L.; Rahwan, Iyad
2018-01-01
Reciprocity stabilizes cooperation from the level of microbes all the way up to humans interacting in small groups, but does reciprocity also underlie stable cooperation between larger human agglomerations, such as nation states? Famously, evolutionary models show that reciprocity could emerge as a widespread strategy for achieving international cooperation. However, existing studies have only detected reciprocity-driven cooperation in a small number of country pairs. We apply a new method for detecting mutual influence in dynamical systems to a new large-scale data set that records state interactions with high temporal resolution. Doing so, we detect reciprocity between many country pairs in the international system and find that these reciprocating country pairs exhibit qualitatively different cooperative dynamics when compared to nonreciprocating pairs. Consistent with evolutionary theories of cooperation, reciprocating country pairs exhibit higher levels of stable cooperation and are more likely to punish instances of noncooperation. However, countries in reciprocity-based relationships are also quicker to forgive single acts of noncooperation by eventually returning to previous levels of mutual cooperation. By contrast, nonreciprocating pairs are more likely to exploit each other’s cooperation via higher rates of defection. Together, these findings provide the strongest evidence to date that reciprocity is a widespread mechanism for achieving international cooperation. PMID:29326983
Detecting reciprocity at a global scale.
Frank, Morgan R; Obradovich, Nick; Sun, Lijun; Woon, Wei Lee; LeVeck, Brad L; Rahwan, Iyad
2018-01-01
Reciprocity stabilizes cooperation from the level of microbes all the way up to humans interacting in small groups, but does reciprocity also underlie stable cooperation between larger human agglomerations, such as nation states? Famously, evolutionary models show that reciprocity could emerge as a widespread strategy for achieving international cooperation. However, existing studies have only detected reciprocity-driven cooperation in a small number of country pairs. We apply a new method for detecting mutual influence in dynamical systems to a new large-scale data set that records state interactions with high temporal resolution. Doing so, we detect reciprocity between many country pairs in the international system and find that these reciprocating country pairs exhibit qualitatively different cooperative dynamics when compared to nonreciprocating pairs. Consistent with evolutionary theories of cooperation, reciprocating country pairs exhibit higher levels of stable cooperation and are more likely to punish instances of noncooperation. However, countries in reciprocity-based relationships are also quicker to forgive single acts of noncooperation by eventually returning to previous levels of mutual cooperation. By contrast, nonreciprocating pairs are more likely to exploit each other's cooperation via higher rates of defection. Together, these findings provide the strongest evidence to date that reciprocity is a widespread mechanism for achieving international cooperation.
Module for multiphoton high-resolution hyperspectral imaging and spectroscopy
NASA Astrophysics Data System (ADS)
Zeytunyan, Aram; Baldacchini, Tommaso; Zadoyan, Ruben
2018-02-01
We developed a module for dual-output, dual-wavelength lasers that facilitates multiphoton imaging and spectroscopy experiments and enables hyperspectral imaging with spectral resolution up to 5 cm-1. High spectral resolution is achieved by employing spectral focusing. Specifically, two sets of grating pairs are used to control the chirps in each laser beam. In contrast with the approach that uses fixed-length glass rods, grating pairs allow matching the spectral resolution and the linewidths of the Raman lines of interest. To demonstrate the performance of the module, we report the results of spectral focusing CARS and SRS microscopy experiments for various test samples and Raman shifts. The developed module can be used for a variety of multimodal imaging and spectroscopy applications, such as single- and multi-color two-photon fluorescence, second harmonic generation, third harmonic generation, pump-probe, transient absorption, and others.
Németh, Krisztina; Domonkos, Celesztina; Sarnyai, Virág; Szemán, Julianna; Jicsinszky, László; Szente, Lajos; Visy, Júlia
2014-10-01
The resolution power of permethylated 6-monoamino-6-monodeoxy-βCD (PMMABCD) - a single isomer, cationic CD derivative - developed previously for chiral analyses in capillary electrophoresis was further studied here. Dansylated amino acids (Dns-AA) were chosen as amphoteric chiral model compounds. Changes in the resolutions of Dns-AAs by varying pH and selector concentrations were investigated and correlated with their structures and chemical properties (isoelectric point and lipophilicity). Maximal resolutions could be achieved at pH 6 or pH 4. The separations improved with increasing concentration of the selector. Baseline or substantially better resolution for 8 pairs of these Dns-AAs could be achieved. Low CD concentration was enough for the separation of the most apolar Dns-AAs. Chiral discrimination ability of PMMABCD was demonstrated by the separation of an artificial mixture of 8 Dns-AA pairs. Copyright © 2014 Elsevier B.V. All rights reserved.
Whole genome DNA methylation: beyond genes silencing.
Tirado-Magallanes, Roberto; Rebbani, Khadija; Lim, Ricky; Pradhan, Sriharsa; Benoukraf, Touati
2017-01-17
The combination of DNA bisulfite treatment with high-throughput sequencing technologies has enabled investigation of genome-wide DNA methylation at near base pair level resolution, far beyond that of the kilobase-long canonical CpG islands that initially revealed the biological relevance of this covalent DNA modification. The latest high-resolution studies have revealed a role for very punctual DNA methylation in chromatin plasticity, gene regulation and splicing. Here, we aim to outline the major biological consequences of DNA methylation recently discovered. We also discuss the necessity of tuning DNA methylation resolution into an adequate scale to ease the integration of the methylome information with other chromatin features and transcription events such as gene expression, nucleosome positioning, transcription factors binding dynamic, gene splicing and genomic imprinting. Finally, our review sheds light on DNA methylation heterogeneity in cell population and the different approaches used for its assessment, including the contribution of single cell DNA analysis technology.
Whole genome DNA methylation: beyond genes silencing
Tirado-Magallanes, Roberto; Rebbani, Khadija; Lim, Ricky; Pradhan, Sriharsa; Benoukraf, Touati
2017-01-01
The combination of DNA bisulfite treatment with high-throughput sequencing technologies has enabled investigation of genome-wide DNA methylation at near base pair level resolution, far beyond that of the kilobase-long canonical CpG islands that initially revealed the biological relevance of this covalent DNA modification. The latest high-resolution studies have revealed a role for very punctual DNA methylation in chromatin plasticity, gene regulation and splicing. Here, we aim to outline the major biological consequences of DNA methylation recently discovered. We also discuss the necessity of tuning DNA methylation resolution into an adequate scale to ease the integration of the methylome information with other chromatin features and transcription events such as gene expression, nucleosome positioning, transcription factors binding dynamic, gene splicing and genomic imprinting. Finally, our review sheds light on DNA methylation heterogeneity in cell population and the different approaches used for its assessment, including the contribution of single cell DNA analysis technology. PMID:27895318
Cotton, R G; Rodrigues, N R; Campbell, R D
1988-01-01
The chemical reactivity of thymine (T), when mismatched with the bases cytosine, guanine, and thymine, and of cytosine (C), when mismatched with thymine, adenine, and cytosine, has been examined. Heteroduplex DNAs containing such mismatched base pairs were first incubated with osmium tetroxide (for T and C mismatches) or hydroxylamine (for C mismatches) and then incubated with piperidine to cleave the DNA at the modified mismatched base. This cleavage was studied with an internally labeled strand containing the mismatched T or C, such that DNA cleavage and thus reactivity could be detected by gel electrophoresis. Cleavage at a total of 13 T and 21 C mismatches isolated (by at least three properly paired bases on both sides) single-base-pair mismatches was identified. All T or C mismatches studied were cleaved. By using end-labeled DNA probes containing T or C single-base-pair mismatches and conditions for limited cleavage, we were able to show that cleavage was at the base predicted by sequence analysis and that mismatches in a length of DNA could be readily detected by such an approach. This procedure may enable detection of all single-base-pair mismatches by use of sense and antisense probes and thus may be used to identify the mutated base and its position in a heteroduplex. Images PMID:3260032
Weston, Kenneth D; Dyck, Martina; Tinnefeld, Philip; Müller, Christian; Herten, Dirk P; Sauer, Markus
2002-10-15
A simple new approach is described and demonstrated for measuring the number of independent emitters along with the fluorescence intensity, lifetime, and emission wavelength for trajectories and images of single molecules and multichromophoric systems using a single PC plug-in card for time-correlated single-photon counting. The number of independent emitters present in the detection volume can be determined using the interphoton times in a manner similar to classical antibunching experiments. In contrast to traditional coincidence analysis based on pulsed laser excitation and direct measurement of coincident photon pairs using a time-to-amplitude converter, the interphoton distances are retrieved afterward by recording the absolute arrival time of each photon with nanosecond time resolution on two spectrally separated detectors. Intensity changes that result from fluctuations of a photophysical parameter can be distinguished from fluctuations due to changes in the number of emitters (e.g., photobleaching) in single chromophore and multichromophore intensity trajectories. This is the first report to demonstrate imaging with contrast based on the number of independently emitting species within the detection volume.
Mapping the zebrafish brain methylome using reduced representation bisulfite sequencing
Chatterjee, Aniruddha; Ozaki, Yuichi; Stockwell, Peter A; Horsfield, Julia A; Morison, Ian M; Nakagawa, Shinichi
2013-01-01
Reduced representation bisulfite sequencing (RRBS) has been used to profile DNA methylation patterns in mammalian genomes such as human, mouse and rat. The methylome of the zebrafish, an important animal model, has not yet been characterized at base-pair resolution using RRBS. Therefore, we evaluated the technique of RRBS in this model organism by generating four single-nucleotide resolution DNA methylomes of adult zebrafish brain. We performed several simulations to show the distribution of fragments and enrichment of CpGs in different in silico reduced representation genomes of zebrafish. Four RRBS brain libraries generated 98 million sequenced reads and had higher frequencies of multiple mapping than equivalent human RRBS libraries. The zebrafish methylome indicates there is higher global DNA methylation in the zebrafish genome compared with its equivalent human methylome. This observation was confirmed by RRBS of zebrafish liver. High coverage CpG dinucleotides are enriched in CpG island shores more than in the CpG island core. We found that 45% of the mapped CpGs reside in gene bodies, and 7% in gene promoters. This analysis provides a roadmap for generating reproducible base-pair level methylomes for zebrafish using RRBS and our results provide the first evidence that RRBS is a suitable technique for global methylation analysis in zebrafish. PMID:23975027
Validating silicon polytrodes with paired juxtacellular recordings: method and dataset
Lopes, Gonçalo; Frazão, João; Nogueira, Joana; Lacerda, Pedro; Baião, Pedro; Aarts, Arno; Andrei, Alexandru; Musa, Silke; Fortunato, Elvira; Barquinha, Pedro; Kampff, Adam R.
2016-01-01
Cross-validating new methods for recording neural activity is necessary to accurately interpret and compare the signals they measure. Here we describe a procedure for precisely aligning two probes for in vivo “paired-recordings” such that the spiking activity of a single neuron is monitored with both a dense extracellular silicon polytrode and a juxtacellular micropipette. Our new method allows for efficient, reliable, and automated guidance of both probes to the same neural structure with micrometer resolution. We also describe a new dataset of paired-recordings, which is available online. We propose that our novel targeting system, and ever expanding cross-validation dataset, will be vital to the development of new algorithms for automatically detecting/sorting single-units, characterizing new electrode materials/designs, and resolving nagging questions regarding the origin and nature of extracellular neural signals. PMID:27306671
Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore
NASA Technical Reports Server (NTRS)
Vercoutere, Wenonah; DeGuzman, Veronica
2003-01-01
The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.
Spatial, Temporal and Spectral Satellite Image Fusion via Sparse Representation
NASA Astrophysics Data System (ADS)
Song, Huihui
Remote sensing provides good measurements for monitoring and further analyzing the climate change, dynamics of ecosystem, and human activities in global or regional scales. Over the past two decades, the number of launched satellite sensors has been increasing with the development of aerospace technologies and the growing requirements on remote sensing data in a vast amount of application fields. However, a key technological challenge confronting these sensors is that they tradeoff between spatial resolution and other properties, including temporal resolution, spectral resolution, swath width, etc., due to the limitations of hardware technology and budget constraints. To increase the spatial resolution of data with other good properties, one possible cost-effective solution is to explore data integration methods that can fuse multi-resolution data from multiple sensors, thereby enhancing the application capabilities of available remote sensing data. In this thesis, we propose to fuse the spatial resolution with temporal resolution and spectral resolution, respectively, based on sparse representation theory. Taking the study case of Landsat ETM+ (with spatial resolution of 30m and temporal resolution of 16 days) and MODIS (with spatial resolution of 250m ~ 1km and daily temporal resolution) reflectance, we propose two spatial-temporal fusion methods to combine the fine spatial information of Landsat image and the daily temporal resolution of MODIS image. Motivated by that the images from these two sensors are comparable on corresponding bands, we propose to link their spatial information on available Landsat- MODIS image pair (captured on prior date) and then predict the Landsat image from the MODIS counterpart on prediction date. To well-learn the spatial details from the prior images, we use a redundant dictionary to extract the basic representation atoms for both Landsat and MODIS images based on sparse representation. Under the scenario of two prior Landsat-MODIS image pairs, we build the corresponding relationship between the difference images of MODIS and ETM+ by training a low- and high-resolution dictionary pair from the given prior image pairs. In the second scenario, i.e., only one Landsat- MODIS image pair being available, we directly correlate MODIS and ETM+ data through an image degradation model. Then, the fusion stage is achieved by super-resolving the MODIS image combining the high-pass modulation in a two-layer fusion framework. Remarkably, the proposed spatial-temporal fusion methods form a unified framework for blending remote sensing images with phenology change or land-cover-type change. Based on the proposed spatial-temporal fusion models, we propose to monitor the land use/land cover changes in Shenzhen, China. As a fast-growing city, Shenzhen faces the problem of detecting the rapid changes for both rational city planning and sustainable development. However, the cloudy and rainy weather in region Shenzhen located makes the capturing circle of high-quality satellite images longer than their normal revisit periods. Spatial-temporal fusion methods are capable to tackle this problem by improving the spatial resolution of images with coarse spatial resolution but frequent temporal coverage, thereby making the detection of rapid changes possible. On two Landsat-MODIS datasets with annual and monthly changes, respectively, we apply the proposed spatial-temporal fusion methods to the task of multiple change detection. Afterward, we propose a novel spatial and spectral fusion method for satellite multispectral and hyperspectral (or high-spectral) images based on dictionary-pair learning and sparse non-negative matrix factorization. By combining the spectral information from hyperspectral image, which is characterized by low spatial resolution but high spectral resolution and abbreviated as LSHS, and the spatial information from multispectral image, which is featured by high spatial resolution but low spectral resolution and abbreviated as HSLS, this method aims to generate the fused data with both high spatial and high spectral resolutions. Motivated by the observation that each hyperspectral pixel can be represented by a linear combination of a few endmembers, this method first extracts the spectral bases of LSHS and HSLS images by making full use of the rich spectral information in LSHS data. The spectral bases of these two categories data then formulate a dictionary-pair due to their correspondence in representing each pixel spectra of LSHS data and HSLS data, respectively. Subsequently, the LSHS image is spatially unmixed by representing the HSLS image with respect to the corresponding learned dictionary to derive its representation coefficients. Combining the spectral bases of LSHS data and the representation coefficients of HSLS data, we finally derive the fused data characterized by the spectral resolution of LSHS data and the spatial resolution of HSLS data.
Solis, Armando D
2014-01-01
The most informative probability distribution functions (PDFs) describing the Ramachandran phi-psi dihedral angle pair, a fundamental descriptor of backbone conformation of protein molecules, are derived from high-resolution X-ray crystal structures using an information-theoretic approach. The Information Maximization Device (IMD) is established, based on fundamental information-theoretic concepts, and then applied specifically to derive highly resolved phi-psi maps for all 20 single amino acid and all 8000 triplet sequences at an optimal resolution determined by the volume of current data. The paper shows that utilizing the latent information contained in all viable high-resolution crystal structures found in the Protein Data Bank (PDB), totaling more than 77,000 chains, permits the derivation of a large number of optimized sequence-dependent PDFs. This work demonstrates the effectiveness of the IMD and the superiority of the resulting PDFs by extensive fold recognition experiments and rigorous comparisons with previously published triplet PDFs. Because it automatically optimizes PDFs, IMD results in improved performance of knowledge-based potentials, which rely on such PDFs. Furthermore, it provides an easy computational recipe for empirically deriving other kinds of sequence-dependent structural PDFs with greater detail and precision. The high-resolution phi-psi maps derived in this work are available for download.
Energy barriers and rates of tautomeric transitions in DNA bases: ab initio quantum chemical study.
Basu, Soumalee; Majumdar, Rabi; Das, Gourab K; Bhattacharyya, Dhananjay
2005-12-01
Tautomeric transitions of DNA bases are proton transfer reactions, which are important in biology. These reactions are involved in spontaneous point mutations of the genetic material. In the present study, intrinsic reaction coordinates (IRC) analyses through ab initio quantum chemical calculations have been carried out for the individual DNA bases A, T, G, C and also A:T and G:C base pairs to estimate the kinetic and thermodynamic barriers using MP2/6-31G** method for tautomeric transitions. Relatively higher values of kinetic barriers (about 50-60 kcal/mol) have been observed for the single bases, indicating that tautomeric alterations of isolated single bases are quite unlikely. On the other hand, relatively lower values of the kinetic barriers (about 20-25 kcal/mol) for the DNA base pairs A:T and G:C clearly suggest that the tautomeric shifts are much more favorable in DNA base pairs than in isolated single bases. The unusual base pairing A':C, T':G, C':A or G':T in the daughter DNA molecule, resulting from a parent DNA molecule with tautomeric shifts, is found to be stable enough to result in a mutation. The transition rate constants for the single DNA bases in addition to the base pairs are also calculated by computing the free energy differences between the transition states and the reactants.
NASA Astrophysics Data System (ADS)
Koh, Eunjung; Song, Ha Jeong; Kwon, Na Young; Kim, Gi Won; Lee, Kwang Ho; Jo, Soyeon; Park, Sujin; Park, Jihyun; Park, Eun Kyeong; Hwang, Seung Yong
2017-06-01
Real time PCR is a standard method for identification of species. One of limitations of the qPCR is that there would be false-positive result due to mismatched hybridization between target sequence and probe depending on the annealing temperature in the PCR condition. As an alternative, fluorescence melting curve analysis (FMCA) could be applied for species identification. FMCA is based on a dual-labeled probe. Even with subtle difference of target sequence, there are visible melting temperature (Tm) shift. One of FMCA applications is distinguishing organisms distributed and consumed globally as popular food ingredients. Their prices are set by species or country of origin. However, counterfeiting or distributing them without any verification procedure are becoming social problems and threatening food safety. Besides distinguishing them in naked eye is very difficult and almost impossible in any processed form. Therefore, it is necessary to identify species in molecular level. In this research three species of squids which have 1-2 base pair differences each are selected as samples since they have the same issue. We designed a probe which perfectly matches with one species and the others mismatches 2 and 1 base pair respectively and labeled with fluorophore and quencher. In an experiment with a single probe, we successfully distinguished them by Tm shift depending on the difference of base pair. By combining FMCA and qPCR chip, smaller-scale assay with higher sensitivity and resolution could be possible, andc furthermore, enabling results analysis with smart phone would realize point-of-care testing (POCT).
An Example-Based Super-Resolution Algorithm for Selfie Images
William, Jino Hans; Venkateswaran, N.; Narayanan, Srinath; Ramachandran, Sandeep
2016-01-01
A selfie is typically a self-portrait captured using the front camera of a smartphone. Most state-of-the-art smartphones are equipped with a high-resolution (HR) rear camera and a low-resolution (LR) front camera. As selfies are captured by front camera with limited pixel resolution, the fine details in it are explicitly missed. This paper aims to improve the resolution of selfies by exploiting the fine details in HR images captured by rear camera using an example-based super-resolution (SR) algorithm. HR images captured by rear camera carry significant fine details and are used as an exemplar to train an optimal matrix-value regression (MVR) operator. The MVR operator serves as an image-pair priori which learns the correspondence between the LR-HR patch-pairs and is effectively used to super-resolve LR selfie images. The proposed MVR algorithm avoids vectorization of image patch-pairs and preserves image-level information during both learning and recovering process. The proposed algorithm is evaluated for its efficiency and effectiveness both qualitatively and quantitatively with other state-of-the-art SR algorithms. The results validate that the proposed algorithm is efficient as it requires less than 3 seconds to super-resolve LR selfie and is effective as it preserves sharp details without introducing any counterfeit fine details. PMID:27064500
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vivian, J. P.; Porter, C.; Wilce, J. A.
2006-11-01
A preparation of replication terminator protein (RTP) of B. subtilis and a 37-base-pair TerI sequence (comprising two binding sites for RTP) has been purified and crystallized. The replication terminator protein (RTP) of Bacillus subtilis binds to specific DNA sequences that halt the progression of the replisome in a polar manner. These terminator complexes flank a defined region of the chromosome into which they allow replication forks to enter but not exit. Forcing the fusion of replication forks in a specific zone is thought to allow the coordination of post-replicative processes. The functional terminator complex comprises two homodimers each of 29more » kDa bound to overlapping binding sites. A preparation of RTP and a 37-base-pair TerI sequence (comprising two binding sites for RTP) has been purified and crystallized. A data set to 3.9 Å resolution with 97.0% completeness and an R{sub sym} of 12% was collected from a single flash-cooled crystal using synchrotron radiation. The diffraction data are consistent with space group P622, with unit-cell parameters a = b = 118.8, c = 142.6 Å.« less
Gries, Jasmin; Schumacher, Dirk; Arand, Julia; Lutsik, Pavlo; Markelova, Maria Rivera; Fichtner, Iduna; Walter, Jörn; Sers, Christine; Tierling, Sascha
2013-01-01
The use of next generation sequencing has expanded our view on whole mammalian methylome patterns. In particular, it provides a genome-wide insight of local DNA methylation diversity at single nucleotide level and enables the examination of single chromosome sequence sections at a sufficient statistical power. We describe a bisulfite-based sequence profiling pipeline, Bi-PROF, which is based on the 454 GS-FLX Titanium technology that allows to obtain up to one million sequence stretches at single base pair resolution without laborious subcloning. To illustrate the performance of the experimental workflow connected to a bioinformatics program pipeline (BiQ Analyzer HT) we present a test analysis set of 68 different epigenetic marker regions (amplicons) in five individual patient-derived xenograft tissue samples of colorectal cancer and one healthy colon epithelium sample as a control. After the 454 GS-FLX Titanium run, sequence read processing and sample decoding, the obtained alignments are quality controlled and statistically evaluated. Comprehensive methylation pattern interpretation (profiling) assessed by analyzing 102-104 sequence reads per amplicon allows an unprecedented deep view on pattern formation and methylation marker heterogeneity in tissues concerned by complex diseases like cancer. PMID:23803588
Validating silicon polytrodes with paired juxtacellular recordings: method and dataset.
Neto, Joana P; Lopes, Gonçalo; Frazão, João; Nogueira, Joana; Lacerda, Pedro; Baião, Pedro; Aarts, Arno; Andrei, Alexandru; Musa, Silke; Fortunato, Elvira; Barquinha, Pedro; Kampff, Adam R
2016-08-01
Cross-validating new methods for recording neural activity is necessary to accurately interpret and compare the signals they measure. Here we describe a procedure for precisely aligning two probes for in vivo "paired-recordings" such that the spiking activity of a single neuron is monitored with both a dense extracellular silicon polytrode and a juxtacellular micropipette. Our new method allows for efficient, reliable, and automated guidance of both probes to the same neural structure with micrometer resolution. We also describe a new dataset of paired-recordings, which is available online. We propose that our novel targeting system, and ever expanding cross-validation dataset, will be vital to the development of new algorithms for automatically detecting/sorting single-units, characterizing new electrode materials/designs, and resolving nagging questions regarding the origin and nature of extracellular neural signals. Copyright © 2016 the American Physiological Society.
Quantum optics with nanowires (Conference Presentation)
NASA Astrophysics Data System (ADS)
Zwiller, Val
2017-02-01
Nanowires offer new opportunities for nanoscale quantum optics; the quantum dot geometry in semiconducting nanowires as well as the material composition and environment can be engineered with unprecedented freedom to improve the light extraction efficiency. Quantum dots in nanowires are shown to be efficient single photon sources, in addition because of the very small fine structure splitting, we demonstrate the generation of entangled pairs of photons from a nanowire. By doping a nanowire and making ohmic contacts on both sides, a nanowire light emitting diode can be obtained with a single quantum dot as the active region. Under forward bias, this will act as an electrically pumped source of single photons. Under reverse bias, an avalanche effect can multiply photocurrent and enables the detection of single photons. Another type of nanowire under study in our group is superconducting nanowires for single photon detection, reaching efficiencies, time resolution and dark counts beyond currently available detectors. We will discuss our first attempts at combining semiconducting nanowire based single photon emitters and superconducting nanowire single photon detectors on a chip to realize integrated quantum circuits.
Super resolution reconstruction of infrared images based on classified dictionary learning
NASA Astrophysics Data System (ADS)
Liu, Fei; Han, Pingli; Wang, Yi; Li, Xuan; Bai, Lu; Shao, Xiaopeng
2018-05-01
Infrared images always suffer from low-resolution problems resulting from limitations of imaging devices. An economical approach to combat this problem involves reconstructing high-resolution images by reasonable methods without updating devices. Inspired by compressed sensing theory, this study presents and demonstrates a Classified Dictionary Learning method to reconstruct high-resolution infrared images. It classifies features of the samples into several reasonable clusters and trained a dictionary pair for each cluster. The optimal pair of dictionaries is chosen for each image reconstruction and therefore, more satisfactory results is achieved without the increase in computational complexity and time cost. Experiments and results demonstrated that it is a viable method for infrared images reconstruction since it improves image resolution and recovers detailed information of targets.
PBOOST: a GPU-based tool for parallel permutation tests in genome-wide association studies.
Yang, Guangyuan; Jiang, Wei; Yang, Qiang; Yu, Weichuan
2015-05-01
The importance of testing associations allowing for interactions has been demonstrated by Marchini et al. (2005). A fast method detecting associations allowing for interactions has been proposed by Wan et al. (2010a). The method is based on likelihood ratio test with the assumption that the statistic follows the χ(2) distribution. Many single nucleotide polymorphism (SNP) pairs with significant associations allowing for interactions have been detected using their method. However, the assumption of χ(2) test requires the expected values in each cell of the contingency table to be at least five. This assumption is violated in some identified SNP pairs. In this case, likelihood ratio test may not be applicable any more. Permutation test is an ideal approach to checking the P-values calculated in likelihood ratio test because of its non-parametric nature. The P-values of SNP pairs having significant associations with disease are always extremely small. Thus, we need a huge number of permutations to achieve correspondingly high resolution for the P-values. In order to investigate whether the P-values from likelihood ratio tests are reliable, a fast permutation tool to accomplish large number of permutations is desirable. We developed a permutation tool named PBOOST. It is based on GPU with highly reliable P-value estimation. By using simulation data, we found that the P-values from likelihood ratio tests will have relative error of >100% when 50% cells in the contingency table have expected count less than five or when there is zero expected count in any of the contingency table cells. In terms of speed, PBOOST completed 10(7) permutations for a single SNP pair from the Wellcome Trust Case Control Consortium (WTCCC) genome data (Wellcome Trust Case Control Consortium, 2007) within 1 min on a single Nvidia Tesla M2090 device, while it took 60 min in a single CPU Intel Xeon E5-2650 to finish the same task. More importantly, when simultaneously testing 256 SNP pairs for 10(7) permutations, our tool took only 5 min, while the CPU program took 10 h. By permuting on a GPU cluster consisting of 40 nodes, we completed 10(12) permutations for all 280 SNP pairs reported with P-values smaller than 1.6 × 10⁻¹² in the WTCCC datasets in 1 week. The source code and sample data are available at http://bioinformatics.ust.hk/PBOOST.zip. gyang@ust.hk; eeyu@ust.hk Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Wide-field microscopy using microcamera arrays
NASA Astrophysics Data System (ADS)
Marks, Daniel L.; Youn, Seo Ho; Son, Hui S.; Kim, Jungsang; Brady, David J.
2013-02-01
A microcamera is a relay lens paired with image sensors. Microcameras are grouped into arrays to relay overlapping views of a single large surface to the sensors to form a continuous synthetic image. The imaged surface may be curved or irregular as each camera may independently be dynamically focused to a different depth. Microcamera arrays are akin to microprocessors in supercomputers in that both join individual processors by an optoelectronic routing fabric to increase capacity and performance. A microcamera may image ten or more megapixels and grouped into an array of several hundred, as has already been demonstrated by the DARPA AWARE Wide-Field program with multiscale gigapixel photography. We adapt gigapixel microcamera array architectures to wide-field microscopy of irregularly shaped surfaces to greatly increase area imaging over 1000 square millimeters at resolutions of 3 microns or better in a single snapshot. The system includes a novel relay design, a sensor electronics package, and a FPGA-based networking fabric. Biomedical applications of this include screening for skin lesions, wide-field and resolution-agile microsurgical imaging, and microscopic cytometry of millions of cells performed in situ.
NASA Technical Reports Server (NTRS)
Vercoutere, W.; Solbrig, A.; DeGuzman, V.; Deamer, D.; Akeson, M.
2003-01-01
We use a biological nano-scale pore to distinguish among individual DNA hairpins that differ by a single site of oxidation or a nick in the sugar-phosphate backbone. In earlier work we showed that the protein ion channel alpha-hemolysin can be used as a detector to distinguish single-stranded from double-stranded DNA, single base pair and single nucleotide differences. This resolution is in part a result of sensitivity to structural changes that influence the molecular dynamics of nucleotides within DNA. The strand cleavage products we examined here included a 5-base-pair (5-bp) hairpin with a 5-prime five-nucleotide overhang, and a complementary five-nucleotide oligomer. These produced predictable shoulder-spike and rapid near-full blockade signatures, respectively. When combined, strand annealing was monitored in real time. The residual current level dropped to a lower discrete level in the shoulder-spike blockade signatures, and the duration lengthened. However, these blockade signatures had a shorter duration than the unmodified l0bp hairpin. To test the pore sensitivity to nucleotide oxidation, we examined a 9-bp hairpin with a terminal 8-oxo-deoxyguanosine (8-oxo-dG), or a penultimate 8-oxo-dG. Each produced blockade signatures that differed from the otherwise identical control 9bp hairpins. This study showed that DNA structure is modified sufficiently by strand cleavage or oxidation damage at a single site to alter in a predictable manner the ionic current blockade signatures produced. This technique improves the ability to assess damage to DNA, and can provide a simple means to help characterize the risks of radiation exposure. It may also provide a method to test radiation protection.
Peña, Victor H.; Fernández, Geysson J.; Gómez-Palacio, Andrés M.; Mejía-Jaramillo, Ana M.; Cantillo, Omar; Triana-Chávez, Omar
2012-01-01
Methods to determine blood-meal sources of hematophagous Triatominae bugs (Chagas disease vectors) are serological or based on PCR employing species-specific primers or heteroduplex analysis, but these are expensive, inaccurate, or problematic when the insect has fed on more than one species. To solve those problems, we developed a technique based on HRM analysis of the mitochondrial gene cytochrome B (Cyt b). This technique recognized 14 species involved in several ecoepidemiological cycles of the transmission of Trypanosoma cruzi and it was suitable with DNA extracted from intestinal content and feces 30 days after feeding, revealing a resolution power that can display mixed feedings. Field samples were analyzed showing blood meal sources corresponding to domestic, peridomiciliary and sylvatic cycles. The technique only requires a single pair of primers that amplify the Cyt b gene in vertebrates and no other standardization, making it quick, easy, relatively inexpensive, and highly accurate. PMID:22389739
A SmallSat constellation mission architecture for a GRACE-type mission design
NASA Astrophysics Data System (ADS)
Deccia, C. M. A.; Nerem, R. S.; Yunck, T.
2017-12-01
The Gravity Recovery and Climate Experiment (GRACE) launched in 2002 and has been providing invaluable information of Earth's time-varying gravity field and GRACE-FO will continue this time series. For this work, we focus on architectures of future post-GRACE-FO like missions. Single pairs of satellites like GRACE and GRACE-FO are inherently limited in their spatio-temporal coverage. Full global coverage for a single pair can take up to 30 days for spatial resolutions of a few hundred kilometers, thus a single satellite pair is unable to observe sub-monthly signals in the Earth's time varying gravity field (e.g. hydrologic signals, etc.). Small satellite systems are becoming increasingly affordable and will soon allow a constellation of GRACE-type satellites to be deployed, with the capability to range between multiple satellites. Here, using simulation studies, we investigate the performance of such a constellation for different numbers of satellites (N) and different orbital configurations, in order to understand the improved performance that might be gained from such future mission architectures.
NASA Astrophysics Data System (ADS)
Filipenko, Mykhaylo; Gleixner, Thomas; Anton, Gisela; Durst, Jürgen; Michel, Thilo
2013-04-01
Many different experiments are being developed to explore the existence of the neutrinoless double beta decay (0 νββ) since it would imply fundamental consequences for particle physics. In this work we present results on the evaluation of Timepix detectors with cadmium-telluride sensor material to search for 0 νββ in 116Cd. This work was carried out with the COBRA collaboration and the Medipix collaboration. Due to the relatively small pixel dimension of 110×110×1000 μm3 the energy deposited by particles typically extends over several detector pixels leading to a track in the pixel matrix. We investigated the separation power regarding different event-types like α-particles, atmospheric muons, single electrons and electron-positron pairs produced at a single vertex. We achieved excellent classification power for α-particles and muons. In addition, we achieved good separation power between single electron and electron-positron pair production events. These separation abilities indicate a very good background reduction for the 0 νββ search. Further, in order to distinguish between 2 νββ and 0 νββ, the energy resolution is of particular importance. We carried out simulations which demonstrate that an energy resolution of 0.43 % is achievable at the Q-value for 0 νββ of 116Cd at 2.814 MeV. We measured an energy resolution of 1.6 % at a nominal energy of 1589 keV for electron-positron tracks which is about two times worse that predicted by our simulations. This deviation is probably due to the problem of detector calibration at energies above 122 keV which is discussed in this paper as well.
Tracking quasi-stationary flow of weak fluorescent signals by adaptive multi-frame correlation.
Ji, L; Danuser, G
2005-12-01
We have developed a novel cross-correlation technique to probe quasi-stationary flow of fluorescent signals in live cells at a spatial resolution that is close to single particle tracking. By correlating image blocks between pairs of consecutive frames and integrating their correlation scores over multiple frame pairs, uncertainty in identifying a globally significant maximum in the correlation score function has been greatly reduced as compared with conventional correlation-based tracking using the signal of only two consecutive frames. This approach proves robust and very effective in analysing images with a weak, noise-perturbed signal contrast where texture characteristics cannot be matched between only a pair of frames. It can also be applied to images that lack prominent features that could be utilized for particle tracking or feature-based template matching. Furthermore, owing to the integration of correlation scores over multiple frames, the method can handle signals with substantial frame-to-frame intensity variation where conventional correlation-based tracking fails. We tested the performance of the method by tracking polymer flow in actin and microtubule cytoskeleton structures labelled at various fluorophore densities providing imagery with a broad range of signal modulation and noise. In applications to fluorescent speckle microscopy (FSM), where the fluorophore density is sufficiently low to reveal patterns of discrete fluorescent marks referred to as speckles, we combined the multi-frame correlation approach proposed above with particle tracking. This hybrid approach allowed us to follow single speckles robustly in areas of high speckle density and fast flow, where previously published FSM analysis methods were unsuccessful. Thus, we can now probe cytoskeleton polymer dynamics in living cells at an entirely new level of complexity and with unprecedented detail.
Observing Holliday junction branch migration one step at a time
NASA Astrophysics Data System (ADS)
Ha, Taekjip
2004-03-01
During genetic recombination, two homologous DNA molecules undergo strand exchange to form a four-way DNA (Holliday) junction and the recognition and processing of this species by branch migration and junction resolving enzymes determine the outcome. We have used single molecule fluorescence techniques to study two intrinsic structural dynamics of the Holliday junction, stacking conformer transitions and spontaneous branch migration. Our studies show that the dynamics of branch migration, resolved with one base pair resolution, is determined by the stability of conformers which in turn depends on the local DNA sequences. Therefore, the energy landscape of Holliday junction branch migation is not uniform, but is rugged.
A high resolution electron microscopy investigation of curvature in carbon nanotubes
NASA Astrophysics Data System (ADS)
Weldon, D. N.; Blau, W. J.; Zandbergen, H. W.
1995-07-01
Evidence for heptagon inclusion in multi-walled carbon nanotubes was sought in arc-produced carbon deposits. Transmission electron microscopy revealed many curved nanotubes although their relative abundance was low. Close examination of the micrographs in the regions of expected heptagon inclusion shows that the curvature is accomplished by folding or fracture of the lattice planes. This observed phenomenon contradicts the theoretical modelling studies which predict stable structures with negative curvature accomplished by heptagon/pentagon pairs. A possible explanation for curvature in single-walled tubes is presented based on a molecular mechanics geometry optimisation study of spa inclusion in a graphite sheet.
Applications of High-Q Microresonators in Cavity Optomechanics and Nonlinear Photonics
NASA Astrophysics Data System (ADS)
Jiang, Wei C.
Optical microresonators confining light to small volumes are indispensable for a great variety of studies and applications. This thesis is devoted to a study of cavity optomechanical and nonlinear optical phenomena in high-Q microresonators with different materials and structures. Based on that, it proposes and demonstrates several novel schemes and device platforms that exhibit great potential for various applications ranging from frequency metrology and quantum photonics, to information processing and sensing. The thesis starts with a demonstration of a high-frequency (above 1 GHz) regenerative optomechanical oscillator based on a 2-mum-radius high-Q silicon microdisk resonator in the silicon-on-insulator platform with an ultra-low threshold pump power at room temperature and atmosphere. It then continues to explore the cavity optomechanics in single-crystal lithium niobate. A compact lithium niobate microdisk optomechanical resonator with high optical and mechanical qualities, large optomechanical coupling, and high mechanical frequency is achieved, enabling the demonstration of regenerative oscillation in the ambience. Meanwhile, I propose and investigate a novel approach for single molecule detection that utilizes the optical spring effect in a high-Q coherent optomechanical oscillator to dramatically enhance the sensing resolution by orders of magnitude compared with conventional resonator-based approaches. In particular, a high-Q silica microsphere is employed to experimentally demonstrate the detection of single Bovine Serum Albumin proteins with a molecular weight of 66 kDalton at a signal-to-noise ratio of 16.8. On the other hand, the thesis focuses on the theoretical and experimental investigation of the generation of high-purity bright photon pairs in a silicon microdisk based on the cavity enhanced four-wave mixing. The device is able to produce multiple photon pairs at different wavelengths in the telecom band with a high spectral brightness of 6.24 x 107 pairs/s/mW 2/GHz and photon-pair correlation with a coincidence-to-accidental ratio of 1386+/-278 while pumped with a continuous-wave laser. Finally, an intriguing approach is proposed for dispersion dynamic tuning and micro-engineering, by taking advantage of the optical forces in nano-optomechanical structures. The proposed approach exhibits great potential for broad applications in dispersion-sensitive processes, which not only offer a new root towards versatile tunable nonlinear photonics, but may also open up a great avenue towards a new regime of nonlinear dynamics coupling between nonlinear optical and optomechanical effects.
Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark
2003-01-01
Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251
Direct Characterization of Ultrafast Energy-Time Entangled Photon Pairs.
MacLean, Jean-Philippe W; Donohue, John M; Resch, Kevin J
2018-02-02
Energy-time entangled photons are critical in many quantum optical phenomena and have emerged as important elements in quantum information protocols. Entanglement in this degree of freedom often manifests itself on ultrafast time scales, making it very difficult to detect, whether one employs direct or interferometric techniques, as photon-counting detectors have insufficient time resolution. Here, we implement ultrafast photon counters based on nonlinear interactions and strong femtosecond laser pulses to probe energy-time entanglement in this important regime. Using this technique and single-photon spectrometers, we characterize all the spectral and temporal correlations of two entangled photons with femtosecond resolution. This enables the witnessing of energy-time entanglement using uncertainty relations and the direct observation of nonlocal dispersion cancellation on ultrafast time scales. These techniques are essential to understand and control the energy-time degree of freedom of light for ultrafast quantum optics.
iSeq: Web-Based RNA-seq Data Analysis and Visualization.
Zhang, Chao; Fan, Caoqi; Gan, Jingbo; Zhu, Ping; Kong, Lei; Li, Cheng
2018-01-01
Transcriptome sequencing (RNA-seq) is becoming a standard experimental methodology for genome-wide characterization and quantification of transcripts at single base-pair resolution. However, downstream analysis of massive amount of sequencing data can be prohibitively technical for wet-lab researchers. A functionally integrated and user-friendly platform is required to meet this demand. Here, we present iSeq, an R-based Web server, for RNA-seq data analysis and visualization. iSeq is a streamlined Web-based R application under the Shiny framework, featuring a simple user interface and multiple data analysis modules. Users without programming and statistical skills can analyze their RNA-seq data and construct publication-level graphs through a standardized yet customizable analytical pipeline. iSeq is accessible via Web browsers on any operating system at http://iseq.cbi.pku.edu.cn .
Gamboa, E. J.; Bachmann, B.; Kraus, D.; ...
2016-08-01
The recent development of high-repetition rate x-ray free electron lasers (FEL), makes it possible to perform x-ray scattering and emission spectroscopy measurements from thin foils or gasses heated to high-energy density conditions by integrating over many experimental shots. Since the expected signal may be weaker than the typical CCD readout noise over the region-of-interest, it is critical to the success of this approach to use a detector with high-energy resolution so that single x-ray photons may be isolated. We describe a dual channel x-ray spectrometer developed for the Atomic and Molecular Optics endstation at the Linac Coherent Light Source (LCLS)more » for x-ray spectroscopy near the K-edge of aluminum. The spectrometer is based on a pair of curved PET (002) crystals coupled to a single pnCCD detector which simultaneously measures x-ray scattering and emission in the forward and backward directions. Furthermore, the signals from single x-ray photons are accumulated permitting continuous single-shot acquisition at 120 Hz.« less
A micromachined membrane-based active probe for biomolecular mechanics measurement
NASA Astrophysics Data System (ADS)
Torun, H.; Sutanto, J.; Sarangapani, K. K.; Joseph, P.; Degertekin, F. L.; Zhu, C.
2007-04-01
A novel micromachined, membrane-based probe has been developed and fabricated as assays to enable parallel measurements. Each probe in the array can be individually actuated, and the membrane displacement can be measured with high resolution using an integrated diffraction-based optical interferometer. To illustrate its application in single-molecule mechanics experiments, this membrane probe was used to measure unbinding forces between L-selectin reconstituted in a polymer-cushioned lipid bilayer on the probe membrane and an antibody adsorbed on an atomic force microscope cantilever. Piconewton range forces between single pairs of interacting molecules were measured from the cantilever bending while using the membrane probe as an actuator. The integrated diffraction-based optical interferometer of the probe was demonstrated to have <10 fm Hz-1/2 noise floor for frequencies as low as 3 Hz with a differential readout scheme. With soft probe membranes, this low noise level would be suitable for direct force measurements without the need for a cantilever. Furthermore, the probe membranes were shown to have 0.5 µm actuation range with a flat response up to 100 kHz, enabling measurements at fast speeds.
Richter, Craig G; Thompson, William H; Bosman, Conrado A; Fries, Pascal
2015-07-01
The quantification of covariance between neuronal activities (functional connectivity) requires the observation of correlated changes and therefore multiple observations. The strength of such neuronal correlations may itself undergo moment-by-moment fluctuations, which might e.g. lead to fluctuations in single-trial metrics such as reaction time (RT), or may co-fluctuate with the correlation between activity in other brain areas. Yet, quantifying the relation between moment-by-moment co-fluctuations in neuronal correlations is precluded by the fact that neuronal correlations are not defined per single observation. The proposed solution quantifies this relation by first calculating neuronal correlations for all leave-one-out subsamples (i.e. the jackknife replications of all observations) and then correlating these values. Because the correlation is calculated between jackknife replications, we address this approach as jackknife correlation (JC). First, we demonstrate the equivalence of JC to conventional correlation for simulated paired data that are defined per observation and therefore allow the calculation of conventional correlation. While the JC recovers the conventional correlation precisely, alternative approaches, like sorting-and-binning, result in detrimental effects of the analysis parameters. We then explore the case of relating two spectral correlation metrics, like coherence, that require multiple observation epochs, where the only viable alternative analysis approaches are based on some form of epoch subdivision, which results in reduced spectral resolution and poor spectral estimators. We show that JC outperforms these approaches, particularly for short epoch lengths, without sacrificing any spectral resolution. Finally, we note that the JC can be applied to relate fluctuations in any smooth metric that is not defined on single observations. Copyright © 2015. Published by Elsevier Inc.
Universal quantum gates for Single Cooper Pair Box based quantum computing
NASA Technical Reports Server (NTRS)
Echternach, P.; Williams, C. P.; Dultz, S. C.; Braunstein, S.; Dowling, J. P.
2000-01-01
We describe a method for achieving arbitrary 1-qubit gates and controlled-NOT gates within the context of the Single Cooper Pair Box (SCB) approach to quantum computing. Such gates are sufficient to support universal quantum computation.
Understanding the kinetic mechanism of RNA single base pair formation
Xu, Xiaojun; Yu, Tao; Chen, Shi-Jie
2016-01-01
RNA functions are intrinsically tied to folding kinetics. The most elementary step in RNA folding is the closing and opening of a base pair. Understanding this elementary rate process is the basis for RNA folding kinetics studies. Previous studies mostly focused on the unfolding of base pairs. Here, based on a hybrid approach, we investigate the folding process at level of single base pairing/stacking. The study, which integrates molecular dynamics simulation, kinetic Monte Carlo simulation, and master equation methods, uncovers two alternative dominant pathways: Starting from the unfolded state, the nucleotide backbone first folds to the native conformation, followed by subsequent adjustment of the base conformation. During the base conformational rearrangement, the backbone either retains the native conformation or switches to nonnative conformations in order to lower the kinetic barrier for base rearrangement. The method enables quantification of kinetic partitioning among the different pathways. Moreover, the simulation reveals several intriguing ion binding/dissociation signatures for the conformational changes. Our approach may be useful for developing a base pair opening/closing rate model. PMID:26699466
The Effect of Illumination on Stereo DTM Quality: Simulations in Support of Europa Exploration
NASA Astrophysics Data System (ADS)
Kirk, R. L.; Howington-Kraus, E.; Hare, T. M.; Jorda, L.
2016-06-01
We have investigated how the quality of stereoscopically measured topography degrades with varying illumination, in particular the ranges of incidence angles and illumination differences over which useful digital topographic models (DTMs) can be recovered. Our approach is to make high-fidelity simulated image pairs of known topography and compare DTMs from stereoanalysis of these images with the input data. Well-known rules of thumb for horizontal resolution (>3-5 pixels) and matching precision (~0.2-0.3 pixels) are generally confirmed, but the best achievable resolution at high incidence angles is ~15 pixels, probably as a result of smoothing internal to the matching algorithm. Single-pass stereo imaging of Europa is likely to yield DTMs of consistent (optimal) quality for all incidence angles ≤85°, and certainly for incidence angles between 40° and 85°. Simulations with pairs of images in which the illumination is not consistent support the utility of shadow tip distance (STD) as a measure of illumination difference, but also suggest new and simpler criteria for evaluating the suitability of stereopairs based on illumination geometry. Our study was motivated by the needs of a mission to Europa, but the approach and (to first order) the results described here are relevant to a wide range of planetary investigations.
[Can the local energy minimization refine the PDB structures of different resolution universally?].
Godzi, M G; Gromova, A P; Oferkin, I V; Mironov, P V
2009-01-01
The local energy minimization was statistically validated as the refinement strategy for PDB structure pairs of different resolution. Thirteen pairs of structures with the only difference in resolution were extracted from PDB, and the structures of 11 identical proteins obtained by different X-ray diffraction techniques were represented. The distribution of RMSD value was calculated for these pairs before and after the local energy minimization of each structure. The MMFF94 field was used for energy calculations, and the quasi-Newton method was used for local energy minimization. By comparison of these two RMSD distributions, the local energy minimization was proved to statistically increase the structural differences in pairs so that it cannot be used for refinement purposes. To explore the prospects of complex refinement strategies based on energy minimization, randomized structures were obtained by moving the initial PDB structures as far as the minimized structures had been moved in a multidimensional space of atomic coordinates. For these randomized structures, the RMSD distribution was calculated and compared with that for minimized structures. The significant differences in their mean values proved the energy surface of the protein to have only few minima near the conformations of different resolution obtained by X-ray diffraction for PDB. Some other results obtained by exploring the energy surface near these conformations are also presented. These results are expected to be very useful for the development of new protein refinement strategies based on energy minimization.
Effect of proton transfer on the electronic coupling in DNA
NASA Astrophysics Data System (ADS)
Rak, Janusz; Makowska, Joanna; Voityuk, Alexander A.
2006-06-01
The effects of single and double proton transfer within Watson-Crick base pairs on donor-acceptor electronic couplings, Vda, in DNA are studied on the bases of quantum chemical calculations. Four dimers [AT,AT], [GC,GC], [GC,AT] and [GC,TA)] are considered. Three techniques - the generalized Mulliken-Hush scheme, the fragment charge method and the diabatic states method - are employed to estimate Vda for hole transfer between base pairs. We show that both single- and double proton transfer (PT) reactions may substantially affect the electronic coupling in DNA. The electronic coupling in [AT,AT] is predicted to be most sensitive to PT. Single PT within the first base pair in the dimer leads to increase in the hole transfer efficiency by a factor of 4, while proton transfer within the second pair should substantially, by 2.7 times, decrease the rate of charge transfer. Thus, directional asymmetry of the PT effects on the electronic coupling is predicted. The changes in the Vda matrix elements correlate with the topological properties of orbitals of donor and acceptor and can be qualitatively rationalized in terms of resonance structures of donor and acceptor. Atomic pair contributions to the Vda matrix elements are also analyzed.
Stochastic parameterization of shallow cumulus convection estimated from high-resolution model data
NASA Astrophysics Data System (ADS)
Dorrestijn, Jesse; Crommelin, Daan T.; Siebesma, A. Pier.; Jonker, Harm J. J.
2013-02-01
In this paper, we report on the development of a methodology for stochastic parameterization of convective transport by shallow cumulus convection in weather and climate models. We construct a parameterization based on Large-Eddy Simulation (LES) data. These simulations resolve the turbulent fluxes of heat and moisture and are based on a typical case of non-precipitating shallow cumulus convection above sea in the trade-wind region. Using clustering, we determine a finite number of turbulent flux pairs for heat and moisture that are representative for the pairs of flux profiles observed in these simulations. In the stochastic parameterization scheme proposed here, the convection scheme jumps randomly between these pre-computed pairs of turbulent flux profiles. The transition probabilities are estimated from the LES data, and they are conditioned on the resolved-scale state in the model column. Hence, the stochastic parameterization is formulated as a data-inferred conditional Markov chain (CMC), where each state of the Markov chain corresponds to a pair of turbulent heat and moisture fluxes. The CMC parameterization is designed to emulate, in a statistical sense, the convective behaviour observed in the LES data. The CMC is tested in single-column model (SCM) experiments. The SCM is able to reproduce the ensemble spread of the temperature and humidity that was observed in the LES data. Furthermore, there is a good similarity between time series of the fractions of the discretized fluxes produced by SCM and observed in LES.
NASA Astrophysics Data System (ADS)
Siregar, V. P.; Agus, S. B.; Subarno, T.; Prabowo, N. W.
2018-05-01
The availability of satellite imagery with a variety of spatial resolution, both free access and commercial become as an option in utilizing the remote sensing technology. Variability of the water column is one of the factors affecting the interpretation results when mapping marine shallow waters. This study aimed to evaluate the influence of water column correction (depth-invariant index) on the accuracy of shallow water habitat classification results using OBIA. This study was conducted in North of Kepulauan Seribu, precisely in Harapan Island and its surrounding areas. Habitat class schemes were based on field observations, which were then used to build habitat classes on satellite imagery. The water column correction was applied to the three pairs of SPOT-7 multispectral bands, which were subsequently used in object-based classification. Satellite image classification was performed with four different approaches, namely (i) using DII transformed bands with single pair band input (B1B2), (ii) multi pairs bands (B1B2, B1B3, and B2B3), (iii) combination of multi pairs band and initial bands, and (iv) only using initial bands. The accuracy test results of the four inputs show the values of Overall Accuracy and Kappa Statistics, respectively 55.84 and 0.48; 68.53 and 0.64; 78.68 and 0.76; 77.66 and 0.74. It shows that the best results when using DII and initial band combination for shallow water benthic classification in this study site.
Tang, Yunqing; Dai, Luru; Zhang, Xiaoming; Li, Junbai; Hendriks, Johnny; Fan, Xiaoming; Gruteser, Nadine; Meisenberg, Annika; Baumann, Arnd; Katranidis, Alexandros; Gensch, Thomas
2015-01-01
Single molecule localization based super-resolution fluorescence microscopy offers significantly higher spatial resolution than predicted by Abbe’s resolution limit for far field optical microscopy. Such super-resolution images are reconstructed from wide-field or total internal reflection single molecule fluorescence recordings. Discrimination between emission of single fluorescent molecules and background noise fluctuations remains a great challenge in current data analysis. Here we present a real-time, and robust single molecule identification and localization algorithm, SNSMIL (Shot Noise based Single Molecule Identification and Localization). This algorithm is based on the intrinsic nature of noise, i.e., its Poisson or shot noise characteristics and a new identification criterion, QSNSMIL, is defined. SNSMIL improves the identification accuracy of single fluorescent molecules in experimental or simulated datasets with high and inhomogeneous background. The implementation of SNSMIL relies on a graphics processing unit (GPU), making real-time analysis feasible as shown for real experimental and simulated datasets. PMID:26098742
FANTOM5 CAGE profiles of human and mouse samples.
Noguchi, Shuhei; Arakawa, Takahiro; Fukuda, Shiro; Furuno, Masaaki; Hasegawa, Akira; Hori, Fumi; Ishikawa-Kato, Sachi; Kaida, Kaoru; Kaiho, Ai; Kanamori-Katayama, Mutsumi; Kawashima, Tsugumi; Kojima, Miki; Kubosaki, Atsutaka; Manabe, Ri-Ichiroh; Murata, Mitsuyoshi; Nagao-Sato, Sayaka; Nakazato, Kenichi; Ninomiya, Noriko; Nishiyori-Sueki, Hiromi; Noma, Shohei; Saijyo, Eri; Saka, Akiko; Sakai, Mizuho; Simon, Christophe; Suzuki, Naoko; Tagami, Michihira; Watanabe, Shoko; Yoshida, Shigehiro; Arner, Peter; Axton, Richard A; Babina, Magda; Baillie, J Kenneth; Barnett, Timothy C; Beckhouse, Anthony G; Blumenthal, Antje; Bodega, Beatrice; Bonetti, Alessandro; Briggs, James; Brombacher, Frank; Carlisle, Ailsa J; Clevers, Hans C; Davis, Carrie A; Detmar, Michael; Dohi, Taeko; Edge, Albert S B; Edinger, Matthias; Ehrlund, Anna; Ekwall, Karl; Endoh, Mitsuhiro; Enomoto, Hideki; Eslami, Afsaneh; Fagiolini, Michela; Fairbairn, Lynsey; Farach-Carson, Mary C; Faulkner, Geoffrey J; Ferrai, Carmelo; Fisher, Malcolm E; Forrester, Lesley M; Fujita, Rie; Furusawa, Jun-Ichi; Geijtenbeek, Teunis B; Gingeras, Thomas; Goldowitz, Daniel; Guhl, Sven; Guler, Reto; Gustincich, Stefano; Ha, Thomas J; Hamaguchi, Masahide; Hara, Mitsuko; Hasegawa, Yuki; Herlyn, Meenhard; Heutink, Peter; Hitchens, Kelly J; Hume, David A; Ikawa, Tomokatsu; Ishizu, Yuri; Kai, Chieko; Kawamoto, Hiroshi; Kawamura, Yuki I; Kempfle, Judith S; Kenna, Tony J; Kere, Juha; Khachigian, Levon M; Kitamura, Toshio; Klein, Sarah; Klinken, S Peter; Knox, Alan J; Kojima, Soichi; Koseki, Haruhiko; Koyasu, Shigeo; Lee, Weonju; Lennartsson, Andreas; Mackay-Sim, Alan; Mejhert, Niklas; Mizuno, Yosuke; Morikawa, Hiromasa; Morimoto, Mitsuru; Moro, Kazuyo; Morris, Kelly J; Motohashi, Hozumi; Mummery, Christine L; Nakachi, Yutaka; Nakahara, Fumio; Nakamura, Toshiyuki; Nakamura, Yukio; Nozaki, Tadasuke; Ogishima, Soichi; Ohkura, Naganari; Ohno, Hiroshi; Ohshima, Mitsuhiro; Okada-Hatakeyama, Mariko; Okazaki, Yasushi; Orlando, Valerio; Ovchinnikov, Dmitry A; Passier, Robert; Patrikakis, Margaret; Pombo, Ana; Pradhan-Bhatt, Swati; Qin, Xian-Yang; Rehli, Michael; Rizzu, Patrizia; Roy, Sugata; Sajantila, Antti; Sakaguchi, Shimon; Sato, Hiroki; Satoh, Hironori; Savvi, Suzana; Saxena, Alka; Schmidl, Christian; Schneider, Claudio; Schulze-Tanzil, Gundula G; Schwegmann, Anita; Sheng, Guojun; Shin, Jay W; Sugiyama, Daisuke; Sugiyama, Takaaki; Summers, Kim M; Takahashi, Naoko; Takai, Jun; Tanaka, Hiroshi; Tatsukawa, Hideki; Tomoiu, Andru; Toyoda, Hiroo; van de Wetering, Marc; van den Berg, Linda M; Verardo, Roberto; Vijayan, Dipti; Wells, Christine A; Winteringham, Louise N; Wolvetang, Ernst; Yamaguchi, Yoko; Yamamoto, Masayuki; Yanagi-Mizuochi, Chiyo; Yoneda, Misako; Yonekura, Yohei; Zhang, Peter G; Zucchelli, Silvia; Abugessaisa, Imad; Arner, Erik; Harshbarger, Jayson; Kondo, Atsushi; Lassmann, Timo; Lizio, Marina; Sahin, Serkan; Sengstag, Thierry; Severin, Jessica; Shimoji, Hisashi; Suzuki, Masanori; Suzuki, Harukazu; Kawai, Jun; Kondo, Naoto; Itoh, Masayoshi; Daub, Carsten O; Kasukawa, Takeya; Kawaji, Hideya; Carninci, Piero; Forrest, Alistair R R; Hayashizaki, Yoshihide
2017-08-29
In the FANTOM5 project, transcription initiation events across the human and mouse genomes were mapped at a single base-pair resolution and their frequencies were monitored by CAGE (Cap Analysis of Gene Expression) coupled with single-molecule sequencing. Approximately three thousands of samples, consisting of a variety of primary cells, tissues, cell lines, and time series samples during cell activation and development, were subjected to a uniform pipeline of CAGE data production. The analysis pipeline started by measuring RNA extracts to assess their quality, and continued to CAGE library production by using a robotic or a manual workflow, single molecule sequencing, and computational processing to generate frequencies of transcription initiation. Resulting data represents the consequence of transcriptional regulation in each analyzed state of mammalian cells. Non-overlapping peaks over the CAGE profiles, approximately 200,000 and 150,000 peaks for the human and mouse genomes, were identified and annotated to provide precise location of known promoters as well as novel ones, and to quantify their activities.
FANTOM5 CAGE profiles of human and mouse samples
Noguchi, Shuhei; Arakawa, Takahiro; Fukuda, Shiro; Furuno, Masaaki; Hasegawa, Akira; Hori, Fumi; Ishikawa-Kato, Sachi; Kaida, Kaoru; Kaiho, Ai; Kanamori-Katayama, Mutsumi; Kawashima, Tsugumi; Kojima, Miki; Kubosaki, Atsutaka; Manabe, Ri-ichiroh; Murata, Mitsuyoshi; Nagao-Sato, Sayaka; Nakazato, Kenichi; Ninomiya, Noriko; Nishiyori-Sueki, Hiromi; Noma, Shohei; Saijyo, Eri; Saka, Akiko; Sakai, Mizuho; Simon, Christophe; Suzuki, Naoko; Tagami, Michihira; Watanabe, Shoko; Yoshida, Shigehiro; Arner, Peter; Axton, Richard A.; Babina, Magda; Baillie, J. Kenneth; Barnett, Timothy C.; Beckhouse, Anthony G.; Blumenthal, Antje; Bodega, Beatrice; Bonetti, Alessandro; Briggs, James; Brombacher, Frank; Carlisle, Ailsa J.; Clevers, Hans C.; Davis, Carrie A.; Detmar, Michael; Dohi, Taeko; Edge, Albert S.B.; Edinger, Matthias; Ehrlund, Anna; Ekwall, Karl; Endoh, Mitsuhiro; Enomoto, Hideki; Eslami, Afsaneh; Fagiolini, Michela; Fairbairn, Lynsey; Farach-Carson, Mary C.; Faulkner, Geoffrey J.; Ferrai, Carmelo; Fisher, Malcolm E.; Forrester, Lesley M.; Fujita, Rie; Furusawa, Jun-ichi; Geijtenbeek, Teunis B.; Gingeras, Thomas; Goldowitz, Daniel; Guhl, Sven; Guler, Reto; Gustincich, Stefano; Ha, Thomas J.; Hamaguchi, Masahide; Hara, Mitsuko; Hasegawa, Yuki; Herlyn, Meenhard; Heutink, Peter; Hitchens, Kelly J.; Hume, David A.; Ikawa, Tomokatsu; Ishizu, Yuri; Kai, Chieko; Kawamoto, Hiroshi; Kawamura, Yuki I.; Kempfle, Judith S.; Kenna, Tony J.; Kere, Juha; Khachigian, Levon M.; Kitamura, Toshio; Klein, Sarah; Klinken, S. Peter; Knox, Alan J.; Kojima, Soichi; Koseki, Haruhiko; Koyasu, Shigeo; Lee, Weonju; Lennartsson, Andreas; Mackay-sim, Alan; Mejhert, Niklas; Mizuno, Yosuke; Morikawa, Hiromasa; Morimoto, Mitsuru; Moro, Kazuyo; Morris, Kelly J.; Motohashi, Hozumi; Mummery, Christine L.; Nakachi, Yutaka; Nakahara, Fumio; Nakamura, Toshiyuki; Nakamura, Yukio; Nozaki, Tadasuke; Ogishima, Soichi; Ohkura, Naganari; Ohno, Hiroshi; Ohshima, Mitsuhiro; Okada-Hatakeyama, Mariko; Okazaki, Yasushi; Orlando, Valerio; Ovchinnikov, Dmitry A.; Passier, Robert; Patrikakis, Margaret; Pombo, Ana; Pradhan-Bhatt, Swati; Qin, Xian-Yang; Rehli, Michael; Rizzu, Patrizia; Roy, Sugata; Sajantila, Antti; Sakaguchi, Shimon; Sato, Hiroki; Satoh, Hironori; Savvi, Suzana; Saxena, Alka; Schmidl, Christian; Schneider, Claudio; Schulze-Tanzil, Gundula G.; Schwegmann, Anita; Sheng, Guojun; Shin, Jay W.; Sugiyama, Daisuke; Sugiyama, Takaaki; Summers, Kim M.; Takahashi, Naoko; Takai, Jun; Tanaka, Hiroshi; Tatsukawa, Hideki; Tomoiu, Andru; Toyoda, Hiroo; van de Wetering, Marc; van den Berg, Linda M.; Verardo, Roberto; Vijayan, Dipti; Wells, Christine A.; Winteringham, Louise N.; Wolvetang, Ernst; Yamaguchi, Yoko; Yamamoto, Masayuki; Yanagi-Mizuochi, Chiyo; Yoneda, Misako; Yonekura, Yohei; Zhang, Peter G.; Zucchelli, Silvia; Abugessaisa, Imad; Arner, Erik; Harshbarger, Jayson; Kondo, Atsushi; Lassmann, Timo; Lizio, Marina; Sahin, Serkan; Sengstag, Thierry; Severin, Jessica; Shimoji, Hisashi; Suzuki, Masanori; Suzuki, Harukazu; Kawai, Jun; Kondo, Naoto; Itoh, Masayoshi; Daub, Carsten O.; Kasukawa, Takeya; Kawaji, Hideya; Carninci, Piero; Forrest, Alistair R.R.; Hayashizaki, Yoshihide
2017-01-01
In the FANTOM5 project, transcription initiation events across the human and mouse genomes were mapped at a single base-pair resolution and their frequencies were monitored by CAGE (Cap Analysis of Gene Expression) coupled with single-molecule sequencing. Approximately three thousands of samples, consisting of a variety of primary cells, tissues, cell lines, and time series samples during cell activation and development, were subjected to a uniform pipeline of CAGE data production. The analysis pipeline started by measuring RNA extracts to assess their quality, and continued to CAGE library production by using a robotic or a manual workflow, single molecule sequencing, and computational processing to generate frequencies of transcription initiation. Resulting data represents the consequence of transcriptional regulation in each analyzed state of mammalian cells. Non-overlapping peaks over the CAGE profiles, approximately 200,000 and 150,000 peaks for the human and mouse genomes, were identified and annotated to provide precise location of known promoters as well as novel ones, and to quantify their activities. PMID:28850106
2017-01-01
The objective of this study was to standardize the high-resolution melting method for identification and discrimination of Toxoplasma gondii, Sarcocystis spp., Neospora spp., and Cryptosporidium spp. by amplification of 18S ribosomal DNA (rDNA) using a single primer pair. The analyses were performed on individual reactions (containing DNA from a single species of a protozoan), on duplex reactions (containing DNA from two species of protozoa in each reaction), and on a multiplex reaction (containing DNA of four parasites in a single reaction). The proposed method allowed us to identify and discriminate the four species by analyzing the derivative, normalized, and difference melting curves, with high reproducibility among and within the experiments, as demonstrated by low coefficients of variation (less than 2.2% and 2.0%, respectively). This is the first study where this method is used for discrimination of these four species of protozoa in a single reaction. PMID:28346485
Biophysics of Magnetic Orientation: Radical Pairs, Biogenic Magnetite, or both?
NASA Astrophysics Data System (ADS)
Kirschvink, Joe
2011-03-01
Two major biophysical mechanisms for magnetoreception in terrestrial animals, one based on biogenic magnetite and another on radical-pair biochemical reactions, have been the subject of experiment and debate for the past 30 years. The magnetite hypothesis has stood the test of time: biogenic magnetite is synthesized biochemically in Bacteria, Protists, and numerous Animal phyla, as well as in some plants. Chains of single-domain crystals have been detected by clean-lab based SQUID magnetometry in animal tissues in all major phyla, followed by high-resolution TEM in selected model organisms, as well as by electrophysiological studies demonstrating the role of the ophthalmic branch of the trigeminal nerve in the magnetoreceptive process. Pulse-remagnetization - configured to uniquely flip the polarity of single-domain ferromagnets - has dramatic effects on the behavior of many birds, honeybees, mole rats, turtles, and bats, to cite a growing list. Magnetite-containing cells in the vicinity of these neurons in fish are now the subject of intense study by our consortium. The existence of a specialized class of magnetite-containing magnetoreceptor cells in animal tissues is no longer controversial. In contrast, less success has been achieved in gaining experimental support across a range of taxa for the radical-pair hypothesis. Although this mechanism was proposed to explain an early observation that birds would not respond to complete inversion of the magnetic vector, many organisms (even some birds) do indeed respond to the field polarity. We also note that few, if any, of these critical experiments have been done using fully double-blind methods. This is joint work with: M. M. Walker (University of Auckland, New Zealand) and M. Winklhofer (LMU Munich, Germany).
NASA Astrophysics Data System (ADS)
Sirunyan, A. M.; Tumasyan, A.; Adam, W.; Ambrogi, F.; Asilar, E.; Bergauer, T.; Brandstetter, J.; Brondolin, E.; Dragicevic, M.; Erö, J.; Flechl, M.; Friedl, M.; Frühwirth, R.; Ghete, V. M.; Grossmann, J.; Hrubec, J.; Jeitler, M.; König, A.; Krammer, N.; Krätschmer, I.; Liko, D.; Madlener, T.; Mikulec, I.; Pree, E.; Rabady, D.; Rad, N.; Rohringer, H.; Schieck, J.; Schöfbeck, R.; Spanring, M.; Spitzbart, D.; Waltenberger, W.; Wittmann, J.; Wulz, C.-E.; Zarucki, M.; Chekhovsky, V.; Mossolov, V.; Suarez Gonzalez, J.; De Wolf, E. A.; Di Croce, D.; Janssen, X.; Lauwers, J.; Van De Klundert, M.; Van Haevermaet, H.; Van Mechelen, P.; Van Remortel, N.; Abu Zeid, S.; Blekman, F.; D'Hondt, J.; De Bruyn, I.; De Clercq, J.; Deroover, K.; Flouris, G.; Lontkovskyi, D.; Lowette, S.; Moortgat, S.; Moreels, L.; Python, Q.; Skovpen, K.; Tavernier, S.; Van Doninck, W.; Van Mulders, P.; Van Parijs, I.; Brun, H.; Clerbaux, B.; De Lentdecker, G.; Delannoy, H.; Fasanella, G.; Favart, L.; Goldouzian, R.; Grebenyuk, A.; Karapostoli, G.; Lenzi, T.; Luetic, J.; Maerschalk, T.; Marinov, A.; Randle-conde, A.; Seva, T.; Vander Velde, C.; Vanlaer, P.; Vannerom, D.; Yonamine, R.; Zenoni, F.; Zhang, F.; Cimmino, A.; Cornelis, T.; Dobur, D.; Fagot, A.; Gul, M.; Khvastunov, I.; Poyraz, D.; Roskas, C.; Salva, S.; Tytgat, M.; Verbeke, W.; Zaganidis, N.; Bakhshiansohi, H.; Bondu, O.; Brochet, S.; Bruno, G.; Caputo, C.; Caudron, A.; De Visscher, S.; Delaere, C.; Delcourt, M.; Francois, B.; Giammanco, A.; Jafari, A.; Komm, M.; Krintiras, G.; Lemaitre, V.; Magitteri, A.; Mertens, A.; Musich, M.; Piotrzkowski, K.; Quertenmont, L.; Vidal Marono, M.; Wertz, S.; Beliy, N.; Aldá Júnior, W. L.; Alves, F. L.; Alves, G. A.; Brito, L.; Correa Martins Junior, M.; Hensel, C.; Moraes, A.; Pol, M. E.; Rebello Teles, P.; Belchior Batista Das Chagas, E.; Carvalho, W.; Chinellato, J.; Custódio, A.; Da Costa, E. M.; Da Silveira, G. G.; De Jesus Damiao, D.; Fonseca De Souza, S.; Huertas Guativa, L. M.; Malbouisson, H.; Melo De Almeida, M.; Mora Herrera, C.; Mundim, L.; Nogima, H.; Santoro, A.; Sznajder, A.; Tonelli Manganote, E. J.; Torres Da Silva De Araujo, F.; Vilela Pereira, A.; Ahuja, S.; Bernardes, C. A.; Fernandez Perez Tomei, T. R.; Gregores, E. M.; Mercadante, P. G.; Novaes, S. F.; Padula, Sandra S.; Romero Abad, D.; Ruiz Vargas, J. C.; Aleksandrov, A.; Hadjiiska, R.; Iaydjiev, P.; Misheva, M.; Rodozov, M.; Shopova, M.; Stoykova, S.; Sultanov, G.; Dimitrov, A.; Glushkov, I.; Litov, L.; Pavlov, B.; Petkov, P.; Fang, W.; Gao, X.; Ahmad, M.; Bian, J. G.; Chen, G. M.; Chen, H. S.; Chen, M.; Chen, Y.; Jiang, C. H.; Leggat, D.; Liao, H.; Liu, Z.; Romeo, F.; Shaheen, S. M.; Spiezia, A.; Tao, J.; Wang, C.; Wang, Z.; Yazgan, E.; Zhang, H.; Zhang, S.; Zhao, J.; Ban, Y.; Chen, G.; Li, Q.; Liu, S.; Mao, Y.; Qian, S. J.; Wang, D.; Xu, Z.; Avila, C.; Cabrera, A.; Chaparro Sierra, L. F.; Florez, C.; González Hernández, C. F.; Ruiz Alvarez, J. D.; Courbon, B.; Godinovic, N.; Lelas, D.; Puljak, I.; Ribeiro Cipriano, P. M.; Sculac, T.; Antunovic, Z.; Kovac, M.; Brigljevic, V.; Ferencek, D.; Kadija, K.; Mesic, B.; Starodumov, A.; Susa, T.; Ather, M. W.; Attikis, A.; Mavromanolakis, G.; Mousa, J.; Nicolaou, C.; Ptochos, F.; Razis, P. A.; Rykaczewski, H.; Finger, M.; Finger, M.; Carrera Jarrin, E.; El-khateeb, E.; Elgammal, S.; Ellithi Kamel, A.; Dewanjee, R. K.; Kadastik, M.; Perrini, L.; Raidal, M.; Tiko, A.; Veelken, C.; Eerola, P.; Pekkanen, J.; Voutilainen, M.; Härkönen, J.; Järvinen, T.; Karimäki, V.; Kinnunen, R.; Lampén, T.; Lassila-Perini, K.; Lehti, S.; Lindén, T.; Luukka, P.; Tuominen, E.; Tuominiemi, J.; Tuovinen, E.; Talvitie, J.; Tuuva, T.; Besancon, M.; Couderc, F.; Dejardin, M.; Denegri, D.; Faure, J. L.; Ferri, F.; Ganjour, S.; Ghosh, S.; Givernaud, A.; Gras, P.; Hamel de Monchenault, G.; Jarry, P.; Kucher, I.; Locci, E.; Machet, M.; Malcles, J.; Negro, G.; Rander, J.; Rosowsky, A.; Sahin, M. Ö.; Titov, M.; Abdulsalam, A.; Antropov, I.; Baffioni, S.; Beaudette, F.; Busson, P.; Cadamuro, L.; Charlot, C.; Granier de Cassagnac, R.; Jo, M.; Lisniak, S.; Lobanov, A.; Martin Blanco, J.; Nguyen, M.; Ochando, C.; Ortona, G.; Paganini, P.; Pigard, P.; Salerno, R.; Sauvan, J. B.; Sirois, Y.; Stahl Leiton, A. G.; Strebler, T.; Yilmaz, Y.; Zabi, A.; Zghiche, A.; Agram, J.-L.; Andrea, J.; Bloch, D.; Brom, J.-M.; Buttignol, M.; Chabert, E. C.; Chanon, N.; Collard, C.; Conte, E.; Coubez, X.; Fontaine, J.-C.; Gelé, D.; Goerlach, U.; Jansová, M.; Le Bihan, A.-C.; Tonon, N.; Van Hove, P.; Gadrat, S.; Beauceron, S.; Bernet, C.; Boudoul, G.; Chierici, R.; Contardo, D.; Depasse, P.; El Mamouni, H.; Fay, J.; Finco, L.; Gascon, S.; Gouzevitch, M.; Grenier, G.; Ille, B.; Lagarde, F.; Laktineh, I. B.; Lethuillier, M.; Mirabito, L.; Pequegnot, A. L.; Perries, S.; Popov, A.; Sordini, V.; Vander Donckt, M.; Viret, S.; Khvedelidze, A.; Tsamalaidze, Z.; Autermann, C.; Feld, L.; Kiesel, M. K.; Klein, K.; Lipinski, M.; Preuten, M.; Schomakers, C.; Schulz, J.; Verlage, T.; Zhukov, V.; Albert, A.; Dietz-Laursonn, E.; Duchardt, D.; Endres, M.; Erdmann, M.; Erdweg, S.; Esch, T.; Fischer, R.; Güth, A.; Hamer, M.; Hebbeker, T.; Heidemann, C.; Hoepfner, K.; Knutzen, S.; Merschmeyer, M.; Meyer, A.; Millet, P.; Mukherjee, S.; Pook, T.; Radziej, M.; Reithler, H.; Rieger, M.; Scheuch, F.; Teyssier, D.; Thüer, S.; Flügge, G.; Kargoll, B.; Kress, T.; Künsken, A.; Lingemann, J.; Müller, T.; Nehrkorn, A.; Nowack, A.; Pistone, C.; Pooth, O.; Stahl, A.; Aldaya Martin, M.; Arndt, T.; Asawatangtrakuldee, C.; Beernaert, K.; Behnke, O.; Behrens, U.; Bermúdez Martínez, A.; Bin Anuar, A. A.; Borras, K.; Botta, V.; Campbell, A.; Connor, P.; Contreras-Campana, C.; Costanza, F.; Diez Pardos, C.; Eckerlin, G.; Eckstein, D.; Eichhorn, T.; Eren, E.; Gallo, E.; Garay Garcia, J.; Geiser, A.; Gizhko, A.; Grados Luyando, J. M.; Grohsjean, A.; Gunnellini, P.; Guthoff, M.; Harb, A.; Hauk, J.; Hempel, M.; Jung, H.; Kalogeropoulos, A.; Kasemann, M.; Keaveney, J.; Kleinwort, C.; Korol, I.; Krücker, D.; Lange, W.; Lelek, A.; Lenz, T.; Leonard, J.; Lipka, K.; Lohmann, W.; Mankel, R.; Melzer-Pellmann, I.-A.; Meyer, A. B.; Mittag, G.; Mnich, J.; Mussgiller, A.; Ntomari, E.; Pitzl, D.; Raspereza, A.; Roland, B.; Savitskyi, M.; Saxena, P.; Shevchenko, R.; Spannagel, S.; Stefaniuk, N.; Van Onsem, G. P.; Walsh, R.; Wen, Y.; Wichmann, K.; Wissing, C.; Zenaiev, O.; Bein, S.; Blobel, V.; Centis Vignali, M.; Dreyer, T.; Garutti, E.; Gonzalez, D.; Haller, J.; Hinzmann, A.; Hoffmann, M.; Karavdina, A.; Klanner, R.; Kogler, R.; Kovalchuk, N.; Kurz, S.; Lapsien, T.; Marchesini, I.; Marconi, D.; Meyer, M.; Niedziela, M.; Nowatschin, D.; Pantaleo, F.; Peiffer, T.; Perieanu, A.; Scharf, C.; Schleper, P.; Schmidt, A.; Schumann, S.; Schwandt, J.; Sonneveld, J.; Stadie, H.; Steinbrück, G.; Stober, F. M.; Stöver, M.; Tholen, H.; Troendle, D.; Usai, E.; Vanelderen, L.; Vanhoefer, A.; Vormwald, B.; Akbiyik, M.; Barth, C.; Baur, S.; Butz, E.; Caspart, R.; Chwalek, T.; Colombo, F.; De Boer, W.; Dierlamm, A.; Freund, B.; Friese, R.; Giffels, M.; Gilbert, A.; Haitz, D.; Hartmann, F.; Heindl, S. M.; Husemann, U.; Kassel, F.; Kudella, S.; Mildner, H.; Mozer, M. U.; Müller, Th.; Plagge, M.; Quast, G.; Rabbertz, K.; Schröder, M.; Shvetsov, I.; Sieber, G.; Simonis, H. J.; Ulrich, R.; Wayand, S.; Weber, M.; Weiler, T.; Williamson, S.; Wöhrmann, C.; Wolf, R.; Anagnostou, G.; Daskalakis, G.; Geralis, T.; Giakoumopoulou, V. A.; Kyriakis, A.; Loukas, D.; Topsis-Giotis, I.; Karathanasis, G.; Kesisoglou, S.; Panagiotou, A.; Saoulidou, N.; Kousouris, K.; Evangelou, I.; Foudas, C.; Kokkas, P.; Mallios, S.; Manthos, N.; Papadopoulos, I.; Paradas, E.; Strologas, J.; Triantis, F. A.; Csanad, M.; Filipovic, N.; Pasztor, G.; Veres, G. I.; Bencze, G.; Hajdu, C.; Horvath, D.; Hunyadi, Á.; Sikler, F.; Veszpremi, V.; Zsigmond, A. J.; Beni, N.; Czellar, S.; Karancsi, J.; Makovec, A.; Molnar, J.; Szillasi, Z.; Bartók, M.; Raics, P.; Trocsanyi, Z. L.; Ujvari, B.; Choudhury, S.; Komaragiri, J. R.; Bahinipati, S.; Bhowmik, S.; Mal, P.; Mandal, K.; Nayak, A.; Sahoo, D. K.; Sahoo, N.; Swain, S. K.; Bansal, S.; Beri, S. B.; Bhatnagar, V.; Chawla, R.; Dhingra, N.; Kalsi, A. K.; Kaur, A.; Kaur, M.; Kumar, R.; Kumari, P.; Mehta, A.; Singh, J. B.; Walia, G.; Kumar, Ashok; Shah, Aashaq; Bhardwaj, A.; Chauhan, S.; Choudhary, B. C.; Garg, R. B.; Keshri, S.; Kumar, A.; Malhotra, S.; Naimuddin, M.; Ranjan, K.; Sharma, R.; Bhardwaj, R.; Bhattacharya, R.; Bhattacharya, S.; Bhawandeep, U.; Dey, S.; Dutt, S.; Dutta, S.; Ghosh, S.; Majumdar, N.; Modak, A.; Mondal, K.; Mukhopadhyay, S.; Nandan, S.; Purohit, A.; Roy, A.; Roy, D.; Roy Chowdhury, S.; Sarkar, S.; Sharan, M.; Thakur, S.; Behera, P. K.; Chudasama, R.; Dutta, D.; Jha, V.; Kumar, V.; Mohanty, A. K.; Netrakanti, P. K.; Pant, L. M.; Shukla, P.; Topkar, A.; Aziz, T.; Dugad, S.; Mahakud, B.; Mitra, S.; Mohanty, G. B.; Sur, N.; Sutar, B.; Banerjee, S.; Bhattacharya, S.; Chatterjee, S.; Das, P.; Guchait, M.; Jain, Sa.; Kumar, S.; Maity, M.; Majumder, G.; Mazumdar, K.; Sarkar, T.; Wickramage, N.; Chauhan, S.; Dube, S.; Hegde, V.; Kapoor, A.; Kothekar, K.; Pandey, S.; Rane, A.; Sharma, S.; Chenarani, S.; Eskandari Tadavani, E.; Etesami, S. M.; Khakzad, M.; Mohammadi Najafabadi, M.; Naseri, M.; Paktinat Mehdiabadi, S.; Rezaei Hosseinabadi, F.; Safarzadeh, B.; Zeinali, M.; Felcini, M.; Grunewald, M.; Abbrescia, M.; Calabria, C.; Colaleo, A.; Creanza, D.; Cristella, L.; De Filippis, N.; De Palma, M.; Errico, F.; Fiore, L.; Iaselli, G.; Lezki, S.; Maggi, G.; Maggi, M.; Miniello, G.; My, S.; Nuzzo, S.; Pompili, A.; Pugliese, G.; Radogna, R.; Ranieri, A.; Selvaggi, G.; Sharma, A.; Silvestris, L.; Venditti, R.; Verwilligen, P.; Abbiendi, G.; Battilana, C.; Bonacorsi, D.; Braibant-Giacomelli, S.; Campanini, R.; Capiluppi, P.; Castro, A.; Cavallo, F. R.; Chhibra, S. S.; Codispoti, G.; Cuffiani, M.; Dallavalle, G. M.; Fabbri, F.; Fanfani, A.; Fasanella, D.; Giacomelli, P.; Grandi, C.; Guiducci, L.; Marcellini, S.; Masetti, G.; Montanari, A.; Navarria, F. L.; Perrotta, A.; Rossi, A. M.; Rovelli, T.; Siroli, G. P.; Tosi, N.; Albergo, S.; Costa, S.; Di Mattia, A.; Giordano, F.; Potenza, R.; Tricomi, A.; Tuve, C.; Barbagli, G.; Chatterjee, K.; Ciulli, V.; Civinini, C.; D'Alessandro, R.; Focardi, E.; Lenzi, P.; Meschini, M.; Paoletti, S.; Russo, L.; Sguazzoni, G.; Strom, D.; Viliani, L.; Benussi, L.; Bianco, S.; Fabbri, F.; Piccolo, D.; Primavera, F.; Calvelli, V.; Ferro, F.; Robutti, E.; Tosi, S.; Benaglia, A.; Brianza, L.; Brivio, F.; Ciriolo, V.; Dinardo, M. E.; Fiorendi, S.; Gennai, S.; Ghezzi, A.; Govoni, P.; Malberti, M.; Malvezzi, S.; Manzoni, R. A.; Menasce, D.; Moroni, L.; Paganoni, M.; Pauwels, K.; Pedrini, D.; Pigazzini, S.; Ragazzi, S.; Redaelli, N.; Tabarelli de Fatis, T.; Buontempo, S.; Cavallo, N.; Di Guida, S.; Fabozzi, F.; Fienga, F.; Iorio, A. O. M.; Khan, W. A.; Lista, L.; Meola, S.; Paolucci, P.; Sciacca, C.; Thyssen, F.; Azzi, P.; Bacchetta, N.; Benato, L.; Bisello, D.; Boletti, A.; Carlin, R.; Carvalho Antunes De Oliveira, A.; Checchia, P.; Dall'Osso, M.; De Castro Manzano, P.; Dorigo, T.; Gasparini, F.; Gasparini, U.; Gozzelino, A.; Lacaprara, S.; Lujan, P.; Meneguzzo, A. T.; Pozzobon, N.; Ronchese, P.; Rossin, R.; Simonetto, F.; Torassa, E.; Ventura, S.; Zanetti, M.; Zotto, P.; Zumerle, G.; Braghieri, A.; Magnani, A.; Montagna, P.; Ratti, S. P.; Re, V.; Ressegotti, M.; Riccardi, C.; Salvini, P.; Vai, I.; Vitulo, P.; Alunni Solestizi, L.; Biasini, M.; Bilei, G. M.; Cecchi, C.; Ciangottini, D.; Fanò, L.; Lariccia, P.; Leonardi, R.; Manoni, E.; Mantovani, G.; Mariani, V.; Menichelli, M.; Rossi, A.; Santocchia, A.; Spiga, D.; Androsov, K.; Azzurri, P.; Bagliesi, G.; Boccali, T.; Borrello, L.; Castaldi, R.; Ciocci, M. A.; Dell'Orso, R.; Fedi, G.; Giannini, L.; Giassi, A.; Grippo, M. T.; Ligabue, F.; Lomtadze, T.; Manca, E.; Mandorli, G.; Martini, L.; Messineo, A.; Palla, F.; Rizzi, A.; Savoy-Navarro, A.; Spagnolo, P.; Tenchini, R.; Tonelli, G.; Venturi, A.; Verdini, P. G.; Barone, L.; Cavallari, F.; Cipriani, M.; Daci, N.; Del Re, D.; Di Marco, E.; Diemoz, M.; Gelli, S.; Longo, E.; Margaroli, F.; Marzocchi, B.; Meridiani, P.; Organtini, G.; Paramatti, R.; Preiato, F.; Rahatlou, S.; Rovelli, C.; Santanastasio, F.; Amapane, N.; Arcidiacono, R.; Argiro, S.; Arneodo, M.; Bartosik, N.; Bellan, R.; Biino, C.; Cartiglia, N.; Cenna, F.; Costa, M.; Covarelli, R.; Degano, A.; Demaria, N.; Kiani, B.; Mariotti, C.; Maselli, S.; Migliore, E.; Monaco, V.; Monteil, E.; Monteno, M.; Obertino, M. M.; Pacher, L.; Pastrone, N.; Pelliccioni, M.; Pinna Angioni, G. L.; Ravera, F.; Romero, A.; Ruspa, M.; Sacchi, R.; Shchelina, K.; Sola, V.; Solano, A.; Staiano, A.; Traczyk, P.; Belforte, S.; Casarsa, M.; Cossutti, F.; Della Ricca, G.; Zanetti, A.; Kim, D. H.; Kim, G. N.; Kim, M. S.; Lee, J.; Lee, S.; Lee, S. W.; Moon, C. S.; Oh, Y. D.; Sekmen, S.; Son, D. C.; Yang, Y. C.; Lee, A.; Kim, H.; Moon, D. H.; Oh, G.; Brochero Cifuentes, J. A.; Goh, J.; Kim, T. J.; Cho, S.; Choi, S.; Go, Y.; Gyun, D.; Ha, S.; Hong, B.; Jo, Y.; Kim, Y.; Lee, K.; Lee, K. S.; Lee, S.; Lim, J.; Park, S. K.; Roh, Y.; Almond, J.; Kim, J.; Kim, J. S.; Lee, H.; Lee, K.; Nam, K.; Oh, S. B.; Radburn-Smith, B. C.; Seo, S. h.; Yang, U. K.; Yoo, H. D.; Yu, G. B.; Choi, M.; Kim, H.; Kim, J. H.; Lee, J. S. H.; Park, I. C.; Choi, Y.; Hwang, C.; Lee, J.; Yu, I.; Dudenas, V.; Juodagalvis, A.; Vaitkus, J.; Ahmed, I.; Ibrahim, Z. A.; Md Ali, M. A. B.; Mohamad Idris, F.; Wan Abdullah, W. A. T.; Yusli, M. N.; Zolkapli, Z.; Reyes-Almanza, R.; Ramirez-Sanchez, G.; Duran-Osuna, M. C.; Castilla-Valdez, H.; De La Cruz-Burelo, E.; Heredia-De La Cruz, I.; Rabadan-Trejo, R. I.; Lopez-Fernandez, R.; Mejia Guisao, J.; Sanchez-Hernandez, A.; Carrillo Moreno, S.; Oropeza Barrera, C.; Vazquez Valencia, F.; Pedraza, I.; Salazar Ibarguen, H. A.; Uribe Estrada, C.; Morelos Pineda, A.; Krofcheck, D.; Butler, P. H.; Ahmad, A.; Ahmad, M.; Hassan, Q.; Hoorani, H. R.; Saddique, A.; Shah, M. A.; Shoaib, M.; Waqas, M.; Bialkowska, H.; Bluj, M.; Boimska, B.; Frueboes, T.; Górski, M.; Kazana, M.; Nawrocki, K.; Szleper, M.; Zalewski, P.; Bunkowski, K.; Byszuk, A.; Doroba, K.; Kalinowski, A.; Konecki, M.; Krolikowski, J.; Misiura, M.; Olszewski, M.; Pyskir, A.; Walczak, M.; Bargassa, P.; Beirão Da Cruz E Silva, C.; Di Francesco, A.; Faccioli, P.; Galinhas, B.; Gallinaro, M.; Hollar, J.; Leonardo, N.; Lloret Iglesias, L.; Nemallapudi, M. V.; Seixas, J.; Strong, G.; Toldaiev, O.; Vadruccio, D.; Varela, J.; Afanasiev, S.; Bunin, P.; Gavrilenko, M.; Golutvin, I.; Gorbunov, I.; Kamenev, A.; Karjavin, V.; Lanev, A.; Malakhov, A.; Matveev, V.; Palichik, V.; Perelygin, V.; Shmatov, S.; Shulha, S.; Skatchkov, N.; Smirnov, V.; Voytishin, N.; Zarubin, A.; Ivanov, Y.; Kim, V.; Kuznetsova, E.; Levchenko, P.; Murzin, V.; Oreshkin, V.; Smirnov, I.; Sulimov, V.; Uvarov, L.; Vavilov, S.; Vorobyev, A.; Andreev, Yu.; Dermenev, A.; Gninenko, S.; Golubev, N.; Karneyeu, A.; Kirsanov, M.; Krasnikov, N.; Pashenkov, A.; Tlisov, D.; Toropin, A.; Epshteyn, V.; Gavrilov, V.; Lychkovskaya, N.; Popov, V.; Pozdnyakov, I.; Safronov, G.; Spiridonov, A.; Stepennov, A.; Toms, M.; Vlasov, E.; Zhokin, A.; Aushev, T.; Bylinkin, A.; Chistov, R.; Danilov, M.; Parygin, P.; Philippov, D.; Polikarpov, S.; Tarkovskii, E.; Andreev, V.; Azarkin, M.; Dremin, I.; Kirakosyan, M.; Terkulov, A.; Baskakov, A.; Belyaev, A.; Boos, E.; Bunichev, V.; Dubinin, M.; Dudko, L.; Ershov, A.; Klyukhin, V.; Kodolova, O.; Lokhtin, I.; Miagkov, I.; Obraztsov, S.; Perfilov, M.; Savrin, V.; Snigirev, A.; Blinov, V.; Skovpen, Y.; Shtol, D.; Azhgirey, I.; Bayshev, I.; Bitioukov, S.; Elumakhov, D.; Kachanov, V.; Kalinin, A.; Konstantinov, D.; Petrov, V.; Ryutin, R.; Sobol, A.; Troshin, S.; Tyurin, N.; Uzunian, A.; Volkov, A.; Adzic, P.; Cirkovic, P.; Devetak, D.; Dordevic, M.; Milosevic, J.; Rekovic, V.; Alcaraz Maestre, J.; Barrio Luna, M.; Cerrada, M.; Colino, N.; De La Cruz, B.; Delgado Peris, A.; Escalante Del Valle, A.; Fernandez Bedoya, C.; Fernández Ramos, J. P.; Flix, J.; Fouz, M. C.; Garcia-Abia, P.; Gonzalez Lopez, O.; Goy Lopez, S.; Hernandez, J. M.; Josa, M. I.; Moran, D.; Pérez-Calero Yzquierdo, A.; Puerta Pelayo, J.; Quintario Olmeda, A.; Redondo, I.; Romero, L.; Soares, M. S.; Álvarez Fernández, A.; Albajar, C.; de Trocóniz, J. F.; Missiroli, M.; Cuevas, J.; Erice, C.; Fernandez Menendez, J.; Gonzalez Caballero, I.; González Fernández, J. R.; Palencia Cortezon, E.; Sanchez Cruz, S.; Vischia, P.; Vizan Garcia, J. M.; Cabrillo, I. J.; Calderon, A.; Chazin Quero, B.; Curras, E.; Duarte Campderros, J.; Fernandez, M.; Garcia-Ferrero, J.; Gomez, G.; Lopez Virto, A.; Marco, J.; Martinez Rivero, C.; Martinez Ruiz del Arbol, P.; Matorras, F.; Piedra Gomez, J.; Rodrigo, T.; Ruiz-Jimeno, A.; Scodellaro, L.; Trevisani, N.; Vila, I.; Vilar Cortabitarte, R.; Abbaneo, D.; Auffray, E.; Baillon, P.; Ball, A. H.; Barney, D.; Bianco, M.; Bloch, P.; Bocci, A.; Botta, C.; Camporesi, T.; Castello, R.; Cepeda, M.; Cerminara, G.; Chapon, E.; Chen, Y.; d'Enterria, D.; Dabrowski, A.; Daponte, V.; David, A.; De Gruttola, M.; De Roeck, A.; Dobson, M.; Dorney, B.; du Pree, T.; Dünser, M.; Dupont, N.; Elliott-Peisert, A.; Everaerts, P.; Fallavollita, F.; Franzoni, G.; Fulcher, J.; Funk, W.; Gigi, D.; Gill, K.; Glege, F.; Gulhan, D.; Harris, P.; Hegeman, J.; Innocente, V.; Janot, P.; Karacheban, O.; Kieseler, J.; Kirschenmann, H.; Knünz, V.; Kornmayer, A.; Kortelainen, M. J.; Krammer, M.; Lange, C.; Lecoq, P.; Lourenço, C.; Lucchini, M. T.; Malgeri, L.; Mannelli, M.; Martelli, A.; Meijers, F.; Merlin, J. A.; Mersi, S.; Meschi, E.; Milenovic, P.; Moortgat, F.; Mulders, M.; Neugebauer, H.; Ngadiuba, J.; Orfanelli, S.; Orsini, L.; Pape, L.; Perez, E.; Peruzzi, M.; Petrilli, A.; Petrucciani, G.; Pfeiffer, A.; Pierini, M.; Racz, A.; Reis, T.; Rolandi, G.; Rovere, M.; Sakulin, H.; Schäfer, C.; Schwick, C.; Seidel, M.; Selvaggi, M.; Sharma, A.; Silva, P.; Sphicas, P.; Stakia, A.; Steggemann, J.; Stoye, M.; Tosi, M.; Treille, D.; Triossi, A.; Tsirou, A.; Veckalns, V.; Verweij, M.; Zeuner, W. D.; Bertl, W.; Caminada, L.; Deiters, K.; Erdmann, W.; Horisberger, R.; Ingram, Q.; Kaestli, H. C.; Kotlinski, D.; Langenegger, U.; Rohe, T.; Wiederkehr, S. A.; Bachmair, F.; Bäni, L.; Berger, P.; Bianchini, L.; Casal, B.; Dissertori, G.; Dittmar, M.; Donegà, M.; Grab, C.; Heidegger, C.; Hits, D.; Hoss, J.; Kasieczka, G.; Klijnsma, T.; Lustermann, W.; Mangano, B.; Marionneau, M.; Meinhard, M. T.; Meister, D.; Micheli, F.; Musella, P.; Nessi-Tedaldi, F.; Pandolfi, F.; Pata, J.; Pauss, F.; Perrin, G.; Perrozzi, L.; Quittnat, M.; Reichmann, M.; Schönenberger, M.; Shchutska, L.; Tavolaro, V. R.; Theofilatos, K.; Vesterbacka Olsson, M. L.; Wallny, R.; Zhu, D. H.; Aarrestad, T. K.; Amsler, C.; Canelli, M. F.; De Cosa, A.; Del Burgo, R.; Donato, S.; Galloni, C.; Hreus, T.; Kilminster, B.; Pinna, D.; Rauco, G.; Robmann, P.; Salerno, D.; Seitz, C.; Takahashi, Y.; Zucchetta, A.; Candelise, V.; Doan, T. H.; Jain, Sh.; Khurana, R.; Kuo, C. M.; Lin, W.; Pozdnyakov, A.; Yu, S. S.; Kumar, Arun; Chang, P.; Chao, Y.; Chen, K. F.; Chen, P. H.; Fiori, F.; Hou, W.-S.; Hsiung, Y.; Liu, Y. F.; Lu, R.-S.; Paganis, E.; Psallidas, A.; Steen, A.; Tsai, J. f.; Asavapibhop, B.; Kovitanggoon, K.; Singh, G.; Srimanobhas, N.; Bakirci, M. N.; Boran, F.; Damarseckin, S.; Demiroglu, Z. S.; Dozen, C.; Eskut, E.; Girgis, S.; Gokbulut, G.; Guler, Y.; Hos, I.; Kangal, E. E.; Kara, O.; Kiminsu, U.; Oglakci, M.; Onengut, G.; Ozdemir, K.; Ozturk, S.; Polatoz, A.; Tali, B.; Turkcapar, S.; Zorbakir, I. S.; Zorbilmez, C.; Bilin, B.; Karapinar, G.; Ocalan, K.; Yalvac, M.; Zeyrek, M.; Gülmez, E.; Kaya, M.; Kaya, O.; Tekten, S.; Yetkin, E. A.; Agaras, M. N.; Atay, S.; Cakir, A.; Cankocak, K.; Grynyov, B.; Levchuk, L.; Aggleton, R.; Ball, F.; Beck, L.; Brooke, J. J.; Burns, D.; Clement, E.; Cussans, D.; Davignon, O.; Flacher, H.; Goldstein, J.; Grimes, M.; Heath, G. P.; Heath, H. F.; Jacob, J.; Kreczko, L.; Lucas, C.; Newbold, D. M.; Paramesvaran, S.; Poll, A.; Sakuma, T.; Seif El Nasr-storey, S.; Smith, D.; Smith, V. J.; Bell, K. W.; Belyaev, A.; Brew, C.; Brown, R. M.; Calligaris, L.; Cieri, D.; Cockerill, D. J. A.; Coughlan, J. A.; Harder, K.; Harper, S.; Olaiya, E.; Petyt, D.; Shepherd-Themistocleous, C. H.; Thea, A.; Tomalin, I. R.; Williams, T.; Auzinger, G.; Bainbridge, R.; Breeze, S.; Buchmuller, O.; Bundock, A.; Casasso, S.; Citron, M.; Colling, D.; Corpe, L.; Dauncey, P.; Davies, G.; De Wit, A.; Della Negra, M.; Di Maria, R.; Elwood, A.; Haddad, Y.; Hall, G.; Iles, G.; James, T.; Lane, R.; Laner, C.; Lyons, L.; Magnan, A.-M.; Malik, S.; Mastrolorenzo, L.; Matsushita, T.; Nash, J.; Nikitenko, A.; Palladino, V.; Pesaresi, M.; Raymond, D. M.; Richards, A.; Rose, A.; Scott, E.; Seez, C.; Shtipliyski, A.; Summers, S.; Tapper, A.; Uchida, K.; Vazquez Acosta, M.; Virdee, T.; Wardle, N.; Winterbottom, D.; Wright, J.; Zenz, S. C.; Cole, J. E.; Hobson, P. R.; Khan, A.; Kyberd, P.; Reid, I. D.; Symonds, P.; Teodorescu, L.; Turner, M.; Borzou, A.; Call, K.; Dittmann, J.; Hatakeyama, K.; Liu, H.; Pastika, N.; Smith, C.; Bartek, R.; Dominguez, A.; Buccilli, A.; Cooper, S. I.; Henderson, C.; Rumerio, P.; West, C.; Arcaro, D.; Avetisyan, A.; Bose, T.; Gastler, D.; Rankin, D.; Richardson, C.; Rohlf, J.; Sulak, L.; Zou, D.; Benelli, G.; Cutts, D.; Garabedian, A.; Hakala, J.; Heintz, U.; Hogan, J. M.; Kwok, K. H. M.; Laird, E.; Landsberg, G.; Mao, Z.; Narain, M.; Pazzini, J.; Piperov, S.; Sagir, S.; Syarif, R.; Yu, D.; Band, R.; Brainerd, C.; Burns, D.; Calderon De La Barca Sanchez, M.; Chertok, M.; Conway, J.; Conway, R.; Cox, P. T.; Erbacher, R.; Flores, C.; Funk, G.; Gardner, M.; Ko, W.; Lander, R.; Mclean, C.; Mulhearn, M.; Pellett, D.; Pilot, J.; Shalhout, S.; Shi, M.; Smith, J.; Stolp, D.; Tos, K.; Tripathi, M.; Wang, Z.; Bachtis, M.; Bravo, C.; Cousins, R.; Dasgupta, A.; Florent, A.; Hauser, J.; Ignatenko, M.; Mccoll, N.; Regnard, S.; Saltzberg, D.; Schnaible, C.; Valuev, V.; Bouvier, E.; Burt, K.; Clare, R.; Ellison, J.; Gary, J. W.; Ghiasi Shirazi, S. M. A.; Hanson, G.; Heilman, J.; Jandir, P.; Kennedy, E.; Lacroix, F.; Long, O. R.; Olmedo Negrete, M.; Paneva, M. I.; Shrinivas, A.; Si, W.; Wang, L.; Wei, H.; Wimpenny, S.; Yates, B. R.; Branson, J. G.; Cittolin, S.; Derdzinski, M.; Gerosa, R.; Hashemi, B.; Holzner, A.; Klein, D.; Kole, G.; Krutelyov, V.; Letts, J.; Macneill, I.; Masciovecchio, M.; Olivito, D.; Padhi, S.; Pieri, M.; Sani, M.; Sharma, V.; Simon, S.; Tadel, M.; Vartak, A.; Wasserbaech, S.; Wood, J.; Würthwein, F.; Yagil, A.; Zevi Della Porta, G.; Amin, N.; Bhandari, R.; Bradmiller-Feld, J.; Campagnari, C.; Dishaw, A.; Dutta, V.; Franco Sevilla, M.; George, C.; Golf, F.; Gouskos, L.; Gran, J.; Heller, R.; Incandela, J.; Mullin, S. D.; Ovcharova, A.; Qu, H.; Richman, J.; Stuart, D.; Suarez, I.; Yoo, J.; Anderson, D.; Bendavid, J.; Bornheim, A.; Lawhorn, J. M.; Newman, H. B.; Nguyen, T.; Pena, C.; Spiropulu, M.; Vlimant, J. R.; Xie, S.; Zhang, Z.; Zhu, R. Y.; Andrews, M. B.; Ferguson, T.; Mudholkar, T.; Paulini, M.; Russ, J.; Sun, M.; Vogel, H.; Vorobiev, I.; Weinberg, M.; Cumalat, J. P.; Ford, W. T.; Jensen, F.; Johnson, A.; Krohn, M.; Leontsinis, S.; Mulholland, T.; Stenson, K.; Wagner, S. R.; Alexander, J.; Chaves, J.; Chu, J.; Dittmer, S.; Mcdermott, K.; Mirman, N.; Patterson, J. R.; Rinkevicius, A.; Ryd, A.; Skinnari, L.; Soffi, L.; Tan, S. M.; Tao, Z.; Thom, J.; Tucker, J.; Wittich, P.; Zientek, M.; Abdullin, S.; Albrow, M.; Apollinari, G.; Apresyan, A.; Apyan, A.; Banerjee, S.; Bauerdick, L. A. T.; Beretvas, A.; Berryhill, J.; Bhat, P. C.; Bolla, G.; Burkett, K.; Butler, J. N.; Canepa, A.; Cerati, G. B.; Cheung, H. W. K.; Chlebana, F.; Cremonesi, M.; Duarte, J.; Elvira, V. D.; Freeman, J.; Gecse, Z.; Gottschalk, E.; Gray, L.; Green, D.; Grünendahl, S.; Gutsche, O.; Harris, R. M.; Hasegawa, S.; Hirschauer, J.; Hu, Z.; Jayatilaka, B.; Jindariani, S.; Johnson, M.; Joshi, U.; Klima, B.; Kreis, B.; Lammel, S.; Lincoln, D.; Lipton, R.; Liu, M.; Liu, T.; Lopes De Sá, R.; Lykken, J.; Maeshima, K.; Magini, N.; Marraffino, J. M.; Maruyama, S.; Mason, D.; McBride, P.; Merkel, P.; Mrenna, S.; Nahn, S.; O'Dell, V.; Pedro, K.; Prokofyev, O.; Rakness, G.; Ristori, L.; Schneider, B.; Sexton-Kennedy, E.; Soha, A.; Spalding, W. J.; Spiegel, L.; Stoynev, S.; Strait, J.; Strobbe, N.; Taylor, L.; Tkaczyk, S.; Tran, N. V.; Uplegger, L.; Vaandering, E. W.; Vernieri, C.; Verzocchi, M.; Vidal, R.; Wang, M.; Weber, H. A.; Whitbeck, A.; Acosta, D.; Avery, P.; Bortignon, P.; Bourilkov, D.; Brinkerhoff, A.; Carnes, A.; Carver, M.; Curry, D.; Field, R. D.; Furic, I. K.; Konigsberg, J.; Korytov, A.; Kotov, K.; Ma, P.; Matchev, K.; Mei, H.; Mitselmakher, G.; Rank, D.; Sperka, D.; Terentyev, N.; Thomas, L.; Wang, J.; Wang, S.; Yelton, J.; Joshi, Y. R.; Linn, S.; Markowitz, P.; Rodriguez, J. L.; Ackert, A.; Adams, T.; Askew, A.; Hagopian, S.; Hagopian, V.; Johnson, K. F.; Kolberg, T.; Martinez, G.; Perry, T.; Prosper, H.; Saha, A.; Santra, A.; Sharma, V.; Yohay, R.; Baarmand, M. M.; Bhopatkar, V.; Colafranceschi, S.; Hohlmann, M.; Noonan, D.; Roy, T.; Yumiceva, F.; Adams, M. R.; Apanasevich, L.; Berry, D.; Betts, R. R.; Cavanaugh, R.; Chen, X.; Evdokimov, O.; Gerber, C. E.; Hangal, D. A.; Hofman, D. J.; Jung, K.; Kamin, J.; Sandoval Gonzalez, I. D.; Tonjes, M. B.; Trauger, H.; Varelas, N.; Wang, H.; Wu, Z.; Zhang, J.; Bilki, B.; Clarida, W.; Dilsiz, K.; Durgut, S.; Gandrajula, R. P.; Haytmyradov, M.; Khristenko, V.; Merlo, J.-P.; Mermerkaya, H.; Mestvirishvili, A.; Moeller, A.; Nachtman, J.; Ogul, H.; Onel, Y.; Ozok, F.; Penzo, A.; Snyder, C.; Tiras, E.; Wetzel, J.; Yi, K.; Blumenfeld, B.; Cocoros, A.; Eminizer, N.; Fehling, D.; Feng, L.; Gritsan, A. V.; Maksimovic, P.; Roskes, J.; Sarica, U.; Swartz, M.; Xiao, M.; You, C.; Al-bataineh, A.; Baringer, P.; Bean, A.; Boren, S.; Bowen, J.; Castle, J.; Khalil, S.; Kropivnitskaya, A.; Majumder, D.; Mcbrayer, W.; Murray, M.; Royon, C.; Sanders, S.; Schmitz, E.; Tapia Takaki, J. D.; Wang, Q.; Ivanov, A.; Kaadze, K.; Maravin, Y.; Mohammadi, A.; Saini, L. K.; Skhirtladze, N.; Toda, S.; Rebassoo, F.; Wright, D.; Anelli, C.; Baden, A.; Baron, O.; Belloni, A.; Calvert, B.; Eno, S. C.; Ferraioli, C.; Hadley, N. J.; Jabeen, S.; Jeng, G. Y.; Kellogg, R. G.; Kunkle, J.; Mignerey, A. C.; Ricci-Tam, F.; Shin, Y. H.; Skuja, A.; Tonwar, S. C.; Abercrombie, D.; Allen, B.; Azzolini, V.; Barbieri, R.; Baty, A.; Bi, R.; Brandt, S.; Busza, W.; Cali, I. A.; D'Alfonso, M.; Demiragli, Z.; Gomez Ceballos, G.; Goncharov, M.; Hsu, D.; Iiyama, Y.; Innocenti, G. M.; Klute, M.; Kovalskyi, D.; Lai, Y. S.; Lee, Y.-J.; Levin, A.; Luckey, P. D.; Maier, B.; Marini, A. C.; Mcginn, C.; Mironov, C.; Narayanan, S.; Niu, X.; Paus, C.; Roland, C.; Roland, G.; Salfeld-Nebgen, J.; Stephans, G. S. F.; Tatar, K.; Velicanu, D.; Wang, J.; Wang, T. W.; Wyslouch, B.; Benvenuti, A. C.; Chatterjee, R. M.; Evans, A.; Hansen, P.; Kalafut, S.; Kubota, Y.; Lesko, Z.; Mans, J.; Nourbakhsh, S.; Ruckstuhl, N.; Rusack, R.; Turkewitz, J.; Acosta, J. G.; Oliveros, S.; Avdeeva, E.; Bloom, K.; Claes, D. R.; Fangmeier, C.; Gonzalez Suarez, R.; Kamalieddin, R.; Kravchenko, I.; Monroy, J.; Siado, J. E.; Snow, G. R.; Stieger, B.; Alyari, M.; Dolen, J.; Godshalk, A.; Harrington, C.; Iashvili, I.; Nguyen, D.; Parker, A.; Rappoccio, S.; Roozbahani, B.; Alverson, G.; Barberis, E.; Hortiangtham, A.; Massironi, A.; Morse, D. M.; Nash, D.; Orimoto, T.; Teixeira De Lima, R.; Trocino, D.; Wood, D.; Bhattacharya, S.; Charaf, O.; Hahn, K. A.; Mucia, N.; Odell, N.; Pollack, B.; Schmitt, M. H.; Sung, K.; Trovato, M.; Velasco, M.; Dev, N.; Hildreth, M.; Hurtado Anampa, K.; Jessop, C.; Karmgard, D. J.; Kellams, N.; Lannon, K.; Loukas, N.; Marinelli, N.; Meng, F.; Mueller, C.; Musienko, Y.; Planer, M.; Reinsvold, A.; Ruchti, R.; Smith, G.; Taroni, S.; Wayne, M.; Wolf, M.; Woodard, A.; Alimena, J.; Antonelli, L.; Bylsma, B.; Durkin, L. S.; Flowers, S.; Francis, B.; Hart, A.; Hill, C.; Ji, W.; Liu, B.; Luo, W.; Puigh, D.; Winer, B. L.; Wulsin, H. W.; Cooperstein, S.; Driga, O.; Elmer, P.; Hardenbrook, J.; Hebda, P.; Higginbotham, S.; Lange, D.; Luo, J.; Marlow, D.; Mei, K.; Ojalvo, I.; Olsen, J.; Palmer, C.; Piroué, P.; Stickland, D.; Tully, C.; Malik, S.; Norberg, S.; Barker, A.; Barnes, V. E.; Das, S.; Folgueras, S.; Gutay, L.; Jha, M. K.; Jones, M.; Jung, A. W.; Khatiwada, A.; Miller, D. H.; Neumeister, N.; Peng, C. C.; Schulte, J. F.; Sun, J.; Wang, F.; Xie, W.; Cheng, T.; Parashar, N.; Stupak, J.; Adair, A.; Akgun, B.; Chen, Z.; Ecklund, K. M.; Geurts, F. J. M.; Guilbaud, M.; Li, W.; Michlin, B.; Northup, M.; Padley, B. P.; Roberts, J.; Rorie, J.; Tu, Z.; Zabel, J.; Bodek, A.; de Barbaro, P.; Demina, R.; Duh, Y. t.; Ferbel, T.; Galanti, M.; Garcia-Bellido, A.; Han, J.; Hindrichs, O.; Khukhunaishvili, A.; Lo, K. H.; Tan, P.; Verzetti, M.; Ciesielski, R.; Goulianos, K.; Mesropian, C.; Agapitos, A.; Chou, J. P.; Gershtein, Y.; Gómez Espinosa, T. A.; Halkiadakis, E.; Heindl, M.; Hughes, E.; Kaplan, S.; Kunnawalkam Elayavalli, R.; Kyriacou, S.; Lath, A.; Montalvo, R.; Nash, K.; Osherson, M.; Saka, H.; Salur, S.; Schnetzer, S.; Sheffield, D.; Somalwar, S.; Stone, R.; Thomas, S.; Thomassen, P.; Walker, M.; Delannoy, A. G.; Foerster, M.; Heideman, J.; Riley, G.; Rose, K.; Spanier, S.; Thapa, K.; Bouhali, O.; Castaneda Hernandez, A.; Celik, A.; Dalchenko, M.; De Mattia, M.; Delgado, A.; Dildick, S.; Eusebi, R.; Gilmore, J.; Huang, T.; Kamon, T.; Mueller, R.; Pakhotin, Y.; Patel, R.; Perloff, A.; Perniè, L.; Rathjens, D.; Safonov, A.; Tatarinov, A.; Ulmer, K. A.; Akchurin, N.; Damgov, J.; De Guio, F.; Dudero, P. R.; Faulkner, J.; Gurpinar, E.; Kunori, S.; Lamichhane, K.; Lee, S. W.; Libeiro, T.; Peltola, T.; Undleeb, S.; Volobouev, I.; Wang, Z.; Greene, S.; Gurrola, A.; Janjam, R.; Johns, W.; Maguire, C.; Melo, A.; Ni, H.; Padeken, K.; Sheldon, P.; Tuo, S.; Velkovska, J.; Xu, Q.; Arenton, M. W.; Barria, P.; Cox, B.; Hirosky, R.; Joyce, M.; Ledovskoy, A.; Li, H.; Neu, C.; Sinthuprasith, T.; Wang, Y.; Wolfe, E.; Xia, F.; Harr, R.; Karchin, P. E.; Sturdy, J.; Zaleski, S.; Brodski, M.; Buchanan, J.; Caillol, C.; Dasu, S.; Dodd, L.; Duric, S.; Gomber, B.; Grothe, M.; Herndon, M.; Hervé, A.; Hussain, U.; Klabbers, P.; Lanaro, A.; Levine, A.; Long, K.; Loveless, R.; Pierro, G. A.; Polese, G.; Ruggles, T.; Savin, A.; Smith, N.; Smith, W. H.; Taylor, D.; Woods, N.; CMS Collaboration
2018-04-01
A search is presented for the production of vector-like quark pairs, T T ‾ or Y Y ‾, with electric charge of 2/3 (T) or - 4 / 3 (Y), in proton-proton collisions at √{ s } = 13TeV. The data were collected by the CMS experiment at the LHC in 2016 and correspond to an integrated luminosity of 35.8fb-1. The T and Y quarks are assumed to decay exclusively to a W boson and a b quark. The search is based on events with a single isolated electron or muon, large missing transverse momentum, and at least four jets with large transverse momenta. In the search, a kinematic reconstruction of the final state observables is performed, which would permit a signal to be detected as a narrow mass peak (≈7% resolution). The observed number of events is consistent with the standard model prediction. Assuming strong pair production of the vector-like quarks and a 100% branching fraction to bW, a lower limit of 1295 GeV at 95% confidence level is set on the T and Y quark masses.
Assessment of the short-term radiometric stability between Terra MODIS and Landsat 7 ETM+ sensors
Choi, Taeyoung; Xiong, Xiaoxiong; Chander, Gyanesh; Angal, A.
2009-01-01
Short-term radiometric stability was evaluated using continuous ETM+ scenes within a single orbit (contact period) and the corresponding MODIS scenes for the four matching solar reflective visible and near-infrared (VNIR) band pairs between the two sensors. The near-simultaneous earth observations were limited by the smaller swath size of ETM+ (183 km) compared to MODIS (2330 km). Two sets of continuous granules for Terra MODIS and Landsat 7 ETM+ were selected and mosaicked based on pixel geolocation information for noncloudy pixels over the African continent. The matching pixel pairs were resampled from a fine to a coarse pixel resolution, and the at-sensor spectral radiance values for a wide dynamic range of the sensors were compared and analyzed, covering various surface types. The following study focuses on radiometric stability analysis from the VNIR band-pairs of ETM+ and MODIS. The Libya-4 desert target was included in the path of this continuous orbit, which served as a verification point between the short-term and the long-term trending results from previous studies. MODTRAN at-sensor spectral radiance simulation is included for a representative desert surface type to evaluate the consistency of the results.
A resolution measure for three-dimensional microscopy
Chao, Jerry; Ram, Sripad; Abraham, Anish V.; Ward, E. Sally; Ober, Raimund J.
2009-01-01
A three-dimensional (3D) resolution measure for the conventional optical microscope is introduced which overcomes the drawbacks of the classical 3D (axial) resolution limit. Formulated within the context of a parameter estimation problem and based on the Cramer-Rao lower bound, this 3D resolution measure indicates the accuracy with which a given distance between two objects in 3D space can be determined from the acquired image. It predicts that, given enough photons from the objects of interest, arbitrarily small distances of separation can be estimated with prespecified accuracy. Using simulated images of point source pairs, we show that the maximum likelihood estimator is capable of attaining the accuracy predicted by the resolution measure. We also demonstrate how different factors, such as extraneous noise sources and the spatial orientation of the imaged object pair, can affect the accuracy with which a given distance of separation can be determined. PMID:20161040
Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon
2010-08-18
It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.
Multi-epoch observations with high spatial resolution of multiple T Tauri systems
NASA Astrophysics Data System (ADS)
Csépány, Gergely; van den Ancker, Mario; Ábrahám, Péter; Köhler, Rainer; Brandner, Wolfgang; Hormuth, Felix; Hiss, Hector
2017-07-01
Context. In multiple pre-main-sequence systems the lifetime of circumstellar discs appears to be shorter than around single stars, and the actual dissipation process may depend on the binary parameters of the systems. Aims: We report high spatial resolution observations of multiple T Tauri systems at optical and infrared wavelengths. We determine whether the components are gravitationally bound and orbital motion is visible, derive orbital parameters, and investigate possible correlations between the binary parameters and disc states. Methods: We selected 18 T Tau multiple systems (16 binary and two triple systems, yielding 16 + 2 × 2 = 20 binary pairs) in the Taurus-Auriga star-forming region from a previous survey, with spectral types from K1 to M5 and separations from 0.22″ (31 AU) to 5.8″ (814 AU). We analysed data acquired in 2006-07 at Calar Alto using the AstraLux lucky imaging system, along with data from SPHERE and NACO at the VLT, and from the literature. Results: We found ten pairs to orbit each other, five pairs that may show orbital motion, and five likely common proper motion pairs. We found no obvious correlation between the stellar parameters and binary configuration. The 10 μm infra-red excess varies between 0.1 and 7.2 mag (similar to the distribution in single stars, where it is between 1.7 and 9.1), implying that the presence of the binary star does not greatly influence the emission from the inner disc. Conclusions: We have detected orbital motion in young T Tauri systems over a timescale of ≈ 20 yr. Further observations with even longer temporal baseline will provide crucial information on the dynamics of these young stellar systems.
NASA Astrophysics Data System (ADS)
Muraviev, A. V.; Smolski, V. O.; Loparo, Z. E.; Vodopyanov, K. L.
2018-04-01
Mid-infrared spectroscopy offers supreme sensitivity for the detection of trace gases, solids and liquids based on tell-tale vibrational bands specific to this spectral region. Here, we present a new platform for mid-infrared dual-comb Fourier-transform spectroscopy based on a pair of ultra-broadband subharmonic optical parametric oscillators pumped by two phase-locked thulium-fibre combs. Our system provides fast (7 ms for a single interferogram), moving-parts-free, simultaneous acquisition of 350,000 spectral data points, spaced by a 115 MHz intermodal interval over the 3.1-5.5 µm spectral range. Parallel detection of 22 trace molecular species in a gas mixture, including isotopologues containing isotopes such as 13C, 18O, 17O, 15N, 34S, 33S and deuterium, with part-per-billion sensitivity and sub-Doppler resolution is demonstrated. The technique also features absolute optical frequency referencing to an atomic clock, a high degree of mutual coherence between the two mid-infrared combs with a relative comb-tooth linewidth of 25 mHz, coherent averaging and feasibility for kilohertz-scale spectral resolution.
Emerging methods to study bacteriophage infection at the single-cell level.
Dang, Vinh T; Sullivan, Matthew B
2014-01-01
Bacteria and their viruses (phages) are abundant across diverse ecosystems and their interactions influence global biogeochemical cycles and incidence of disease. Problematically, both classical and metagenomic methods insufficiently assess the host specificity of phages and phage-host infection dynamics in nature. Here we review emerging methods to study phage-host interaction and infection dynamics with a focus on those that offer resolution at the single-cell level. These methods leverage ever-increasing sequence data to identify virus signals from single-cell amplified genome datasets or to produce primers/probes to target particular phage-bacteria pairs (digital PCR and phageFISH), even in complex communities. All three methods enable study of phage infection of uncultured bacteria from environmental samples, while the latter also discriminates between phage-host interaction outcomes (e.g., lytic, chronic, lysogenic) in model systems. Together these techniques enable quantitative, spatiotemporal studies of phage-bacteria interactions from environmental samples of any ecosystem, which will help elucidate and predict the ecological and evolutionary impacts of specific phage-host pairings in nature.
The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure.
Leontis, N B; Westhof, E
1998-09-01
A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings. Thus, each non-Watson-Crick pair could be characterized by a phylogenetic signature of variations between isosteric-like pairings. In addition to the conservative changes, which form a dictionary of pairings isosterically compatible with those observed in the crystal structure, concerted changes involving several base pairs also occur. The latter covariations may indicate transitions between related but distinctive motifs within the loop E of 5S ribosomal RNA.
Example-Based Super-Resolution Fluorescence Microscopy.
Jia, Shu; Han, Boran; Kutz, J Nathan
2018-04-23
Capturing biological dynamics with high spatiotemporal resolution demands the advancement in imaging technologies. Super-resolution fluorescence microscopy offers spatial resolution surpassing the diffraction limit to resolve near-molecular-level details. While various strategies have been reported to improve the temporal resolution of super-resolution imaging, all super-resolution techniques are still fundamentally limited by the trade-off associated with the longer image acquisition time that is needed to achieve higher spatial information. Here, we demonstrated an example-based, computational method that aims to obtain super-resolution images using conventional imaging without increasing the imaging time. With a low-resolution image input, the method provides an estimate of its super-resolution image based on an example database that contains super- and low-resolution image pairs of biological structures of interest. The computational imaging of cellular microtubules agrees approximately with the experimental super-resolution STORM results. This new approach may offer potential improvements in temporal resolution for experimental super-resolution fluorescence microscopy and provide a new path for large-data aided biomedical imaging.
NASA Astrophysics Data System (ADS)
Liu, W. C.; Wu, B.
2018-04-01
High-resolution 3D modelling of lunar surface is important for lunar scientific research and exploration missions. Photogrammetry is known for 3D mapping and modelling from a pair of stereo images based on dense image matching. However dense matching may fail in poorly textured areas and in situations when the image pair has large illumination differences. As a result, the actual achievable spatial resolution of the 3D model from photogrammetry is limited by the performance of dense image matching. On the other hand, photoclinometry (i.e., shape from shading) is characterised by its ability to recover pixel-wise surface shapes based on image intensity and imaging conditions such as illumination and viewing directions. More robust shape reconstruction through photoclinometry can be achieved by incorporating images acquired under different illumination conditions (i.e., photometric stereo). Introducing photoclinometry into photogrammetric processing can therefore effectively increase the achievable resolution of the mapping result while maintaining its overall accuracy. This research presents an integrated photogrammetric and photoclinometric approach for pixel-resolution 3D modelling of the lunar surface. First, photoclinometry is interacted with stereo image matching to create robust and spatially well distributed dense conjugate points. Then, based on the 3D point cloud derived from photogrammetric processing of the dense conjugate points, photoclinometry is further introduced to derive the 3D positions of the unmatched points and to refine the final point cloud. The approach is able to produce one 3D point for each image pixel within the overlapping area of the stereo pair so that to obtain pixel-resolution 3D models. Experiments using the Lunar Reconnaissance Orbiter Camera - Narrow Angle Camera (LROC NAC) images show the superior performances of the approach compared with traditional photogrammetric technique. The results and findings from this research contribute to optimal exploitation of image information for high-resolution 3D modelling of the lunar surface, which is of significance for the advancement of lunar and planetary mapping.
Long working distance objective lenses for single atom trapping and imaging
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pritchard, J. D., E-mail: jonathan.pritchard@strath.ac.uk; Department of Physics, University of Strathclyde, 107 Rottenrow East, Glasgow G4 0NG; Isaacs, J. A.
We present a pair of optimized objective lenses with long working distances of 117 mm and 65 mm, respectively, that offer diffraction limited performance for both Cs and Rb wavelengths when imaging through standard vacuum windows. The designs utilise standard catalog lens elements to provide a simple and cost-effective solution. Objective 1 provides NA = 0.175 offering 3 μm resolution whilst objective 2 is optimized for high collection efficiency with NA = 0.29 and 1.8 μm resolution. This flexible design can be further extended for use at shorter wavelengths by simply re-optimising the lens separations.
Shi, Liang; Khandurina, Julia; Ronai, Zsolt; Li, Bi-Yu; Kwan, Wai King; Wang, Xun; Guttman, András
2003-01-01
A capillary gel electrophoresis based automated DNA fraction collection technique was developed to support a novel DNA fragment-pooling strategy for expressed sequence tag (EST) library construction. The cDNA population is first cleaved by BsaJ I and EcoR I restriction enzymes, and then subpooled by selective ligation with specific adapters followed by polymerase chain reaction (PCR) amplification and labeling. Combination of this cDNA fingerprinting method with high-resolution capillary gel electrophoresis separation and precise fractionation of individual cDNA transcript representatives avoids redundant fragment selection and concomitant repetitive sequencing of abundant transcripts. Using a computer-controlled capillary electrophoresis device the transcript representatives were separated by their size and fractions were automatically collected in every 30 s into 96-well plates. The high resolving power of the sieving matrix ensured sequencing grade separation of the DNA fragments (i.e., single-base resolution) and successful fraction collection. Performance and precision of the fraction collection procedure was validated by PCR amplification of the collected DNA fragments followed by capillary electrophoresis analysis for size and purity verification. The collected and PCR-amplified transcript representatives, ranging up to several hundred base pairs, were then sequenced to create an EST library.
Vernier-like super resolution with guided correlated photon pairs.
Nespoli, Matteo; Goan, Hsi-Sheng; Shih, Min-Hsiung
2016-01-11
We describe a dispersion-enabled, ultra-low power realization of super-resolution in an integrated Mach-Zehnder interferometer. Our scheme is based on a Vernier-like effect in the coincident detection of frequency correlated, non-degenerate photon pairs at the sensor output in the presence of group index dispersion. We design and simulate a realistic integrated refractive index sensor in a silicon nitride on silica platform and characterize its performance in the proposed scheme. We present numerical results showing a sensitivity improvement upward of 40 times over a traditional sensing scheme. The device we design is well within the reach of modern semiconductor fabrication technology. We believe this is the first metrology scheme that uses waveguide group index dispersion as a resource to attain super-resolution.
Using Pair Programming to Teach CAD Based Engineering Graphics
ERIC Educational Resources Information Center
Leland, Robert P.
2010-01-01
Pair programming was introduced into a course in engineering graphics that emphasizes solid modeling using SolidWorks. In pair programming, two students work at a single computer, and periodically trade off roles as driver (hands on the keyboard and mouse) and navigator (discuss strategy and design issues). Pair programming was used in a design…
NASA Astrophysics Data System (ADS)
Payne, A.; Ambal, K.; Boehme, C.; Williams, C. C.
2015-05-01
A study of a force detected single-spin magnetic resonance measurement concept with atomic spatial resolution is presented. The method is based upon electrostatic force detection of spin-selection rule controlled single-electron tunneling between two electrically isolated paramagnetic states. Single-spin magnetic resonance detection is possible by measuring the force detected tunneling charge noise on and off spin resonance. Simulation results of this charge noise, based upon physical models of the tunneling and spin physics, are directly compared to measured atomic force microscopy system noise. The results show that the approach could provide single-spin measurement of electrically isolated qubit states with atomic spatial resolution at room temperature.
Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion
Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.
2014-01-01
The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089
Development of the Advanced Energetic Pair Telescope (AdEPT) for Medium-Energy Gamma-Ray Astronomy
NASA Technical Reports Server (NTRS)
Hunter, Stanley D.; Bloser, Peter F.; Dion, Michael P.; McConnell, Mark L.; deNolfo, Georgia A.; Son, Seunghee; Ryan, James M.; Stecker, Floyd W.
2011-01-01
Progress in high-energy gamma-ray science has been dramatic since the launch of INTEGRAL, AGILE and FERMI. These instruments, however, are not optimized for observations in the medium-energy (approx.0.3< E(sub gamma)< approx.200 MeV) regime where many astrophysical objects exhibit unique, transitory behavior, such as spectral breaks, bursts, and flares. We outline some of the major science goals of a medium-energy mission. These science goals are best achieved with a combination of two telescopes, a Compton telescope and a pair telescope, optimized to provide significant improvements in angular resolution and sensitivity. In this paper we describe the design of the Advanced Energetic Pair Telescope (AdEPT) based on the Three-Dimensional Track Imager (3-DTI) detector. This technology achieves excellent, medium-energy sensitivity, angular resolution near the kinematic limit, and gamma-ray polarization sensitivity, by high resolution 3-D electron tracking. We describe the performance of a 30x30x30 cm3 prototype of the AdEPT instrument.
Neural noise and movement-related codes in the macaque supplementary motor area.
Averbeck, Bruno B; Lee, Daeyeol
2003-08-20
We analyzed the variability of spike counts and the coding capacity of simultaneously recorded pairs of neurons in the macaque supplementary motor area (SMA). We analyzed the mean-variance functions for single neurons, as well as signal and noise correlations between pairs of neurons. All three statistics showed a strong dependence on the bin width chosen for analysis. Changes in the correlation structure of single neuron spike trains over different bin sizes affected the mean-variance function, and signal and noise correlations between pairs of neurons were much smaller at small bin widths, increasing monotonically with the width of the bin. Analyses in the frequency domain showed that the noise between pairs of neurons, on average, was most strongly correlated at low frequencies, which explained the increase in noise correlation with increasing bin width. The coding performance was analyzed to determine whether the temporal precision of spike arrival times and the interactions within and between neurons could improve the prediction of the upcoming movement. We found that in approximately 62% of neuron pairs, the arrival times of spikes at a resolution between 66 and 40 msec carried more information than spike counts in a 200 msec bin. In addition, in 19% of neuron pairs, inclusion of within (11%)- or between-neuron (8%) correlations in spike trains improved decoding accuracy. These results suggest that in some SMA neurons elements of the spatiotemporal pattern of activity may be relevant for neural coding.
Delplanque, Aleksandra; Wawrzynczyk, Dominika; Jaworski, Pawel; Matczyszyn, Katarzyna; Pawlik, Krzysztof; Buckle, Malcolm; Nyk, Marcin; Nogues, Claude; Samoc, Marek
2015-01-01
Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio) probes in Förster Resonance Energy Transfer (FRET) where trivalent lanthanide ions (La3+) act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm) NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA) by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5) modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+) and the acceptor (Cy5) with sensitivity at a nanometre scale.
NASA Astrophysics Data System (ADS)
Hu, H.; Wu, B.
2017-07-01
The Narrow-Angle Camera (NAC) on board the Lunar Reconnaissance Orbiter (LRO) comprises of a pair of closely attached high-resolution push-broom sensors, in order to improve the swath coverage. However, the two image sensors do not share the same lenses and cannot be modelled geometrically using a single physical model. Thus, previous works on dense matching of stereo pairs of NAC images would generally create two to four stereo models, each with an irregular and overlapping region of varying size. Semi-Global Matching (SGM) is a well-known dense matching method and has been widely used for image-based 3D surface reconstruction. SGM is a global matching algorithm relying on global inference in a larger context rather than individual pixels to establish stable correspondences. The stereo configuration of LRO NAC images causes severe problem for image matching methods such as SGM, which emphasizes global matching strategy. Aiming at using SGM for image matching of LRO NAC stereo pairs for precision 3D surface reconstruction, this paper presents a coupled epipolar rectification methods for LRO NAC stereo images, which merges the image pair in the disparity space and in this way, only one stereo model will be estimated. For a stereo pair (four) of NAC images, the method starts with the boresight calibration by finding correspondence in the small overlapping stripe between each pair of NAC images and bundle adjustment of the stereo pair, in order to clean the vertical disparities. Then, the dominate direction of the images are estimated by project the center of the coverage area to the reference image and back-projected to the bounding box plane determined by the image orientation parameters iteratively. The dominate direction will determine an affine model, by which the pair of NAC images are warped onto the object space with a given ground resolution and in the meantime, a mask is produced indicating the owner of each pixel. SGM is then used to generate a disparity map for the stereo pair and each correspondence is transformed back to the owner and 3D points are derived through photogrammetric space intersection. Experimental results reveal that the proposed method is able to reduce gaps and inconsistencies caused by the inaccurate boresight offsets between the two NAC cameras and the irregular overlapping regions, and finally generate precise and consistent 3D surface models from the NAC stereo images automatically.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Studier, F.W.; Daegelen, P.; Lenski, R. E.
2009-12-01
Each difference between the genome sequences of Escherichia coli B strains REL606 and BL21(DE3) can be interpreted in light of known laboratory manipulations plus a gene conversion between ribosomal RNA operons. Two treatments with 1-methyl-3-nitro-1-nitrosoguanidine in the REL606 lineage produced at least 93 single-base-pair mutations ({approx} 90% GC-to-AT transitions) and 3 single-base-pair GC deletions. Two UV treatments in the BL21(DE3) lineage produced only 4 single-base-pair mutations but 16 large deletions. P1 transductions from K-12 into the two B lineages produced 317 single-base-pair differences and 9 insertions or deletions, reflecting differences between B DNA in BL21(DE3) and integrated restriction fragments ofmore » K-12 DNA inherited by REL606. Two sites showed selective enrichment of spontaneous mutations. No unselected spontaneous single-base-pair mutations were evident. The genome sequences revealed that a progenitor of REL606 had been misidentified, explaining initially perplexing differences. Limited sequencing of other B strains defined characteristic properties of B and allowed assembly of the inferred genome of the ancestral B of Delbrueck and Luria. Comparison of the B and K-12 genomes shows that more than half of the 3793 proteins of their basic genomes are predicted to be identical, although {approx} 310 appear to be functional in either B or K-12 but not in both. The ancestral basic genome appears to have had {approx} 4039 coding sequences occupying {approx} 4.0 Mbp. Repeated horizontal transfer from diverged Escherichia coli genomes and homologous recombination may explain the observed variable distribution of single-base-pair differences. Fifteen sites are occupied by phage-related elements, but only six by comparable elements at the same site. More than 50 sites are occupied by IS elements in both B and K, 16 in common, and likely founding IS elements are identified. A signature of widespread cryptic phage P4-type mobile elements was identified. Complex deletions (dense clusters of small deletions and substitutions) apparently removed nonessential genes from {approx} 30 sites in the basic genomes.« less
USDA-ARS?s Scientific Manuscript database
The current study evaluates the potential of using high resolution DNA melting assays to discriminate species in the genus, Isaria. The study utilizes a previously identified 103 base pair PCR amplicon, which was reported to be selective for Isaria fumosorosea. Our study finds the amplicon selective...
Guillen Bonilla, José Trinidad; Guillen Bonilla, Alex; Rodríguez Betancourtt, Verónica M.; Guillen Bonilla, Héctor; Casillas Zamora, Antonio
2017-01-01
The application of the sensor optical fibers in the areas of scientific instrumentation and industrial instrumentation is very attractive due to its numerous advantages. In the industry of civil engineering for example, quasi-distributed sensors made with optical fiber are used for reliable strain and temperature measurements. Here, a quasi-distributed sensor in the frequency domain is discussed. The sensor consists of a series of low-finesse Fabry-Perot interferometers where each Fabry-Perot interferometer acts as a local sensor. Fabry-Perot interferometers are formed by pairs of identical low reflective Bragg gratings imprinted in a single mode fiber. All interferometer sensors have different cavity length, provoking frequency-domain multiplexing. The optical signal represents the superposition of all interference patterns which can be decomposed using the Fourier transform. The frequency spectrum was analyzed and sensor’s properties were defined. Following that, a quasi-distributed sensor was numerically simulated. Our sensor simulation considers sensor properties, signal processing, noise system, and instrumentation. The numerical results show the behavior of resolution vs. signal-to-noise ratio. From our results, the Fabry-Perot sensor has high resolution and low resolution. Both resolutions are conceivable because the Fourier Domain Phase Analysis (FDPA) algorithm elaborates two evaluations of Bragg wavelength shift. PMID:28420083
Guillen Bonilla, José Trinidad; Guillen Bonilla, Alex; Rodríguez Betancourtt, Verónica M; Guillen Bonilla, Héctor; Casillas Zamora, Antonio
2017-04-14
The application of the sensor optical fibers in the areas of scientific instrumentation and industrial instrumentation is very attractive due to its numerous advantages. In the industry of civil engineering for example, quasi-distributed sensors made with optical fiber are used for reliable strain and temperature measurements. Here, a quasi-distributed sensor in the frequency domain is discussed. The sensor consists of a series of low-finesse Fabry-Perot interferometers where each Fabry-Perot interferometer acts as a local sensor. Fabry-Perot interferometers are formed by pairs of identical low reflective Bragg gratings imprinted in a single mode fiber. All interferometer sensors have different cavity length, provoking frequency-domain multiplexing. The optical signal represents the superposition of all interference patterns which can be decomposed using the Fourier transform. The frequency spectrum was analyzed and sensor's properties were defined. Following that, a quasi-distributed sensor was numerically simulated. Our sensor simulation considers sensor properties, signal processing, noise system, and instrumentation. The numerical results show the behavior of resolution vs. signal-to-noise ratio. From our results, the Fabry-Perot sensor has high resolution and low resolution. Both resolutions are conceivable because the Fourier Domain Phase Analysis (FDPA) algorithm elaborates two evaluations of Bragg wavelength shift.
Wang, Yi-Siang; Yin, Chih-Chien; Chao, Sheng D
2014-10-07
We perform an ab initio computational study of molecular complexes with the general formula CF3X-B that involve one trifluorohalomethane CF3X (X = Cl or Br) and one of a series of Lewis bases B in the gas phase. The Lewis bases are so chosen that they provide a range of electron-donating abilities for comparison. Based on the characteristics of their electron pairs, we consider the Lewis bases with a single n-pair (NH3 and PH3), two n-pairs (H2O and H2S), two n-pairs with an unsaturated bond (H2CO and H2CS), and a single π-pair (C2H4) and two π-pairs (C2H2). The aim is to systematically investigate the influence of the electron pair characteristics and the central atom substitution effects on the geometries and energetics of the formed complexes. The counterpoise-corrected supermolecule MP2 and coupled-cluster single double with perturbative triple [CCSD(T)] levels of theory have been employed, together with a series of basis sets up to aug-cc-pVTZ. The angular and radial configurations, the binding energies, and the electrostatic potentials of the stable complexes have been compared and discussed as the Lewis base varies. For those complexes where halogen bonding plays a significant role, the calculated geometries and energetics are consistent with the σ-hole model. Upon formation of stable complexes, the C-X bond lengths shorten, while the C-X vibrational frequencies increase, thus rendering blueshifting halogen bonds. The central atom substitution usually enlarges the intermolecular bond distances while it reduces the net charge transfers, thus weakening the bond strengths. The analysis based on the σ-hole model is grossly reliable but requires suitable modifications incorporating the central atom substitution effects, in particular, when interaction components other than electrostatic contributions are involved.
NASA Astrophysics Data System (ADS)
Baker, Kirk R.; Hawkins, Andy; Kelly, James T.
2014-12-01
Near source modeling is needed to assess primary and secondary pollutant impacts from single sources and single source complexes. Source-receptor relationships need to be resolved from tens of meters to tens of kilometers. Dispersion models are typically applied for near-source primary pollutant impacts but lack complex photochemistry. Photochemical models provide a realistic chemical environment but are typically applied using grid cell sizes that may be larger than the distance between sources and receptors. It is important to understand the impacts of grid resolution and sub-grid plume treatments on photochemical modeling of near-source primary pollution gradients. Here, the CAMx photochemical grid model is applied using multiple grid resolutions and sub-grid plume treatment for SO2 and compared with a receptor mesonet largely impacted by nearby sources approximately 3-17 km away in a complex terrain environment. Measurements are compared with model estimates of SO2 at 4- and 1-km resolution, both with and without sub-grid plume treatment and inclusion of finer two-way grid nests. Annual average estimated SO2 mixing ratios are highest nearest the sources and decrease as distance from the sources increase. In general, CAMx estimates of SO2 do not compare well with the near-source observations when paired in space and time. Given the proximity of these sources and receptors, accuracy in wind vector estimation is critical for applications that pair pollutant predictions and observations in time and space. In typical permit applications, predictions and observations are not paired in time and space and the entire distributions of each are directly compared. Using this approach, model estimates using 1-km grid resolution best match the distribution of observations and are most comparable to similar studies that used dispersion and Lagrangian modeling systems. Model-estimated SO2 increases as grid cell size decreases from 4 km to 250 m. However, it is notable that the 1-km model estimates using 1-km meteorological model input are higher than the 1-km model simulation that used interpolated 4-km meteorology. The inclusion of sub-grid plume treatment did not improve model skill in predicting SO2 in time and space and generally acts to keep emitted mass aloft.
Accelerating calculations of RNA secondary structure partition functions using GPUs
2013-01-01
Background RNA performs many diverse functions in the cell in addition to its role as a messenger of genetic information. These functions depend on its ability to fold to a unique three-dimensional structure determined by the sequence. The conformation of RNA is in part determined by its secondary structure, or the particular set of contacts between pairs of complementary bases. Prediction of the secondary structure of RNA from its sequence is therefore of great interest, but can be computationally expensive. In this work we accelerate computations of base-pair probababilities using parallel graphics processing units (GPUs). Results Calculation of the probabilities of base pairs in RNA secondary structures using nearest-neighbor standard free energy change parameters has been implemented using CUDA to run on hardware with multiprocessor GPUs. A modified set of recursions was introduced, which reduces memory usage by about 25%. GPUs are fastest in single precision, and for some hardware, restricted to single precision. This may introduce significant roundoff error. However, deviations in base-pair probabilities calculated using single precision were found to be negligible compared to those resulting from shifting the nearest-neighbor parameters by a random amount of magnitude similar to their experimental uncertainties. For large sequences running on our particular hardware, the GPU implementation reduces execution time by a factor of close to 60 compared with an optimized serial implementation, and by a factor of 116 compared with the original code. Conclusions Using GPUs can greatly accelerate computation of RNA secondary structure partition functions, allowing calculation of base-pair probabilities for large sequences in a reasonable amount of time, with a negligible compromise in accuracy due to working in single precision. The source code is integrated into the RNAstructure software package and available for download at http://rna.urmc.rochester.edu. PMID:24180434
NASA Technical Reports Server (NTRS)
Kavaya, Michael J.; Singh, Upendra N.; Koch, Grady J.; Yu, Jirong; Frehlich, Rod G.
2009-01-01
We present preliminary results of computer simulations of the error in measuring carbon dioxide mixing ratio profiles from earth orbit. The simulated sensor is a pulsed, 2-micron, coherent-detection lidar alternately operating on at least two wavelengths. The simulated geometry is a nadir viewing lidar measuring the column content signal. Atmospheric absorption is modeled using FASCODE3P software with the HITRAN 2004 absorption line data base. Lidar shot accumulation is employed up to the horizontal resolution limit. Horizontal resolutions of 50, 100, and 200 km are shown. Assuming a 400 km spacecraft orbit, the horizontal resolutions correspond to measurement times of about 7, 14, and 28 s. We simulate laser pulse-pair repetition frequencies from 1 Hz to 100 kHz. The range of shot accumulation is 7 to 2.8 million pulse-pairs. The resultant error is shown as a function of horizontal resolution, laser pulse-pair repetition frequency, and laser pulse energy. The effect of different on and off pulse energies is explored. The results are compared to simulation results of others and to demonstrated 2-micron operating points at NASA Langley.
Papavasileiou, Antonios; Madesis, Panagiotis B; Karaoglanidis, George S
2016-09-01
Brown rot is a devastating disease of stone fruit caused by Monilinia spp. Among these species, Monilinia fructicola is a quarantine pathogen in Europe but has recently been detected in several European countries. Identification of brown rot agents relies on morphological differences or use of molecular methods requiring fungal isolation. The current study was initiated to develop and validate a high-resolution melting (HRM) method for the identification of the Monilinia spp. and for the detection of M. fructicola among other brown rot pathogens. Based on the sequence of the cytb intron from M. laxa, M. fructicola, M. fructigena, M. mumecola, M. linhartiana, and M. yunnanensis isolates originating from several countries, a pair of universal primers for species identification and a pair of primers specific to M. fructicola were designed. The specificity of the primers was verified to ensure against cross-reaction with other fungal species. The melting curve analysis using the universal primers generated six different HRM curve profiles, each one specific for each species. Τhe HRM analysis primers specific to M. fructicola amplified a 120-bp region with a distinct melt profile corresponding to the presence of M. fructicola, regardless of the presence of other species. HRM analysis can be a useful tool for rapid identification and differentiation of the six Monilinia spp. using a single primer pair. This novel assay has the potential for simultaneous identification and differentiation of the closely related Monilinia spp. as well as for the differentiation of M. fructicola from other common pathogens or saprophytes that may occur on the diseased fruit.
Compton scatter tomography in TOF-PET
NASA Astrophysics Data System (ADS)
Hemmati, Hamidreza; Kamali-Asl, Alireza; Ay, Mohammadreza; Ghafarian, Pardis
2017-10-01
Scatter coincidences contain hidden information about the activity distribution on the positron emission tomography (PET) imaging system. However, in conventional reconstruction, the scattered data cause the blurring of images and thus are estimated and subtracted from detected coincidences. List mode format provides a new aspect to use time of flight (TOF) and energy information of each coincidence in the reconstruction process. In this study, a novel approach is proposed to reconstruct activity distribution using the scattered data in the PET system. For each single scattering coincidence, a scattering angle can be determined by the recorded energy of the detected photons, and then possible locations of scattering can be calculated based on the scattering angle. Geometry equations show that these sites lie on two arcs in 2D mode or the surface of a prolate spheroid in 3D mode, passing through the pair of detector elements. The proposed method uses a novel and flexible technique to estimate source origin locations from the possible scattering locations, using the TOF information. Evaluations were based on a Monte-Carlo simulation of uniform and non-uniform phantoms at different resolutions of time and detector energy. The results show that although the energy uncertainties deteriorate the image spatial resolution in the proposed method, the time resolution has more impact on image quality than the energy resolution. With progress of the TOF system, the reconstruction using the scattered data can be used in a complementary manner, or to improve image quality in the next generation of PET systems.
Compositions and methods for detecting single nucleotide polymorphisms
Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.
2016-11-22
Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.
APOLLO: a quality assessment service for single and multiple protein models.
Wang, Zheng; Eickholt, Jesse; Cheng, Jianlin
2011-06-15
We built a web server named APOLLO, which can evaluate the absolute global and local qualities of a single protein model using machine learning methods or the global and local qualities of a pool of models using a pair-wise comparison approach. Based on our evaluations on 107 CASP9 (Critical Assessment of Techniques for Protein Structure Prediction) targets, the predicted quality scores generated from our machine learning and pair-wise methods have an average per-target correlation of 0.671 and 0.917, respectively, with the true model quality scores. Based on our test on 92 CASP9 targets, our predicted absolute local qualities have an average difference of 2.60 Å with the actual distances to native structure. http://sysbio.rnet.missouri.edu/apollo/. Single and pair-wise global quality assessment software is also available at the site.
NASA Astrophysics Data System (ADS)
Wiese, D. N.; McCullough, C. M.
2017-12-01
Studies have shown that both single pair low-low satellite-to-satellite tracking (LL-SST) and dual-pair LL-SST hypothetical future satellite gravimetry missions utilizing improved onboard measurement systems relative to the Gravity Recovery and Climate Experiment (GRACE) will be limited by temporal aliasing errors; that is, the error introduced through deficiencies in models of high frequency mass variations required for the data processing. Here, we probe the spatio-temporal characteristics of temporal aliasing errors to understand their impact on satellite gravity retrievals using high fidelity numerical simulations. We find that while aliasing errors are dominant at long wavelengths and multi-day timescales, improving knowledge of high frequency mass variations at these resolutions translates into only modest improvements (i.e. spatial resolution/accuracy) in the ability to measure temporal gravity variations at monthly timescales. This result highlights the reliance on accurate models of high frequency mass variations for gravity processing, and the difficult nature of reducing temporal aliasing errors and their impact on satellite gravity retrievals.
Evidence of Knowledge Acquisition in a Cognitive Flexibility-Based Computer Learning Environment
Heath, Scott; Higgs, John; Ambruso, Daniel R.
2008-01-01
Background A computer-based learning experience was developed using cognitive flexibility theory to overcome the pitfalls often encountered in existing medical education. An earlier study (not published) showed significant pretest-posttest increase in scores, as well as a significant positive correlation between choosing to complete the module individually or in pairs. Method This experience was presented as part of a second-year course in medical school with randomized assignment for students to complete the program as pairs or individuals. Results Sixty-six scores of 101 medical students (31 from students working as singles and 35 from 70 working in pairs) were analyzed. Out of 47 possible points, the mean pretest score was 15.1 (SD = 6.4, range 13.7-15.9). The mean posttest score was 22.9 (SD = 5.2, range 21.1-24.2). Posttest scores were statistically significantly higher than pretest scores (p<.001, Cohen's d = 1.17, average gain 7.8 points). Both pairs and singles showed pre-to-post test score gains, but the score gains of pairs and singles were not significantly different. Conclusion This learning module served as an effective instructional intervention. However, the effect of collaboration, measured by score gains for pairs, was not significantly different from score gains of students completing the assignment individually. PMID:20165544
NASA Astrophysics Data System (ADS)
Yang, Guang; Ye, Xujiong; Slabaugh, Greg; Keegan, Jennifer; Mohiaddin, Raad; Firmin, David
2016-03-01
In this paper, we propose a novel self-learning based single-image super-resolution (SR) method, which is coupled with dual-tree complex wavelet transform (DTCWT) based denoising to better recover high-resolution (HR) medical images. Unlike previous methods, this self-learning based SR approach enables us to reconstruct HR medical images from a single low-resolution (LR) image without extra training on HR image datasets in advance. The relationships between the given image and its scaled down versions are modeled using support vector regression with sparse coding and dictionary learning, without explicitly assuming reoccurrence or self-similarity across image scales. In addition, we perform DTCWT based denoising to initialize the HR images at each scale instead of simple bicubic interpolation. We evaluate our method on a variety of medical images. Both quantitative and qualitative results show that the proposed approach outperforms bicubic interpolation and state-of-the-art single-image SR methods while effectively removing noise.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sirunyan, A. M.; Tumasyan, A.; Adam, W.
A search is presented for the production of vector-like quark pairs, Tmore » $$\\overline{\\mathrm{T}}$$or Y$$\\overline{\\mathrm{Y}}$$, with electric charge of 2/3 (T) or -4/3 (Y), in proton-proton collisions at $$\\sqrt{s} =$$ 13 TeV. The data were collected by the CMS experiment at the LHC in 2016 and correspond to an integrated luminosity of 35.8 fb$$^{-1}$$. The T and Y quarks are assumed to decay exclusively to a W boson and a b quark. The search is based on events with a single isolated electron or muon, large missing transverse momentum, and at least four jets with large transverse momenta. In the search, a kinematic reconstruction of the final state observables is performed, which would permit a signal to be detected as a narrow mass peak ($$\\approx$$7% resolution). The observed number of events is consistent with the standard model prediction. Assuming strong pair production of the vector-like quarks and a 100% branching fraction to bW, a lower limit of 1295 GeV at 95% confidence level is set on the T and Y quark masses.« less
Sirunyan, A. M.; Tumasyan, A.; Adam, W.; ...
2018-02-03
A search is presented for the production of vector-like quark pairs, Tmore » $$\\overline{\\mathrm{T}}$$or Y$$\\overline{\\mathrm{Y}}$$, with electric charge of 2/3 (T) or -4/3 (Y), in proton-proton collisions at $$\\sqrt{s} =$$ 13 TeV. The data were collected by the CMS experiment at the LHC in 2016 and correspond to an integrated luminosity of 35.8 fb$$^{-1}$$. The T and Y quarks are assumed to decay exclusively to a W boson and a b quark. The search is based on events with a single isolated electron or muon, large missing transverse momentum, and at least four jets with large transverse momenta. In the search, a kinematic reconstruction of the final state observables is performed, which would permit a signal to be detected as a narrow mass peak ($$\\approx$$7% resolution). The observed number of events is consistent with the standard model prediction. Assuming strong pair production of the vector-like quarks and a 100% branching fraction to bW, a lower limit of 1295 GeV at 95% confidence level is set on the T and Y quark masses.« less
Pilot production and advanced development of large-area picosecond photodetectors
NASA Astrophysics Data System (ADS)
Minot, Michael J.; Adams, Bernhard W.; Aviles, Melvin; Bond, Justin L.; Craven, Christopher A.; Cremer, Till; Foley, Michael R.; Lyashenko, Alexey; Popecki, Mark A.; Stochaj, Michael E.; Worstell, William A.; Mane, Anil U.; Elam, Jeffrey W.; Siegmund, Oswald H. W.; Ertley, Camden; Frisch, Henry; Elagin, Andrey
2016-09-01
We report pilot production and advanced development performance results achieved for Large Area Picosecond Photodetectors (LAPPD). The LAPPD is a microchannel plate (MCP) based photodetector, capable of imaging with single-photon sensitivity at high spatial and temporal resolutions in a hermetic package with an active area of 400 square centimeters. In December 2015, Incom Inc. completed installation of equipment and facilities for demonstration of early stage pilot production of LAPPD. Initial fabrication trials commenced in January 2016. The "baseline" LAPPD employs an all-glass hermetic package with top and bottom plates and sidewalls made of borosilicate float glass. Signals are generated by a bi-alkali Na2KSb photocathode and amplified with a stacked chevron pair of "next generation" MCPs produced by applying resistive and emissive atomic layer deposition coatings to borosilicate glass capillary array (GCA) substrates. Signals are collected on RF strip-line anodes applied to the bottom plates which exit the detector via pinfree hermetic seals under the side walls. Prior tests show that LAPPDs have electron gains greater than 107, submillimeter space resolution for large pulses and several mm for single photons, time resolutions of 50 picoseconds for single photons, predicted resolution of less than 5 picoseconds for large pulses, high stability versus charge extraction, and good uniformity. LAPPD performance results for product produced during the first half of 2016 will be reviewed. Recent advances in the development of LAPPD will also be reviewed, as the baseline design is adapted to meet the requirements for a wide range of emerging application. These include a novel ceramic package design, ALD coated MCPs optimized to have a low temperature coefficient of resistance (TCR) and further advances to adapt the LAPPD for cryogenic applications using Liquid Argon (LAr). These developments will meet the needs for DOE-supported RD for the Deep Underground Neutrino Experiment (DUNE), nuclear physics applications such as EIC, medical, homeland security and astronomical applications for direct and indirect photon detection.
Watson-Crick base pairing controls excited-state decay in natural DNA.
Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang
2014-10-13
Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints
Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.
2015-01-01
Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536
Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G
2015-05-14
Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.
Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition.
Renneberg, Dorte; Dervan, Peter B
2003-05-14
The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.
High Speed Computational Ghost Imaging via Spatial Sweeping
NASA Astrophysics Data System (ADS)
Wang, Yuwang; Liu, Yang; Suo, Jinli; Situ, Guohai; Qiao, Chang; Dai, Qionghai
2017-03-01
Computational ghost imaging (CGI) achieves single-pixel imaging by using a Spatial Light Modulator (SLM) to generate structured illuminations for spatially resolved information encoding. The imaging speed of CGI is limited by the modulation frequency of available SLMs, and sets back its practical applications. This paper proposes to bypass this limitation by trading off SLM’s redundant spatial resolution for multiplication of the modulation frequency. Specifically, a pair of galvanic mirrors sweeping across the high resolution SLM multiply the modulation frequency within the spatial resolution gap between SLM and the final reconstruction. A proof-of-principle setup with two middle end galvanic mirrors achieves ghost imaging as fast as 42 Hz at 80 × 80-pixel resolution, 5 times faster than state-of-the-arts, and holds potential for one magnitude further multiplication by hardware upgrading. Our approach brings a significant improvement in the imaging speed of ghost imaging and pushes ghost imaging towards practical applications.
Zhan, Qiuqiang; Liu, Haichun; Wang, Baoju; Wu, Qiusheng; Pu, Rui; Zhou, Chao; Huang, Bingru; Peng, Xingyun; Ågren, Hans; He, Sailing
2017-10-20
Stimulated emission depletion microscopy provides a powerful sub-diffraction imaging modality for life science studies. Conventionally, stimulated emission depletion requires a relatively high light intensity to obtain an adequate depletion efficiency through only light-matter interaction. Here we show efficient emission depletion for a class of lanthanide-doped upconversion nanoparticles with the assistance of interionic cross relaxation, which significantly lowers the laser intensity requirements of optical depletion. We demonstrate two-color super-resolution imaging using upconversion nanoparticles (resolution ~ 66 nm) with a single pair of excitation/depletion beams. In addition, we show super-resolution imaging of immunostained cytoskeleton structures of fixed cells (resolution ~ 82 nm) using upconversion nanoparticles. These achievements provide a new perspective for the development of photoswitchable luminescent probes and will broaden the applications of lanthanide-doped nanoparticles for sub-diffraction microscopic imaging.
Room-temperature ultrafast nonlinear spectroscopy of a single molecule
NASA Astrophysics Data System (ADS)
Liebel, Matz; Toninelli, Costanza; van Hulst, Niek F.
2018-01-01
Single-molecule spectroscopy aims to unveil often hidden but potentially very important contributions of single entities to a system's ensemble response. Albeit contributing tremendously to our ever growing understanding of molecular processes, the fundamental question of temporal evolution, or change, has thus far been inaccessible, thus painting a static picture of a dynamic world. Here, we finally resolve this dilemma by performing ultrafast time-resolved transient spectroscopy on a single molecule. By tracing the femtosecond evolution of excited electronic state spectra of single molecules over hundreds of nanometres of bandwidth at room temperature, we reveal their nonlinear ultrafast response in an effective three-pulse scheme with fluorescence detection. A first excitation pulse is followed by a phase-locked de-excitation pulse pair, providing spectral encoding with 25 fs temporal resolution. This experimental realization of true single-molecule transient spectroscopy demonstrates that two-dimensional electronic spectroscopy of single molecules is experimentally within reach.
Globally optimal tumor segmentation in PET-CT images: a graph-based co-segmentation method.
Han, Dongfeng; Bayouth, John; Song, Qi; Taurani, Aakant; Sonka, Milan; Buatti, John; Wu, Xiaodong
2011-01-01
Tumor segmentation in PET and CT images is notoriously challenging due to the low spatial resolution in PET and low contrast in CT images. In this paper, we have proposed a general framework to use both PET and CT images simultaneously for tumor segmentation. Our method utilizes the strength of each imaging modality: the superior contrast of PET and the superior spatial resolution of CT. We formulate this problem as a Markov Random Field (MRF) based segmentation of the image pair with a regularized term that penalizes the segmentation difference between PET and CT. Our method simulates the clinical practice of delineating tumor simultaneously using both PET and CT, and is able to concurrently segment tumor from both modalities, achieving globally optimal solutions in low-order polynomial time by a single maximum flow computation. The method was evaluated on clinically relevant tumor segmentation problems. The results showed that our method can effectively make use of both PET and CT image information, yielding segmentation accuracy of 0.85 in Dice similarity coefficient and the average median hausdorff distance (HD) of 6.4 mm, which is 10% (resp., 16%) improvement compared to the graph cuts method solely using the PET (resp., CT) images.
Optimization of single-base-pair mismatch discrimination in oligonucleotide microarrays
NASA Technical Reports Server (NTRS)
Urakawa, Hidetoshi; El Fantroussi, Said; Smidt, Hauke; Smoot, James C.; Tribou, Erik H.; Kelly, John J.; Noble, Peter A.; Stahl, David A.
2003-01-01
The discrimination between perfect-match and single-base-pair-mismatched nucleic acid duplexes was investigated by using oligonucleotide DNA microarrays and nonequilibrium dissociation rates (melting profiles). DNA and RNA versions of two synthetic targets corresponding to the 16S rRNA sequences of Staphylococcus epidermidis (38 nucleotides) and Nitrosomonas eutropha (39 nucleotides) were hybridized to perfect-match probes (18-mer and 19-mer) and to a set of probes having all possible single-base-pair mismatches. The melting profiles of all probe-target duplexes were determined in parallel by using an imposed temperature step gradient. We derived an optimum wash temperature for each probe and target by using a simple formula to calculate a discrimination index for each temperature of the step gradient. This optimum corresponded to the output of an independent analysis using a customized neural network program. These results together provide an experimental and analytical framework for optimizing mismatch discrimination among all probes on a DNA microarray.
Concept for room temperature single-spin tunneling force microscopy with atomic spatial resolution
NASA Astrophysics Data System (ADS)
Payne, Adam
A study of a force detected single-spin magnetic resonance measurement concept with atomic spatial resolution is presented. The method is based upon electrostatic force detection of spin-selection rule controlled single electron tunneling between two electrically isolated paramagnetic states. Single-spin magnetic resonance detection is possible by measuring the force detected tunneling charge noise on and off spin resonance. Simulation results of this charge noise, based upon physical models of the tunneling and spin physics, are directly compared to measured atomic force microscopy (AFM) system noise. The results show that the approach could provide single-spin measurement of electrically isolated defect states with atomic spatial resolution at room temperature.
Lemeshewsky, G.P.; Rahman, Z.-U.; Schowengerdt, R.A.; Reichenbach, S.E.
2002-01-01
Enhanced false color images from mid-IR, near-IR (NIR), and visible bands of the Landsat thematic mapper (TM) are commonly used for visually interpreting land cover type. Described here is a technique for sharpening or fusion of NIR with higher resolution panchromatic (Pan) that uses a shift-invariant implementation of the discrete wavelet transform (SIDWT) and a reported pixel-based selection rule to combine coefficients. There can be contrast reversals (e.g., at soil-vegetation boundaries between NIR and visible band images) and consequently degraded sharpening and edge artifacts. To improve performance for these conditions, I used a local area-based correlation technique originally reported for comparing image-pyramid-derived edges for the adaptive processing of wavelet-derived edge data. Also, using the redundant data of the SIDWT improves edge data generation. There is additional improvement because sharpened subband imagery is used with the edge-correlation process. A reported technique for sharpening three-band spectral imagery used forward and inverse intensity, hue, and saturation transforms and wavelet-based sharpening of intensity. This technique had limitations with opposite contrast data, and in this study sharpening was applied to single-band multispectral-Pan image pairs. Sharpening used simulated 30-m NIR imagery produced by degrading the spatial resolution of a higher resolution reference. Performance, evaluated by comparison between sharpened and reference image, was improved when sharpened subband data were used with the edge correlation.
Hybrid region merging method for segmentation of high-resolution remote sensing images
NASA Astrophysics Data System (ADS)
Zhang, Xueliang; Xiao, Pengfeng; Feng, Xuezhi; Wang, Jiangeng; Wang, Zuo
2014-12-01
Image segmentation remains a challenging problem for object-based image analysis. In this paper, a hybrid region merging (HRM) method is proposed to segment high-resolution remote sensing images. HRM integrates the advantages of global-oriented and local-oriented region merging strategies into a unified framework. The globally most-similar pair of regions is used to determine the starting point of a growing region, which provides an elegant way to avoid the problem of starting point assignment and to enhance the optimization ability for local-oriented region merging. During the region growing procedure, the merging iterations are constrained within the local vicinity, so that the segmentation is accelerated and can reflect the local context, as compared with the global-oriented method. A set of high-resolution remote sensing images is used to test the effectiveness of the HRM method, and three region-based remote sensing image segmentation methods are adopted for comparison, including the hierarchical stepwise optimization (HSWO) method, the local-mutual best region merging (LMM) method, and the multiresolution segmentation (MRS) method embedded in eCognition Developer software. Both the supervised evaluation and visual assessment show that HRM performs better than HSWO and LMM by combining both their advantages. The segmentation results of HRM and MRS are visually comparable, but HRM can describe objects as single regions better than MRS, and the supervised and unsupervised evaluation results further prove the superiority of HRM.
Shivanandan, Arun; Unnikrishnan, Jayakrishnan; Radenovic, Aleksandra
2015-01-01
Single Molecule Localization Microscopy techniques like PhotoActivated Localization Microscopy, with their sub-diffraction limit spatial resolution, have been popularly used to characterize the spatial organization of membrane proteins, by means of quantitative cluster analysis. However, such quantitative studies remain challenged by the techniques’ inherent sources of errors such as a limited detection efficiency of less than 60%, due to incomplete photo-conversion, and a limited localization precision in the range of 10 – 30nm, varying across the detected molecules, mainly depending on the number of photons collected from each. We provide analytical methods to estimate the effect of these errors in cluster analysis and to correct for them. These methods, based on the Ripley’s L(r) – r or Pair Correlation Function popularly used by the community, can facilitate potentially breakthrough results in quantitative biology by providing a more accurate and precise quantification of protein spatial organization. PMID:25794150
Yang, Lixia; Zhong, Zhensheng; Tong, Cailing; Jia, Huan; Liu, Yiran; Chen, Gang
2018-06-08
A wobble A∙C pair can be protonated at near physiological pH to form a more stable wobble A+∙C pair. Here, we constructed an RNA hairpin (rHP) and three mutants with one A-U base pair substituted with an A∙C mismatch on the top (near the loop, U22C), middle (U25C) and bottom (U29C) positions of the stem, respectively. Our results on single-molecule mechanical (un)folding using optical tweezers reveal the destabilization effect of A-U to A∙C pair substitution, and protonation-dependent enhancement of mechanical stability facilitated through an increased folding rate, or decreased unfolding rate, or both. Our data show that protonation may occur rapidly upon the formation of apparent mechanical folding transition state. Furthermore, we measured the bulk -1 ribosomal frameshifting efficiencies of the hairpins by a cell-free translation assay. For the mRNA hairpins studied, -1 frameshifting efficiency correlates with mechanical unfolding force at equilibrium and folding rate at around 15 pN. U29C has a frameshifting efficiency similar to that of rHP (~2%). Accordingly, the bottom 2-4 base pairs of U29C may not form under a stretching force at pH 7.3, which is consistent with the fact that the bottom base pairs of the hairpins may be disrupted by ribosome at the slippery site. U22C and U25C have a similar frameshifting efficiency (~1%), indicating that both unfolding and folding rates of an mRNA hairpin in a crowded environment may affect frameshifting. Our data indicate that mechanical (un)folding of RNA hairpins may mimic how mRNAs unfold and fold in the presence of translating ribosomes.
Guan, Xiaoyan; Brownstein, Naomi C; Young, Nicolas L; Marshall, Alan G
2017-01-30
Bottom-up tandem mass spectrometry (MS/MS) is regularly used in proteomics to identify proteins from a sequence database. De novo sequencing is also available for sequencing peptides with relatively short sequence lengths. We recently showed that paired Lys-C and Lys-N proteases produce peptides of identical mass and similar retention time, but different tandem mass spectra. Such parallel experiments provide complementary information, and allow for up to 100% MS/MS sequence coverage. Here, we report digestion by paired Lys-C and Lys-N proteases of a seven-protein mixture: human hemoglobin alpha, bovine carbonic anhydrase 2, horse skeletal muscle myoglobin, hen egg white lysozyme, bovine pancreatic ribonuclease, bovine rhodanese, and bovine serum albumin, followed by reversed-phase nanoflow liquid chromatography, collision-induced dissociation, and 14.5 T Fourier transform ion cyclotron resonance mass spectrometry. Matched pairs of product peptide ions of equal precursor mass and similar retention times from each digestion are compared, leveraging single-residue transposed information with independent interferences to confidently identify fragment ion types, residues, and peptides. Selected pairs of product ion mass spectra for de novo sequenced protein segments from each member of the mixture are presented. Pairs of the transposed product ions as well as complementary information from the parallel experiments allow for both high MS/MS coverage for long peptide sequences and high confidence in the amino acid identification. Moreover, the parallel experiments in the de novo sequencing reduce false-positive matches of product ions from the single-residue transposed peptides from the same segment, and thereby further improve the confidence in protein identification. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
e.motion - European Initiatives for a Future Gravity Field Mission
NASA Astrophysics Data System (ADS)
Gruber, T.
2017-12-01
Since 2010 a large team of European scientists, with the support of technological and industrial partners, is preparing proposals for new gravity field missions as follow-up to GRACE, GOCE and GRACE-FO. The main goal of the proposed mission concepts is the long term observation of the time variable gravity field with significantly increased spatial and temporal resolution as it can be performed nowadays with GRACE or in the near future with GRACE Follow-On. These observations are crucial for long term monitoring of mass variations in the system Earth in order to improve our knowledge about the global and regional water cycle as well as about processes of the solid Earth. Starting from the existing concepts of single pair mission like GRACE and GRACE-FO, sensitivity, spatial and temporal resolution shall be increased, such that also smaller scale time variable signals can be resolved, which cannot be detected with the current techniques. For such a mission concept new and significantly improved observation techniques are needed. This concerns in particular the measurement of inter-satellite distances, the observation of non-gravitational accelerations, the configuration of the satellite orbit and most important the implementation of constellation of satellite pairs. All in all three proposals have been prepared by the e.motion team specifying in detail the mission design and the performance in terms of science applications. Starting with a single-pair pendulum mission, which was proposed for ESA's Earth Explorer 8 call (EE8), more recently a double-pair Bender-type mission was proposed for the ESA's EE9 call. In between several studies on European (DLR and ESA) and inter-agency level (ESA-NASA) have been performed. The presentation provides a summary about all these initiatives, derives some conclusions which can be drawn from the mission proposals and study results and gives an outlook about future initiatives for gravity field missions in Europe.
Scott, Ann E; Milward, Mike; Linden, Gerard J; Matthews, John B; Carlile, Monica J; Lundy, Fionnuala T; Naeeni, Mojgan A; Lorraine Martin, S; Walker, Brian; Kinane, Denis; Brock, Gareth R; Chapple, Iain L C
2012-02-01
To characterize and map temporal changes in the biological and clinical phenotype during a 21-day experimental gingivitis study. Experimental gingivitis was induced over 21 days in healthy human volunteers (n = 56), after which normal brushing was resumed (resolution phase). Gingival and plaque indices were assessed. Gingival crevicular fluid was collected from four paired test and contra-lateral control sites in each volunteer during induction (Days 0, 7, 14 and 21) and resolution (Days 28 and 42) of experimental gingivitis. Fluid volumes were measured and a single analyte was quantified from each site-specific, 30s sample. Data were evaluated by analysis of repeated measurements and paired sample tests. Clinical indices and gingival crevicular fluid volumes at test sites increased from Day 0, peaking at Day 21 (test/control differences all p < 0.0001) and decreased back to control levels by Day 28. Levels of four inflammatory markers showed similar patterns, with significant differences between test and control apparent at Day 7 (substance P, cathepsin G, interleukin-1β, elastase: all p < 0.03) and peaking at Day 21 (all p < 0.002). Levels of α-1-antitrypsin showed no pattern. Levels of substance P, cathepsin G, interleukin-1β and neutrophil elastase act as objective biomarkers of gingival inflammation induction and resolution that typically precede phenotypical changes. © 2011 John Wiley & Sons A/S.
In-depth study of single photon time resolution for the Philips digital silicon photomultiplier
NASA Astrophysics Data System (ADS)
Liu, Z.; Gundacker, S.; Pizzichemi, M.; Ghezzi, A.; Auffray, E.; Lecoq, P.; Paganoni, M.
2016-06-01
The digital silicon photomultiplier (SiPM) has been commercialised by Philips as an innovative technology compared to analog silicon photomultiplier devices. The Philips digital SiPM, has a pair of time to digital converters (TDCs) connected to 12800 single photon avalanche diodes (SPADs). Detailed measurements were performed to understand the low photon time response of the Philips digital SiPM. The single photon time resolution (SPTR) of every single SPAD in a pixel consisting of 3200 SPADs was measured and an average value of 85 ps full width at half maximum (FWHM) was observed. Each SPAD sends the signal to the TDC with different signal propagation time, resulting in a so called trigger network skew. This distribution of the trigger network skew for a pixel (3200 SPADs) has been measured and a variation of 50 ps FWHM was extracted. The SPTR of the whole pixel is the combination of SPAD jitter, trigger network skew, and the SPAD non-uniformity. The SPTR of a complete pixel was 103 ps FWHM at 3.3 V above breakdown voltage. Further, the effect of the crosstalk at a low photon level has been studied, with the two photon time resolution degrading if the events are a combination of detected (true) photons and crosstalk events. Finally, the time response to multiple photons was investigated.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Yi-Siang; Yin, Chih-Chien; Chao, Sheng D., E-mail: sdchao@spring.iam.ntu.edu.tw
2014-10-07
We perform an ab initio computational study of molecular complexes with the general formula CF{sub 3}X—B that involve one trifluorohalomethane CF{sub 3}X (X = Cl or Br) and one of a series of Lewis bases B in the gas phase. The Lewis bases are so chosen that they provide a range of electron-donating abilities for comparison. Based on the characteristics of their electron pairs, we consider the Lewis bases with a single n-pair (NH{sub 3} and PH{sub 3}), two n-pairs (H{sub 2}O and H{sub 2}S), two n-pairs with an unsaturated bond (H{sub 2}CO and H{sub 2}CS), and a single π-pairmore » (C{sub 2}H{sub 4}) and two π-pairs (C{sub 2}H{sub 2}). The aim is to systematically investigate the influence of the electron pair characteristics and the central atom substitution effects on the geometries and energetics of the formed complexes. The counterpoise-corrected supermolecule MP2 and coupled-cluster single double with perturbative triple [CCSD(T)] levels of theory have been employed, together with a series of basis sets up to aug-cc-pVTZ. The angular and radial configurations, the binding energies, and the electrostatic potentials of the stable complexes have been compared and discussed as the Lewis base varies. For those complexes where halogen bonding plays a significant role, the calculated geometries and energetics are consistent with the σ-hole model. Upon formation of stable complexes, the C–X bond lengths shorten, while the C–X vibrational frequencies increase, thus rendering blueshifting halogen bonds. The central atom substitution usually enlarges the intermolecular bond distances while it reduces the net charge transfers, thus weakening the bond strengths. The analysis based on the σ-hole model is grossly reliable but requires suitable modifications incorporating the central atom substitution effects, in particular, when interaction components other than electrostatic contributions are involved.« less
Design and Analysis of a Single-Camera Omnistereo Sensor for Quadrotor Micro Aerial Vehicles (MAVs).
Jaramillo, Carlos; Valenti, Roberto G; Guo, Ling; Xiao, Jizhong
2016-02-06
We describe the design and 3D sensing performance of an omnidirectional stereo (omnistereo) vision system applied to Micro Aerial Vehicles (MAVs). The proposed omnistereo sensor employs a monocular camera that is co-axially aligned with a pair of hyperboloidal mirrors (a vertically-folded catadioptric configuration). We show that this arrangement provides a compact solution for omnidirectional 3D perception while mounted on top of propeller-based MAVs (not capable of large payloads). The theoretical single viewpoint (SVP) constraint helps us derive analytical solutions for the sensor's projective geometry and generate SVP-compliant panoramic images to compute 3D information from stereo correspondences (in a truly synchronous fashion). We perform an extensive analysis on various system characteristics such as its size, catadioptric spatial resolution, field-of-view. In addition, we pose a probabilistic model for the uncertainty estimation of 3D information from triangulation of back-projected rays. We validate the projection error of the design using both synthetic and real-life images against ground-truth data. Qualitatively, we show 3D point clouds (dense and sparse) resulting out of a single image captured from a real-life experiment. We expect the reproducibility of our sensor as its model parameters can be optimized to satisfy other catadioptric-based omnistereo vision under different circumstances.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ogle, James M.; Brodersen, Ditlev E.; Clemons, William M.
Crystal structures of the 30S ribosomal subunit in complex with messenger RNA and cognate transfer RNA in the A site, both in the presence and absence of the antibiotic paromomycin, have been solved at between 3.1 and 3.3 angstroms resolution. Cognate transfer RNA (tRNA) binding induces global domain movements of the 30S subunit and changes in the conformation of the universally conserved and essential bases A1492, A1493, and G530 of 16S RNA. These bases interact intimately with the minor groove of the first two base pairs between the codon and anticodon, thus sensing Watson-Crick base-pairing geometry and discriminating against near-cognatemore » tRNA. The third, or 'wobble,' position of the codon is free to accommodate certain noncanonical base pairs. By partially inducing these structural changes, paromomycin facilitates binding of near-cognate tRNAs.« less
Jibran, Rubina; Sullivan, Kerry L; Crowhurst, Ross; Erridge, Zoe A; Chagné, David; McLachlan, Andrew R G; Brummell, David A; Dijkwel, Paul P; Hunter, Donald A
2015-11-01
Stresses such as energy deprivation, wounding and water-supply disruption often contribute to rapid deterioration of harvested tissues. To uncover the genetic regulation behind such stresses, a simple assessment system was used to detect senescence mutants in conjunction with two rapid mapping techniques to identify the causal mutations. To demonstrate the power of this approach, immature inflorescences of Arabidopsis plants that contained ethyl methanesulfonate-induced lesions were detached and screened for altered timing of dark-induced senescence. Numerous mutant lines displaying accelerated or delayed timing of senescence relative to wild type were discovered. The underlying mutations in three of these were identified using High Resolution Melting analysis to map to a chromosomal arm followed by a whole-genome sequencing-based mapping method, termed 'Needle in the K-Stack', to identify the causal lesions. All three mutations were single base pair changes and occurred in the same gene, NON-YELLOW COLORING1 (NYC1), a chlorophyll b reductase of the short-chain dehydrogenase/reductase (SDR) superfamily. This was consistent with the mutants preferentially retaining chlorophyll b, although substantial amounts of chlorophyll b were still lost. The single base pair mutations disrupted NYC1 function by three distinct mechanisms, one by producing a termination codon, the second by interfering with correct intron splicing and the third by replacing a highly conserved proline with a non-equivalent serine residue. This non-synonymous amino acid change, which occurred in the NADPH binding domain of NYC1, is the first example of such a mutation in an SDR protein inhibiting a physiological response in plants. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.
IIPImage: Large-image visualization
NASA Astrophysics Data System (ADS)
Pillay, Ruven
2014-08-01
IIPImage is an advanced high-performance feature-rich image server system that enables online access to full resolution floating point (as well as other bit depth) images at terabyte scales. Paired with the VisiOmatic (ascl:1408.010) celestial image viewer, the system can comfortably handle gigapixel size images as well as advanced image features such as both 8, 16 and 32 bit depths, CIELAB colorimetric images and scientific imagery such as multispectral images. Streaming is tile-based, which enables viewing, navigating and zooming in real-time around gigapixel size images. Source images can be in either TIFF or JPEG2000 format. Whole images or regions within images can also be rapidly and dynamically resized and exported by the server from a single source image without the need to store multiple files in various sizes.
NASA Astrophysics Data System (ADS)
Buckman, S. M.; Ius, D.
1996-02-01
This paper reports on the development of a digital coincidence-counting system which comprises a custom-built data acquisition card and associated PC software. The system has been designed to digitise the pulse-trains from two radiation detectors at a rate of 20 MSamples/s with 12-bit resolution. Through hardware compression of the data, the system can continuously record both individual pulse-shapes and the time intervals between pulses. Software-based circuits are used to process the stored pulse trains. These circuits are constructed simply by linking together icons representing various components such as coincidence mixers, time delays, single-channel analysers, deadtimes and scalers. This system enables a pair of pulse trains to be processed repeatedly using any number of different methods. Some preliminary results are presented in order to demonstrate the versatility and efficiency of this new method.
Localization-based super-resolution imaging of cellular structures.
Kanchanawong, Pakorn; Waterman, Clare M
2013-01-01
Fluorescence microscopy allows direct visualization of fluorescently tagged proteins within cells. However, the spatial resolution of conventional fluorescence microscopes is limited by diffraction to ~250 nm, prompting the development of super-resolution microscopy which offers resolution approaching the scale of single proteins, i.e., ~20 nm. Here, we describe protocols for single molecule localization-based super-resolution imaging, using focal adhesion proteins as an example and employing either photoswitchable fluorophores or photoactivatable fluorescent proteins. These protocols should also be easily adaptable to imaging a broad array of macromolecular assemblies in cells whose components can be fluorescently tagged and assemble into high density structures.
Kalim, Shahid; Nazir, Shaista; Khan, Zia Ullah
2013-01-01
Protocols based on newer high sensitivity Troponin T (hsTropT) assays can rule in a suspected Acute Myocardial Infarction (AMI) as early as 3 hours. We conducted this study to audit adherence to our Trust's newly introduced AMI diagnostic protocol based on paired hsTropT testing at 0 and 3 hours. We retrospectively reviewed data of all patients who had hsTropT test done between 1st and 7th May 2012. Patient's demographics, utility of single or paired samples, time interval between paired samples, patient's presenting symptoms and ECG findings were noted and their means, medians, Standard deviations and proportions were calculated. A total of 66 patients had hsTropT test done during this period. Mean age was 63.30 +/- 17.46 years and 38 (57.57%) were males. Twenty-four (36.36%) patients had only single, rather than protocol recommended paired hsTropT samples, taken. Among the 42 (63.63%) patients with paired samples, the mean time interval was found to be 4.41 +/- 5.7 hours. Contrary to the recommendations, 15 (22.73%) had a very long whereas 2 (3.03%) had a very short time interval between two samples. A subgroup analysis of patients with single samples, found only 2 (3.03%) patient with ST-segment elevation, appropriate for single testing. Our study confirmed that in a large number of patients the protocol for paired sampling or a recommended time interval of 3 hours between 2 samples was not being followed.
High-resolution mapping of transcription factor binding sites on native chromatin
Kasinathan, Sivakanthan; Orsi, Guillermo A.; Zentner, Gabriel E.; Ahmad, Kami; Henikoff, Steven
2014-01-01
Sequence-specific DNA-binding proteins including transcription factors (TFs) are key determinants of gene regulation and chromatin architecture. Formaldehyde cross-linking and sonication followed by Chromatin ImmunoPrecipitation (X-ChIP) is widely used for profiling of TF binding, but is limited by low resolution and poor specificity and sensitivity. We present a simple protocol that starts with micrococcal nuclease-digested uncross-linked chromatin and is followed by affinity purification of TFs and paired-end sequencing. The resulting ORGANIC (Occupied Regions of Genomes from Affinity-purified Naturally Isolated Chromatin) profiles of Saccharomyces cerevisiae Abf1 and Reb1 provide highly accurate base-pair resolution maps that are not biased toward accessible chromatin, and do not require input normalization. We also demonstrate the high specificity of our method when applied to larger genomes by profiling Drosophila melanogaster GAGA Factor and Pipsqueak. Our results suggest that ORGANIC profiling is a widely applicable high-resolution method for sensitive and specific profiling of direct protein-DNA interactions. PMID:24336359
High-Fidelity Down-Conversion Source for Secure Communications Using On-Demand Single Photons
NASA Technical Reports Server (NTRS)
Roberts, Tony
2015-01-01
AdvR, Inc., has built an efficient, fully integrated, waveguide-based source of spectrally uncorrelated photon pairs that will accelerate research and development (R&D) in the emerging field of quantum information science. Key to the innovation is the use of submicron periodically poled waveguides to produce counter propagating photon pairs, which is enabled by AdvR's patented segmented microelectrode poling technique. This novel device will provide a high brightness source of down-conversion pairs with enhanced spectral properties and low attenuation, and it will operate in the visible to the mid-infrared spectral region. A waveguide-based source of spectrally and spatially pure heralded photons will contribute to a wide range of NASA's advanced technology development efforts, including on-demand single photon sources for high-rate spaced-based secure communications.
Carr, Carolyn E; Khutsishvili, Irine; Marky, Luis A
2018-06-22
Triplex formation occurs via interaction of a third strand with the major groove of double stranded nucleic acid, through Hoogsteen hydrogen bonding. In this work, we use a combination of temperature-dependent UV spectroscopy and differential scanning calorimetry to determine complete thermodynamic profiles for the unfolding of poly(rA)•poly(rU) (Duplex) and poly(rA)•2poly(rU) (Triplex). Our thermodynamic results are in good agreement with the much earlier work of Krakauer and Sturtevant using only UV melting techniques. The folding of these two helices yielded an uptake of ions, ΔnNa+ = 0.15 mol Na+/mol base-pair (Duplex) and 0.30 mol Na+/mole base-triplet (Triplex), which are consistent with their polymer behavior and the higher charge density parameter of triple helices. The osmotic stress technique yielded a release of structural water, ΔnW = 2 mol H2O/mol base-pair (Duplex unfolding into single strands) and an uptake of structural water, ΔnW = 2 mol H2O/mole base-pair (Triplex unfolding into Duplex and a single strand). However, an overall release of electrostricted waters is obtained for the unfolding of both complexes from pressure perturbation calorimetric experiments. In total, the ΔV values obtained for the unfolding of Triplex into Duplex and a single strand correspond to an immobilization of two structural waters and a release of three electrostricted waters. The ΔV values obtained for the unfolding of Duplex into two single strands correspond to the release of two structural waters and the immobilization of four electrostricted water molecules.
Localization-based super-resolution imaging meets high-content screening.
Beghin, Anne; Kechkar, Adel; Butler, Corey; Levet, Florian; Cabillic, Marine; Rossier, Olivier; Giannone, Gregory; Galland, Rémi; Choquet, Daniel; Sibarita, Jean-Baptiste
2017-12-01
Single-molecule localization microscopy techniques have proven to be essential tools for quantitatively monitoring biological processes at unprecedented spatial resolution. However, these techniques are very low throughput and are not yet compatible with fully automated, multiparametric cellular assays. This shortcoming is primarily due to the huge amount of data generated during imaging and the lack of software for automation and dedicated data mining. We describe an automated quantitative single-molecule-based super-resolution methodology that operates in standard multiwell plates and uses analysis based on high-content screening and data-mining software. The workflow is compatible with fixed- and live-cell imaging and allows extraction of quantitative data like fluorophore photophysics, protein clustering or dynamic behavior of biomolecules. We demonstrate that the method is compatible with high-content screening using 3D dSTORM and DNA-PAINT based super-resolution microscopy as well as single-particle tracking.
Kinematic Alignment and Bonding of Silicon Mirrors for High-Resolution Astronomical X-Ray Optics
NASA Technical Reports Server (NTRS)
Chan, Kai-Wing; Mazzarella, James R.; Saha, Timo T.; Zhang, William W.; Mcclelland, Ryan S.; Biskack, Michael P.; Riveros, Raul E.; Allgood, Kim D.; Kearney, John D.; Sharpe, Marton V.;
2017-01-01
Optics for the next generation's high-resolution, high throughput x-ray telescope requires fabrication of well-formed lightweight mirror segments and their integration at arc-second precision. Recent advances in the fabrication of silicon mirrors developed at NASA/Goddard prompted us to develop a new method of mirror alignment and integration. In this method, stiff silicon mirrors are aligned quasi-kinematically and are bonded in an interlocking fashion to produce a "meta-shell" with large collective area. We address issues of aligning and bonding mirrors with this method and show a recent result of 4 seconds-of-arc for a single pair of mirrors tested at soft x-rays.
Crystal structure of a four-stranded intercalated DNA: d(C4)
NASA Technical Reports Server (NTRS)
Chen, L.; Cai, L.; Zhang, X.; Rich, A.
1994-01-01
The crystal structure of d(C4) solved at 2.3-A resolution reveals a four-stranded molecule composed of two interdigitated or intercalated duplexes. The duplexes are held together by hemiprotonated cytosine-cytosine base pairs and are parallel stranded, but the two duplexes point in opposite directions. The molecule has a slow right-handed twist of 12.4 degrees between covalently linked cytosine base pairs, and the base stacking distance is 3.1 A. This is in general agreement with the NMR studies. A biological role for DNA in this conformation is suggested.
Characterization of stacked-crystal PET detector designs for measurement of both TOF and DOI.
Schmall, Jeffrey P; Surti, Suleman; Karp, Joel S
2015-05-07
A PET detector with good timing resolution and two-level depth-of-interaction (DOI) discrimination can be constructed using a single-ended readout of scintillator stacks of Lanthanum Bromide (LaBr3), with various Cerium dopant concentrations, including pure Cerium Bromide (CeBr3). The stacked crystal geometry creates a unique signal shape for interactions occurring in each layer, which can be used to identify the DOI, while retaining the inherently good timing properties of LaBr3 and CeBr3. In this work, single pixel elements are used to optimize the choice of scintillator, coupling of layers, and type of photodetector, evaluating the performance using a fast, single-channel photomultiplier tube (PMT) and a single 4 × 4 mm(2) silicon photomultiplier (SiPM). We also introduce a method to quantify and evaluate the DOI discrimination accuracy. From signal shape measurements using fast waveform sampling, we found that in addition to differences in signal rise times, between crystal layers, there were also differences in the signal fall times. A DOI accuracy of 98% was achieved using our classification method for a stacked crystal pair, consisting of a 15 mm long LaBr3(Ce:20%) crystal on top of a 15 mm long CeBr3 crystal, readout using a PMT. A DOI accuracy of 95% was measured with a stack of two, identical, 12 mm long, CeBr3 crystals. The DOI accuracy of this crystal pair was reduced to 91% when using a SiPM for readout. For the stack of two, 12 mm long, CeBr3 crystals, a coincidence timing resolution (average of timing results from the top and bottom layer) of 199 ps was measured using a PMT, and this was improved to 153 ps when using a SiPM. These results show that with stacked LaBr3/CeBr3 scintillators and fast waveform sampling nearly perfect DOI accuracy can be achieved with excellent timing resolution-timing resolution that is only minimally degraded compared to results from a single CeBr3 crystal of comparable length to the stacked crystals. The interface in the stacked crystal geometry itself plays a major role in creating the differences in signal shape and this can be used to construct stacked DOI detectors using the same scintillator type, thereby simplifying and broadening the application of this technique.
Fluorescence multiplexing with time-resolved and spectral discrimination using a near-IR detector.
Zhu, Li; Stryjewski, Wieslaw; Lassiter, Suzanne; Soper, Steven A
2003-05-15
We report on the design and performance of a two-color, time-resolved detector for the acquisition of both steady-state and time-resolved fluorescence data acquired in real time during the capillary gel electrophoresis separation of DNA sequencing fragments. The detector consisted of a pair of pulsed laser diodes operating at 680 and 780 nm. The diode heads were coupled directly to single-mode fibers, which were terminated into a single fiber mounted via a FC/PC connector to the detector body. The detector contained a dichroic filter, which directed the dual-laser beams to an objective. The objective focused the laser light into a capillary gel column and also collected the resulting fluorescence emission. The dual-color emission was transmitted through the dichroic and focused onto a multimode fiber (core diameter 50 microm), which carried the luminescence to a pair of single-photon avalanche diodes (SPADs). The emission was sorted spectrally using a second dichroic onto one of two SPADs and isolated using appropriate interference filters (710- or 810-nm channel). The dual-color detector demonstrated a time response of 450 and 510 ps (fwhm) for the 710- and 810-nm channels, respectively. The mass detection limits for two near-IR dye-labeled sequencing primers electrophoresed in a capillary gel column were found to be 7.1 x 10(-21) and 3.2 x 10(-20) mol (SNR = 3) for the 710- and 810-nm detector channels, respectively. In addition, no leakage of luminescence excited at 680 nm was observed in the 810-nm channel or 780-nm excited luminescence into the 710-nm channel. An M13mp18 template was sequenced in a single capillary gel column using a two-color, two-lifetime format. The read length was found to be 650 base pairs for the test template at a calling accuracy of 95.1% using a linear poly(dimethylacrylamide) (POP6) gel column, with the read length determined primarily by the electrophoretic resolution produced by the sieving gel.
Webster, G D; Sanderson, M R; Skelly, J V; Neidle, S; Swann, P F; Li, B F; Tickle, I J
1990-01-01
The crystal structure of the dodecanucleotide d(CGCAAGCTGGCG) has been determined to a resolution of 2.5 A and refined to an R factor of 19.3% for 1710 reflections. The sequence crystallizes as a B-type double helix, with two G(anti).A(syn) base pairs. These are stabilized by three-center hydrogen bonds to pyrimidines that induce perturbations in base-pair geometry. The central AGCT region of the helix has a wide (greater than 6 A) minor groove. PMID:2395870
Single-shot and single-sensor high/super-resolution microwave imaging based on metasurface.
Wang, Libo; Li, Lianlin; Li, Yunbo; Zhang, Hao Chi; Cui, Tie Jun
2016-06-01
Real-time high-resolution (including super-resolution) imaging with low-cost hardware is a long sought-after goal in various imaging applications. Here, we propose broadband single-shot and single-sensor high-/super-resolution imaging by using a spatio-temporal dispersive metasurface and an imaging reconstruction algorithm. The metasurface with spatio-temporal dispersive property ensures the feasibility of the single-shot and single-sensor imager for super- and high-resolution imaging, since it can convert efficiently the detailed spatial information of the probed object into one-dimensional time- or frequency-dependent signal acquired by a single sensor fixed in the far-field region. The imaging quality can be improved by applying a feature-enhanced reconstruction algorithm in post-processing, and the desired imaging resolution is related to the distance between the object and metasurface. When the object is placed in the vicinity of the metasurface, the super-resolution imaging can be realized. The proposed imaging methodology provides a unique means to perform real-time data acquisition, high-/super-resolution images without employing expensive hardware (e.g. mechanical scanner, antenna array, etc.). We expect that this methodology could make potential breakthroughs in the areas of microwave, terahertz, optical, and even ultrasound imaging.
An integrated hyperspectral and SAR satellite constellation for environment monitoring
NASA Astrophysics Data System (ADS)
Wang, Jinnian; Ren, Fuhu; Xie, Chou; An, Jun; Tong, Zhanbo
2017-09-01
A fully-integrated, Hyperspectral optical and SAR (Synthetic Aperture Radar) constellation of small earth observation satellites will be deployed over multiple launches from last December to next five years. The Constellation is expected to comprise a minimum of 16 satellites (8 SAR and 8 optical ) flying in two orbital planes, with each plane consisting of four satellite pairs, equally-spaced around the orbit plane. Each pair of satellites will consist of a hyperspectral/mutispectral optical satellite and a high-resolution SAR satellite (X-band) flying in tandem. The constellation is expected to offer a number of innovative capabilities for environment monitoring. As a pre-launch experiment, two hyperspectral earth observation minisatellites, Spark 01 and 02 were launched as secondary payloads together with Tansat in December 2016 on a CZ-2D rocket. The satellites feature a wide-range hyperspectral imager. The ground resolution is 50 m, covering spectral range from visible to near infrared (420 nm - 1000 nm) and a swath width of 100km. The imager has an average spectral resolution of 5 nm with 148 channels, and a single satellite could obtain hyperspectral imagery with 2.5 million km2 per day, for global coverage every 16 days. This paper describes the potential applications of constellation image in environment monitoring.
Unique Thermal Stability of Unnatural Hydrophobic Ds Bases in Double-Stranded DNAs.
Kimoto, Michiko; Hirao, Ichiro
2017-10-20
Genetic alphabet expansion technology, the introduction of unnatural bases or base pairs into replicable DNA, has rapidly advanced as a new synthetic biology area. A hydrophobic unnatural base pair between 7-(2-thienyl)imidazo[4,5-b]pyridine (Ds) and 2-nitro-4-propynylpyrrole (Px) exhibited high fidelity as a third base pair in PCR. SELEX methods using the Ds-Px pair enabled high-affinity DNA aptamer generation, and introducing a few Ds bases into DNA aptamers extremely augmented their affinities and selectivities to target proteins. Here, to further scrutinize the functions of this highly hydrophobic Ds base, the thermal stabilities of double-stranded DNAs (dsDNA) containing a noncognate Ds-Ds or G-Ds pair were examined. The thermal stability of the Ds-Ds self-pair was as high as that of the natural G-C pair, and apart from the generally higher stability of the G-C pair than that of the A-T pair, most of the 5'-pyrimidine-Ds-purine-3' sequences, such as CDsA and TDsA, exhibited higher stability than the 5'-purine-Ds-pyrimidine-3' sequences, such as GDsC and ADsC, in dsDNAs. This trait enabled the GC-content-independent control of the thermal stability of the designed dsDNA fragments. The melting temperatures of dsDNA fragments containing the Ds-Ds pair can be predicted from the nearest-neighbor parameters including the Ds base. In addition, the noncognate G-Ds pair can efficiently distinguish its neighboring cognate natural base pairs from noncognate pairs. We demonstrated that real-time PCR using primers containing Ds accurately detected a single-nucleotide mismatch in target DNAs. These unique properties of the Ds base that affect the stabilities of the neighboring base pairs could impart new functions to DNA molecules and technologies.
NASA Astrophysics Data System (ADS)
Hansen, Andreas; Liakos, Dimitrios G.; Neese, Frank
2011-12-01
A production level implementation of the high-spin open-shell (spin unrestricted) single reference coupled pair, quadratic configuration interaction and coupled cluster methods with up to doubly excited determinants in the framework of the local pair natural orbital (LPNO) concept is reported. This work is an extension of the closed-shell LPNO methods developed earlier [F. Neese, F. Wennmohs, and A. Hansen, J. Chem. Phys. 130, 114108 (2009), 10.1063/1.3086717; F. Neese, A. Hansen, and D. G. Liakos, J. Chem. Phys. 131, 064103 (2009), 10.1063/1.3173827]. The internal space is spanned by localized orbitals, while the external space for each electron pair is represented by a truncated PNO expansion. The laborious integral transformation associated with the large number of PNOs becomes feasible through the extensive use of density fitting (resolution of the identity (RI)) techniques. Technical complications arising for the open-shell case and the use of quasi-restricted orbitals for the construction of the reference determinant are discussed in detail. As in the closed-shell case, only three cutoff parameters control the average number of PNOs per electron pair, the size of the significant pair list, and the number of contributing auxiliary basis functions per PNO. The chosen threshold default values ensure robustness and the results of the parent canonical methods are reproduced to high accuracy. Comprehensive numerical tests on absolute and relative energies as well as timings consistently show that the outstanding performance of the LPNO methods carries over to the open-shell case with minor modifications. Finally, hyperfine couplings calculated with the variational LPNO-CEPA/1 method, for which a well-defined expectation value type density exists, indicate the great potential of the LPNO approach for the efficient calculation of molecular properties.
The ChIP-exo Method: Identifying Protein-DNA Interactions with Near Base Pair Precision.
Perreault, Andrea A; Venters, Bryan J
2016-12-23
Chromatin immunoprecipitation (ChIP) is an indispensable tool in the fields of epigenetics and gene regulation that isolates specific protein-DNA interactions. ChIP coupled to high throughput sequencing (ChIP-seq) is commonly used to determine the genomic location of proteins that interact with chromatin. However, ChIP-seq is hampered by relatively low mapping resolution of several hundred base pairs and high background signal. The ChIP-exo method is a refined version of ChIP-seq that substantially improves upon both resolution and noise. The key distinction of the ChIP-exo methodology is the incorporation of lambda exonuclease digestion in the library preparation workflow to effectively footprint the left and right 5' DNA borders of the protein-DNA crosslink site. The ChIP-exo libraries are then subjected to high throughput sequencing. The resulting data can be leveraged to provide unique and ultra-high resolution insights into the functional organization of the genome. Here, we describe the ChIP-exo method that we have optimized and streamlined for mammalian systems and next-generation sequencing-by-synthesis platform.
Pilot Production of Large Area Microchannel Plates and Picosecond Photodetectors
NASA Astrophysics Data System (ADS)
Minot, M.; Adams, B.; Abiles, M.; Bond, J.; Craven, C.; Cremer, T.; Foley, M.; Lyashenko, A.; Popecki, M.; Stochaj, M.; Worstell, W.; Elam, J.; Mane, A.; Siegmund, O.; Ertley, C.
2016-09-01
Pilot production performance is reported for large area atomic layer deposition (ALD) coated microchannel plates (ALD-GCA-MCPs) and for Large Area Picosecond Photodetectors (LAPPD™) which incorporate them. "Hollowcore" glass capillary array (GCA) substrates are coated with ALD resistive and emissive layers to form the ALDGCA- MCPs, an approach that facilitates independent selection of glass substrates that are mechanically stronger and that have lower levels of radioactive alkali elements compared to conventional MCP lead glass, reducing background noise[1,2,3,4]. ALD-GCA-MCPs have competitive gain ( 104 each or 107 for a chevron pair ), enhanced lifetime and gain stability (7 C cm-2 of charge extraction), reduced background levels (0.028 events cm-2 sec-1) and low gamma-ray detection efficiency. They can be fabricated in large area (20cm X 20 cm) planar and curved formats suitable for use in high radiation environment applications, including astronomy, space instrumentation, and remote night time sensing. The LAPPD™ photodetector incorporates these ALD-GCA-MCPs in an all-glass hermetic package with top and bottom plates and sidewalls made of borosilicate float glass. Signals are generated by a bi-alkali Na2KSb photocathode, amplified with a stacked chevron pair of ALD-GCA-MCPs. Signals are collected on RF strip-line anodes integrated into to the bottom plates which exit the detector via pin-free hermetic seals under the side walls [5]. Tests show that LAPPDTMs have electron gains greater than 107, submillimeter spatial resolution for large (multiphoton) pulses and several mm for single photons, time resolution less than 50 picoseconds for single photons, predicted resolution less than 5 picoseconds for large pulses, high stability versus charge extraction[6], and good uniformity for applications including astrophysics, neutron detection, high energy physics Cherenkov light detection, and quantum-optical photon-correlation experiments.
2004-08-01
on a pair of high -resolution, LCD medical monitors. The change to the new workstation has required us to rewrite the software... In the original CRT-based system, the two 7 images forming a stereo pair were displayed alternately on the same CRT face, at a high frame rate (120 Hz...then, separately, receive the stereo screening exam on the research GE digital mammography unit.
Compressive Sensing for Radar and Radar Sensor Networks
2013-12-02
Zero Correlation Zone Sequence Pair Sets for MIMO Radar Inspired by recent advances in MIMO radar, we apply orthogonal phase coded waveforms to MIMO ...radar system in order to gain better range resolution and target direction finding performance [2]. We provide and investigate a generalized MIMO radar...ZCZ) sequence-Pair Set (ZCZPS). We also study the MIMO radar ambiguity function of the system using phase coded waveforms, based on which we analyze
Example-based super-resolution for single-image analysis from the Chang'e-1 Mission
NASA Astrophysics Data System (ADS)
Wu, Fan-Lu; Wang, Xiang-Jun
2016-11-01
Due to the low spatial resolution of images taken from the Chang'e-1 (CE-1) orbiter, the details of the lunar surface are blurred and lost. Considering the limited spatial resolution of image data obtained by a CCD camera on CE-1, an example-based super-resolution (SR) algorithm is employed to obtain high-resolution (HR) images. SR reconstruction is important for the application of image data to increase the resolution of images. In this article, a novel example-based algorithm is proposed to implement SR reconstruction by single-image analysis, and the computational cost is reduced compared to other example-based SR methods. The results show that this method can enhance the resolution of images using SR and recover detailed information about the lunar surface. Thus it can be used for surveying HR terrain and geological features. Moreover, the algorithm is significant for the HR processing of remotely sensed images obtained by other imaging systems.
Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.
2011-01-01
The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242
Nanopore analysis of polymers in solution.
NASA Astrophysics Data System (ADS)
Deamer, David
2002-03-01
Nanopores represent a novel approach for investigating macromolecules in solution. Polymers that have been analyzed by this technique include polyethylene glycol (PEG), certain proteins and nucleic acids. The a-hemolysin pore inserted into lipid bilayers provides continuous non-gated ion current through a pore diameter of approximately 1.5 - 2 nm. Nucleic acid molecules can be driven through the pore by imposing a voltage across the supporting membrane. Single stranded, but not double stranded nucleic acids pass through in strict linear sequence from one end of the molecule to the other. While in the pore, the molecule reduces ionic current, and properties of the ionic current blockade such as duration, mean amplitude and modulations of amplitude provide information about structure and composition of the nucleic acid. For a given molecular species, the duration of the blockade is a function of chain length, and the rate of blockades is linearly related to concentration. More recent studies have shown that the a-hemolysin nanopore can discriminate between synthetic DNA molecules differing by a single base pair or even a single nucleotide. These results indicate that a nanopore may have the resolution required for nucleic acid sequencing applications.
An Automated System for Accurately Tracking and Measuring Multiple Targets in Six Dimensions
2001-08-01
diffracted with good efficiency. The deflection medium is a crystal material TeO2 . The power of the electrical signal is 2W. The corresponding diffraction...between 50 MHz and 100 MHz. The acoustooptical deflector used a birefregent TeO2 single crystal as the ultrasonic medium where the light deflection take...pair of glass substrates with sufficient thickness (> 1 mm). The thick glass plate reduces the spatial resolution of the fiberoptic plate. To reduce
Mismatch cleavage by single-strand specific nucleases
Till, Bradley J.; Burtner, Chris; Comai, Luca; Henikoff, Steven
2004-01-01
We have investigated the ability of single-strand specific (sss) nucleases from different sources to cleave single base pair mismatches in heteroduplex DNA templates used for mutation and single-nucleotide polymorphism analysis. The TILLING (Targeting Induced Local Lesions IN Genomes) mismatch cleavage protocol was used with the LI-COR gel detection system to assay cleavage of amplified heteroduplexes derived from a variety of induced mutations and naturally occurring polymorphisms. We found that purified nucleases derived from celery (CEL I), mung bean sprouts and Aspergillus (S1) were able to specifically cleave nearly all single base pair mismatches tested. Optimal nicking of heteroduplexes for mismatch detection was achieved using higher pH, temperature and divalent cation conditions than are routinely used for digestion of single-stranded DNA. Surprisingly, crude plant extracts performed as well as the highly purified preparations for this application. These observations suggest that diverse members of the S1 family of sss nucleases act similarly in cleaving non-specifically at bulges in heteroduplexes, and single-base mismatches are the least accessible because they present the smallest single-stranded region for enzyme binding. We conclude that a variety of sss nucleases and extracts can be effectively used for high-throughput mutation and polymorphism discovery. PMID:15141034
Transcription factors as readers and effectors of DNA methylation.
Zhu, Heng; Wang, Guohua; Qian, Jiang
2016-08-01
Recent technological advances have made it possible to decode DNA methylomes at single-base-pair resolution under various physiological conditions. Many aberrant or differentially methylated sites have been discovered, but the mechanisms by which changes in DNA methylation lead to observed phenotypes, such as cancer, remain elusive. The classical view of methylation-mediated protein-DNA interactions is that only proteins with a methyl-CpG binding domain (MBD) can interact with methylated DNA. However, evidence is emerging to suggest that transcription factors lacking a MBD can also interact with methylated DNA. The identification of these proteins and the elucidation of their characteristics and the biological consequences of methylation-dependent transcription factor-DNA interactions are important stepping stones towards a mechanistic understanding of methylation-mediated biological processes, which have crucial implications for human development and disease.
Transcription factors as readers and effectors of DNA methylation
Zhu, Heng; Wang, Guohua; Qian, Jiang
2017-01-01
Recent technological advances have made it possible to decode DNA methylomes at single-base-pair resolution under various physiological conditions. Many aberrant or differentially methylated sites have been discovered, but the mechanisms by which changes in DNA methylation lead to observed phenotypes, such as cancer, remain elusive. The classical view of methylation-mediated protein-DNA interactions is that only proteins with a methyl-CpG binding domain (MBD) can interact with methylated DNA. However, evidence is emerging to suggest that transcription factors lacking a MBD can also interact with methylated DNA. The identification of these proteins and the elucidation of their characteristics and the biological consequences of methylation-dependent transcription factor-DNA interactions are important stepping stones towards a mechanistic understanding of methylation-mediated biological processes, which have crucial implications for human development and disease. PMID:27479905
An overview of instrumentation for the Large Binocular Telescope
NASA Astrophysics Data System (ADS)
Wagner, R. Mark
2012-09-01
An overview of instrumentation for the Large Binocular Telescope (LBT) is presented. Optical instrumentation includes the Large Binocular Camera (LBC), a pair of wide-field (27' x 27') mosaic CCD imagers at the prime focus, and the Multi-Object Double Spectrograph (MODS), a pair of dual-beam blue-red optimized long-slit spectrographs mounted at the left and right direct F/15 Gregorian foci incorporating multiple slit masks for multi-object spectroscopy over a 6' field and spectral resolutions of up to 2000. Infrared instrumentation includes the LBT Near-IR Spectroscopic Utility with Camera and Integral Field Unit for Extragalactic Research (LUCI), a modular near-infrared (0.9-2.5 μm) imager and spectrograph pair mounted at the left and right front bent F/15 Gregorian foci and designed for seeing-limited (FOV: 4' × 4') imaging, long-slit spectroscopy, and multiobject spectroscopy utilizing cooled slit masks and diffraction limited (FOV: 0'.5 × 0'.5) imaging and long-slit spectroscopy. Strategic instruments under development that can utilize the full 23-m baseline of the LBT include an interferometric cryogenic beam combiner with near-infrared and thermal-infrared instruments for Fizeau imaging and nulling interferometry (LBTI) and an optical bench near-infrared beam combiner utilizing multi-conjugate adaptive optics for high angular resolution and sensitivity (LINC-NIRVANA). LBTI is currently undergoing commissioning on the LBT and utilizing the installed adaptive secondary mirrors in both single- sided and two-sided beam combination modes. In addition, a fiber-fed bench spectrograph (PEPSI) capable of ultra high resolution spectroscopy and spectropolarimetry (R = 40,000-300,000) will be available as a principal investigator instrument. Over the past four years the LBC pair, LUCI1, and MODS1 have been commissioned and are now scheduled for routine partner science observations. The delivery of both LUCI2 and MODS2 is anticipated before the end of 2012. The availability of all these instruments mounted simultaneously on the LBT permits unique science, flexible scheduling, and improved operational support.
Competing bosonic condensates in optical lattice with a mixture of single and pair hoppings
NASA Astrophysics Data System (ADS)
Travin, V. M.; Kopeć, T. K.
2017-01-01
A system of ultra-cold atoms with single boson and pair tunneling of bosonic atoms is considered in an optical lattice at arbitrary temperature. A mean-field theory was applied to the extended Bose-Hubbard Hamiltonian describing the system in order to investigate the competition between superfluid and pair superfluid as a function of the chemical potential and the temperature. To this end we have applied a method based on the Laplace transform method for the efficient calculation of the statistical sum for the quantum Hamiltonian. These results may be of interest for experiments on cold atom systems in optical lattices.
Results on top-quark physics and top-quark-like signatures by CMS
NASA Astrophysics Data System (ADS)
Chabert, Eric; CMS Collaboration
2017-07-01
This report reviews the results obtained by the CMS Collaboration on top quark physics, focusing on the latest ones based on p-p collisions provided by the LHC at \\sqrt{s}=13{{TeV}} during Run II. It covers measurements of single-top, top quark pairs and associated productions as well as measurements of top quark properties. Finally several beyond the standard model searches involving top quark in the final states are presented, such as searches for supersymmetry in the third generation, heavy resonances decaying into a top quark pair, or dark matter produced in association to a single-top or a top quark pair.
Single-shot and single-sensor high/super-resolution microwave imaging based on metasurface
Wang, Libo; Li, Lianlin; Li, Yunbo; Zhang, Hao Chi; Cui, Tie Jun
2016-01-01
Real-time high-resolution (including super-resolution) imaging with low-cost hardware is a long sought-after goal in various imaging applications. Here, we propose broadband single-shot and single-sensor high-/super-resolution imaging by using a spatio-temporal dispersive metasurface and an imaging reconstruction algorithm. The metasurface with spatio-temporal dispersive property ensures the feasibility of the single-shot and single-sensor imager for super- and high-resolution imaging, since it can convert efficiently the detailed spatial information of the probed object into one-dimensional time- or frequency-dependent signal acquired by a single sensor fixed in the far-field region. The imaging quality can be improved by applying a feature-enhanced reconstruction algorithm in post-processing, and the desired imaging resolution is related to the distance between the object and metasurface. When the object is placed in the vicinity of the metasurface, the super-resolution imaging can be realized. The proposed imaging methodology provides a unique means to perform real-time data acquisition, high-/super-resolution images without employing expensive hardware (e.g. mechanical scanner, antenna array, etc.). We expect that this methodology could make potential breakthroughs in the areas of microwave, terahertz, optical, and even ultrasound imaging. PMID:27246668
Inertial collapse of bubble pairs near a solid surface
NASA Astrophysics Data System (ADS)
Alahyari Beig, Shahaboddin; Johnsen, Eric
2017-11-01
Cavitation occurs in a variety of applications ranging from naval structures to biomedical ultrasound. One important consequence is structural damage to neighboring surfaces following repeated inertial collapse of vapor bubbles. Although the mechanical loading produced by the collapse of a single bubble has been widely investigated, less is known about the detailed dynamics of the collapse of multiple bubbles. In such a problem, the bubble-bubble interactions typically affect the dynamics, e.g., by increasing the non-sphericity of the bubbles and amplifying/hindering the collapse intensity depending on the flow parameters. Here, we quantify the effects of bubble-bubble interactions on the bubble dynamics, as well as the pressures/temperatures produced by the collapse of a pair of gas bubbles near a rigid surface. We perform high-resolution simulations of this problem by solving the three-dimensional compressible Navier-Stokes equations for gas/liquid flows. The results are used to investigate the non-spherical bubble dynamics and characterize the pressure and temperature fields based on the relevant parameters entering the problem: stand-off distance, geometrical configuration (angle, relative size, distance), collapse strength. This research was supported in part by ONR Grant N00014-12-1-0751 and NSF Grant CBET 1253157.
System implications of large radiometric array antennas
NASA Technical Reports Server (NTRS)
Levis, C. A.; Lin, H. C.
1976-01-01
Current radiometric earth and atmospheric sensing systems in the centimeter wavelength range generally employ a directive antenna connected through a single terminal pair to a Dicke receiver. It is shown that this approach does not lend itself to systems with greatly increased spatial resolution. Signal to noise considerations relating to antenna efficiency force the introduction of active elements at the subarray level; thus, if Dicke switching is to be used, it must be distributed throughout the system. Some possible approaches are suggested. The introduction of active elements at the subarray level is found to ease the design constraints on time delay elements, necessary for bandwidth, and on multiple beam generation, required in order to achieve sufficient integration time with high resolution.
NASA Astrophysics Data System (ADS)
Yang, Bo; Rodgers, M. T.
2015-08-01
Hypermethylation of cytosine in expanded (CCG)n•(CGG)n trinucleotide repeats results in Fragile X syndrome, the most common cause of inherited mental retardation. The (CCG)n•(CGG)n repeats adopt i-motif conformations that are preferentially stabilized by base-pairing interactions of protonated base pairs of cytosine. Here we investigate the effects of 5-methylation and the sugar moiety on the base-pairing energies (BPEs) of protonated cytosine base pairs by examining protonated nucleoside base pairs of 2'-deoxycytidine (dCyd) and 5-methyl-2'-deoxycytidine (m5dCyd) using threshold collision-induced dissociation techniques. 5-Methylation of a single or both cytosine residues leads to very small change in the BPE. However, the accumulated effect may be dramatic in diseased state trinucleotide repeats where many methylated base pairs may be present. The BPEs of the protonated nucleoside base pairs examined here significantly exceed those of Watson-Crick dGuo•dCyd and neutral dCyd•dCyd base pairs, such that these base-pairing interactions provide the major forces responsible for stabilization of DNA i-motif conformations. Compared with isolated protonated nucleobase pairs of cytosine and 1-methylcytosine, the 2'-deoxyribose sugar produces an effect similar to the 1-methyl substituent, and leads to a slight decrease in the BPE. These results suggest that the base-pairing interactions may be slightly weaker in nucleic acids, but that the extended backbone is likely to exert a relatively small effect on the total BPE. The proton affinity (PA) of m5dCyd is also determined by competitive analysis of the primary dissociation pathways that occur in parallel for the protonated (m5dCyd)H+(dCyd) nucleoside base pair and the absolute PA of dCyd previously reported.
NASA Astrophysics Data System (ADS)
Sun, Ce; Lu, Ning; Wang, Jinguo; Lee, Jihyung; Peng, Xin; Klie, Robert F.; Kim, Moon J.
2013-12-01
The single twin boundary with crystallographic orientation relationship (1¯1¯1¯)//(111) [01¯1]//[011¯] was created by wafer bonding. Electron diffraction patterns and high-resolution transmission electron microscopy images demonstrated the well control of the rotation angle between the bonded pair. At the twin boundary, one unit of wurtzite structure was found between two zinc-blende matrices. High-angle annular dark-field scanning transmission electron microscopy images showed Cd- and Te-terminated for the two bonded portions, respectively. The I-V curve across the twin boundary showed increasingly nonlinear behavior, indicating a potential barrier at the bonded twin boundary.
First Dark Matter Constraints from SuperCDMS Single-Charge Sensitive Detectors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Agnese, R.; et al.
We present the first limits on inelastic electron-scattering dark matter and dark photon absorption using a prototype SuperCDMS detector having a charge resolution of 0.1 electron-hole pairs (CDMS HVeV, a 0.93 gram CDMS HV device). These electron-recoil limits significantly improve experimental constraints on dark matter particles with masses as low as 1 MeV/more » $$\\mathrm{c^2}$$. We demonstrate a sensitivity to dark photons competitive with other leading approaches but using substantially less exposure (0.49 gram days). These results demonstrate the scientific potential of phonon-mediated semiconductor detectors that are sensitive to single electronic excitations.« less
Kondo, Jiro; Westhof, Eric
2011-10-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.
Kondo, Jiro; Westhof, Eric
2011-01-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431
NASA Astrophysics Data System (ADS)
Dawson, K.; Scheller, S.; Dillon, J. G.; Orphan, V. J.
2016-12-01
Stable isotope probing (SIP) is a valuable tool for gaining insights into ecophysiology and biogeochemical cycling of environmental microbial communities by tracking isotopically labeled compounds into cellular macromolecules as well as into byproducts of respiration. SIP, in conjunction with nanoscale secondary ion mass spectrometry (NanoSIMS), allows for the visualization of isotope incorporation at the single cell level. In this manner, both active cells within a diverse population as well as heterogeneity in metabolism within a homogeneous population can be observed. The ecophysiological implications of these single cell stable isotope measurements are often limited to the taxonomic resolution of paired fluorescence in situ hybridization (FISH) microscopy. Here we introduce a taxonomy-independent method using multi-isotope SIP and NanoSIMS for identifying and grouping phenotypically similar microbial cells by their chemical and isotopic fingerprint. This method was applied to SIP experiments in a sulfur-cycling biofilm collected from sulfidic intertidal vents amended with 13C-acetate, 15N-ammonium, and 33S-sulfate. Using a cluster analysis technique based on fuzzy c-means to group cells according to their isotope (13C/12C, 15N/14N, and 33S/32S) and elemental ratio (C/CN and S/CN) profiles, our analysis partitioned 2200 cellular regions of interest (ROIs) into 5 distinct groups. These isotope phenotype groupings are reflective of the variation in labeled substrate uptake by cells in a multispecies metabolic network dominated by Gamma- and Deltaproteobacteria. Populations independently grouped by isotope phenotype were subsequently compared with paired FISH data, demonstrating a single coherent deltaproteobacterial cluster and multiple gammaproteobacterial groups, highlighting the distinct ecophysiologies of spatially-associated microbes within the sulfur-cycling biofilm from White Point Beach, CA.
Dawson, Katherine S.; Scheller, Silvan; Dillon, Jesse G.; Orphan, Victoria J.
2016-01-01
Stable isotope probing (SIP) is a valuable tool for gaining insights into ecophysiology and biogeochemical cycling of environmental microbial communities by tracking isotopically labeled compounds into cellular macromolecules as well as into byproducts of respiration. SIP, in conjunction with nanoscale secondary ion mass spectrometry (NanoSIMS), allows for the visualization of isotope incorporation at the single cell level. In this manner, both active cells within a diverse population as well as heterogeneity in metabolism within a homogeneous population can be observed. The ecophysiological implications of these single cell stable isotope measurements are often limited to the taxonomic resolution of paired fluorescence in situ hybridization (FISH) microscopy. Here we introduce a taxonomy-independent method using multi-isotope SIP and NanoSIMS for identifying and grouping phenotypically similar microbial cells by their chemical and isotopic fingerprint. This method was applied to SIP experiments in a sulfur-cycling biofilm collected from sulfidic intertidal vents amended with 13C-acetate, 15N-ammonium, and 33S-sulfate. Using a cluster analysis technique based on fuzzy c-means to group cells according to their isotope (13C/12C, 15N/14N, and 33S/32S) and elemental ratio (C/CN and S/CN) profiles, our analysis partitioned ~2200 cellular regions of interest (ROIs) into five distinct groups. These isotope phenotype groupings are reflective of the variation in labeled substrate uptake by cells in a multispecies metabolic network dominated by Gamma- and Deltaproteobacteria. Populations independently grouped by isotope phenotype were subsequently compared with paired FISH data, demonstrating a single coherent deltaproteobacterial cluster and multiple gammaproteobacterial groups, highlighting the distinct ecophysiologies of spatially-associated microbes within the sulfur-cycling biofilm from White Point Beach, CA. PMID:27303371
Real-time spectral characterization of a photon pair source using a chirped supercontinuum seed.
Erskine, Jennifer; England, Duncan; Kupchak, Connor; Sussman, Benjamin
2018-02-15
Photon pair sources have wide ranging applications in a variety of quantum photonic experiments and protocols. Many of these protocols require well controlled spectral correlations between the two output photons. However, due to low cross-sections, measuring the joint spectral properties of photon pair sources has historically been a challenging and time-consuming task. Here, we present an approach for the real-time measurement of the joint spectral properties of a fiber-based four wave mixing source. We seed the four wave mixing process using a broadband chirped pulse, studying the stimulated process to extract information regarding the spontaneous process. In addition, we compare stimulated emission measurements with the spontaneous process to confirm the technique's validity. Joint spectral measurements have taken many hours historically and several minutes with recent techniques. Here, measurements have been demonstrated in 5-30 s depending on resolution, offering substantial improvement. Additional benefits of this approach include flexible resolution, large measurement bandwidth, and reduced experimental overhead.
NASA Astrophysics Data System (ADS)
Couceiro, Miguel; Crespo, Paulo; Marques, Rui F.; Fonte, Paulo
2014-06-01
Scatter Fraction (SF) and Noise Equivalent Count Rate (NECR) of a 2400 mm wide axial field-of-view Positron Emission Tomography (PET) system based on Resistive Plate Chamber (RPC) detectors with 300 ps Time Of Flight (TOF) resolution were studied by simulation using Geant4. The study followed the NEMA NU2-2001 standards, using the standard 700 mm long phantom and an axially extended one with 1800 mm, modeling the foreseeable use of this PET system. Data was processed based on the actual RPC readout, which requires a 0.2 μs non-paralyzable dead time for timing signals and a paralyzable dead time (τps) for position signals. For NECR, the best coincidence trigger consisted of a multiple time window coincidence sorter retaining single coincidence pairs (involving only two photons) and all possible coincidence pairs obtained from Multiple coincidences, keeping only those for which the direct TOF-reconstructed point falls inside a tight region surrounding the phantom. For the 700 mm phantom, the SF was 51.8% and, with τps = 3.0 μs, the peak NECR was 167 kcps at 7.6 kBq/cm3. Using τps = 1.0 μs the NECR was 349 kcps at 7.6 kBq/cm3, and no peak was found. For the 1800 mm phantom, the SF was slightly higher, and the NECR curves were identical to those obtained with the standard phantom, but shifted to lower activity concentrations. Although the higher SF, the values obtained for NECR allow concluding that the proposed scanner is expected to outperform current commercial PET systems.
Texton-based super-resolution for achieving high spatiotemporal resolution in hybrid camera system
NASA Astrophysics Data System (ADS)
Kamimura, Kenji; Tsumura, Norimichi; Nakaguchi, Toshiya; Miyake, Yoichi
2010-05-01
Many super-resolution methods have been proposed to enhance the spatial resolution of images by using iteration and multiple input images. In a previous paper, we proposed the example-based super-resolution method to enhance an image through pixel-based texton substitution to reduce the computational cost. In this method, however, we only considered the enhancement of a texture image. In this study, we modified this texton substitution method for a hybrid camera to reduce the required bandwidth of a high-resolution video camera. We applied our algorithm to pairs of high- and low-spatiotemporal-resolution videos, which were synthesized to simulate a hybrid camera. The result showed that the fine detail of the low-resolution video can be reproduced compared with bicubic interpolation and the required bandwidth could be reduced to about 1/5 in a video camera. It was also shown that the peak signal-to-noise ratios (PSNRs) of the images improved by about 6 dB in a trained frame and by 1.0-1.5 dB in a test frame, as determined by comparison with the processed image using bicubic interpolation, and the average PSNRs were higher than those obtained by the well-known Freeman’s patch-based super-resolution method. Compared with that of the Freeman’s patch-based super-resolution method, the computational time of our method was reduced to almost 1/10.
Detecting Earthquakes over a Seismic Network using Single-Station Similarity Measures
NASA Astrophysics Data System (ADS)
Bergen, Karianne J.; Beroza, Gregory C.
2018-03-01
New blind waveform-similarity-based detection methods, such as Fingerprint and Similarity Thresholding (FAST), have shown promise for detecting weak signals in long-duration, continuous waveform data. While blind detectors are capable of identifying similar or repeating waveforms without templates, they can also be susceptible to false detections due to local correlated noise. In this work, we present a set of three new methods that allow us to extend single-station similarity-based detection over a seismic network; event-pair extraction, pairwise pseudo-association, and event resolution complete a post-processing pipeline that combines single-station similarity measures (e.g. FAST sparse similarity matrix) from each station in a network into a list of candidate events. The core technique, pairwise pseudo-association, leverages the pairwise structure of event detections in its network detection model, which allows it to identify events observed at multiple stations in the network without modeling the expected move-out. Though our approach is general, we apply it to extend FAST over a sparse seismic network. We demonstrate that our network-based extension of FAST is both sensitive and maintains a low false detection rate. As a test case, we apply our approach to two weeks of continuous waveform data from five stations during the foreshock sequence prior to the 2014 Mw 8.2 Iquique earthquake. Our method identifies nearly five times as many events as the local seismicity catalog (including 95% of the catalog events), and less than 1% of these candidate events are false detections.
Jaramillo, Carlos; Valenti, Roberto G.; Guo, Ling; Xiao, Jizhong
2016-01-01
We describe the design and 3D sensing performance of an omnidirectional stereo (omnistereo) vision system applied to Micro Aerial Vehicles (MAVs). The proposed omnistereo sensor employs a monocular camera that is co-axially aligned with a pair of hyperboloidal mirrors (a vertically-folded catadioptric configuration). We show that this arrangement provides a compact solution for omnidirectional 3D perception while mounted on top of propeller-based MAVs (not capable of large payloads). The theoretical single viewpoint (SVP) constraint helps us derive analytical solutions for the sensor’s projective geometry and generate SVP-compliant panoramic images to compute 3D information from stereo correspondences (in a truly synchronous fashion). We perform an extensive analysis on various system characteristics such as its size, catadioptric spatial resolution, field-of-view. In addition, we pose a probabilistic model for the uncertainty estimation of 3D information from triangulation of back-projected rays. We validate the projection error of the design using both synthetic and real-life images against ground-truth data. Qualitatively, we show 3D point clouds (dense and sparse) resulting out of a single image captured from a real-life experiment. We expect the reproducibility of our sensor as its model parameters can be optimized to satisfy other catadioptric-based omnistereo vision under different circumstances. PMID:26861351
DOE Office of Scientific and Technical Information (OSTI.GOV)
Margaryan, Amur
2011-10-01
A new timing technique for single photons based on the radio frequency phototube and optical clock or femtosecond optical frequency comb generator is proposed. The technique has a 20 ps resolution for single photons, is capable of operating with MHz frequencies and achieving 10 fs instability level.
Daily monitoring of 30 m crop condition over complex agricultural landscapes
NASA Astrophysics Data System (ADS)
Sun, L.; Gao, F.; Xie, D.; Anderson, M. C.; Yang, Y.
2017-12-01
Crop progress provides information necessary for efficient irrigation, scheduling fertilization and harvesting operations at optimal times for achieving higher yields. In the United States, crop progress reports are released online weekly by US Department of Agriculture (USDA) - National Agricultural Statistics Service (NASS). However, the ground data collection is time consuming and subjective, and these reports are provided at either district (multiple counties) or state level. Remote sensing technologies have been widely used to map crop conditions, to extract crop phenology, and to predict crop yield. However, for current satellite-based sensors, it is difficult to acquire both high spatial resolution and frequent coverage. For example, Landsat satellites are capable to capture 30 m resolution images, while the long revisit cycles, cloud contamination further limited their use in detecting rapid surface changes. On the other hand, MODIS can provide daily observations, but with coarse spatial resolutions range from 250 to 1000 m. In recent years, multi-satellite data fusion technology such as the Spatial and Temporal Adaptive Reflectance Fusion Model (STARFM) has been used to combine the spatial resolution of Landsat with the temporal frequency of MODIS. It has been found that this synthetic dataset could provide more valuable information compared to the images acquired from only one single sensor. However, accuracy of STARFM depends on heterogeneity of landscape and available clear image pairs of MODIS and Landsat. In this study, a new fusion method was developed using the crop vegetation index (VI) timeseries extracted from "pure" MODIS pixels and Landsat overpass images to generate daily 30 m VI for crops. The fusion accuracy was validated by comparing to the original Landsat images. Results show that the relative error in non-rapid growing period is around 3-5% and in rapid growing period is around 6-8% . The accuracy is much better than that of STARFM which is 4-9% in non-rapid growing period and 10-16% in rapid growing period based on 13 image pairs. The predicted VI from this approach looks consistent and smooth in the SLC-off gap stripes of Landsat 7 ETM+ image. The new fusion results will be used to map crop phenology and to predict crop yield at field scale in the complex agricultural landscapes.
Medintz, Igor; Wong, Wendy W.; Berti, Lorenzo; Shiow, Lawrence; Tom, Jennifer; Scherer, James; Sensabaugh, George; Mathies, Richard A.
2001-01-01
An assay is described for high-throughput single nucleotide polymorphism (SNP) genotyping on a microfabricated capillary array electrophoresis (CAE) microchip. The assay targets the three common variants at the HFE locus associated with the genetic disease hereditary hemochromatosis (HHC). The assay employs allele-specific PCR (ASPCR) for the C282Y (845g->a), H63D (187c->g), and S65C (193a->t) variants using fluorescently-labeled energy-transfer (ET) allele-specific primers. Using a 96-channel radial CAE microplate, the labeled ASPCR products generated from 96 samples in a reference Caucasian population are simultaneously separated with single-base-pair resolution and genotyped in under 10 min. Detection is accomplished with a laser-excited rotary four-color fluorescence scanner. The allele-specific amplicons are differentiated on the basis of both their size and the color of the label emission. This study is the first demonstration of the combined use of ASPCR with ET primers and microfabricated radial CAE microplates to perform multiplex SNP analyses in a clinically relevant population. PMID:11230165
Shiroguchi, Katsuyuki; Jia, Tony Z.; Sims, Peter A.; Xie, X. Sunney
2012-01-01
RNA sequencing (RNA-Seq) is a powerful tool for transcriptome profiling, but is hampered by sequence-dependent bias and inaccuracy at low copy numbers intrinsic to exponential PCR amplification. We developed a simple strategy for mitigating these complications, allowing truly digital RNA-Seq. Following reverse transcription, a large set of barcode sequences is added in excess, and nearly every cDNA molecule is uniquely labeled by random attachment of barcode sequences to both ends. After PCR, we applied paired-end deep sequencing to read the two barcodes and cDNA sequences. Rather than counting the number of reads, RNA abundance is measured based on the number of unique barcode sequences observed for a given cDNA sequence. We optimized the barcodes to be unambiguously identifiable, even in the presence of multiple sequencing errors. This method allows counting with single-copy resolution despite sequence-dependent bias and PCR-amplification noise, and is analogous to digital PCR but amendable to quantifying a whole transcriptome. We demonstrated transcriptome profiling of Escherichia coli with more accurate and reproducible quantification than conventional RNA-Seq. PMID:22232676
Imaging and Force Recognition of Single Molecular Behaviors Using Atomic Force Microscopy
Li, Mi; Dang, Dan; Liu, Lianqing; Xi, Ning; Wang, Yuechao
2017-01-01
The advent of atomic force microscopy (AFM) has provided a powerful tool for investigating the behaviors of single native biological molecules under physiological conditions. AFM can not only image the conformational changes of single biological molecules at work with sub-nanometer resolution, but also sense the specific interactions of individual molecular pair with piconewton force sensitivity. In the past decade, the performance of AFM has been greatly improved, which makes it widely used in biology to address diverse biomedical issues. Characterizing the behaviors of single molecules by AFM provides considerable novel insights into the underlying mechanisms guiding life activities, contributing much to cell and molecular biology. In this article, we review the recent developments of AFM studies in single-molecule assay. The related techniques involved in AFM single-molecule assay were firstly presented, and then the progress in several aspects (including molecular imaging, molecular mechanics, molecular recognition, and molecular activities on cell surface) was summarized. The challenges and future directions were also discussed. PMID:28117741
Micro-rheology on (polymer-grafted) colloids using optical tweezers.
Gutsche, C; Elmahdy, M M; Kegler, K; Semenov, I; Stangner, T; Otto, O; Ueberschär, O; Keyser, U F; Krueger, M; Rauscher, M; Weeber, R; Harting, J; Kim, Y W; Lobaskin, V; Netz, R R; Kremer, F
2011-05-11
Optical tweezers are experimental tools with extraordinary resolution in positioning (± 1 nm) a micron-sized colloid and in the measurement of forces (± 50 fN) acting on it-without any mechanical contact. This enables one to carry out a multitude of novel experiments in nano- and microfluidics, of which the following will be presented in this review: (i) forces within single pairs of colloids in media of varying concentration and valency of the surrounding ionic solution, (ii) measurements of the electrophoretic mobility of single colloids in different solvents (concentration, valency of the ionic solution and pH), (iii) similar experiments as in (i) with DNA-grafted colloids, (iv) the nonlinear response of single DNA-grafted colloids in shear flow and (v) the drag force on single colloids pulled through a polymer solution. The experiments will be described in detail and their analysis discussed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Yujie; Gong, Sha; Wang, Zhen
The thermodynamic and kinetic parameters of an RNA base pair were obtained through a long-time molecular dynamics simulation of the opening-closing switch process of the base pair near its melting temperature. The thermodynamic parameters were in good agreement with the nearest-neighbor model. The opening rates showed strong temperature dependence, however, the closing rates showed only weak temperature dependence. The transition path time was weakly temperature dependent and was insensitive to the energy barrier. The diffusion constant exhibited super-Arrhenius behavior. The free energy barrier of breaking a single base stack results from the enthalpy increase, ΔH, caused by the disruption ofmore » hydrogen bonding and base-stacking interactions. The free energy barrier of base pair closing comes from the unfavorable entropy loss, ΔS, caused by the restriction of torsional angles. These results suggest that a one-dimensional free energy surface is sufficient to accurately describe the dynamics of base pair opening and closing, and the dynamics are Brownian.« less
Study on the Spatial Resolution of Single and Multiple Coincidences Compton Camera
NASA Astrophysics Data System (ADS)
Andreyev, Andriy; Sitek, Arkadiusz; Celler, Anna
2012-10-01
In this paper we study the image resolution that can be obtained from the Multiple Coincidences Compton Camera (MCCC). The principle of MCCC is based on a simultaneous acquisition of several gamma-rays emitted in cascade from a single nucleus. Contrary to a standard Compton camera, MCCC can theoretically provide the exact location of a radioactive source (based only on the identification of the intersection point of three cones created by a single decay), without complicated tomographic reconstruction. However, practical implementation of the MCCC approach encounters several problems, such as low detection sensitivities result in very low probability of coincident triple gamma-ray detection, which is necessary for the source localization. It is also important to evaluate how the detection uncertainties (finite energy and spatial resolution) influence identification of the intersection of three cones, thus the resulting image quality. In this study we investigate how the spatial resolution of the reconstructed images using the triple-cone reconstruction (TCR) approach compares to images reconstructed from the same data using standard iterative method based on single-cone. Results show, that FWHM for the point source reconstructed with TCR was 20-30% higher than the one obtained from the standard iterative reconstruction based on expectation maximization (EM) algorithm and conventional single-cone Compton imaging. Finite energy and spatial resolutions of the MCCC detectors lead to errors in conical surfaces definitions (“thick” conical surfaces) which only amplify in image reconstruction when intersection of three cones is being sought. Our investigations show that, in spite of being conceptually appealing, the identification of triple cone intersection constitutes yet another restriction of the multiple coincidence approach which limits the image resolution that can be obtained with MCCC and TCR algorithm.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ikuta, Rikizo; Kato, Hiroshi; Kusaka, Yoshiaki
We experimentally demonstrate a high-fidelity visible-to-telecommunicationwavelength conversion of a photon by using a solid-state-based difference frequency generation. In the experiment, one half of a pico-second visible entangled photon pair at 780 nm is converted to a 1522-nm photon. Using superconducting single-photon detectors with low dark count rates and small timing jitters, we observed a fidelity of 0.93±0.04 after the wavelength conversion.
The Promiscuity of [beta]-Strand Pairing Allows for Rational Design of [beta]-Sheet Face Inversion
DOE Office of Scientific and Technical Information (OSTI.GOV)
Makabe, Koki; Koide, Shohei
2009-06-17
Recent studies suggest the dominant role of main-chain H-bond formation in specifying {beta}-sheet topology. Its essentially sequence-independent nature implies a large degree of freedom in designing {beta}-sheet-based nanomaterials. Here we show rational design of {beta}-sheet face inversions by incremental deletions of {beta}-strands from the single-layer {beta}-sheet of Borrelia outer surface protein A. We show that a {beta}-sheet structure can be maintained when a large number of native contacts are removed and that one can design large-scale conformational transitions of a {beta}-sheet such as face inversion by exploiting the promiscuity of strand-strand interactions. High-resolution X-ray crystal structures confirmed the success ofmore » the design and supported the importance of main-chain H-bonds in determining {beta}-sheet topology. This work suggests a simple but effective strategy for designing and controlling nanomaterials based on {beta}-rich peptide self-assemblies.« less
Resolution enhancement of low-quality videos using a high-resolution frame
NASA Astrophysics Data System (ADS)
Pham, Tuan Q.; van Vliet, Lucas J.; Schutte, Klamer
2006-01-01
This paper proposes an example-based Super-Resolution (SR) algorithm of compressed videos in the Discrete Cosine Transform (DCT) domain. Input to the system is a Low-Resolution (LR) compressed video together with a High-Resolution (HR) still image of similar content. Using a training set of corresponding LR-HR pairs of image patches from the HR still image, high-frequency details are transferred from the HR source to the LR video. The DCT-domain algorithm is much faster than example-based SR in spatial domain 6 because of a reduction in search dimensionality, which is a direct result of the compact and uncorrelated DCT representation. Fast searching techniques like tree-structure vector quantization 16 and coherence search1 are also key to the improved efficiency. Preliminary results on MJPEG sequence show promising result of the DCT-domain SR synthesis approach.
Gorodetsky, Alon A.; Buzzeo, Marisa C.
2009-01-01
The base pair stack of DNA has been demonstrated as a medium for long range charge transport chemistry both in solution and at DNA-modified surfaces. This chemistry is exquisitely sensitive to structural perturbations in the base pair stack as occur with lesions, single base mismatches, and protein binding. We have exploited this sensitivity for the development of reliable electrochemical assays based on DNA charge transport at self-assembled DNA monolayers. Here we discuss the characteristic features, applications, and advantages of DNA-mediated electrochemistry. PMID:18980370
The simple perfection of quantum correlation in human vision.
Bouman, Maarten A
2006-01-01
A theory is presented that specifies the amount of light that is needed for the perception of any stimulus that is defined in space, time and color. For detection and discrimination mechanistic neural elements with deterministic procedures exist. Twin pairs of red and green cones are ordered in three sets along clockwise and counter clockwise revolving spirals and along circles around the center of the fovea. In the rod-free fovea the red pairs are ordered along the spirals and the green along the circles. Each cone is accompanied by--dependent on retinal eccentricity--up to 100 satellite rods. For the retinal signal processing such a receptor group constitutes a space-quantum in analogy with time-quanta of about 0.04 s. In the peripheral retina the red and green twin pairs of space-quanta are roughly ordered along and at random distributed over the spirals and circles. Over each time-quantum, the cone and rods of a space-quantum sum their responses in a common nerve circuit of the luminosity channel. The summation's results from twin pairs of the same set of space-quanta are correlated by two-fold spatio-temporal coincidence mechanisms in the retina. Their outcome signals the perception of light, movement and edge. In the fused binocular visual field the movement and edge signals of the three sets from both eyes perfectly join vectorially together, provided the responding pairs of space-quanta are binocularly in perfect register as they normally are. The receptor's Weber gain control makes the receptor an all-or-none-system. The space-quantum's De Vries gain control makes its sensitivity equal to the average of the poisson fluctuations in quantum absorption per time-quantum. The controls are based on, respectively, arithmetically feed forward and backward inhibitive nerve mechanisms. The thermal noise of the photo-pigment resets the controls. The response to the second quantum absorption in a time-quantum in the individual rod, red or green cone has accession to the white, red or green nerve color circuit, respectively, and produces there a corresponding color signal. Already a single absorption in a blue cone is for a blue signal. In the retina, for the generation of yellow signals, the color circuits of individual red and green cones of each mixed entwined triple of red and green twin pairs of space-quanta are cross-connected through a nerve opponent color circuit. In the lateral geniculate nucleus in groups of seven neighboring triples, through two nerve opponent color circuits that are common for the two eyes together, the red and green signals as well as the yellow and blue mutually annihilate each other's color. White signals remain. In anomalous trichromacy, the space-quanta of some pairs have different cones or in one of them the cone is missing. In dichromacy, all pairs have different cones or one type of cones is missing. For perceptive resolution the periodic scanning of the retinal image by the eye tremor in synchrony with the time-quanta, overrules the limit of optical resolution as set by diffraction in the eye optics. Dependent on pupil diameter the scanning contributes up to a factor of about 30 to resolution. The action potentials of the Purkinje cells in the myocardium generate the time-quanta of the central nervous system as well as the mechanical scanning of the retinal image through the synchronic periodic variation of the tonus in the eye muscles.
Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain
2012-10-11
Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.
Genetic and DNA sequence analysis of the kanamycin resistance transposon Tn903.
Grindley, N D; Joyce, C M
1980-01-01
The kanamycin resistance transposon Tn903 consists of a unique region of about 1000 base pairs bounded by a pair of 1050-base-pair inverted repeat sequences. Each repeat contains two Pvu II endonuclease cleavage sites separated by 520 base pairs. We have constructed derivatives of Tn903 in which this 520-base-pair fragment is deleted from one or both repeats. Those derivatives that lack both 520-base-pair fragments cannot transpose, whereas those that lack just one remain transposition proficient. One such transposable derivative, Tn903 delta I, has been selected for further study. We have determined the sequence of the intact inverted repeat. The 18 base pairs at each end are identical and inverted relative to one another, a structure characteristic of insertion sequences. Additional experiments indicate that a single inverted repeat from Tn903 can, in fact, transpose; we propose that this element be called IS903. To correlate the DNA sequence with genetic activities, we have created mutations by inserting a 10-base-pair DNA fragment at several sites within the intact repeat of Tn903 delta 1, and we have examined the effect of such insertions on transposability. The results suggest that IS903 encodes a 307-amino-acid polypeptide (a "transposase") that is absolutely required for transposition of IS903 or Tn903. Images PMID:6261245
Complete plastid genome sequence of goosegrass (Eleusine indica) and comparison with other Poaceae.
Zhang, Hui; Hall, Nathan; McElroy, J Scott; Lowe, Elijah K; Goertzen, Leslie R
2017-02-05
Eleusine indica, also known as goosegrass, is a serious weed in at least 42 countries. In this paper we report the complete plastid genome sequence of goosegrass obtained by de novo assembly of paired-end and mate-paired reads generated by Illumina sequencing of total genomic DNA. The goosegrass plastome is a circular molecule of 135,151bp in length, consisting of two single-copy regions separated by a pair of inverted repeats (IRs) of 20,919 bases. The large (LSC) and the small (SSC) single-copy regions span 80,667 bases and 12,646 bases, respectively. The plastome of goosegrass has 38.19% GC content and includes 108 unique genes, of which 76 are protein-coding, 28 are transfer RNA, and 4 are ribosomal RNA. The goosegrass plastome sequence was compared to eight other species of Poaceae. Although generally conserved with respect to Poaceae, this genomic resource will be useful for evolutionary studies within this weed species and the genus Eleusine. Copyright © 2016. Published by Elsevier B.V.
Machine Learning Based Single-Frame Super-Resolution Processing for Lensless Blood Cell Counting
Huang, Xiwei; Jiang, Yu; Liu, Xu; Xu, Hang; Han, Zhi; Rong, Hailong; Yang, Haiping; Yan, Mei; Yu, Hao
2016-01-01
A lensless blood cell counting system integrating microfluidic channel and a complementary metal oxide semiconductor (CMOS) image sensor is a promising technique to miniaturize the conventional optical lens based imaging system for point-of-care testing (POCT). However, such a system has limited resolution, making it imperative to improve resolution from the system-level using super-resolution (SR) processing. Yet, how to improve resolution towards better cell detection and recognition with low cost of processing resources and without degrading system throughput is still a challenge. In this article, two machine learning based single-frame SR processing types are proposed and compared for lensless blood cell counting, namely the Extreme Learning Machine based SR (ELMSR) and Convolutional Neural Network based SR (CNNSR). Moreover, lensless blood cell counting prototypes using commercial CMOS image sensors and custom designed backside-illuminated CMOS image sensors are demonstrated with ELMSR and CNNSR. When one captured low-resolution lensless cell image is input, an improved high-resolution cell image will be output. The experimental results show that the cell resolution is improved by 4×, and CNNSR has 9.5% improvement over the ELMSR on resolution enhancing performance. The cell counting results also match well with a commercial flow cytometer. Such ELMSR and CNNSR therefore have the potential for efficient resolution improvement in lensless blood cell counting systems towards POCT applications. PMID:27827837
Enantiopure heterobimetallic single-chain magnets from the chiral Ru(III) building block.
Ru, Jing; Gao, Feng; Wu, Tao; Yao, Min-Xia; Li, Yi-Zhi; Zuo, Jing-Lin
2014-01-21
A pair of one-dimensional enantiomers based on the versatile chiral dicyanoruthenate(III) building block have been synthesized and they are chiral single-chain magnets with the effective spin-reversal barrier of 28.2 K.
NASA Astrophysics Data System (ADS)
Werner, C. L.; Wegmuller, U.; Strozzi, T.; Wiesmann, A.
2006-12-01
Principle contributors to the noise in differential SAR interferograms are temporal phase stability of the surface, geometry relating to baseline and surface slope, and propagation path delay variations due to tropospheric water vapor and the ionosphere. Time series analysis of multiple interferograms generated from a stack of SAR SLC images seeks to determine the deformation history of the surface while reducing errors. Only those scatterers within a resolution element that are stable and coherent for each interferometric pair contribute to the desired deformation signal. Interferograms with baselines exceeding 1/3 the critical baseline have substantial geometrical decorrelation for distributed targets. Short baseline pairs with multiple reference scenes can be combined using least-squares estimation to obtain a global deformation solution. Alternately point-like persistent scatterers can be identified in scenes that do not exhibit geometrical decorrelation associated with large baselines. In this approach interferograms are formed from a stack of SAR complex images using a single reference scene. Stable distributed scatter pixels are excluded however due to the presence of large baselines. We apply both point- based and short-baseline methodologies and compare results for a stack of fine-beam Radarsat data acquired in 2002-2004 over a rapidly subsiding oil field near Lost Hills, CA. We also investigate the density of point-like scatters with respect to image resolution. The primary difficulty encountered when applying time series methods is phase unwrapping errors due to spatial and temporal gaps. Phase unwrapping requires sufficient spatial and temporal sampling. Increasing the SAR range bandwidth increases the range resolution as well as increasing the critical interferometric baseline that defines the required satellite orbital tube diameter. Sufficient spatial sampling also permits unwrapping because of the reduced phase/pixel gradient. Short time intervals further reduce the differential phase due to deformation when the deformation is continuous. Lower frequency systems (L- vs. C-Band) substantially improve the ability to unwrap the phase correctly by directly reducing both interferometric phase amplitude and temporal decorrelation.
Image Mosaic Method Based on SIFT Features of Line Segment
Zhu, Jun; Ren, Mingwu
2014-01-01
This paper proposes a novel image mosaic method based on SIFT (Scale Invariant Feature Transform) feature of line segment, aiming to resolve incident scaling, rotation, changes in lighting condition, and so on between two images in the panoramic image mosaic process. This method firstly uses Harris corner detection operator to detect key points. Secondly, it constructs directed line segments, describes them with SIFT feature, and matches those directed segments to acquire rough point matching. Finally, Ransac method is used to eliminate wrong pairs in order to accomplish image mosaic. The results from experiment based on four pairs of images show that our method has strong robustness for resolution, lighting, rotation, and scaling. PMID:24511326
Multichordal charge exchange recombination spectroscopy on Doublet III (abstract)
NASA Astrophysics Data System (ADS)
Seraydarian, R. P.; Burrell, K. H.; Kahn, C.
1985-05-01
Single shot, multipoint ion temperature and plasma rotation profiles have been routinely obtained on the Doublet III tokamak for 32 consecutive time slices with 20-ms resolution. A six-chord tangentially viewing spectroscopic diagnostic has been built to look at radiation emitted by fully stripped low-Z impurity ions (He, C, O) that have undergone charge exchange recombination with hydrogen atoms from a 3-MW heating beam. The main components of the instrument are a single monochromator for wavelength dispersion, a single image intensifier tube for photon gain, and a pair of 1024-element linear photodiode arrays for detection. A special arrangement of fiber optics allows simultaneous data acquisition from all chords without the use of scanning mirrors or other moving parts. Ion temperature profiles taken under a variety of plasma conditions will be presented.
High resolution time interval counter
Condreva, Kenneth J.
1994-01-01
A high resolution counter circuit measures the time interval between the occurrence of an initial and a subsequent electrical pulse to two nanoseconds resolution using an eight megahertz clock. The circuit includes a main counter for receiving electrical pulses and generating a binary word--a measure of the number of eight megahertz clock pulses occurring between the signals. A pair of first and second pulse stretchers receive the signal and generate a pair of output signals whose widths are approximately sixty-four times the time between the receipt of the signals by the respective pulse stretchers and the receipt by the respective pulse stretchers of a second subsequent clock pulse. Output signals are thereafter supplied to a pair of start and stop counters operable to generate a pair of binary output words representative of the measure of the width of the pulses to a resolution of two nanoseconds. Errors associated with the pulse stretchers are corrected by providing calibration data to both stretcher circuits, and recording start and stop counter values. Stretched initial and subsequent signals are combined with autocalibration data and supplied to an arithmetic logic unit to determine the time interval in nanoseconds between the pair of electrical pulses being measured.
High resolution time interval counter
Condreva, K.J.
1994-07-26
A high resolution counter circuit measures the time interval between the occurrence of an initial and a subsequent electrical pulse to two nanoseconds resolution using an eight megahertz clock. The circuit includes a main counter for receiving electrical pulses and generating a binary word--a measure of the number of eight megahertz clock pulses occurring between the signals. A pair of first and second pulse stretchers receive the signal and generate a pair of output signals whose widths are approximately sixty-four times the time between the receipt of the signals by the respective pulse stretchers and the receipt by the respective pulse stretchers of a second subsequent clock pulse. Output signals are thereafter supplied to a pair of start and stop counters operable to generate a pair of binary output words representative of the measure of the width of the pulses to a resolution of two nanoseconds. Errors associated with the pulse stretchers are corrected by providing calibration data to both stretcher circuits, and recording start and stop counter values. Stretched initial and subsequent signals are combined with autocalibration data and supplied to an arithmetic logic unit to determine the time interval in nanoseconds between the pair of electrical pulses being measured. 3 figs.
DiBianca, F A; Gupta, V; Zeman, H D
2000-08-01
A computed tomography imaging technique called variable resolution x-ray (VRX) detection provides detector resolution ranging from that of clinical body scanning to that of microscopy (1 cy/mm to 100 cy/mm). The VRX detection technique is based on a new principle denoted as "projective compression" that allows the detector resolution element to scale proportionally to the image field size. Two classes of VRX detector geometry are considered. Theoretical aspects related to x-ray physics and data sampling are presented. Measured resolution parameters (line-spread function and modulation-transfer function) are presented and discussed. A VRX image that resolves a pair of 50 micron tungsten hairs spaced 30 microns apart is shown.
NASA Astrophysics Data System (ADS)
Noh, M. J.; Howat, I. M.
2017-12-01
Glaciers and ice sheets are changing rapidly. Digital Elevation Models (DEMs) and Velocity Maps (VMs) obtained from repeat satellite imagery provide critical measurements of changes in glacier dynamics and mass balance over large, remote areas. DEMs created from stereopairs obtained during the same satellite pass through sensor re-pointing (i.e. "in-track stereo") have been most commonly used. In-track stereo has the advantage of minimizing the time separation and, thus, surface motion between image acquisitions, so that the ice surface can be assumed motionless in when collocating pixels between image pairs. Since the DEM extraction process assumes that all motion between collocated pixels is due to parallax or sensor model error, significant ice motion results in DEM quality loss or failure. In-track stereo, however, puts a greater demand on satellite tasking resources and, therefore, is much less abundant than single-scan imagery. Thus, if ice surface motion can be mitigated, the ability to extract surface elevation measurements from pairs of repeat single-scan "cross-track" imagery would greatly increase the extent and temporal resolution of ice surface change. Additionally, the ice motion measured by the DEM extraction process would itself provide a useful velocity measurement. We develop a novel algorithm for generating high-quality DEMs and VMs from cross-track image pairs without any prior information using the Surface Extraction from TIN-based Searchspace Minimization (SETSM) algorithm and its sensor model bias correction capabilities. Using a test suite of repeat, single-scan imagery from WorldView and QuickBird sensors collected over fast-moving outlet glaciers, we develop a method by which RPC biases between images are first calculated and removed over ice-free surfaces. Subpixel displacements over the ice are then constrained and used to correct the parallax estimate. Initial tests yield DEM results with the same quality as in-track stereo for cases where snowfall has not occurred between the two images and when the images have similar ground sample distances. The resulting velocity map also closely matches independent measurements.
Radial Velocities of 41 Kepler Eclipsing Binaries
NASA Astrophysics Data System (ADS)
Matson, Rachel A.; Gies, Douglas R.; Guo, Zhao; Williams, Stephen J.
2017-12-01
Eclipsing binaries are vital for directly determining stellar parameters without reliance on models or scaling relations. Spectroscopically derived parameters of detached and semi-detached binaries allow us to determine component masses that can inform theories of stellar and binary evolution. Here we present moderate resolution ground-based spectra of stars in close binary systems with and without (detected) tertiary companions observed by NASA’s Kepler mission and analyzed for eclipse timing variations. We obtain radial velocities and spectroscopic orbits for five single-lined and 35 double-lined systems, and confirm one false positive eclipsing binary. For the double-lined spectroscopic binaries, we also determine individual component masses and examine the mass ratio {M}2/{M}1 distribution, which is dominated by binaries with like-mass pairs and semi-detached classical Algol systems that have undergone mass transfer. Finally, we constrain the mass of the tertiary component for five double-lined binaries with previously detected companions.
BiQ Analyzer HT: locus-specific analysis of DNA methylation by high-throughput bisulfite sequencing
Lutsik, Pavlo; Feuerbach, Lars; Arand, Julia; Lengauer, Thomas; Walter, Jörn; Bock, Christoph
2011-01-01
Bisulfite sequencing is a widely used method for measuring DNA methylation in eukaryotic genomes. The assay provides single-base pair resolution and, given sufficient sequencing depth, its quantitative accuracy is excellent. High-throughput sequencing of bisulfite-converted DNA can be applied either genome wide or targeted to a defined set of genomic loci (e.g. using locus-specific PCR primers or DNA capture probes). Here, we describe BiQ Analyzer HT (http://biq-analyzer-ht.bioinf.mpi-inf.mpg.de/), a user-friendly software tool that supports locus-specific analysis and visualization of high-throughput bisulfite sequencing data. The software facilitates the shift from time-consuming clonal bisulfite sequencing to the more quantitative and cost-efficient use of high-throughput sequencing for studying locus-specific DNA methylation patterns. In addition, it is useful for locus-specific visualization of genome-wide bisulfite sequencing data. PMID:21565797
Watson, Christopher M; Crinnion, Laura A; Harrison, Sally M; Lascelles, Carolina; Antanaviciute, Agne; Carr, Ian M; Bonthron, David T; Sheridan, Eamonn
2016-01-01
Next generation sequencing methodologies are facilitating the rapid characterisation of novel structural variants at nucleotide resolution. These approaches are particularly applicable to variants initially identified using alternative molecular methods. We report a child born with bilateral postaxial syndactyly of the feet and bilateral fifth finger clinodactyly. This was presumed to be an autosomal recessive syndrome, due to the family history of consanguinity. Karyotype analysis revealed a homozygous pericentric inversion of chromosome 7 (46,XX,inv(7)(p15q21)x2) which was confirmed to be heterozygous in both unaffected parents. Since the resolution of the karyotype was insufficient to identify any putatively causative gene, we undertook medium-coverage whole genome sequencing using paired-end reads, in order to elucidate the molecular breakpoints. In a two-step analysis, we first narrowed down the region by identifying discordant read-pairs, and then determined the precise molecular breakpoint by analysing the mapping locations of "soft-clipped" breakpoint-spanning reads. PCR and Sanger sequencing confirmed the identified breakpoints, both of which were located in intergenic regions. Significantly, the 7p15 breakpoint was located 523 kb upstream of HOXA13, the locus for hand-foot-genital syndrome. By inference from studies of HOXA locus control in the mouse, we suggest that the inversion has delocalised a HOXA13 enhancer to produce the phenotype observed in our patient. This study demonstrates how modern genetic diagnostic approach can characterise structural variants at nucleotide resolution and provide potential insights into functional regulation.
NASA Astrophysics Data System (ADS)
Khakimov, R. I.; Henson, B. M.; Shin, D. K.; Hodgman, S. S.; Dall, R. G.; Baldwin, K. G. H.; Truscott, A. G.
2016-12-01
Ghost imaging is a counter-intuitive phenomenon—first realized in quantum optics—that enables the image of a two-dimensional object (mask) to be reconstructed using the spatio-temporal properties of a beam of particles with which it never interacts. Typically, two beams of correlated photons are used: one passes through the mask to a single-pixel (bucket) detector while the spatial profile of the other is measured by a high-resolution (multi-pixel) detector. The second beam never interacts with the mask. Neither detector can reconstruct the mask independently, but temporal cross-correlation between the two beams can be used to recover a ‘ghost’ image. Here we report the realization of ghost imaging using massive particles instead of photons. In our experiment, the two beams are formed by correlated pairs of ultracold, metastable helium atoms, which originate from s-wave scattering of two colliding Bose-Einstein condensates. We use higher-order Kapitza-Dirac scattering to generate a large number of correlated atom pairs, enabling the creation of a clear ghost image with submillimetre resolution. Future extensions of our technique could lead to the realization of ghost interference, and enable tests of Einstein-Podolsky-Rosen entanglement and Bell’s inequalities with atoms.
NASA Astrophysics Data System (ADS)
Kycia, Jan Bronislaw
An ultra-high-vacuum crystal growth facility using the electron beam float zone refining method was designed and built. High quality single crystals of UPtsb3 were grown. Material quality was characterized by mass spectrometry and x-ray scattering techniques. Low temperature resistivity, AC susceptibility and specific heat measurements were also conducted. We find that the transition temperature of the material can be varied systematically by annealing. The suppression of the superconducting transition from defects is consistent with a modified Abrikosov-Gorkov formula that includes anisotropic pairing, Fermi surface anisotropy and anisotropic scattering by defects. High resolution nuclear magnetic resonance (NMR) measurements of bulk superfluid sp3He-B were performed at temperatures above 0.5 mK and at pressures from 0.3 to 28.8 bar. The resonance frequency of the bulk superfluid sp3He-B is shifted from the Larmor frequency of the normal fluid. According to the theory of Greaves the frequency shift at the superfluid transition determines a specific combination, betasb{345}, of the five fourth-order coefficients of the order parameter invariants used in the Ginzburg-Landau description of superfluid sp3He. NMR measurements were performed to determine the coefficient betasb{345} and its dependence on pressure. The results are in agreement with the theoretical calculations of Sauls and Serene that are based on strong coupling contributions which are enhanced at higher pressures.
Rovibrational hybrid fs/ps CARS using a volume Bragg grating for N₂ thermometry.
Scherman, M; Nafa, M; Schmid, T; Godard, A; Bresson, A; Attal-Tretout, B; Joubert, P
2016-02-01
Coherent anti-Stokes Raman scattering (CARS) spectra of N2 in the hybrid femtosecond/picosecond regime have been recorded with 0.7 cm(-1) resolution. The Q-branch rovibrational structure has been resolved, making it suitable for gas-phase simultaneous rotational and vibrational thermometry applications. Resolving this spectral structure requires synchronization of a narrowband picosecond probe pulse with a broadband femtosecond pair of pump and Stokes pulses. It is achieved using a single femtosecond ytterbium-laser source and a volume Bragg grating in a compact experimental arrangement.
NASA Astrophysics Data System (ADS)
Entekhabi, D.; Jagdhuber, T.; Das, N. N.; Baur, M.; Link, M.; Piles, M.; Akbar, R.; Konings, A. G.; Mccoll, K. A.; Alemohammad, S. H.; Montzka, C.; Kunstmann, H.
2016-12-01
The active-passive soil moisture retrieval algorithm of NASA's SMAP mission depends on robust statistical estimation of active-passive covariation (β) and vegetation structure (Γ) parameters in order to provide reliable global measurements of soil moisture on an intermediate level (9km) compared to the native resolution of the radiometer (36km) and radar (3km) instruments. These parameters apply to the SMAP radiometer-radar combination over the period of record that was cut short with the end of the SMAP radar transmission. They also apply to the current SMAP radiometer and Sentinel 1A/B radar combination for high-resolution surface soil moisture mapping. However, the performance of the statistically-based approach is directly dependent on the selection of a representative time frame in which these parameters can be estimated assuming dynamic soil moisture and stationary soil roughness and vegetation cover. Here, we propose a novel, data-driven and physics-based single-pass retrieval of active-passive microwave covariation and vegetation parameters for the SMAP mission. The algorithm does not depend on time series analyses and can be applied using minimum one pair of an active-passive acquisition. The algorithm stems from the physical link between microwave emission and scattering via conservation of energy. The formulation of the emission radiative transfer is combined with the Distorted Born Approximation of radar scattering for vegetated land surfaces. The two formulations are simultaneously solved for the covariation and vegetation structure parameters. Preliminary results from SMAP active-passive observations (April 13th to July 7th 2015) compare well with the time-series statistical approach and confirms the capability of this method to estimate these parameters. Moreover, the method is not restricted to a given frequency (applies to both L-band and C-band combinations for the radar) or incidence angle (all angles and not just the fixed 40° incidence). Therefore, the approach is applicable to the combination of SMAP and Sentinel-1A/B data for active-passive and high-resolution soil moisture estimation.
Yu, Feiqiao Brian; Blainey, Paul C; Schulz, Frederik; Woyke, Tanja; Horowitz, Mark A; Quake, Stephen R
2017-07-05
Metagenomics and single-cell genomics have enabled genome discovery from unknown branches of life. However, extracting novel genomes from complex mixtures of metagenomic data can still be challenging and represents an ill-posed problem which is generally approached with ad hoc methods. Here we present a microfluidic-based mini-metagenomic method which offers a statistically rigorous approach to extract novel microbial genomes while preserving single-cell resolution. We used this approach to analyze two hot spring samples from Yellowstone National Park and extracted 29 new genomes, including three deeply branching lineages. The single-cell resolution enabled accurate quantification of genome function and abundance, down to 1% in relative abundance. Our analyses of genome level SNP distributions also revealed low to moderate environmental selection. The scale, resolution, and statistical power of microfluidic-based mini-metagenomics make it a powerful tool to dissect the genomic structure of microbial communities while effectively preserving the fundamental unit of biology, the single cell.
Single-trial evaluative conditioning can be moderated by instructed forgetting.
Gast, Anne; Kattner, Florian
2016-09-01
Evaluative conditioning (EC) is a change in the valence of a conditioned stimulus (CS) due to previous pairing with an affective unconditioned stimulus (US). Several previous studies indicate that EC is related to memory of the CS-US pairs. Previous studies, however, typically cannot distinguish between the influence of CS-US knowledge during measurement and during encoding. In addition, by measuring rather than manipulating memory, they do not test the causal effect of memory on EC. The present study employed a "directed forgetting" procedure to the EC paradigm instructing participants to either forget or remember certain CS-US pairs. We found that EC effects after single learning trials were stronger for to-be-remembered than for to-be-forgotten pairs. Manipulation checks showed that the forgetting manipulation also successfully modulated memory for the target pairs and reduced both retroactive and proactive interference on memory for other pairs. Item-based analyses further demonstrated that the size of EC depended on CS-US memory. The results suggest that EC relies on available memory during measurement of the EC effect.
Rahman, Masudur; Neff, David; Green, Nathaniel; Norton, Michael L.
2016-01-01
Although there is a long history of the study of the interaction of DNA with carbon surfaces, limited information exists regarding the interaction of complex DNA-based nanostructures with the important material graphite, which is closely related to graphene. In view of the capacity of DNA to direct the assembly of proteins and optical and electronic nanoparticles, the potential for combining DNA-based materials with graphite, which is an ultra-flat, conductive carbon substrate, requires evaluation. A series of imaging studies utilizing Atomic Force Microscopy has been applied in order to provide a unified picture of this important interaction of structured DNA and graphite. For the test structure examined, we observe a rapid destabilization of the complex DNA origami structure, consistent with a strong interaction of single-stranded DNA with the carbon surface. This destabilizing interaction can be obscured by an intentional or unintentional primary intervening layer of single-stranded DNA. Because the interaction of origami with graphite is not completely dissociative, and because the frustrated, expanded structure is relatively stable over time in solution, it is demonstrated that organized structures of pairs of the model protein streptavidin can be produced on carbon surfaces using DNA origami as the directing material. PMID:28335324
AfterQC: automatic filtering, trimming, error removing and quality control for fastq data.
Chen, Shifu; Huang, Tanxiao; Zhou, Yanqing; Han, Yue; Xu, Mingyan; Gu, Jia
2017-03-14
Some applications, especially those clinical applications requiring high accuracy of sequencing data, usually have to face the troubles caused by unavoidable sequencing errors. Several tools have been proposed to profile the sequencing quality, but few of them can quantify or correct the sequencing errors. This unmet requirement motivated us to develop AfterQC, a tool with functions to profile sequencing errors and correct most of them, plus highly automated quality control and data filtering features. Different from most tools, AfterQC analyses the overlapping of paired sequences for pair-end sequencing data. Based on overlapping analysis, AfterQC can detect and cut adapters, and furthermore it gives a novel function to correct wrong bases in the overlapping regions. Another new feature is to detect and visualise sequencing bubbles, which can be commonly found on the flowcell lanes and may raise sequencing errors. Besides normal per cycle quality and base content plotting, AfterQC also provides features like polyX (a long sub-sequence of a same base X) filtering, automatic trimming and K-MER based strand bias profiling. For each single or pair of FastQ files, AfterQC filters out bad reads, detects and eliminates sequencer's bubble effects, trims reads at front and tail, detects the sequencing errors and corrects part of them, and finally outputs clean data and generates HTML reports with interactive figures. AfterQC can run in batch mode with multiprocess support, it can run with a single FastQ file, a single pair of FastQ files (for pair-end sequencing), or a folder for all included FastQ files to be processed automatically. Based on overlapping analysis, AfterQC can estimate the sequencing error rate and profile the error transform distribution. The results of our error profiling tests show that the error distribution is highly platform dependent. Much more than just another new quality control (QC) tool, AfterQC is able to perform quality control, data filtering, error profiling and base correction automatically. Experimental results show that AfterQC can help to eliminate the sequencing errors for pair-end sequencing data to provide much cleaner outputs, and consequently help to reduce the false-positive variants, especially for the low-frequency somatic mutations. While providing rich configurable options, AfterQC can detect and set all the options automatically and require no argument in most cases.
Yang, Qi; Zhang, Yanzhu; Zhao, Tiebiao; Chen, YangQuan
2017-04-04
Image super-resolution using self-optimizing mask via fractional-order gradient interpolation and reconstruction aims to recover detailed information from low-resolution images and reconstruct them into high-resolution images. Due to the limited amount of data and information retrieved from low-resolution images, it is difficult to restore clear, artifact-free images, while still preserving enough structure of the image such as the texture. This paper presents a new single image super-resolution method which is based on adaptive fractional-order gradient interpolation and reconstruction. The interpolated image gradient via optimal fractional-order gradient is first constructed according to the image similarity and afterwards the minimum energy function is employed to reconstruct the final high-resolution image. Fractional-order gradient based interpolation methods provide an additional degree of freedom which helps optimize the implementation quality due to the fact that an extra free parameter α-order is being used. The proposed method is able to produce a rich texture detail while still being able to maintain structural similarity even under large zoom conditions. Experimental results show that the proposed method performs better than current single image super-resolution techniques. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.
Caging and Photoactivation in Single-Molecule Förster Resonance Energy Transfer Experiments
2017-01-01
Caged organic fluorophores are established tools for localization-based super-resolution imaging. Their use relies on reversible deactivation of standard organic fluorophores by chemical reduction or commercially available caged dyes with ON switching of the fluorescent signal by ultraviolet (UV) light. Here, we establish caging of cyanine fluorophores and caged rhodamine dyes, i.e., chemical deactivation of fluorescence, for single-molecule Förster resonance energy transfer (smFRET) experiments with freely diffusing molecules. They allow temporal separation and sorting of multiple intramolecular donor–acceptor pairs during solution-based smFRET. We use this “caged FRET” methodology for the study of complex biochemical species such as multisubunit proteins or nucleic acids containing more than two fluorescent labels. Proof-of-principle experiments and a characterization of the uncaging process in the confocal volume are presented. These reveal that chemical caging and UV reactivation allow temporal uncoupling of convoluted fluorescence signals from, e.g., multiple spectrally similar donor or acceptor molecules on nucleic acids. We also use caging without UV reactivation to remove unwanted overlabeled species in experiments with the homotrimeric membrane transporter BetP. We finally outline further possible applications of the caged FRET methodology, such as the study of weak biochemical interactions, which are otherwise impossible with diffusion-based smFRET techniques because of the required low concentrations of fluorescently labeled biomolecules. PMID:28362086
Next generation sequencing applications for microRNA biomarker discovery in toxicological studies
Next Generation Sequencing (NGS) technology will be reviewed for its base pair resolution, wide dynamic range, and insights into the genome and transcriptome, with special focus upon the biomarker potential of microRNAs (miRNAs). The first part of this presentation reviews commo...
Development of position-sensitive time-of-flight spectrometer for fission fragment research
Arnold, C. W.; Tovesson, F.; Meierbachtol, K.; ...
2014-07-09
A position-sensitive, high-resolution time-of-flight detector for fission fragments has been developed. The SPectrometer for Ion DEtermination in fission Research (SPIDER) is a 2E–2v spectrometer designed to measure the mass of light fission fragments to a single mass unit. The time pick-off detector pairs to be used in SPIDER have been tested with α-particles from 229Th and its decay chain and α-particles and spontaneous fission fragments from 252Cf. Each detector module is comprised of thin electron conversion foil, electrostatic mirror, microchannel plates, and delay-line anodes. Particle trajectories on the order of 700 mm are determined accurately to within 0.7 mm. Flightmore » times were measured with 250 ps resolution FWHM. Computed particle velocities are accurate to within 0.06 mm/ns corresponding to a precision of 0.5%. As a result, an ionization chamber capable of 400 keV energy resolution coupled with the velocity measurements described here will pave the way for modestly efficient measurements of light fission fragments with unit mass resolution.« less
Characterization of stacked-crystal PET detector designs for measurement of both TOF and DOI
Schmall, Jeffrey P; Surti, Suleman; Karp, Joel S
2015-01-01
A PET detector with good timing resolution and two-level depth-of-interaction (DOI) discrimination can be constructed using a single-ended readout of scintillator stacks of Lanthanum Bromide (LaBr3), with various Cerium dopant concentrations, including pure Cerium Bromide (CeBr3). The stacked crystal geometry creates a unique signal shape for interactions occurring in each layer, which can be used to identify the DOI, while retaining the inherently good timing properties of LaBr3 and CeBr3. In this work, single pixel elements are used to optimize the choice of scintillator, coupling of layers, and type of photodetector, evaluating the performance using a fast, single-channel photomultiplier tube (PMT) and a single 4×4 mm2 silicon photomultiplier (SiPM). We also introduce a method to quantify and evaluate the DOI discrimination accuracy. From signal shape measurements using fast waveform sampling, we found that in addition to differences in signal rise times, between crystal layers, there were also differences in the signal fall times. A DOI accuracy of 98% was achieved using our classification method for a stacked crystal pair, consisting of a 15-mm long LaBr3(Ce:20%) crystal on top of a 15-mm long CeBr3 crystal, readout using a PMT. A DOI accuracy of 95% was measured with a stack of two, identical, 12-mm long, CeBr3 crystals. The DOI accuracy of this crystal pair was reduced to 91% when using a SiPM for readout. For the stack of two, 12-mm long, CeBr3 crystals, a coincidence timing resolution (average of timing results from the top and bottom layer) of 199 ps was measured using a PMT, and this was improved to 153 ps when using a SiPM. These results show that with stacked LaBr3/CeBr3 scintillators and fast waveform sampling nearly perfect DOI accuracy can be achieved with excellent timing resolution—timing resolution that is only minimally degraded compared to results from a single CeBr3 crystal of comparable length to the stacked crystals. The interface in the stacked crystal geometry itself plays a major role in creating the differences in signal shape and this can be used to construct stacked DOI detectors using the same scintillator type, thereby simplifying and broadening the application of this technique. PMID:25860172
Ra, Yong-Ho; Navamathavan, Rangaswamy; Yoo, Hee-Il; Lee, Cheul-Ro
2014-03-12
We report the controlled synthesis of InGaN/GaN multiple quantum well (MQW) uniaxial (c-plane) and coaxial (m-plane) nanowire (NW) heterostructures by metalorganic chemical vapor deposition. Two kinds of heterostructure NW light-emitting diodes (LEDs) have been fabricated: (1) 10 pairs of InGaN/GaN MQW layers in the c-plane on the top of n-GaN NWs where Mg-doped p-GaN NW is axially grown (2) p-GaN/10 pairs of InGaN/GaN shell structure were surrounded by n-GaN core. Here, we discuss a comparative analysis based on the m-plane and the c-plane oriented InGaN/GaN MQW NW arrays. High-resolution transmission electron microscopy studies revealed that the barrier and the well structures of MQW were observed to be substantially clear with regular intervals while the interface regions were extremely sharp. The c-plane and m-plane oriented MQW single NW was utilized for the parallel assembly fabrication of the LEDs via a focused ion beam. The polarization induced effects on the c-plane and m-plane oriented MQW NWs were precisely compared via power dependence electroluminescence. The electrical properties of m-plane NWs exhibited superior characteristics than that of c-plane NWs owing to the absence of piezoelectric polarization fields. According to this study, high-quality m-plane coaxial NWs can be utilized for the realization of high-brightness LEDs.
Murakami, Tatsuya C; Mano, Tomoyuki; Saikawa, Shu; Horiguchi, Shuhei A; Shigeta, Daichi; Baba, Kousuke; Sekiya, Hiroshi; Shimizu, Yoshihiro; Tanaka, Kenji F; Kiyonari, Hiroshi; Iino, Masamitsu; Mochizuki, Hideki; Tainaka, Kazuki; Ueda, Hiroki R
2018-04-01
A three-dimensional single-cell-resolution mammalian brain atlas will accelerate systems-level identification and analysis of cellular circuits underlying various brain functions. However, its construction requires efficient subcellular-resolution imaging throughout the entire brain. To address this challenge, we developed a fluorescent-protein-compatible, whole-organ clearing and homogeneous expansion protocol based on an aqueous chemical solution (CUBIC-X). The expanded, well-cleared brain enabled us to construct a point-based mouse brain atlas with single-cell annotation (CUBIC-Atlas). CUBIC-Atlas reflects inhomogeneous whole-brain development, revealing a significant decrease in the cerebral visual and somatosensory cortical areas during postnatal development. Probabilistic activity mapping of pharmacologically stimulated Arc-dVenus reporter mouse brains onto CUBIC-Atlas revealed the existence of distinct functional structures in the hippocampal dentate gyrus. CUBIC-Atlas is shareable by an open-source web-based viewer, providing a new platform for whole-brain cell profiling.
Spatial and Angular Resolution Enhancement of Light Fields Using Convolutional Neural Networks
NASA Astrophysics Data System (ADS)
Gul, M. Shahzeb Khan; Gunturk, Bahadir K.
2018-05-01
Light field imaging extends the traditional photography by capturing both spatial and angular distribution of light, which enables new capabilities, including post-capture refocusing, post-capture aperture control, and depth estimation from a single shot. Micro-lens array (MLA) based light field cameras offer a cost-effective approach to capture light field. A major drawback of MLA based light field cameras is low spatial resolution, which is due to the fact that a single image sensor is shared to capture both spatial and angular information. In this paper, we present a learning based light field enhancement approach. Both spatial and angular resolution of captured light field is enhanced using convolutional neural networks. The proposed method is tested with real light field data captured with a Lytro light field camera, clearly demonstrating spatial and angular resolution improvement.
Spatial and Angular Resolution Enhancement of Light Fields Using Convolutional Neural Networks.
Gul, M Shahzeb Khan; Gunturk, Bahadir K
2018-05-01
Light field imaging extends the traditional photography by capturing both spatial and angular distribution of light, which enables new capabilities, including post-capture refocusing, post-capture aperture control, and depth estimation from a single shot. Micro-lens array (MLA) based light field cameras offer a cost-effective approach to capture light field. A major drawback of MLA based light field cameras is low spatial resolution, which is due to the fact that a single image sensor is shared to capture both spatial and angular information. In this paper, we present a learning based light field enhancement approach. Both spatial and angular resolution of captured light field is enhanced using convolutional neural networks. The proposed method is tested with real light field data captured with a Lytro light field camera, clearly demonstrating spatial and angular resolution improvement.
Synthesis and Properties of Size-expanded DNAs: Toward Designed, Functional Genetic Systems
Krueger, Andrew T.; Lu, Haige; Lee, Alex H. F.; Kool, Eric T.
2008-01-01
We describe the design, synthesis, and properties of DNA-like molecules in which the base pairs are expanded by benzo homologation. The resulting size-expanded genetic helices are called xDNA (“expanded DNA”) and yDNA (“wide DNA”). The large component bases are fluorescent, and they display high stacking affinity. When singly substituted into natural DNA, they are destabilizing because the benzo-expanded base pair size is too large for the natural helix. However, when all base pairs are expanded, xDNA and yDNA form highly stable, sequence-selective double helices. The size-expanded DNAs are candidates for components of new, functioning genetic systems. In addition, the fluorescence of expanded DNA bases makes them potentially useful in probing nucleic acids. PMID:17309194
NASA Astrophysics Data System (ADS)
Ding, Xuemei; Wang, Bingyuan; Liu, Dongyuan; Zhang, Yao; He, Jie; Zhao, Huijuan; Gao, Feng
2018-02-01
During the past two decades there has been a dramatic rise in the use of functional near-infrared spectroscopy (fNIRS) as a neuroimaging technique in cognitive neuroscience research. Diffuse optical tomography (DOT) and optical topography (OT) can be employed as the optical imaging techniques for brain activity investigation. However, most current imagers with analogue detection are limited by sensitivity and dynamic range. Although photon-counting detection can significantly improve detection sensitivity, the intrinsic nature of sequential excitations reduces temporal resolution. To improve temporal resolution, sensitivity and dynamic range, we develop a multi-channel continuous-wave (CW) system for brain functional imaging based on a novel lock-in photon-counting technique. The system consists of 60 Light-emitting device (LED) sources at three wavelengths of 660nm, 780nm and 830nm, which are modulated by current-stabilized square-wave signals at different frequencies, and 12 photomultiplier tubes (PMT) based on lock-in photon-counting technique. This design combines the ultra-high sensitivity of the photon-counting technique with the parallelism of the digital lock-in technique. We can therefore acquire the diffused light intensity for all the source-detector pairs (SD-pairs) in parallel. The performance assessments of the system are conducted using phantom experiments, and demonstrate its excellent measurement linearity, negligible inter-channel crosstalk, strong noise robustness and high temporal resolution.
Detecting earthquakes over a seismic network using single-station similarity measures
NASA Astrophysics Data System (ADS)
Bergen, Karianne J.; Beroza, Gregory C.
2018-06-01
New blind waveform-similarity-based detection methods, such as Fingerprint and Similarity Thresholding (FAST), have shown promise for detecting weak signals in long-duration, continuous waveform data. While blind detectors are capable of identifying similar or repeating waveforms without templates, they can also be susceptible to false detections due to local correlated noise. In this work, we present a set of three new methods that allow us to extend single-station similarity-based detection over a seismic network; event-pair extraction, pairwise pseudo-association, and event resolution complete a post-processing pipeline that combines single-station similarity measures (e.g. FAST sparse similarity matrix) from each station in a network into a list of candidate events. The core technique, pairwise pseudo-association, leverages the pairwise structure of event detections in its network detection model, which allows it to identify events observed at multiple stations in the network without modeling the expected moveout. Though our approach is general, we apply it to extend FAST over a sparse seismic network. We demonstrate that our network-based extension of FAST is both sensitive and maintains a low false detection rate. As a test case, we apply our approach to 2 weeks of continuous waveform data from five stations during the foreshock sequence prior to the 2014 Mw 8.2 Iquique earthquake. Our method identifies nearly five times as many events as the local seismicity catalogue (including 95 per cent of the catalogue events), and less than 1 per cent of these candidate events are false detections.
Reducing Earth Topography Resolution for SMAP Mission Ground Tracks Using K-Means Clustering
NASA Technical Reports Server (NTRS)
Rizvi, Farheen
2013-01-01
The K-means clustering algorithm is used to reduce Earth topography resolution for the SMAP mission ground tracks. As SMAP propagates in orbit, knowledge of the radar antenna footprints on Earth is required for the antenna misalignment calibration. Each antenna footprint contains a latitude and longitude location pair on the Earth surface. There are 400 pairs in one data set for the calibration model. It is computationally expensive to calculate corresponding Earth elevation for these data pairs. Thus, the antenna footprint resolution is reduced. Similar topographical data pairs are grouped together with the K-means clustering algorithm. The resolution is reduced to the mean of each topographical cluster called the cluster centroid. The corresponding Earth elevation for each cluster centroid is assigned to the entire group. Results show that 400 data points are reduced to 60 while still maintaining algorithm performance and computational efficiency. In this work, sensitivity analysis is also performed to show a trade-off between algorithm performance versus computational efficiency as the number of cluster centroids and algorithm iterations are increased.
An emperor penguin population estimate: the first global, synoptic survey of a species from space.
Fretwell, Peter T; Larue, Michelle A; Morin, Paul; Kooyman, Gerald L; Wienecke, Barbara; Ratcliffe, Norman; Fox, Adrian J; Fleming, Andrew H; Porter, Claire; Trathan, Phil N
2012-01-01
Our aim was to estimate the population of emperor penguins (Aptenodytes fosteri) using a single synoptic survey. We examined the whole continental coastline of Antarctica using a combination of medium resolution and Very High Resolution (VHR) satellite imagery to identify emperor penguin colony locations. Where colonies were identified, VHR imagery was obtained in the 2009 breeding season. The remotely-sensed images were then analysed using a supervised classification method to separate penguins from snow, shadow and guano. Actual counts of penguins from eleven ground truthing sites were used to convert these classified areas into numbers of penguins using a robust regression algorithm.We found four new colonies and confirmed the location of three previously suspected sites giving a total number of emperor penguin breeding colonies of 46. We estimated the breeding population of emperor penguins at each colony during 2009 and provide a population estimate of ~238,000 breeding pairs (compared with the last previously published count of 135,000-175,000 pairs). Based on published values of the relationship between breeders and non-breeders, this translates to a total population of ~595,000 adult birds.There is a growing consensus in the literature that global and regional emperor penguin populations will be affected by changing climate, a driver thought to be critical to their future survival. However, a complete understanding is severely limited by the lack of detailed knowledge about much of their ecology, and importantly a poor understanding of their total breeding population. To address the second of these issues, our work now provides a comprehensive estimate of the total breeding population that can be used in future population models and will provide a baseline for long-term research.
An Emperor Penguin Population Estimate: The First Global, Synoptic Survey of a Species from Space
Fretwell, Peter T.; LaRue, Michelle A.; Morin, Paul; Kooyman, Gerald L.; Wienecke, Barbara; Ratcliffe, Norman; Fox, Adrian J.; Fleming, Andrew H.; Porter, Claire; Trathan, Phil N.
2012-01-01
Our aim was to estimate the population of emperor penguins (Aptenodytes fosteri) using a single synoptic survey. We examined the whole continental coastline of Antarctica using a combination of medium resolution and Very High Resolution (VHR) satellite imagery to identify emperor penguin colony locations. Where colonies were identified, VHR imagery was obtained in the 2009 breeding season. The remotely-sensed images were then analysed using a supervised classification method to separate penguins from snow, shadow and guano. Actual counts of penguins from eleven ground truthing sites were used to convert these classified areas into numbers of penguins using a robust regression algorithm. We found four new colonies and confirmed the location of three previously suspected sites giving a total number of emperor penguin breeding colonies of 46. We estimated the breeding population of emperor penguins at each colony during 2009 and provide a population estimate of ∼238,000 breeding pairs (compared with the last previously published count of 135,000–175,000 pairs). Based on published values of the relationship between breeders and non-breeders, this translates to a total population of ∼595,000 adult birds. There is a growing consensus in the literature that global and regional emperor penguin populations will be affected by changing climate, a driver thought to be critical to their future survival. However, a complete understanding is severely limited by the lack of detailed knowledge about much of their ecology, and importantly a poor understanding of their total breeding population. To address the second of these issues, our work now provides a comprehensive estimate of the total breeding population that can be used in future population models and will provide a baseline for long-term research. PMID:22514609
Chatzidimopoulos, Michael; Ganopoulos, Ioannis; Vellios, Evangelos; Madesis, Panagiotis; Tsaftaris, Athanasios; Pappas, Athanassios C
2014-11-01
A rapid, high-resolution melting (HRM) analysis protocol was developed to detect sequence variations associated with resistance to the QoIs, benzimidazoles and dicarboximides in Botrytis cinerea airborne inoculum. HRM analysis was applied directly in fungal DNA collected from air samplers with selective medium. Three and five different genotypes were detected and classified according to their melting profiles in BenA and bos1 genes associated with resistance to benzimidazoles and dicarboximides, respectively. The sensitivity of the methodology was evident in the case of the QoIs, where genotypes varying either by a single nucleotide polymorphism or an additional 1205-bp intron were separated accurately with a single pair of primers. The developed two-step protocol was completed in 82 min and showed reduced variation in the melting curves' formation. HRM analysis rapidly detected the major mutations found in greenhouse strains providing accurate data for successfully controlling grey mould. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Comparison of VRX CT scanners geometries
NASA Astrophysics Data System (ADS)
DiBianca, Frank A.; Melnyk, Roman; Duckworth, Christopher N.; Russ, Stephan; Jordan, Lawrence M.; Laughter, Joseph S.
2001-06-01
A technique called Variable-Resolution X-ray (VRX) detection greatly increases the spatial resolution in computed tomography (CT) and digital radiography (DR) as the field size decreases. The technique is based on a principle called `projective compression' that allows both the resolution element and the sampling distance of a CT detector to scale with the subject or field size. For very large (40 - 50 cm) field sizes, resolution exceeding 2 cy/mm is possible and for very small fields, microscopy is attainable with resolution exceeding 100 cy/mm. This paper compares the benefits obtainable with two different VRX detector geometries: the single-arm geometry and the dual-arm geometry. The analysis is based on Monte Carlo simulations and direct calculations. The results of this study indicate that the dual-arm system appears to have more advantages than the single-arm technique.
NASA Technical Reports Server (NTRS)
Skakun, Sergii; Roger, Jean-Claude; Vermote, Eric F.; Masek, Jeffrey G.; Justice, Christopher O.
2017-01-01
This study investigates misregistration issues between Landsat-8/OLI and Sentinel-2A/MSI at 30 m resolution, and between multi-temporal Sentinel-2A images at 10 m resolution using a phase correlation approach and multiple transformation functions. Co-registration of 45 Landsat-8 to Sentinel-2A pairs and 37 Sentinel-2A to Sentinel-2A pairs were analyzed. Phase correlation proved to be a robust approach that allowed us to identify hundreds and thousands of control points on images acquired more than 100 days apart. Overall, misregistration of up to 1.6 pixels at 30 m resolution between Landsat-8 and Sentinel-2A images, and 1.2 pixels and 2.8 pixels at 10 m resolution between multi-temporal Sentinel-2A images from the same and different orbits, respectively, were observed. The non-linear Random Forest regression used for constructing the mapping function showed best results in terms of root mean square error (RMSE), yielding an average RMSE error of 0.07+/-0.02 pixels at 30 m resolution, and 0.09+/-0.05 and 0.15+/-0.06 pixels at 10 m resolution for the same and adjacent Sentinel-2A orbits, respectively, for multiple tiles and multiple conditions. A simpler 1st order polynomial function (affine transformation) yielded RMSE of 0.08+/-0.02 pixels at 30 m resolution and 0.12+/-0.06 (same Sentinel-2A orbits) and 0.20+/-0.09 (adjacent orbits) pixels at 10 m resolution.
Validation of cryo-EM structure of IP₃R1 channel.
Murray, Stephen C; Flanagan, John; Popova, Olga B; Chiu, Wah; Ludtke, Steven J; Serysheva, Irina I
2013-06-04
About a decade ago, three electron cryomicroscopy (cryo-EM) single-particle reconstructions of IP3R1 were reported at low resolution. It was disturbing that these structures bore little similarity to one another, even at the level of quaternary structure. Recently, we published an improved structure of IP3R1 at ∼1 nm resolution. However, this structure did not bear any resemblance to any of the three previously published structures, leading to the question of why the structure should be considered more reliable than the original three. Here, we apply several methods, including class-average/map comparisons, tilt-pair validation, and use of multiple refinement software packages, to give strong evidence for the reliability of our recent structure. The map resolution and feature resolvability are assessed with the gold standard criterion. This approach is generally applicable to assessing the validity of cryo-EM maps of other molecular machines. Copyright © 2013 Elsevier Ltd. All rights reserved.
A high resolution InSAR topographic reconstruction research in urban area based on TerraSAR-X data
NASA Astrophysics Data System (ADS)
Qu, Feifei; Qin, Zhang; Zhao, Chaoying; Zhu, Wu
2011-10-01
Aiming at the problems of difficult unwrapping and phase noise in InSAR DEM reconstruction, especially for the high-resolution TerraSAR-X data, this paper improved the height reconstruction algorithm in view of "remove-restore" based on external coarse DEM and multi-interferogram processing, proposed a height calibration method based on CR+GPS data. Several measures have been taken for urban high resolution DEM reconstruction with TerraSAR data. The SAR interferometric pairs with long spatial and short temporal baselines are served for the DEM. The external low resolution and low accuracy DEM is applied for the "remove-restore" concept to ease the phase unwrapping. The stochastic errors including atmospheric effects and phase noise are suppressed by weighted averaging of DEM phases. Six TerraSAR-X data are applied to create the twelve-meter's resolution DEM over Xian, China with the newly-proposed method. The heights in discrete GPS benchmarks are used to calibrate the result, and the RMS of 3.29 meter is achieved by comparing with 1:50000 DEM.
The presence of codon-anticodon pairs in the acceptor stem of tRNAs.
Rodin, S; Rodin, A; Ohno, S
1996-01-01
A total of 1268 available (excluding mitochondrial) tRNA sequences was used to reconstruct the common consensus image of their acceptor domains. Its structure appeared as a 11-bp-long double-stranded palindrome with complementary triplets in the center, each flanked by the 3'-ACCD and NGGU-5' motifs on each strand (D, base determinator). The palindrome readily extends up to the modern tRNA-like cloverleaf passing through an intermediate hairpin having in the center the single-stranded triplet, in supplement to its double-stranded precursor. The latter might represent an original anticodon-codon pair mapped at 1-2-3 positions of the present-day tRNA acceptors. This conclusion is supported by the striking correlation: in pairs of consensus tRNAs with complementary anticodons, their bases at the 2nd position of the acceptor stem were also complementary. Accordingly, inverse complementarity was also evident at the 71st position of the acceptor stem. With a single exception (tRNA(Phe)-tRNA(Glu) pair), the parallelism is especially impressive for the pairs of tRNAs recognized by aminoacyl-tRNA synthetases (aaRS) from the opposite classes. The above complementarity still doubly presented at the key central position of real single-stranded anticodons and their hypothetical double-stranded precursors is consistent with our previous data pointing to the double-strand use of ancient RNAs in the origin of the main actors in translation- tRNAs with complementary anticodons and the two classes of aaRS. Images Fig. 3 Table 2 Fig. 4 PMID:8643439
Yuan, Tiezhu; Wang, Hongqiang; Cheng, Yongqiang; Qin, Yuliang
2017-01-01
Radar imaging based on electromagnetic vortex can achieve azimuth resolution without relative motion. The present paper investigates this imaging technique with the use of a single receiving antenna through theoretical analysis and experimental results. Compared with the use of multiple receiving antennas, the echoes from a single receiver cannot be used directly for image reconstruction using Fourier method. The reason is revealed by using the point spread function. An additional phase is compensated for each mode before imaging process based on the array parameters and the elevation of the targets. A proof-of-concept imaging system based on a circular phased array is created, and imaging experiments of corner-reflector targets are performed in an anechoic chamber. The azimuthal image is reconstructed by the use of Fourier transform and spectral estimation methods. The azimuth resolution of the two methods is analyzed and compared through experimental data. The experimental results verify the principle of azimuth resolution and the proposed phase compensation method. PMID:28335487
47 CFR 90.313 - Frequency loading criteria.
Code of Federal Regulations, 2010 CFR
2010-10-01
..., Washington, or more from the location of base stations authorized on that pair without reference to loading... Industrial Radio Services, if the base station facility is to be used by more than a single licensee, the...
Krumm, Sabine; Kivisaari, Sasa L; Monsch, Andreas U; Reinhardt, Julia; Ulmer, Stephan; Stippich, Christoph; Kressig, Reto W; Taylor, Kirsten I
2017-05-01
The parietal lobe is important for successful recognition memory, but its role is not yet fully understood. We investigated the parietal lobes' contribution to immediate paired-associate memory and delayed item-recognition memory separately for hits (targets) and correct rejections (distractors). We compared the behavioral performance of 56 patients with known parietal and medial temporal lobe dysfunction (i.e. early Alzheimer's Disease) to 56 healthy control participants in an immediate paired and delayed single item object memory task. Additionally, we performed voxel-based morphometry analyses to investigate the functional-neuroanatomic relationships between performance and voxel-based estimates of atrophy in whole-brain analyses. Behaviorally, all participants performed better identifying targets than rejecting distractors. The voxel-based morphometry analyses associated atrophy in the right ventral parietal cortex with fewer correct responses to familiar items (i.e. hits) in the immediate and delayed conditions. Additionally, medial temporal lobe integrity correlated with better performance in rejecting distractors, but not in identifying targets, in the immediate paired-associate task. Our findings suggest that the parietal lobe critically supports successful immediate and delayed target recognition memory, and that the ventral aspect of the parietal cortex and the medial temporal lobe may have complementary preferences for identifying targets and rejecting distractors, respectively, during recognition memory. Copyright © 2017. Published by Elsevier Inc.
Femtosecond Laser--Pumped Source of Entangled Photons for Quantum Cryptography Applications
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pan, D.; Donaldson, W.; Sobolewski, R.
2007-07-31
We present an experimental setup for generation of entangled-photon pairs via spontaneous parametric down-conversion, based on the femtosecond-pulsed laser. Our entangled-photon source utilizes a 76-MHz-repetition-rate, 100-fs-pulse-width, mode-locked, ultrafast femtosecond laser, which can produce, on average, more photon pairs than a cw laser of an equal pump power. The resulting entangled pairs are counted by a pair of high-quantum-efficiency, single-photon, silicon avalanche photodiodes. Our apparatus is intended as an efficient source/receiver system for the quantum communications and quantum cryptography applications.
Kotasidis, F A; Matthews, J C; Angelis, G I; Noonan, P J; Jackson, A; Price, P; Lionheart, W R; Reader, A J
2011-05-21
Incorporation of a resolution model during statistical image reconstruction often produces images of improved resolution and signal-to-noise ratio. A novel and practical methodology to rapidly and accurately determine the overall emission and detection blurring component of the system matrix using a printed point source array within a custom-made Perspex phantom is presented. The array was scanned at different positions and orientations within the field of view (FOV) to examine the feasibility of extrapolating the measured point source blurring to other locations in the FOV and the robustness of measurements from a single point source array scan. We measured the spatially-variant image-based blurring on two PET/CT scanners, the B-Hi-Rez and the TruePoint TrueV. These measured spatially-variant kernels and the spatially-invariant kernel at the FOV centre were then incorporated within an ordinary Poisson ordered subset expectation maximization (OP-OSEM) algorithm and compared to the manufacturer's implementation using projection space resolution modelling (RM). Comparisons were based on a point source array, the NEMA IEC image quality phantom, the Cologne resolution phantom and two clinical studies (carbon-11 labelled anti-sense oligonucleotide [(11)C]-ASO and fluorine-18 labelled fluoro-l-thymidine [(18)F]-FLT). Robust and accurate measurements of spatially-variant image blurring were successfully obtained from a single scan. Spatially-variant resolution modelling resulted in notable resolution improvements away from the centre of the FOV. Comparison between spatially-variant image-space methods and the projection-space approach (the first such report, using a range of studies) demonstrated very similar performance with our image-based implementation producing slightly better contrast recovery (CR) for the same level of image roughness (IR). These results demonstrate that image-based resolution modelling within reconstruction is a valid alternative to projection-based modelling, and that, when using the proposed practical methodology, the necessary resolution measurements can be obtained from a single scan. This approach avoids the relatively time-consuming and involved procedures previously proposed in the literature.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ronzhin, A.; Los, S.; Martens, M.
2011-02-01
We report on work to develop a system with about 100 picoseconds (ps) time resolution for time of flight positron emission tomography [TOF-PET]. The chosen photo detectors for the study were Silicon Photomultipliers (SiPM's). This study was based on extensive experience in studying timing properties of SiPM's. The readout of these devices used the commercial high speed digitizer DRS4. We applied different algorithms to get the best time resolution of 155 ps Guassian (sigma) for a LYSO crystal coupled to a SiPM. We consider the work as a first step in building a prototype TOF-PET module. The field of positron-emission-tomographymore » (PET) has been rapidly developing. But there are significant limitations in how well current PET scanners can reconstruct images, related to how fast data can be acquired, how much volume they can image, and the spatial and temporal resolution of the generated photons. Typical modern scanners now include multiple rings of detectors, which can image a large volume of the patient. In this type of scanner, one can treat each ring as a separate detector and require coincidences only within the ring, or treat the entire region viewed by the scanner as a single 3 dimensional volume. This 3d technique has significantly better sensitivity since more photon pair trajectories are accepted. However, the scattering of photons within the volume of the patient, and the effect of random coincidences limits the technique. The advent of sub-nanosecond timing resolution detectors means that there is potentially much better rejection of scattered photon events and random coincidence events in the 3D technique. In addition, if the timing is good enough, then the origin of photons pairs can be determined better, resulting in improved spatial resolution - so called 'Time-of-Flight' PET, or TOF-PET. Currently a lot of activity has occurred in applications of SiPMs for TOF-PET. This is due to the devices very good time resolution, low profile, lack of high voltage needed, and their non-sensitivity to magnetic fields. While investigations into this technique have begun elsewhere, we feel that the extensive SiPM characterization and data acquisition expertise of Fermilab, and the historical in-depth research of PET imaging at University of Chicago will combine to make significant strides in this field. We also benefit by a working relationship with the SiPM producer STMicroelectronics (STM).« less
Arlt, Martin F.; Ozdemir, Alev Cagla; Birkeland, Shanda R.; Lyons, Robert H.; Glover, Thomas W.; Wilson, Thomas E.
2011-01-01
Copy-number variants (CNVs) are a major source of genetic variation in human health and disease. Previous studies have implicated replication stress as a causative factor in CNV formation. However, existing data are technically limited in the quality of comparisons that can be made between human CNVs and experimentally induced variants. Here, we used two high-resolution strategies—single nucleotide polymorphism (SNP) arrays and mate-pair sequencing—to compare CNVs that occur constitutionally to those that arise following aphidicolin-induced DNA replication stress in the same human cells. Although the optimized methods provided complementary information, sequencing was more sensitive to small variants and provided superior structural descriptions. The majority of constitutional and all aphidicolin-induced CNVs appear to be formed via homology-independent mechanisms, while aphidicolin-induced CNVs were of a larger median size than constitutional events even when mate-pair data were considered. Aphidicolin thus appears to stimulate formation of CNVs that closely resemble human pathogenic CNVs and the subset of larger nonhomologous constitutional CNVs. PMID:21212237
NASA Astrophysics Data System (ADS)
Fyta, Maria; Netz, Roland R.
2012-03-01
Using molecular dynamics (MD) simulations in conjunction with the SPC/E water model, we optimize ionic force-field parameters for seven different halide and alkali ions, considering a total of eight ion-pairs. Our strategy is based on simultaneous optimizing single-ion and ion-pair properties, i.e., we first fix ion-water parameters based on single-ion solvation free energies, and in a second step determine the cation-anion interaction parameters (traditionally given by mixing or combination rules) based on the Kirkwood-Buff theory without modification of the ion-water interaction parameters. In doing so, we have introduced scaling factors for the cation-anion Lennard-Jones (LJ) interaction that quantify deviations from the standard mixing rules. For the rather size-symmetric salt solutions involving bromide and chloride ions, the standard mixing rules work fine. On the other hand, for the iodide and fluoride solutions, corresponding to the largest and smallest anion considered in this work, a rescaling of the mixing rules was necessary. For iodide, the experimental activities suggest more tightly bound ion pairing than given by the standard mixing rules, which is achieved in simulations by reducing the scaling factor of the cation-anion LJ energy. For fluoride, the situation is different and the simulations show too large attraction between fluoride and cations when compared with experimental data. For NaF, the situation can be rectified by increasing the cation-anion LJ energy. For KF, it proves necessary to increase the effective cation-anion Lennard-Jones diameter. The optimization strategy outlined in this work can be easily adapted to different kinds of ions.
An efficient and near linear scaling pair natural orbital based local coupled cluster method.
Riplinger, Christoph; Neese, Frank
2013-01-21
In previous publications, it was shown that an efficient local coupled cluster method with single- and double excitations can be based on the concept of pair natural orbitals (PNOs) [F. Neese, A. Hansen, and D. G. Liakos, J. Chem. Phys. 131, 064103 (2009)]. The resulting local pair natural orbital-coupled-cluster single double (LPNO-CCSD) method has since been proven to be highly reliable and efficient. For large molecules, the number of amplitudes to be determined is reduced by a factor of 10(5)-10(6) relative to a canonical CCSD calculation on the same system with the same basis set. In the original method, the PNOs were expanded in the set of canonical virtual orbitals and single excitations were not truncated. This led to a number of fifth order scaling steps that eventually rendered the method computationally expensive for large molecules (e.g., >100 atoms). In the present work, these limitations are overcome by a complete redesign of the LPNO-CCSD method. The new method is based on the combination of the concepts of PNOs and projected atomic orbitals (PAOs). Thus, each PNO is expanded in a set of PAOs that in turn belong to a given electron pair specific domain. In this way, it is possible to fully exploit locality while maintaining the extremely high compactness of the original LPNO-CCSD wavefunction. No terms are dropped from the CCSD equations and domains are chosen conservatively. The correlation energy loss due to the domains remains below <0.05%, which implies typically 15-20 but occasionally up to 30 atoms per domain on average. The new method has been given the acronym DLPNO-CCSD ("domain based LPNO-CCSD"). The method is nearly linear scaling with respect to system size. The original LPNO-CCSD method had three adjustable truncation thresholds that were chosen conservatively and do not need to be changed for actual applications. In the present treatment, no additional truncation parameters have been introduced. Any additional truncation is performed on the basis of the three original thresholds. There are no real-space cutoffs. Single excitations are truncated using singles-specific natural orbitals. Pairs are prescreened according to a multipole expansion of a pair correlation energy estimate based on local orbital specific virtual orbitals (LOSVs). Like its LPNO-CCSD predecessor, the method is completely of black box character and does not require any user adjustments. It is shown here that DLPNO-CCSD is as accurate as LPNO-CCSD while leading to computational savings exceeding one order of magnitude for larger systems. The largest calculations reported here featured >8800 basis functions and >450 atoms. In all larger test calculations done so far, the LPNO-CCSD step took less time than the preceding Hartree-Fock calculation, provided no approximations have been introduced in the latter. Thus, based on the present development reliable CCSD calculations on large molecules with unprecedented efficiency and accuracy are realized.
Resonant inelastic X-ray scattering spectrometer with 25meV resolution at the Cu K -edge
Ketenoglu, Didem; Harder, Manuel; Klementiev, Konstantin; ...
2015-06-27
An unparalleled resolution is reported with an inelastic X-ray scattering instrument at the CuK-edge. Based on a segmented concave analyzer, featuring single-crystal quartz (SiO 2) pixels, the spectrometer delivers a resolution near 25meV (FWHM) at 8981eV. Besides the quartz analyzer, the performance of the spectrometer relies on a four-bounce Si(553) high-resolution monochromator and focusing Kirkpatrick–Baez optics. The measured resolution agrees with the ray-tracing simulation of an ideal spectrometer. The performance of the spectrometer is demonstrated by reproducing the phonon dispersion curve of a beryllium single-crystal.
Single-molecule fluorescence reveals the unwinding stepping mechanism of replicative helicase.
Syed, Salman; Pandey, Manjula; Patel, Smita S; Ha, Taekjip
2014-03-27
Bacteriophage T7 gp4 serves as a model protein for replicative helicases that couples deoxythymidine triphosphate (dTTP) hydrolysis to directional movement and DNA strand separation. We employed single-molecule fluorescence resonance energy transfer methods to resolve steps during DNA unwinding by T7 helicase. We confirm that the unwinding rate of T7 helicase decreases with increasing base pair stability. For duplexes containing >35% guanine-cytosine (GC) base pairs, we observed stochastic pauses every 2-3 bp during unwinding. The dwells on each pause were distributed nonexponentially, consistent with two or three rounds of dTTP hydrolysis before each unwinding step. Moreover, we observed backward movements of the enzyme on GC-rich DNAs at low dTTP concentrations. Our data suggest a coupling ratio of 1:1 between base pairs unwound and dTTP hydrolysis, and they further support the concept that nucleic acid motors can have a hierarchy of different-sized steps or can accumulate elastic energy before transitioning to a subsequent phase. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
NASA Technical Reports Server (NTRS)
Hunter, Stanley D.
2011-01-01
Gamma-ray astrophysics probes the highest energy, exotic phenomena in astrophysics. In the medium-energy regime, 0.1-200 MeV, many astrophysical objects exhibit unique and transitory behavior such as the transition from electron dominated to hadron dominated processes, spectral breaks, bursts, and flares. Medium-energy gamma-ray imaging however, continues to be a major challenge particularly because of high background, low effective area, and low source intensities. The sensitivity and angular resolution required to address these challenges requires a leap in technology. The Advance Energetic Pair Telescope (AdEPT) being developed at GSFC is designed to image gamma rays above 5 MeV via pair production with angular resolution of 1-10 deg. In addition AdEPT will, for the first time, provide high polarization sensitivity in this energy range. This performance is achieved by reducing the effective area in favor of enhanced angular resolution through the use of a low-density gaseous conversion medium. AdEPT is based on the Three-Dimensional Track Imager (3-DTI) technology that combines a large volume Negative Ion Time Projection Chamber (NITPC) with 2-D Micro-Well Detector (MWD) readout. I will review the major science topics addressable with medium-energy gamma-rays and discuss the current status of the AdEPT technology, a proposed balloon instrument, and the design of a future satellite mission.
In trans paired nicking triggers seamless genome editing without double-stranded DNA cutting.
Chen, Xiaoyu; Janssen, Josephine M; Liu, Jin; Maggio, Ignazio; 't Jong, Anke E J; Mikkers, Harald M M; Gonçalves, Manuel A F V
2017-09-22
Precise genome editing involves homologous recombination between donor DNA and chromosomal sequences subjected to double-stranded DNA breaks made by programmable nucleases. Ideally, genome editing should be efficient, specific, and accurate. However, besides constituting potential translocation-initiating lesions, double-stranded DNA breaks (targeted or otherwise) are mostly repaired through unpredictable and mutagenic non-homologous recombination processes. Here, we report that the coordinated formation of paired single-stranded DNA breaks, or nicks, at donor plasmids and chromosomal target sites by RNA-guided nucleases based on CRISPR-Cas9 components, triggers seamless homology-directed gene targeting of large genetic payloads in human cells, including pluripotent stem cells. Importantly, in addition to significantly reducing the mutagenicity of the genome modification procedure, this in trans paired nicking strategy achieves multiplexed, single-step, gene targeting, and yields higher frequencies of accurately edited cells when compared to the standard double-stranded DNA break-dependent approach.CRISPR-Cas9-based gene editing involves double-strand breaks at target sequences, which are often repaired by mutagenic non-homologous end-joining. Here the authors use Cas9 nickases to generate coordinated single-strand breaks in donor and target DNA for precise homology-directed gene editing.
NASA Astrophysics Data System (ADS)
Riplinger, Christoph; Pinski, Peter; Becker, Ute; Valeev, Edward F.; Neese, Frank
2016-01-01
Domain based local pair natural orbital coupled cluster theory with single-, double-, and perturbative triple excitations (DLPNO-CCSD(T)) is a highly efficient local correlation method. It is known to be accurate and robust and can be used in a black box fashion in order to obtain coupled cluster quality total energies for large molecules with several hundred atoms. While previous implementations showed near linear scaling up to a few hundred atoms, several nonlinear scaling steps limited the applicability of the method for very large systems. In this work, these limitations are overcome and a linear scaling DLPNO-CCSD(T) method for closed shell systems is reported. The new implementation is based on the concept of sparse maps that was introduced in Part I of this series [P. Pinski, C. Riplinger, E. F. Valeev, and F. Neese, J. Chem. Phys. 143, 034108 (2015)]. Using the sparse map infrastructure, all essential computational steps (integral transformation and storage, initial guess, pair natural orbital construction, amplitude iterations, triples correction) are achieved in a linear scaling fashion. In addition, a number of additional algorithmic improvements are reported that lead to significant speedups of the method. The new, linear-scaling DLPNO-CCSD(T) implementation typically is 7 times faster than the previous implementation and consumes 4 times less disk space for large three-dimensional systems. For linear systems, the performance gains and memory savings are substantially larger. Calculations with more than 20 000 basis functions and 1000 atoms are reported in this work. In all cases, the time required for the coupled cluster step is comparable to or lower than for the preceding Hartree-Fock calculation, even if this is carried out with the efficient resolution-of-the-identity and chain-of-spheres approximations. The new implementation even reduces the error in absolute correlation energies by about a factor of two, compared to the already accurate previous implementation.
1981-06-01
pairwise conflict or an indication of BCAS control . A Pair Record is also created when an aircraft receives a resolution advisory from BCAS or from a non ...replying site: Update track numbers: ILS!I’ (pair record shows a non -connected site in control ) T"_N CALL AI!CPAFTPAIRriwTIFICRTaOI: ( both aircraft...Springfield, Virginia 22161 a>- U S Department of Transportain Systems Research & Development Service LWashington, D.C. 20590 94 This document is
Nine pairs of megastigmane enantiomers from the leaves of Eucommia ulmoides Oliver.
Yan, Jiankun; Shi, Xuliu; Donkor, Paul Owusu; Zhu, Huajie; Gao, Xiumei; Ding, Liqin; Qiu, Feng
2017-10-01
Nine pairs of megastigmane enantiomers (1a/1b-9a/9b), comprising two new compounds (6S,9R)-blumenol C (7b), (6S,9S)-blumenol C (8b), two pairs of enantiomers (+)-(6R)-eucomegastigmane A (1a), (-)-(6S)-eucomegastigmane A (1b), (+)-(3S,4S)-eucomegastigmane B (5a), (-)-(3R,4R)-eucomegastigmane B (5b) isolated by chiral resolution firstly, and twelve known compounds, were isolated from the leaves of Eucommia ulmoides Oliver. Their structures were elucidated based on extensive spectroscopic analysis. Absolute configurations of the megastigmane enantiomers were assigned by comparing experimental ECD and OR with calculated ECD and OR. Docking-based virtual screening of all compounds showed that megastigmane enantiomers have weak intermolecular interactions with the binding site residues of angiotensin-converting enzyme (ACE) and angiotensin II type 1 receptor (AT 1 R).
Performance evaluation of a high-resolution brain PET scanner using four-layer MPPC DOI detectors.
Watanabe, Mitsuo; Saito, Akinori; Isobe, Takashi; Ote, Kibo; Yamada, Ryoko; Moriya, Takahiro; Omura, Tomohide
2017-08-18
A high-resolution positron emission tomography (PET) scanner, dedicated to brain studies, was developed and its performance was evaluated. A four-layer depth of interaction detector was designed containing five detector units axially lined up per layer board. Each of the detector units consists of a finely segmented (1.2 mm) LYSO scintillator array and an 8 × 8 array of multi-pixel photon counters. Each detector layer has independent front-end and signal processing circuits, and the four detector layers are assembled as a detector module. The new scanner was designed to form a detector ring of 430 mm diameter with 32 detector modules and 168 detector rings with a 1.2 mm pitch. The total crystal number is 655 360. The transaxial and axial field of views (FOVs) are 330 mm in diameter and 201.6 mm, respectively, which are sufficient to measure a whole human brain. The single-event data generated at each detector module were transferred to the data acquisition servers through optical fiber cables. The single-event data from all detector modules were merged and processed to create coincidence event data in on-the-fly software in the data acquisition servers. For image reconstruction, the high-resolution mode (HR-mode) used a 1.2 mm 2 crystal segment size and the high-speed mode (HS-mode) used a 4.8 mm 2 size by collecting 16 crystal segments of 1.2 mm each to reduce the computational cost. The performance of the brain PET scanner was evaluated. For the intrinsic spatial resolution of the detector module, coincidence response functions of the detector module pair, which faced each other at various angles, were measured by scanning a 0.25 mm diameter 22 Na point source. The intrinsic resolutions were obtained with 1.08 mm full width at half-maximum (FWHM) and 1.25 mm FWHM on average at 0 and 22.5 degrees in the first layer pair, respectively. The system spatial resolutions were less than 1.0 mm FWHM throughout the whole FOV, using a list-mode dynamic RAMLA (LM-DRAMA). The system sensitivity was 21.4 cps kBq -1 as measured using an 18 F line source aligned with the center of the transaxial FOV. High count rate capability was evaluated using a cylindrical phantom (20 cm diameter × 70 cm length), resulting in 249 kcps in true and 27.9 kcps at 11.9 kBq ml -1 at the peak count in a noise equivalent count rate (NECR_2R). Single-event data acquisition and on-the-fly software coincidence detection performed well, exceeding 25 Mcps and 2.3 Mcps for single and coincidence count rates, respectively. Using phantom studies, we also demonstrated its imaging capabilities by means of a 3D Hoffman brain phantom and an ultra-micro hot-spot phantom. The images obtained were of acceptable quality for high-resolution determination. As clinical and pre-clinical studies, we imaged brains of a human and of small animals.
Performance evaluation of a high-resolution brain PET scanner using four-layer MPPC DOI detectors
NASA Astrophysics Data System (ADS)
Watanabe, Mitsuo; Saito, Akinori; Isobe, Takashi; Ote, Kibo; Yamada, Ryoko; Moriya, Takahiro; Omura, Tomohide
2017-09-01
A high-resolution positron emission tomography (PET) scanner, dedicated to brain studies, was developed and its performance was evaluated. A four-layer depth of interaction detector was designed containing five detector units axially lined up per layer board. Each of the detector units consists of a finely segmented (1.2 mm) LYSO scintillator array and an 8 × 8 array of multi-pixel photon counters. Each detector layer has independent front-end and signal processing circuits, and the four detector layers are assembled as a detector module. The new scanner was designed to form a detector ring of 430 mm diameter with 32 detector modules and 168 detector rings with a 1.2 mm pitch. The total crystal number is 655 360. The transaxial and axial field of views (FOVs) are 330 mm in diameter and 201.6 mm, respectively, which are sufficient to measure a whole human brain. The single-event data generated at each detector module were transferred to the data acquisition servers through optical fiber cables. The single-event data from all detector modules were merged and processed to create coincidence event data in on-the-fly software in the data acquisition servers. For image reconstruction, the high-resolution mode (HR-mode) used a 1.2 mm2 crystal segment size and the high-speed mode (HS-mode) used a 4.8 mm2 size by collecting 16 crystal segments of 1.2 mm each to reduce the computational cost. The performance of the brain PET scanner was evaluated. For the intrinsic spatial resolution of the detector module, coincidence response functions of the detector module pair, which faced each other at various angles, were measured by scanning a 0.25 mm diameter 22Na point source. The intrinsic resolutions were obtained with 1.08 mm full width at half-maximum (FWHM) and 1.25 mm FWHM on average at 0 and 22.5 degrees in the first layer pair, respectively. The system spatial resolutions were less than 1.0 mm FWHM throughout the whole FOV, using a list-mode dynamic RAMLA (LM-DRAMA). The system sensitivity was 21.4 cps kBq-1 as measured using an 18F line source aligned with the center of the transaxial FOV. High count rate capability was evaluated using a cylindrical phantom (20 cm diameter × 70 cm length), resulting in 249 kcps in true and 27.9 kcps at 11.9 kBq ml-1 at the peak count in a noise equivalent count rate (NECR_2R). Single-event data acquisition and on-the-fly software coincidence detection performed well, exceeding 25 Mcps and 2.3 Mcps for single and coincidence count rates, respectively. Using phantom studies, we also demonstrated its imaging capabilities by means of a 3D Hoffman brain phantom and an ultra-micro hot-spot phantom. The images obtained were of acceptable quality for high-resolution determination. As clinical and pre-clinical studies, we imaged brains of a human and of small animals.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yeo, Hyun Koo; Lee, Jae Young
2012-04-18
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.
Yeo, Hyun Koo; Lee, Jae Young
2010-05-01
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .
Simultaneous deblurring and iterative reconstruction of CBCT for image guided brain radiosurgery.
Hashemi, SayedMasoud; Song, William Y; Sahgal, Arjun; Lee, Young; Huynh, Christopher; Grouza, Vladimir; Nordström, Håkan; Eriksson, Markus; Dorenlot, Antoine; Régis, Jean Marie; Mainprize, James G; Ruschin, Mark
2017-04-07
One of the limiting factors in cone-beam CT (CBCT) image quality is system blur, caused by detector response, x-ray source focal spot size, azimuthal blurring, and reconstruction algorithm. In this work, we develop a novel iterative reconstruction algorithm that improves spatial resolution by explicitly accounting for image unsharpness caused by different factors in the reconstruction formulation. While the model-based iterative reconstruction techniques use prior information about the detector response and x-ray source, our proposed technique uses a simple measurable blurring model. In our reconstruction algorithm, denoted as simultaneous deblurring and iterative reconstruction (SDIR), the blur kernel can be estimated using the modulation transfer function (MTF) slice of the CatPhan phantom or any other MTF phantom, such as wire phantoms. The proposed image reconstruction formulation includes two regularization terms: (1) total variation (TV) and (2) nonlocal regularization, solved with a split Bregman augmented Lagrangian iterative method. The SDIR formulation preserves edges, eases the parameter adjustments to achieve both high spatial resolution and low noise variances, and reduces the staircase effect caused by regular TV-penalized iterative algorithms. The proposed algorithm is optimized for a point-of-care head CBCT unit for image-guided radiosurgery and is tested with CatPhan phantom, an anthropomorphic head phantom, and 6 clinical brain stereotactic radiosurgery cases. Our experiments indicate that SDIR outperforms the conventional filtered back projection and TV penalized simultaneous algebraic reconstruction technique methods (represented by adaptive steepest-descent POCS algorithm, ASD-POCS) in terms of MTF and line pair resolution, and retains the favorable properties of the standard TV-based iterative reconstruction algorithms in improving the contrast and reducing the reconstruction artifacts. It improves the visibility of the high contrast details in bony areas and the brain soft-tissue. For example, the results show the ventricles and some brain folds become visible in SDIR reconstructed images and the contrast of the visible lesions is effectively improved. The line-pair resolution was improved from 12 line-pair/cm in FBP to 14 line-pair/cm in SDIR. Adjusting the parameters of the ASD-POCS to achieve 14 line-pair/cm caused the noise variance to be higher than the SDIR. Using these parameters for ASD-POCS, the MTF of FBP and ASD-POCS were very close and equal to 0.7 mm -1 which was increased to 1.2 mm -1 by SDIR, at half maximum.
Simultaneous deblurring and iterative reconstruction of CBCT for image guided brain radiosurgery
NASA Astrophysics Data System (ADS)
Hashemi, SayedMasoud; Song, William Y.; Sahgal, Arjun; Lee, Young; Huynh, Christopher; Grouza, Vladimir; Nordström, Håkan; Eriksson, Markus; Dorenlot, Antoine; Régis, Jean Marie; Mainprize, James G.; Ruschin, Mark
2017-04-01
One of the limiting factors in cone-beam CT (CBCT) image quality is system blur, caused by detector response, x-ray source focal spot size, azimuthal blurring, and reconstruction algorithm. In this work, we develop a novel iterative reconstruction algorithm that improves spatial resolution by explicitly accounting for image unsharpness caused by different factors in the reconstruction formulation. While the model-based iterative reconstruction techniques use prior information about the detector response and x-ray source, our proposed technique uses a simple measurable blurring model. In our reconstruction algorithm, denoted as simultaneous deblurring and iterative reconstruction (SDIR), the blur kernel can be estimated using the modulation transfer function (MTF) slice of the CatPhan phantom or any other MTF phantom, such as wire phantoms. The proposed image reconstruction formulation includes two regularization terms: (1) total variation (TV) and (2) nonlocal regularization, solved with a split Bregman augmented Lagrangian iterative method. The SDIR formulation preserves edges, eases the parameter adjustments to achieve both high spatial resolution and low noise variances, and reduces the staircase effect caused by regular TV-penalized iterative algorithms. The proposed algorithm is optimized for a point-of-care head CBCT unit for image-guided radiosurgery and is tested with CatPhan phantom, an anthropomorphic head phantom, and 6 clinical brain stereotactic radiosurgery cases. Our experiments indicate that SDIR outperforms the conventional filtered back projection and TV penalized simultaneous algebraic reconstruction technique methods (represented by adaptive steepest-descent POCS algorithm, ASD-POCS) in terms of MTF and line pair resolution, and retains the favorable properties of the standard TV-based iterative reconstruction algorithms in improving the contrast and reducing the reconstruction artifacts. It improves the visibility of the high contrast details in bony areas and the brain soft-tissue. For example, the results show the ventricles and some brain folds become visible in SDIR reconstructed images and the contrast of the visible lesions is effectively improved. The line-pair resolution was improved from 12 line-pair/cm in FBP to 14 line-pair/cm in SDIR. Adjusting the parameters of the ASD-POCS to achieve 14 line-pair/cm caused the noise variance to be higher than the SDIR. Using these parameters for ASD-POCS, the MTF of FBP and ASD-POCS were very close and equal to 0.7 mm-1 which was increased to 1.2 mm-1 by SDIR, at half maximum.
Wan, Qian; Zhuo, Ji-Bin; Wang, Xiao-Xue; Lin, Cai-Xia; Yuan, Yao-Feng
2015-03-28
A structurally simple, 2,2-diferrocenylpropane-based ion pair receptor 1 was synthesized and characterized by (1)H NMR, (13)C NMR, HRMS, elemental analyses, and single-crystal X-ray diffraction. The ion pair receptor 1 showed excellent selectivity and sensitivity towards Pb(2+) with multi-channel responses: a fluorescence enhancement (more than 42-fold), a notable color change from yellow to red, redox anodic shift (ΔE1/2 = 151 mV), while HSO4(-) promoted fluorescence enhancement when Pb(2+) or Zn(2+) was bonded to the cation binding-site. (1)H NMR titration and density functional theory were performed to reveal the sensing mechanism based on photo-induced electron transfer (PET).
Yu, Feiqiao Brian; Blainey, Paul C; Schulz, Frederik; Woyke, Tanja; Horowitz, Mark A; Quake, Stephen R
2017-01-01
Metagenomics and single-cell genomics have enabled genome discovery from unknown branches of life. However, extracting novel genomes from complex mixtures of metagenomic data can still be challenging and represents an ill-posed problem which is generally approached with ad hoc methods. Here we present a microfluidic-based mini-metagenomic method which offers a statistically rigorous approach to extract novel microbial genomes while preserving single-cell resolution. We used this approach to analyze two hot spring samples from Yellowstone National Park and extracted 29 new genomes, including three deeply branching lineages. The single-cell resolution enabled accurate quantification of genome function and abundance, down to 1% in relative abundance. Our analyses of genome level SNP distributions also revealed low to moderate environmental selection. The scale, resolution, and statistical power of microfluidic-based mini-metagenomics make it a powerful tool to dissect the genomic structure of microbial communities while effectively preserving the fundamental unit of biology, the single cell. DOI: http://dx.doi.org/10.7554/eLife.26580.001 PMID:28678007
2013-01-01
Background The field of cancer genomics has rapidly adopted next-generation sequencing (NGS) in order to study and characterize malignant tumors with unprecedented resolution. In particular for cancer, one is often trying to identify somatic mutations – changes specific to a tumor and not within an individual’s germline. However, false positive and false negative detections often result from lack of sufficient variant evidence, contamination of the biopsy by stromal tissue, sequencing errors, and the erroneous classification of germline variation as tumor-specific. Results We have developed a generalized Bayesian analysis framework for matched tumor/normal samples with the purpose of identifying tumor-specific alterations such as single nucleotide mutations, small insertions/deletions, and structural variation. We describe our methodology, and discuss its application to other types of paired-tissue analysis such as the detection of loss of heterozygosity as well as allelic imbalance. We also demonstrate the high level of sensitivity and specificity in discovering simulated somatic mutations, for various combinations of a) genomic coverage and b) emulated heterogeneity. Conclusion We present a Java-based implementation of our methods named Seurat, which is made available for free academic use. We have demonstrated and reported on the discovery of different types of somatic change by applying Seurat to an experimentally-derived cancer dataset using our methods; and have discussed considerations and practices regarding the accurate detection of somatic events in cancer genomes. Seurat is available at https://sites.google.com/site/seuratsomatic. PMID:23642077
Christoforides, Alexis; Carpten, John D; Weiss, Glen J; Demeure, Michael J; Von Hoff, Daniel D; Craig, David W
2013-05-04
The field of cancer genomics has rapidly adopted next-generation sequencing (NGS) in order to study and characterize malignant tumors with unprecedented resolution. In particular for cancer, one is often trying to identify somatic mutations--changes specific to a tumor and not within an individual's germline. However, false positive and false negative detections often result from lack of sufficient variant evidence, contamination of the biopsy by stromal tissue, sequencing errors, and the erroneous classification of germline variation as tumor-specific. We have developed a generalized Bayesian analysis framework for matched tumor/normal samples with the purpose of identifying tumor-specific alterations such as single nucleotide mutations, small insertions/deletions, and structural variation. We describe our methodology, and discuss its application to other types of paired-tissue analysis such as the detection of loss of heterozygosity as well as allelic imbalance. We also demonstrate the high level of sensitivity and specificity in discovering simulated somatic mutations, for various combinations of a) genomic coverage and b) emulated heterogeneity. We present a Java-based implementation of our methods named Seurat, which is made available for free academic use. We have demonstrated and reported on the discovery of different types of somatic change by applying Seurat to an experimentally-derived cancer dataset using our methods; and have discussed considerations and practices regarding the accurate detection of somatic events in cancer genomes. Seurat is available at https://sites.google.com/site/seuratsomatic.
DNA sequence-dependent mechanics and protein-assisted bending in repressor-mediated loop formation
Boedicker, James Q.; Garcia, Hernan G.; Johnson, Stephanie; Phillips, Rob
2014-01-01
As the chief informational molecule of life, DNA is subject to extensive physical manipulations. The energy required to deform double-helical DNA depends on sequence, and this mechanical code of DNA influences gene regulation, such as through nucleosome positioning. Here we examine the sequence-dependent flexibility of DNA in bacterial transcription factor-mediated looping, a context for which the role of sequence remains poorly understood. Using a suite of synthetic constructs repressed by the Lac repressor and two well-known sequences that show large flexibility differences in vitro, we make precise statistical mechanical predictions as to how DNA sequence influences loop formation and test these predictions using in vivo transcription and in vitro single-molecule assays. Surprisingly, sequence-dependent flexibility does not affect in vivo gene regulation. By theoretically and experimentally quantifying the relative contributions of sequence and the DNA-bending protein HU to DNA mechanical properties, we reveal that bending by HU dominates DNA mechanics and masks intrinsic sequence-dependent flexibility. Such a quantitative understanding of how mechanical regulatory information is encoded in the genome will be a key step towards a predictive understanding of gene regulation at single-base pair resolution. PMID:24231252
Ye, Qing; Pan, Hao; Liu, Changhua
2015-01-01
This research proposes a novel framework of final drive simultaneous failure diagnosis containing feature extraction, training paired diagnostic models, generating decision threshold, and recognizing simultaneous failure modes. In feature extraction module, adopt wavelet package transform and fuzzy entropy to reduce noise interference and extract representative features of failure mode. Use single failure sample to construct probability classifiers based on paired sparse Bayesian extreme learning machine which is trained only by single failure modes and have high generalization and sparsity of sparse Bayesian learning approach. To generate optimal decision threshold which can convert probability output obtained from classifiers into final simultaneous failure modes, this research proposes using samples containing both single and simultaneous failure modes and Grid search method which is superior to traditional techniques in global optimization. Compared with other frequently used diagnostic approaches based on support vector machine and probability neural networks, experiment results based on F 1-measure value verify that the diagnostic accuracy and efficiency of the proposed framework which are crucial for simultaneous failure diagnosis are superior to the existing approach. PMID:25722717
Total teleportation of a single-photon state
DOE Office of Scientific and Technical Information (OSTI.GOV)
Humble, Travis S; Bennink, Ryan S; Grice, Warren P
2008-01-01
Recent demonstrations of teleportation have transferred quantum information encoded into either polarization or field-quadrature degrees of freedom (DOFs), but an outstanding question is how to simultaneously teleport quantum information encoded into multiple DOFs. We describe how the transverse-spatial, spectral and polarization states of a single photon can be simultaneously teleported using a pair of multimode, polarization-entangled photons derived from spontaneous parametric down-conversion. Furthermore, when the initial photon pair is maximally entangled in the spatial, spectral, and polarization DOFs then the photon s full quantum state can be reliably teleported using a Bell-state measurement based on sum-frequency generation.
Veenstra, Richard D
2016-01-01
The development of the patch clamp technique has enabled investigators to directly measure gap junction conductance between isolated pairs of small cells with resolution to the single channel level. The dual patch clamp recording technique requires specialized equipment and the acquired skill to reliably establish gigaohm seals and the whole cell recording configuration with high efficiency. This chapter describes the equipment needed and methods required to achieve accurate measurement of macroscopic and single gap junction channel conductances. Inherent limitations with the dual whole cell recording technique and methods to correct for series access resistance errors are defined as well as basic procedures to determine the essential electrical parameters necessary to evaluate the accuracy of gap junction conductance measurements using this approach.
USDA-ARS?s Scientific Manuscript database
Single pollen grains were isolated from an intact anther of a sugarcane cultivar and collected using a pair of special forceps. The single pollen grains were lysed in an alkali/detergent solution respectively. The resulting solution was used as the template for Whole Genome Amplification. Genomic DN...
NASA Technical Reports Server (NTRS)
Wiese, D. N.; Nerem, R. S.; Lemoine, F. G.
2011-01-01
Future satellite missions dedicated to measuring time-variable gravity will need to address the concern of temporal aliasing errors; i.e., errors due to high-frequency mass variations. These errors have been shown to be a limiting error source for future missions with improved sensors. One method of reducing them is to fly multiple satellite pairs, thus increasing the sampling frequency of the mission. While one could imagine a system architecture consisting of dozens of satellite pairs, this paper explores the more economically feasible option of optimizing the orbits of two pairs of satellites. While the search space for this problem is infinite by nature, steps have been made to reduce it via proper assumptions regarding some parameters and a large number of numerical simulations exploring appropriate ranges for other parameters. A search space originally consisting of 15 variables is reduced to two variables with the utmost impact on mission performance: the repeat period of both pairs of satellites (shown to be near-optimal when they are equal to each other), as well as the inclination of one of the satellite pairs (the other pair is assumed to be in a polar orbit). To arrive at this conclusion, we assume circular orbits, repeat groundtracks for both pairs of satellites, a 100-km inter-satellite separation distance, and a minimum allowable operational satellite altitude of 290 km based on a projected 10-year mission lifetime. Given the scientific objectives of determining time-variable hydrology, ice mass variations, and ocean bottom pressure signals with higher spatial resolution, we find that an optimal architecture consists of a polar pair of satellites coupled with a pair inclined at 72deg, both in 13-day repeating orbits. This architecture provides a 67% reduction in error over one pair of satellites, in addition to reducing the longitudinal striping to such a level that minimal post-processing is required, permitting a substantial increase in the spatial resolution of the gravity field products. It should be emphasized that given different sets of scientific objectives for the mission, or a different minimum allowable satellite altitude, different architectures might be selected.
A scaling relation between merger rate of galaxies and their close pair count
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jiang, C. Y.; Jing, Y. P.; Han, Jiaxin, E-mail: ypjing@sjtu.edu.cn
We study how to measure the galaxy merger rate from the observed close pair count. Using a high-resolution N-body/SPH cosmological simulation, we find an accurate scaling relation between galaxy pair counts and merger rates down to a stellar mass ratio of about 1:30. The relation explicitly accounts for the dependence on redshift (or time), on pair separation, and on mass of the two galaxies in a pair. With this relation, one can easily obtain the mean merger timescale for a close pair of galaxies. The use of virial masses, instead of the stellar mass, is motivated by the fact thatmore » the dynamical friction timescale is mainly determined by the dark matter surrounding central and satellite galaxies. This fact can also minimize the error induced by uncertainties in modeling star formation in the simulation. Since the virial mass can be determined from the well-established relation between the virial masses and the stellar masses in observations, our scaling relation can easily be applied to observations to obtain the merger rate and merger timescale. For major merger pairs (1:1-1:4) of galaxies above a stellar mass of 4 × 10{sup 10} h {sup –1} M{sub ☉} at z = 0.1, it takes about 0.31 Gyr to merge for pairs within a projected distance of 20 h {sup –1} kpc with a stellar mass ratio of 1:1, while the time goes up to 1.6 Gyr for mergers with stellar mass ratio of 1:4. Our results indicate that a single timescale usually used in the literature is not accurate to describe mergers with a stellar mass ratio spanning even a narrow range from 1:1 to 1:4.« less
Cryogenic colocalization microscopy for nanometer-distance measurements.
Weisenburger, Siegfried; Jing, Bo; Hänni, Dominik; Reymond, Luc; Schuler, Benjamin; Renn, Alois; Sandoghdar, Vahid
2014-03-17
The main limiting factor in spatial resolution of localization microscopy is the number of detected photons. Recently we showed that cryogenic measurements improve the photostability of fluorophores, giving access to Angstrom precision in localization of single molecules. Here, we extend this method to colocalize two fluorophores attached to well-defined positions of a double-stranded DNA. By measuring the separations of the fluorophore pairs prepared at different design positions, we verify the feasibility of cryogenic distance measurement with sub-nanometer accuracy. We discuss the important challenges of our method as well as its potential for further improvement and various applications.
Detection limit of intragenic deletions with targeted array comparative genomic hybridization
2013-01-01
Background Pathogenic mutations range from single nucleotide changes to deletions or duplications that encompass a single exon to several genes. The use of gene-centric high-density array comparative genomic hybridization (aCGH) has revolutionized the detection of intragenic copy number variations. We implemented an exon-centric design of high-resolution aCGH to detect single- and multi-exon deletions and duplications in a large set of genes using the OGT 60 K and 180 K arrays. Here we describe the molecular characterization and breakpoint mapping of deletions at the smaller end of the detectable range in several genes using aCGH. Results The method initially implemented to detect single to multiple exon deletions, was able to detect deletions much smaller than anticipated. The selected deletions we describe vary in size, ranging from over 2 kb to as small as 12 base pairs. The smallest of these deletions are only detectable after careful manual review during data analysis. Suspected deletions smaller than the detection size for which the method was optimized, were rigorously followed up and confirmed with PCR-based investigations to uncover the true detection size limit of intragenic deletions with this technology. False-positive deletion calls often demonstrated single nucleotide changes or an insertion causing lower hybridization of probes demonstrating the sensitivity of aCGH. Conclusions With optimizing aCGH design and careful review process, aCGH can uncover intragenic deletions as small as dozen bases. These data provide insight that will help optimize probe coverage in array design and illustrate the true assay sensitivity. Mapping of the breakpoints confirms smaller deletions and contributes to the understanding of the mechanism behind these events. Our knowledge of the mutation spectra of several genes can be expected to change as previously unrecognized intragenic deletions are uncovered. PMID:24304607
NASA Astrophysics Data System (ADS)
Hamann, H.; Jimenez Marianno, F.; Klein, L.; Albrecht, C.; Freitag, M.; Hinds, N.; Lu, S.
2015-12-01
A big data geospatial analytics platform:Physical Analytics Information Repository and Services (PAIRS)Fernando Marianno, Levente Klein, Siyuan Lu, Conrad Albrecht, Marcus Freitag, Nigel Hinds, Hendrik HamannIBM TJ Watson Research Center, Yorktown Heights, NY 10598A major challenge in leveraging big geospatial data sets is the ability to quickly integrate multiple data sources into physical and statistical models and be run these models in real time. A geospatial data platform called Physical Analytics Information and Services (PAIRS) is developed on top of open source hardware and software stack to manage Terabyte of data. A new data interpolation and re gridding is implemented where any geospatial data layers can be associated with a set of global grid where the grid resolutions is doubling for consecutive layers. Each pixel on the PAIRS grid have an index that is a combination of locations and time stamp. The indexing allow quick access to data sets that are part of a global data layers and allowing to retrieve only the data of interest. PAIRS takes advantages of parallel processing framework (Hadoop) in a cloud environment to digest, curate, and analyze the data sets while being very robust and stable. The data is stored on a distributed no-SQL database (Hbase) across multiple server, data upload and retrieval is parallelized where the original analytics task is broken up is smaller areas/volume, analyzed independently, and then reassembled for the original geographical area. The differentiating aspect of PAIRS is the ability to accelerate model development across large geographical regions and spatial resolution ranging from 0.1 m up to hundreds of kilometer. System performance is benchmarked on real time automated data ingestion and retrieval of Modis and Landsat data layers. The data layers are curated for sensor error, verified for correctness, and analyzed statistically to detect local anomalies. Multi-layer query enable PAIRS to filter different data layers based on specific conditions (e.g analyze flooding risk of a property based on topography, soil ability to hold water, and forecasted precipitation) or retrieve information about locations that share similar weather and vegetation patterns during extreme weather events like heat wave.
The crystal structure of an oligo(U):pre-mRNA duplex from a trypanosome RNA editing substrate
Mooers, Blaine H.M.; Singh, Amritanshu
2011-01-01
Guide RNAs bind antiparallel to their target pre-mRNAs to form editing substrates in reaction cycles that insert or delete uridylates (Us) in most mitochondrial transcripts of trypanosomes. The 5′ end of each guide RNA has an anchor sequence that binds to the pre-mRNA by base-pair complementarity. The template sequence in the middle of the guide RNA directs the editing reactions. The 3′ ends of most guide RNAs have ∼15 contiguous Us that bind to the purine-rich unedited pre-mRNA upstream of the editing site. The resulting U-helix is rich in G·U wobble base pairs. To gain insights into the structure of the U-helix, we crystallized 8 bp of the U-helix in one editing substrate for the A6 mRNA of Trypanosoma brucei. The fragment provides three samples of the 5′-AGA-3′/5′-UUU-3′ base-pair triple. The fusion of two identical U-helices head-to-head promoted crystallization. We obtained X-ray diffraction data with a resolution limit of 1.37 Å. The U-helix had low and high twist angles before and after each G·U wobble base pair; this variation was partly due to shearing of the wobble base pairs as revealed in comparisons with a crystal structure of a 16-nt RNA with all Watson–Crick base pairs. Both crystal structures had wider major grooves at the junction between the poly(U) and polypurine tracts. This junction mimics the junction between the template helix and the U-helix in RNA-editing substrates and may be a site of major groove invasion by RNA editing proteins. PMID:21878548
Treatment of ocean tide aliasing in the context of a next generation gravity field mission
NASA Astrophysics Data System (ADS)
Hauk, Markus; Pail, Roland
2018-07-01
Current temporal gravity field solutions from Gravity Recovery and Climate Experiment (GRACE) suffer from temporal aliasing errors due to undersampling of signal to be recovered (e.g. hydrology), uncertainties in the de-aliasing models (usually atmosphere and ocean) and imperfect ocean tide models. Especially the latter will be one of the most limiting factors in determining high-resolution temporal gravity fields from future gravity missions such as GRACE Follow-On and Next-Generation Gravity Missions (NGGM). In this paper a method to co-parametrize ocean tide parameters of the eight main tidal constituents over time spans of several years is analysed and assessed. Numerical closed-loop simulations of low-low satellite-to-satellite-tracking missions for a single polar pair and a double pair Bender-type formation are performed, using time variable geophysical background models and noise assumptions for new generation instrument technology. Compared to the single pair mission, results show a reduction of tide model errors up to 70 per cent for dedicated tidal constituents due to an enhanced spatial and temporal sampling and error isotropy for the double pair constellation. Extending the observation period from 1 to 3 yr leads to a further reduction of tidal errors up to 60 per cent for certain constituents, and considering non-tidal mass changes during the estimation process leads to reductions of tidal errors between 20 and 80 per cent. As part of a two-step approach, the estimated tide model is used for de-aliasing during gravity field retrieval in a second iteration, resulting in more than 50 per cent reduction of ocean tide aliasing errors for a NGGM Bender-type formation.
Treatment of ocean tide aliasing in the context of a next generation gravity field mission
NASA Astrophysics Data System (ADS)
Hauk, Markus; Pail, Roland
2018-04-01
Current temporal gravity field solutions from GRACE suffer from temporal aliasing errors due to under-sampling of signal to be recovered (e.g. hydrology), uncertainties in the de-aliasing models (usually atmosphere and ocean), and imperfect ocean tide models. Especially the latter will be one of the most limiting factors in determining high resolution temporal gravity fields from future gravity missions such as GRACE Follow-on and Next-Generation Gravity Missions (NGGM). In this paper a method to co-parameterize ocean tide parameters of the 8 main tidal constituents over time spans of several years is analysed and assessed. Numerical closed-loop simulations of low-low satellite-to-satellite-tracking missions for a single polar pair and a double pair Bender-type formation are performed, using time variable geophysical background models and noise assumptions for new generation instrument technology. Compared to the single pair mission, results show a reduction of tide model errors up to 70 per cent for dedicated tidal constituents due to an enhanced spatial and temporal sampling and error isotropy for the double pair constellation. Extending the observation period from one to three years leads to a further reduction of tidal errors up to 60 per cent for certain constituents, and considering non-tidal mass changes during the estimation process leads to reductions of tidal errors between 20 per cent and 80 per cent. As part of a two-step approach, the estimated tide model is used for de-aliasing during gravity field retrieval in a second iteration, resulting in more than 50 per cent reduction of ocean tide aliasing errors for a NGGM Bender-type formation.
Sanchez Sorzano, Carlos Oscar; Alvarez-Cabrera, Ana Lucia; Kazemi, Mohsen; Carazo, Jose María; Jonić, Slavica
2016-04-26
Single-particle electron microscopy (EM) has been shown to be very powerful for studying structures and associated conformational changes of macromolecular complexes. In the context of analyzing conformational changes of complexes, distinct EM density maps obtained by image analysis and three-dimensional (3D) reconstruction are usually analyzed in 3D for interpretation of structural differences. However, graphic visualization of these differences based on a quantitative analysis of elastic transformations (deformations) among density maps has not been done yet due to a lack of appropriate methods. Here, we present an approach that allows such visualization. This approach is based on statistical analysis of distances among elastically aligned pairs of EM maps (one map is deformed to fit the other map), and results in visualizing EM maps as points in a lower-dimensional distance space. The distances among points in the new space can be analyzed in terms of clusters or trajectories of points related to potential conformational changes. The results of the method are shown with synthetic and experimental EM maps at different resolutions. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.
A high precision ultrasonic system for vibration measurements
NASA Astrophysics Data System (ADS)
Young, M. S.; Li, Y. C.
1992-11-01
A microcomputer-aided ultrasonic system that can be used to measure the vibratory displacements of an object is presented. A pair of low cost 40-kHz ultrasonic transducers is used to transmit ultrasound toward an object and receive the ultrasound reflected from the object. The relative motion of the object modulates the phase angle difference between the transmitted and received ultrasound signals. A single-chip microcomputer-based phase detector was designed to record and analyze the phase shift information which is then sent to a PC-AT microcomputer for processing. We have developed an ingenious method to reconstruct the relative motion of an object from the acquired data of the phase difference changes. A digital plotter based experiment was also designed for testing the performance of the whole system. The measured accuracy of the system in the reported experiments is within +/- 0.4 mm and the theoretical maximal measurable speed of the object is 89.6 cm/s. The main advantages of this ultrasonic vibration measurement system are high resolution, low cost, noncontact measurement, and easy installation.
Four base recognition by triplex-forming oligonucleotides at physiological pH
Rusling, David A.; Powers, Vicki E. C.; Ranasinghe, Rohan T.; Wang, Yang; Osborne, Sadie D.; Brown, Tom; Fox, Keith R.
2005-01-01
We have achieved recognition of all 4 bp by triple helix formation at physiological pH, using triplex-forming oligonucleotides that contain four different synthetic nucleotides. BAU [2′-aminoethoxy-5-(3-aminoprop-1-ynyl)uridine] recognizes AT base pairs with high affinity, MeP (3-methyl-2 aminopyridine) binds to GC at higher pHs than cytosine, while APP (6-(3-aminopropyl)-7-methyl-3H-pyrrolo[2,3-d]pyrimidin-2(7H)-one) and S [N-(4-(3-acetamidophenyl)thiazol-2-yl-acetamide)] bind to CG and TA base pairs, respectively. Fluorescence melting and DNase I footprinting demonstrate successful triplex formation at a 19mer oligopurine sequence that contains two CG and two TA interruptions. The complexes are pH dependent, but are still stable at pH 7.0. BAU, MeP and APP retain considerable selectivity, and single base pair changes opposite these residues cause a large reduction in affinity. In contrast, S is less selective and tolerates CG pairs as well as TA. PMID:15911633
Paired analysis of TCRα and TCRβ chains at the single-cell level in mice
Dash, Pradyot; McClaren, Jennifer L.; Oguin, Thomas H.; Rothwell, William; Todd, Brandon; Morris, Melissa Y.; Becksfort, Jared; Reynolds, Cory; Brown, Scott A.; Doherty, Peter C.; Thomas, Paul G.
2010-01-01
Characterizing the TCRα and TCRβ chains expressed by T cells responding to a given pathogen or underlying autoimmunity helps in the development of vaccines and immunotherapies, respectively. However, our understanding of complementary TCRα and TCRβ chain utilization is very limited for pathogen- and autoantigen-induced immunity. To address this problem, we have developed a multiplex nested RT-PCR method for the simultaneous amplification of transcripts encoding the TCRα and TCRβ chains from single cells. This multiplex method circumvented the lack of antibodies specific for variable regions of mouse TCRα chains and the need for prior knowledge of variable region usage in the TCRβ chain, resulting in a comprehensive, unbiased TCR repertoire analysis with paired coexpression of TCRα and TCRβ chains with single-cell resolution. Using CD8+ CTLs specific for an influenza epitope recovered directly from the pneumonic lungs of mice, this technique determined that 25% of such effectors expressed a dominant, nonproductively rearranged Tcra transcript. T cells with these out-of-frame Tcra mRNAs also expressed an alternate, in-frame Tcra, whereas approximately 10% of T cells had 2 productive Tcra transcripts. The proportion of cells with biallelic transcription increased over the course of a response, a finding that has implications for immune memory and autoimmunity. This technique may have broad applications in mouse models of human disease. PMID:21135507
A low-drift, low-noise, multichannel dc voltage source for segmented-electrode Paul traps
NASA Astrophysics Data System (ADS)
Beev, Nikolai; Fenske, Julia-Aileen; Hannig, Stephan; Schmidt, Piet O.
2017-05-01
We present the design, construction, and characterization of a multichannel, low-drift, low-noise dc voltage source specially designed for biasing the electrodes of segmented linear Paul traps. The system produces 20 output voltage pairs having a common-mode range of 0 to +120 V with 3.7 mV/LSB (least significant bit) resolution and differential ranges of ±5 V with 150 μV/LSB or ±16 V with 610 μV/LSB resolution. All common-mode and differential voltages are independently controllable, and all pairs share the same ground reference. The measured drift of the voltages after warm-up is lower than 1 LSB peak-to-peak on the time scale of 2 h. The noise of an output voltage measured with respect to ground is <10 μVRMS within 10 Hz-100 kHz, with spectral density lower than 3 nV Hz-1/2 above 50 kHz. The performance of the system is limited by the external commercial multichannel DAC unit NI 9264, and in principle, it is possible to achieve higher stability and lower noise with the same voltage ranges. The system has a compact, modular, and scalable architecture, having all parts except for the DAC chassis housed within a single 19″ 3HE rack.
Yang, Haozhe; Mei, Hui; Seela, Frank
2015-07-06
Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Alternatively Constrained Dictionary Learning For Image Superresolution.
Lu, Xiaoqiang; Yuan, Yuan; Yan, Pingkun
2014-03-01
Dictionaries are crucial in sparse coding-based algorithm for image superresolution. Sparse coding is a typical unsupervised learning method to study the relationship between the patches of high-and low-resolution images. However, most of the sparse coding methods for image superresolution fail to simultaneously consider the geometrical structure of the dictionary and the corresponding coefficients, which may result in noticeable superresolution reconstruction artifacts. In other words, when a low-resolution image and its corresponding high-resolution image are represented in their feature spaces, the two sets of dictionaries and the obtained coefficients have intrinsic links, which has not yet been well studied. Motivated by the development on nonlocal self-similarity and manifold learning, a novel sparse coding method is reported to preserve the geometrical structure of the dictionary and the sparse coefficients of the data. Moreover, the proposed method can preserve the incoherence of dictionary entries and provide the sparse coefficients and learned dictionary from a new perspective, which have both reconstruction and discrimination properties to enhance the learning performance. Furthermore, to utilize the model of the proposed method more effectively for single-image superresolution, this paper also proposes a novel dictionary-pair learning method, which is named as two-stage dictionary training. Extensive experiments are carried out on a large set of images comparing with other popular algorithms for the same purpose, and the results clearly demonstrate the effectiveness of the proposed sparse representation model and the corresponding dictionary learning algorithm.
NASA Astrophysics Data System (ADS)
Ma, Wen-Long; Liu, Ren-Bao
2016-08-01
Single-molecule sensitivity of nuclear magnetic resonance (NMR) and angstrom resolution of magnetic resonance imaging (MRI) are the highest challenges in magnetic microscopy. Recent development in dynamical-decoupling- (DD) enhanced diamond quantum sensing has enabled single-nucleus NMR and nanoscale NMR. Similar to conventional NMR and MRI, current DD-based quantum sensing utilizes the "frequency fingerprints" of target nuclear spins. The frequency fingerprints by their nature cannot resolve different nuclear spins that have the same noise frequency or differentiate different types of correlations in nuclear-spin clusters, which limit the resolution of single-molecule MRI. Here we show that this limitation can be overcome by using "wave-function fingerprints" of target nuclear spins, which is much more sensitive than the frequency fingerprints to the weak hyperfine interaction between the targets and a sensor under resonant DD control. We demonstrate a scheme of angstrom-resolution MRI that is capable of counting and individually localizing single nuclear spins of the same frequency and characterizing the correlations in nuclear-spin clusters. A nitrogen-vacancy-center spin sensor near a diamond surface, provided that the coherence time is improved by surface engineering in the near future, may be employed to determine with angstrom resolution the positions and conformation of single molecules that are isotope labeled. The scheme in this work offers an approach to breaking the resolution limit set by the "frequency gradients" in conventional MRI and to reaching the angstrom-scale resolution.
NASA Astrophysics Data System (ADS)
Gros, P.; Bernard, D.
2017-02-01
We benchmark various available event generators in Geant4 and EGS5 in the light of ongoing projects for high angular-resolution pair-conversion telescopes at low energy. We compare the distributions of key kinematic variables extracted from the geometry of the three final state particles. We validate and use as reference an exact generator using the full 5D differential cross-section of the conversion process. We focus in particular on the effect of the unmeasured recoiling nucleus on the angular resolution. We show that for high resolution trackers, the choice of the generator affects the estimated resolution of the telescope. We also show that the current available generator are unable to describe accurately a linearly polarised photon source.
Hummer, Gerhard
2015-01-01
We present a new algorithm for simulating reaction-diffusion equations at single-particle resolution. Our algorithm is designed to be both accurate and simple to implement, and to be applicable to large and heterogeneous systems, including those arising in systems biology applications. We combine the use of the exact Green's function for a pair of reacting particles with the approximate free-diffusion propagator for position updates to particles. Trajectory reweighting in our free-propagator reweighting (FPR) method recovers the exact association rates for a pair of interacting particles at all times. FPR simulations of many-body systems accurately reproduce the theoretically known dynamic behavior for a variety of different reaction types. FPR does not suffer from the loss of efficiency common to other path-reweighting schemes, first, because corrections apply only in the immediate vicinity of reacting particles and, second, because by construction the average weight factor equals one upon leaving this reaction zone. FPR applications include the modeling of pathways and networks of protein-driven processes where reaction rates can vary widely and thousands of proteins may participate in the formation of large assemblies. With a limited amount of bookkeeping necessary to ensure proper association rates for each reactant pair, FPR can account for changes to reaction rates or diffusion constants as a result of reaction events. Importantly, FPR can also be extended to physical descriptions of protein interactions with long-range forces, as we demonstrate here for Coulombic interactions. PMID:26005592
Blind prediction of noncanonical RNA structure at atomic accuracy.
Watkins, Andrew M; Geniesse, Caleb; Kladwang, Wipapat; Zakrevsky, Paul; Jaeger, Luc; Das, Rhiju
2018-05-01
Prediction of RNA structure from nucleotide sequence remains an unsolved grand challenge of biochemistry and requires distinct concepts from protein structure prediction. Despite extensive algorithmic development in recent years, modeling of noncanonical base pairs of new RNA structural motifs has not been achieved in blind challenges. We report a stepwise Monte Carlo (SWM) method with a unique add-and-delete move set that enables predictions of noncanonical base pairs of complex RNA structures. A benchmark of 82 diverse motifs establishes the method's general ability to recover noncanonical pairs ab initio, including multistrand motifs that have been refractory to prior approaches. In a blind challenge, SWM models predicted nucleotide-resolution chemical mapping and compensatory mutagenesis experiments for three in vitro selected tetraloop/receptors with previously unsolved structures (C7.2, C7.10, and R1). As a final test, SWM blindly and correctly predicted all noncanonical pairs of a Zika virus double pseudoknot during a recent community-wide RNA-Puzzle. Stepwise structure formation, as encoded in the SWM method, enables modeling of noncanonical RNA structure in a variety of previously intractable problems.
Lead Telluride Quantum Dot Solar Cells Displaying External Quantum Efficiencies Exceeding 120%
2015-01-01
Multiple exciton generation (MEG) in semiconducting quantum dots is a process that produces multiple charge-carrier pairs from a single excitation. MEG is a possible route to bypass the Shockley-Queisser limit in single-junction solar cells but it remains challenging to harvest charge-carrier pairs generated by MEG in working photovoltaic devices. Initial yields of additional carrier pairs may be reduced due to ultrafast intraband relaxation processes that compete with MEG at early times. Quantum dots of materials that display reduced carrier cooling rates (e.g., PbTe) are therefore promising candidates to increase the impact of MEG in photovoltaic devices. Here we demonstrate PbTe quantum dot-based solar cells, which produce extractable charge carrier pairs with an external quantum efficiency above 120%, and we estimate an internal quantum efficiency exceeding 150%. Resolving the charge carrier kinetics on the ultrafast time scale with pump–probe transient absorption and pump–push–photocurrent measurements, we identify a delayed cooling effect above the threshold energy for MEG. PMID:26488847
Shu, Deming; Shvydko, Yuri; Stoupin, Stanislav A.; Khachatryan, Ruben; Goetze, Kurt A.; Roberts, Timothy
2015-04-14
A method and an ultrahigh-resolution spectrometer including a precision mechanical structure for positioning inelastic X-ray scattering optics are provided. The spectrometer includes an X-ray monochromator and an X-ray analyzer, each including X-ray optics of a collimating (C) crystal, a pair of dispersing (D) element crystals, anomalous transmission filter (F) and a wavelength (W) selector crystal. A respective precision mechanical structure is provided with the X-ray monochromator and the X-ray analyzer. The precision mechanical structure includes a base plate, such as an aluminum base plate; positioning stages for D-crystal alignment; positioning stages with an incline sensor for C/F/W-crystal alignment, and the positioning stages including flexure-based high-stiffness structure.
Super-resolution from single photon emission: toward biological application
NASA Astrophysics Data System (ADS)
Moreva, E.; Traina, P.; Forneris, J.; Ditalia Tchernij, S.; Guarina, L.; Franchino, C.; Picollo, F.; Ruo Berchera, I.; Brida, G.; Degiovanni, I. P.; Carabelli, V.; Olivero, P.; Genovese, M.
2017-08-01
Properties of quantum light represent a tool for overcoming limits of classical optics. Several experiments have demonstrated this advantage ranging from quantum enhanced imaging to quantum illumination. In this work, experimental demonstration of quantum-enhanced resolution in confocal fluorescence microscopy will be presented. This is achieved by exploiting the non-classical photon statistics of fluorescence emission of single nitrogen-vacancy (NV) color centers in diamond. By developing a general model of super-resolution based on the direct sampling of the kth-order autocorrelation function of the photoluminescence signal, we show the possibility to resolve, in principle, arbitrarily close emitting centers. Finally, possible applications of NV-based fluorescent nanodiamonds in biosensing and future developments will be presented.
Spectroscopy of Single AlInAs Quantum Dots
NASA Astrophysics Data System (ADS)
Derebezov, I. A.; Gaisler, A. V.; Gaisler, V. A.; Dmitriev, D. V.; Toropov, A. I.; Kozhukhov, A. S.; Shcheglov, D. V.; Latyshev, A. V.; Aseev, A. L.
2018-03-01
A system of quantum dots based on Al x In1- x As/Al y Ga1- y As solid solutions is investigated. The use of Al x In1- x As wide-gap solid solutions as the basis of quantum dots substantially extends the spectral emission range to the short-wavelength region, including the wavelength region near 770 nm, which is of interest for the development of aerospace systems of quantum cryptography. The optical characteristics of Al x In1- x As single quantum dots grown by the Stranski-Krastanov mechanism were studied by cryogenic microphotoluminescence. The statistics of the emission of single quantum dot excitons was studied using a Hanbury Brown-Twiss interferometer. The pair photon correlation function indicates the sub-Poissonian nature of the emission statistics, which directly confirms the possibility of developing single-photon emitters based on Al x In1- x As quantum dots. The fine structure of quantum dot exciton states was investigated at wavelengths near 770 nm. The splitting of the exciton states is found to be similar to the natural width of exciton lines, which is of great interest for the development of entangled photon pair emitters based on Al x In1- x As quantum dots.
Tian, Kai; Chen, Xiaowei; Luan, Binquan; Singh, Prashant; Yang, Zhiyu; Gates, Kent S; Lin, Mengshi; Mustapha, Azlin; Gu, Li-Qun
2018-05-22
Accurate and rapid detection of single-nucleotide polymorphism (SNP) in pathogenic mutants is crucial for many fields such as food safety regulation and disease diagnostics. Current detection methods involve laborious sample preparations and expensive characterizations. Here, we investigated a single locked nucleic acid (LNA) approach, facilitated by a nanopore single-molecule sensor, to accurately determine SNPs for detection of Shiga toxin producing Escherichia coli (STEC) serotype O157:H7, and cancer-derived EGFR L858R and KRAS G12D driver mutations. Current LNA applications that require incorporation and optimization of multiple LNA nucleotides. But we found that in the nanopore system, a single LNA introduced in the probe is sufficient to enhance the SNP discrimination capability by over 10-fold, allowing accurate detection of the pathogenic mutant DNA mixed in a large amount of the wild-type DNA. Importantly, the molecular mechanistic study suggests that such a significant improvement is due to the effect of the single-LNA that both stabilizes the fully matched base-pair and destabilizes the mismatched base-pair. This sensitive method, with a simplified, low cost, easy-to-operate LNA design, could be generalized for various applications that need rapid and accurate identification of single-nucleotide variations.
Diffractive shear interferometry for extreme ultraviolet high-resolution lensless imaging
NASA Astrophysics Data System (ADS)
Jansen, G. S. M.; de Beurs, A.; Liu, X.; Eikema, K. S. E.; Witte, S.
2018-05-01
We demonstrate a novel imaging approach and associated reconstruction algorithm for far-field coherent diffractive imaging, based on the measurement of a pair of laterally sheared diffraction patterns. The differential phase profile retrieved from such a measurement leads to improved reconstruction accuracy, increased robustness against noise, and faster convergence compared to traditional coherent diffractive imaging methods. We measure laterally sheared diffraction patterns using Fourier-transform spectroscopy with two phase-locked pulse pairs from a high harmonic source. Using this approach, we demonstrate spectrally resolved imaging at extreme ultraviolet wavelengths between 28 and 35 nm.
Xin, Qiuhong; Ogura, Yukiko; Matsushima, Toshiya
2017-07-01
To examine how resource competition contributes to patch-use behaviour, we examined domestic chicks foraging in an I-shaped maze equipped with two terminal feeders. In a variable interval schedule, one feeder supplied grains three times more frequently than the other, and the sides were reversed midway through the experiment. The maze was partitioned into two lanes by a transparent wall, so that chicks fictitiously competed without actual interference. Stay time at feeders was compared among three groups. The "single" group contained control chicks; the "pair" group comprised the pairs of chicks tested in the fictitious competition; "mirror" included single chicks accompanied by their respective mirror images. Both "pair" and "mirror" chicks showed facilitated running. In terms of the patch-use ratio, "pair" chicks showed precise matching at approximately 3:1 with significant mutual dependence, whereas "single" and "mirror" chicks showed a comparable under-matching. The facilitated running increased visits to feeders, but failed to predict the patch-use ratio of the subject. At the reversal, quick switching occurred similarly in all groups, but the "pair" chicks revealed a stronger memory-based matching. Perceived competition therefore contributes to precise matching and lasting memory of the better feeder, in a manner dissociated from socially facilitated food search. Copyright © 2017 Elsevier B.V. All rights reserved.
Single-Image Super-Resolution Based on Rational Fractal Interpolation.
Zhang, Yunfeng; Fan, Qinglan; Bao, Fangxun; Liu, Yifang; Zhang, Caiming
2018-08-01
This paper presents a novel single-image super-resolution (SR) procedure, which upscales a given low-resolution (LR) input image to a high-resolution image while preserving the textural and structural information. First, we construct a new type of bivariate rational fractal interpolation model and investigate its analytical properties. This model has different forms of expression with various values of the scaling factors and shape parameters; thus, it can be employed to better describe image features than current interpolation schemes. Furthermore, this model combines the advantages of rational interpolation and fractal interpolation, and its effectiveness is validated through theoretical analysis. Second, we develop a single-image SR algorithm based on the proposed model. The LR input image is divided into texture and non-texture regions, and then, the image is interpolated according to the characteristics of the local structure. Specifically, in the texture region, the scaling factor calculation is the critical step. We present a method to accurately calculate scaling factors based on local fractal analysis. Extensive experiments and comparisons with the other state-of-the-art methods show that our algorithm achieves competitive performance, with finer details and sharper edges.
Quantifying sub-pixel urban impervious surface through fusion of optical and inSAR imagery
Yang, L.; Jiang, L.; Lin, H.; Liao, M.
2009-01-01
In this study, we explored the potential to improve urban impervious surface modeling and mapping with the synergistic use of optical and Interferometric Synthetic Aperture Radar (InSAR) imagery. We used a Classification and Regression Tree (CART)-based approach to test the feasibility and accuracy of quantifying Impervious Surface Percentage (ISP) using four spectral bands of SPOT 5 high-resolution geometric (HRG) imagery and three parameters derived from the European Remote Sensing (ERS)-2 Single Look Complex (SLC) SAR image pair. Validated by an independent ISP reference dataset derived from the 33 cm-resolution digital aerial photographs, results show that the addition of InSAR data reduced the ISP modeling error rate from 15.5% to 12.9% and increased the correlation coefficient from 0.71 to 0.77. Spatially, the improvement is especially noted in areas of vacant land and bare ground, which were incorrectly mapped as urban impervious surfaces when using the optical remote sensing data. In addition, the accuracy of ISP prediction using InSAR images alone is only marginally less than that obtained by using SPOT imagery. The finding indicates the potential of using InSAR data for frequent monitoring of urban settings located in cloud-prone areas.
High-resolution optical polarimetric elastography for measuring the mechanical properties of tissue
NASA Astrophysics Data System (ADS)
Hudnut, Alexa W.; Armani, Andrea M.
2018-02-01
Traditionally, chemical and molecular markers have been the predominate method in diagnostics. Recently, alternate methods of determining tissue and disease characteristics have been proposed based on testing the mechanical behavior of biomaterials. Existing methods for performing elastography measurements, such as atomic force microscopy, compression testing, and ultrasound elastography, require either extensive sample processing or have poor resolution. In the present work, we demonstrate an optical polarimetric elastography device to characterize the mechanical properties of salmon skeletal muscle. A fiber-coupled 1550nm laser paired with an optical polarizer is used to create a fiber optic sensing region. By measuring the change in polarization from the initial state to the final state within the fiber sensing region with a polarimeter, the loading-unloading curves can be determined for the biomaterial. The device is used to characterize the difference between samples with a range of collagen membranes. The loading-unloading curves are used to determine the change in polarization phase and energy loss of the samples at 10%, 20% and 30% strain. As expected, the energy loss is a better metric for measuring the mechanical properties of the tissues because it incorporates the entire loading-unloading curve rather than a single point. Using this metric, it is demonstrated the device can repeatedly differentiate between the different membrane configurations.
Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju
2017-02-01
Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.
Hard choices in assessing survival past dams — a comparison of single- and paired-release strategies
Zydlewski, Joseph D.; Stich, Daniel S.; Sigourney, Douglas B.
2017-01-01
Mark–recapture models are widely used to estimate survival of salmon smolts migrating past dams. Paired releases have been used to improve estimate accuracy by removing components of mortality not attributable to the dam. This method is accompanied by reduced precision because (i) sample size is reduced relative to a single, large release; and (ii) variance calculations inflate error. We modeled an idealized system with a single dam to assess trade-offs between accuracy and precision and compared methods using root mean squared error (RMSE). Simulations were run under predefined conditions (dam mortality, background mortality, detection probability, and sample size) to determine scenarios when the paired release was preferable to a single release. We demonstrate that a paired-release design provides a theoretical advantage over a single-release design only at large sample sizes and high probabilities of detection. At release numbers typical of many survival studies, paired release can result in overestimation of dam survival. Failures to meet model assumptions of a paired release may result in further overestimation of dam-related survival. Under most conditions, a single-release strategy was preferable.
Assessing resolution in live cell structured illumination microscopy
NASA Astrophysics Data System (ADS)
Pospíšil, Jakub; Fliegel, Karel; Klíma, Miloš
2017-12-01
Structured Illumination Microscopy (SIM) is a powerful super-resolution technique, which is able to enhance the resolution of optical microscope beyond the Abbe diffraction limit. In the last decade, numerous SIM methods that achieve the resolution of 100 nm in the lateral dimension have been developed. The SIM setups with new high-speed cameras and illumination pattern generators allow rapid acquisition of the live specimen. Therefore, SIM is widely used for investigation of the live structures in molecular and live cell biology. Quantitative evaluation of resolution enhancement in a real sample is essential to describe the efficiency of super-resolution microscopy technique. However, measuring the resolution of a live cell sample is a challenging task. Based on our experimental findings, the widely used Fourier ring correlation (FRC) method does not seem to be well suited for measuring the resolution of SIM live cell video sequences. Therefore, the resolution assessing methods based on Fourier spectrum analysis are often used. We introduce a measure based on circular average power spectral density (PSDca) estimated from a single SIM image (one video frame). PSDca describes the distribution of the power of a signal with respect to its spatial frequency. Spatial resolution corresponds to the cut-off frequency in Fourier space. In order to estimate the cut-off frequency from a noisy signal, we use a spectral subtraction method for noise suppression. In the future, this resolution assessment approach might prove useful also for single-molecule localization microscopy (SMLM) live cell imaging.
Microfluidic cell trap array for controlled positioning of single cells on adhesive micropatterns.
Lin, Laiyi; Chu, Yeh-Shiu; Thiery, Jean Paul; Lim, Chwee Teck; Rodriguez, Isabel
2013-02-21
Adhesive micropattern arrays permit the continuous monitoring and systematic study of the behavior of spatially confined cells of well-defined shape and size in ordered configurations. This technique has contributed to defining mechanisms that control cell polarity and cell functions, including proliferation, apoptosis, differentiation and migration in two-dimensional cell culture systems. These micropattern studies often involve isolating a single cell on one adhesive protein micropattern using random seeding methods. Random seeding has been successful for isolated and, to a lesser degree, paired patterns, where two patterns are placed in close proximity. Using this method, we found that the probability of obtaining one cell per pattern decreases significantly as the number of micropatterns in a cluster increases, from 16% for paired micropatterns to 0.3% for clusters of 6 micropatterns. This work presents a simple yet effective platform based on a microfludic sieve-like trap array to exert precise control over the positioning of single cells on micropatterns. We observed a 4-fold improvement over random seeding in the efficiency of placing a pair of single cells on paired micropattern and a 40-fold improvement for 6-pattern clusters. The controlled nature of this platform can also allow the juxtaposition of two different cell populations through a simple modification in the trap arrangement. With excellent control of the identity, number and position of neighbouring cells, this cell-positioning platform provides a unique opportunity for the extension of two-dimensional micropattern studies beyond paired micropatterns to organizations containing many cells or different cell types.
2011-01-01
Background The performance of 3D-based virtual screening similarity functions is affected by the applied conformations of compounds. Therefore, the results of 3D approaches are often less robust than 2D approaches. The application of 3D methods on multiple conformer data sets normally reduces this weakness, but entails a significant computational overhead. Therefore, we developed a special conformational space encoding by means of Gaussian mixture models and a similarity function that operates on these models. The application of a model-based encoding allows an efficient comparison of the conformational space of compounds. Results Comparisons of our 4D flexible atom-pair approach with over 15 state-of-the-art 2D- and 3D-based virtual screening similarity functions on the 40 data sets of the Directory of Useful Decoys show a robust performance of our approach. Even 3D-based approaches that operate on multiple conformers yield inferior results. The 4D flexible atom-pair method achieves an averaged AUC value of 0.78 on the filtered Directory of Useful Decoys data sets. The best 2D- and 3D-based approaches of this study yield an AUC value of 0.74 and 0.72, respectively. As a result, the 4D flexible atom-pair approach achieves an average rank of 1.25 with respect to 15 other state-of-the-art similarity functions and four different evaluation metrics. Conclusions Our 4D method yields a robust performance on 40 pharmaceutically relevant targets. The conformational space encoding enables an efficient comparison of the conformational space. Therefore, the weakness of the 3D-based approaches on single conformations is circumvented. With over 100,000 similarity calculations on a single desktop CPU, the utilization of the 4D flexible atom-pair in real-world applications is feasible. PMID:21733172
Testing the single-state dominance hypothesis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Álvarez-Rodríguez, R.; Moreno, O.; Moya de Guerra, E.
2013-12-30
We present a theoretical analysis of the single-state dominance hypothesis for the two-neutrino double-beta decay process. The theoretical framework is a proton-neutron QRPA based on a deformed Hartree-Fock mean field with BCS pairing correlations. We focus on the decays of {sup 100}Mo, {sup 116}Cd and {sup 128}Te. We do not find clear evidences for single-state dominance within the present approach.
Single image super resolution algorithm based on edge interpolation in NSCT domain
NASA Astrophysics Data System (ADS)
Zhang, Mengqun; Zhang, Wei; He, Xinyu
2017-11-01
In order to preserve the texture and edge information and to improve the space resolution of single frame, a superresolution algorithm based on Contourlet (NSCT) is proposed. The original low resolution image is transformed by NSCT, and the directional sub-band coefficients of the transform domain are obtained. According to the scale factor, the high frequency sub-band coefficients are amplified by the interpolation method based on the edge direction to the desired resolution. For high frequency sub-band coefficients with noise and weak targets, Bayesian shrinkage is used to calculate the threshold value. The coefficients below the threshold are determined by the correlation among the sub-bands of the same scale to determine whether it is noise and de-noising. The anisotropic diffusion filter is used to effectively enhance the weak target in the low contrast region of the target and background. Finally, the high-frequency sub-band is amplified by the bilinear interpolation method to the desired resolution, and then combined with the high-frequency subband coefficients after de-noising and small target enhancement, the NSCT inverse transform is used to obtain the desired resolution image. In order to verify the effectiveness of the proposed algorithm, the proposed algorithm and several common image reconstruction methods are used to test the synthetic image, motion blurred image and hyperspectral image, the experimental results show that compared with the traditional single resolution algorithm, the proposed algorithm can obtain smooth edges and good texture features, and the reconstructed image structure is well preserved and the noise is suppressed to some extent.
Willerslev, Eske; Gilbert, M Thomas P; Binladen, Jonas; Ho, Simon YW; Campos, Paula F; Ratan, Aakrosh; Tomsho, Lynn P; da Fonseca, Rute R; Sher, Andrei; Kuznetsova, Tatanya V; Nowak-Kemp, Malgosia; Roth, Terri L; Miller, Webb; Schuster, Stephan C
2009-01-01
Background The scientific literature contains many examples where DNA sequence analyses have been used to provide definitive answers to phylogenetic problems that traditional (non-DNA based) approaches alone have failed to resolve. One notable example concerns the rhinoceroses, a group for which several contradictory phylogenies were proposed on the basis of morphology, then apparently resolved using mitochondrial DNA fragments. Results In this study we report the first complete mitochondrial genome sequences of the extinct ice-age woolly rhinoceros (Coelodonta antiquitatis), and the threatened Javan (Rhinoceros sondaicus), Sumatran (Dicerorhinus sumatrensis), and black (Diceros bicornis) rhinoceroses. In combination with the previously published mitochondrial genomes of the white (Ceratotherium simum) and Indian (Rhinoceros unicornis) rhinoceroses, this data set putatively enables reconstruction of the rhinoceros phylogeny. While the six species cluster into three strongly supported sister-pairings: (i) The black/white, (ii) the woolly/Sumatran, and (iii) the Javan/Indian, resolution of the higher-level relationships has no statistical support. The phylogenetic signal from individual genes is highly diffuse, with mixed topological support from different genes. Furthermore, the choice of outgroup (horse vs tapir) has considerable effect on reconstruction of the phylogeny. The lack of resolution is suggestive of a hard polytomy at the base of crown-group Rhinocerotidae, and this is supported by an investigation of the relative branch lengths. Conclusion Satisfactory resolution of the rhinoceros phylogeny may not be achievable without additional analyses of substantial amounts of nuclear DNA. This study provides a compelling demonstration that, in spite of substantial sequence length, there are significant limitations with single-locus phylogenetics. We expect further examples of this to appear as next-generation, large-scale sequencing of complete mitochondrial genomes becomes commonplace in evolutionary studies. "The human factor in classification is nowhere more evident than in dealing with this superfamily (Rhinocerotoidea)." G. G. Simpson (1945) PMID:19432984
Pena, Loren D M; Jiang, Yong-Hui; Schoch, Kelly; Spillmann, Rebecca C; Walley, Nicole; Stong, Nicholas; Rapisardo Horn, Sarah; Sullivan, Jennifer A; McConkie-Rosell, Allyn; Kansagra, Sujay; Smith, Edward C; El-Dairi, Mays; Bellet, Jane; Keels, Martha Ann; Jasien, Joan; Kranz, Peter G; Noel, Richard; Nagaraj, Shashi K; Lark, Robert K; Wechsler, Daniel S G; Del Gaudio, Daniela; Leung, Marco L; Hendon, Laura G; Parker, Collette C; Jones, Kelly L; Goldstein, David B; Shashi, Vandana
2018-04-01
PurposeTo describe examples of missed pathogenic variants on whole-exome sequencing (WES) and the importance of deep phenotyping for further diagnostic testing.MethodsGuided by phenotypic information, three children with negative WES underwent targeted single-gene testing.ResultsIndividual 1 had a clinical diagnosis consistent with infantile systemic hyalinosis, although WES and a next-generation sequencing (NGS)-based ANTXR2 test were negative. Sanger sequencing of ANTXR2 revealed a homozygous single base pair insertion, previously missed by the WES variant caller software. Individual 2 had neurodevelopmental regression and cerebellar atrophy, with no diagnosis on WES. New clinical findings prompted Sanger sequencing and copy number testing of PLA2G6. A novel homozygous deletion of the noncoding exon 1 (not included in the WES capture kit) was detected, with extension into the promoter, confirming the clinical suspicion of infantile neuroaxonal dystrophy. Individual 3 had progressive ataxia, spasticity, and magnetic resonance image changes of vanishing white matter leukoencephalopathy. An NGS leukodystrophy gene panel and WES showed a heterozygous pathogenic variant in EIF2B5; no deletions/duplications were detected. Sanger sequencing of EIF2B5 showed a frameshift indel, probably missed owing to failure of alignment.ConclusionThese cases illustrate potential pitfalls of WES/NGS testing and the importance of phenotype-guided molecular testing in yielding diagnoses.
Pena, Loren DM; Jiang, Yong-Hui; Schoch, Kelly; Spillmann, Rebecca C.; Walley, Nicole; Stong, Nicholas; Horn, Sarah Rapisardo; Sullivan, Jennifer A.; McConkie-Rosell, Allyn; Kansagra, Sujay; Smith, Edward C.; El-Dairi, Mays; Bellet, Jane; Ann Keels, Martha; Jasien, Joan; Kranz, Peter G.; Noel, Richard; Nagaraj, Shashi K.; Lark, Robert K.; Wechsler, Daniel SG; del Gaudio, Daniela; Leung, Marco L.; Hendon, Laura G.; Parker, Collette C.; Jones, Kelly L.; Goldstein, David B.; Shashi, Vandana
2017-01-01
Purpose To describe examples of missed pathogenic variants on whole exome sequencing (WES) and the importance of deep phenotyping for further diagnostic testing. Methods Guided by phenotypic information, three children with negative WES underwent targeted single gene testing. Results Individual 1 had a clinical diagnosis consistent with infantile systemic hyalinosis, although WES and an NGS-based ANTXR2 test were negative. Sanger sequencing of ANTXR2 revealed a homozygous single base pair insertion, previously missed by the WES variant caller software. Individual 2 had neurodevelopmental regression and cerebellar atrophy, with no diagnosis on WES. New clinical findings prompted Sanger sequencing and copy number testing of PLA2G6. A novel homozygous deletion of the non-coding exon 1 (not included in the WES capture kit) was detected, with extension into the promoter, confirming the clinical suspicion of infantile neuroaxonal dystrophy. Individual 3 had progressive ataxia, spasticity and MRI changes of vanishing white matter leukoencephalopathy. An NGS leukodystrophy gene panel and WES showed a heterozygous pathogenic variant in EIF2B5; no deletions/duplications were detected. Sanger sequencing of EIF2B5 showed a frameshift indel, likely missed due to failure of alignment. Conclusions These cases illustrate potential pitfalls of WES/NGS testing, and the importance of phenotype-guided molecular testing in yielding diagnoses. PMID:28914269
Adaptive Markov Random Fields for Example-Based Super-resolution of Faces
NASA Astrophysics Data System (ADS)
Stephenson, Todd A.; Chen, Tsuhan
2006-12-01
Image enhancement of low-resolution images can be done through methods such as interpolation, super-resolution using multiple video frames, and example-based super-resolution. Example-based super-resolution, in particular, is suited to images that have a strong prior (for those frameworks that work on only a single image, it is more like image restoration than traditional, multiframe super-resolution). For example, hallucination and Markov random field (MRF) methods use examples drawn from the same domain as the image being enhanced to determine what the missing high-frequency information is likely to be. We propose to use even stronger prior information by extending MRF-based super-resolution to use adaptive observation and transition functions, that is, to make these functions region-dependent. We show with face images how we can adapt the modeling for each image patch so as to improve the resolution.
Jang, Joon Hee; Huang, Yu; Zheng, Peilin; Jo, Myeong Chan; Bertolet, Grant; Qin, Lidong; Liu, Dongfang
2015-01-01
The immunological synapse (IS) is one of the most pivotal communication strategies in immune cells. Understanding the molecular basis of the IS provides critical information regarding how immune cells mount an effective immune response. Fluorescence microscopy provides a fundamental tool to study the IS. However, current imaging techniques for studying the IS cannot sufficiently achieve high resolution in real cell-cell conjugates. Here we present a new device that allows for high-resolution imaging of the IS with conventional confocal microscopy in a high-throughput manner. Combining micropits and single cell trap arrays, we have developed a new microfluidic platform that allows visualization of the IS in vertically “stacked” cells. Using this vertical cell pairing (VCP) system, we investigated the dynamics of the inhibitory synapse mediated by an inhibitory receptor, programed death protein-1 (PD-1) and the cytotoxic synapse at the single cell level. In addition to the technique innovation, we demonstrated novel biological findings by this VCP device, including novel distribution of F-actin and cytolytic granules at the IS, PD-1 microclusters in the NK IS, and kinetics of cytotoxicity. We propose that this high-throughput, cost-effective, easy-to-use VCP system, along with conventional imaging techniques, can be used to address a number of significant biological questions in a variety of disciplines. PMID:26123352
A rule of seven in Watson-Crick base-pairing of mismatched sequences.
Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip
2012-05-13
Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.
Oscillatory magnetic tweezers based on ferromagnetic beads and simple coaxial coils
NASA Astrophysics Data System (ADS)
Trepat, Xavier; Grabulosa, Mireia; Buscemi, Lara; Rico, Fèlix; Fabry, Ben; Fredberg, Jeffrey J.; Farré, Ramon
2003-09-01
We report the design and validation of simple magnetic tweezers for oscillating ferromagnetic beads in the piconewton and nanometer scales. The system is based on a single pair of coaxial coils operating in two sequential modes: permanent magnetization of the beads through a large and brief pulse of magnetic field and generation of magnetic gradients to produce uniaxial oscillatory forces. By using this two step method, the magnetic moment of the beads remains constant during measurements. Therefore, the applied force can be computed and varies linearly with the driving signal. No feedback control is required to produce well defined force oscillations over a wide bandwidth. The design of the coils was optimized to obtain high magnetic fields (280 mT) and gradients (2 T/m) with high homogeneity (5% variation) within the sample. The magnetic tweezers were implemented in an inverted optical microscope with a videomicroscopy-based multiparticle tracking system. The apparatus was validated with 4.5 μm magnetite beads obtaining forces up to ˜2 pN and subnanometer resolution. The applicability of the device includes microrheology of biopolymer and cell cytoplasm, molecular mechanics, and mechanotransduction in living cells.
Rayleigh-wave mode separation by high-resolution linear radon transform
Luo, Y.; Xia, J.; Miller, R.D.; Xu, Y.; Liu, J.; Liu, Q.
2009-01-01
Multichannel analysis of surface waves (MASW) method is an effective tool for obtaining vertical shear wave profiles from a single non-invasive measurement. One key step of the MASW method is generation of a dispersion image and extraction of a reliable dispersion curve from raw multichannel shot records. Because different Rayleigh-wave modes normally interfere with each other in the time and space domain, it is necessary to perform mode separation and reconstruction to increase the accuracy of phase velocities determined from a dispersion image. In this paper, we demonstrate the effectiveness of high-resolution linear Radon transform (LRT) as a means of separating and reconstructing multimode, dispersive Rayleigh-wave energy. We first introduce high-resolution LRT methods and Rayleigh-wave mode separation using high-resolution LRT. Next, we use synthetic data and a real-world example to demonstrate the effectiveness of Rayleigh-wave mode separation using high-resolution LRT. Our synthetic and real-world results demonstrate that (1) high-resolution LRT successfully separates and reconstructs multimode dispersive Rayleigh-wave energy with high resolution allowing the multimode energy to be more accurately determined. The horizontal resolution of the Rayleigh-wave method can be increased by extraction of dispersion curves from a pair of traces in the mode-separated shot gather and (2) multimode separation and reconstruction expand the usable frequency range of higher mode dispersive energy, which increases the depth of investigation and provides a means for accurately determining cut-off frequencies. ?? 2009 The Authors Journal compilation ?? 2009 RAS.
Zhao, Peiwen; Bu, Yuxiang
2016-01-14
In this work, we computationally design radical nucleobases which possess improved electronic properties, especially diradical properties through introducing a cyclopentadiene radical. We predict that the detailed electromagnetic features of base assemblies are based on the orientation of the extra five-membered cyclopentadiene ring. Broken symmetry DFT calculations take into account the relevant structures and properties. Our results reveal that both the radicalized DNA bases and the base pairs formed when they combine with their counterparts remain stable and display larger spin delocalization. The mode of embedding the cyclopentadiene free radical in the structures has some influence on the degree of π-conjugation, which results in various diradical characteristics. Single-layered radical base pairs all have an open-shell singlet ground state, but the energy difference between singlet and triplet is not significant. For two-layered radical base pairs, the situation is more complex. All of them have an open-shell state as their ground state, including an open-shell singlet state and an open-shell triplet state. That is, the majority of radical base pairs possess anti-ferromagnetic or ferromagnetic characteristics. We present here a more in-depth discussion and analyses to study the magnetic characteristics of radical bases and base pairs. As an important factor, two-layered radical base pairs also have been carefully analyzed. We hope that all the measurements and results presented here will stimulate further detailed insights into the related mechanisms in modified DNA bases and the design of better ring-expanded DNA magnetic materials.
Muhire, Brejnev Muhizi; Golden, Michael; Murrell, Ben; Lefeuvre, Pierre; Lett, Jean-Michel; Gray, Alistair; Poon, Art Y F; Ngandu, Nobubelo Kwanele; Semegni, Yves; Tanov, Emil Pavlov; Monjane, Adérito Luis; Harkins, Gordon William; Varsani, Arvind; Shepherd, Dionne Natalie; Martin, Darren Patrick
2014-02-01
Single-stranded DNA (ssDNA) viruses have genomes that are potentially capable of forming complex secondary structures through Watson-Crick base pairing between their constituent nucleotides. A few of the structural elements formed by such base pairings are, in fact, known to have important functions during the replication of many ssDNA viruses. Unknown, however, are (i) whether numerous additional ssDNA virus genomic structural elements predicted to exist by computational DNA folding methods actually exist and (ii) whether those structures that do exist have any biological relevance. We therefore computationally inferred lists of the most evolutionarily conserved structures within a diverse selection of animal- and plant-infecting ssDNA viruses drawn from the families Circoviridae, Anelloviridae, Parvoviridae, Nanoviridae, and Geminiviridae and analyzed these for evidence of natural selection favoring the maintenance of these structures. While we find evidence that is consistent with purifying selection being stronger at nucleotide sites that are predicted to be base paired than at sites predicted to be unpaired, we also find strong associations between sites that are predicted to pair with one another and site pairs that are apparently coevolving in a complementary fashion. Collectively, these results indicate that natural selection actively preserves much of the pervasive secondary structure that is evident within eukaryote-infecting ssDNA virus genomes and, therefore, that much of this structure is biologically functional. Lastly, we provide examples of various highly conserved but completely uncharacterized structural elements that likely have important functions within some of the ssDNA virus genomes analyzed here.
Muhire, Brejnev Muhizi; Golden, Michael; Murrell, Ben; Lefeuvre, Pierre; Lett, Jean-Michel; Gray, Alistair; Poon, Art Y. F.; Ngandu, Nobubelo Kwanele; Semegni, Yves; Tanov, Emil Pavlov; Monjane, Adérito Luis; Harkins, Gordon William; Varsani, Arvind; Shepherd, Dionne Natalie
2014-01-01
Single-stranded DNA (ssDNA) viruses have genomes that are potentially capable of forming complex secondary structures through Watson-Crick base pairing between their constituent nucleotides. A few of the structural elements formed by such base pairings are, in fact, known to have important functions during the replication of many ssDNA viruses. Unknown, however, are (i) whether numerous additional ssDNA virus genomic structural elements predicted to exist by computational DNA folding methods actually exist and (ii) whether those structures that do exist have any biological relevance. We therefore computationally inferred lists of the most evolutionarily conserved structures within a diverse selection of animal- and plant-infecting ssDNA viruses drawn from the families Circoviridae, Anelloviridae, Parvoviridae, Nanoviridae, and Geminiviridae and analyzed these for evidence of natural selection favoring the maintenance of these structures. While we find evidence that is consistent with purifying selection being stronger at nucleotide sites that are predicted to be base paired than at sites predicted to be unpaired, we also find strong associations between sites that are predicted to pair with one another and site pairs that are apparently coevolving in a complementary fashion. Collectively, these results indicate that natural selection actively preserves much of the pervasive secondary structure that is evident within eukaryote-infecting ssDNA virus genomes and, therefore, that much of this structure is biologically functional. Lastly, we provide examples of various highly conserved but completely uncharacterized structural elements that likely have important functions within some of the ssDNA virus genomes analyzed here. PMID:24284329
Multi-user distribution of polarization entangled photon pairs
DOE Office of Scientific and Technical Information (OSTI.GOV)
Trapateau, J.; Orieux, A.; Diamanti, E.
We experimentally demonstrate multi-user distribution of polarization entanglement using commercial telecom wavelength division demultiplexers. The entangled photon pairs are generated from a broadband source based on spontaneous parametric down conversion in a periodically poled lithium niobate crystal using a double path setup employing a Michelson interferometer and active phase stabilisation. We test and compare demultiplexers based on various technologies and analyze the effect of their characteristics, such as losses and polarization dependence, on the quality of the distributed entanglement for three channel pairs of each demultiplexer. In all cases, we obtain a Bell inequality violation, whose value depends on themore » demultiplexer features. This demonstrates that entanglement can be distributed to at least three user pairs of a network from a single source. Additionally, we verify for the best demultiplexer that the violation is maintained when the pairs are distributed over a total channel attenuation corresponding to 20 km of optical fiber. These techniques are therefore suitable for resource-efficient practical implementations of entanglement-based quantum key distribution and other quantum communication network applications.« less
Super-resolution optical microscopy study of telomere structure.
Phipps, Mary Lisa; Goodwin, Peter M; Martinez, Jennifer S; Goodwin, Edwin H
2016-09-01
Chromosome ends are shielded from exonucleolytic attack and inappropriate end-joining by terminal structures called telomeres; these structures are potential targets for anticancer drugs. Telomeres are composed of a simple DNA sequence (5?-TTAGGG-3? in humans) repeated more than a thousand times, a short 3? single-stranded overhang, and numerous proteins. Electron microscopy has shown that the 3? overhang pairs with the complementary strand at an internal site creating a small displacement loop and a large double-stranded “t-loop.” Our goal is to determine whether all telomeres adopt the t-loop configuration, or whether there are two or more distinct configurations. Progress in optimizing super-resolution (SR) microscopy for this ongoing investigation is reported here. Results suggest that under certain conditions sample preparation procedures may disrupt chromatin by causing loss of nucleosomes. This finding may limit the use of SR microscopy in telomere studies.
Performance of a multistep fluorescence-gated proportional counter for hard X-ray astronomy
NASA Technical Reports Server (NTRS)
Dietz, K. L.; Ramsey, B. D.; Weisskopf, M. C.
1992-01-01
Results from the first flight of our proportional counter in an imaging telescope led us to rebuild the detector. We have used a Penning gas mixture (xenon + 1 percent isobutylene) and introduced a preamplification region to improve the energy resolution. We have rebuilt the pressure vessel making novel use of molybdenum as the housing material in order to reduce the residual instrument background, particularly in the fluorescence-gated mode for which the detector design has been optimized. We have also increased the sensitive gas depth from 9 to 14 cm to further increase the sensitivity to both fluorescent pairs and conventional singles. Our calibrations have shown that the overall energy resolution of the detector has been enhanced by a factor of 2, and we predict that the sensitivity at float will increase by a factor of 3 in the 50-70 keV energy band.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Eric A. Wernert; William R. Sherman; Chris Eller
2012-03-01
We present a pair of open-recipe, affordably-priced, easy-to-integrate, and easy-to-use visualization systems. The IQ-wall is an ultra-resolution tiled display wall that scales up to 24 screens with a single PC. The IQ-station is a semi-immersive display system that utilizes commodity stereoscopic displays, lower cost tracking systems, and touch overlays. These systems have been designed to support a wide range of research, education, creative activities, and information presentations. They were designed to work equally well as stand-alone installations or as part of a larger distributed visualization ecosystem. We detail the hardware and software components of these systems, describe our deployments andmore » experiences in a variety of research lab and university environments, and share our insights for effective support and community development.« less
Super-resolution optical microscopy study of telomere structure
NASA Astrophysics Data System (ADS)
Phipps, Mary Lisa; Goodwin, Peter M.; Martinez, Jennifer S.; Goodwin, Edwin H.
2016-09-01
Chromosome ends are shielded from exonucleolytic attack and inappropriate end-joining by terminal structures called telomeres; these structures are potential targets for anticancer drugs. Telomeres are composed of a simple DNA sequence (5‧-TTAGGG-3‧ in humans) repeated more than a thousand times, a short 3‧ single-stranded overhang, and numerous proteins. Electron microscopy has shown that the 3‧ overhang pairs with the complementary strand at an internal site creating a small displacement loop and a large double-stranded "t-loop." Our goal is to determine whether all telomeres adopt the t-loop configuration, or whether there are two or more distinct configurations. Progress in optimizing super-resolution (SR) microscopy for this ongoing investigation is reported here. Results suggest that under certain conditions sample preparation procedures may disrupt chromatin by causing loss of nucleosomes. This finding may limit the use of SR microscopy in telomere studies.
Meisburger, Steve P.; Sutton, Julie L.; Chen, Huimin; Pabit, Suzette A.; Kirmizialtin, Serdal; Elber, Ron; Pollack, Lois
2013-01-01
Nucleic acids are highly charged polyelectrolytes that interact strongly with salt ions. Rigid, base-paired regions are successfully described with worm like chain models, but non base-paired single stranded regions have fundamentally different polymer properties because of their greater flexibility. Recently, attention has turned to single stranded nucleic acids due to the growing recognition of their biological importance, as well as the availability of sophisticated experimental techniques sensitive to the conformation of individual molecules. We investigate polyelectrolyte properties of poly(dT), an important and widely studied model system for flexible single stranded nucleic acids, in physiologically important mixed mono- and di-valent salt. We report measurements of the form factor and interparticle interactions using SAXS, end to end distances using smFRET, and number of excess ions using ASAXS. We present a coarse-grained model that accounts for flexibility, excluded volume, and electrostatic interactions in these systems. Predictions of the model are validated against experiment. We also discuss the state of all-atom, explicit solvent Molecular Dynamics simulations of poly(dT), the next step in understanding the complexities of ion interactions with these highly charged and flexible polymers. PMID:23606337
Genome Editing Tools in Plants
Mohanta, Tapan Kumar; Bashir, Tufail; Hashem, Abeer; Bae, Hanhong
2017-01-01
Genome editing tools have the potential to change the genomic architecture of a genome at precise locations, with desired accuracy. These tools have been efficiently used for trait discovery and for the generation of plants with high crop yields and resistance to biotic and abiotic stresses. Due to complex genomic architecture, it is challenging to edit all of the genes/genomes using a particular genome editing tool. Therefore, to overcome this challenging task, several genome editing tools have been developed to facilitate efficient genome editing. Some of the major genome editing tools used to edit plant genomes are: Homologous recombination (HR), zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), pentatricopeptide repeat proteins (PPRs), the CRISPR/Cas9 system, RNA interference (RNAi), cisgenesis, and intragenesis. In addition, site-directed sequence editing and oligonucleotide-directed mutagenesis have the potential to edit the genome at the single-nucleotide level. Recently, adenine base editors (ABEs) have been developed to mutate A-T base pairs to G-C base pairs. ABEs use deoxyadeninedeaminase (TadA) with catalytically impaired Cas9 nickase to mutate A-T base pairs to G-C base pairs. PMID:29257124
Reconstructed Image Spatial Resolution of Multiple Coincidences Compton Imager
NASA Astrophysics Data System (ADS)
Andreyev, Andriy; Sitek, Arkadiusz; Celler, Anna
2010-02-01
We study the multiple coincidences Compton imager (MCCI) which is based on a simultaneous acquisition of several photons emitted in cascade from a single nuclear decay. Theoretically, this technique should provide a major improvement in localization of a single radioactive source as compared to a standard Compton camera. In this work, we investigated the performance and limitations of MCCI using Monte Carlo computer simulations. Spatial resolutions of the reconstructed point source have been studied as a function of the MCCI parameters, including geometrical dimensions and detector characteristics such as materials, energy and spatial resolutions.
Li, Rugang; Padmanabhan, Chellappan; Ling, Kai-Shu
2017-01-01
Tomato planta macho viroid (TPMVd), including isolates previously designated as Mexican papita viroid (MPVd), causes serious disease on tomatoes in North America. Two predominant variants, sharing 93.8% sequence identity, incited distinct severe (MPVd-S) or mild (MPVd-M) symptoms on tomato. To identify virulence determinant factor, a series of chimeric infectious clones were generated using synthetic DNA approach to progressively replace each structural domain between the two variants. In bioassays on tomato 'Rutgers', three chimeras containing Terminal Left and Pathogenicity (MPVd-H1), Central (MPVd-H2), or Variable (MPVd-H3) of MPVd-S, incited mild to intermediate symptoms. However, a chimera containing Terminal Right (T R ) of MPVd-S (MPVd-H4) incited severe symptoms. Only one base-pair mutation in the T R domain between MPVd-M ( 176 U:A 185 ) and MPVd-S ( 174 G:C 183 ) was identified. A reciprocal mutant (MPVd-H5) rendered the chimeric viroid mild on tomato. This single base-pair in the T R domain was determined as the virulence determinant factor for TPMVd. Published by Elsevier Inc.
NASA Astrophysics Data System (ADS)
Haldren, H. A.; Perey, D. F.; Yost, W. T.; Cramer, K. E.; Gupta, M. C.
2018-05-01
A digitally controlled instrument for conducting single-frequency and swept-frequency ultrasonic phase measurements has been developed based on a constant-frequency pulsed phase-locked-loop (CFPPLL) design. This instrument uses a pair of direct digital synthesizers to generate an ultrasonically transceived tone-burst and an internal reference wave for phase comparison. Real-time, constant-frequency phase tracking in an interrogated specimen is possible with a resolution of 0.000 38 rad (0.022°), and swept-frequency phase measurements can be obtained. Using phase measurements, an absolute thickness in borosilicate glass is presented to show the instrument's efficacy, and these results are compared to conventional ultrasonic pulse-echo time-of-flight (ToF) measurements. The newly developed instrument predicted the thickness with a mean error of -0.04 μm and a standard deviation of error of 1.35 μm. Additionally, the CFPPLL instrument shows a lower measured phase error in the absence of changing temperature and couplant thickness than high-resolution cross-correlation ToF measurements at a similar signal-to-noise ratio. By showing higher accuracy and precision than conventional pulse-echo ToF measurements and lower phase errors than cross-correlation ToF measurements, the new digitally controlled CFPPLL instrument provides high-resolution absolute ultrasonic velocity or path-length measurements in solids or liquids, as well as tracking of material property changes with high sensitivity. The ability to obtain absolute phase measurements allows for many new applications than possible with previous ultrasonic pulsed phase-locked loop instruments. In addition to improved resolution, swept-frequency phase measurements add useful capability in measuring properties of layered structures, such as bonded joints, or materials which exhibit non-linear frequency-dependent behavior, such as dispersive media.
NASA Astrophysics Data System (ADS)
Ni, Fang; Nakatsukasa, Takashi
2018-04-01
To describe quantal collective phenomena, it is useful to requantize the time-dependent mean-field dynamics. We study the time-dependent Hartree-Fock-Bogoliubov (TDHFB) theory for the two-level pairing Hamiltonian, and compare results of different quantization methods. The one constructing microscopic wave functions, using the TDHFB trajectories fulfilling the Einstein-Brillouin-Keller quantization condition, turns out to be the most accurate. The method is based on the stationary-phase approximation to the path integral. We also examine the performance of the collective model which assumes that the pairing gap parameter is the collective coordinate. The applicability of the collective model is limited for the nuclear pairing with a small number of single-particle levels, because the pairing gap parameter represents only a half of the pairing collective space.
Single-shot three-dimensional reconstruction based on structured light line pattern
NASA Astrophysics Data System (ADS)
Wang, ZhenZhou; Yang, YongMing
2018-07-01
Reconstruction of the object by single-shot is of great importance in many applications, in which the object is moving or its shape is non-rigid and changes irregularly. In this paper, we propose a single-shot structured light 3D imaging technique that calculates the phase map from the distorted line pattern. This technique makes use of the image processing techniques to segment and cluster the projected structured light line pattern from one single captured image. The coordinates of the clustered lines are extracted to form a low-resolution phase matrix which is then transformed to full-resolution phase map by spline interpolation. The 3D shape of the object is computed from the full-resolution phase map and the 2D camera coordinates. Experimental results show that the proposed method was able to reconstruct the three-dimensional shape of the object robustly from one single image.
Structure of a bacterial RNA polymerase holoenzyme open promoter complex
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bae, Brian; Feklistov, Andrey; Lass-Napiorkowska, Agnieszka
2015-09-08
Initiation of transcription is a primary means for controlling gene expression. In bacteria, the RNA polymerase (RNAP) holoenzyme binds and unwinds promoter DNA, forming the transcription bubble of the open promoter complex (RPo). We have determined crystal structures, refined to 4.14 Å-resolution, of RPo containing Thermus aquaticus RNAP holoenzyme and promoter DNA that includes the full transcription bubble. The structures, combined with biochemical analyses, reveal key features supporting the formation and maintenance of the double-strand/single-strand DNA junction at the upstream edge of the -10 element where bubble formation initiates. The results also reveal RNAP interactions with duplex DNA just upstreammore » of the -10 element and potential protein/DNA interactions that direct the DNA template strand into the RNAP active site. Addition of an RNA primer to yield a 4 base-pair post-translocated RNA:DNA hybrid mimics an initially transcribing complex at the point where steric clash initiates abortive initiation and σA dissociation.« less
Structure of a bacterial RNA polymerase holoenzyme open promoter complex
Bae, Brian; Feklistov, Andrey; Lass-Napiorkowska, Agnieszka; ...
2015-09-08
Initiation of transcription is a primary means for controlling gene expression. In bacteria, the RNA polymerase (RNAP) holoenzyme binds and unwinds promoter DNA, forming the transcription bubble of the open promoter complex (RPo). We have determined crystal structures, refined to 4.14 Å-resolution, of RPo containing Thermus aquaticus RNAP holoenzyme and promoter DNA that includes the full transcription bubble. The structures, combined with biochemical analyses, reveal key features supporting the formation and maintenance of the double-strand/single-strand DNA junction at the upstream edge of the -10 element where bubble formation initiates. The results also reveal RNAP interactions with duplex DNA just upstreammore » of the -10 element and potential protein/DNA interactions that direct the DNA template strand into the RNAP active site. Additionally a RNA primer to yield a 4 base-pair post-translocated RNA:DNA hybrid mimics an initially transcribing complex at the point where steric clash initiates abortive initiation and σ A dissociation.« less
NASA Astrophysics Data System (ADS)
Zhang, Lei; Lei, Dongsheng; Smith, Jessica M.; Zhang, Meng; Tong, Huimin; Zhang, Xing; Lu, Zhuoyang; Liu, Jiankang; Alivisatos, A. Paul; Ren, Gang
2016-03-01
DNA base pairing has been used for many years to direct the arrangement of inorganic nanocrystals into small groupings and arrays with tailored optical and electrical properties. The control of DNA-mediated assembly depends crucially on a better understanding of three-dimensional structure of DNA-nanocrystal-hybridized building blocks. Existing techniques do not allow for structural determination of these flexible and heterogeneous samples. Here we report cryo-electron microscopy and negative-staining electron tomography approaches to image, and three-dimensionally reconstruct a single DNA-nanogold conjugate, an 84-bp double-stranded DNA with two 5-nm nanogold particles for potential substrates in plasmon-coupling experiments. By individual-particle electron tomography reconstruction, we obtain 14 density maps at ~2-nm resolution. Using these maps as constraints, we derive 14 conformations of dsDNA by molecular dynamics simulations. The conformational variation is consistent with that from liquid solution, suggesting that individual-particle electron tomography could be an expected approach to study DNA-assembling and flexible protein structure and dynamics.
Quantitative Understanding of SHAPE Mechanism from RNA Structure and Dynamics Analysis.
Hurst, Travis; Xu, Xiaojun; Zhao, Peinan; Chen, Shi-Jie
2018-05-10
The selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) method probes RNA local structural and dynamic information at single nucleotide resolution. To gain quantitative insights into the relationship between nucleotide flexibility, RNA 3D structure, and SHAPE reactivity, we develop a 3D Structure-SHAPE Relationship model (3DSSR) to rebuild SHAPE profiles from 3D structures. The model starts from RNA structures and combines nucleotide interaction strength and conformational propensity, ligand (SHAPE reagent) accessibility, and base-pairing pattern through a composite function to quantify the correlation between SHAPE reactivity and nucleotide conformational stability. The 3DSSR model shows the relationship between SHAPE reactivity and RNA structure and energetics. Comparisons between the 3DSSR-predicted SHAPE profile and the experimental SHAPE data show correlation, suggesting that the extracted analytical function may have captured the key factors that determine the SHAPE reactivity profile. Furthermore, the theory offers an effective method to sieve RNA 3D models and exclude models that are incompatible with experimental SHAPE data.
Qu, Cheng; Pu, Zong-Jin; Zhou, Gui-Sheng; Wang, Jun; Zhu, Zhen-Hua; Yue, Shi-Jun; Li, Jian-Ping; Shang, Li-Li; Tang, Yu-Ping; Shi, Xu-Qin; Liu, Pei; Guo, Jian-Ming; Sun, Jing; Tang, Zhi-Shu; Zhao, Jing; Zhao, Bu-Chang; Duan, Jin-Ao
2017-09-01
A sensitive, reliable, and powerful ultra-high performance liquid chromatography coupled to triple quadrupole tandem mass spectrometry method was developed for simultaneous quantification of the 15 main bio-active components including phenolic acids and flavonoids within 13 min for the first time. The proposed method was first reported and validated by good linearity (r 2 > 0.9975), limit of detection (1.12-7.01 ng/mL), limit of quantification (3.73-23.37 ng/mL), intra- and inter-day precisions (RSD ≤ 1.92%, RSD ≤ 2.45%), stability (RSD ≤ 5.63%), repeatability (RSD ≤ 4.34%), recovery (96.84-102.12%), and matrix effects (0.92-1.02). The established analytical methodology was successfully applied to comparative analysis of main bio-active components in the herb pair Danshen-Honghua and its single herbs. Compared to the single herb, the content of most flavonoid glycosides was remarkably increased in their herb pair, and main phenolic acids were decreased, conversely. The content changes of the main components in the herb pair supported the synergistic effects on promoting blood circulation and removing blood stasis. The results provide a scientific basis and reference for the quality control of Danshen-Honghua herb pair and the drug interactions based on variation of bio-active components in herb pairs. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Reddy, B.S.; Seshadri, T.P.; Sakore, T.D.
1979-01-01
Acridine orange and proflavine form complexes with the dinucleoside monophosphate, 5-iodocytidylyl(3'-5') guanosine (iodoCpG). The acridine orange-iodoCpG crystals are monoclinic, space group P2/sub 1/, with unit cell dimensions a = 14.36 A, b = 19.64 A, c = 20.67 A, ..beta.. = 102.5. The proflavine-iodoCpG crystals are monoclinic, space group C2, with unit cell dimensions a = 32.14 A, b = 22.23 A, c = 18.42 A, ..beta.. = 123.3. Both structures have been solved to atomic resolution by Patterson and Fourier methods, and refined by full matrix least squares. Acridine orange forms an intercalative structure with iodoCpG but the acridinemore » nucleus lies asymmetrically in the intercalation site. This asymmetric intercalation is accompanied by a sliding of base-pairs upon the acridine nucleus. Base-pairs above and below the drug are separated by about 6.8 A and are twisted about 10/sup 0/. Proflavine demonstrates symmetric intercalation with iodoCpG. Hydrogen bonds connect amino- groups on proflavine with phosphate oxygen atoms on the dinucleotide. Base-pairs above and below the intercalative proflavine molecule are twisted about 36/sup 0/. The altered magnitude of this angular twist reflects the sugar puckering pattern that is observed. We propose a proflavine-DNA and an acridine orange-DNA binding model. We will describe these models in detail in this paper.« less
M&A For Lithography Of Sparse Arrays Of Sub-Micrometer Features
Brueck, Steven R.J.; Chen, Xiaolan; Zaidi, Saleem; Devine, Daniel J.
1998-06-02
Methods and apparatuses are disclosed for the exposure of sparse hole and/or mesa arrays with line:space ratios of 1:3 or greater and sub-micrometer hole and/or mesa diameters in a layer of photosensitive material atop a layered material. Methods disclosed include: double exposure interferometric lithography pairs in which only those areas near the overlapping maxima of each single-period exposure pair receive a clearing exposure dose; double interferometric lithography exposure pairs with additional processing steps to transfer the array from a first single-period interferometric lithography exposure pair into an intermediate mask layer and a second single-period interferometric lithography exposure to further select a subset of the first array of holes; a double exposure of a single period interferometric lithography exposure pair to define a dense array of sub-micrometer holes and an optical lithography exposure in which only those holes near maxima of both exposures receive a clearing exposure dose; combination of a single-period interferometric exposure pair, processing to transfer resulting dense array of sub-micrometer holes into an intermediate etch mask, and an optical lithography exposure to select a subset of initial array to form a sparse array; combination of an optical exposure, transfer of exposure pattern into an intermediate mask layer, and a single-period interferometric lithography exposure pair; three-beam interferometric exposure pairs to form sparse arrays of sub-micrometer holes; five- and four-beam interferometric exposures to form a sparse array of sub-micrometer holes in a single exposure. Apparatuses disclosed include arrangements for the three-beam, five-beam and four-beam interferometric exposures.
Detecting Single-Nucleotide Substitutions Induced by Genome Editing.
Miyaoka, Yuichiro; Chan, Amanda H; Conklin, Bruce R
2016-08-01
The detection of genome editing is critical in evaluating genome-editing tools or conditions, but it is not an easy task to detect genome-editing events-especially single-nucleotide substitutions-without a surrogate marker. Here we introduce a procedure that significantly contributes to the advancement of genome-editing technologies. It uses droplet digital polymerase chain reaction (ddPCR) and allele-specific hydrolysis probes to detect single-nucleotide substitutions generated by genome editing (via homology-directed repair, or HDR). HDR events that introduce substitutions using donor DNA are generally infrequent, even with genome-editing tools, and the outcome is only one base pair difference in 3 billion base pairs of the human genome. This task is particularly difficult in induced pluripotent stem (iPS) cells, in which editing events can be very rare. Therefore, the technological advances described here have implications for therapeutic genome editing and experimental approaches to disease modeling with iPS cells. © 2016 Cold Spring Harbor Laboratory Press.
An overview and the current status of instrumentation at the Large Binocular Telescope Observatory
NASA Astrophysics Data System (ADS)
Wagner, R. Mark; Edwards, Michelle L.; Kuhn, Olga; Thompson, David; Veillet, Christian
2014-07-01
An overview of instrumentation for the Large Binocular Telescope (LBT) is presented. Optical instrumentation includes the Large Binocular Camera (LBC), a pair of wide-field (24' × 24') mosaic CCD imagers at the prime focus, and the Multi-Object Double Spectrograph (MODS), a pair of dual-beam blue-red optimized long-slit spectrographs mounted at the left and right direct F/15 Gregorian foci incorporating multiple slit masks for multi-object spectroscopy over a 6' field and spectral resolutions of up to 2000. Infrared instrumentation includes the LBT Near-IR Spectrometer (LUCI), a modular near-infrared (0.9-2.5 μm) imager and spectrograph pair mounted at the left and right front-bent F/15 Gregorian foci and designed for seeing-limited (FOV: 4' × 4') imaging, long-slit spectroscopy, and multi-object spectroscopy utilizing cooled slit masks and diffraction limited (FOV: 0'.5 x 0'.5) imaging and long-slit spectroscopy. Strategic instruments under development that can utilize the full 23 m baseline of the LBT include an interferometric cryogenic beam combiner with near-infrared and thermal-infrared instruments for Fizeau imaging and nulling interferometry (LBTI) and an optical bench near- infrared beam combiner utilizing multi-conjugate adaptive optics for high angular resolution and sensitivity (LINC-NIRVANA). LBTI is currently undergoing commissioning and performing science observations on the LBT utilizing the installed adaptive secondary mirrors in both single-sided and two-sided beam combination modes. In addition, a fiber-fed bench spectrograph (PEPSI) capable of ultra high resolution spectroscopy and spectropolarimetry (R = 40,000-300,000) will be available as a principal investigator instrument. Installation and testing of the bench spectrograph will begin in July 2014. Over the past four years the LBC pair, LUCI1, and MODS1 have been commissioned and are now scheduled for routine partner science observations. Both LUCI2 and MODS2 passed their laboratory acceptance milestones in the summer of 2013 and have been installed on the LBT. LUCI2 is currently being commissioned and the data analysis is well underway. Diffraction-limited commissioning of its adaptive optics modes will begin in the 2014B semester. MODS2 commissioning began in May 2014 and will completed in the 2014B semester as well. Binocular testing and commissioning of both the LUCI and MODS pairs will begin in 2014B with the goal that this capability could be offered sometime in 2015. The availability of all these instruments mounted simultaneously on the LBT permits unique science, flexible scheduling, and improved operational support.
Quasichemical analysis of the cluster-pair approximation for the thermodynamics of proton hydration
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pollard, Travis; Beck, Thomas L.; Department of Physics, University of Cincinnati, Cincinnati, Ohio 45221
2014-06-14
A theoretical analysis of the cluster-pair approximation (CPA) is presented based on the quasichemical theory of solutions. The sought single-ion hydration free energy of the proton includes an interfacial potential contribution by definition. It is shown, however, that the CPA involves an extra-thermodynamic assumption that does not guarantee uniform convergence to a bulk free energy value with increasing cluster size. A numerical test of the CPA is performed using the classical polarizable AMOEBA force field and supporting quantum chemical calculations. The enthalpy and free energy differences are computed for the kosmotropic Na{sup +}/F{sup −} ion pair in water clusters ofmore » size n = 5, 25, 105. Additional calculations are performed for the chaotropic Rb{sup +}/I{sup −} ion pair. A small shift in the proton hydration free energy and a larger shift in the hydration enthalpy, relative to the CPA values, are predicted based on the n = 105 simulations. The shifts arise from a combination of sequential hydration and interfacial potential effects. The AMOEBA and quantum chemical results suggest an electrochemical surface potential of water in the range −0.4 to −0.5 V. The physical content of single-ion free energies and implications for ion-water force field development are also discussed.« less
A simple procedure for γ- γ lifetime measurements using multi-element fast-timing arrays
NASA Astrophysics Data System (ADS)
Régis, J.-M.; Dannhoff, M.; Jolie, J.
2018-07-01
The lifetimes of nuclear excited states are important observables in nuclear physics. Their precise measurement is of key importance for developing and testing nuclear models as they are directly linked with the quantum nature of the nuclear system. The γ- γ timing technique represents a direct lifetime determination by means of time-difference measurements between the γ rays which directly feed and decay from a nuclear excited state. Using arrays of very-fast scintillator detectors, picosecond-sensitive time-difference measurements can be performed. We propose to construct a symmetric energy-energy-time cube as is usually done to perform γ- γ coincidence analyses and lifetime determination with high-resolution germanium detectors. By construction, a symmetric mean time-walk characteristics is obtained, that can be precisely determined and used as a single time correction for all the data independently of the detectors. We present the results of timing characteristics measurements of an array with six LaBr3(Ce) detectors, as obtained using a 152Eu point γ-ray source. Compared with a single detector pair, the time resolution of the symmetrised time-difference spectra of the array is nearly unaffected.
Rosenbloom, Alyssa B; Lee, Sang-Hyuk; To, Milton; Lee, Antony; Shin, Jae Yen; Bustamante, Carlos
2014-09-09
We studied the single-molecule photo-switching properties of Dronpa, a green photo-switchable fluorescent protein and a popular marker for photoactivated localization microscopy. We found the excitation light photoactivates as well as deactivates Dronpa single molecules, hindering temporal separation and limiting super resolution. To resolve this limitation, we have developed a slow-switching Dronpa variant, rsKame, featuring a V157L amino acid substitution proximal to the chromophore. The increased steric hindrance generated by the substitution reduced the excitation light-induced photoactivation from the dark to fluorescent state. To demonstrate applicability, we paired rsKame with PAmCherry1 in a two-color photoactivated localization microscopy imaging method to observe the inner and outer mitochondrial membrane structures and selectively labeled dynamin related protein 1 (Drp1), responsible for membrane scission during mitochondrial fission. We determined the diameter and length of Drp1 helical rings encircling mitochondria during fission and showed that, whereas their lengths along mitochondria were not significantly changed, their diameters decreased significantly. These results suggest support for the twistase model of Drp1 constriction, with potential loss of subunits at the helical ends.
Multi-image CAD employing features derived from ipsilateral mammographic views
NASA Astrophysics Data System (ADS)
Good, Walter F.; Zheng, Bin; Chang, Yuan-Hsiang; Wang, Xiao Hui; Maitz, Glenn S.; Gur, David
1999-05-01
On mammograms, certain kinds of features related to masses (e.g., location, texture, degree of spiculation, and integrated density difference) tend to be relatively invariant, or at last predictable, with respect to breast compression. Thus, ipsilateral pairs of mammograms may contain information not available from analyzing single views separately. To demonstrate the feasibility of incorporating multi-view features into CAD algorithm, `single-image' CAD was applied to each individual image in a set of 60 ipsilateral studies, after which all possible pairs of suspicious regions, consisting of one from each view, were formed. For these 402 pairs we defined and evaluated `multi-view' features such as: (1) relative position of centers of regions; (2) ratio of lengths of region projections parallel to nipple axis lines; (3) ratio of integrated contrast difference; (4) ratio of the sizes of the suspicious regions; and (5) measure of relative complexity of region boundaries. Each pair was identified as either a `true positive/true positive' (T) pair (i.e., two regions which are projections of the same actual mass), or as a falsely associated pair (F). Distributions for each feature were calculated. A Bayesian network was trained and tested to classify pairs of suspicious regions based exclusively on the multi-view features described above. Distributions for all features were significantly difference for T versus F pairs as indicated by likelihood ratios. Performance of the Bayesian network, which was measured by ROC analysis, indicates a significant ability to distinguish between T pairs and F pairs (Az equals 0.82 +/- 0.03), using information that is attributed to the multi-view content. This study is the first demonstration that there is a significant amount of spatial information that can be derived from ipsilateral pairs of mammograms.
Application of advanced cytometric and molecular technologies to minimal residual disease monitoring
NASA Astrophysics Data System (ADS)
Leary, James F.; He, Feng; Reece, Lisa M.
2000-04-01
Minimal residual disease monitoring presents a number of theoretical and practical challenges. Recently it has been possible to meet some of these challenges by combining a number of new advanced biotechnologies. To monitor the number of residual tumor cells requires complex cocktails of molecular probes that collectively provide sensitivities of detection on the order of one residual tumor cell per million total cells. Ultra-high-speed, multi parameter flow cytometry is capable of analyzing cells at rates in excess of 100,000 cells/sec. Residual tumor selection marker cocktails can be optimized by use of receiver operating characteristic analysis. New data minimizing techniques when combined with multi variate statistical or neural network classifications of tumor cells can more accurately predict residual tumor cell frequencies. The combination of these techniques can, under at least some circumstances, detect frequencies of tumor cells as low as one cell in a million with an accuracy of over 98 percent correct classification. Detection of mutations in tumor suppressor genes requires insolation of these rare tumor cells and single-cell DNA sequencing. Rare residual tumor cells can be isolated at single cell level by high-resolution single-cell cell sorting. Molecular characterization of tumor suppressor gene mutations can be accomplished using a combination of single- cell polymerase chain reaction amplification of specific gene sequences followed by TA cloning techniques and DNA sequencing. Mutations as small as a single base pair in a tumor suppressor gene of a single sorted tumor cell have been detected using these methods. Using new amplification procedures and DNA micro arrays it should be possible to extend the capabilities shown in this paper to screening of multiple DNA mutations in tumor suppressor and other genes on small numbers of sorted metastatic tumor cells.
The multiplicity and anisotropy of galactic satellite accretion
NASA Astrophysics Data System (ADS)
Shao, Shi; Cautun, Marius; Frenk, Carlos S.; Grand, Robert J. J.; Gómez, Facundo A.; Marinacci, Federico; Simpson, Christine M.
2018-05-01
We study the incidence of group and filamentary dwarf galaxy accretion into Milky Way (MW) mass haloes using two types of hydrodynamical simulations: EAGLE, which resolves a large cosmological volume, and the AURIGA suite, which are very high resolution zoom-in simulations of individual MW-sized haloes. The present-day 11 most massive satellites are predominantly (75 per cent) accreted in single events, 14 per cent in pairs, and 6 per cent in triplets, with higher group multiplicities being unlikely. Group accretion becomes more common for fainter satellites, with 60 per cent of the top 50 satellites accreted singly, 12 per cent in pairs, and 28 per cent in richer groups. A group similar in stellar mass to the Large Magellanic Cloud would bring on average 15 members with stellar mass larger than 104 M⊙. Half of the top 11 satellites are accreted along the two richest filaments. The accretion of dwarf galaxies is highly anisotropic, taking place preferentially perpendicular to the halo minor axis, and, within this plane, preferentially along the halo major axis. The satellite entry points tend to be aligned with the present-day central galaxy disc and satellite plane, but to a lesser extent than with the halo shape. Dwarfs accreted in groups or along the richest filament have entry points that show an even larger degree of alignment with the host halo than the full satellite population. We also find that having most satellites accreted as a single group or along a single filament is unlikely to explain the MW disc of satellites.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tada, Kohei; Kashihara, Wataru; Baba, Masaaki
2014-11-14
Rotationally resolved high-resolution fluorescence excitation spectra of {sup 14}NO{sub 3} radical have been observed for the 662 nm band, which is assigned as the 0–0 band of the B{sup ~2}E′ ←X{sup ~2}A{sub 2}′ transition, by crossing a single-mode laser beam perpendicularly to a collimated molecular beam. More than 3000 rotational lines were detected in 15 070–15 145 cm{sup −1} region, but it is difficult to find the rotational line series. Remarkable rotational line pairs, whose interval is about 0.0246 cm{sup −1}, were found in the observed spectrum. This interval is the same amount with the spin-rotation splitting of the X{sup ~2}A{sub 2}′more » (υ = 0, k = 0, N = 1) level. From this interval and the observed Zeeman splitting up to 360 G, seven line pairs were assigned as the transitions to the {sup 2}E′{sub 3/2} (J′ = 1.5) levels and 15 line pairs were assigned as the transitions to the {sup 2}E′{sub 1/2} (J′ = 0.5) levels. From the rotational analysis, we recognized that the {sup 2}E′ state splits into {sup 2}E′{sub 3/2} and {sup 2}E′{sub 1/2} by the spin-orbit interaction and the effective spin-orbit interaction constant was roughly estimated as –21 cm{sup −1}. From the number of the rotational line pairs, we concluded that the complicated rotational structure of this 662 nm band of {sup 14}NO{sub 3} mainly owes to the vibronic interaction between the B{sup ~2}E′ state and the dark A{sup ~2}E″ state through the a{sub 2}″ symmetry vibrational mode.« less
An Interactive Program on Digitizing Historical Seismograms
NASA Astrophysics Data System (ADS)
Xu, Y.; Xu, T.
2013-12-01
Retrieving information from historical seismograms is of great importance since they are considered the unique sources that provide quantitative information of historical earthquakes. Modern techniques of seismology require digital forms of seismograms that are essentially a sequence of time-amplitude pairs. However, the historical seismograms, after scanned into computers, are two dimensional arrays. Each element of the arrays contains the grayscale value or RGB value of the corresponding pixel. The problem of digitizing historical seismograms, referred to as converting historical seismograms to digital seismograms, can be formulated as an inverse problem that generating sequences of time-amplitude pairs from a two dimension arrays. This problem has infinite solutions. The algorithm for automatic digitization of historical seismogram presented considers several features of seismograms, including continuity, smoothness of the seismic traces as the prior information, and assumes that the amplitude is a single-valued function of time. An interactive program based on the algorithm is also presented. The program is developed using Matlab GUI and has both automatic and manual modality digitization. Users can easily switch between them, and try different combinations to get the optimal results. Several examples are given to illustrate the results of digitizing seismograms using the program, including a photographic record and a wide-angle reflection/refraction seismogram. Digitized result of the program (redrawn using Golden Software Surfer for high resolution image). (a) shows the result of automatic digitization, and (b) is the result after manual correction.
Stereo and IMU-Assisted Visual Odometry for Small Robots
NASA Technical Reports Server (NTRS)
2012-01-01
This software performs two functions: (1) taking stereo image pairs as input, it computes stereo disparity maps from them by cross-correlation to achieve 3D (three-dimensional) perception; (2) taking a sequence of stereo image pairs as input, it tracks features in the image sequence to estimate the motion of the cameras between successive image pairs. A real-time stereo vision system with IMU (inertial measurement unit)-assisted visual odometry was implemented on a single 750 MHz/520 MHz OMAP3530 SoC (system on chip) from TI (Texas Instruments). Frame rates of 46 fps (frames per second) were achieved at QVGA (Quarter Video Graphics Array i.e. 320 240), or 8 fps at VGA (Video Graphics Array 640 480) resolutions, while simultaneously tracking up to 200 features, taking full advantage of the OMAP3530's integer DSP (digital signal processor) and floating point ARM processors. This is a substantial advancement over previous work as the stereo implementation produces 146 Mde/s (millions of disparities evaluated per second) in 2.5W, yielding a stereo energy efficiency of 58.8 Mde/J, which is 3.75 better than prior DSP stereo while providing more functionality.
Corresponding-states laws for protein solutions.
Katsonis, Panagiotis; Brandon, Simon; Vekilov, Peter G
2006-09-07
The solvent around protein molecules in solutions is structured and this structuring introduces a repulsion in the intermolecular interaction potential at intermediate separations. We use Monte Carlo simulations with isotropic, pair-additive systems interacting with such potentials. We test if the liquid-liquid and liquid-solid phase lines in model protein solutions can be predicted from universal curves and a pair of experimentally determined parameters, as done for atomic and colloid materials using several laws of corresponding states. As predictors, we test three properties at the critical point for liquid-liquid separation: temperature, as in the original van der Waals law, the second virial coefficient, and a modified second virial coefficient, all paired with the critical volume fraction. We find that the van der Waals law is best obeyed and appears more general than its original formulation: A single universal curve describes all tested nonconformal isotropic pair-additive systems. Published experimental data for the liquid-liquid equilibrium for several proteins at various conditions follow a single van der Waals curve. For the solid-liquid equilibrium, we find that no single system property serves as its predictor. We go beyond corresponding-states correlations and put forth semiempirical laws, which allow prediction of the critical temperature and volume fraction solely based on the range of attraction of the intermolecular interaction potential.
The Advanced Pair Telescope (APT) Mission Concept
NASA Technical Reports Server (NTRS)
Hunter, Stanley; Buckley, James H.
2008-01-01
We present a mission concept for the Advanced Pair Telescope (APT), a high-energy gamma-ray instrument with an order of magnitude improvement in sensitivity, 6 sr field of view, and angular resolution a factor of 3-10 times that of GLAST. With its very wide instantaneous field-of-view and large effective area, this instrument would be capable of detecting GRBs at very large redshifts, would enable a very high resolution study of SNRs and PWN, and could provide hour-scale temporal resolution of transients from many AGN and galactic sources. The APT instrument will consist of a Xe time-projection-chamber tracker that bridges the energy regime between Compton scattering and pair production and will provide an unprecedented improvement in angular resolution; a thick scintillating-fiber trackerlcalorimeter that will provide sensitivity and energy resolution to higher energies and will possess a factor of 10 improvement in geometric factor over GLAST; and an anticoincidence detector using scintillator-tiles to reject charged particles. After the anticipated 10-years of GLAST operation , the APT instrument would provide continued coverage of the critial high-energy gamma-ray band (between 30 MeV to 100 GeV), providing an essential component of broad-band multiwavelength studies of the high-energy universe.
Nick-free formation of reciprocal heteroduplexes: a simple solution to the topological problem.
Wilson, J H
1979-01-01
Because the individual strands of DNA are intertwined, formation of heteroduplex structures between duplexes--as in presumed recombination intermediates--presents a topological puzzle, known as the winding problem. Previous approaches to this problem have assumed that single-strand breaks are required to permit formation of fully coiled heteroduplexes. This paper describes a simple, nick-free solution to the winding problem that satisfies all topological constraints. Homologous duplexes associated by their minor-groove surfaces can switch strand pairing to form reciprocal heteroduplexes that coil together into a compact, four-stranded helix throughout the region of pairing. Model building shows that this fused heteroduplex structure is plausible, being composed entirely of right-handed primary helices with Watson-Crick base pairing throughout. Its simplicity of formation, structural symmetry, and high degree of specificity are suggestive of a natural mechanism for alignment by base pairing between intact homologous duplexes. Implications for genetic recombination are discussed. Images PMID:291028
Janssen, Patricia A; Keen, Lois; Soolsma, Jetty; Seymour, Laurie C; Harris, Susan J; Klein, Michael C; Reime, Birgit
2005-01-01
To evaluate the success of a competency-based nursing orientation programme for a single-room maternity care unit by measuring improvement in self-reported competency after six months. Single-room maternity care has challenged obstetrical nurses to provide comprehensive nursing care during all phases of the in-hospital birth experience. In this model, nurses provide intrapartum, postpartum and newborn care in one room. To date, an evaluation of nursing education for single-room maternity care has not been published. A prospective cohort design comparing self-reported competencies prior to starting work in the single-room maternity care and six months after. Nurses completed a competency-based education programme in which they could select from a menu of learning methods and content areas according to their individual needs. Learning methods included classroom lectures, self-paced learning packages, and preceptorships in the clinical area. Competencies were measured by a standardized perinatal self-efficacy tool and a tool developed by the authors for this study, the Single-Room Maternity Care Competency Tool. A paired analysis was undertaken to take into account the paired (before and after) nature of the design. Scores on the perinatal self-efficacy scale and the single-room maternity care competency tool were improved. These differences were statistically significant. Improvements in perinatal and single-room maternity care-specific competencies suggest that our education programme was successful in preparing nurses for their new role in the single-room maternity care setting. This conclusion is supported by reported increases in nursing and patient satisfaction in the single-room maternity care compared with the traditional labour/delivery and postpartum settings. An education programme tailored to the learning needs of experienced clinical nurses contributes to improvements in nursing competencies and patient care.
Grassani, Davide; Simbula, Angelica; Pirotta, Stefano; Galli, Matteo; Menotti, Matteo; Harris, Nicholas C; Baehr-Jones, Tom; Hochberg, Michael; Galland, Christophe; Liscidini, Marco; Bajoni, Daniele
2016-04-01
Compact silicon integrated devices, such as micro-ring resonators, have recently been demonstrated as efficient sources of quantum correlated photon pairs. The mass production of integrated devices demands the implementation of fast and reliable techniques to monitor the device performances. In the case of time-energy correlations, this is particularly challenging, as it requires high spectral resolution that is not currently achievable in coincidence measurements. Here we reconstruct the joint spectral density of photons pairs generated by spontaneous four-wave mixing in a silicon ring resonator by studying the corresponding stimulated process, namely stimulated four wave mixing. We show that this approach, featuring high spectral resolution and short measurement times, allows one to discriminate between nearly-uncorrelated and highly-correlated photon pairs.
NASA Astrophysics Data System (ADS)
Zhu, Aichun; Wang, Tian; Snoussi, Hichem
2018-03-01
This paper addresses the problems of the graphical-based human pose estimation in still images, including the diversity of appearances and confounding background clutter. We present a new architecture for estimating human pose using a Convolutional Neural Network (CNN). Firstly, a Relative Mixture Deformable Model (RMDM) is defined by each pair of connected parts to compute the relative spatial information in the graphical model. Secondly, a Local Multi-Resolution Convolutional Neural Network (LMR-CNN) is proposed to train and learn the multi-scale representation of each body parts by combining different levels of part context. Thirdly, a LMR-CNN based hierarchical model is defined to explore the context information of limb parts. Finally, the experimental results demonstrate the effectiveness of the proposed deep learning approach for human pose estimation.
Probing conformational dynamics by photoinduced electron transfer
NASA Astrophysics Data System (ADS)
Neuweiler, Hannes; Herten, Dirk P.; Marme, N.; Knemeyer, J. P.; Piestert, Oliver; Tinnefeld, Philip; Sauer, Marcus
2004-07-01
We demonstrate how photoinduced electron transfer (PET) reactions can be successfully applied to monitor conformational dynamics in individual biopolymers. Single-pair fluorescence resonance energy transfer (FRET) experiments are ideally suited to study conformational dynamics occurring on the nanometer scale, e.g. during protein folding or unfolding. In contrast, conformational dynamics with functional significance, for example occurring in enzymes at work, often appear on much smaller spatial scales of up to several Angströms. Our results demonstrate that selective PET-reactions between fluorophores and amino acids or DNA nucleotides represent a versatile tool to measure small-scale conformational dynamics in biopolymers on a wide range of time scales, extending from nanoseconds to seconds, at the single-molecule level under equilibrium conditions. That is, the monitoring of conformational dynamics of biopolymers with temporal resolutions comparable to those within reach using new techniques of molecular dynamic simulations. We present data about structural changes of single biomolecules like DNA hairpins and peptides by using quenching electron transfer reactions between guanosine or tryptophan residues in close proximity to fluorescent dyes. Furthermore, we demonstrate that the strong distance dependence of charge separation reactions on the sub-nanometer scale can be used to develop conformationally flexible PET-biosensors. These sensors enable the detection of specific target molecules in the sub-picomolar range and allow one to follow their molecular binding dynamics with temporal resolution.
Ionospheric modifications detected by a dense network of single frequency GNSS receivers
NASA Astrophysics Data System (ADS)
Mrak, S.; Semeter, J. L.
2017-12-01
It has been predicted that the region of totality during a total solar eclipse can launch atmospheric gravity waves with large enough amplitude to cause traveling ionospheric disturbances (TIDs). We report initial results from a remote sensing campaign involving a dense hybrid network of single- and dual-frequency GNSS receivers deployed underneath the 21 August 2017 solar eclipse. The campaign took place in central Missouri, involving 84 Trimble dual-frequency receivers, complemented by 2 additional 50 Hz dual-frequency receivers and 15 single-frequency receivers, together constructing 100 receivers with average mutual separation of less than 25 km and with a time resolution of 1 second or better. The initial results show a crescent shaped enhancement bulge in front of region of totality, extending all the way from Canada to Gulf of Mexico. In addition, in the path of totality is noticed a great depletion region, followed by a pair of transverse waves propagating in west-east direction. In the following months, we will explore the transition region carried by the totality by a virtue of hyper dense network of GNSS receivers with 1 second resolution. In addition to TEC data decomposition we will explore effects of the totality on the raw measurements (phase, code and signal intensity), and to the navigation solution which is likely to be effected by a different propagation conditions with respect to other days.
Chromosomal stasis in distinct families of marine Percomorpharia from South Atlantic.
Paim, Fabilene Gomes; Almeida, Leandro Aragão da Hora; Affonso, Paulo Roberto Antunes de Mello; Sobrinho-Scudeler, Patrícia Elda; Oliveira, Claudio; Diniz, Débora
2017-01-01
The weakness of physical barriers in the marine environment and the dispersal potential of fish populations have been invoked as explanations of the apparent karyotype stasis of marine Percomorpha, but several taxa remain poorly studied cytogenetically. To increase the chromosomal data in this fish group, we analyzed cytogenetically three widespread Atlantic species from distinct families: Chaetodipterus faber Broussonet, 1782 (Ephippidae), Lutjanus synagris Linnaeus, 1758 (Lutjanidae) and Rypticus randalli Courtenay, 1967 (Serranidae). The three species shared a karyotype composed of 2n=48 acrocentric chromosomes, single nucleolus organizer regions (NORs) and reduced amounts of centromeric heterochromatin. A single NOR-bearing pair was identified in all species by physical mapping of 18S rDNA while non-syntenic 5S rRNA genes were located at centromeric region of a single pair. The similar karyotypic macrostructure observed in unrelated groups of Percomorpharia reinforces the conservative karyoevolution of marine teleosteans. Nonetheless, the species could be differentiated based on the pair bearing ribosomal cistrons, revealing the importance of microstructural analyses in species with symmetric and stable karyotypes.
Fan, Hsiu-Fang; Cox, Michael M.; Li, Hung-Wen
2011-01-01
RecA recombinases play a central role in homologous recombination. Once assembled on single-stranded (ss) DNA, RecA nucleoprotein filaments mediate the pairing of homologous DNA sequences and strand exchange processes. We have designed two experiments based on tethered particle motion (TPM) to investigate the fates of the invading and the outgoing strands during E. coli RecA-mediated pairing and strand exchange at the single-molecule level in the absence of force. TPM experiments measure the tethered bead Brownian motion indicative of the DNA tether length change resulting from RecA binding and dissociation. Experiments with beads labeled on either the invading strand or the outgoing strand showed that DNA pairing and strand exchange occurs successfully in the presence of either ATP or its non-hydrolyzable analog, ATPγS. The strand exchange rates and efficiencies are similar under both ATP and ATPγS conditions. In addition, the Brownian motion time-courses suggest that the strand exchange process progresses uni-directionally in the 5′-to-3′ fashion, using a synapse segment with a wide and continuous size distribution. PMID:21765895
Domingo, Olwen; Hellmuth, Isabell; Jäschke, Andres; Kreutz, Christoph; Helm, Mark
2015-01-01
Propargyl groups are attractive functional groups for labeling purposes, as they allow CuAAC-mediated bioconjugation. Their size minimally exceeds that of a methyl group, the latter being frequent in natural nucleotide modifications. To understand under which circumstances propargyl-containing oligodeoxynucleotides preserve base pairing, we focused on the exocyclic amine of cytidine. Residues attached to the exocyclic N4 may orient away from or toward the Watson–Crick face, ensuing dramatic alteration of base pairing properties. ROESY-NMR experiments suggest a uniform orientation toward the Watson–Crick face of N4-propargyl residues in derivatives of both deoxycytidine and 5-methyl-deoxycytidine. In oligodeoxynucleotides, however, UV-melting indicated that N4-propargyl-deoxycytidine undergoes standard base pairing. This implies a rotation of the propargyl moiety toward the ‘CH’-edge as a result of base pairing on the Watson–Crick face. In oligonucleotides containing the corresponding 5-methyl-deoxycytidine derivative, dramatically reduced melting temperatures indicate impaired Watson–Crick base pairing. This was attributed to a steric clash of the propargyl moiety with the 5-methyl group, which prevents back rotation to the ‘CH’-edge, consequently preventing Watson–Crick geometry. Our results emphasize the tendency of an opposing nucleic acid strand to mechanically rotate single N4-substituents to make way for Watson–Crick base pairing, providing no steric hindrance is present on the ‘CH’-edge. PMID:25934805
High-resolution Myogenic Lineage Mapping by Single-Cell Mass Cytometry
Porpiglia, Ermelinda; Samusik, Nikolay; Ho, Andrew Tri Van; Cosgrove, Benjamin D.; Mai, Thach; Davis, Kara L.; Jager, Astraea; Nolan, Garry P.; Bendall, Sean C.; Fantl, Wendy J.; Blau, Helen M.
2017-01-01
Muscle regeneration is a dynamic process during which cell state and identity change over time. A major roadblock has been a lack of tools to resolve a myogenic progression in vivo. Here we capitalize on a transformative technology, single-cell mass cytometry (CyTOF), to identify in vivo skeletal muscle stem cell and previously unrecognized progenitor populations that precede differentiation. We discovered two cell surface markers, CD9 and CD104, whose combined expression enabled in vivo identification and prospective isolation of stem and progenitor cells. Data analysis using the X-shift algorithm paired with single-cell force directed layout visualization, defined a molecular signature of the activated stem cell state (CD44+/CD98+/MyoD+) and delineated a myogenic trajectory during recovery from acute muscle injury. Our studies uncover the dynamics of skeletal muscle regeneration in vivo and pave the way for the elucidation of the regulatory networks that underlie cell-state transitions in muscle diseases and aging. PMID:28414312
Absorption spectroscopy at the ultimate quantum limit from single-photon states
NASA Astrophysics Data System (ADS)
Whittaker, R.; Erven, C.; Neville, A.; Berry, M.; O'Brien, J. L.; Cable, H.; Matthews, J. C. F.
2017-02-01
Absorption spectroscopy is routinely used to characterise chemical and biological samples. For the state-of-the-art in laser absorption spectroscopy, precision is theoretically limited by shot-noise due to the fundamental Poisson-distribution of photon number in laser radiation. In practice, the shot-noise limit can only be achieved when all other sources of noise are eliminated. Here, we use wavelength-correlated and tuneable photon pairs to demonstrate how absorption spectroscopy can be performed with precision beyond the shot-noise limit and near the ultimate quantum limit by using the optimal probe for absorption measurement—single photons. We present a practically realisable scheme, which we characterise both the precision and accuracy of by measuring the response of a control feature. We demonstrate that the technique can successfully probe liquid samples and using two spectrally similar types of haemoglobin we show that obtaining a given precision in resolution requires fewer heralded single probe photons compared to using an idealised laser.
3D high- and super-resolution imaging using single-objective SPIM.
Galland, Remi; Grenci, Gianluca; Aravind, Ajay; Viasnoff, Virgile; Studer, Vincent; Sibarita, Jean-Baptiste
2015-07-01
Single-objective selective-plane illumination microscopy (soSPIM) is achieved with micromirrored cavities combined with a laser beam-steering unit installed on a standard inverted microscope. The illumination and detection are done through the same objective. soSPIM can be used with standard sample preparations and features high background rejection and efficient photon collection, allowing for 3D single-molecule-based super-resolution imaging of whole cells or cell aggregates. Using larger mirrors enabled us to broaden the capabilities of our system to image Drosophila embryos.
Single image super-resolution based on convolutional neural networks
NASA Astrophysics Data System (ADS)
Zou, Lamei; Luo, Ming; Yang, Weidong; Li, Peng; Jin, Liujia
2018-03-01
We present a deep learning method for single image super-resolution (SISR). The proposed approach learns end-to-end mapping between low-resolution (LR) images and high-resolution (HR) images. The mapping is represented as a deep convolutional neural network which inputs the LR image and outputs the HR image. Our network uses 5 convolution layers, which kernels size include 5×5, 3×3 and 1×1. In our proposed network, we use residual-learning and combine different sizes of convolution kernels at the same layer. The experiment results show that our proposed method performs better than the existing methods in reconstructing quality index and human visual effects on benchmarked images.
Ultrabright, narrow-band photon-pair source for atomic quantum memories
NASA Astrophysics Data System (ADS)
Tsai, Pin-Ju; Chen, Ying-Cheng
2018-06-01
We demonstrate an ultrabright, narrow-band and frequency-tunable photon-pair source based on cavity-enhanced spontaneous parametric down conversion (SPDC) which is compatible with atomic transition of rubidium D 2-line (780 nm) or cesium D 2-line (852 nm). With the pump beam alternating between a high and a low power phase, the output is switching between the optical parametric oscillator (OPO) and photon-pair generation mode. We utilize the OPO output light to lock the cavity length to maintain the double resonances of signal and idler, as well as to lock the signal frequency to cesium atomic transition. With a type-II phase matching and a double-passed pump scheme such that the cluster frequency spacing is larger than the SPDC bandwidth, the photon-pair output is in a nearly single-mode operation as confirmed by a scanning Fabry–Perot interferometer with its output detected by a photomultiplier. The achieved generation and detection rates are 7.24× {10}5 and 6142 s‑1 mW‑1, respectively. The correlation time of the photon pair is 21.6(2.2) ns, corresponding to a bandwidth of 2π × 6.6(6) MHz. The spectral brightness is 1.06× {10}5 s‑1 mW‑1 MHz‑1. This is a relatively high value under a single-mode operation with the cavity-SPDC scheme. The generated single photons can be readily used in experiments related to atomic quantum memories.
Structural and Biochemical Determinants of Ligand Binding by the c-di-GMP Riboswitch
DOE Office of Scientific and Technical Information (OSTI.GOV)
Smith, K.; Lipchock, S; Livingston,
2010-01-01
The bacterial second messenger c-di-GMP is used in many species to control essential processes that allow the organism to adapt to its environment. The c-di-GMP riboswitch (GEMM) is an important downstream target in this signaling pathway and alters gene expression in response to changing concentrations of c-di-GMP. The riboswitch selectively recognizes its second messenger ligand primarily through contacts with two critical nucleotides. However, these two nucleotides are not the most highly conserved residues within the riboswitch sequence. Instead, nucleotides that stack with c-di-GMP and that form tertiary RNA contacts are the most invariant. Biochemical and structural evidence reveals that themore » most common natural variants are able to make alternative pairing interactions with both guanine bases of the ligand. Additionally, a high-resolution (2.3 {angstrom}) crystal structure of the native complex reveals that a single metal coordinates the c-di-GMP backbone. Evidence is also provided that after transcription of the first nucleotide on the 3{prime}-side of the P1 helix, which is predicted to be the molecular switch, the aptamer is functional for ligand binding. Although large energetic effects occur when several residues in the RNA are altered, mutations at the most conserved positions, rather than at positions that base pair with c-di-GMP, have the most detrimental effects on binding. Many mutants retain sufficient c-di-GMP affinity for the RNA to remain biologically relevant, which suggests that this motif is quite resilient to mutation.« less
The Spectral and Environment Properties of z ∼ 2.0–2.5 Quasar Pairs
NASA Astrophysics Data System (ADS)
Lusso, Elisabeta; Fumagalli, Michele; Rafelski, Marc; Neeleman, Marcel; Prochaska, Jason X.; Hennawi, Joseph F.; O’Meara, John M.; Theuns, Tom
2018-06-01
We present the first results from our survey of intervening and proximate Lyman limit systems (LLSs) at z ∼ 2.0–2.5 using the Wide Field Camera 3 on board the Hubble Space Telescope. The quasars in our sample are projected pairs with proper transverse separations R ⊥ ≤ 150 kpc and line-of-sight velocity separations ≲11,000 km s‑1. We construct a stacked ultraviolet (rest-frame wavelengths 700–2000 Å) spectrum of pairs corrected for the intervening Lyman forest and Lyman continuum absorption. The observed spectral composite presents a moderate flux excess for the most prominent broad emission lines, a ∼30% decrease in flux at λ = 800–900 Å compared to a stack of brighter quasars not in pairs at similar redshifts, and lower values of the mean free path of the H I ionizing radiation for pairs ({λ }mfp}912 = 140.7 ± 20.2 {h}70-1 Mpc) compared to single quasars ({λ }mfp}912 = 213.8 ± 28 {h}70-1 Mpc) at the average redshift z ≃ 2.44. From the modeling of LLS absorption in these pairs, we find a higher (∼20%) incidence of proximate LLSs with log {N}{{H}{{I}}} ≥ 17.2 at δv < 5000 km s‑1 compared to single quasars (∼6%). These two rates are different at the 5σ level. Moreover, we find that optically thick absorbers are equally shared between foreground and background quasars. Based on these pieces of evidence, we conclude that there is a moderate excess of gas-absorbing Lyman continuum photons in our closely projected quasar pairs compared to single quasars. We argue that this gas arises mostly within large-scale structures or partially neutral regions inside the dark matter halos where these close pairs reside.
Binding of DNA hairpins to an assembler-strand as part of a primordial translation device
NASA Astrophysics Data System (ADS)
Baumann, Ulrich
1987-09-01
A crucial event in the process leading to the origin of life is the emergence of a simple translation device. To approach experimental realization of this device the binding ability of short DNA hairpins to complementary oligonucleotides fixed on a solid support was investigated. The binding is achieved by base pairing between the loop nucleotides of the hairpins containing different numbers of adenosine residues and oligothymidylates covalently linked to cellulose. The loop has to consist of at least five nucleotides to achieve binding. The exact number of established base pairs was determined in two ways. First, the elution temperatures of hairpins and those of oligoadenylates which had the length of the loop were compared. Secondly, the architecture of the loop was analyzed by means of the single-strand-specific nuclease from mung bean acting as structural probe. Onlyn-2 of n loop nucleotides of a hairpin are able to form base pairs. Therefore, a strong evidence for the formation of a triplet of base pairs between primeval tRNA and mRNA sufficient to stabilize the complex enzyme-free is given.
Brovarets', O O; Hovorun, D M
2010-01-01
A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*<---->Gua.Cyt<---->Gua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.
McDonald, A. D.; Jones, B. J. P.; Nygren, D. R.; ...
2018-03-26
A new method to tag the barium daughter in the double beta decay ofmore » $$^{136}$$Xe is reported. Using the technique of single molecule fluorescent imaging (SMFI), individual barium dication (Ba$$^{++}$$) resolution at a transparent scanning surface has been demonstrated. A single-step photo-bleach confirms the single ion interpretation. Individual ions are localized with super-resolution ($$\\sim$$2~nm), and detected with a statistical significance of 12.9~$$\\sigma$$ over backgrounds. This lays the foundation for a new and potentially background-free neutrinoless double beta decay technology, based on SMFI coupled to high pressure xenon gas time projection chambers.« less
Oikawa, Hiroyuki; Takahashi, Takumi; Kamonprasertsuk, Supawich; Takahashi, Satoshi
2018-01-31
Single-molecule (sm) fluorescence time series measurements based on the line confocal optical system are a powerful strategy for the investigation of the structure, dynamics, and heterogeneity of biological macromolecules. This method enables the detection of more than several thousands of fluorescence photons per millisecond from single fluorophores, implying that the potential time resolution for measurements of the fluorescence resonance energy transfer (FRET) efficiency is 10 μs. However, the necessity of using imaging photodetectors in the method limits the time resolution in the FRET efficiency measurements to approximately 100 μs. In this investigation, a new photodetector called a hybrid photodetector (HPD) was incorporated into the line confocal system to improve the time resolution without sacrificing the length of the time series detection. Among several settings examined, the system based on a slit width of 10 μm and a high-speed counting device made the best of the features of the line confocal optical system and the HPD. This method achieved a time resolution of 10 μs and an observation time of approximately 5 ms in the sm-FRET time series measurements. The developed device was used for the native state of the B domain of protein A.
Zou, Dong; Sun, Shixiang; Li, Rujiao; Liu, Jiang; Zhang, Jing; Zhang, Zhang
2015-01-01
DNA methylation plays crucial roles during embryonic development. Here we present MethBank (http://dnamethylome.org), a DNA methylome programming database that integrates the genome-wide single-base nucleotide methylomes of gametes and early embryos in different model organisms. Unlike extant relevant databases, MethBank incorporates the whole-genome single-base-resolution methylomes of gametes and early embryos at multiple different developmental stages in zebrafish and mouse. MethBank allows users to retrieve methylation levels, differentially methylated regions, CpG islands, gene expression profiles and genetic polymorphisms for a specific gene or genomic region. Moreover, it offers a methylome browser that is capable of visualizing high-resolution DNA methylation profiles as well as other related data in an interactive manner and thus is of great helpfulness for users to investigate methylation patterns and changes of gametes and early embryos at different developmental stages. Ongoing efforts are focused on incorporation of methylomes and related data from other organisms. Together, MethBank features integration and visualization of high-resolution DNA methylation data as well as other related data, enabling identification of potential DNA methylation signatures in different developmental stages and accordingly providing an important resource for the epigenetic and developmental studies. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Multiscale registration algorithm for alignment of meshes
NASA Astrophysics Data System (ADS)
Vadde, Srikanth; Kamarthi, Sagar V.; Gupta, Surendra M.
2004-03-01
Taking a multi-resolution approach, this research work proposes an effective algorithm for aligning a pair of scans obtained by scanning an object's surface from two adjacent views. This algorithm first encases each scan in the pair with an array of cubes of equal and fixed size. For each scan in the pair a surrogate scan is created by the centroids of the cubes that encase the scan. The Gaussian curvatures of points across the surrogate scan pair are compared to find the surrogate corresponding points. If the difference between the Gaussian curvatures of any two points on the surrogate scan pair is less than a predetermined threshold, then those two points are accepted as a pair of surrogate corresponding points. The rotation and translation values between the surrogate scan pair are determined by using a set of surrogate corresponding points. Using the same rotation and translation values the original scan pairs are aligned. The resulting registration (or alignment) error is computed to check the accuracy of the scan alignment. When the registration error becomes acceptably small, the algorithm is terminated. Otherwise the above process is continued with cubes of smaller and smaller sizes until the algorithm is terminated. However at each finer resolution the search space for finding the surrogate corresponding points is restricted to the regions in the neighborhood of the surrogate points that were at found at the preceding coarser level. The surrogate corresponding points, as the resolution becomes finer and finer, converge to the true corresponding points on the original scans. This approach offers three main benefits: it improves the chances of finding the true corresponding points on the scans, minimize the adverse effects of noise in the scans, and reduce the computational load for finding the corresponding points.
Entropy Beacon: A Hairpin-Free DNA Amplification Strategy for Efficient Detection of Nucleic Acids
2015-01-01
Here, we propose an efficient strategy for enzyme- and hairpin-free nucleic acid detection called an entropy beacon (abbreviated as Ebeacon). Different from previously reported DNA hybridization/displacement-based strategies, Ebeacon is driven forward by increases in the entropy of the system, instead of free energy released from new base-pair formation. Ebeacon shows high sensitivity, with a detection limit of 5 pM target DNA in buffer and 50 pM in cellular homogenate. Ebeacon also benefits from the hairpin-free amplification strategy and zero-background, excellent thermostability from 20 °C to 50 °C, as well as good resistance to complex environments. In particular, based on the huge difference between the breathing rate of a single base pair and two adjacent base pairs, Ebeacon also shows high selectivity toward base mutations, such as substitution, insertion, and deletion and, therefore, is an efficient nucleic acid detection method, comparable to most reported enzyme-free strategies. PMID:26505212
Zhang, Qi; Zeng, Xin; Younkin, Sam; Kawli, Trupti; Snyder, Michael P; Keleş, Sündüz
2016-02-24
Chromatin immunoprecipitation followed by sequencing (ChIP-seq) experiments revolutionized genome-wide profiling of transcription factors and histone modifications. Although maturing sequencing technologies allow these experiments to be carried out with short (36-50 bps), long (75-100 bps), single-end, or paired-end reads, the impact of these read parameters on the downstream data analysis are not well understood. In this paper, we evaluate the effects of different read parameters on genome sequence alignment, coverage of different classes of genomic features, peak identification, and allele-specific binding detection. We generated 101 bps paired-end ChIP-seq data for many transcription factors from human GM12878 and MCF7 cell lines. Systematic evaluations using in silico variations of these data as well as fully simulated data, revealed complex interplay between the sequencing parameters and analysis tools, and indicated clear advantages of paired-end designs in several aspects such as alignment accuracy, peak resolution, and most notably, allele-specific binding detection. Our work elucidates the effect of design on the downstream analysis and provides insights to investigators in deciding sequencing parameters in ChIP-seq experiments. We present the first systematic evaluation of the impact of ChIP-seq designs on allele-specific binding detection and highlights the power of pair-end designs in such studies.
Imaging the beating heart in the mouse using intravital microscopy techniques
Vinegoni, Claudio; Aguirre, Aaron D; Lee, Sungon; Weissleder, Ralph
2017-01-01
Real-time microscopic imaging of moving organs at single-cell resolution represents a major challenge in studying complex biology in living systems. Motion of the tissue from the cardiac and respiratory cycles severely limits intravital microscopy by compromising ultimate spatial and temporal imaging resolution. However, significant recent advances have enabled single-cell resolution imaging to be achieved in vivo. In this protocol, we describe experimental procedures for intravital microscopy based on a combination of thoracic surgery, tissue stabilizers and acquisition gating methods, which enable imaging at the single-cell level in the beating heart in the mouse. Setup of the model is typically completed in 1 h, which allows 2 h or more of continuous cardiac imaging. This protocol can be readily adapted for the imaging of other moving organs, and it will therefore broadly facilitate in vivo high-resolution microscopy studies. PMID:26492138
NASA Astrophysics Data System (ADS)
Kheymits, M. D.; Leonov, A. A.; Zverev, V. G.; Galper, A. M.; Arkhangelskaya, I. V.; Arkhangelskiy, A. I.; Suchkov, S. I.; Topchiev, N. P.; Yurkin, Yu T.; Bakaldin, A. V.; Dalkarov, O. D.
2016-02-01
The GAMMA-400 gamma-ray space-based telescope has as its main goals to measure cosmic γ-ray fluxes and the electron-positron cosmic-ray component produced, theoretically, in dark-matter-particles decay or annihilation processes, to search for discrete γ-ray sources and study them in detail, to examine the energy spectra of diffuse γ-rays — both galactic and extragalactic — and to study gamma-ray bursts (GRBs) and γ-rays from the active Sun. Scientific goals of GAMMA-400 telescope require fine angular resolution. The telescope is of a pair-production type. In the converter-tracker, the incident gamma-ray photon converts into electron-positron pair in the tungsten layer and then the tracks are detected by silicon- strip position-sensitive detectors. Multiple scattering processes become a significant obstacle in the incident-gamma direction reconstruction for energies below several gigaelectronvolts. The method of utilising this process to improve the resolution is proposed in the presented work.
Determination of the pairing-strength constants in the isovector plus isoscalar pairing case
NASA Astrophysics Data System (ADS)
Mokhtari, D.; Fellah, M.; Allal, N. H.
2016-05-01
A method for the determination of the pairing-strength constants, in the neutron-proton (n-p) isovector plus isoscalar pairing case, is proposed in the framework of the BCS theory. It is based on the fitting of these constants to reproduce the experimentally known pairing gap parameters as well as the root-mean-squared (r.m.s) charge radii values. The method is applied to some proton-rich even-even nuclei. The single-particle energies used are those of a deformed Woods-Saxon mean field. It is shown that the obtained value of the ratio GnpT=0/G npT=1 is of the same order as the ones, arbitrary chosen, of some previous works. The effect of the inclusion of the isoscalar n-p pairing in the r.m.s matter radii is then numerically studied for the same nuclei.
A NEW METHOD FOR FINDING POINT SOURCES IN HIGH-ENERGY NEUTRINO DATA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fang, Ke; Miller, M. Coleman
The IceCube collaboration has reported the first detection of high-energy astrophysical neutrinos, including ∼50 high-energy starting events, but no individual sources have been identified. It is therefore important to develop the most sensitive and efficient possible algorithms to identify the point sources of these neutrinos. The most popular current method works by exploring a dense grid of possible directions to individual sources, and identifying the single direction with the maximum probability of having produced multiple detected neutrinos. This method has numerous strengths, but it is computationally intensive and because it focuses on the single best location for a point source,more » additional point sources are not included in the evidence. We propose a new maximum likelihood method that uses the angular separations between all pairs of neutrinos in the data. Unlike existing autocorrelation methods for this type of analysis, which also use angular separations between neutrino pairs, our method incorporates information about the point-spread function and can identify individual point sources. We find that if the angular resolution is a few degrees or better, then this approach reduces both false positive and false negative errors compared to the current method, and is also more computationally efficient up to, potentially, hundreds of thousands of detected neutrinos.« less
NASA Astrophysics Data System (ADS)
Sargent, Garrett C.; Ratliff, Bradley M.; Asari, Vijayan K.
2017-08-01
The advantage of division of focal plane imaging polarimeters is their ability to obtain temporally synchronized intensity measurements across a scene; however, they sacrifice spatial resolution in doing so due to their spatially modulated arrangement of the pixel-to-pixel polarizers and often result in aliased imagery. Here, we propose a super-resolution method based upon two previously trained extreme learning machines (ELM) that attempt to recover missing high frequency and low frequency content beyond the spatial resolution of the sensor. This method yields a computationally fast and simple way of recovering lost high and low frequency content from demosaicing raw microgrid polarimetric imagery. The proposed method outperforms other state-of-the-art single-image super-resolution algorithms in terms of structural similarity and peak signal-to-noise ratio.
NASA Astrophysics Data System (ADS)
Preibisch, Stephan; Rohlfing, Torsten; Hasak, Michael P.; Tomancak, Pavel
2008-03-01
Single Plane Illumination Microscopy (SPIM; Huisken et al., Nature 305(5686):1007-1009, 2004) is an emerging microscopic technique that enables live imaging of large biological specimens in their entirety. By imaging the living biological sample from multiple angles SPIM has the potential to achieve isotropic resolution throughout even relatively large biological specimens. For every angle, however, only a relatively shallow section of the specimen is imaged with high resolution, whereas deeper regions appear increasingly blurred. In order to produce a single, uniformly high resolution image, we propose here an image mosaicing algorithm that combines state of the art groupwise image registration for alignment with content-based image fusion to prevent degrading of the fused image due to regional blurring of the input images. For the registration stage, we introduce an application-specific groupwise transformation model that incorporates per-image as well as groupwise transformation parameters. We also propose a new fusion algorithm based on Gaussian filters, which is substantially faster than fusion based on local image entropy. We demonstrate the performance of our mosaicing method on data acquired from living embryos of the fruit fly, Drosophila, using four and eight angle acquisitions.
Femtosecond profiling of shaped x-ray pulses
NASA Astrophysics Data System (ADS)
Hoffmann, M. C.; Grguraš, I.; Behrens, C.; Bostedt, C.; Bozek, J.; Bromberger, H.; Coffee, R.; Costello, J. T.; DiMauro, L. F.; Ding, Y.; Doumy, G.; Helml, W.; Ilchen, M.; Kienberger, R.; Lee, S.; Maier, A. R.; Mazza, T.; Meyer, M.; Messerschmidt, M.; Schorb, S.; Schweinberger, W.; Zhang, K.; Cavalieri, A. L.
2018-03-01
Arbitrary manipulation of the temporal and spectral properties of x-ray pulses at free-electron lasers would revolutionize many experimental applications. At the Linac Coherent Light Source at Stanford National Accelerator Laboratory, the momentum phase-space of the free-electron laser driving electron bunch can be tuned to emit a pair of x-ray pulses with independently variable photon energy and femtosecond delay. However, while accelerator parameters can easily be adjusted to tune the electron bunch phase-space, the final impact of these actuators on the x-ray pulse cannot be predicted with sufficient precision. Furthermore, shot-to-shot instabilities that distort the pulse shape unpredictably cannot be fully suppressed. Therefore, the ability to directly characterize the x-rays is essential to ensure precise and consistent control. In this work, we have generated x-ray pulse pairs via electron bunch shaping and characterized them on a single-shot basis with femtosecond resolution through time-resolved photoelectron streaking spectroscopy. This achievement completes an important step toward future x-ray pulse shaping techniques.
Assembling short reads from jumping libraries with large insert sizes.
Vasilinetc, Irina; Prjibelski, Andrey D; Gurevich, Alexey; Korobeynikov, Anton; Pevzner, Pavel A
2015-10-15
Advances in Next-Generation Sequencing technologies and sample preparation recently enabled generation of high-quality jumping libraries that have a potential to significantly improve short read assemblies. However, assembly algorithms have to catch up with experimental innovations to benefit from them and to produce high-quality assemblies. We present a new algorithm that extends recently described exSPAnder universal repeat resolution approach to enable its applications to several challenging data types, including jumping libraries generated by the recently developed Illumina Nextera Mate Pair protocol. We demonstrate that, with these improvements, bacterial genomes often can be assembled in a few contigs using only a single Nextera Mate Pair library of short reads. Described algorithms are implemented in C++ as a part of SPAdes genome assembler, which is freely available at bioinf.spbau.ru/en/spades. ap@bioinf.spbau.ru Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Plaçais, Pierre-Yves; Trannoy, Séverine; Friedrich, Anja B; Tanimoto, Hiromu; Preat, Thomas
2013-11-14
One of the challenges facing memory research is to combine network- and cellular-level descriptions of memory encoding. In this context, Drosophila offers the opportunity to decipher, down to single-cell resolution, memory-relevant circuits in connection with the mushroom bodies (MBs), prominent structures for olfactory learning and memory. Although the MB-afferent circuits involved in appetitive learning were recently described, the circuits underlying appetitive memory retrieval remain unknown. We identified two pairs of cholinergic neurons efferent from the MB α vertical lobes, named MB-V3, that are necessary for the retrieval of appetitive long-term memory (LTM). Furthermore, LTM retrieval was correlated to an enhanced response to the rewarded odor in these neurons. Strikingly, though, silencing the MB-V3 neurons did not affect short-term memory (STM) retrieval. This finding supports a scheme of parallel appetitive STM and LTM processing. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Small Rad51 and Dmc1 Complexes Often Co-occupy Both Ends of a Meiotic DNA Double Strand Break
Brown, M. Scott; Grubb, Jennifer; Zhang, Annie; Rust, Michael J.; Bishop, Douglas K.
2015-01-01
The Eukaryotic RecA-like proteins Rad51 and Dmc1 cooperate during meiosis to promote recombination between homologous chromosomes by repairing programmed DNA double strand breaks (DSBs). Previous studies showed that Rad51 and Dmc1 form partially overlapping co-foci. Here we show these Rad51-Dmc1 co-foci are often arranged in pairs separated by distances of up to 400 nm. Paired co-foci remain prevalent when DSBs are dramatically reduced or when strand exchange or synapsis is blocked. Super-resolution dSTORM microscopy reveals that individual foci observed by conventional light microscopy are often composed of two or more substructures. The data support a model in which the two tracts of ssDNA formed by a single DSB separate from one another by distances of up to 400 nm, with both tracts often bound by one or more short (about 100 nt) Rad51 filaments and also by one or more short Dmc1 filaments. PMID:26719980
Multi-Element CZT Array for Nuclear Safeguards Applications
NASA Astrophysics Data System (ADS)
Kwak, S.-W.; Lee, A.-R.; Shin, J.-K.; Park, U.-R.; Park, S.; Kim, Y.; Chung, H.
2016-12-01
Due to its electronic properties, a cadmium zinc telluride (CZT) detector has been used as a hand-held portable nuclear measurement instrument. However, a CZT detector has low detection efficiency because of a limitation of its single crystal growth. To address its low efficiency, we have constructed a portable four-CZT array based gamma-ray spectrometer consisting of a CZT array, electronics for signal processing and software. Its performance has been characterized in terms of energy resolution and detection efficiency using radioactive sources and nuclear materials. Experimental results showed that the detection efficiency of the four-CZT array based gamma-ray spectrometer was much higher than that of a single CZT detector in the array. The FWHMs of the CZT array were 9, 18, and 21 keV at 185.7, 662, and 1,332 keV, respectively. Some gamma-rays in a range of 100 keV to 200 keV were not clear in a single crystal detector while those from the CZT array system were observed to be clear. The energy resolution of the CZT array system was only slightely worse than those of the single CZT detectors. By combining several single crystals and summing signals from each single detector at a digital electronic circuit, the detection efficiency of a CZT array system increased without degradation of its energy resolution. The technique outlined in this paper shows a very promising method for designing a CZT-based gamma-ray spectroscopy that overcomes the fundamental limitations of a small volume CZT detector.
Targeting excited states in all-trans polyenes with electron-pair states.
Boguslawski, Katharina
2016-12-21
Wavefunctions restricted to electron pair states are promising models for strongly correlated systems. Specifically, the pair Coupled Cluster Doubles (pCCD) ansatz allows us to accurately describe bond dissociation processes and heavy-element containing compounds with multiple quasi-degenerate single-particle states. Here, we extend the pCCD method to model excited states using the equation of motion (EOM) formalism. As the cluster operator of pCCD is restricted to electron-pair excitations, EOM-pCCD allows us to target excited electron-pair states only. To model singly excited states within EOM-pCCD, we modify the configuration interaction ansatz of EOM-pCCD to contain also single excitations. Our proposed model represents a simple and cost-effective alternative to conventional EOM-CC methods to study singly excited electronic states. The performance of the excited state models is assessed against the lowest-lying excited states of the uranyl cation and the two lowest-lying excited states of all-trans polyenes. Our numerical results suggest that EOM-pCCD including single excitations is a good starting point to target singly excited states.
Superresolution Imaging using Single-Molecule Localization
Patterson, George; Davidson, Michael; Manley, Suliana; Lippincott-Schwartz, Jennifer
2013-01-01
Superresolution imaging is a rapidly emerging new field of microscopy that dramatically improves the spatial resolution of light microscopy by over an order of magnitude (∼10–20-nm resolution), allowing biological processes to be described at the molecular scale. Here, we discuss a form of superresolution microscopy based on the controlled activation and sampling of sparse subsets of photoconvertible fluorescent molecules. In this single-molecule based imaging approach, a wide variety of probes have proved valuable, ranging from genetically encodable photoactivatable fluorescent proteins to photoswitchable cyanine dyes. These have been used in diverse applications of superresolution imaging: from three-dimensional, multicolor molecule localization to tracking of nanometric structures and molecules in living cells. Single-molecule-based superresolution imaging thus offers exciting possibilities for obtaining molecular-scale information on biological events occurring at variable timescales. PMID:20055680
The spatial extent and distribution of star formation in 3D-HST mergers at z ˜ 1.5
NASA Astrophysics Data System (ADS)
Schmidt, Kasper B.; Rix, Hans-Walter; da Cunha, Elisabete; Brammer, Gabriel B.; Cox, Thomas J.; van Dokkum, Pieter; Förster Schreiber, Natascha M.; Franx, Marijn; Fumagalli, Mattia; Jonsson, Patrik; Lundgren, Britt; Maseda, Michael V.; Momcheva, Ivelina; Nelson, Erica J.; Skelton, Rosalind E.; van der Wel, Arjen; Whitaker, Katherine E.
2013-06-01
We present an analysis of the spatial distribution of star formation in a sample of 60 visually identified galaxy merger candidates at z > 1. Our sample, drawn from the 3D-HST survey, is flux limited and was selected to have high star formation rates based on fits of their broad-band, low spatial resolution spectral energy distributions. It includes plausible pre-merger (close pairs) and post-merger (single objects with tidal features) systems, with total stellar masses and star formation rates derived from multiwavelength photometry. Here we use near-infrared slitless spectra from 3D-HST which produce Hα or [O III] emission line maps as proxies for star formation maps. This provides a first comprehensive high-resolution, empirical picture of where star formation occurred in galaxy mergers at the epoch of peak cosmic star formation rate. We find that detectable star formation can occur in one or both galaxy centres, or in tidal tails. The most common case (58 per cent) is that star formation is largely concentrated in a single, compact region, coincident with the centre of (one of) the merger components. No correlations between star formation morphology and redshift, total stellar mass or star formation rate are found. A restricted set of hydrodynamical merger simulations between similarly massive and gas-rich objects implies that star formation should be detectable in both merger components, when the gas fractions of the individual components are the same. This suggests that z ˜ 1.5 mergers typically occur between galaxies whose gas fractions, masses and/or star formation rates are distinctly different from one another.
The Spatial Extent and Distribution of Star Formation in 3D-HST Mergers at z is approximately 1.5
NASA Technical Reports Server (NTRS)
Schmidt, Kasper B.; Rix, Hans-Walter; da Cunha, Elisabete; Brammer, Gabriel B.; Cox, Thomas J.; Van Dokkum, Pieter; Foerster Schreiber, Natascha M.; Franx, Marijn; Fumagalli, Mattia; Jonsson, Patrik;
2013-01-01
We present an analysis of the spatial distribution of star formation in a sample of 60 visually identified galaxy merger candidates at z greater than 1. Our sample, drawn from the 3D-HST survey, is flux-limited and was selected to have high star formation rates based on fits of their broad-band, low spatial resolution spectral energy distributions. It includes plausible pre-merger (close pairs) and post-merger (single objects with tidal features) systems,with total stellar masses and star formation rates derived from multi-wavelength photometry. Here we use near-infrared slitless spectra from 3D-HST which produce H or [OIII] emission line maps as proxies for star-formation maps. This provides a first comprehensive high-resolution, empirical picture of where star formation occurred in galaxy mergers at the epoch of peak cosmic star formation rate. We find that detectable star formation can occur in one or both galaxy centres, or in tidal tails. The most common case (58%) is that star formation is largely concentrated in a single, compact region, coincident with the centre of (one of) the merger components. No correlations between star formation morphology and redshift, total stellar mass, or star formation rate are found. A restricted set of hydrodynamical merger simulationsbetween similarly massive and gas-rich objects implies that star formation should be detectable in both merger components, when the gas fractions of the individual components are the same. This suggests that z is approximately 1.5 mergers typically occur between galaxies whose gas fractions, masses, andor star formation rates are distinctly different from one another.
Ilev, Ilko; Waynant, Ronald; Gannot, Israel; Gandjbakhche, Amir
2007-09-01
A novel fiber-optic confocal approach for ultrahigh depth-resolution (
NASA Astrophysics Data System (ADS)
Iyer, Vijay; Saggau, Peter
2003-10-01
In laser-scanning microscopy, acousto-optic (AO) deflection provides a means to quickly position a laser beam to random locations throughout the field-of-view. Compared to conventional laser-scanning using galvanometer-driven mirrors, this approach increases the frame rate and signal-to-noise ratio, and reduces time spent illuminating sites of no interest. However, random-access AO scanning has not yet been combined with multi-photon microscopy, primarily because the femtosecond laser pulses employed are subject to significant amounts of both spatial and temporal dispersion upon propagation through common AO materials. Left uncompensated, spatial dispersion reduces the microscope"s spatial resolution while temporal dispersion reduces the multi-photon excitation efficacy. In previous work, we have demonstrated, 1) the efficacy of a single diffraction grating scheme which reduces the spatial dispersion at least 3-fold throughout the field-of-view, and 2) the use of a novel stacked-prism pre-chirper for compensating the temporal dispersion of a pair of AODs using a shorter mechanical path length (2-4X) than standard prism-pair arrangements. In this work, we demonstrate for the first time the use of these compensation approaches with a custom-made large-area slow-shear TeO2 AOD specifically suited for the development of a high-resolution 2-D random-access AO scanning multi-photon laser-scanning microscope (AO-MPLSM).
Abdallah, Abdallah M.; Hill-Cawthorne, Grant A.; Otto, Thomas D.; Coll, Francesc; Guerra-Assunção, José Afonso; Gao, Ge; Naeem, Raeece; Ansari, Hifzur; Malas, Tareq B.; Adroub, Sabir A.; Verboom, Theo; Ummels, Roy; Zhang, Huoming; Panigrahi, Aswini Kumar; McNerney, Ruth; Brosch, Roland; Clark, Taane G.; Behr, Marcel A.; Bitter, Wilbert; Pain, Arnab
2015-01-01
Although Bacillus Calmette-Guérin (BCG) vaccines against tuberculosis have been available for more than 90 years, their effectiveness has been hindered by variable protective efficacy and a lack of lasting memory responses. One factor contributing to this variability may be the diversity of the BCG strains that are used around the world, in part from genomic changes accumulated during vaccine production and their resulting differences in gene expression. We have compared the genomes and transcriptomes of a global collection of fourteen of the most widely used BCG strains at single base-pair resolution. We have also used quantitative proteomics to identify key differences in expression of proteins across five representative BCG strains of the four tandem duplication (DU) groups. We provide a comprehensive map of single nucleotide polymorphisms (SNPs), copy number variation and insertions and deletions (indels) across fourteen BCG strains. Genome-wide SNP characterization allowed the construction of a new and robust phylogenic genealogy of BCG strains. Transcriptional and proteomic profiling revealed a metabolic remodeling in BCG strains that may be reflected by altered immunogenicity and possibly vaccine efficacy. Together, these integrated-omic data represent the most comprehensive catalogue of genetic variation across a global collection of BCG strains. PMID:26487098
The architecture of the spliceosomal U4/U6.U5 tri-snRNP
Nguyen, Thi Hoang Duong; Galej, Wojciech P.; Bai, Xiao-chen; Savva, Christos G.; Newman, Andrew J.; Scheres, Sjors H. W.; Nagai, Kiyoshi
2015-01-01
U4/U6.U5 tri-snRNP is a 1.5 MDa pre-assembled spliceosomal complex comprising U5 snRNA, extensively base-paired U4/U6 snRNAs and >30 proteins, including the key components Prp8, Brr2 and Snu114. The tri-snRNP combines with a pre-mRNA substrate bound to U1 and U2 snRNPs and transforms into a catalytically active spliceosome following extensive compositional and conformational changes triggered by unwinding of the U4/U6 snRNAs. CryoEM single-particle reconstruction of yeast tri-snRNP at 5.9Å resolution reveals the essentially complete organization of its RNA and protein components. The single-stranded region of U4 snRNA between its 3′-stem-loop and the U4/U6 snRNA stem I is loaded into the Brr2 helicase active site ready for unwinding. Snu114 and the N-terminal domain of Prp8 position U5 snRNA to insert its Loop I, which aligns the exons for splicing, into the Prp8 active site cavity. The structure provides crucial insights into the activation process and the active site of the spliceosome. PMID:26106855
NASA Astrophysics Data System (ADS)
Li, Jiqin; Bao, Zhenmin; Li, Ling; Wang, Xiaojian; Wang, Shi; Hu, Xiaoli
2013-09-01
Zhikong scallop ( Chlamys farreri) is an important maricultured species in China. Many researches on this species, such as population genetics and QTL fine-mapping, need a large number of molecular markers. In this study, based on the expressed sequence tags (EST), a total of 300 putative single nucleotide polymorphisms (SNPs) were selected and validated using high resolution melting (HRM) technology with unlabeled probe. Of them, 101 (33.7%) were found to be polymorphic in 48 individuals from 4 populations. Further evaluation with 48 individuals from Qingdao population showed that all the polymorphic loci had two alleles with the minor allele frequency ranged from 0.046 to 0.500. The observed and expected heterozygosities ranged from 0.000 to 0.925 and from 0.089 to 0.505, respectively. Fifteen loci deviated significantly from Hardy-Weinberg equilibrium and significant linkage disequilibrate was detected in one pair of markers. BLASTx gave significant hits for 72 of the 101 polymorphic SNP-containing ESTs. Thirty four polymorphic SNP loci were predicted to be non-synonymous substitutions as they caused either the change of codons (33 SNPs) or pretermination of translation (1 SNP). The markers developed can be used for the population studies and genetic improvement on Zhikong scallop.
Analysis of practical backoff protocols for contention resolution with multiple servers
DOE Office of Scientific and Technical Information (OSTI.GOV)
Goldberg, L.A.; MacKenzie, P.D.
Backoff protocols are probably the most widely used protocols for contention resolution in multiple access channels. In this paper, we analyze the stochastic behavior of backoff protocols for contention resolution among a set of clients and servers, each server being a multiple access channel that deals with contention like an Ethernet channel. We use the standard model in which each client generates requests for a given server according to a Bemoulli distribution with a specified mean. The client-server request rate of a system is the maximum over all client-server pairs (i, j) of the sum of all request rates associatedmore » with either client i or server j. Our main result is that any superlinear polynomial backoff protocol is stable for any multiple-server system with a sub-unit client-server request rate. We confirm the practical relevance of our result by demonstrating experimentally that the average waiting time of requests is very small when such a system is run with reasonably few clients and reasonably small request rates such as those that occur in actual ethernets. Our result is the first proof of stability for any backoff protocol for contention resolution with multiple servers. Our result is also the first proof that any weakly acknowledgment based protocol is stable for contention resolution with multiple servers and such high request rates. Two special cases of our result are of interest. Hastad, Leighton and Rogoff have shown that for a single-server system with a sub-unit client-server request rate any modified superlinear polynomial backoff protocol is stable. These modified backoff protocols are similar to standard backoff protocols but require more random bits to implement. The special case of our result in which there is only one server extends the result of Hastad, Leighton and Rogoff to standard (practical) backoff protocols. Finally, our result applies to dynamic routing in optical networks.« less
Yagi, Kiyoshi; Otaki, Hiroki
2014-02-28
A perturbative extension to optimized coordinate vibrational self-consistent field (oc-VSCF) is proposed based on the quasi-degenerate perturbation theory (QDPT). A scheme to construct the degenerate space (P space) is developed, which incorporates degenerate configurations and alleviates the divergence of perturbative expansion due to localized coordinates in oc-VSCF (e.g., local O-H stretching modes of water). An efficient configuration selection scheme is also implemented, which screens out the Hamiltonian matrix element between the P space configuration (p) and the complementary Q space configuration (q) based on a difference in their quantum numbers (λpq = ∑s|ps - qs|). It is demonstrated that the second-order vibrational QDPT based on optimized coordinates (oc-VQDPT2) smoothly converges with respect to the order of the mode coupling, and outperforms the conventional one based on normal coordinates. Furthermore, an improved, fast algorithm is developed for optimizing the coordinates. First, the minimization of the VSCF energy is conducted in a restricted parameter space, in which only a portion of pairs of coordinates is selectively transformed. A rational index is devised for this purpose, which identifies the important coordinate pairs to mix from others that may remain unchanged based on the magnitude of harmonic coupling induced by the transformation. Second, a cubic force field (CFF) is employed in place of a quartic force field, which bypasses intensive procedures that arise due to the presence of the fourth-order force constants. It is found that oc-VSCF based on CFF together with the pair selection scheme yields the coordinates similar in character to the conventional ones such that the final vibrational energy is affected very little while gaining an order of magnitude acceleration. The proposed method is applied to ethylene and trans-1,3-butadiene. An accurate, multi-resolution potential, which combines the MP2 and coupled-cluster with singles, doubles, and perturbative triples level of electronic structure theory, is generated and employed in the oc-VQDPT2 calculation to obtain the fundamental tones as well as selected overtones/combination tones coupled to the fundamentals through the Fermi resonance. The calculated frequencies of ethylene and trans-1,3-butadiene are found to be in excellent agreement with the experimental values with a mean absolute error of 8 and 9 cm(-1), respectively.
A curved RNA helix incorporating an internal loop with G·A and A·A non-Watson–Crick base pairing
Baeyens, Katrien J.; De Bondt, Hendrik L.; Pardi, Arthur; Holbrook, Stephen R.
1996-01-01
The crystal structure of the RNA dodecamer 5′-GGCC(GAAA)GGCC-3′ has been determined from x-ray diffraction data to 2.3-Å resolution. In the crystal, these oligomers form double helices around twofold symmetry axes. Four consecutive non-Watson–Crick base pairs make up an internal loop in the middle of the duplex, including sheared G·A pairs and novel asymmetric A·A pairs. This internal loop sequence produces a significant curvature and narrowing of the double helix. The helix is curved by 34° from end to end and the diameter is narrowed by 24% in the internal loop. A Mn2+ ion is bound directly to the N7 of the first guanine in the Watson–Crick region following the internal loop and the phosphate of the preceding residue. This Mn2+ location corresponds to a metal binding site observed in the hammerhead catalytic RNA. PMID:8917508
Imaging whole Escherichia coli bacteria by using single-particle x-ray diffraction
NASA Astrophysics Data System (ADS)
Miao, Jianwei; Hodgson, Keith O.; Ishikawa, Tetsuya; Larabell, Carolyn A.; Legros, Mark A.; Nishino, Yoshinori
2003-01-01
We report the first experimental recording, to our knowledge, of the diffraction pattern from intact Escherichia coli bacteria using coherent x-rays with a wavelength of 2 Å. By using the oversampling phasing method, a real space image at a resolution of 30 nm was directly reconstructed from the diffraction pattern. An R factor used for characterizing the quality of the reconstruction was in the range of 5%, which demonstrated the reliability of the reconstruction process. The distribution of proteins inside the bacteria labeled with manganese oxide has been identified and this distribution confirmed by fluorescence microscopy images. Compared with lens-based microscopy, this diffraction-based imaging approach can examine thicker samples, such as whole cultured cells, in three dimensions with resolution limited only by radiation damage. Looking forward, the successful recording and reconstruction of diffraction patterns from biological samples reported here represent an important step toward the potential of imaging single biomolecules at near-atomic resolution by combining single-particle diffraction with x-ray free electron lasers.
Ristanović, Zoran; Kerssens, Marleen M; Kubarev, Alexey V; Hendriks, Frank C; Dedecker, Peter; Hofkens, Johan; Roeffaers, Maarten B J; Weckhuysen, Bert M
2015-02-02
Fluid catalytic cracking (FCC) is a major process in oil refineries to produce gasoline and base chemicals from crude oil fractions. The spatial distribution and acidity of zeolite aggregates embedded within the 50-150 μm-sized FCC spheres heavily influence their catalytic performance. Single-molecule fluorescence-based imaging methods, namely nanometer accuracy by stochastic chemical reactions (NASCA) and super-resolution optical fluctuation imaging (SOFI) were used to study the catalytic activity of sub-micrometer zeolite ZSM-5 domains within real-life FCC catalyst particles. The formation of fluorescent product molecules taking place at Brønsted acid sites was monitored with single turnover sensitivity and high spatiotemporal resolution, providing detailed insight in dispersion and catalytic activity of zeolite ZSM-5 aggregates. The results point towards substantial differences in turnover frequencies between the zeolite aggregates, revealing significant intraparticle heterogeneities in Brønsted reactivity. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kowal, Ewa A.; Ganguly, Manjori; Pallan, Pradeep S.
As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2'-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson-Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C-H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 {angstrom} resolution in the presence of Mg{sup 2+}. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry andmore » the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA.« less
2011-01-01
As part of an ongoing effort to explore the effect of major groove electrostatics on the thermodynamic stability and structure of DNA, a 7-deaza-2′-deoxyadenosine:dT (7-deaza-dA:dT) base pair in the Dickerson–Drew dodecamer (DDD) was studied. The removal of the electronegative N7 atom on dA and the replacement with an electropositive C–H in the major groove was expected to have a significant effect on major groove electrostatics. The structure of the 7-deaza-dA:dT base pair was determined at 1.1 Å resolution in the presence of Mg2+. The 7-deaza-dA, which is isosteric for dA, had minimal effect on the base pairing geometry and the conformation of the DDD in the crystalline state. There was no major groove cation association with the 7-deaza-dA heterocycle. In solution, circular dichroism showed a positive Cotton effect centered at 280 nm and a negative Cotton effect centered at 250 nm that were characteristic of a right-handed helix in the B-conformation. However, temperature-dependent NMR studies showed increased exchange between the thymine N3 imino proton of the 7-deaza-dA:dT base pair and water, suggesting reduced stacking interactions and an increased rate of base pair opening. This correlated with the observed thermodynamic destabilization of the 7-deaza-dA modified duplex relative to the DDD. A combination of UV melting and differential scanning calorimetry experiments were conducted to evaluate the relative contributions of enthalpy and entropy in the thermodynamic destabilization of the DDD. The most significant contribution arose from an unfavorable enthalpy term, which probably results from less favorable stacking interactions in the modified duplex, which was accompanied by a significant reduction in the release of water and cations from the 7-deaza-dA modified DNA. PMID:22059929
Predictive spectroscopy and chemical imaging based on novel optical systems
NASA Astrophysics Data System (ADS)
Nelson, Matthew Paul
1998-10-01
This thesis describes two futuristic optical systems designed to surpass contemporary spectroscopic methods for predictive spectroscopy and chemical imaging. These systems are advantageous to current techniques in a number of ways including lower cost, enhanced portability, shorter analysis time, and improved S/N. First, a novel optical approach to predicting chemical and physical properties based on principal component analysis (PCA) is proposed and evaluated. A regression vector produced by PCA is designed into the structure of a set of paired optical filters. Light passing through the paired filters produces an analog detector signal directly proportional to the chemical/physical property for which the regression vector was designed. Second, a novel optical system is described which takes a single-shot approach to chemical imaging with high spectroscopic resolution using a dimension-reduction fiber-optic array. Images are focused onto a two- dimensional matrix of optical fibers which are drawn into a linear distal array with specific ordering. The distal end is imaged with a spectrograph equipped with an ICCD camera for spectral analysis. Software is used to extract the spatial/spectral information contained in the ICCD images and deconvolute them into wave length-specific reconstructed images or position-specific spectra which span a multi-wavelength space. This thesis includes a description of the fabrication of two dimension-reduction arrays as well as an evaluation of the system for spatial and spectral resolution, throughput, image brightness, resolving power, depth of focus, and channel cross-talk. PCA is performed on the images by treating rows of the ICCD images as spectra and plotting the scores of each PC as a function of reconstruction position. In addition, iterative target transformation factor analysis (ITTFA) is performed on the spectroscopic images to generate ``true'' chemical maps of samples. Univariate zero-order images, univariate first-order spectroscopic images, bivariate first-order spectroscopic images, and multivariate first-order spectroscopic images of the temporal development of laser-induced plumes are presented and interpreted. Reconstructed chemical images generated using bivariate and trivariate wavelength techniques, bimodal and trimodal PCA methods, and bimodal and trimodal ITTFA approaches are also included.
Using Quasiparticle Poisoning To Detect Photons
NASA Technical Reports Server (NTRS)
Echternach, Pierre; Day, Peter
2006-01-01
According to a proposal, a phenomenon associated with excitation of quasiparticles in certain superconducting quantum devices would be exploited as a means of detecting photons with exquisite sensitivity. The phenomenon could also be exploited to perform medium-resolution spectroscopy. The proposal was inspired by the observation that Coulomb blockade devices upon which some quantum logic gates are based are extremely sensitive to quasiparticles excited above the superconducting gaps in their leads. The presence of quasiparticles in the leads can be easily detected via the charge states. If quasiparticles could be generated in the leads by absorption of photons, then the devices could be used as very sensitive detectors of electromagnetic radiation over the spectral range from x-rays to submillimeter waves. The devices in question are single-Cooper-pair boxes (SCBs), which are mesoscopic superconducting devices developed for quantum computing. An SCB consists of a small superconducting island connected to a reservoir via a small tunnel junction and connected to a voltage source through a gate capacitor. An SCB is an artificial two-level quantum system, the Hamiltonian of which can be controlled by the gate voltage. One measures the expected value of the charge of the eigenvectors of this quantum system by use of a radio-frequency single-electron transistor. A plot of this expected value of charge as a function of gate voltage resembles a staircase that, in the ideal case, consists of steps of height 2 e (where e is the charge of one electron). Experiments have shown that depending on the parameters of the device, quasiparticles in the form of "broken" Cooper pairs present in the reservoir can tunnel to the island, giving rise to steps of 1 e. This effect is sometimes called "poisoning." Simulations have shown that an extremely small average number of quasiparticles can generate a 1-e periodic signal. In a device according to the proposal, this poisoning would be turned to advantage. Depending on the wavelength, an antenna or other component would be used to couple radiation into the reservoir, wherein the absorption of photons would break Cooper pairs, thereby creating quasiparticles that, in turn, would tunnel to the island, creating a 1-e signal. On the basis of conservative estimates of device parameters derived from experimental data and computational simulations that fit the data, it has been estimated that the noise equivalent power of a device according to the proposal could be as low as 6 10(exp -22) W/Hz(exp 1/2). It has also been estimated that the spectroscopic resolution (photon energy divided by increment of photon energy) of such a device in visible light would exceed 100.
NASA Astrophysics Data System (ADS)
Zhou, Xin; Liu, Xiang; Jeffries, Jay B.; Hanson, R. K.
2003-08-01
The water vapour spectrum in the 1-2 µm near-infrared region is systematically analysed to find the best absorption transitions for sensitive measurement of H2O concentration and temperature in combustion environments using a single tunable diode laser with typical distributed feedback single-mode scanning range (1 cm-1). The use of a single laser, even with relatively narrow tuning range, can offer distinct advantages over wavelength-multiplexing techniques. The strategy and spectroscopic criteria for selecting optimum wavelength regions and absorption line combinations are discussed. It should be stressed that no single figure of merit can be derived to simplify the selection process, and the optimum line pair should be chosen case by case. Our investigation reveals that the 1.8 µm spectral region is especially promising, and we have identified 10 of the best water line pairs in this spectral region for temperature measurements in flames. Based on these findings, a pair of H2O transitions near 1.8 µm was targeted for the design and development of an initial single-laser sensor for simultaneously measuring H2O concentration and temperature in atmospheric-pressure flames. As part of the sensor development effort, fundamental spectroscopic parameters including the line strength, line-centre frequency and lower state energies of the probed transitions were measured experimentally to improve the current databases. We conclude with demonstration results in a steady and a forced atmospheric-pressure laboratory combustor.
Milestone Report:3.2.2.26 Appliances, HVAC & Water Heating R&D-Select Sorption Technology
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ally, Moonis Raza
The purpose of this report is to select a sorption technology based on recent work completed on characterizing working pairs for both absorption and adsorption technologies based on Global Warming Potential (GWP) of less than 100 (relative to carbon dioxide, 100-year atmospheric life span) and zero Ozone Depletion Potential (ODP). From a total of eighty-three potential working pairs (absorption technology), there were only two candidate working pairs for the absorption technology, and 8 potential working pairs for adsorption technology. After screening these ten potential candidates on the basis of sizes of the desorber, absorber/adsorber, evaporator, condenser, and rectifier (where applicable),more » the ORNL-Georgia Tech study concluded that best working pairs are NH3-H2O for the most compact system in terms of heat transfer equipment surface area, and NH3-LiNO3 and MeOH-[mmin][DMP] where efficiency is most important. Based on a single-stage absorption and adsorption modeling using the Engineering Equation Solver (EES), the performance of both sorption systems was evaluated from known heat transfer correlations, and thermos-physical properties. Based on these results, the technology chosen is absorption technology. The selected technology is absorption for the reasons cited in Section 4.« less
Comparison of different "along the track" high resolution satellite stereo-pair for DSM extraction
NASA Astrophysics Data System (ADS)
Nikolakopoulos, Konstantinos G.
2013-10-01
The possibility to create DEM from stereo pairs is based on the Pythagoras theorem and on the principles of photogrammetry that are applied to aerial photographs stereo pairs for the last seventy years. The application of these principles to digital satellite stereo data was inherent in the first satellite missions. During the last decades the satellite stereo-pairs were acquired across the track in different days (SPOT, ERS etc.). More recently the same-date along the track stereo-data acquisition seems to prevail (Terra ASTER, SPOT5 HRS, Cartosat, ALOS Prism) as it reduces the radiometric image variations (refractive effects, sun illumination, temporal changes) and thus increases the correlation success rate in any image matching.Two of the newest satellite sensors with stereo collection capability is Cartosat and ALOS Prism. Both of them acquire stereopairs along the track with a 2,5m spatial resolution covering areas of 30X30km. In this study we compare two different satellite stereo-pair collected along the track for DSM creation. The first one is created from a Cartosat stereopair and the second one from an ALOS PRISM triplet. The area of study is situated in Chalkidiki Peninsula, Greece. Both DEMs were created using the same ground control points collected with a Differential GPS. After a first control for random or systematic errors a statistical analysis was done. Points of certified elevation have been used to estimate the accuracy of these two DSMs. The elevation difference between the different DEMs was calculated. 2D RMSE, correlation and the percentile value were also computed and the results are presented.
Single Color Multiplexed ddPCR Copy Number Measurements and Single Nucleotide Variant Genotyping.
Wood-Bouwens, Christina M; Ji, Hanlee P
2018-01-01
Droplet digital PCR (ddPCR) allows for accurate quantification of genetic events such as copy number variation and single nucleotide variants. Probe-based assays represent the current "gold-standard" for detection and quantification of these genetic events. Here, we introduce a cost-effective single color ddPCR assay that allows for single genome resolution quantification of copy number and single nucleotide variation.
Easy way to determine quantitative spatial resolution distribution for a general inverse problem
NASA Astrophysics Data System (ADS)
An, M.; Feng, M.
2013-12-01
The spatial resolution computation of a solution was nontrivial and more difficult than solving an inverse problem. Most geophysical studies, except for tomographic studies, almost uniformly neglect the calculation of a practical spatial resolution. In seismic tomography studies, a qualitative resolution length can be indicatively given via visual inspection of the restoration of a synthetic structure (e.g., checkerboard tests). An effective strategy for obtaining quantitative resolution length is to calculate Backus-Gilbert resolution kernels (also referred to as a resolution matrix) by matrix operation. However, not all resolution matrices can provide resolution length information, and the computation of resolution matrix is often a difficult problem for very large inverse problems. A new class of resolution matrices, called the statistical resolution matrices (An, 2012, GJI), can be directly determined via a simple one-parameter nonlinear inversion performed based on limited pairs of random synthetic models and their inverse solutions. The total procedure were restricted to forward/inversion processes used in the real inverse problem and were independent of the degree of inverse skill used in the solution inversion. Spatial resolution lengths can be directly given during the inversion. Tests on 1D/2D/3D model inversion demonstrated that this simple method can be at least valid for a general linear inverse problem.
O'Toole, Amanda S.; Miller, Stacy; Haines, Nathan; Zink, M. Coleen; Serra, Martin J.
2006-01-01
Thermodynamic parameters are reported for duplex formation of 48 self-complementary RNA duplexes containing Watson–Crick terminal base pairs (GC, AU and UA) with all 16 possible 3′ double-nucleotide overhangs; mimicking the structures of short interfering RNAs (siRNA) and microRNAs (miRNA). Based on nearest-neighbor analysis, the addition of a second dangling nucleotide to a single 3′ dangling nucleotide increases stability of duplex formation up to 0.8 kcal/mol in a sequence dependent manner. Results from this study in conjunction with data from a previous study [A. S. O'Toole, S. Miller and M. J. Serra (2005) RNA, 11, 512.] allows for the development of a refined nearest-neighbor model to predict the influence of 3′ double-nucleotide overhangs on the stability of duplex formation. The model improves the prediction of free energy and melting temperature when tested against five oligomers with various core duplex sequences. Phylogenetic analysis of naturally occurring miRNAs was performed to support our results. Selection of the effector miR strand of the mature miRNA duplex appears to be dependent upon the identity of the 3′ double-nucleotide overhang. Thermodynamic parameters for 3′ single terminal overhangs adjacent to a UA pair are also presented. PMID:16820533
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ngo, Anh T.; Skeini, Timur; Iancu, Violeta
Carotenoids and chlorophyll are essential parts of plant leaves and are involved in photosynthesis, a vital biological process responsible for the origin of life on Earth. Here, we investigate how beta-carotene and chlorophyll-a form mixed molecular phases On a Au(111) surface using low-temperature scanning tunneling microscopy and molecular manipulation at the single-molecule level supported by density functional theory calculations. By isolating individual molecules from nanoscale molecular clusters with a scanning tunneling microscope tip, we are able to identify five beta-carotene conformations including a structure exhibiting a three-dimensional conformation. Furthermore, molecular resolution images enable direct visualization of beta-carotene/chlorophyll-a clsuters, with intimatemore » structural details highlighting how they pair: beta-carotene preferentially positions next to chlorophyll-a and induces switching of chlorophyll-a from straight to several bent tail conformations in the molecular clusters.« less
Enhancing quantum sensing sensitivity by a quantum memory
Zaiser, Sebastian; Rendler, Torsten; Jakobi, Ingmar; Wolf, Thomas; Lee, Sang-Yun; Wagner, Samuel; Bergholm, Ville; Schulte-Herbrüggen, Thomas; Neumann, Philipp; Wrachtrup, Jörg
2016-01-01
In quantum sensing, precision is typically limited by the maximum time interval over which phase can be accumulated. Memories have been used to enhance this time interval beyond the coherence lifetime and thus gain precision. Here, we demonstrate that by using a quantum memory an increased sensitivity can also be achieved. To this end, we use entanglement in a hybrid spin system comprising a sensing and a memory qubit associated with a single nitrogen-vacancy centre in diamond. With the memory we retain the full quantum state even after coherence decay of the sensor, which enables coherent interaction with distinct weakly coupled nuclear spin qubits. We benchmark the performance of our hybrid quantum system against use of the sensing qubit alone by gradually increasing the entanglement of sensor and memory. We further apply this quantum sensor-memory pair for high-resolution NMR spectroscopy of single 13C nuclear spins. PMID:27506596
All-fiber upconversion high spectral resolution wind lidar using a Fabry-Perot interferometer.
Shangguan, Mingjia; Xia, Haiyun; Wang, Chong; Qiu, Jiawei; Shentu, Guoliang; Zhang, Qiang; Dou, Xiankang; Pan, Jian-Wei
2016-08-22
An all-fiber, micro-pulse and eye-safe high spectral resolution wind lidar (HSRWL) at 1.5 μm is proposed and demonstrated by using a pair of upconversion single-photon detectors and a fiber Fabry-Perot scanning interferometer (FFP-SI). In order to improve the optical detection efficiency, both the transmission spectrum and the reflection spectrum of the FFP-SI are used for spectral analyses of the aerosol backscatter and the reference laser pulse. Taking advantages of high signal-to-noise ratio of the detectors and high spectral resolution of the FFP-SI, the center frequencies and the bandwidths of spectra of the aerosol backscatter are obtained simultaneously. Continuous LOS wind observations are carried out on two days at Hefei (31.843 °N, 117.265 °E), China. The horizontal detection range of 4 km is realized with temporal resolution of 1 minute. The spatial resolution is switched from 30 m to 60 m at distance of 1.8 km. In a comparison experiment, LOS wind measurements from the HSRWL show good agreement with the results from an ultrasonic wind sensor (Vaisala windcap WMT52). An empirical method is adopted to evaluate the precision of the measurements. The standard deviation of the wind speed is 0.76 m/s at 1.8 km. The standard deviation of bandwidth variation is 2.07 MHz at 1.8 km.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dong, Bin
2015-01-01
Optical microscopy imaging of single molecules and single particles is an essential method for studying fundamental biological and chemical processes at the molecular and nanometer scale. The best spatial resolution (~ λ/2) achievable in traditional optical microscopy is governed by the diffraction of light. However, single molecule-based super-localization and super-resolution microscopy imaging techniques have emerged in the past decade. Individual molecules can be localized with nanometer scale accuracy and precision for studying of biological and chemical processes.This work uncovered the heterogeneous properties of the pore structures. In this dissertation, the coupling of molecular transport and catalytic reaction at the singlemore » molecule and single particle level in multilayer mesoporous nanocatalysts was elucidated. Most previous studies dealt with these two important phenomena separately. A fluorogenic oxidation reaction of non-fluorescent amplex red to highly fluorescent resorufin was tested. The diffusion behavior of single resorufin molecules in aligned nanopores was studied using total internal reflection fluorescence microscopy (TIRFM).« less
NASA Astrophysics Data System (ADS)
Zhang, Xuyan; Zhang, Zhiyao; Wang, Shubing; Liang, Dong; Li, Heping; Liu, Yong
2018-03-01
We propose and demonstrate an approach that can achieve high-resolution quantization by employing soliton self-frequency shift and spectral compression. Our approach is based on a bi-directional comb-fiber architecture which is composed of a Sagnac-loop-based mirror and a comb-like combination of N sections of interleaved single-mode fibers and high nonlinear fibers. The Sagnac-loop-based mirror placed at the terminal of a bus line reflects the optical pulses back to the bus line to achieve additional N-stage spectral compression, thus single-stage soliton self-frequency shift (SSFS) and (2 N - 1)-stage spectral compression are realized in the bi-directional scheme. The fiber length in the architecture is numerically optimized, and the proposed quantization scheme is evaluated by both simulation and experiment in the case of N = 2. In the experiment, a quantization resolution of 6.2 bits is obtained, which is 1.2-bit higher than that of its uni-directional counterpart.
NASA Astrophysics Data System (ADS)
Chi, Yuxi; Yu, Liping; Pan, Bing
2018-05-01
A low-cost, portable, robust and high-resolution single-camera stereo-digital image correlation (stereo-DIC) system for accurate surface three-dimensional (3D) shape and deformation measurements is described. This system adopts a single consumer-grade high-resolution digital Single Lens Reflex (SLR) camera and a four-mirror adaptor, rather than two synchronized industrial digital cameras, for stereo image acquisition. In addition, monochromatic blue light illumination and coupled bandpass filter imaging are integrated to ensure the robustness of the system against ambient light variations. In contrast to conventional binocular stereo-DIC systems, the developed pseudo-stereo-DIC system offers the advantages of low cost, portability, robustness against ambient light variations, and high resolution. The accuracy and precision of the developed single SLR camera-based stereo-DIC system were validated by measuring the 3D shape of a stationary sphere along with in-plane and out-of-plane displacements of a translated planar plate. Application of the established system to thermal deformation measurement of an alumina ceramic plate and a stainless-steel plate subjected to radiation heating was also demonstrated.
Dual Resolution Images from Paired Fingerprint Cards
National Institute of Standards and Technology Data Gateway
NIST Dual Resolution Images from Paired Fingerprint Cards (Web, free access) NIST Special Database 30 is being distributed for use in development and testing of fingerprint compression and fingerprint matching systems. The database allows the user to develop and evaluate data compression algorithms for fingerprint images scanned at both 19.7 ppmm (500 dpi) and 39.4 ppmm (1000 dpi). The data consist of 36 ten-print paired cards with both the rolled and plain images scanned at 19.7 and 39.4 pixels per mm. A newer version of the compression/decompression software on the CDROM can be found at the website http://www.nist.gov/itl/iad/ig/nigos.cfm as part of the NBIS package.
Two-Drug Antimicrobial Chemotherapy: A Mathematical Model and Experiments with Mycobacterium marinum
Ankomah, Peter; Levin, Bruce R.
2012-01-01
Multi-drug therapy is the standard-of-care treatment for tuberculosis. Despite this, virtually all studies of the pharmacodynamics (PD) of mycobacterial drugs employed for the design of treatment protocols are restricted to single agents. In this report, mathematical models and in vitro experiments with Mycobacterium marinum and five antimycobacterial drugs are used to quantitatively evaluate the pharmaco-, population and evolutionary dynamics of two-drug antimicrobial chemotherapy regimes. Time kill experiments with single and pairs of antibiotics are used to estimate the parameters and evaluate the fit of Hill-function-based PD models. While Hill functions provide excellent fits for the PD of each single antibiotic studied, rifampin, amikacin, clarithromycin, streptomycin and moxifloxacin, two-drug Hill functions with a unique interaction parameter cannot account for the PD of any of the 10 pairs of these drugs. If we assume two antibiotic-concentration dependent functions for the interaction parameter, one for sub-MIC and one for supra-MIC drug concentrations, the modified biphasic Hill function provides a reasonably good fit for the PD of all 10 pairs of antibiotics studied. Monte Carlo simulations of antibiotic treatment based on the experimentally-determined PD functions are used to evaluate the potential microbiological efficacy (rate of clearance) and evolutionary consequences (likelihood of generating multi-drug resistance) of these different drug combinations as well as their sensitivity to different forms of non-adherence to therapy. These two-drug treatment simulations predict varying outcomes for the different pairs of antibiotics with respect to the aforementioned measures of efficacy. In summary, Hill functions with biphasic drug-drug interaction terms provide accurate analogs for the PD of pairs of antibiotics and M. marinum. The models, experimental protocols and computer simulations used in this study can be applied to evaluate the potential microbiological and evolutionary efficacy of two-drug therapy for any bactericidal antibiotics and bacteria that can be cultured in vitro. PMID:22253599
Unusual target site disruption by the rare-cutting HNH restriction endonuclease PacI
Shen, Betty; Heiter, Daniel F.; Chan, Siu-Hong; Wang, Hua; Xu, Shuang-Yong; Morgan, Richard D.; Wilson, Geoffrey G.; Stoddard, Barry L.
2010-01-01
The crystal structure of the rare-cutting HNH restriction endonuclease PacI in complex with its eight base pair target recognition sequence 5'-TTAATTAA-3' has been determined to 1.9 Å resolution. The enzyme forms an extended homodimer, with each subunit containing two zinc-bound motifs surrounding a ββα-metal catalytic site. The latter is unusual in that a tyrosine residue likely initiates strand-cleavage. PacI dramatically distorts its target sequence from Watson-Crick duplex DNA basepairing, with every base separated from its original partner. Two bases on each strand are unpaired, four are engaged in non-canonical A:A and T:T base pairs, and the remaining two bases are matched with new Watson-Crick partners. This represents a highly unusual DNA binding mechanism for a restriction endonuclease, and implies that initial recognition of the target site might involve significantly different contacts from those visualized in the DNA-bound cocrystal structures. PMID:20541511
Lazzari, Maurizio; Bettini, Simone; Ciani, Franco; Franceschini, Valeria
2008-10-01
The GLUT-1 isoform of the glucose transporter is commonly considered a reliable molecular marker of blood-brain barrier endothelia in the neural vasculature organized in a three-dimensional network of single vessels. The central nervous system of the axolotl Ambystoma mexicanum is characterized by a vascular architecture that contains both single and paired vessels. The presence and distribution of the GLUT-1 transporter are studied in this urodele using both immunoperoxidase histochemistry and immunogold technique. Light microscopy reveals immunopositivity in both parenchymal and meningeal vessels. The transverse-sectioned pairs of vessels do not show the same size. Furthermore, in the same pair, the two elements often differ in diameter. The main regions of the central nervous system show a different percentage of the paired structures. Only immunogold cytochemistry reveals different staining intensity in the two adjoined elements of a vascular pair. Colloidal gold particles show an asymmetric distribution in the endothelia of both single and paired vessels. These particles are more numerous on the abluminal surface than on the luminal one. The particle density is calculated in both vascular types. The different values could indicate functional differences between single and paired vessels and between the two adjoined elements of a pair, regarding glucose transport.
Image resolution enhancement via image restoration using neural network
NASA Astrophysics Data System (ADS)
Zhang, Shuangteng; Lu, Yihong
2011-04-01
Image super-resolution aims to obtain a high-quality image at a resolution that is higher than that of the original coarse one. This paper presents a new neural network-based method for image super-resolution. In this technique, the super-resolution is considered as an inverse problem. An observation model that closely follows the physical image acquisition process is established to solve the problem. Based on this model, a cost function is created and minimized by a Hopfield neural network to produce high-resolution images from the corresponding low-resolution ones. Not like some other single frame super-resolution techniques, this technique takes into consideration point spread function blurring as well as additive noise and therefore generates high-resolution images with more preserved or restored image details. Experimental results demonstrate that the high-resolution images obtained by this technique have a very high quality in terms of PSNR and visually look more pleasant.
Franson Interference Generated by a Two-Level System
NASA Astrophysics Data System (ADS)
Peiris, M.; Konthasinghe, K.; Muller, A.
2017-01-01
We report a Franson interferometry experiment based on correlated photon pairs generated via frequency-filtered scattered light from a near-resonantly driven two-level semiconductor quantum dot. In contrast to spontaneous parametric down-conversion and four-wave mixing, this approach can produce single pairs of correlated photons. We have measured a Franson visibility as high as 66%, which goes beyond the classical limit of 50% and approaches the limit of violation of Bell's inequalities (70.7%).
Triple Helix Formation in a Topologically Controlled DNA Nanosystem.
Yamagata, Yutaro; Emura, Tomoko; Hidaka, Kumi; Sugiyama, Hiroshi; Endo, Masayuki
2016-04-11
In the present study, we demonstrate single-molecule imaging of triple helix formation in DNA nanostructures. The binding of the single-molecule third strand to double-stranded DNA in a DNA origami frame was examined using two different types of triplet base pairs. The target DNA strand and the third strand were incorporated into the DNA frame, and the binding of the third strand was controlled by the formation of Watson-Crick base pairing. Triple helix formation was monitored by observing the structural changes in the incorporated DNA strands. It was also examined using a photocaged third strand wherein the binding of the third strand was directly observed using high-speed atomic force microscopy during photoirradiation. We found that the binding of the third strand could be controlled by regulating duplex formation and the uncaging of the photocaged strands in the designed nanospace. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Highly efficient heralded single-photon source for telecom wavelengths based on a PPLN waveguide.
Bock, Matthias; Lenhard, Andreas; Chunnilall, Christopher; Becher, Christoph
2016-10-17
We present the realization of a highly efficient photon pair source based on spontaneous parametric downconversion (SPDC) in a periodically poled lithium niobate (PPLN) ridge waveguide. The source is suitable for long distance quantum communication applications as the photon pairs are located at the centers of the telecommunication O- and C- band at 1312 nm and 1557 nm. The high efficiency is confirmed by a conversion efficiency of 4 × 10-6 - which is to our knowledge among the highest conversion efficiencies reported so far - and a heralding efficiency of 64.1 ± 2.1%. The heralded single-photon properties are confirmed by the measurement of the photon statistics with a Click/No-Click method as well as the heralded g(2)-function. A minimum value for g(2)(0) of 0.001 ± 0.0003 indicating clear antibunching has been observed.
Dey, B.; Ratcliff, B.; Va’vra, J.
2017-02-16
In this article, we explore the angular resolution limits attainable in small FDIRC designs taking advantage of the new highly pixelated detectors that are now available. Since the basic FDIRC design concept attains its particle separation performance mostly in the angular domain as measured by two-dimensional pixels, this paper relies primarily on a pixel-based analysis, with additional chromatic corrections using the time domain, requiring single photon timing resolution at a level of 100–200 ps only. This approach differs from other modern DIRC design concepts such as TOP or TORCH detectors, whose separation performances rely more strongly on time-dependent analyses. Inmore » conclusion, we find excellent single photon resolution with a geometry where individual bars are coupled to a single plate, which is coupled in turn to a cylindrical lens focusing camera.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dey, B.; Ratcliff, B.; Va’vra, J.
In this article, we explore the angular resolution limits attainable in small FDIRC designs taking advantage of the new highly pixelated detectors that are now available. Since the basic FDIRC design concept attains its particle separation performance mostly in the angular domain as measured by two-dimensional pixels, this paper relies primarily on a pixel-based analysis, with additional chromatic corrections using the time domain, requiring single photon timing resolution at a level of 100–200 ps only. This approach differs from other modern DIRC design concepts such as TOP or TORCH detectors, whose separation performances rely more strongly on time-dependent analyses. Inmore » conclusion, we find excellent single photon resolution with a geometry where individual bars are coupled to a single plate, which is coupled in turn to a cylindrical lens focusing camera.« less
Ultrasound guided electrical impedance tomography for 2D free-interface reconstruction
NASA Astrophysics Data System (ADS)
Liang, Guanghui; Ren, Shangjie; Dong, Feng
2017-07-01
The free-interface detection problem is normally seen in industrial or biological processes. Electrical impedance tomography (EIT) is a non-invasive technique with advantages of high-speed and low cost, and is a promising solution for free-interface detection problems. However, due to the ill-posed and nonlinear characteristics, the spatial resolution of EIT is low. To deal with the issue, an ultrasound guided EIT is proposed to directly reconstruct the geometric configuration of the target free-interface. In the method, the position of the central point of the target interface is measured by a pair of ultrasound transducers mounted at the opposite side of the objective domain, and then the position measurement is used as the prior information for guiding the EIT-based free-interface reconstruction. During the process, a constrained least squares framework is used to fuse the information from different measurement modalities, and the Lagrange multiplier-based Levenberg-Marquardt method is adopted to provide the iterative solution of the constraint optimization problem. The numerical results show that the proposed ultrasound guided EIT method for the free-interface reconstruction is more accurate than the single modality method, especially when the number of valid electrodes is limited.
Currie, Dustin W; Comstock, R Dawn; Fields, Sarah K; Cantu, Robert C
To compare initial and recurrent concussions regarding average number of days between concussions, acute concussion symptoms and symptom resolution time, and return to play time. High school athletes sustaining multiple concussions linked within sport seasons drawn from a large sports injury surveillance study. Retrospective analysis of longitudinal surveillance data. Number of days between concussions, number of symptoms endorsed, specific symptoms endorsed, symptom resolution time, return to play time. Median time between initial and recurrent concussions was 21 days (interquartile range = 10-43 days). Loss of consciousness, the only significant symptom difference, occurred more frequently in recurrent (6.8%) than initial (1.7%) concussions (P = .04). No significant difference was found in the number of symptoms (P = .84) or symptom resolution time (P = .74). Recurrent concussions kept athletes from play longer than initial concussions (P < .0001); 26.6% of recurrent concussions were season ending. We found that athletes' initial and recurrent concussions had similar symptom presentations and resolution time. Despite these similarities, athletes were restricted from returning to play for longer periods following a recurrent concussion, indicating clinicians are managing recurrent concussions more conservatively. It is probable that concussion recognition and management are superior now compared with when previous studies were published, possibly improving recurrent concussion outcomes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
McDonald, A. D.; Jones, B. J. P.; Nygren, D. R.
A new method to tag the barium daughter in the double beta decay ofmore » $$^{136}$$Xe is reported. Using the technique of single molecule fluorescent imaging (SMFI), individual barium dication (Ba$$^{++}$$) resolution at a transparent scanning surface has been demonstrated. A single-step photo-bleach confirms the single ion interpretation. Individual ions are localized with super-resolution ($$\\sim$$2~nm), and detected with a statistical significance of 12.9~$$\\sigma$$ over backgrounds. This lays the foundation for a new and potentially background-free neutrinoless double beta decay technology, based on SMFI coupled to high pressure xenon gas time projection chambers.« less
Single-Molecule and Superresolution Imaging in Live Bacteria Cells
Biteen, Julie S.; Moerner, W.E.
2010-01-01
Single-molecule imaging enables biophysical measurements devoid of ensemble averaging, gives enhanced spatial resolution beyond the diffraction limit, and permits superresolution reconstructions. Here, single-molecule and superresolution imaging are applied to the study of proteins in live Caulobacter crescentus cells to illustrate the power of these methods in bacterial imaging. Based on these techniques, the diffusion coefficient and dynamics of the histidine protein kinase PleC, the localization behavior of the polar protein PopZ, and the treadmilling behavior and protein superstructure of the structural protein MreB are investigated with sub-40-nm spatial resolution, all in live cells. PMID:20300204
Ultrahigh resolution multicolor colocalization of single fluorescent probes
Weiss, Shimon; Michalet, Xavier; Lacoste, Thilo D.
2005-01-18
A novel optical ruler based on ultrahigh-resolution colocalization of single fluorescent probes is described. Two unique families of fluorophores are used, namely energy-transfer fluorescent beads and semiconductor nanocrystal (NC) quantum dots, that can be excited by a single laser wavelength but emit at different wavelengths. A novel multicolor sample-scanning confocal microscope was constructed which allows one to image each fluorescent light emitter, free of chromatic aberrations, by scanning the sample with nanometer scale steps using a piezo-scanner. The resulting spots are accurately localized by fitting them to the known shape of the excitation point-spread-function of the microscope.
Characterizing hydraulic conductivity with the direct-push permeameter
Butler, J.J.; Dietrich, P.; Wittig, V.; Christy, T.
2007-01-01
The direct-push permeameter (DPP) is a promising approach for obtaining high-resolution information about vertical variations in hydraulic conductivity (K) in shallow unconsolidated settings. This small-diameter tool, which consists of a short screened section with a pair of transducers inset in the tool near the screen, is pushed into the subsurface to a depth at which a K estimate is desired. A short hydraulic test is then performed by injecting water through the screen at a constant rate (less than 4 L/min) while pressure changes are monitored at the transducer locations. Hydraulic conductivity is calculated using the injection rate and the pressure changes in simple expressions based on Darcy's Law. In units of moderate or higher hydraulic conductivity (more than 1 m/d), testing at a single level can be completed within 10 to 15 min. Two major advantages of the method are its speed and the insensitivity of the K estimates to the zone of compaction created by tool advancement. The potential of the approach has been assessed at two extensively studied sites in the United States and Germany over a K range commonly faced in practical field investigations (0.02 to 500 m/d). The results of this assessment demonstrate that the DPP can provide high-resolution K estimates that are in good agreement with estimates obtained through other means. ?? 2007 National Ground Water Association.
Sun, Pei; Gardner, Justin L.; Costagli, Mauro; Ueno, Kenichi; Waggoner, R. Allen; Tanaka, Keiji; Cheng, Kang
2013-01-01
Cells in the animal early visual cortex are sensitive to contour orientations and form repeated structures known as orientation columns. At the behavioral level, there exist 2 well-known global biases in orientation perception (oblique effect and radial bias) in both animals and humans. However, their neural bases are still under debate. To unveil how these behavioral biases are achieved in the early visual cortex, we conducted high-resolution functional magnetic resonance imaging experiments with a novel continuous and periodic stimulation paradigm. By inserting resting recovery periods between successive stimulation periods and introducing a pair of orthogonal stimulation conditions that differed by 90° continuously, we focused on analyzing a blood oxygenation level-dependent response modulated by the change in stimulus orientation and reliably extracted orientation preferences of single voxels. We found that there are more voxels preferring horizontal and vertical orientations, a physiological substrate underlying the oblique effect, and that these over-representations of horizontal and vertical orientations are prevalent in the cortical regions near the horizontal- and vertical-meridian representations, a phenomenon related to the radial bias. Behaviorally, we also confirmed that there exists perceptual superiority for horizontal and vertical orientations around horizontal and vertical meridians, respectively. Our results, thus, refined the neural mechanisms of these 2 global biases in orientation perception. PMID:22661413
Chang, Hing-Chiu; Chuang, Tzu-Chao; Lin, Yi-Ru; Wang, Fu-Nien; Huang, Teng-Yi; Chung, Hsiao-Wen
2013-04-01
This study investigates the application of a modified reversed gradient algorithm to the Propeller-EPI imaging method (periodically rotated overlapping parallel lines with enhanced reconstruction based on echo-planar imaging readout) for corrections of geometric distortions due to the EPI readout. Propeller-EPI acquisition was executed with 360-degree rotational coverage of the k-space, from which the image pairs with opposite phase-encoding gradient polarities were extracted for reversed gradient geometric and intensity corrections. The spatial displacements obtained on a pixel-by-pixel basis were fitted using a two-dimensional polynomial followed by low-pass filtering to assure correction reliability in low-signal regions. Single-shot EPI images were obtained on a phantom, whereas high spatial resolution T2-weighted and diffusion tensor Propeller-EPI data were acquired in vivo from healthy subjects at 3.0 Tesla, to demonstrate the effectiveness of the proposed algorithm. Phantom images show success of the smoothed displacement map concept in providing improvements of the geometric corrections at low-signal regions. Human brain images demonstrate prominently superior reconstruction quality of Propeller-EPI images with modified reversed gradient corrections as compared with those obtained without corrections, as evidenced from verification against the distortion-free fast spin-echo images at the same level. The modified reversed gradient method is an effective approach to obtain high-resolution Propeller-EPI images with substantially reduced artifacts.
Katsura, Masaki; Sato, Jiro; Akahane, Masaaki; Mise, Yoko; Sumida, Kaoru; Abe, Osamu
2017-08-01
To compare image quality characteristics of high-resolution computed tomography (HRCT) in the evaluation of interstitial lung disease using three different reconstruction methods: model-based iterative reconstruction (MBIR), adaptive statistical iterative reconstruction (ASIR), and filtered back projection (FBP). Eighty-nine consecutive patients with interstitial lung disease underwent standard-of-care chest CT with 64-row multi-detector CT. HRCT images were reconstructed in 0.625-mm contiguous axial slices using FBP, ASIR, and MBIR. Two radiologists independently assessed the images in a blinded manner for subjective image noise, streak artifacts, and visualization of normal and pathologic structures. Objective image noise was measured in the lung parenchyma. Spatial resolution was assessed by measuring the modulation transfer function (MTF). MBIR offered significantly lower objective image noise (22.24±4.53, P<0.01 among all pairs, Student's t-test) compared with ASIR (39.76±7.41) and FBP (51.91±9.71). MTF (spatial resolution) was increased using MBIR compared with ASIR and FBP. MBIR showed improvements in visualization of normal and pathologic structures over ASIR and FBP, while ASIR was rated quite similarly to FBP. MBIR significantly improved subjective image noise (P<0.01 among all pairs, the sign test), and streak artifacts (P<0.01 each for MBIR vs. the other 2 image data sets). MBIR provides high-quality HRCT images for interstitial lung disease by reducing image noise and streak artifacts and improving spatial resolution compared with ASIR and FBP. Copyright © 2017 Elsevier B.V. All rights reserved.
Spatial Classification of Orchards and Vineyards with High Spatial Resolution Panchromatic Imagery
DOE Office of Scientific and Technical Information (OSTI.GOV)
Warner, Timothy; Steinmaus, Karen L.
2005-02-01
New high resolution single spectral band imagery offers the capability to conduct image classifications based on spatial patterns in imagery. A classification algorithm based on autocorrelation patterns was developed to automatically extract orchards and vineyards from satellite imagery. The algorithm was tested on IKONOS imagery over Granger, WA, which resulted in a classification accuracy of 95%.
Ionomers for Ion-Conducting Energy Materials
NASA Astrophysics Data System (ADS)
Colby, Ralph
For ionic actuators and battery separators, it is vital to utilize single-ion conducting ionomers that avoid the detrimental polarization of other ions. Single-ion conducting ionomers are synthesized based on DFT calculations, with low glass transition temperatures (facile dynamics) to prepare ion-conducting membranes for battery separators that conduct Li+ or Na+. Characterization by X-ray scattering, dielectric spectroscopy, FTIR, NMR and linear viscoelasticity collectively develop a coherent picture of ionic aggregation and both counterion and polymer dynamics. 7Li NMR diffusion measurements find that diffusion is faster than expected by conductivity using the Nernst-Einstein equation, which means that the majority of Li diffusion occurs by ion pairs moving with the polymer segmental motion. Segmental motion only contributes to ionic conduction in the rare event that one of these ion pairs has an extra Li (a positive triple ion). This leads us to a new metric for ion-conducting soft materials, the product of the cation number density p0 and their diffusion coefficient D; p0D is the diffusive flux of lithium ions. This new metric has a maximum at intermediate ion content that corresponds to the overlap of ion pair polarizability volumes. At higher ion contents, the ion pairs interact strongly and form larger aggregation states that retard segmental motion of both mobile ion pairs and triple ions.
Thermodynamic insights into 2-thiouridine-enhanced RNA hybridization
Larsen, Aaron T.; Fahrenbach, Albert C.; Sheng, Jia; Pian, Julia; Szostak, Jack W.
2015-01-01
Nucleobase modifications dramatically alter nucleic acid structure and thermodynamics. 2-thiouridine (s2U) is a modified nucleobase found in tRNAs and known to stabilize U:A base pairs and destabilize U:G wobble pairs. The recently reported crystal structures of s2U-containing RNA duplexes do not entirely explain the mechanisms responsible for the stabilizing effect of s2U or whether this effect is entropic or enthalpic in origin. We present here thermodynamic evaluations of duplex formation using ITC and UV thermal denaturation with RNA duplexes containing internal s2U:A and s2U:U pairs and their native counterparts. These results indicate that s2U stabilizes both duplexes. The stabilizing effect is entropic in origin and likely results from the s2U-induced preorganization of the single-stranded RNA prior to hybridization. The same preorganizing effect is likely responsible for structurally resolving the s2U:U pair-containing duplex into a single conformation with a well-defined H-bond geometry. We also evaluate the effect of s2U on single strand conformation using UV- and CD-monitored thermal denaturation and on nucleoside conformation using 1H NMR spectroscopy, MD and umbrella sampling. These results provide insights into the effects that nucleobase modification has on RNA structure and thermodynamics and inform efforts toward improving both ribozyme-catalyzed and nonenzymatic RNA copying. PMID:26240387
Fabrications and application of single crystalline GaN for high-performance deep UV photodetectors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Velazquez, R.; Rivera, M.; Feng, P., E-mail: p.feng@upr.edu
2016-08-15
High-quality single crystalline Gallium Nitride (GaN) semiconductor has been synthesized using molecule beam epitaxy (MBE) technique for development of high-performance deep ultraviolet (UV) photodetectors. Thickness of the films was estimated by using surface profile meter and scanning electron microscope. Electronic states and elemental composition of the films were obtained using Raman scattering spectroscopy. The orientation, crystal structure and phase purity of the films were examined using a Siemens x-ray diffractometer radiation. The surface microstructure was studied using high resolution scanning electron microscopy (SEM). Two types of metal pairs: Al-Al, Al-Cu or Cu-Cu were used for interdigital electrodes on GaN filmmore » in order to examine the Schottky properties of the GaN based photodetector. The characterizations of the fabricated prototype include the stability, responsivity, response and recovery times. Typical time dependent photoresponsivity by switching different UV light source on and off five times for each 240 seconds at a bias of 2V, respectively, have been obtained. The detector appears to be highly sensitive to various UV wavelengths of light with very stable baseline and repeatability. The obtained photoresponsivity was up to 354 mA/W at the bias 2V. Higher photoresponsivity could be obtained if higher bias was applied but it would unavoidably result in a higher dark current. Thermal effect on the fabricated GaN based prototype was discussed.« less
Winter precipitation particle size distribution measurement by Multi-Angle Snowflake Camera
NASA Astrophysics Data System (ADS)
Huang, Gwo-Jong; Kleinkort, Cameron; Bringi, V. N.; Notaroš, Branislav M.
2017-12-01
From the radar meteorology viewpoint, the most important properties for quantitative precipitation estimation of winter events are 3D shape, size, and mass of precipitation particles, as well as the particle size distribution (PSD). In order to measure these properties precisely, optical instruments may be the best choice. The Multi-Angle Snowflake Camera (MASC) is a relatively new instrument equipped with three high-resolution cameras to capture the winter precipitation particle images from three non-parallel angles, in addition to measuring the particle fall speed using two pairs of infrared motion sensors. However, the results from the MASC so far are usually presented as monthly or seasonally, and particle sizes are given as histograms, no previous studies have used the MASC for a single storm study, and no researchers use MASC to measure the PSD. We propose the methodology for obtaining the winter precipitation PSD measured by the MASC, and present and discuss the development, implementation, and application of the new technique for PSD computation based on MASC images. Overall, this is the first study of the MASC-based PSD. We present PSD MASC experiments and results for segments of two snow events to demonstrate the performance of our PSD algorithm. The results show that the self-consistency of the MASC measured single-camera PSDs is good. To cross-validate PSD measurements, we compare MASC mean PSD (averaged over three cameras) with the collocated 2D Video Disdrometer, and observe good agreements of the two sets of results.
A single Watson-Crick G x C base pair in water: aqueous hydrogen bonds in hydrophobic cavities.
Sawada, Tomohisa; Fujita, Makoto
2010-05-26
Hydrogen bond (H-bond) formation in water has been a challenging task because water molecules are constant competitors. In biological systems, however, stable H-bonds are formed by shielding the H-bonding sites from the competing water molecules within hydrophobic pockets. Inspired by the nature's elaborated way, we found that even mononucleotides (G and C) can form the minimal G x C Watson-Crick pair in water by simply providing a synthetic cavity that efficiently shields the Watson-Crick H-bonding sites. The minimal Watson-Crick structure in water was elucidated by NMR study and firmly characterized by crystallographic analysis. The crystal structure also displays that, within the cavity, coencapsulated anions and solvents efficiently mediate the minimal G x C Watson-Crick pair formation. Furthermore, the competition experiments with the other nucleobases clearly revealed the evident selectivity for the G x C base pairing in water. These results show the fact that a H-bonded nucleobase pair was effectively induced and stabilized in the local environment of an artificial hydrophobic cavity.
Three-color Sagnac source of polarization-entangled photon pairs.
Hentschel, Michael; Hübel, Hannes; Poppe, Andreas; Zeilinger, Anton
2009-12-07
We demonstrate a compact and stable source of polarization-entangled pairs of photons, one at 810 nm wavelength for high detection efficiency and the other at 1550 nm for long-distance fiber communication networks. Due to a novel Sagnac-based design of the interferometer no active stabilization is needed. Using only one 30 mm ppKTP bulk crystal the source produces photons with a spectral brightness of 1.13 x 10(6) pairs/s/mW/THz with an entanglement fidelity of 98.2%. Both photons are single-mode fiber coupled and ready to be used in quantum key distribution (QKD) or transmission of photonic quantum states over large distances.
Exploring the Limits of DNA Size: Naphtho-homologated DNA Bases and Pairs
Lee, Alex H. F.; Kool, Eric T.
2008-01-01
A new design for DNA bases and base pairs is described in which the pyrimidine bases are widened by naphtho-homologation. Two naphtho-homologated deoxyribosides, dyyT (1) and dyyC (2) were synthesized and could be incorporated into oligonucleotides as suitably protected phosphoramidite derivatives. The deoxyribosides were found to be fluorescent, with emission maxima at 446 and 433 nm, respectively. Studies with single substitutions of 1 and 2 in the natural DNA context revealed exceptionally strong base stacking propensity for both. Sequences containing multiple substitutions of 1 and 2 paired opposite adenine and guanine were subsequently mixed and studied by several analytical methods. Data from UV mixing experiments, FRET measurements, fluorescence quenching experiments, and hybridizations on beads suggest that complementary “doublewide DNA” (yyDNA) strands may self-assemble into helical complexes with 1:1 stoichiometry. Data from thermal denaturation plots and CD spectra were less conclusive. Control experiments in one sequence context gave evidence that yyDNA helices, if formed, are preferentially antiparallel and are sequence selective. Hypothesized base pairing schemes are analogous to Watson-Crick pairing, but with glycosidic C1′-C1′ distances widened by over 45%, to ca. 15.2 Å. The possible self-assembly of the double-wide DNA helix establishes a new limit for the size of information-encoding, DNA-like molecules, and the fluorescence of yyDNA bases suggests uses as reporters in monomeric and oligomeric forms. PMID:16834396
Building Change Detection in Very High Resolution Satellite Stereo Image Time Series
NASA Astrophysics Data System (ADS)
Tian, J.; Qin, R.; Cerra, D.; Reinartz, P.
2016-06-01
There is an increasing demand for robust methods on urban sprawl monitoring. The steadily increasing number of high resolution and multi-view sensors allows producing datasets with high temporal and spatial resolution; however, less effort has been dedicated to employ very high resolution (VHR) satellite image time series (SITS) to monitor the changes in buildings with higher accuracy. In addition, these VHR data are often acquired from different sensors. The objective of this research is to propose a robust time-series data analysis method for VHR stereo imagery. Firstly, the spatial-temporal information of the stereo imagery and the Digital Surface Models (DSMs) generated from them are combined, and building probability maps (BPM) are calculated for all acquisition dates. In the second step, an object-based change analysis is performed based on the derivative features of the BPM sets. The change consistence between object-level and pixel-level are checked to remove any outlier pixels. Results are assessed on six pairs of VHR satellite images acquired within a time span of 7 years. The evaluation results have proved the efficiency of the proposed method.
Buchmueller, Karen L; Staples, Andrew M; Howard, Cameron M; Horick, Sarah M; Uthe, Peter B; Le, N Minh; Cox, Kari K; Nguyen, Binh; Pacheco, Kimberly A O; Wilson, W David; Lee, Moses
2005-01-19
Pyrrole (Py) and imidazole (Im) polyamides can be designed to target specific DNA sequences. The effect that the pyrrole and imidazole arrangement, plus DNA sequence, have on sequence specificity and binding affinity has been investigated using DNA melting (DeltaT(M)), circular dichroism (CD), and surface plasmon resonance (SPR) studies. SPR results obtained from a complete set of triheterocyclic polyamides show a dramatic difference in the affinity of f-ImPyIm for its cognate DNA (K(eq) = 1.9 x 10(8) M(-1)) and f-PyPyIm for its cognate DNA (K(eq) = 5.9 x 10(5) M(-1)), which could not have been anticipated prior to characterization of these compounds. Moreover, f-ImPyIm has a 10-fold greater affinity for CGCG than distamycin A has for its cognate, AATT. To understand this difference, the triamide dimers are divided into two structural groupings: central and terminal pairings. The four possible central pairings show decreasing selectivity and affinity for their respective cognate sequences: -ImPy > -PyPy- > -PyIm- approximately -ImIm-. These results extend the language of current design motifs for polyamide sequence recognition to include the use of "words" for recognizing two adjacent base pairs, rather than "letters" for binding to single base pairs. Thus, polyamides designed to target Watson-Crick base pairs should utilize the strength of -ImPy- and -PyPy- central pairings. The f/Im and f/Py terminal groups yielded no advantage for their respective C/G or T/A base pairs. The exception is with the -ImPy- central pairing, for which f/Im has a 10-fold greater affinity for C/G than f/Py has for T/A.
Peng, Zhiyong; Soper, Steven A.; Pingle, Maneesh R.; Barany, Francis; Davis, Lloyd M.
2015-01-01
Detection of pathogenic bacteria and viruses require strategies that can signal the presence of these targets in near real-time due to the potential threats created by rapid dissemination into water and/or food supplies. In this paper, we report an innovative strategy that can rapidly detect bacterial pathogens using reporter sequences found in their genome without requiring polymerase chain reaction (PCR). A pair of strain-specific primers was designed based on the 16S rRNA gene and were end-labeled with a donor (Cy5) or acceptor (Cy5.5) dye. In the presence of the target bacterium, the primers were joined using a ligase detection reaction (LDR) only when the primers were completely complementary to the target sequence to form a reverse molecular beacon (rMB), thus bringing Cy5 (donor) and Cy5.5 (acceptor) into close proximity to allow fluorescence resonance energy transfer (FRET) to occur. These rMBs were subsequently analyzed using single-molecule detection of the FRET pairs (single-pair FRET; spFRET). The LDR was performed using a continuous flow thermal cycling process configured in a cyclic olefin copolymer (COC) microfluidic device using either 2 or 20 thermal cycles. Single-molecule photon bursts from the resulting rMBs were detected on-chip and registered using a simple laser-induced fluorescence (LIF) instrument. The spFRET signatures from the target pathogens were reported in as little as 2.6 min using spFRET. PMID:21047095
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ghosh, Tarini Shankar; Chaitanya, S. Krishna; Sankararamakrishnan, Ramasubbu, E-mail: rsankar@iitk.ac.in
New classes of helix–helix interactions in protein structures are reported in which interactions only occur at the terminal regions or between the terminal region of one helix and the middle region of another helix. Helix–helix interactions are important for the structure, stability and function of α-helical proteins. Helices that either cross in the middle or show extensive contacts between each other, such as coiled coils, have been investigated in previous studies. Interactions between two helices can also occur only at the terminal regions or between the terminal region of one helix and the middle region of another helix. Examples ofmore » such helix pairs are found in aquaporin, H{sup +}/Cl{sup −} transporter and Bcl-2 proteins. The frequency of the occurrence of such ‘end-to-end’ (EE) and ‘end-to-middle’ (EM) helix pairs in protein structures is not known. Questions regarding the residue preferences in the interface and the mode of interhelical interactions in such helix pairs also remain unanswered. In this study, high-resolution structures of all-α proteins from the PDB have been systematically analyzed and the helix pairs that interact only in EE or EM fashion have been extracted. EE and EM helix pairs have been categorized into five classes (N–N, N–C, C–C, N–MID and C–MID) depending on the region of interaction. Nearly 13% of 5725 helix pairs belonged to one of the five classes. Analysis of single-residue propensities indicated that hydrophobic and polar residues prefer to occur in the C-terminal and N-terminal regions, respectively. Hydrophobic C-terminal interacting residues and polar N-terminal interacting residues are also highly conserved. A strong correlation exists between some of the residue properties (surface area/volume and length of side chains) and their preferences for occurring in the interface of EE and EM helix pairs. In contrast to interacting non-EE/EM helix pairs, helices in EE and EM pairs are farther apart. In these helix pairs, residues with large surface area/volume and longer side chains are preferred in the interfacial region.« less
NASA Astrophysics Data System (ADS)
Houriez, Céline; Vallet, Valérie; Réal, Florent; Meot-Ner Mautner, Michael; Masella, Michel
2017-10-01
We performed molecular dynamics simulations of carboxylate/methylated ammonium ion pairs solvated in bulk water and of carboxylate/methylated ammonium salt solutions at ambient conditions using an ab initio-based polarizable force field whose parameters are assigned to reproduce only high end quantum computations, at the Møller-Plesset second-order perturbation theory/complete basis set limit level, regarding single ions and ion pairs as isolated and micro-hydrated in gas phase. Our results agree with the available experimental results regarding carboxylate/ammonium salt solutions. For instance, our force field approach predicts the percentage of acetate associated with ammonium ions in CH3 COO-/CH3 NH3+ solutions at the 0.2-0.8M concentration scale to range from 14% to 35%, in line with the estimates computed from the experimental ion association constant in liquid water. Moreover our simulations predict the number of water molecules released from the ion first hydration shell to the bulk upon ion association to be about 2.0 ± 0.6 molecules for acetate/protonated amine ion pairs, 3.1 ± 1.5 molecules for the HCOO-/NH4+ pair and 3.3 ± 1.2 molecules for the CH3COO-/(CH3)4N+ pair. For protonated amine-based ion pairs, these values are in line with experiment for alkali/halide pairs solvated in bulk water. All these results demonstrate the promising feature of ab initio-based force fields, i.e., their capacity in accurately modeling chemical systems that cannot be readily investigated using available experimental techniques.
The Crystal Structure of Non-Modified and Bipyridine-Modified PNA Duplexes
Yeh, Joanne I.; Pohl, Ehmke; Truan, Daphne; He, Wei; Sheldrick, George M.; Du, Shoucheng; Achim, Catalina
2011-01-01
Peptide nucleic acid (PNA) is a synthetic analogue of DNA that commonly has an N-aminoethlyl-glycine backbone. The crystal structure of two PNA duplexes, one containing eight standard nucleobase pairs (GGCATCGG)2 (pdb: 3MBS), and the other containing the same nucleobase pairs and a central pair of bipyridine ligands (pdb: 3MBU), has been solved with a resolution of 1.2 Å and 1.05 Å, respectively. The non-modified PNA duplex adopts a P-type helical structure s i m i l a r t o that of previously characterized PNAs. The atomic-level resolution of the structures allowed us to observe for the first time specific modes of interaction between the terminal lysines of the PNA and the backbone and nucleobases situated in the vicinity of the lysines, which are considered an important factor in the induction of a preferred handedness in PNA duplexes. These results support the notion that while PNA typically adopts a P-type helical structure, its flexibility is relatively high. For example, the base pair rise in the bipyridine-containing PNA is the largest measured to date in a PNA homoduplex. The two bipyridines are bulged out of the duplex and are aligned parallel to the minor groove of the PNA. In the case of the bipyridine-containing PNA, two bipyridines from adjacent PNA duplexes form a π-stacked pair that relates the duplexes within the crystal. The bulging out of the bipyridines causes bending of the PNA duplex, which is in contrast to the structure previously reported for biphenyl-modified DNA duplexes in solution, where the biphenyls are π-stacking with adjacent nucleobase pairs and adopt an intrahelical geometry [Johar et al., Chem. Eur. J., 2008, 14, 2080]. This difference shows that relatively small perturbations can significantly impact the relative position of nucleobase analogues in nucleic acid duplexes. PMID:20859960
Spring-Connell, Alexander M.; Evich, Marina G.; Debelak, Harald; Seela, Frank; Germann, Markus W.
2016-01-01
A truly universal nucleobase enables a host of novel applications such as simplified templates for PCR primers, randomized sequencing and DNA based devices. A universal base must pair indiscriminately to each of the canonical bases with little or preferably no destabilization of the overall duplex. In reality, many candidates either destabilize the duplex or do not base pair indiscriminatingly. The novel base 8-aza-7-deazaadenine (pyrazolo[3,4-d]pyrimidin- 4-amine) N8-(2′deoxyribonucleoside), a deoxyadenosine analog (UB), pairs with each of the natural DNA bases with little sequence preference. We have utilized NMR complemented with molecular dynamic calculations to characterize the structure and dynamics of a UB incorporated into a DNA duplex. The UB participates in base stacking with little to no perturbation of the local structure yet forms an unusual base pair that samples multiple conformations. These local dynamics result in the complete disappearance of a single UB proton resonance under native conditions. Accommodation of the UB is additionally stabilized via heightened backbone conformational sampling. NMR combined with various computational techniques has allowed for a comprehensive characterization of both structural and dynamic effects of the UB in a DNA duplex and underlines that the UB as a strong candidate for universal base applications. PMID:27566150
Mark T. Banik; Harold H. Burdsall
1998-01-01
Ten single-spore isolates each of Armillaria sinapina, A. cepistipes, and North American biological species (NABS)X and XI were paired in all combinations. A second set of ten single-spore isolates of each species was likewise paired. Each pairing was duplicated for a total of 3280 pairs. Using the standard morphological criteria (e.g., fluffy, crustose) to assess the...
Image-receptor performance: a comparison of Trophy RVG UI sensor and Kodak Ektaspeed Plus film.
Ludlow, J; Mol, A
2001-01-01
Objective. This study compares the physical characteristics of the RVG UI sensor (RVG) with Ektaspeed Plus film. Dose-response curves were generated for film and for each of 6 available RVG modes. An aluminum step-wedge was used to evaluate exposure latitude. Spatial resolution was assessed by using a line-pair test tool. Latitude and resolution were assessed by observers for both modalities. The RVG was further characterized by its modulation transfer function. Exposure latitude was equal for film and RVG in the periodontal mode. Other gray scale modes demonstrated much lower latitude. The average maximum resolution was 15.3 line-pairs per millimeter (lp/mm) for RVG in high-resolution mode, 10.5 lp/mm for RVG in low-resolution mode, and 20 lp/mm for film (P <.0001). Modulation transfer function measurements supported the subjective assessments. In periodontal mode, the RVG UI sensor demonstrates exposure latitude similar to that of Ektaspeed Plus film. Film images exhibit significantly higher spatial resolution than the RVG images acquired in high-resolution mode.
DNA origami-based shape IDs for single-molecule nanomechanical genotyping
NASA Astrophysics Data System (ADS)
Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai
2017-04-01
Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.
DNA origami-based shape IDs for single-molecule nanomechanical genotyping
Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai
2017-01-01
Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ∼10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level. PMID:28382928
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hoidn, Oliver R.; Seidler, Gerald T., E-mail: seidler@uw.edu
We have integrated mass-produced commercial complementary metal-oxide-semiconductor (CMOS) image sensors and off-the-shelf single-board computers into an x-ray camera platform optimized for acquisition of x-ray spectra and radiographs at energies of 2–6 keV. The CMOS sensor and single-board computer are complemented by custom mounting and interface hardware that can be easily acquired from rapid prototyping services. For single-pixel detection events, i.e., events where the deposited energy from one photon is substantially localized in a single pixel, we establish ∼20% quantum efficiency at 2.6 keV with ∼190 eV resolution and a 100 kHz maximum detection rate. The detector platform’s useful intrinsic energymore » resolution, 5-μm pixel size, ease of use, and obvious potential for parallelization make it a promising candidate for many applications at synchrotron facilities, in laser-heating plasma physics studies, and in laboratory-based x-ray spectrometry.« less
Angelis, G I; Reader, A J; Markiewicz, P J; Kotasidis, F A; Lionheart, W R; Matthews, J C
2013-08-07
Recent studies have demonstrated the benefits of a resolution model within iterative reconstruction algorithms in an attempt to account for effects that degrade the spatial resolution of the reconstructed images. However, these algorithms suffer from slower convergence rates, compared to algorithms where no resolution model is used, due to the additional need to solve an image deconvolution problem. In this paper, a recently proposed algorithm, which decouples the tomographic and image deconvolution problems within an image-based expectation maximization (EM) framework, was evaluated. This separation is convenient, because more computational effort can be placed on the image deconvolution problem and therefore accelerate convergence. Since the computational cost of solving the image deconvolution problem is relatively small, multiple image-based EM iterations do not significantly increase the overall reconstruction time. The proposed algorithm was evaluated using 2D simulations, as well as measured 3D data acquired on the high-resolution research tomograph. Results showed that bias reduction can be accelerated by interleaving multiple iterations of the image-based EM algorithm solving the resolution model problem, with a single EM iteration solving the tomographic problem. Significant improvements were observed particularly for voxels that were located on the boundaries between regions of high contrast within the object being imaged and for small regions of interest, where resolution recovery is usually more challenging. Minor differences were observed using the proposed nested algorithm, compared to the single iteration normally performed, when an optimal number of iterations are performed for each algorithm. However, using the proposed nested approach convergence is significantly accelerated enabling reconstruction using far fewer tomographic iterations (up to 70% fewer iterations for small regions). Nevertheless, the optimal number of nested image-based EM iterations is hard to be defined and it should be selected according to the given application.
Zhang, Jingdong; Zhu, Tao; Zhou, Huan; Huang, Shihong; Liu, Min; Huang, Wei
2016-11-28
We demonstrate a cost-effective distributed fiber sensing system for the multi-parameter detection of the vibration, the temperature, and the strain by integrating phase-sensitive optical time domain reflectometry (φ-OTDR) and Brillouin optical time domain reflectometry (B-OTDR). Taking advantage of the fast changing property of the vibration and the static properties of the temperature and the strain, both the width and intensity of the laser pulses are modulated and injected into the single-mode sensing fiber proportionally, so that three concerned parameters can be extracted simultaneously by only one photo-detector and one data acquisition channel. A data processing method based on Gaussian window short time Fourier transform (G-STFT) is capable of achieving high spatial resolution in B-OTDR. The experimental results show that up to 4.8kHz vibration sensing with 3m spatial resolution at 10km standard single-mode fiber can be realized, as well as the distributed temperature and stress profiles along the same fiber with 80cm spatial resolution.
A Transportable Gravity Gradiometer Based on Atom Interferometry
NASA Technical Reports Server (NTRS)
Yu, Nan; Thompson, Robert J.; Kellogg, James R.; Aveline, David C.; Maleki, Lute; Kohel, James M.
2010-01-01
A transportable atom interferometer-based gravity gradiometer has been developed at JPL to carry out measurements of Earth's gravity field at ever finer spatial resolutions, and to facilitate high-resolution monitoring of temporal variations in the gravity field from ground- and flight-based platforms. Existing satellite-based gravity missions such as CHAMP and GRACE measure the gravity field via precise monitoring of the motion of the satellites; i.e. the satellites themselves function as test masses. JPL's quantum gravity gradiometer employs a quantum phase measurement technique, similar to that employed in atomic clocks, made possible by recent advances in laser cooling and manipulation of atoms. This measurement technique is based on atomwave interferometry, and individual laser-cooled atoms are used as drag-free test masses. The quantum gravity gradiometer employs two identical atom interferometers as precision accelerometers to measure the difference in gravitational acceleration between two points (Figure 1). By using the same lasers for the manipulation of atoms in both interferometers, the accelerometers have a common reference frame and non-inertial accelerations are effectively rejected as common mode noise in the differential measurement of the gravity gradient. As a result, the dual atom interferometer-based gravity gradiometer allows gravity measurements on a moving platform, while achieving the same long-term stability of the best atomic clocks. In the laboratory-based prototype (Figure 2), the cesium atoms used in each atom interferometer are initially collected and cooled in two separate magneto-optic traps (MOTs). Each MOT, consisting of three orthogonal pairs of counter-propagating laser beams centered on a quadrupole magnetic field, collects up to 10(exp 9) atoms. These atoms are then launched vertically as in an atom fountain by switching off the magnetic field and introducing a slight frequency shift between pairs of lasers to create a moving rest frame for the trapped atoms. While still in this moving-frame molasses, the laser frequencies are further detuned from the atomic resonance (while maintaining this relative frequency shift) to cool the atom cloud's temperature to 2 K or below, corresponding to an rms velocity of less than 2 cm/s. After launch, the cold atoms undergo further state and velocity selection to prepare for atom interferometry. The atom interferometers are then realized using laser-induced stimulated Raman transitions to perform the necessary manipulations of each atom, and the resulting interferometer phase is measured using laser-induced fluorescence for state-normalized detection. More than 20 laser beams with independent controls of frequency, phase, and intensity are required for this measurement sequence. This instrument can facilitate the study of Earth's gravitational field from surface and air vehicles, as well as from space by allowing gravity mapping from a low-cost, single spacecraft mission. In addition, the operation of atom interferometer-based instruments in space offers greater sensitivity than is possible in terrestrial instruments due to the much longer interrogation times available in the microgravity environment. A space-based quantum gravity gradiometer has the potential to achieve sensitivities similar to the GRACE mission at long spatial wavelengths, and will also have resolution similar to GOCE for measurement at shorter length scales.
Kumar, Amit; Park, HaJeung; Fang, Pengfei; Parkesh, Raman; Guo, Min; Nettles, Kendall W.; Disney, Matthew D.
2011-01-01
RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5′CUG/3′GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures are disclosed of a model DM1 triplet repeating construct, 5′r(UUGGGC(CUG)3GUCC)2, refined to 2.20 Å and 1.52 Å resolution. Here, differences in orientation of the 5′ dangling UU end between the two structures induce changes in the backbone groove width, which reveals that non-canonical 1×1 nucleotide UU internal loops can display an ensemble of pairing conformations. In the 2.20 Å structure, CUGa, the 5′UU forms one hydrogen-bonded pairs with a 5′UU of a neighboring helix in the unit cell to form a pseudo-infinite helix. The central 1×1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1×1 nucleotide UU internal loops each form a one hydrogen-bonded pair. In the 1.52 Å structure, CUGb, the 5′ UU dangling end is tucked into the major groove of the duplex. While the canonical paired bases show no change in base pairing, in CUGb the terminal 1×1 nucleotide UU internal loops form now two hydrogen-bonded pairs. Thus, the shift in major groove induced by the 5′UU dangling end alters non-canonical base patterns. Collectively, these structures indicate that 1×1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands. PMID:21988728
Kumar, Amit; Park, HaJeung; Fang, Pengfei; Parkesh, Raman; Guo, Min; Nettles, Kendall W; Disney, Matthew D
2011-11-15
RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5'CUG/3'GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures of a model DM1 triplet repeating construct, 5'r[UUGGGC(CUG)(3)GUCC](2), refined to 2.20 and 1.52 Å resolution are disclosed. Here, differences in the orientation of the 5' dangling UU end between the two structures induce changes in the backbone groove width, which reveals that noncanonical 1 × 1 nucleotide UU internal loops can display an ensemble of pairing conformations. In the 2.20 Å structure, CUGa, the 5' UU forms a one hydrogen-bonded pair with a 5' UU of a neighboring helix in the unit cell to form a pseudoinfinite helix. The central 1 × 1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1 × 1 nucleotide UU internal loops each form a one-hydrogen bond pair. In the 1.52 Å structure, CUGb, the 5' UU dangling end is tucked into the major groove of the duplex. While the canonically paired bases show no change in base pairing, in CUGb the terminal 1 × 1 nucleotide UU internal loops now form two hydrogen-bonded pairs. Thus, the shift in the major groove induced by the 5' UU dangling end alters noncanonical base patterns. Collectively, these structures indicate that 1 × 1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kumar, Amit; Park, HaJeung; Fang, Pengfei
2012-03-27
RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5'CUG/3'GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures of a model DM1 triplet repeating construct, 5'r[{und UU}GGGC(C{und U}G){sub 3}GUCC]{sub 2}, refined to 2.20 and 1.52 {angstrom} resolution are disclosed. Here, differences in the orientation of the 5' dangling UU end between the two structures induce changes in the backbone groove width, which reveals that noncanonical 1 x 1 nucleotide UU internal loops can display an ensemble of pairing conformations.more » In the 2.20 {angstrom} structure, CUGa, the 5' UU forms a one hydrogen-bonded pair with a 5' UU of a neighboring helix in the unit cell to form a pseudoinfinite helix. The central 1 x 1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1 x 1 nucleotide UU internal loops each form a one-hydrogen bond pair. In the 1.52 {angstrom} structure, CUGb, the 5' UU dangling end is tucked into the major groove of the duplex. While the canonically paired bases show no change in base pairing, in CUGb the terminal 1 x 1 nucleotide UU internal loops now form two hydrogen-bonded pairs. Thus, the shift in the major groove induced by the 5' UU dangling end alters noncanonical base patterns. Collectively, these structures indicate that 1 x 1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands.« less
Leonard, D A; Rajaram, N; Kerppola, T K
1997-05-13
Interactions among transcription factors that bind to separate sequence elements require bending of the intervening DNA and juxtaposition of interacting molecular surfaces in an appropriate orientation. Here, we examine the effects of single amino acid substitutions adjacent to the basic regions of Fos and Jun as well as changes in sequences flanking the AP-1 site on DNA bending. Substitution of charged amino acid residues at positions adjacent to the basic DNA-binding domains of Fos and Jun altered DNA bending. The change in DNA bending was directly proportional to the change in net charge for all heterodimeric combinations between these proteins. Fos and Jun induced distinct DNA bends at different binding sites. Exchange of a single base pair outside of the region contacted in the x-ray crystal structure altered DNA bending. Substitution of base pairs flanking the AP-1 site had converse effects on the opposite directions of DNA bending induced by homodimers and heterodimers. These results suggest that Fos and Jun induce DNA bending in part through electrostatic interactions between amino acid residues adjacent to the basic region and base pairs flanking the AP-1 site. DNA bending by Fos and Jun at inverted binding sites indicated that heterodimers bind to the AP-1 site in a preferred orientation. Mutation of a conserved arginine within the basic regions of Fos and transversion of the central C:G base pair in the AP-1 site to G:C had complementary effects on the orientation of heterodimer binding and DNA bending. The conformational variability of the Fos-Jun-AP-1 complex may contribute to its functional versatility at different promoters.
Zhang, Meng; Gao, Jiazi; Huang, Xu; Zhang, Min; Liu, Bei
2017-01-01
Quantitative computed tomography-based finite element analysis (QCT/FEA) has been developed to predict vertebral strength. However, QCT/FEA models may be different with scan resolutions and element sizes. The aim of this study was to explore the effects of scan resolutions and element sizes on QCT/FEA outcomes. Nine bovine vertebral bodies were scanned using the clinical CT scanner and reconstructed from datasets with the two-slice thickness, that is, 0.6 mm (PA resolution) and 1 mm (PB resolution). There were significantly linear correlations between the predicted and measured principal strains (R2 > 0.7, P < 0.0001), and the predicted vertebral strength and stiffness were modestly correlated with the experimental values (R2 > 0.6, P < 0.05). Two different resolutions and six different element sizes were combined in pairs, and finite element (FE) models of bovine vertebral cancellous bones in the 12 cases were obtained. It showed that the mechanical parameters of FE models with the PB resolution were similar to those with the PA resolution. The computational accuracy of FE models with the element sizes of 0.41 × 0.41 × 0.6 mm3 and 0.41 × 0.41 × 1 mm3 was higher by comparing the apparent elastic modulus and yield strength. Therefore, scan resolution and element size should be chosen optimally to improve the accuracy of QCT/FEA. PMID:29065624
NASA Technical Reports Server (NTRS)
Kang, C.; Berger, I.; Lockshin, C.; Ratliff, R.; Moyzis, R.; Rich, A.
1995-01-01
In most metazoans, the telomeric cytosine-rich strand repeating sequence is d(TAACCC). The crystal structure of this sequence was solved to 1.9-A resolution. Four strands associate via the cytosine-containing parts to form a four-stranded intercalated structure held together by C.C+ hydrogen bonds. The base-paired strands are parallel to each other, and the two duplexes are intercalated into each other in opposite orientations. One TAA end forms a highly stabilized loop with the 5' thymine Hoogsteen-base-paired to the third adenine. The 5' end of this loop is in close proximity to the 3' end of one of the other intercalated cytosine strands. Instead of being entirely in a DNA duplex, this structure suggests the possibility of an alternative conformation for the cytosine-rich telomere strands.
Hydration sites of unpaired RNA bases: a statistical analysis of the PDB structures.
Kirillova, Svetlana; Carugo, Oliviero
2011-10-19
Hydration is crucial for RNA structure and function. X-ray crystallography is the most commonly used method to determine RNA structures and hydration and, therefore, statistical surveys are based on crystallographic results, the number of which is quickly increasing. A statistical analysis of the water molecule distribution in high-resolution X-ray structures of unpaired RNA nucleotides showed that: different bases have the same penchant to be surrounded by water molecules; clusters of water molecules indicate possible hydration sites, which, in some cases, match those of the major and minor grooves of RNA and DNA double helices; complex hydrogen bond networks characterize the solvation of the nucleotides, resulting in a significant rigidity of the base and its surrounding water molecules. Interestingly, the hydration sites around unpaired RNA bases do not match, in general, the positions that are occupied by the second nucleotide when the base-pair is formed. The hydration sites around unpaired RNA bases were found. They do not replicate the atom positions of complementary bases in the Watson-Crick pairs.
Hydration sites of unpaired RNA bases: a statistical analysis of the PDB structures
2011-01-01
Background Hydration is crucial for RNA structure and function. X-ray crystallography is the most commonly used method to determine RNA structures and hydration and, therefore, statistical surveys are based on crystallographic results, the number of which is quickly increasing. Results A statistical analysis of the water molecule distribution in high-resolution X-ray structures of unpaired RNA nucleotides showed that: different bases have the same penchant to be surrounded by water molecules; clusters of water molecules indicate possible hydration sites, which, in some cases, match those of the major and minor grooves of RNA and DNA double helices; complex hydrogen bond networks characterize the solvation of the nucleotides, resulting in a significant rigidity of the base and its surrounding water molecules. Interestingly, the hydration sites around unpaired RNA bases do not match, in general, the positions that are occupied by the second nucleotide when the base-pair is formed. Conclusions The hydration sites around unpaired RNA bases were found. They do not replicate the atom positions of complementary bases in the Watson-Crick pairs. PMID:22011380
Pair correlations in low-lying T =0 states of odd-odd nuclei with six nucleons
NASA Astrophysics Data System (ADS)
Fu, G. J.; Zhao, Y. M.; Arima, A.
2018-02-01
In this paper, we study pair correlations in low-lying T =0 states for two typical cases of odd-odd N =Z nuclei. The first case is six nucleons in a single j =9 /2 shell, for which we study the S -broken-pair approximation, the isoscalar spin-1 pair condensation, and the isoscalar spin-aligned pair condensation, with schematic interactions. In the second case, we study pair approximations and correlation energies for 22Na, 34Cl, 46V, 62Ga, and 94Ag in multi-j shells with effective interactions. A few T =0 states are found to be well represented by isoscalar nucleon pairs. The isoscalar spin-aligned pairs play an important role for the yrast T =0 states with I ˜2 j and I ˜Imax in 22Na, 46V, and 94Ag. The overlap between the isoscalar J =1 pair wave function and the shell-model wave function is around 0.5 for the I =1 ,3 states of 34Cl and the I =1 state of 94Ag. The I =9 state of 62Ga is very well described by the isoscalar J =3 pair condensation. The broken-pair approximation (which is similar to the 2-quasiparticle excitation of the isovector pair condensation) is appropriate for quite few states, such as the I =1 -3 states of 34Cl and the I =5 state of 62Ga. The correlation energies are presented in this paper. It is noted that the picture based on nucleon-pair wave functions is not always in agreement with the picture based on correlation energies.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kondo, Takeshi; Palczewski, Ari; Hamaya, Yoichiro
We use angle-resolved photoemission spectroscopy and a new quantitative approach based on the partial density of states to study properties of seemingly disconnected portions of the Fermi surface (FS) that are present in the pseudogap state of cuprates called Fermi arcs. We find that the normal state FS collapses very abruptly into Fermi arcs at the pseudogap temperature (T*). Surprisingly, the length of the Fermi arcs remains constant over an extended temperature range between (T*) and T pair, consistent with the presence of an ordered state below T*. These arcs collapse again at the temperature below which pair formation occursmore » (T pair) either to a point or a very short arc, whose length is limited by our experimental resolution. The tips of the arcs span between points defining a set of wave vectors in momentum space, which are the fingerprints of the ordered state that causes the pseudogap.« less
NASA Astrophysics Data System (ADS)
Liu, Lingling; Li, Chenxi; Zhao, Huijuan; Yi, Xi; Gao, Feng; Meng, Wei; Lu, Yiming
2014-03-01
Radiance is sensitive to the variations of tissue optical parameters, such as absorption coefficient μa, scattering coefficient μs, and anisotropy factor g. Therefore, similar to fluence, radiance can be used for tissue characterization. Compared with fluence, radiance has the advantage of offering the direction information of light intensity. Taking such advantage, the optical parameters can be determined by rotating the detector through 360 deg with only a single optode pair. Instead of the translation mode used in the fluence-based technologies, the Rotation mode has less invasiveness in the clinical diagnosis. This paper explores a new method to obtain the optical properties by measuring the distribution of light intensity in liquid phantom with only a single optode pair and the detector rotation through 360 deg. The angular radiance and distance-dependent radiance are verified by comparing experimental measurement data with Monte Carlo (MC) simulation for the short source-detector separations and diffusion approximation for the large source-detector separations. Detecting angular radiance with only a single optode pair under a certain source-detection separation will present a way for prostate diagnose and light dose calculation during the photon dynamic therapy (PDT).
Electro-optic modulation for high-speed characterization of entangled photon pairs
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lukens, Joseph M.; Odele, Ogaga D.; Leaird, Daniel E.
In this study, we demonstrate a new biphoton manipulation and characterization technique based on electro-optic intensity modulation and time shifting. By applying fast modulation signals with a sharply peaked cross-correlation to each photon from an entangled pair, it is possible to measure temporal correlations with significantly higher precision than that attainable using standard single-photon detection. Low-duty-cycle pulses and maximal-length sequences are considered as modulation functions, reducing the time spread in our correlation measurement by a factor of five compared to our detector jitter. With state-of-the-art electro-optic components, we expect the potential to surpass the speed of any single-photon detectors currentlymore » available.« less
Electro-optic modulation for high-speed characterization of entangled photon pairs
Lukens, Joseph M.; Odele, Ogaga D.; Leaird, Daniel E.; ...
2015-11-10
In this study, we demonstrate a new biphoton manipulation and characterization technique based on electro-optic intensity modulation and time shifting. By applying fast modulation signals with a sharply peaked cross-correlation to each photon from an entangled pair, it is possible to measure temporal correlations with significantly higher precision than that attainable using standard single-photon detection. Low-duty-cycle pulses and maximal-length sequences are considered as modulation functions, reducing the time spread in our correlation measurement by a factor of five compared to our detector jitter. With state-of-the-art electro-optic components, we expect the potential to surpass the speed of any single-photon detectors currentlymore » available.« less
Phase-space analysis of the Schwinger effect in inhomogeneous electromagnetic fields
NASA Astrophysics Data System (ADS)
Kohlfürst, Christian
2018-05-01
Schwinger pair production in spatially and temporally inhomogeneous electric and magnetic fields is studied. The focus is on the particle phase-space distribution within a high-intensity few-cycle pulse. Accurate numerical solutions of a quantum kinetic theory (DHW formalism) are presented in momentum space and, with the aid of coarse-graining techniques, in a mixed spatial-momentum representation. Additionally, signatures of the carrier-envelope phase as well as spin-field interactions are discussed on the basis of a trajectory-based model taking into account instantaneous pair production and relativistic single-particle dynamics. Although our simple semi-classical single-particle model cannot describe every aspect of the particle production process (quantum interferences), essential features such as spin-field interactions are captured.
Waveguide-Coupled Superconducting Nanowire Single-Photon Detectors
NASA Technical Reports Server (NTRS)
Beyer, Andrew D.; Briggs, Ryan M.; Marsili, Francesco; Cohen, Justin D.; Meenehan, Sean M.; Painter, Oskar J.; Shaw, Matthew D.
2015-01-01
We have demonstrated WSi-based superconducting nanowire single-photon detectors coupled to SiNx waveguides with integrated ring resonators. This photonics platform enables the implementation of robust and efficient photon-counting detectors with fine spectral resolution near 1550 nm.
A small, linear, piezoelectric ultrasonic cryomotor
NASA Astrophysics Data System (ADS)
Dong, Shuxiang; Yan, Li; Wang, Naigang; Viehland, Dwight; Jiang, Xiaoning; Rehrig, Paul; Hackenberger, Wes
2005-01-01
A small, linear-type, piezoelectric ultrasonic cryomotor has been developed for precision positioning at extremely low temperatures (⩾-200°C). This cryomotor consists of a pair of Pb(Mg1/3Nb2/3)O3-PbTiO3 single crystal stacks, which are piezoelectrically excited into the rotating third-bending mode of the cryomotor stator's center, which in turn drives a contacted slider into linear motion via frictional forces. The performance characteristics achieved by the cryomotor are: (i) a maximum linear speed of >50mm /s; (ii) a stroke of >10mm; (iii) a driving force of >0.2N; (iv) a response time of ˜29ms; and (v) a step resolution of ˜20nm.
Pietrzak, Robert H; Scott, James Cobb; Harel, Brian T; Lim, Yen Ying; Snyder, Peter J; Maruff, Paul
2012-11-01
Alprazolam is a benzodiazepine that, when administered acutely, results in impairments in several aspects of cognition, including attention, learning, and memory. However, the profile (i.e., component processes) that underlie alprazolam-related decrements in visual paired associate learning has not been fully explored. In this double-blind, placebo-controlled, randomized cross-over study of healthy older adults, we used a novel, "process-based" computerized measure of visual paired associate learning to examine the effect of a single, acute 1-mg dose of alprazolam on component processes of visual paired associate learning and memory. Acute alprazolam challenge was associated with a large magnitude reduction in visual paired associate learning and memory performance (d = 1.05). Process-based analyses revealed significant increases in distractor, exploratory, between-search, and within-search error types. Analyses of percentages of each error type suggested that, relative to placebo, alprazolam challenge resulted in a decrease in the percentage of exploratory errors and an increase in the percentage of distractor errors, both of which reflect memory processes. Results of this study suggest that acute alprazolam challenge decreases visual paired associate learning and memory performance by reducing the strength of the association between pattern and location, which may reflect a general breakdown in memory consolidation, with less evidence of reductions in executive processes (e.g., working memory) that facilitate visual paired associate learning and memory. Copyright © 2012 John Wiley & Sons, Ltd.
Fraley, Stephanie I; Hardick, Justin; Masek, Billie J; Jo Masek, Billie; Athamanolap, Pornpat; Rothman, Richard E; Gaydos, Charlotte A; Carroll, Karen C; Wakefield, Teresa; Wang, Tza-Huei; Yang, Samuel
2013-10-01
Comprehensive profiling of nucleic acids in genetically heterogeneous samples is important for clinical and basic research applications. Universal digital high-resolution melt (U-dHRM) is a new approach to broad-based PCR diagnostics and profiling technologies that can overcome issues of poor sensitivity due to contaminating nucleic acids and poor specificity due to primer or probe hybridization inaccuracies for single nucleotide variations. The U-dHRM approach uses broad-based primers or ligated adapter sequences to universally amplify all nucleic acid molecules in a heterogeneous sample, which have been partitioned, as in digital PCR. Extensive assay optimization enables direct sequence identification by algorithm-based matching of melt curve shape and Tm to a database of known sequence-specific melt curves. We show that single-molecule detection and single nucleotide sensitivity is possible. The feasibility and utility of U-dHRM is demonstrated through detection of bacteria associated with polymicrobial blood infection and microRNAs (miRNAs) associated with host response to infection. U-dHRM using broad-based 16S rRNA gene primers demonstrates universal single cell detection of bacterial pathogens, even in the presence of larger amounts of contaminating bacteria; U-dHRM using universally adapted Lethal-7 miRNAs in a heterogeneous mixture showcases the single copy sensitivity and single nucleotide specificity of this approach.
Ariel, Robert; Price, Jodi; Hertzog, Christopher
2015-01-01
Value-based remembering in free recall tasks may be spared from the typical age-related cognitive decline observed for episodic memory. However, it is unclear whether value-based remembering for associative information is also spared from age-related cognitive decline. The current experiments evaluated the contribution of agenda-based based regulation and strategy use during study to age differences and similarities in value-based remembering of associative information. Participants studied word pairs (Experiments 1-2) or single words (Experiment 2) slated with different point values by moving a mouse controlled cursor to different spatial locations to reveal either items for study or the point value associated with remembering each item. Some participants also provided strategy reports for each item. Younger and older adults allocated greater time to studying high than low valued information, reported using normatively effective encoding strategies to learn high-valued pairs, and avoided study of low-valued pairs. As a consequence, both age groups selectively remembered more high than low-valued items. Despite nearly identical regulatory behavior, an associative memory deficit for older adults was present for high valued pairs. Age differences in value-based remembering did not occur when the materials were word lists. Fluid intelligence also moderated the effectiveness of older adults’ strategy use for high valued pairs (Experiment 2). These results suggest that age differences in associative value-based remembering may be due to some older adults’ gleaning less benefit from using normatively effective encoding strategies rather than age differences in metacognitive self-regulation per se. PMID:26523692
Using Single Colors and Color Pairs to Communicate Basic Tastes.
Woods, Andy T; Spence, Charles
2016-01-01
Recently, it has been demonstrated that people associate each of the basic tastes (e.g., sweet, sour, bitter, and salty) with specific colors (e.g., red, green, black, and white). In the present study, we investigated whether pairs of colors (both associated with a particular taste or taste word) would give rise to stronger associations relative to pairs of colors that were associated with different tastes. We replicate the findings of previous studies highlighting the existence of a robust crossmodal correspondence between individual colors and basic tastes. However, while there was evidence that pairs of colors could indeed communicate taste information more consistently than single colors, our participants took more than twice as long to match the color pairs with tastes than the single colors. Possible reasons for these results are discussed.
NASA Astrophysics Data System (ADS)
Wen, C.; Ge, B. H.; Cui, Y. X.; Li, F. H.; Zhu, J.; Yu, R.; Cheng, Z. Y.
2014-11-01
The stacking faults (SFs) in an AlSb/GaAs (001) interface were investigated using a 300 kV spherical aberration-corrected high-resolution transmission electron microscope (HRTEM). The structure and strain distribution of the single and intersecting (V-shaped) SFs associated with partial dislocations (PDs) were characterized by the [110] HRTEM images and geometric phase analysis, respectively. In the biaxial strain maps ɛxx and ɛyy, a SF can be divided into several sections under different strain states (positive or negative strain values). Furthermore, the strain state for the same section of a SF is in contrast to each other in ɛxx and ɛyy strain maps. The modification in the strain states was attributed to the variation in the local atomic displacements for the SF in the AlSb film on the GaAs substrate recorded in the lattice image. Finally, the single SF was found to be bounded by two 30° PDs. A pair of 30° PDs near the heteroepitaxial interface reacted to form a Lomer-Cottrell sessile dislocation located at the vertices of V-shaped SFs with opposite screw components. The roles of misfit dislocations, such as the PDs, in strain relaxation were also discussed.
Anazawa, T; Yasuda, K; Ishiwata, S
1992-05-01
We have devised a simple method for measuring tension development of single myofibrils by micromanipulation with a pair of glass micro-needles. The tension was estimated from the deflection of a flexible needle under an inverted phase-contrast microscope equipped with an image processor, so that the tension development is always accompanied by the shortening of the myofibril (auxotonic condition) in the present setup. The advantage of this method is that the measurement of tension (1/30 s for time resolution and about 0.05 micrograms for accuracy of tension measurement; 0.05 microns as a spatial resolution for displacement of the micro-needle) and the observation of sarcomere structure are possible at the same time, and the technique to hold myofibrils, even single myofibrils, is very simple. This method has been applied to study the tension development of glycerinated skeletal myofibrils under the condition where spontaneous oscillation of sarcomeres is induced, i.e., the coexistence of MgATP, MgADP and inorganic phosphate without free Ca2+. Under this condition, we found that the tension of myofibrils spontaneously oscillates accompanied by the oscillation of sarcomere length with a main period of a few seconds; the period was lengthened and shortened with stretch and release of myofibrils. A possible mechanism of the oscillation is discussed.
NASA Astrophysics Data System (ADS)
Mercer, Jason J.; Westbrook, Cherie J.
2016-11-01
Microform is important in understanding wetland functions and processes. But collecting imagery of and mapping the physical structure of peatlands is often expensive and requires specialized equipment. We assessed the utility of coupling computer vision-based structure from motion with multiview stereo photogrammetry (SfM-MVS) and ground-based photos to map peatland topography. The SfM-MVS technique was tested on an alpine peatland in Banff National Park, Canada, and guidance was provided on minimizing errors. We found that coupling SfM-MVS with ground-based photos taken with a point and shoot camera is a viable and competitive technique for generating ultrahigh-resolution elevations (i.e., <0.01 m, mean absolute error of 0.083 m). In evaluating 100+ viable SfM-MVS data collection and processing scenarios, vegetation was found to considerably influence accuracy. Vegetation class, when accounted for, reduced absolute error by as much as 50%. The logistic flexibility of ground-based SfM-MVS paired with its high resolution, low error, and low cost makes it a research area worth developing as well as a useful addition to the wetland scientists' toolkit.