Sample records for single nucleotide difference

  1. Compositions and methods for detecting single nucleotide polymorphisms

    DOEpatents

    Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.

    2016-11-22

    Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.

  2. Aspergillus and Penicillium identification using DNA sequences: Barcode or MLST?

    USDA-ARS?s Scientific Manuscript database

    Current methods in DNA technology can detect single nucleotide polymorphisms with measurable accuracy using several different approaches appropriate for different uses. If there are even single nucleotide differences that are invariant markers of the species, we can accomplish identification through...

  3. PCR/LDR/capillary electrophoresis for detection of single-nucleotide differences between fetal and maternal DNA in maternal plasma.

    PubMed

    Yi, Ping; Chen, Zhuqin; Zhao, Yan; Guo, Jianxin; Fu, Huabin; Zhou, Yuanguo; Yu, Lili; Li, Li

    2009-03-01

    The discovery of fetal DNA in maternal plasma has opened up an approach for noninvasive diagnosis. We have now assessed the possibility of detecting single-nucleotide differences between fetal and maternal DNA in maternal plasma by polymerase chain reaction (PCR)/ligase detection reaction((LDR)/capillary electrophoresis. PCR/LDR/capillary electrophoresis was applied to detect the genotype of c.454-397T>gene (ESR1) from experimental DNA models of maternal plasma at different sensitivity levels and 13 maternal plasma samples.alphaC in estrogen receptor. (1) Our results demonstrated that the technique could discriminate low abundance single-nucleotide mutation with a mutant/normal allele ratio up to 1:10 000. (2) Examination of ESR1 c.454-397T>C genotypes by using the method of restriction fragment length analysis was performed in 25 pregnant women, of whom 13 pregnant women had homozygous genotypes. The c.454-397T>C genotypes of paternally inherited fetal DNA in maternal plasma of these 13 women were detected by PCR/LDR/capillary electrophoresis, which were accordant with the results of umbilical cord blood. PCR/LDR/capillary electrophoresis has very high sensitivity to distinguish low abundance single nucleotide differences and can discriminate point mutations and single-nucleotide polymorphisms(SNPs) of paternally inherited fetal DNA in maternal plasma.

  4. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    PubMed

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-28

    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  5. An Engineered Kinetic Amplification Mechanism for Single Nucleotide Variant Discrimination by DNA Hybridization Probes.

    PubMed

    Chen, Sherry Xi; Seelig, Georg

    2016-04-20

    Even a single-nucleotide difference between the sequences of two otherwise identical biological nucleic acids can have dramatic functional consequences. Here, we use model-guided reaction pathway engineering to quantitatively improve the performance of selective hybridization probes in recognizing single nucleotide variants (SNVs). Specifically, we build a detection system that combines discrimination by competition with DNA strand displacement-based catalytic amplification. We show, both mathematically and experimentally, that the single nucleotide selectivity of such a system in binding to single-stranded DNA and RNA is quadratically better than discrimination due to competitive hybridization alone. As an additional benefit the integrated circuit inherits the property of amplification and provides at least 10-fold better sensitivity than standard hybridization probes. Moreover, we demonstrate how the detection mechanism can be tuned such that the detection reaction is agnostic to the position of the SNV within the target sequence. in contrast, prior strand displacement-based probes designed for kinetic discrimination are highly sensitive to position effects. We apply our system to reliably discriminate between different members of the let-7 microRNA family that differ in only a single base position. Our results demonstrate the power of systematic reaction network design to quantitatively improve biotechnology.

  6. Genetic polymorphisms in ESR1 and ESR2 genes, and risk of hypospadias in a multiethnic study population.

    PubMed

    Choudhry, Shweta; Baskin, Laurence S; Lammer, Edward J; Witte, John S; Dasgupta, Sudeshna; Ma, Chen; Surampalli, Abhilasha; Shen, Joel; Shaw, Gary M; Carmichael, Suzan L

    2015-05-01

    Estrogenic endocrine disruptors acting via estrogen receptors α (ESR1) and β (ESR2) have been implicated in the etiology of hypospadias, a common congenital malformation of the male external genitalia. We determined the association of single nucleotide polymorphisms in ESR1 and ESR2 genes with hypospadias in a racially/ethnically diverse study population of California births. We investigated the relationship between hypospadias and 108 ESR1 and 36 ESR2 single nucleotide polymorphisms in 647 cases and 877 population based nonmalformed controls among infants born in selected California counties from 1990 to 2003. Subgroup analyses were performed by race/ethnicity (nonHispanic white and Hispanic subjects) and by hypospadias severity (mild to moderate and severe). Odds ratios for 33 of the 108 ESR1 single nucleotide polymorphisms had p values less than 0.05 (p = 0.05 to 0.007) for risk of hypospadias. However, none of the 36 ESR2 single nucleotide polymorphisms was significantly associated. In stratified analyses the association results were consistent by disease severity but different sets of single nucleotide polymorphisms were significantly associated with hypospadias in nonHispanic white and Hispanic subjects. Due to high linkage disequilibrium across the single nucleotide polymorphisms, haplotype analyses were conducted and identified 6 haplotype blocks in ESR1 gene that had haplotypes significantly associated with an increased risk of hypospadias (OR 1.3 to 1.8, p = 0.04 to 0.00001). Similar to single nucleotide polymorphism analysis, different ESR1 haplotypes were associated with risk of hypospadias in nonHispanic white and Hispanic subjects. No significant haplotype association was observed for ESR2. The data provide evidence that ESR1 single nucleotide polymorphisms and haplotypes influence the risk of hypospadias in white and Hispanic subjects, and warrant further examination in other study populations. Copyright © 2015 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  7. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

    PubMed Central

    Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

    2016-01-01

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

  8. Lack of Association Between Toll-like Receptor 2 Polymorphisms (R753Q and A-16934T) and Atopic Dermatitis in Children from Thrace Region of Turkey

    PubMed Central

    Can, Ceren; Yazıcıoğlu, Mehtap; Gürkan, Hakan; Tozkır, Hilmi; Görgülü, Adnan; Süt, Necdet Hilmi

    2017-01-01

    Background: Atopic dermatitis is the most common chronic inflammatory skin disease. A complex interaction of both genetic and environmental factors is thought to contribute to the disease. Aims: To evaluate whether single nucleotide polymorphisms in the TLR2 gene c.2258C>T (R753Q) (rs5743708) and TLR2 c.-148+1614T>A (A-16934T) (rs4696480) (NM_0032643) are associated with atopic dermatitis in Turkish children. Study Design: Case-control study. Methods: The study was conducted on 70 Turkish children with atopic dermatitis aged 0.5-18 years. The clinical severity of atopic dermatitis was evaluated by the severity scoring of atopic dermatitis index. Serum total IgE levels, specific IgE antibodies to inhalant and food allergens were measured in both atopic dermatitis patients and controls, skin prick tests were done on 70 children with atopic dermatitis. Genotyping for TLR2 (R753Q and A-16934T) single nucleotide polymorphisms was performed in both atopic dermatitis patients and controls. Results: Cytosine-cytosine and cytosin-thymine genotype frequencies of the TLR2 R753Q single nucleotide polymorphism in the atopic dermatitis group were determined as being 98.6% and 1.4%, cytosine allele frequency for TLR2 R753Q single nucleotide polymorphism was determined as 99.29% and the thymine allele frequency was 0.71%, thymine-thymine, thymine-adenine, and adenine-adenine genotype frequencies of the TLR2 A-16934T single nucleotide polymorphism were 24.3%, 44.3%, and 31.4%. The thymine allele frequency for the TLR2 A-16934T single nucleotide polymorphism in the atopic dermatitis group was 46.43%, and the adenine allele frequency was 53.57%, respectively. There was not statistically significant difference between the groups for all investigated polymorphisms (p>0.05). For all single nucleotide polymorphisms studied, allelic distribution was analogous among atopic dermatitis patients and controls, and no significant statistical difference was observed. No homozygous carriers of the TLR2 R753Q single nucleotide polymorphism were found in the atopic dermatitis and control groups. Conclusion: The TLR2 (R753Q and A-16934T) single nucleotide polymorphisms are not associated with atopic dermatitis in a group of Turkish patients. PMID:28443596

  9. Lack of Association Between Toll-like Receptor 2 Polymorphisms (R753Q and A-16934T) and Atopic Dermatitis in Children from Thrace Region of Turkey.

    PubMed

    Can, Ceren; Yazıcıoğlu, Mehtap; Gürkan, Hakan; Tozkır, Hilmi; Görgülü, Adnan; Süt, Necdet Hilmi

    2017-05-05

    Atopic dermatitis is the most common chronic inflammatory skin disease. A complex interaction of both genetic and environmental factors is thought to contribute to the disease. To evaluate whether single nucleotide polymorphisms in the TLR2 gene c.2258C>T (R753Q) (rs5743708) and TLR2 c.-148+1614T>A (A-16934T) (rs4696480) (NM_0032643) are associated with atopic dermatitis in Turkish children. Case-control study. The study was conducted on 70 Turkish children with atopic dermatitis aged 0.5-18 years. The clinical severity of atopic dermatitis was evaluated by the severity scoring of atopic dermatitis index. Serum total IgE levels, specific IgE antibodies to inhalant and food allergens were measured in both atopic dermatitis patients and controls, skin prick tests were done on 70 children with atopic dermatitis. Genotyping for TLR2 (R753Q and A-16934T) single nucleotide polymorphisms was performed in both atopic dermatitis patients and controls. Cytosine-cytosine and cytosin-thymine genotype frequencies of the TLR2 R753Q single nucleotide polymorphism in the atopic dermatitis group were determined as being 98.6% and 1.4%, cytosine allele frequency for TLR2 R753Q single nucleotide polymorphism was determined as 99.29% and the thymine allele frequency was 0.71%, thymine-thymine, thymine-adenine, and adenine-adenine genotype frequencies of the TLR2 A-16934T single nucleotide polymorphism were 24.3%, 44.3%, and 31.4%. The thymine allele frequency for the TLR2 A-16934T single nucleotide polymorphism in the atopic dermatitis group was 46.43%, and the adenine allele frequency was 53.57%, respectively. There was not statistically significant difference between the groups for all investigated polymorphisms (p>0.05). For all single nucleotide polymorphisms studied, allelic distribution was analogous among atopic dermatitis patients and controls, and no significant statistical difference was observed. No homozygous carriers of the TLR2 R753Q single nucleotide polymorphism were found in the atopic dermatitis and control groups. The TLR2 (R753Q and A-16934T) single nucleotide polymorphisms are not associated with atopic dermatitis in a group of Turkish patients.

  10. High-throughput discovery of rare human nucleotide polymorphisms by Ecotilling

    PubMed Central

    Till, Bradley J.; Zerr, Troy; Bowers, Elisabeth; Greene, Elizabeth A.; Comai, Luca; Henikoff, Steven

    2006-01-01

    Human individuals differ from one another at only ∼0.1% of nucleotide positions, but these single nucleotide differences account for most heritable phenotypic variation. Large-scale efforts to discover and genotype human variation have been limited to common polymorphisms. However, these efforts overlook rare nucleotide changes that may contribute to phenotypic diversity and genetic disorders, including cancer. Thus, there is an increasing need for high-throughput methods to robustly detect rare nucleotide differences. Toward this end, we have adapted the mismatch discovery method known as Ecotilling for the discovery of human single nucleotide polymorphisms. To increase throughput and reduce costs, we developed a universal primer strategy and implemented algorithms for automated band detection. Ecotilling was validated by screening 90 human DNA samples for nucleotide changes in 5 gene targets and by comparing results to public resequencing data. To increase throughput for discovery of rare alleles, we pooled samples 8-fold and found Ecotilling to be efficient relative to resequencing, with a false negative rate of 5% and a false discovery rate of 4%. We identified 28 new rare alleles, including some that are predicted to damage protein function. The detection of rare damaging mutations has implications for models of human disease. PMID:16893952

  11. CNTNAP2 Is Significantly Associated With Speech Sound Disorder in the Chinese Han Population.

    PubMed

    Zhao, Yun-Jing; Wang, Yue-Ping; Yang, Wen-Zhu; Sun, Hong-Wei; Ma, Hong-Wei; Zhao, Ya-Ru

    2015-11-01

    Speech sound disorder is the most common communication disorder. Some investigations support the possibility that the CNTNAP2 gene might be involved in the pathogenesis of speech-related diseases. To investigate single-nucleotide polymorphisms in the CNTNAP2 gene, 300 unrelated speech sound disorder patients and 200 normal controls were included in the study. Five single-nucleotide polymorphisms were amplified and directly sequenced. Significant differences were found in the genotype (P = .0003) and allele (P = .0056) frequencies of rs2538976 between patients and controls. The excess frequency of the A allele in the patient group remained significant after Bonferroni correction (P = .0280). A significant haplotype association with rs2710102T/+rs17236239A/+2538976A/+2710117A (P = 4.10e-006) was identified. A neighboring single-nucleotide polymorphism, rs10608123, was found in complete linkage disequilibrium with rs2538976, and the genotypes exactly corresponded to each other. The authors propose that these CNTNAP2 variants increase the susceptibility to speech sound disorder. The single-nucleotide polymorphisms rs10608123 and rs2538976 may merge into one single-nucleotide polymorphism. © The Author(s) 2015.

  12. Imputation of single nucleotide polymorhpism genotypes of Hereford cattle: reference panel size, family relationship and population structure

    USDA-ARS?s Scientific Manuscript database

    The objective of this study is to investigate single nucleotide polymorphism (SNP) genotypes imputation of Hereford cattle. Purebred Herefords were from two sources, Line 1 Hereford (N=240) and representatives of Industry Herefords (N=311). Using different reference panels of 62 and 494 males with 1...

  13. Electrical detection and quantification of single and mixed DNA nucleotides in suspension

    NASA Astrophysics Data System (ADS)

    Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah

    2016-09-01

    High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.

  14. Bitterness of the Non-nutritive Sweetener Acesulfame Potassium Varies With Polymorphisms in TAS2R9 and TAS2R31

    PubMed Central

    2013-01-01

    Demand for nonnutritive sweeteners continues to increase due to their ability to provide desirable sweetness with minimal calories. Acesulfame potassium and saccharin are well-studied nonnutritive sweeteners commonly found in food products. Some individuals report aversive sensations from these sweeteners, such as bitter and metallic side tastes. Recent advances in molecular genetics have provided insight into the cause of perceptual differences across people. For example, common alleles for the genes TAS2R9 and TAS2R38 explain variable response to the bitter drugs ofloxacin in vitro and propylthiouracil in vivo. Here, we wanted to determine whether differences in the bitterness of acesulfame potassium could be predicted by common polymorphisms (genetic variants) in bitter taste receptor genes (TAS2Rs). We genotyped participants (n = 108) for putatively functional single nucleotide polymorphisms in 5 TAS2Rs and asked them to rate the bitterness of 25 mM acesulfame potassium on a general labeled magnitude scale. Consistent with prior reports, we found 2 single nucleotide polymorphisms in TAS2R31 were associated with acesulfame potassium bitterness. However, TAS2R9 alleles also predicted additional variation in acesulfame potassium bitterness. Conversely, single nucleotide polymorphisms in TAS2R4, TAS2R38, and near TAS2R16 were not significant predictors. Using 1 single nucleotide polymorphism each from TAS2R9 and TAS2R31, we modeled the simultaneous influence of these single nucleotide polymorphisms on acesulfame potassium bitterness; together, these 2 single nucleotide polymorphisms explained 13.4% of the variance in perceived bitterness. These data suggest multiple polymorphisms within TAS2Rs contribute to the ability to perceive the bitterness from acesulfame potassium. PMID:23599216

  15. OmpF, a nucleotide-sensing nanoprobe, computational evaluation of single channel activities

    NASA Astrophysics Data System (ADS)

    Abdolvahab, R. H.; Mobasheri, H.; Nikouee, A.; Ejtehadi, M. R.

    2016-09-01

    The results of highthroughput practical single channel experiments should be formulated and validated by signal analysis approaches to increase the recognition precision of translocating molecules. For this purpose, the activities of the single nano-pore forming protein, OmpF, in the presence of nucleotides were recorded in real time by the voltage clamp technique and used as a means for nucleotide recognition. The results were analyzed based on the permutation entropy of current Time Series (TS), fractality, autocorrelation, structure function, spectral density, and peak fraction to recognize each nucleotide, based on its signature effect on the conductance, gating frequency and voltage sensitivity of channel at different concentrations and membrane potentials. The amplitude and frequency of ion current fluctuation increased in the presence of Adenine more than Cytosine and Thymine in milli-molar (0.5 mM) concentrations. The variance of the current TS at various applied voltages showed a non-monotonic trend whose initial increasing slope in the presence of Thymine changed to a decreasing one in the second phase and was different from that of Adenine and Cytosine; e.g., by increasing the voltage from 40 to 140 mV in the 0.5 mM concentration of Adenine or Cytosine, the variance decreased by one third while for the case of Thymine it was doubled. Moreover, according to the structure function of TS, the fractality of current TS differed as a function of varying membrane potentials (pd) and nucleotide concentrations. Accordingly, the calculated permutation entropy of the TS, validated the biophysical approach defined for the recognition of different nucleotides at various concentrations, pd's and polarities. Thus, the promising outcomes of the combined experimental and theoretical methodologies presented here can be implemented as a complementary means in pore-based nucleotide recognition approaches.

  16. Single nucleotide polymorphisms in specific candidate genes are associated with phenotypic differences in days open for first lactation in Holstein cows

    USDA-ARS?s Scientific Manuscript database

    Previously, a candidate gene approach identified 51 single nucleotide polymorphisms (SNP) associated with genetic merit for reproductive traits and 26 associated with genetic merit for production in dairy bulls. We evaluated association of the 77 SNPs with days open (DO) for first lactation in a pop...

  17. Single nucleotide polymorphism analysis reveals heterogeneity within a seedling tree population of a polyembryonic mango cultivar.

    PubMed

    Winterhagen, Patrick; Wünsche, Jens-Norbert

    2016-05-01

    Within a polyembryonic mango seedling tree population, the genetic background of individuals should be identical because vigorous plants for cultivation are expected to develop from nucellar embryos representing maternal clones. Due to the fact that the mango cultivar 'Hôi' is assigned to the polyembryonic ecotype, an intra-cultivar variability of ethylene receptor genes was unexpected. Ethylene receptors in plants are conserved, but the number of receptors or receptor isoforms is variable regarding different plant species. However, it is shown here that the ethylene receptor MiETR1 is present in various isoforms within the mango cultivar 'Hôi'. The investigation of single nucleotide polymorphisms revealed that different MiETR1 isoforms can not be discriminated simply by individual single nucleotide exchanges but by the specific arrangement of single nucleotide polymorphisms at certain positions in the exons of MiETR1. Furthermore, an MiETR1 isoform devoid of introns in the genomic sequence was identified. The investigation demonstrates some limitations of high resolution melting and ScreenClust analysis and points out the necessity of sequencing to identify individual isoforms and to determine the variability within the tree population.

  18. Detection of Strand Cleavage And Oxidation Damage Using Model DNA Molecules Captured in a Nanoscale Pore

    NASA Technical Reports Server (NTRS)

    Vercoutere, W.; Solbrig, A.; DeGuzman, V.; Deamer, D.; Akeson, M.

    2003-01-01

    We use a biological nano-scale pore to distinguish among individual DNA hairpins that differ by a single site of oxidation or a nick in the sugar-phosphate backbone. In earlier work we showed that the protein ion channel alpha-hemolysin can be used as a detector to distinguish single-stranded from double-stranded DNA, single base pair and single nucleotide differences. This resolution is in part a result of sensitivity to structural changes that influence the molecular dynamics of nucleotides within DNA. The strand cleavage products we examined here included a 5-base-pair (5-bp) hairpin with a 5-prime five-nucleotide overhang, and a complementary five-nucleotide oligomer. These produced predictable shoulder-spike and rapid near-full blockade signatures, respectively. When combined, strand annealing was monitored in real time. The residual current level dropped to a lower discrete level in the shoulder-spike blockade signatures, and the duration lengthened. However, these blockade signatures had a shorter duration than the unmodified l0bp hairpin. To test the pore sensitivity to nucleotide oxidation, we examined a 9-bp hairpin with a terminal 8-oxo-deoxyguanosine (8-oxo-dG), or a penultimate 8-oxo-dG. Each produced blockade signatures that differed from the otherwise identical control 9bp hairpins. This study showed that DNA structure is modified sufficiently by strand cleavage or oxidation damage at a single site to alter in a predictable manner the ionic current blockade signatures produced. This technique improves the ability to assess damage to DNA, and can provide a simple means to help characterize the risks of radiation exposure. It may also provide a method to test radiation protection.

  19. The association of single-nucleotide polymorphisms in the oxytocin receptor and G protein-coupled receptor kinase 6 (GRK6) genes with oxytocin dosing requirements and labor outcomes.

    PubMed

    Grotegut, Chad A; Ngan, Emily; Garrett, Melanie E; Miranda, Marie Lynn; Ashley-Koch, Allison E; Swamy, Geeta K

    2017-09-01

    Oxytocin is a potent uterotonic agent that is widely used for induction and augmentation of labor. Oxytocin has a narrow therapeutic index and the optimal dosing for any individual woman varies widely. The objective of this study was to determine whether genetic variation in the oxytocin receptor (OXTR) or in the gene encoding G protein-coupled receptor kinase 6 (GRK6), which regulates desensitization of the oxytocin receptor, could explain variation in oxytocin dosing and labor outcomes among women being induced near term. Pregnant women with a singleton gestation residing in Durham County, NC, were prospectively enrolled as part of the Healthy Pregnancy, Healthy Baby cohort study. Those women undergoing an induction of labor at 36 weeks or greater were genotyped for 18 haplotype-tagging single-nucleotide polymorphisms in OXTR and 7 haplotype-tagging single-nucleotide polymorphisms in GRK6 using TaqMan assays. Linear regression was used to examine the relationship between maternal genotype and maximal oxytocin infusion rate, total oxytocin dose received, and duration of labor. Logistic regression was used to test for the association of maternal genotype with mode of delivery. For each outcome, backward selection techniques were utilized to control for important confounding variables and additive genetic models were used. Race/ethnicity was included in all models because of differences in allele frequencies across populations, and Bonferroni correction for multiple testing was used. DNA was available from 482 women undergoing induction of labor at 36 weeks or greater. Eighteen haplotype-tagging single-nucleotide polymorphisms within OXTR and 7 haplotype-tagging single-nucleotide polymorphisms within GRK6 were examined. Five single-nucleotide polymorphisms in OXTR showed nominal significance with maximal infusion rate of oxytocin, and two single-nucleotide polymorphisms in OXTR were associated with total oxytocin dose received. One single-nucleotide polymorphism in OXTR and two single-nucleotide polymorphisms in GRK6 were associated with duration of labor, one of which met the multiple testing threshold (P = .0014, rs2731664 [GRK6], mean duration of labor, 17.7 hours vs 20.2 hours vs 23.5 hours for AA, AC, and CC genotypes, respectively). Three single-nucleotide polymorphisms, two in OXTR and one in GRK6, showed nominal significance with mode of delivery. Genetic variation in OXTR and GRK6 is associated with the amount of oxytocin required as well as the duration of labor and risk for cesarean delivery among women undergoing induction of labor near term. With further research, pharmacogenomic approaches may potentially be utilized to develop personalized treatment to improve safety and efficacy outcomes among women undergoing induction of labor. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA.

    PubMed

    Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V

    2015-03-04

    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

  1. Single nucleotide polymorphism analysis using different colored dye dimer probes

    NASA Astrophysics Data System (ADS)

    Marmé, Nicole; Friedrich, Achim; Denapaite, Dalia; Hakenbeck, Regine; Knemeyer, Jens-Peter

    2006-09-01

    Fluorescence quenching by dye dimer formation has been utilized to develop hairpin-structured DNA probes for the detection of a single nucleotide polymorphism (SNP) in the penicillin target gene pbp2x, which is implicated in the penicillin resistance of Streptococcus pneumoniae. We designed two specific DNA probes for the identification of the pbp2x genes from a penicillin susceptible strain R6 and a resistant strain Streptococcus mitis 661 using green-fluorescent tetramethylrhodamine (TMR) and red-fluorescent DY-636, respectively. Hybridization of each of the probes to its respective target DNA sequence opened the DNA hairpin probes, consequently breaking the nonfluorescent dye dimers into fluorescent species. This hybridization of the target with the hairpin probe achieved single nucleotide specific detection at nanomolar concentrations via increased fluorescence.

  2. Failure of replicating the association between hippocampal volume and 3 single-nucleotide polymorphisms identified from the European genome-wide association study in Asian populations.

    PubMed

    Li, Ming; Ohi, Kazutaka; Chen, Chunhui; He, Qinghua; Liu, Jie-Wei; Chen, Chuansheng; Luo, Xiong-Jian; Dong, Qi; Hashimoto, Ryota; Su, Bing

    2014-12-01

    Hippocampal volume is a key brain structure for learning ability and memory process, and hippocampal atrophy is a recognized biological marker of Alzheimer's disease. However, the genetic bases of hippocampal volume are still unclear although it is a heritable trait. Genome-wide association studies (GWASs) on hippocampal volume have implicated several significantly associated genetic variants in Europeans. Here, to test the contributions of these GWASs identified genetic variants to hippocampal volume in different ethnic populations, we screened the GWAS-identified candidate single-nucleotide polymorphisms in 3 independent healthy Asian brain imaging samples (a total of 990 subjects). The results showed that none of these single-nucleotide polymorphisms were associated with hippocampal volume in either individual or combined Asian samples. The replication results suggested a complexity of genetic architecture for hippocampal volume and potential genetic heterogeneity between different ethnic populations. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. The nucleotide sequence and genome organization of Plasmopara halstedii virus.

    PubMed

    Heller-Dohmen, Marion; Göpfert, Jens C; Pfannstiel, Jens; Spring, Otmar

    2011-03-17

    Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2) were established. RNA1 consisted of 2793 nucleotides (nt) exclusive its 3' poly(A) tract and a single open-reading frame (ORF1) of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR) of 18 nt and a 3' untranslated region (3' UTR) of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp) and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A) and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A) tract and a second ORF (ORF2) of 1128 nt. ORF2 coded for the single viral coat protein (CP) and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb) and RNA2 (ca. 1.4 kb) were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. The results showed the presence of a single and new virus type in different P. halstedii isolates. Insignificant viral sequence variation indicated that the virus did not account for differences in pathogenicity of the oomycete P. halstedii.

  4. Variation of Cats under Domestication: Genetic Assignment of Domestic Cats to Breeds and Worldwide Random Bred Populations

    PubMed Central

    Kurushima, J. D.; Lipinski, M. J.; Gandolfi, B.; Froenicke, L.; Grahn, J. C.; Grahn, R. A.; Lyons, L. A.

    2012-01-01

    Summary Both cat breeders and the lay public have interests in the origins of their pets, not only in the genetic identity of the purebred individuals, but also the historical origins of common household cats. The cat fancy is a relatively new institution with over 85% of its 40–50 breeds arising only in the past 75 years, primarily through selection on single-gene aesthetic traits. The short, yet intense cat breed history poses a significant challenge to the development of a genetic marker-based breed identification strategy. Using different breed assignment strategies and methods, 477 cats representing 29 fancy breeds were analysed with 38 short tandem repeats, 148 intergenic and five phenotypic single nucleotide polymorphisms. Results suggest the frequentist method of Paetkau (accuracy single nucleotide polymorphisms = 0.78, short tandem repeats = 0.88) surpasses the Bayesian method of Rannala and Mountain (single nucleotide polymorphisms = 0.56, short tandem repeats = 0.83) for accurate assignment of individuals to the correct breed. Additionally, a post-assignment verification step with the five phenotypic single nucleotide polymorphisms accurately identified between 0.31 and 0.58 of the mis-assigned individuals raising the sensitivity of assignment with the frequentist method to 0.89 and 0.92 single nucleotide polymorphisms and short tandem repeats respectively. This study provides a novel multi-step assignment strategy and suggests that, despite their short breed history and breed family groupings, a majority of cats can be assigned to their proper breed or population of origin, i.e. race. PMID:23171373

  5. Single Color Multiplexed ddPCR Copy Number Measurements and Single Nucleotide Variant Genotyping.

    PubMed

    Wood-Bouwens, Christina M; Ji, Hanlee P

    2018-01-01

    Droplet digital PCR (ddPCR) allows for accurate quantification of genetic events such as copy number variation and single nucleotide variants. Probe-based assays represent the current "gold-standard" for detection and quantification of these genetic events. Here, we introduce a cost-effective single color ddPCR assay that allows for single genome resolution quantification of copy number and single nucleotide variation.

  6. Analysis of in vivo correction of defined mismatches in the DNA mismatch repair mutants msh2, msh3 and msh6 of Saccharomyces cerevisiae.

    PubMed

    Lühr, B; Scheller, J; Meyer, P; Kramer, W

    1998-02-01

    We have analysed the correction of defined mismatches in wild-type and msh2, msh3, msh6 and msh3 msh6 mutants of Saccharomyces cerevisiae in two different yeast strain backgrounds by transformation with plasmid heteroduplex DNA constructs. Ten different base/base mismatches, two single-nucleotide loops and a 38-nucleotide loop were tested. Repair of all types of mismatches was severely impaired in msh2 and msh3 msh6 mutants. In msh6 mutants, repair efficiency of most base/base mismatches was reduced to a similar extent as in msh3 msh6 double mutants. G/T and A/C mismatches, however, displayed residual repair in msh6 mutants in one strain background, implying a role for Msh3p in recognition of base/base mismatches. Furthermore, the efficiency of repair of base/base mismatches was considerably reduced in msh3 mutants in one strain background, indicating a requirement for MSH3 for fully efficient mismatch correction. Also the efficiency of repair of the 38-nucleotide loop was reduced in msh3 mutants, and to a lesser extent in msh6 mutants. The single-nucleotide loop with an unpaired A was less efficiently repaired in msh3 mutants and that with an unpaired T was less efficiently corrected in msh6 mutants, indicating non-redundant functions for the two proteins in the recognition of single-nucleotide loops.

  7. Distinctive features of single nucleotide alterations in induced pluripotent stem cells with different types of DNA repair deficiency disorders

    PubMed Central

    Okamura, Kohji; Sakaguchi, Hironari; Sakamoto-Abutani, Rie; Nakanishi, Mahito; Nishimura, Ken; Yamazaki-Inoue, Mayu; Ohtaka, Manami; Periasamy, Vaiyapuri Subbarayan; Alshatwi, Ali Abdullah; Higuchi, Akon; Hanaoka, Kazunori; Nakabayashi, Kazuhiko; Takada, Shuji; Hata, Kenichiro; Toyoda, Masashi; Umezawa, Akihiro

    2016-01-01

    Disease-specific induced pluripotent stem cells (iPSCs) have been used as a model to analyze pathogenesis of disease. In this study, we generated iPSCs derived from a fibroblastic cell line of xeroderma pigmentosum (XP) group A (XPA-iPSCs), a rare autosomal recessive hereditary disease in which patients develop skin cancer in the areas of skin exposed to sunlight. XPA-iPSCs exhibited hypersensitivity to ultraviolet exposure and accumulation of single-nucleotide substitutions when compared with ataxia telangiectasia-derived iPSCs that were established in a previous study. However, XPA-iPSCs did not show any chromosomal instability in vitro, i.e. intact chromosomes were maintained. The results were mutually compensating for examining two major sources of mutations, nucleotide excision repair deficiency and double-strand break repair deficiency. Like XP patients, XPA-iPSCs accumulated single-nucleotide substitutions that are associated with malignant melanoma, a manifestation of XP. These results indicate that XPA-iPSCs may serve a monitoring tool (analogous to the Ames test but using mammalian cells) to measure single-nucleotide alterations, and may be a good model to clarify pathogenesis of XP. In addition, XPA-iPSCs may allow us to facilitate development of drugs that delay genetic alteration and decrease hypersensitivity to ultraviolet for therapeutic applications. PMID:27197874

  8. A graphene-based platform for single nucleotide polymorphism (SNP) genotyping.

    PubMed

    Liu, Meng; Zhao, Huimin; Chen, Shuo; Yu, Hongtao; Zhang, Yaobin; Quan, Xie

    2011-06-15

    A facile, rapid, stable and sensitive approach for fluorescent detection of single nucleotide polymorphism (SNP) is designed based on DNA ligase reaction and π-stacking between the graphene and the nucleotide bases. In the presence of perfectly matched DNA, DNA ligase can catalyze the linkage of fluorescein amidite-labeled single-stranded DNA (ssDNA) and a phosphorylated ssDNA, and thus the formation of a stable duplex in high yield. However, the catalytic reaction cannot effectively carry out with one-base mismatched DNA target. In this case, we add graphene to the system in order to produce different quenching signals due to its different adsorption affinity for ssDNA and double-stranded DNA. Taking advantage of the unique surface property of graphene and the high discriminability of DNA ligase, the proposed protocol exhibits good performance in SNP genotyping. The results indicate that it is possible to accurately determine SNP with frequency as low as 2.6% within 40 min. Furthermore, the presented flexible strategy facilitates the development of other biosensing applications in the future. Copyright © 2011 Elsevier B.V. All rights reserved.

  9. Detecting and Removing Ascertainment Bias in Microsatellites from the HGDP-CEPH Panel

    PubMed Central

    Eriksson, Anders; Manica, Andrea

    2011-01-01

    Although ascertainment bias in single nucleotide polymorphisms is a well-known problem, it is generally accepted that microsatellites have mutation rates too high for bias to be a concern. Here, we analyze in detail the large set of microsatellites typed for the Human Genetic Diversity Panel (HGDP)-CEPH panel. We develop a novel framework based on rarefaction to compare heterozygosity across markers with different mutation rates. We find that, whereas di- and tri-nucleotides show similar patterns of within- and between-population heterozygosity, tetra-nucleotides are inconsistent with the other two motifs. In addition, di- and tri-nucleotides are consistent with 16 unbiased tetra-nucleotide markers, whereas the HPGP-CEPH tetra-nucleotides are significantly different. This discrepancy is due to the HGDP-CEPH tetra-nucleotides being too homogeneous across Eurasia, even after their slower mutation rate is taken into account by rarefying the other markers. The most likely explanation for this pattern is ascertainment bias. We strongly advocate the exclusion of tetra-nucleotides from future population genetics analysis of this dataset, and we argue that other microsatellite datasets should be investigated for the presence of bias using the approach outlined in this article. PMID:22384358

  10. Prokaryotic Nucleotide Composition Is Shaped by Both Phylogeny and the Environment

    DOE PAGES

    Reichenberger, Erin R.; Rosen, Gail; Hershberg, Uri; ...

    2015-04-09

    Here, the causes of the great variation in nucleotide composition of prokaryotic genomes have long been disputed. Here, we use extensive metagenomic and whole-genome data to demonstrate that both phylogeny and the environment shape prokaryotic nucleotide content. We show that across environments, various phyla are characterized by different mean guanine and cytosine (GC) values as well as by the extent of variation on that mean value. At the same time, we show that GC-content varies greatly as a function of environment, in a manner that cannot be entirely explained by disparities in phylogenetic composition. We find environmentally driven differences inmore » nucleotide content not only between highly diverged environments (e.g., soil, vs. aquatic vs. human gut) but also within a single type of environment. More specifically, we demonstrate that some human guts are associated with a microbiome that is consistently more GC-rich across phyla, whereas others are associated with a more AT-rich microbiome. These differences appear to be driven both by variations in phylogenetic composition and by environmental differences—which are independent of these phylogenetic composition differences. Combined, our results demonstrate that both phylogeny and the environment significantly affect nucleotide composition and that the environmental differences affecting nucleotide composition are far subtler than previously appreciated.« less

  11. Genomic diversity of the human intestinal parasite Entamoeba histolytica

    PubMed Central

    2012-01-01

    Background Entamoeba histolytica is a significant cause of disease worldwide. However, little is known about the genetic diversity of the parasite. We re-sequenced the genomes of ten laboratory cultured lines of the eukaryotic pathogen Entamoeba histolytica in order to develop a picture of genetic diversity across the genome. Results The extreme nucleotide composition bias and repetitiveness of the E. histolytica genome provide a challenge for short-read mapping, yet we were able to define putative single nucleotide polymorphisms in a large portion of the genome. The results suggest a rather low level of single nucleotide diversity, although genes and gene families with putative roles in virulence are among the more polymorphic genes. We did observe large differences in coverage depth among genes, indicating differences in gene copy number between genomes. We found evidence indicating that recombination has occurred in the history of the sequenced genomes, suggesting that E. histolytica may reproduce sexually. Conclusions E. histolytica displays a relatively low level of nucleotide diversity across its genome. However, large differences in gene family content and gene copy number are seen among the sequenced genomes. The pattern of polymorphism indicates that E. histolytica reproduces sexually, or has done so in the past, which has previously been suggested but not proven. PMID:22630046

  12. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.

    PubMed

    Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  13. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

    NASA Astrophysics Data System (ADS)

    Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  14. Prokaryotic nucleotide composition is shaped by both phylogeny and the environment.

    PubMed

    Reichenberger, Erin R; Rosen, Gail; Hershberg, Uri; Hershberg, Ruth

    2015-04-09

    The causes of the great variation in nucleotide composition of prokaryotic genomes have long been disputed. Here, we use extensive metagenomic and whole-genome data to demonstrate that both phylogeny and the environment shape prokaryotic nucleotide content. We show that across environments, various phyla are characterized by different mean guanine and cytosine (GC) values as well as by the extent of variation on that mean value. At the same time, we show that GC-content varies greatly as a function of environment, in a manner that cannot be entirely explained by disparities in phylogenetic composition. We find environmentally driven differences in nucleotide content not only between highly diverged environments (e.g., soil, vs. aquatic vs. human gut) but also within a single type of environment. More specifically, we demonstrate that some human guts are associated with a microbiome that is consistently more GC-rich across phyla, whereas others are associated with a more AT-rich microbiome. These differences appear to be driven both by variations in phylogenetic composition and by environmental differences-which are independent of these phylogenetic composition differences. Combined, our results demonstrate that both phylogeny and the environment significantly affect nucleotide composition and that the environmental differences affecting nucleotide composition are far subtler than previously appreciated. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  15. Impact of IL-10 (−1082) Promoter–Single Nucleotide Polymorphism on the Outcome of Hepatitis C Virus Genotype 4 Infection

    PubMed Central

    Helal, Soheir F.; Gomaa, Howayda E.; Thabet, Eman H.; Younan, Mariam A.; Helmy, Neveen A.

    2014-01-01

    Immunoregulatory cytokines may influence the hepatitis C virus (HCV) infection outcome. This study aimed to determine the genotypic and allelic frequencies of the interleukin (IL)-10 (−1082) G/A polymorphism, and its association with chronicity or resolution of HCV genotype 4 infection in Egypt. The frequencies of different dimorphic polymorphisms based on single nucleotide substitution in chronic HCV patients (50) and resolved HCV patients (50) were: IL-10 (−1082) G/G 22 (44%) and 18 (36%), G/A 19 (38%) and 24 (48%), and A/A 9 (18%), and 8 (16%), respectively. In the sustained virologic response (SVR) (36) and spontaneously resolved subjects (14) groups, the frequencies were: IL-10 (−1082) G/G 11 (30.6%) and 7 (50%) G/A 18 (50%) and 6 (42.9%), A/A 7 (19.4%) and 1 (7.1%), respectively. An association between male gender and chronic hepatitis C outcome (P value 0.041) was found. However, no significant gender difference was found when we compared females versus males with elevated alanine transaminase (ALT) levels in the chronic HCV patient group (P value = 1). CONCLUSION No significant difference in the frequency of IL-10 single nucleotide polymorphism (SNP) at position 1082 was found between chronic and resolved HCV subjects. PMID:24833945

  16. Impact of IL-10 (-1082) promoter-single nucleotide polymorphism on the outcome of hepatitis C virus genotype 4 infection.

    PubMed

    Helal, Soheir F; Gomaa, Howayda E; Thabet, Eman H; Younan, Mariam A; Helmy, Neveen A

    2014-01-01

    Immunoregulatory cytokines may influence the hepatitis C virus (HCV) infection outcome. This study aimed to determine the genotypic and allelic frequencies of the interleukin (IL)-10 (-1082) G/A polymorphism, and its association with chronicity or resolution of HCV genotype 4 infection in Egypt. The frequencies of different dimorphic polymorphisms based on single nucleotide substitution in chronic HCV patients (50) and resolved HCV patients (50) were: IL-10 (-1082) G/G 22 (44%) and 18 (36%), G/A 19 (38%) and 24 (48%), and A/A 9 (18%), and 8 (16%), respectively. In the sustained virologic response (SVR) (36) and spontaneously resolved subjects (14) groups, the frequencies were: IL-10 (-1082) G/G 11 (30.6%) and 7 (50%) G/A 18 (50%) and 6 (42.9%), A/A 7 (19.4%) and 1 (7.1%), respectively. An association between male gender and chronic hepatitis C outcome (P value 0.041) was found. However, no significant gender difference was found when we compared females versus males with elevated alanine transaminase (ALT) levels in the chronic HCV patient group (P value = 1). No significant difference in the frequency of IL-10 single nucleotide polymorphism (SNP) at position 1082 was found between chronic and resolved HCV subjects.

  17. Association between Single Nucleotide Polymorphisms of the Major Histocompatibility Complex Class II Gene and Newcastle Disease Virus Titre and Body Weight in Leung Hang Khao Chickens

    PubMed Central

    Molee, A.; Kongroi, K.; Kuadsantia, P.; Poompramun, C.; Likitdecharote, B.

    2016-01-01

    The aim of the present study was to investigate the effect of single nucleotide polymorphisms in the major histocompatibility complex (MHC) class II gene on resistance to Newcastle disease virus and body weight of the Thai indigenous chicken, Leung Hang Khao (Gallus gallus domesticus). Blood samples were collected for single nucleotide polymorphism analysis from 485 chickens. Polymerase chain reaction sequencing was used to classify single nucleotide polymorphisms of class II MHC. Body weights were measured at the ages of 3, 4, 5, and 7 months. Titres of Newcastle disease virus at 2 weeks to 7 months were determined and the correlation between body weight and titre was analysed. The association between single nucleotide polymorphisms and body weight and titre were analysed by a generalized linear model. Seven single nucleotide polymorphisms were identified: C125T, A126T, C209G, C242T, A243T, C244T, and A254T. Significant correlations between log titre and body weight were found at 2 and 4 weeks. Associations between single nucleotide polymorphisms and titre were found for C209G and A254T, and between all single nucleotide polymorphisms (except A243T) and body weight. The results showed that class II MHC is associated with both titre of Newcastle disease virus and body weight in Leung Hang Khao chickens. This is of concern because improved growth traits are the main goal of breeding selection. Moreover, the results suggested that MHC has a pleiotropic effect on the titre and growth performance. This mechanism should be investigated in a future study. PMID:26732325

  18. Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

    PubMed

    Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

    2012-05-01

    The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Functional analysis of regulatory single-nucleotide polymorphisms.

    PubMed

    Pampín, Sandra; Rodríguez-Rey, José C

    2007-04-01

    The identification of regulatory polymorphisms has become a key problem in human genetics. In the past few years there has been a conceptual change in the way in which regulatory single-nucleotide polymorphisms are studied. We revise the new approaches and discuss how gene expression studies can contribute to a better knowledge of the genetics of common diseases. New techniques for the association of single-nucleotide polymorphisms with changes in gene expression have been recently developed. This, together with a more comprehensive use of the old in-vitro methods, has produced a great amount of genetic information. When added to current databases, it will help to design better tools for the detection of regulatory single-nucleotide polymorphisms. The identification of functional regulatory single-nucleotide polymorphisms cannot be done by the simple inspection of DNA sequence. In-vivo techniques, based on primer-extension, and the more recently developed 'haploChIP' allow the association of gene variants to changes in gene expression. Gene expression analysis by conventional in-vitro techniques is the only way to identify the functional consequences of regulatory single-nucleotide polymorphisms. The amount of information produced in the last few years will help to refine the tools for the future analysis of regulatory gene variants.

  20. Detecting Single-Nucleotide Substitutions Induced by Genome Editing.

    PubMed

    Miyaoka, Yuichiro; Chan, Amanda H; Conklin, Bruce R

    2016-08-01

    The detection of genome editing is critical in evaluating genome-editing tools or conditions, but it is not an easy task to detect genome-editing events-especially single-nucleotide substitutions-without a surrogate marker. Here we introduce a procedure that significantly contributes to the advancement of genome-editing technologies. It uses droplet digital polymerase chain reaction (ddPCR) and allele-specific hydrolysis probes to detect single-nucleotide substitutions generated by genome editing (via homology-directed repair, or HDR). HDR events that introduce substitutions using donor DNA are generally infrequent, even with genome-editing tools, and the outcome is only one base pair difference in 3 billion base pairs of the human genome. This task is particularly difficult in induced pluripotent stem (iPS) cells, in which editing events can be very rare. Therefore, the technological advances described here have implications for therapeutic genome editing and experimental approaches to disease modeling with iPS cells. © 2016 Cold Spring Harbor Laboratory Press.

  1. Single nucleotide polymorphisms from Theobroma cacao expressed sequence tags associated with witches' broom disease in cacao.

    PubMed

    Lima, L S; Gramacho, K P; Carels, N; Novais, R; Gaiotto, F A; Lopes, U V; Gesteira, A S; Zaidan, H A; Cascardo, J C M; Pires, J L; Micheli, F

    2009-07-14

    In order to increase the efficiency of cacao tree resistance to witches' broom disease, which is caused by Moniliophthora perniciosa (Tricholomataceae), we looked for molecular markers that could help in the selection of resistant cacao genotypes. Among the different markers useful for developing marker-assisted selection, single nucleotide polymorphisms (SNPs) constitute the most common type of sequence difference between alleles and can be easily detected by in silico analysis from expressed sequence tag libraries. We report the first detection and analysis of SNPs from cacao-M. perniciosa interaction expressed sequence tags, using bioinformatics. Selection based on analysis of these SNPs should be useful for developing cacao varieties resistant to this devastating disease.

  2. Detecting associated single-nucleotide polymorphisms on the X chromosome in case control genome-wide association studies.

    PubMed

    Chen, Zhongxue; Ng, Hon Keung Tony; Li, Jing; Liu, Qingzhong; Huang, Hanwen

    2017-04-01

    In the past decade, hundreds of genome-wide association studies have been conducted to detect the significant single-nucleotide polymorphisms that are associated with certain diseases. However, most of the data from the X chromosome were not analyzed and only a few significant associated single-nucleotide polymorphisms from the X chromosome have been identified from genome-wide association studies. This is mainly due to the lack of powerful statistical tests. In this paper, we propose a novel statistical approach that combines the information of single-nucleotide polymorphisms on the X chromosome from both males and females in an efficient way. The proposed approach avoids the need of making strong assumptions about the underlying genetic models. Our proposed statistical test is a robust method that only makes the assumption that the risk allele is the same for both females and males if the single-nucleotide polymorphism is associated with the disease for both genders. Through simulation study and a real data application, we show that the proposed procedure is robust and have excellent performance compared to existing methods. We expect that many more associated single-nucleotide polymorphisms on the X chromosome will be identified if the proposed approach is applied to current available genome-wide association studies data.

  3. Genome-wide divergence and linkage disequilibrium analyses for Capsicum baccatum revealed by genome-anchored single nucleotide polymorphisms

    USDA-ARS?s Scientific Manuscript database

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...

  4. Nucleotide Sequences and Comparison of Two Large Conjugative Plasmids from Different Campylobacter species

    DTIC Science & Technology

    2004-01-01

    alleles have different predicted lengths, e.g. in pCC31, cpp46 starts with ATGATG whereas in pTet this gene starts with only one ATG; in ssb1 , cmgB7 and...homologues in plasmid pVT745 from Actinobacillus actinomycetemcomitans, and a single-stranded DNA-binding protein ssb1 that may coat the single-stranded

  5. Molecular characterization of the vitamin D receptor (VDR) gene in Holstein cows.

    PubMed

    Ali, Mayar O; El-Adl, Mohamed A; Ibrahim, Hussam M M; Elseedy, Youssef Y; Rizk, Mohamed A; El-Khodery, Sabry A

    2018-06-01

    Vitamin D plays a vital role in calcium homeostasis, growth, and immunoregulation. Because little is known about the vitamin D receptor (VDR) gene in cattle, the aim of the present investigation was to present the molecular characterization of exons 5 and 6 of the VDR gene in Holstein cows. DNA extraction, genomic sequencing, phylogenetic analysis, synteny mapping and single nucleotide gene polymorphism analysis of the VDR gene were performed to assess blood samples collected from 50 clinically healthy Holstein cows. The results revealed the presence of a 450-base pair (bp) nucleotide sequence that resembled exons 5 and 6 with intron 5 enclosed between these exons. Sequence alignment and phylogenetic analysis revealed a close relationship between the sequenced VDR region and that found in Hereford cattle. A close association between this region and the corresponding region in small ruminants was also documented. Moreover, a single nucleotide polymorphism (SNP) that caused the replacement of a glutamate with an arginine in the deduced amino acid sequence was detected at position 7 of exon 5. In conclusion, Holstein and Hereford cattle differ with respect to exon 5 of the VDR gene. Phylogenetic analysis of the VDR gene based on nucleotide sequence produced different results from prior analyses based on amino acid sequence. Copyright © 2018 Elsevier Ltd. All rights reserved.

  6. A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice.

    PubMed

    Jiao, Yan; Yan, Jian; Jiao, Feng; Yang, Hongbin; Donahue, Leah Rae; Li, Xinmin; Roe, Bruce A; Stuart, John; Gu, Weikuan

    2007-04-17

    The long bone abnormality (lbab) mouse is a new autosomal recessive mutant characterized by overall smaller body size with proportionate dwarfing of all organs and shorter long bones. Previous linkage analysis has located the lbab mutation on chromosome 1 between the markers D1Mit9 and D1Mit488. A genome-based positional approach was used to identify a mutation associated with lbab disease. A total of 122 genes and expressed sequence tags at the lbab region were screened for possible mutation by using genomic DNA from lbabl/lbab, lbab/+, and +/+ B6 mice and high throughput temperature gradient capillary electrophoresis. A sequence difference was identified in one of the amplicons of gene Nppc between lbab/lbab and +/+ mice. One-step reverse transcriptase polymerase chain reaction was performed to validate the difference of Nppc in different types of mice at the mRNA level. The mutation of Nppc was unique in lbab/lbab mice among multiple mouse inbred strains. The mutation of Nppc is co-segregated with lbab disease in 200 progenies produced from heterozygous lbab/+ parents. A single nucleotide mutation of Nppc is associated with dwarfism in lbab/lbab mice. Current genome information and technology allow us to efficiently identify single nucleotide mutations from roughly mapped disease loci. The lbab mouse is a useful model for hereditary human achondroplasia.

  7. A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice

    PubMed Central

    Jiao, Yan; Yan, Jian; Jiao, Feng; Yang, HongBin; Donahue, Leah Rae; Li, Xinmin; Roe, Bruce A; Stuart, John; Gu, Weikuan

    2007-01-01

    Background The long bone abnormality (lbab) mouse is a new autosomal recessive mutant characterized by overall smaller body size with proportionate dwarfing of all organs and shorter long bones. Previous linkage analysis has located the lbab mutation on chromosome 1 between the markers D1Mit9 and D1Mit488. Results A genome-based positional approach was used to identify a mutation associated with lbab disease. A total of 122 genes and expressed sequence tags at the lbab region were screened for possible mutation by using genomic DNA from lbabl/lbab, lbab/+, and +/+ B6 mice and high throughput temperature gradient capillary electrophoresis. A sequence difference was identified in one of the amplicons of gene Nppc between lbab/lbab and +/+ mice. One-step reverse transcriptase polymerase chain reaction was performed to validate the difference of Nppc in different types of mice at the mRNA level. The mutation of Nppc was unique in lbab/lbab mice among multiple mouse inbred strains. The mutation of Nppc is co-segregated with lbab disease in 200 progenies produced from heterozygous lbab/+ parents. Conclusion A single nucleotide mutation of Nppc is associated with dwarfism in lbab/lbab mice. Current genome information and technology allow us to efficiently identify single nucleotide mutations from roughly mapped disease loci. The lbab mouse is a useful model for hereditary human achondroplasia. PMID:17439653

  8. Uncovering drug-responsive regulatory elements

    PubMed Central

    Luizon, Marcelo R; Ahituv, Nadav

    2015-01-01

    Nucleotide changes in gene regulatory elements can have a major effect on interindividual differences in drug response. For example, by reviewing all published pharmacogenomic genome-wide association studies, we show here that 96.4% of the associated single nucleotide polymorphisms reside in noncoding regions. We discuss how sequencing technologies are improving our ability to identify drug response-associated regulatory elements genome-wide and to annotate nucleotide variants within them. We highlight specific examples of how nucleotide changes in these elements can affect drug response and illustrate the techniques used to find them and functionally characterize them. Finally, we also discuss challenges in the field of drug-responsive regulatory elements that need to be considered in order to translate these findings into the clinic. PMID:26555224

  9. A genetic variation map for chicken with 2.8 million single nucleotide polymorphisms

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wong, G K; Hillier, L; Brandstrom, M

    2005-02-20

    We describe a genetic variation map for the chicken genome containing 2.8 million single nucleotide polymorphisms (SNPs), based on a comparison of the sequences of 3 domestic chickens (broiler, layer, Silkie) to their wild ancestor Red Jungle Fowl (RJF). Subsequent experiments indicate that at least 90% are true SNPs, and at least 70% are common SNPs that segregate in many domestic breeds. Mean nucleotide diversity is about 5 SNP/kb for almost every possible comparison between RJF and domestic lines, between two different domestic lines, and within domestic lines--contrary to the idea that domestic animals are highly inbred relative to theirmore » wild ancestors. In fact, most of the SNPs originated prior to domestication, and there is little to no evidence of selective sweeps for adaptive alleles on length scales of greater than 100 kb.« less

  10. Spontaneous Transport of Single-Stranded DNA through Graphene-MoS2 Heterostructure Nanopores.

    PubMed

    Luan, Binquan; Zhou, Ruhong

    2018-04-24

    The effective transport of a single-stranded DNA (ssDNA) molecule through a solid-state nanopore is essential to the future success of high-throughput and low-cost DNA sequencing. Compatible with current electric sensing technologies, here, we propose and demonstrate by molecular dynamics simulations the ssDNA transport through a quasi-two-dimensional nanopore in a heterostructure stacked together with different 2D materials, such as graphene and molybdenum disulfide (MoS 2 ). Due to different chemical potentials, U, of DNA bases on different 2D materials, it is energetically favorable for a ssDNA molecule to move from the low- U MoS 2 surface to the high- U graphene surface through a nanopore. With the proper attraction between the negatively charged phosphate group in each nucleotide and the positively charged Mo atoms exposed on the pore surface, the ssDNA molecule can be temporarily seized and released thereafter through a thermal activation, that is, a slow and possible nucleotide-by-nucleotide transport. A theoretical formulation is then developed for the free energy of the ssDNA transiting a heterostructure nanopore to properly characterize the non-equilibrium stick-slip-like motion of a ssDNA molecule.

  11. [Single-nucleotide polymorphism in populations of sockeye salmon Oncorhynchus nerka from Kamchatka Peninsula].

    PubMed

    Khrustaleva, A M; Gritsenko, O F; Klovach, N V

    2013-11-01

    The genetic polymorphism of 45 single-nucleotide polymorphism loci was examined in the four largest wild populations of sockeye salmon Oncorhynchusnerka from drainages of the Asian coast of the Pacific Ocean (Eastern and Western Kamchatka). It was demonstrated that sockeye salmon from the Palana River were considerably different from all other populations examined. The most probable explanation of the observed differences is the suggestion on possible demographic events in the history of this population associated with the decrease in its effective number. To study the origin, colonization patterns, and evolution of Asian sockeye salmon, as well as to resolve some of the applied tasks, like population assignment and genetic identification, a differentiation approach to SNP-marker selection was suggested. Adaptively important loci that evolve under the pressure of balancing (stabilizing) selection were identified, thanks to which the number of loci that provide the baseline classification error rates in the population assignment tests was reduced to 30. It was demonstrated that SNPs located in the MHC2 and GPH genes were affected by diversifying selection. Procedures for selecting single-nucleotide polymorphisms for phylogenetic studies of Asian sockeye salmon were suggested. Using principal-component analysis, 17 loci that adequately reproduce genetic differentiation within arid among the regions of the origin of Kamchatka sockeye salmon, were selected.

  12. Improved prediction of biochemical recurrence after radical prostatectomy by genetic polymorphisms.

    PubMed

    Morote, Juan; Del Amo, Jokin; Borque, Angel; Ars, Elisabet; Hernández, Carlos; Herranz, Felipe; Arruza, Antonio; Llarena, Roberto; Planas, Jacques; Viso, María J; Palou, Joan; Raventós, Carles X; Tejedor, Diego; Artieda, Marta; Simón, Laureano; Martínez, Antonio; Rioja, Luis A

    2010-08-01

    Single nucleotide polymorphisms are inherited genetic variations that can predispose or protect individuals against clinical events. We hypothesized that single nucleotide polymorphism profiling may improve the prediction of biochemical recurrence after radical prostatectomy. We performed a retrospective, multi-institutional study of 703 patients treated with radical prostatectomy for clinically localized prostate cancer who had at least 5 years of followup after surgery. All patients were genotyped for 83 prostate cancer related single nucleotide polymorphisms using a low density oligonucleotide microarray. Baseline clinicopathological variables and single nucleotide polymorphisms were analyzed to predict biochemical recurrence within 5 years using stepwise logistic regression. Discrimination was measured by ROC curve AUC, specificity, sensitivity, predictive values, net reclassification improvement and integrated discrimination index. The overall biochemical recurrence rate was 35%. The model with the best fit combined 8 covariates, including the 5 clinicopathological variables prostate specific antigen, Gleason score, pathological stage, lymph node involvement and margin status, and 3 single nucleotide polymorphisms at the KLK2, SULT1A1 and TLR4 genes. Model predictive power was defined by 80% positive predictive value, 74% negative predictive value and an AUC of 0.78. The model based on clinicopathological variables plus single nucleotide polymorphisms showed significant improvement over the model without single nucleotide polymorphisms, as indicated by 23.3% net reclassification improvement (p = 0.003), integrated discrimination index (p <0.001) and likelihood ratio test (p <0.001). Internal validation proved model robustness (bootstrap corrected AUC 0.78, range 0.74 to 0.82). The calibration plot showed close agreement between biochemical recurrence observed and predicted probabilities. Predicting biochemical recurrence after radical prostatectomy based on clinicopathological data can be significantly improved by including patient genetic information. Copyright (c) 2010 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  13. A Polymorphism in the Retinol Binding Protein 4 Gene is Not Associated with Gestational Diabetes Mellitus in Several Different Ethnic Groups

    PubMed Central

    Urschitz, Johann; Sultan, Omar; Ward, Kenneth

    2011-01-01

    Objective Various Asian and Pacifific Islander groups have higher prevalence rates of type 2 diabetes and gestational diabetes. This increased incidence is likely to include genetic factors. Single nucleotide polymorphisms in the retinol binding protein 4 gene have been linked to the occurrence of type 2 diabetes. Hypothesizing a link between retinol binding protein 4 and gestational diabetes, we performed a candidate gene study to look for an association between an important retinol binding protein gene polymorphism (rs3758539) and gestational diabetes. Study Design Blood was collected from Caucasian, Asian, and Pacific Islander women diagnosed with gestational diabetes and from ethnically matched non-diabetic controls. DNA was extracted and real time PCR technology (TaqMan, Applied Biosystems) used to screen for the rs3758539 single nucleotide polymorphism located 5′ of exon 1 of the retinol binding protein 4 gene. Results Genotype and allele frequencies in the controls and gestational diabetes cases were tested using chi-square contingency tests. Genotype frequencies were in Hardy-Weinberg equilibrium. There was no association between the rs3758539 retinol binding protein 4 single nucleotide polymorphism and gestational diabetes in the Caucasian, Filipino, or Pacific Islander groups. Conclusion Interestingly, the rs3758539 retinol binding protein 4 single nucleotide polymorphism was not found to be associated with gestational diabetes. The absence of association suggests that gestational and type 2 diabetes may have more divergent molecular pathophysiology than previously suspected. PMID:21886308

  14. [Meta-analysis on relationship between single nucleotide polymorphism of rs2231142 in ABCG2 gene and gout in East Asian population].

    PubMed

    Wu, Lei; He, Yao; Zhang, Di

    2015-11-01

    To systematically evaluate the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout in East Asian population. The literature retrieval was conducted by using English databases (Medline, EMbase), Chinese databases (CNKI, Vip, Wanfang, SinaMed) and others to collect the published papers on the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout by the end of December 2014. Meta-analysis was performed with software Stata 12.0. Nine studies were included. There were significant associations between increased risk of gout and single nucleotide polymorphism of rs2231142, the combined OR was 2.04 (95%CI: 1.82-2.28) for A allele and C allele, 1.97 (95%CI: 1.57-2.48) for CA and CC, 3.71 (95%CI: 3.07-4.47) for AA and CC. Sex and region specific subgroup analysis showed less heterogeneity. There is significant association between gout and single nucleotide polymorphism of rs2231142 in East Asian population, and A allele is a high risk gene for gout.

  15. Cacao single-nucleotide polymorphism (SNP) markers: A discovery strategy to identify SNPs for genotyping, genetic mapping and genome wide association studies (GWAS)

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide polymorphisms (SNPs) are the most common genetic markers in Theobroma cacao, occurring approximately once in every 200 nucleotides. SNPs, like microsatellites, are co-dominant and PCR-based, but they have several advantages over microsatellites. They are unambiguous, so that a SN...

  16. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  17. Evidence of codon usage in the nearest neighbor spacing distribution of bases in bacterial genomes

    NASA Astrophysics Data System (ADS)

    Higareda, M. F.; Geiger, O.; Mendoza, L.; Méndez-Sánchez, R. A.

    2012-02-01

    Statistical analysis of whole genomic sequences usually assumes a homogeneous nucleotide density throughout the genome, an assumption that has been proved incorrect for several organisms since the nucleotide density is only locally homogeneous. To avoid giving a single numerical value to this variable property, we propose the use of spectral statistics, which characterizes the density of nucleotides as a function of its position in the genome. We show that the cumulative density of bases in bacterial genomes can be separated into an average (or secular) plus a fluctuating part. Bacterial genomes can be divided into two groups according to the qualitative description of their secular part: linear and piecewise linear. These two groups of genomes show different properties when their nucleotide spacing distribution is studied. In order to analyze genomes having a variable nucleotide density, statistically, the use of unfolding is necessary, i.e., to get a separation between the secular part and the fluctuations. The unfolding allows an adequate comparison with the statistical properties of other genomes. With this methodology, four genomes were analyzed Burkholderia, Bacillus, Clostridium and Corynebacterium. Interestingly, the nearest neighbor spacing distributions or detrended distance distributions are very similar for species within the same genus but they are very different for species from different genera. This difference can be attributed to the difference in the codon usage.

  18. Genome sequences of a mouse-avirulent and a mouse-virulent strain of Ross River virus.

    PubMed

    Faragher, S G; Meek, A D; Rice, C M; Dalgarno, L

    1988-04-01

    The nucleotide sequence of the genomic RNA of a mouse-avirulent strain of Ross River virus, RRV NB5092 (isolated in 1969), has been determined and the corresponding sequence for the prototype mouse-virulent strain, RRV T48 (isolated in 1959), has been completed. The RRV NB5092 genome is approximately 11,674 nucleotides in length, compared with 11,853 nucleotides for RRV T48. RRV NB5092 and RRV T48 have the same genome organization. For both viruses an untranslated region of 80 nucleotides at the 5' end of the genome is followed by a 7440-nucleotide open reading frame which is interrupted after 5586 nucleotides by a single opal termination codon. By homology with other alphaviruses, the 5586-nucleotide open reading frame encodes the nonstructural proteins nsP1, nsP2, and nsP3; a fourth nonstructural protein, nsP4, is produced by read-through of the opal codon. The RRV nonstructural proteins show strong homology with the corresponding proteins of Sindbis virus and Semliki Forest virus in terms of size, net charge, and hydropathy characteristics. However, homology is not uniform between or within the proteins; nsP1, nsP2, and nsP4 contain extended domains which are highly conserved between alphaviruses, while the C-terminal region of nsP3 shows little conservation in sequence or length between alphaviruses. An untranslated "junction" region of 44 nucleotides (for RRV NB5092) or 47 nucleotides (for RRV T48) separates the nonstructural and structural protein coding regions. The structural proteins (capsid-E3-E2-6K-E1) are translated from an open reading frame of 3762 nucleotides which is followed by a 3'-untranslated region of approximately 348 nucleotides (for RRV NB5092) or 524 nucleotides (for RRV T48). Excluding deletions and insertions, the genomes of RRV NB5092 and RRV T48 differ at 284 nucleotides, representing a sequence divergence of 2.38%. Sequence deletions or insertions were found only in the noncoding regions and include a 173-nucleotide deletion in the 3'-untranslated region of RRV NB5092, compared with RRV T48. In the coding regions, most of the nucleotide differences are silent; there are 36 amino acid differences in the nonstructural proteins and 12 in the structural proteins. The distribution of amino acid differences between the two RRV strains correlates with the location of domains which are poorly conserved in sequence between alphaviruses. The possible role of amino acid differences in envelope glycoproteins E1 and E2 in determining the different antigenic and biological properties of RRV NB5092 and RRV T48 is discussed.

  19. Genomic Epidemiology of Salmonella enterica Serotype Enteritidis based on Population Structure of Prevalent Lineages

    PubMed Central

    Desai, Prerak T.; den Bakker, Henk C.; Mikoleit, Matthew; Tolar, Beth; Trees, Eija; Hendriksen, Rene S.; Frye, Jonathan G.; Porwollik, Steffen; Weimer, Bart C.; Wiedmann, Martin; Weinstock, George M.; Fields, Patricia I.; McClelland, Michael

    2014-01-01

    Salmonella enterica serotype Enteritidis is one of the most commonly reported causes of human salmonellosis. Its low genetic diversity, measured by fingerprinting methods, has made subtyping a challenge. We used whole-genome sequencing to characterize 125 S. enterica Enteritidis and 3 S. enterica serotype Nitra strains. Single-nucleotide polymorphisms were filtered to identify 4,887 reliable loci that distinguished all isolates from each other. Our whole-genome single-nucleotide polymorphism typing approach was robust for S. enterica Enteritidis subtyping with combined data for different strains from 2 different sequencing platforms. Five major genetic lineages were recognized, which revealed possible patterns of geographic and epidemiologic distribution. Analyses on the population dynamics and evolutionary history estimated that major lineages emerged during the 17th–18th centuries and diversified during the 1920s and 1950s. PMID:25147968

  20. Mycobacterium leprae: genes, pseudogenes and genetic diversity

    PubMed Central

    Singh, Pushpendra; Cole, Stewart T

    2011-01-01

    Leprosy, which has afflicted human populations for millenia, results from infection with Mycobacterium leprae, an unculturable pathogen with an exceptionally long generation time. Considerable insight into the biology and drug resistance of the leprosy bacillus has been obtained from genomics. M. leprae has undergone reductive evolution and pseudogenes now occupy half of its genome. Comparative genomics of four different strains revealed remarkable conservation of the genome (99.995% identity) yet uncovered 215 polymorphic sites, mainly single nucleotide polymorphisms, and a handful of new pseudogenes. Mapping these polymorphisms in a large panel of strains defined 16 single nucleotide polymorphism-subtypes that showed strong geographical associations and helped retrace the evolution of M. leprae. PMID:21162636

  1. Annotate-it: a Swiss-knife approach to annotation, analysis and interpretation of single nucleotide variation in human disease

    PubMed Central

    2012-01-01

    The increasing size and complexity of exome/genome sequencing data requires new tools for clinical geneticists to discover disease-causing variants. Bottlenecks in identifying the causative variation include poor cross-sample querying, constantly changing functional annotation and not considering existing knowledge concerning the phenotype. We describe a methodology that facilitates exploration of patient sequencing data towards identification of causal variants under different genetic hypotheses. Annotate-it facilitates handling, analysis and interpretation of high-throughput single nucleotide variant data. We demonstrate our strategy using three case studies. Annotate-it is freely available and test data are accessible to all users at http://www.annotate-it.org. PMID:23013645

  2. Four Linked Genes Participate in Controlling Sporulation Efficiency in Budding Yeast

    PubMed Central

    Ben-Ari, Giora; Zenvirth, Drora; Sherman, Amir; David, Lior; Klutstein, Michael; Lavi, Uri; Hillel, Jossi; Simchen, Giora

    2006-01-01

    Quantitative traits are conditioned by several genetic determinants. Since such genes influence many important complex traits in various organisms, the identification of quantitative trait loci (QTLs) is of major interest, but still encounters serious difficulties. We detected four linked genes within one QTL, which participate in controlling sporulation efficiency in Saccharomyces cerevisiae. Following the identification of single nucleotide polymorphisms by comparing the sequences of 145 genes between the parental strains SK1 and S288c, we analyzed the segregating progeny of the cross between them. Through reciprocal hemizygosity analysis, four genes, RAS2, PMS1, SWS2, and FKH2, located in a region of 60 kilobases on Chromosome 14, were found to be associated with sporulation efficiency. Three of the four “high” sporulation alleles are derived from the “low” sporulating strain. Two of these sporulation-related genes were verified through allele replacements. For RAS2, the causative variation was suggested to be a single nucleotide difference in the upstream region of the gene. This quantitative trait nucleotide accounts for sporulation variability among a set of ten closely related winery yeast strains. Our results provide a detailed view of genetic complexity in one “QTL region” that controls a quantitative trait and reports a single nucleotide polymorphism-trait association in wild strains. Moreover, these findings have implications on QTL identification in higher eukaryotes. PMID:17112318

  3. Makeup of the genetic correlation between milk production traits using genome-wide single nucleotide polymorphism information.

    PubMed

    van Binsbergen, R; Veerkamp, R F; Calus, M P L

    2012-04-01

    The correlated responses between traits may differ depending on the makeup of genetic covariances, and may differ from the predictions of polygenic covariances. Therefore, the objective of the present study was to investigate the makeup of the genetic covariances between the well-studied traits: milk yield, fat yield, protein yield, and their percentages in more detail. Phenotypic records of 1,737 heifers of research farms in 4 different countries were used after homogenizing and adjusting for management effects. All cows had a genotype for 37,590 single nucleotide polymorphisms (SNP). A bayesian stochastic search variable selection model was used to estimate the SNP effects for each trait. About 0.5 to 1.0% of the SNP had a significant effect on 1 or more traits; however, the SNP without a significant effect explained most of the genetic variances and covariances of the traits. Single nucleotide polymorphism correlations differed from the polygenic correlations, but only 10 regions were found with an effect on multiple traits; in 1 of these regions the DGAT1 gene was previously reported with an effect on multiple traits. This region explained up to 41% of the variances of 4 traits and explained a major part of the correlation between fat yield and fat percentage and contributes to asymmetry in correlated response between fat yield and fat percentage. Overall, for the traits in this study, the infinitesimal model is expected to be sufficient for the estimation of the variances and covariances. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  4. Structural characterization of Helicobacter pylori dethiobiotin synthetase reveals differences between family members

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Porebski, Przemyslaw J.; Klimecka, Maria; Chruszcz, Maksymilian

    2012-07-11

    Dethiobiotin synthetase (DTBS) is involved in the biosynthesis of biotin in bacteria, fungi, and plants. As humans lack this pathway, DTBS is a promising antimicrobial drug target. We determined structures of DTBS from Helicobacter pylori (hpDTBS) bound with cofactors and a substrate analog, and described its unique characteristics relative to other DTBS proteins. Comparison with bacterial DTBS orthologs revealed considerable structural differences in nucleotide recognition. The C-terminal region of DTBS proteins, which contains two nucleotide-recognition motifs, differs greatly among DTBS proteins from different species. The structure of hpDTBS revealed that this protein is unique and does not contain a C-terminalmore » region containing one of the motifs. The single nucleotide-binding motif in hpDTBS is similar to its counterpart in GTPases; however, isothermal titration calorimetry binding studies showed that hpDTBS has a strong preference for ATP. The structural determinants of ATP specificity were assessed with X-ray crystallographic studies of hpDTBS-ATP and hpDTBS-GTP complexes. The unique mode of nucleotide recognition in hpDTBS makes this protein a good target for H. pylori-specific inhibitors of the biotin synthesis pathway.« less

  5. Infectious mononucleosis-linked HLA class I single nucleotide polymorphism is associated with multiple sclerosis.

    PubMed

    Jafari, Naghmeh; Broer, Linda; Hoppenbrouwers, Ilse A; van Duijn, Cornelia M; Hintzen, Rogier Q

    2010-11-01

    Multiple sclerosis is a presumed autoimmune disease associated with genetic and environmental risk factors such as infectious mononucleosis. Recent research has shown infectious mononucleosis to be associated with a specific HLA class I polymorphism. Our aim was to test if the infectious mononucleosis-linked HLA class I single nucleotide polymorphism (rs6457110) is also associated with multiple sclerosis. Genotyping of the HLA-A single nucleotide polymorphism rs6457110 using TaqMan was performed in 591 multiple sclerosis cases and 600 controls. The association of multiple sclerosis with the HLA-A single nucleotide polymorphism was tested using logistic regression adjusted for age, sex and HLA-DRB1*1501. HLA-A minor allele (A) is associated with multiple sclerosis (OR = 0.68; p = 4.08 × 10( -5)). After stratification for HLA-DRB1*1501 risk allele (T) carrier we showed a significant OR of 0.70 (p = 0.003) for HLA-A. HLA class I single nucleotide polymorphism rs6457110 is associated with infectious mononucleosis and multiple sclerosis, independent of the major class II allele, supporting the hypothesis that shared genetics may contribute to the association between infectious mononucleosis and multiple sclerosis.

  6. Aquaporin-4 polymorphisms and brain/body weight ratio in sudden infant death syndrome (SIDS).

    PubMed

    Studer, Jacqueline; Bartsch, Christine; Haas, Cordula

    2014-07-01

    Failure in the regulation of homeostatic water balance in the brain is associated with severe cerebral edema and increased brain weights and may also play an important role in the pathogenesis of sudden infant death syndrome (SIDS). We genotyped three single-nucleotide polymorphisms in the aquaporin-4 water channel-encoding gene (AQP4), which were previously shown to be associated with (i) SIDS in Norwegian infants (rs2075575), (ii) severe brain edema (rs9951307), and (iii) increased brain water permeability (rs3906956). We also determined whether the brain/body weight ratio is increased in SIDS infants compared with sex- and age-matched controls. Genotyping of the three AQP4 single-nucleotide polymorphisms was performed in 160 Caucasian SIDS infants and 181 healthy Swiss adults using a single-base extension method. Brain and body weights were measured during autopsy in 157 SIDS and 59 non-SIDS infants. No differences were detected in the allelic frequencies of the three AQP4 single-nucleotide polymorphisms between SIDS and adult controls. The brain/body weight ratio was similarly distributed in SIDS and non-SIDS infants. Variations in the AQP4 gene seem of limited significance as predisposing factors in Caucasian SIDS infants. Increased brain weights may only become evident in conjunction with environmental or other genetic risk factors.

  7. Association of Nitric Oxide Synthase and Matrix Metalloprotease Single Nucleotide Polymorphisms with Preeclampsia and Its Complications

    PubMed Central

    Leonardo, Daniela P.; Albuquerque, Dulcinéia M.; Lanaro, Carolina; Baptista, Letícia C.; Cecatti, José G.; Surita, Fernanda G.; Parpinelli, Mary A.; Costa, Fernando F.; Franco-Penteado, Carla F.; Fertrin, Kleber Y.; Costa, Maria Laura

    2015-01-01

    Background Preeclampsia is one of the leading causes of maternal and neonatal morbidity and mortality in the world, but its appearance is still unpredictable and its pathophysiology has not been entirely elucidated. Genetic studies have associated single nucleotide polymorphisms in genes encoding nitric oxide synthase and matrix metalloproteases with preeclampsia, but the results are largely inconclusive across different populations. Objectives To investigate the association of single nucleotide polymorphisms (SNPs) in NOS3 (G894T, T-786C, and a variable number of tandem repetitions VNTR in intron 4), MMP2 (C-1306T), and MMP9 (C-1562T) genes with preeclampsia in patients from Southeastern Brazil. Methods This prospective case-control study enrolled 77 women with preeclampsia and 266 control pregnant women. Clinical data were collected to assess risk factors and the presence of severe complications, such as eclampsia and HELLP (hemolysis, elevated liver enzymes, and low platelets) syndrome. Results We found a significant association between the single nucleotide polymorphism NOS3 T-786C and preeclampsia, independently from age, height, weight, or the other SNPs studied, and no association was found with the other polymorphisms. Age and history of preeclampsia were also identified as risk factors. The presence of at least one polymorphic allele for NOS3 T-786C was also associated with the occurrence of eclampsia or HELLP syndrome among preeclamptic women. Conclusions Our data support that the NOS3 T-786C SNP is associated with preeclampsia and the severity of its complications. PMID:26317342

  8. A Bioluminometric Method of DNA Sequencing

    NASA Technical Reports Server (NTRS)

    Ronaghi, Mostafa; Pourmand, Nader; Stolc, Viktor; Arnold, Jim (Technical Monitor)

    2001-01-01

    Pyrosequencing is a bioluminometric single-tube DNA sequencing method that takes advantage of co-operativity between four enzymes to monitor DNA synthesis. In this sequencing-by-synthesis method, a cascade of enzymatic reactions yields detectable light, which is proportional to incorporated nucleotides. Pyrosequencing has the advantages of accuracy, flexibility and parallel processing. It can be easily automated. Furthermore, the technique dispenses with the need for labeled primers, labeled nucleotides and gel-electrophoresis. In this chapter, the use of this technique for different applications is discussed.

  9. Nucleotide sequence of a resistance breaking mutant of southern bean mosaic virus.

    PubMed

    Lee, L; Anderson, E J

    1998-01-01

    SBMV-S is a resistance-breaking mutant of an Arkansas isolate of the bean strain of southern bean mosaic virus (SBMV-BARK) that is able to move systemically in Phaseolus vulgaris cvs. Pinto and Great Northern, whereas the wild-type SBMV-BARK causes local necrotic lesions and is restricted to the inoculated leaves of these hosts. Sequence analysis of the 4136 nucleotide genomes of SBMV-BARK and SBMV-S revealed seven nucleotide differences, but only four deduced amino acid changes. A single amino acid change occurred in the C-terminal region of the putative RNA-dependent RNA polymerase and three differences were identified in the N-terminal portion of the virus coat protein. SBMV-BARK and SBMV-S were compared with other sobemoviruses and were found to contain a high level of nucleotide sequence identity (91.3%) to SBMV-B. Unlike SBMV-B however, SBMV-BARK and SBMV-S contained four putative overlapping open reading frames, making them more similar in genome organization to the cowpea strain, SBMV-C. The possibility exists that mutations or even errors, that resulted in mis-identification of open reading frames, occurred in previously published information on nucleotide sequence and genomic organization for SBMV-B.

  10. Apolipoprotein E genotyping by multiplex tetra-primer amplification refractory mutation system PCR in single reaction tube.

    PubMed

    Yang, Young Geun; Kim, Jong Yeol; Park, Su Jeong; Kim, Suhng Wook; Jeon, Ok-Hee; Kim, Doo-Sik

    2007-08-31

    Apolipoprotein E (APOE) plays a critical role in lipoprotein metabolism by binding to both low-density lipoprotein and APOE receptors. The APOE gene has three allelic forms, epsilon2, epsilon3, and epsilon4, which encode different isoforms of the APOE protein. In this study, we have developed a new genotyping method for APOE. Our multiplex tetra-primer amplification refractory mutation system (multiplex T-ARMS) polymerase chain reaction (PCR) was performed in a single reaction tube with six primers consisting of two common primers and two specific primers for each of two single nucleotide polymorphism (SNP) sites. We obtained definitive electropherograms that showed three (epsilon2/epsilon2, epsilon3/epsilon3, and epsilon4/epsilon4), four (epsilon2/epsilon3 and epsilon3/epsilon4), and five (epsilon2/epsilon4) amplicons by multiplex T-ARMS PCR in a single reaction tube. Multiplex T-ARMS PCR for APOE genotyping is a simple and accurate method that requires only a single PCR reaction, without any another treatments or expensive instrumentation, to simultaneously identify two sites of single nucleotide polymorphisms.

  11. Gene-gene, gene-environment, gene-nutrient interactions and single nucleotide polymorphisms of inflammatory cytokines.

    PubMed

    Nadeem, Amina; Mumtaz, Sadaf; Naveed, Abdul Khaliq; Aslam, Muhammad; Siddiqui, Arif; Lodhi, Ghulam Mustafa; Ahmad, Tausif

    2015-05-15

    Inflammation plays a significant role in the etiology of type 2 diabetes mellitus (T2DM). The rise in the pro-inflammatory cytokines is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury, oxidative stress and beta cell apoptosis in T2DM. Among the recognized markers are interleukin (IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha (TNF-α), C-reactive protein, resistin, adiponectin, tissue plasminogen activator, fibrinogen and heptoglobins. Diabetes mellitus has firm genetic and very strong environmental influence; exhibiting a polygenic mode of inheritance. Many single nucleotide polymorphisms (SNPs) in various genes including those of pro and anti-inflammatory cytokines have been reported as a risk for T2DM. Not all the SNPs have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups. The inter-ethnic variations can be explained by the fact that gene expression may be regulated by gene-gene, gene-environment and gene-nutrient interactions. This review highlights the impact of these interactions on determining the role of single nucleotide polymorphism of IL-6, TNF-α, resistin and adiponectin in pathogenesis of T2DM.

  12. Discovery, genotyping and characterization of structural variation and novel sequence at single nucleotide resolution from de novo genome assemblies on a population scale.

    PubMed

    Liu, Siyang; Huang, Shujia; Rao, Junhua; Ye, Weijian; Krogh, Anders; Wang, Jun

    2015-01-01

    Comprehensive recognition of genomic variation in one individual is important for understanding disease and developing personalized medication and treatment. Many tools based on DNA re-sequencing exist for identification of single nucleotide polymorphisms, small insertions and deletions (indels) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction of population-scale pan-genomes. Our study also highlights the usefulness of the de novo assembly strategy for definition of genome structure.

  13. Predicting the disease of Alzheimer with SNP biomarkers and clinical data using data mining classification approach: decision tree.

    PubMed

    Erdoğan, Onur; Aydin Son, Yeşim

    2014-01-01

    Single Nucleotide Polymorphisms (SNPs) are the most common genomic variations where only a single nucleotide differs between individuals. Individual SNPs and SNP profiles associated with diseases can be utilized as biological markers. But there is a need to determine the SNP subsets and patients' clinical data which is informative for the diagnosis. Data mining approaches have the highest potential for extracting the knowledge from genomic datasets and selecting the representative SNPs as well as most effective and informative clinical features for the clinical diagnosis of the diseases. In this study, we have applied one of the widely used data mining classification methodology: "decision tree" for associating the SNP biomarkers and significant clinical data with the Alzheimer's disease (AD), which is the most common form of "dementia". Different tree construction parameters have been compared for the optimization, and the most accurate tree for predicting the AD is presented.

  14. Yeast ribonuclease III uses a network of multiple hydrogen bonds for RNA binding and cleavage.

    PubMed

    Lavoie, Mathieu; Abou Elela, Sherif

    2008-08-19

    Members of the bacterial RNase III family recognize a variety of short structured RNAs with few common features. It is not clear how this group of enzymes supports high cleavage fidelity while maintaining a broad base of substrates. Here we show that the yeast orthologue of RNase III (Rnt1p) uses a network of 2'-OH-dependent interactions to recognize substrates with different structures. We designed a series of bipartite substrates permitting the distinction between binding and cleavage defects. Each substrate was engineered to carry a single or multiple 2'- O-methyl or 2'-fluoro ribonucleotide substitutions to prevent the formation of hydrogen bonds with a specific nucleotide or group of nucleotides. Interestingly, introduction of 2'- O-methyl ribonucleotides near the cleavage site increased the rate of catalysis, indicating that 2'-OH are not required for cleavage. Substitution of nucleotides in known Rnt1p binding site with 2'- O-methyl ribonucleotides inhibited cleavage while single 2'-fluoro ribonucleotide substitutions did not. This indicates that while no single 2'-OH is essential for Rnt1p cleavage, small changes in the substrate structure are not tolerated. Strikingly, several nucleotide substitutions greatly increased the substrate dissociation constant with little or no effect on the Michaelis-Menten constant or rate of catalysis. Together, the results indicate that Rnt1p uses a network of nucleotide interactions to identify its substrate and support two distinct modes of binding. One mode is primarily mediated by the dsRNA binding domain and leads to the formation of stable RNA/protein complex, while the other requires the presence of the nuclease and N-terminal domains and leads to RNA cleavage.

  15. Phosphate-Modified Nucleotides for Monitoring Enzyme Activity.

    PubMed

    Ermert, Susanne; Marx, Andreas; Hacker, Stephan M

    2017-04-01

    Nucleotides modified at the terminal phosphate position have been proven to be interesting entities to study the activity of a variety of different protein classes. In this chapter, we present various types of modifications that were attached as reporter molecules to the phosphate chain of nucleotides and briefly describe the chemical reactions that are frequently used to synthesize them. Furthermore, we discuss a variety of applications of these molecules. Kinase activity, for instance, was studied by transfer of a phosphate modified with a reporter group to the target proteins. This allows not only studying the activity of kinases, but also identifying their target proteins. Moreover, kinases can also be directly labeled with a reporter at a conserved lysine using acyl-phosphate probes. Another important application for phosphate-modified nucleotides is the study of RNA and DNA polymerases. In this context, single-molecule sequencing is made possible using detection in zero-mode waveguides, nanopores or by a Förster resonance energy transfer (FRET)-based mechanism between the polymerase and a fluorophore-labeled nucleotide. Additionally, fluorogenic nucleotides that utilize an intramolecular interaction between a fluorophore and the nucleobase or an intramolecular FRET effect have been successfully developed to study a variety of different enzymes. Finally, also some novel techniques applying electron paramagnetic resonance (EPR)-based detection of nucleotide cleavage or the detection of the cleavage of fluorophosphates are discussed. Taken together, nucleotides modified at the terminal phosphate position have been applied to study the activity of a large diversity of proteins and are valuable tools to enhance the knowledge of biological systems.

  16. Candida kantuleensis sp. nov., a d-xylose-fermenting yeast species isolated from peat in a tropical peat swamp forest.

    PubMed

    Nitiyon, Sukanya; Khunnamwong, Pannida; Lertwattanasakul, Noppon; Limtong, Savitree

    2018-05-24

    Three strains (DMKU-XE11 T , DMKU-XE15 and DMKU-XE20) representing a single novel anamorphic and d-xylose-fermenting yeast species were obtained from three peat samples collected from Khan Thulee peat swamp forest in Surat Thani province, Thailand. The strains differed from each other by one to two nucleotide substitutions in the sequences of the D1/D2 region of the large subunit (LSU) rRNA gene and zero to one nucleotide substitution in the internal transcribed spacer (ITS) region. Phylogenetic analysis based on the combined sequences of the ITS and the D1/D2 regions showed that the three strains represented a single Candida species that was distinct from the other related species in the Lodderomyces/Candida albicans clade. The three strains form a subclade with the other Candida species including Candida sanyaensis, Candida tropicalis and Candida sojae. C. sanyaensis was the most closely related species, with 2.1-2.4 % nucleotide substitutions in the D1/D2 region of the LSU rRNA gene, and 3.8-4.0 % nucleotide substitutions in the ITS region. The three strains (DMKU-XE11 T , DMKU-XE15 and DMKU-XE20) were assigned as a single novel species, which was named Candida kantuleensis sp. nov. The type strain is DMKU-XE11 T (=CBS 15219 T =TBRC 7764 T ). The MycoBank number for C. kantuleensis sp. nov. is MB 824179.

  17. IL-TIF/IL-22: genomic organization and mapping of the human and mouse genes.

    PubMed

    Dumoutier, L; Van Roost, E; Ameye, G; Michaux, L; Renauld, J C

    2000-12-01

    IL-TIF is a new cytokine originally identified as a gene induced by IL-9 in murine T lymphocytes, and showing 22% amino acid identity with IL-10. Here, we report the sequence and organization of the mouse and human IL-TIF genes, which both consist of 6 exons spreading over approximately 6 Kb. The IL-TIF gene is a single copy gene in humans, and is located on chromosome 12q15, at 90 Kb from the IFN gamma gene, and at 27 Kb from the AK155 gene, which codes for another IL-10-related cytokine. In the mouse, the IL-TIF gene is located on chromosome 10, also in the same region as the IFN gamma gene. Although it is a single copy gene in BALB/c and DBA/2 mice, the IL-TIF gene is duplicated in other strains such as C57Bl/6, FVB and 129. The two copies, which show 98% nucleotide identity in the coding region, were named IL-TIF alpha and IL-TIF beta. Beside single nucleotide variations, they differ by a 658 nucleotide deletion in IL-TIF beta, including the first non-coding exon and 603 nucleotides from the promoter. A DNA fragment corresponding to this deletion was sufficient to confer IL-9-regulated expression of a luciferase reporter plasmid, suggesting that the IL-TIF beta gene is either differentially regulated, or not expressed at all.

  18. Molecular dynamics studies on the interaction and encapsulation processes of the nucleotide and peptide chains inside of a carbon nanotube matrix with inclusion of gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Kholmurodov, Kholmirzo; Dushanov, Eric; Khusenov, Mirzoaziz; Rahmonov, Khaiyom; Zelenyak, Tatyana; Doroshkevich, Alexander; Majumder, Subrata

    2017-05-01

    Studying of molecular systems as single nucleotides, nucleotide and peptide chains, RNA and DNA interacting with metallic nanoparticles within a carbon nanotube matrix represents a great interest in modern research. In this respect it is worth mentioning the development of the electronics diagnostic apparatus, the biochemical and biotechnological application tools (nanorobotic design, facilities of drug delivery in a living cell), so on. In the present work using molecular dynamics (MD) simulation method the interaction process of small nucleotide chains (NCs) and elongated peptide chains with different sets of metallic nanoparticles (NPs) on a matrix from carbon nanotube (CNT) were simulated to study their mechanisms of encapsulation and folding processes. We have performed a series of the MD calculations with different NC,peptides-NP-CNT models that were aimed on the investigation of the peculiarities of NC,peptide-NP interactions, the formation of bonds and structures in the system, as well as the dynamical behavior in an environment confined by the CNT matrix.

  19. Nucleotide cleaving agents and method

    DOEpatents

    Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.

    2000-01-01

    The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.

  20. Refactoring the Genetic Code for Increased Evolvability

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pines, Gur; Winkler, James D.; Pines, Assaf

    ABSTRACT The standard genetic code is robust to mutations during transcription and translation. Point mutations are likely to be synonymous or to preserve the chemical properties of the original amino acid. Saturation mutagenesis experiments suggest that in some cases the best-performing mutant requires replacement of more than a single nucleotide within a codon. These replacements are essentially inaccessible to common error-based laboratory engineering techniques that alter a single nucleotide per mutation event, due to the extreme rarity of adjacent mutations. In this theoretical study, we suggest a radical reordering of the genetic code that maximizes the mutagenic potential of singlemore » nucleotide replacements. We explore several possible genetic codes that allow a greater degree of accessibility to the mutational landscape and may result in a hyperevolvable organism that could serve as an ideal platform for directed evolution experiments. We then conclude by evaluating the challenges of constructing such recoded organisms and their potential applications within the field of synthetic biology. IMPORTANCE The conservative nature of the genetic code prevents bioengineers from efficiently accessing the full mutational landscape of a gene via common error-prone methods. Here, we present two computational approaches to generate alternative genetic codes with increased accessibility. These new codes allow mutational transitions to a larger pool of amino acids and with a greater extent of chemical differences, based on a single nucleotide replacement within the codon, thus increasing evolvability both at the single-gene and at the genome levels. Given the widespread use of these techniques for strain and protein improvement, along with more fundamental evolutionary biology questions, the use of recoded organisms that maximize evolvability should significantly improve the efficiency of directed evolution, library generation, and fitness maximization.« less

  1. Refactoring the Genetic Code for Increased Evolvability

    DOE PAGES

    Pines, Gur; Winkler, James D.; Pines, Assaf; ...

    2017-11-14

    ABSTRACT The standard genetic code is robust to mutations during transcription and translation. Point mutations are likely to be synonymous or to preserve the chemical properties of the original amino acid. Saturation mutagenesis experiments suggest that in some cases the best-performing mutant requires replacement of more than a single nucleotide within a codon. These replacements are essentially inaccessible to common error-based laboratory engineering techniques that alter a single nucleotide per mutation event, due to the extreme rarity of adjacent mutations. In this theoretical study, we suggest a radical reordering of the genetic code that maximizes the mutagenic potential of singlemore » nucleotide replacements. We explore several possible genetic codes that allow a greater degree of accessibility to the mutational landscape and may result in a hyperevolvable organism that could serve as an ideal platform for directed evolution experiments. We then conclude by evaluating the challenges of constructing such recoded organisms and their potential applications within the field of synthetic biology. IMPORTANCE The conservative nature of the genetic code prevents bioengineers from efficiently accessing the full mutational landscape of a gene via common error-prone methods. Here, we present two computational approaches to generate alternative genetic codes with increased accessibility. These new codes allow mutational transitions to a larger pool of amino acids and with a greater extent of chemical differences, based on a single nucleotide replacement within the codon, thus increasing evolvability both at the single-gene and at the genome levels. Given the widespread use of these techniques for strain and protein improvement, along with more fundamental evolutionary biology questions, the use of recoded organisms that maximize evolvability should significantly improve the efficiency of directed evolution, library generation, and fitness maximization.« less

  2. Association of single nucleotide polymorphism in CD28(C/T-I3 + 17) and CD40 (C/T-1) genes with the Graves' disease.

    PubMed

    Mustafa, Saima; Fatima, Hira; Fatima, Sadia; Khosa, Tafheem; Akbar, Atif; Shaikh, Rehan Sadiq; Iqbal, Furhan

    2018-01-01

    To find out a correlation between the single nucleotide polymorphisms in cluster of differentiation 28 and cluster of differentiation 40 genes with Graves' disease, if any. This case-control study was conducted at the Multan Institute of Nuclear Medicine and Radiotherapy, Multan, Pakistan, and comprised blood samples of Graves' disease patients and controls. Various risk factors were also correlated either with the genotype at each single-nucleotide polymorphism or with various combinations of genotypes studied during present investigation. Of the 160 samples, there were 80(50%) each from patients and controls. Risk factor analysis revealed that gender (p=0.008), marital status (p<0.001), education (p<0.001), smoking (p<0.001), tri-iodothyronine (P <0.001), thyroxin (p<0.001) and thyroid-stimulating hormone (p<0.000) levels in blood were associated with Graves' disease. Both single-nucleotide polymorphisms in both genes were not associated with Graves' disease, either individually or in any combined form.

  3. Identification and Characterization of Novel Variations in Platelet G-Protein Coupled Receptor (GPCR) Genes in Patients Historically Diagnosed with Type 1 von Willebrand Disease.

    PubMed

    Stockley, Jacqueline; Nisar, Shaista P; Leo, Vincenzo C; Sabi, Essa; Cunningham, Margaret R; Eikenboom, Jeroen C; Lethagen, Stefan; Schneppenheim, Reinhard; Goodeve, Anne C; Watson, Steve P; Mundell, Stuart J; Daly, Martina E

    2015-01-01

    The clinical expression of type 1 von Willebrand disease may be modified by co-inheritance of other mild bleeding diatheses. We previously showed that mutations in the platelet P2Y12 ADP receptor gene (P2RY12) could contribute to the bleeding phenotype in patients with type 1 von Willebrand disease. Here we investigated whether variations in platelet G protein-coupled receptor genes other than P2RY12 also contributed to the bleeding phenotype. Platelet G protein-coupled receptor genes P2RY1, F2R, F2RL3, TBXA2R and PTGIR were sequenced in 146 index cases with type 1 von Willebrand disease and the potential effects of identified single nucleotide variations were assessed using in silico methods and heterologous expression analysis. Seven heterozygous single nucleotide variations were identified in 8 index cases. Two single nucleotide variations were detected in F2R; a novel c.-67G>C transversion which reduced F2R transcriptional activity and a rare c.1063C>T transition predicting a p.L355F substitution which did not interfere with PAR1 expression or signalling. Two synonymous single nucleotide variations were identified in F2RL3 (c.402C>G, p.A134 =; c.1029 G>C p.V343 =), both of which introduced less commonly used codons and were predicted to be deleterious, though neither of them affected PAR4 receptor expression. A third single nucleotide variation in F2RL3 (c.65 C>A; p.T22N) was co-inherited with a synonymous single nucleotide variation in TBXA2R (c.6680 C>T, p.S218 =). Expression and signalling of the p.T22N PAR4 variant was similar to wild-type, while the TBXA2R variation introduced a cryptic splice site that was predicted to cause premature termination of protein translation. The enrichment of single nucleotide variations in G protein-coupled receptor genes among type 1 von Willebrand disease patients supports the view of type 1 von Willebrand disease as a polygenic disorder.

  4. Characteristics of hyperpolarization-activated cyclic nucleotide-gated channels in dorsal root ganglion neurons at different ages and sizes.

    PubMed

    Hou, Baohua; Chen, Hengling; Qu, Xiangwei; Lin, Xianguang; Luo, Fang; Li, Chenhong

    2015-11-11

    In rat's sensory neurons, hyperpolarization-activated inward currents (Ih) play an essential role in mediating action potentials and contributing to neuronal excitability. Classified by the size of neurons and ages, we studied the Ih and transcription levels of hyperpolarization-activated cyclic nucleotide-gated (HCN) channels using electrophysiology and the single-cell RT-PCR. In voltage-clamp studies, Ih and half-maximal activation voltage (V1/2) changed with age and size. An analysis of all HCN subtypes in dorsal root ganglion (DRG) neurons by single-cell RT-PCR was carried out. HCN1 and HCN3 in medium-small elderly neurons had a weak expression. HCN2 in newborns and HCN4 in elderly rats also had a weak expression. The aim of this study is to examine the age-related Ih and HCN channels subunits in different ages and sizes of DRG neurons. The results would be significant in understanding the physiological and pathophysiological function of different sizes of DRG neurons in different age periods.

  5. Detecting Single-Nucleotides by Tunneling Current Measurements at Sub-MHz Temporal Resolution.

    PubMed

    Morikawa, Takanori; Yokota, Kazumichi; Tanimoto, Sachie; Tsutsui, Makusu; Taniguchi, Masateru

    2017-04-18

    Label-free detection of single-nucleotides was performed by fast tunneling current measurements in a polar solvent at 1 MHz sampling rate using SiO₂-protected Au nanoprobes. Short current spikes were observed, suggestive of trapping/detrapping of individual nucleotides between the nanoelectrodes. The fall and rise features of the electrical signatures indicated signal retardation by capacitance effects with a time constant of about 10 microseconds. The high temporal resolution revealed current fluctuations, reflecting the molecular conformation degrees of freedom in the electrode gap. The method presented in this work may enable direct characterizations of dynamic changes in single-molecule conformations in an electrode gap in liquid.

  6. [Single nucleotide polymorphism and its application in allogeneic hematopoietic stem cell transplantation--review].

    PubMed

    Li, Su-Xia

    2004-12-01

    Single nucleotide polymorphism (SNP) is the third genetic marker after restriction fragment length polymorphism (RFLP) and short tandem repeat. It represents the most density genetic variability in the human genome and has been widely used in gene location, cloning, and research of heredity variation, as well as parenthood identification in forensic medicine. As steady heredity polymorphism, single nucleotide polymorphism is becoming the focus of attention in monitoring chimerism and minimal residual disease in the patients after allogeneic hematopoietic stem cell transplantation. The article reviews SNP heredity characterization, analysis techniques and its applications in allogeneic stem cell transplantation and other fields.

  7. Using Single-Nucleotide Polymorphisms To Discriminate Disease-Associated from Carried Genomes of Neisseria meningitidis▿†

    PubMed Central

    Katz, Lee S.; Sharma, Nitya V.; Harcourt, Brian H.; Thomas, Jennifer Dolan; Wang, Xin; Mayer, Leonard W.; Jordan, I. King

    2011-01-01

    Neisseria meningitidis is one of the main agents of bacterial meningitis, causing substantial morbidity and mortality worldwide. However, most of the time N. meningitidis is carried as a commensal not associated with invasive disease. The genomic basis of the difference between disease-associated and carried isolates of N. meningitidis may provide critical insight into mechanisms of virulence, yet it has remained elusive. Here, we have taken a comparative genomics approach to interrogate the difference between disease-associated and carried isolates of N. meningitidis at the level of individual nucleotide variations (i.e., single nucleotide polymorphisms [SNPs]). We aligned complete genome sequences of 8 disease-associated and 4 carried isolates of N. meningitidis to search for SNPs that show mutually exclusive patterns of variation between the two groups. We found 63 SNPs that distinguish the 8 disease-associated genomes from the 4 carried genomes of N. meningitidis, which is far more than can be expected by chance alone given the level of nucleotide variation among the genomes. The putative list of SNPs that discriminate between disease-associated and carriage genomes may be expected to change with increased sampling or changes in the identities of the isolates being compared. Nevertheless, we show that these discriminating SNPs are more likely to reflect phenotypic differences than shared evolutionary history. Discriminating SNPs were mapped to genes, and the functions of the genes were evaluated for possible connections to virulence mechanisms. A number of overrepresented functional categories related to virulence were uncovered among SNP-associated genes, including genes related to the category “symbiosis, encompassing mutualism through parasitism.” PMID:21622743

  8. Single nucleotide resolution RNA-seq uncovers new regulatory mechanisms in the opportunistic pathogen Streptococcus agalactiae.

    PubMed

    Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe

    2015-05-30

    Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.

  9. A new single-nucleotide polymorphism database for rainbow trout generated through whole genome re-sequencing

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

  10. Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array

    USDA-ARS?s Scientific Manuscript database

    High-density single nucleotide polymorphism (SNP) genotyping chips are a powerful tool for studying genomic patterns of diversity, inferring ancestral relationships among individuals in populations and studying marker-trait associations in mapping experiments. We developed a genotyping array includ...

  11. Novel high-speed droplet-allele specific-polymerase chain reaction: application in the rapid genotyping of single nucleotide polymorphisms.

    PubMed

    Taira, Chiaki; Matsuda, Kazuyuki; Yamaguchi, Akemi; Sueki, Akane; Koeda, Hiroshi; Takagi, Fumio; Kobayashi, Yukihiro; Sugano, Mitsutoshi; Honda, Takayuki

    2013-09-23

    Single nucleotide alterations such as single nucleotide polymorphisms (SNP) and single nucleotide mutations are associated with responses to drugs and predisposition to several diseases, and they contribute to the pathogenesis of malignancies. We developed a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) with our droplet-PCR machine (droplet-AS-PCR). Using 8 SNP loci, we evaluated the specificity and sensitivity of droplet-AS-PCR. Buccal cells were pretreated with proteinase K and subjected directly to the droplet-AS-PCR without DNA extraction. The genotypes determined using the droplet-AS-PCR were then compared with those obtained by direct sequencing. Specific PCR amplifications for the 8 SNP loci were detected, and the detection limit of the droplet-AS-PCR was found to be 0.1-5.0% by dilution experiments. Droplet-AS-PCR provided specific amplification when using buccal cells, and all the genotypes determined within 9 min were consistent with those obtained by direct sequencing. Our novel droplet-AS-PCR assay enabled high-speed amplification retaining specificity and sensitivity and provided ultra-rapid genotyping. Crude samples such as buccal cells were available for the droplet-AS-PCR assay, resulting in the reduction of the total analysis time. Droplet-AS-PCR may therefore be useful for genotyping or the detection of single nucleotide alterations. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Sequence polymorphism data of the hypervariable regions of mitochondrial DNA in the Yadav population of Haryana.

    PubMed

    Verma, Kapil; Sharma, Sapna; Sharma, Arun; Dalal, Jyoti; Bhardwaj, Tapeshwar

    2018-06-01

    Genetic variations among humans occur both within and among populations and range from single nucleotide changes to multiple-nucleotide variants. These multiple-nucleotide variants are useful for studying the relationships among individuals or various population groups. The study of human genetic variations can help scientists understand how different population groups are biologically related to one another. Sequence analysis of hypervariable regions of human mitochondrial DNA (mtDNA) has been successfully used for the genetic characterization of different population groups for forensic purposes. It is well established that different ethnic or population groups differ significantly in their mtDNA distributions. In the last decade, very little research has been conducted on mtDNA variations in the Indian population, although such data would be useful for elucidating the history of human population expansion across the world. Moreover, forensic studies on mtDNA variations in the Indian subcontinent are also scarce, particularly in the northern part of India. In this report, variations in the hypervariable regions of mtDNA were analyzed in the Yadav population of Haryana. Different molecular diversity indices were computed. Further, the obtained haplotypes were classified into different haplogroups and the phylogenetic relationship between different haplogroups was inferred.

  13. A gold nanoparticles-based colorimetric test to detect single nucleotide polymorphisms for improvement of personalized therapy of psoriasis

    NASA Astrophysics Data System (ADS)

    Marsella, Alessandra; Valentini, Paola; Tarantino, Paolo; Congedo, Maurizio; Pompa, Pier Paolo

    2016-04-01

    We report a simple, rapid and low-cost test, based on gold nanoparticles, for the naked-eye colorimetric detection of a signature of single nucleotide polymorphisms (SNPs) relevant for the personalized medicine of psoriasis patients. We validated the colorimetric assay on real-world DNA samples from a cohort of 30 psoriasis patients and we compared the results, in double-blind, with those obtained with two state-of-the-art instrumental techniques, namely reverse dot blotting and direct sequencing, finding 100% agreement. We demonstrated high accuracy, sensitivity and specificity of the colorimetric test that can be easily adapted for the genotypization of different SNPs, important for the pharmacogenomics of various diseases, and in other fields, such as food traceability and population structure analysis.

  14. Complete nucleotide sequences of the coat protein messenger RNAs of brome mosaic virus and cowpea chlorotic mottle virus.

    PubMed Central

    Dasgupta, R; Kaesberg, P

    1982-01-01

    The nucleotide sequences of the subgenomic coat protein messengers (RNA4's) of two related bromoviruses, brome mosaic virus (BMV) and cowpea chlorotic mottle virus (CCMV), have been determined by direct RNA and CDNA sequencing without cloning. BMV RNA4 is 876 b long including a 5' noncoding region of nine nucleotides and a 3' noncoding region of 300 nucleotides. CCMV RNA 4 is 824 b long, including a 5' noncoding region of 10 nucleotides and a 3' noncoding region of 244 nucleotides. The encoded coat proteins are similar in length (188 amino acids for BMV and 189 amino acids for CCMV) and display about 70% homology in their amino acid sequences. Length difference between the two RNAs is due mostly to a single deletion, in CCMV with respect to BMV, of about 57 b immediately following the coding region. Allowing for this deletion the RNAs are indicate that mutations leading to divergence were constrained in the coding region primarily by the requirement of maintaining a favorable coat protein structure and in the 3' noncoding region primarily by the requirement of maintaining a favorable RNA spatial configuration. PMID:6895941

  15. Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

    PubMed Central

    Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai

    2010-01-01

    DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

  16. Genome-wide association study of fertility traits in dairy cattle using high-density single nucleotide polymorphism marker panels

    USDA-ARS?s Scientific Manuscript database

    Unfavorable genetic correlations between production and fertility traits are well documented. Genetic selection for fertility traits is slow, however, due to low heritabilities. Identification of single nucleotide polymorphisms (SNP) involved in reproduction could improve reliability of genomic esti...

  17. Discovery, Validation and Characterization of 1039 Cattle Single Nucleotide Polymorphisms

    USDA-ARS?s Scientific Manuscript database

    We identified approximately 13000 putative single nucleotide polymorphisms (SNPs) by comparison of repeat-masked BAC-end sequences from the cattle RPCI-42 BAC library with whole-genome shotgun contigs of cattle genome assembly Btau 1.0. Genotyping of a subset of these SNPs was performed on a panel ...

  18. High-throughput single nucleotide polymorphism genotyping for breeding applications in rice using the BeadXpress platform

    USDA-ARS?s Scientific Manuscript database

    Multiplexed single nucleotide polymorphism (SNP) markers have the potential to increase the speed and cost-effectiveness of genotyping, provided that an optimal SNP density is used for each application. To test the efficiency of multiplexed SNP genotyping for diversity, mapping and breeding applicat...

  19. Developing Single Nucleotide Polymorphism (SNP) markers from transcriptome sequences for the identification of longan (Dimocarpus longan) germplasm

    USDA-ARS?s Scientific Manuscript database

    Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...

  20. Informativeness of single nucleotide polymorphisms and relationships among onion populations from important world production regions

    USDA-ARS?s Scientific Manuscript database

    Single nucleotide polymorphisms (SNPs) were genotyped using a high-density array and DNAs from individual plants from important onion populations from major production regions world-wide and the likely progenitor of onion, Allium vavilovii. Genotypes at 1226 SNPs were used to estimate genetic relati...

  1. Relationships among calpastatin single nucleotide polymorphisms, calpastatin expression and tenderness in pork longissimus

    USDA-ARS?s Scientific Manuscript database

    Genome scans in the pig have identified a region on chromosome 2 (SSC2) associated with tenderness. Calpastatin is a likely positional candidate gene in this region because of its inhibitory role in the calpain system that is involved in postmortem tenderization. Novel single nucleotide polymorphism...

  2. Lineage and genogroup-defining single nucleotide polymorphisms of Escherichia coli 0157:H7

    USDA-ARS?s Scientific Manuscript database

    Escherichia coli O157:H7 is a zoonotic human pathogen for which cattle are an important reservoir host. Using both previously published and new sequencing data, a 48-locus single nucleotide polymorphism (SNP) based typing panel was developed that redundantly identified eleven genogroups that span ...

  3. A new single-nucleotide polymorphisms database for rainbow trout generated through whole genome resequencing of selected samples

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...

  4. Defining the mRNA recognition signature of a bacterial toxin protein

    DOE PAGES

    Schureck, Marc A.; Dunkle, Jack A.; Maehigashi, Tatsuya; ...

    2015-10-27

    Bacteria contain multiple type II toxins that selectively degrade mRNAs bound to the ribosome to regulate translation and growth and facilitate survival during the stringent response. Ribosome-dependent toxins recognize a variety of three-nucleotide codons within the aminoacyl (A) site, but how these endonucleases achieve substrate specificity remains poorly understood. In this paper, we identify the critical features for how the host inhibition of growth B (HigB) toxin recognizes each of the three A-site nucleotides for cleavage. X-ray crystal structures of HigB bound to two different codons on the ribosome illustrate how HigB uses a microbial RNase-like nucleotide recognition loop tomore » recognize either cytosine or adenosine at the second A-site position. Strikingly, a single HigB residue and 16S rRNA residue C1054 form an adenosine-specific pocket at the third A-site nucleotide, in contrast to how tRNAs decode mRNA. Finally, our results demonstrate that the most important determinant for mRNA cleavage by ribosome-dependent toxins is interaction with the third A-site nucleotide.« less

  5. Defining the mRNA recognition signature of a bacterial toxin protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schureck, Marc A.; Dunkle, Jack A.; Maehigashi, Tatsuya

    Bacteria contain multiple type II toxins that selectively degrade mRNAs bound to the ribosome to regulate translation and growth and facilitate survival during the stringent response. Ribosome-dependent toxins recognize a variety of three-nucleotide codons within the aminoacyl (A) site, but how these endonucleases achieve substrate specificity remains poorly understood. In this paper, we identify the critical features for how the host inhibition of growth B (HigB) toxin recognizes each of the three A-site nucleotides for cleavage. X-ray crystal structures of HigB bound to two different codons on the ribosome illustrate how HigB uses a microbial RNase-like nucleotide recognition loop tomore » recognize either cytosine or adenosine at the second A-site position. Strikingly, a single HigB residue and 16S rRNA residue C1054 form an adenosine-specific pocket at the third A-site nucleotide, in contrast to how tRNAs decode mRNA. Finally, our results demonstrate that the most important determinant for mRNA cleavage by ribosome-dependent toxins is interaction with the third A-site nucleotide.« less

  6. A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms

    PubMed Central

    Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.

    2003-01-01

    A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708

  7. Biological nanopore MspA for DNA sequencing

    NASA Astrophysics Data System (ADS)

    Manrao, Elizabeth A.

    Unlocking the information hidden in the human genome provides insight into the inner workings of complex biological systems and can be used to greatly improve health-care. In order to allow for widespread sequencing, new technologies are required that provide fast and inexpensive readings of DNA. Nanopore sequencing is a third generation DNA sequencing technology that is currently being developed to fulfill this need. In nanopore sequencing, a voltage is applied across a small pore in an electrolyte solution and the resulting ionic current is recorded. When DNA passes through the channel, the ionic current is partially blocked. If the DNA bases uniquely modulate the ionic current flowing through the channel, the time trace of the current can be related to the sequence of DNA passing through the pore. There are two main challenges to realizing nanopore sequencing: identifying a pore with sensitivity to single nucleotides and controlling the translocation of DNA through the pore so that the small single nucleotide current signatures are distinguishable from background noise. In this dissertation, I explore the use of Mycobacterium smegmatis porin A (MspA) for nanopore sequencing. In order to determine MspA's sensitivity to single nucleotides, DNA strands of various compositions are held in the pore as the resulting ionic current is measured. DNA is immobilized in MspA by attaching it to a large molecule which acts as an anchor. This technique confirms the single nucleotide resolution of the pore and additionally shows that MspA is sensitive to epigenetic modifications and single nucleotide polymorphisms. The forces from the electric field within MspA, the effective charge of nucleotides, and elasticity of DNA are estimated using a Freely Jointed Chain model of single stranded DNA. These results offer insight into the interactions of DNA within the pore. With the nucleotide sensitivity of MspA confirmed, a method is introduced to controllably pass DNA through the pore. Using a DNA polymerase, DNA strands are stepped through MspA one nucleotide at a time. The steps are observable as distinct levels on the ionic-current time-trace and are related to the DNA sequence. These experiments overcome the two fundamental challenges to realizing MspA nanopore sequencing and pave the way to the development of a commercial technology.

  8. Precise Estimation of Allele Frequencies of Single-Nucleotide Polymorphisms by a Quantitative SSCP Analysis of Pooled DNA

    PubMed Central

    Sasaki, Tomonari; Tahira, Tomoko; Suzuki, Akari; Higasa, Koichiro; Kukita, Yoji; Baba, Shingo; Hayashi, Kenshi

    2001-01-01

    We show that single-nucleotide polymorphisms (SNPs) of moderate to high heterozygosity (minor allele frequencies >10%) can be efficiently detected, and their allele frequencies accurately estimated, by pooling the DNA samples and applying a capillary-based SSCP analysis. In this method, alleles are separated into peaks, and their frequencies can be reliably and accurately quantified from their peak heights (SD <1.8%). We found that as many as 40% of publicly available SNPs that were analyzed by this method have widely differing allele frequency distributions among groups of different ethnicity (parents of Centre d'Etude Polymorphisme Humaine families vs. Japanese individuals). These results demonstrate the effectiveness of the present pooling method in the reevaluation of candidate SNPs that have been collected by examination of limited numbers of individuals. The method should also serve as a robust quantitative technique for studies in which a precise estimate of SNP allele frequencies is essential—for example, in linkage disequilibrium analysis. PMID:11083945

  9. Developing single nucleotide polymorphism (SNP) markers from transcriptome sequences for identification of longan (Dimocarpus longan) germplasm

    PubMed Central

    Wang, Boyi; Tan, Hua-Wei; Fang, Wanping; Meinhardt, Lyndel W; Mischke, Sue; Matsumoto, Tracie; Zhang, Dapeng

    2015-01-01

    Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in 50 longan germplasm accessions, including cultivated varieties and wild germplasm; and designated 25 SNP markers that unambiguously identified all tested longan varieties with high statistical rigor (P<0.0001). Multiple trees from the same clone were verified and off-type trees were identified. Diversity analysis revealed genetic relationships among analyzed accessions. Cultivated varieties differed significantly from wild populations (Fst=0.300; P<0.001), demonstrating untapped genetic diversity for germplasm conservation and utilization. Within cultivated varieties, apparent differences between varieties from China and those from Thailand and Hawaii indicated geographic patterns of genetic differentiation. These SNP markers provide a powerful tool to manage longan genetic resources and breeding, with accurate and efficient genotype identification. PMID:26504559

  10. Helicase Stepping Investigated with One-Nucleotide Resolution Fluorescence Resonance Energy Transfer

    NASA Astrophysics Data System (ADS)

    Lin, Wenxia; Ma, Jianbing; Nong, Daguan; Xu, Chunhua; Zhang, Bo; Li, Jinghua; Jia, Qi; Dou, Shuoxing; Ye, Fangfu; Xi, Xuguang; Lu, Ying; Li, Ming

    2017-09-01

    Single-molecule Förster resonance energy transfer is widely applied to study helicases by detecting distance changes between a pair of dyes anchored to overhangs of a forked DNA. However, it has been lacking single-base pair (1-bp) resolution required for revealing stepping kinetics of helicases. We designed a nanotensioner in which a short DNA is bent to exert force on the overhangs, just as in optical or magnetic tweezers. The strategy improved the resolution of Förster resonance energy transfer to 0.5 bp, high enough to uncover differences in DNA unwinding by yeast Pif1 and E. coli RecQ whose unwinding behaviors cannot be differentiated by currently practiced methods. We found that Pif1 exhibits 1-bp-stepping kinetics, while RecQ breaks 1 bp at a time but sequesters the nascent nucleotides and releases them randomly. The high-resolution data allowed us to propose a three-parameter model to quantitatively interpret the apparently different unwinding behaviors of the two helicases which belong to two superfamilies.

  11. A resource of single-nucleotide polymorphisms for rainbow trout generated by restriction-site associated DNA sequencing of doubled haploids

    USDA-ARS?s Scientific Manuscript database

    Salmonid genomes are considered to be in a pseudo-tetraploid state as a result of an evolutionarily recent genome duplication event. This situation complicates single nucleotide polymorphism (SNP) discovery in rainbow trout as many putative SNPs are actually paralogous sequence variants (PSVs) and ...

  12. Single nucleotide polymorphisms in candidate genes associated with fertilizing ability of sperm and subsequent embryonic development in cattle

    USDA-ARS?s Scientific Manuscript database

    Fertilization and development of the preimplantation embryo is under genetic control. The goal of the current study was to test 434 single nucleotide polymorphisms (SNPs) for association with genetic variation in fertilization and early embryonic development. The approach was to produce embryos from...

  13. Prospects for inferring pairwise relationships with single nucleotide polymorphisms

    Treesearch

    Jeffery C. Glaubitz; O. Eugene, Jr. Rhodes; J. Andrew DeWoody

    2003-01-01

    An extraordinarily large number of single nucleotide polymorphisms (SNPs) are now available in humans as well as in other model organisms. Technological advancements may soon make it feasible to assay hundreds of SNPs in virtually any organism of interest. One potential application of SNPs is the determination of pairwise genetic relationships in populations without...

  14. Short communication: Relationship of call rate and accuracy of single nucleotide polymorphism genotypes in dairy cattle

    USDA-ARS?s Scientific Manuscript database

    Call rate has been used as a measure of quality on both a single nucleotide polymorphism (SNP) and animal basis since SNP genotypes were first used in genomic evaluation of dairy cattle. The genotyping laboratories perform initial quality control screening and genotypes that fail are usually exclude...

  15. Single nucleotide polymorphisms generated by genotyping by sequencing to characterize genome-wide diversity, linkage disequilibrium, and selective sweeps in cultivated watermelon

    USDA-ARS?s Scientific Manuscript database

    Large datasets containing single nucleotide polymorphisms (SNPs) are used to analyze genome-wide diversity in a robust collection of cultivars from representative accessions, across the world. The extent of linkage disequilibrium (LD) within a population determines the number of markers required fo...

  16. Lack of Association Between Polymorphisms in Dopa Decarboxylase and Dopamine Receptor-1 Genes With Childhood Autism in Chinese Han Population.

    PubMed

    Yu, Hong; Liu, Jun; Yang, Aiping; Yang, Guohui; Yang, Wenjun; Lei, Heyue; Quan, Jianjun; Zhang, Zengyu

    2016-04-01

    Genetic factors play an important role in childhood autism. This study is to determine the association of single-nucleotide polymorphisms in dopa decarboxylase (DDC) and dopamine receptor-1 (DRD1) genes with childhood autism, in a Chinese Han population. A total of 211 autistic children and 250 age- and gender-matched healthy controls were recruited. The severity of disease was determined by Children Autism Rating Scale scores. TaqMan Probe by real-time polymerase chain reaction was used to determine genotypes and allele frequencies of single-nucleotide polymorphism rs6592961 in DDC and rs251937 in DRD1. Case-control and case-only studies were respectively performed, to determine the contribution of both single-nucleotide polymorphisms to the predisposition of disease and its severity. Our results showed that there was no significant association of the genotypes and allele frequencies of both single-nucleotide polymorphisms concerning childhood autism and its severity. More studies with larger samples are needed to corroborate their predicting roles. © The Author(s) 2015.

  17. Single-molecule comparison of DNA Pol I activity with native and analog nucleotides

    NASA Astrophysics Data System (ADS)

    Gul, Osman; Olsen, Tivoli; Choi, Yongki; Corso, Brad; Weiss, Gregory; Collins, Philip

    2014-03-01

    DNA polymerases are critical enzymes for DNA replication, and because of their complex catalytic cycle they are excellent targets for investigation by single-molecule experimental techniques. Recently, we studied the Klenow fragment (KF) of DNA polymerase I using a label-free, electronic technique involving single KF molecules attached to carbon nanotube transistors. The electronic technique allowed long-duration monitoring of a single KF molecule while processing thousands of template strands. Processivity of up to 42 nucleotide bases was directly observed, and statistical analysis of the recordings determined key kinetic parameters for the enzyme's open and closed conformations. Subsequently, we have used the same technique to compare the incorporation of canonical nucleotides like dATP to analogs like 1-thio-2'-dATP. The analog had almost no affect on duration of the closed conformation, during which the nucleotide is incorporated. On the other hand, the analog increased the rate-limiting duration of the open conformation by almost 40%. We propose that the thiolated analog interferes with KF's recognition and binding, two key steps that determine its ensemble turnover rate.

  18. Transcript-specific, single-nucleotide polymorphism discovery and linkage analysis in hexaploid bread wheat (Triticum aestivum L.).

    PubMed

    Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J

    2011-12-01

    Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  19. TPH-2 Polymorphisms Interact with Early Life Stress to Influence Response to Treatment with Antidepressant Drugs.

    PubMed

    Xu, Zhi; Reynolds, Gavin P; Yuan, Yonggui; Shi, Yanyan; Pu, Mengjia; Zhang, Zhijun

    2016-11-01

    Variation in genes implicated in monoamine neurotransmission may interact with environmental factors to influence antidepressant response. We aimed to determine how a range of single nucleotide polymorphisms in monoaminergic genes influence this response to treatment and how they interact with childhood trauma and recent life stress in a Chinese sample. An initial study of monoaminergic coding region single nucleotide polymorphisms identified significant associations of TPH2 and HTR1B single nucleotide polymorphisms with treatment response that showed interactions with childhood and recent life stress, respectively (Xu et al., 2012). A total of 47 further single nucleotide polymorphisms in 17 candidate monoaminergic genes were genotyped in 281 Chinese Han patients with major depressive disorder. Response to 6 weeks' antidepressant treatment was determined by change in the 17-item Hamilton Depression Rating Scale score, and previous stressful events were evaluated by the Life Events Scale and Childhood Trauma Questionnaire-Short Form. Three TPH2 single nucleotide polymorphisms (rs11178998, rs7963717, and rs2171363) were significantly associated with antidepressant response in this Chinese sample, as was a haplotype in TPH2 (rs2171363 and rs1487278). One of these, rs2171363, showed a significant interaction with childhood adversity in its association with antidepressant response. These findings provide further evidence that variation in TPH2 is associated with antidepressant response and may also interact with childhood trauma to influence outcome of antidepressant treatment. © The Author 2016. Published by Oxford University Press on behalf of CINP.

  20. TPH-2 Polymorphisms Interact with Early Life Stress to Influence Response to Treatment with Antidepressant Drugs

    PubMed Central

    Reynolds, Gavin P.; Yuan, Yonggui; Shi, Yanyan; Pu, Mengjia; Zhang, Zhijun

    2016-01-01

    Background: Variation in genes implicated in monoamine neurotransmission may interact with environmental factors to influence antidepressant response. We aimed to determine how a range of single nucleotide polymorphisms in monoaminergic genes influence this response to treatment and how they interact with childhood trauma and recent life stress in a Chinese sample. An initial study of monoaminergic coding region single nucleotide polymorphisms identified significant associations of TPH2 and HTR1B single nucleotide polymorphisms with treatment response that showed interactions with childhood and recent life stress, respectively (Xu et al., 2012). Methods: A total of 47 further single nucleotide polymorphisms in 17 candidate monoaminergic genes were genotyped in 281 Chinese Han patients with major depressive disorder. Response to 6 weeks’ antidepressant treatment was determined by change in the 17-item Hamilton Depression Rating Scale score, and previous stressful events were evaluated by the Life Events Scale and Childhood Trauma Questionnaire-Short Form. Results: Three TPH2 single nucleotide polymorphisms (rs11178998, rs7963717, and rs2171363) were significantly associated with antidepressant response in this Chinese sample, as was a haplotype in TPH2 (rs2171363 and rs1487278). One of these, rs2171363, showed a significant interaction with childhood adversity in its association with antidepressant response. Conclusions: These findings provide further evidence that variation in TPH2 is associated with antidepressant response and may also interact with childhood trauma to influence outcome of antidepressant treatment. PMID:27521242

  1. Proteogenomic Investigation of Strain Variation in Clinical Mycobacterium tuberculosis Isolates.

    PubMed

    Heunis, Tiaan; Dippenaar, Anzaan; Warren, Robin M; van Helden, Paul D; van der Merwe, Ruben G; Gey van Pittius, Nicolaas C; Pain, Arnab; Sampson, Samantha L; Tabb, David L

    2017-10-06

    Mycobacterium tuberculosis consists of a large number of different strains that display unique virulence characteristics. Whole-genome sequencing has revealed substantial genetic diversity among clinical M. tuberculosis isolates, and elucidating the phenotypic variation encoded by this genetic diversity will be of the utmost importance to fully understand M. tuberculosis biology and pathogenicity. In this study, we integrated whole-genome sequencing and mass spectrometry (GeLC-MS/MS) to reveal strain-specific characteristics in the proteomes of two clinical M. tuberculosis Latin American-Mediterranean isolates. Using this approach, we identified 59 peptides containing single amino acid variants, which covered ∼9% of all coding nonsynonymous single nucleotide variants detected by whole-genome sequencing. Furthermore, we identified 29 distinct peptides that mapped to a hypothetical protein not present in the M. tuberculosis H37Rv reference proteome. Here, we provide evidence for the expression of this protein in the clinical M. tuberculosis SAWC3651 isolate. The strain-specific databases enabled confirmation of genomic differences (i.e., large genomic regions of difference and nonsynonymous single nucleotide variants) in these two clinical M. tuberculosis isolates and allowed strain differentiation at the proteome level. Our results contribute to the growing field of clinical microbial proteogenomics and can improve our understanding of phenotypic variation in clinical M. tuberculosis isolates.

  2. Precise detection of de novo single nucleotide variants in human genomes.

    PubMed

    Gómez-Romero, Laura; Palacios-Flores, Kim; Reyes, José; García, Delfino; Boege, Margareta; Dávila, Guillermo; Flores, Margarita; Schatz, Michael C; Palacios, Rafael

    2018-05-22

    The precise determination of de novo genetic variants has enormous implications across different fields of biology and medicine, particularly personalized medicine. Currently, de novo variations are identified by mapping sample reads from a parent-offspring trio to a reference genome, allowing for a certain degree of differences. While widely used, this approach often introduces false-positive (FP) results due to misaligned reads and mischaracterized sequencing errors. In a previous study, we developed an alternative approach to accurately identify single nucleotide variants (SNVs) using only perfect matches. However, this approach could be applied only to haploid regions of the genome and was computationally intensive. In this study, we present a unique approach, coverage-based single nucleotide variant identification (COBASI), which allows the exploration of the entire genome using second-generation short sequence reads without extensive computing requirements. COBASI identifies SNVs using changes in coverage of exactly matching unique substrings, and is particularly suited for pinpointing de novo SNVs. Unlike other approaches that require population frequencies across hundreds of samples to filter out any methodological biases, COBASI can be applied to detect de novo SNVs within isolated families. We demonstrate this capability through extensive simulation studies and by studying a parent-offspring trio we sequenced using short reads. Experimental validation of all 58 candidate de novo SNVs and a selection of non-de novo SNVs found in the trio confirmed zero FP calls. COBASI is available as open source at https://github.com/Laura-Gomez/COBASI for any researcher to use. Copyright © 2018 the Author(s). Published by PNAS.

  3. Mapping the neutralizing epitopes on the glycoprotein of infectious haematopoietic necrosis virus, a fish rhabdovirus

    USGS Publications Warehouse

    Huang, C.; Chien, M.S.; Landolt, M.L.; Batts, W.; Winton, J.

    1996-01-01

    Twelve neutralizing monoclonal antibodies (MAbs) against the fish rhabdovirus, infectious haematopoietic necrosis virus (IHNV), were used to select 20 MAb escape mutants. The nucleotide sequence of the entire glycoprotein (G) gene was determined for six mutants representing differing cross-neutralization patterns and each had a single nucleotide change leading to a single amino acid substitution within one of three regions of the protein. These data were used to design nested PCR primers to amplify portions of the G gene of the 14 remaining mutants. When the PCR products from these mutants were sequenced, they also had single nucleotide substitutions coding for amino acid substitutions at the same, or nearby, locations. Of the 20 mutants for which all or part of the glycoprotein gene was sequenced, two MAbs selected mutants with substitutions at amino acids 230-231 (antigenic site I) and the remaining MAbs selected mutants with substitutions at amino acids 272-276 (antigenic site II). Two MAbs that selected mutants mapping to amino acids 272-276, selected other mutants that mapped to amino acids 78-81, raising the possibility that this portion of the N terminus of the protein was part of a discontinuous epitope defining antigenic site II. CLUSTAL alignment of the glycoproteins of rabies virus, vesicular stomatitis virus and IHNV revealed similarities in the location of the neutralizing epitopes and a high degree of conservation among cysteine residues, indicating that the glycoproteins of three different genera of animal rhabdoviruses may share a similar three-dimensional structure in spite of extensive sequence divergence.

  4. No association between polymorphisms in the DDC gene and paranoid schizophrenia in a northern Chinese population.

    PubMed

    Zhang, Boyu; Jia, Yanbin; Yuan, Yanbo; Yu, Xin; Xu, Qi; Shen, Yucun; Shen, Yan

    2004-09-01

    Several lines of evidence suggest that dysfunctions of neurotransmitters are associated with schizophrenia. DOPA decarboxylase (DDC) is an enzyme involved directly in the synthesis of dopamine and serotonin, and indirectly in the synthesis of noradrenaline. Therefore, the DDC gene can be considered a candidate gene for schizophrenia. We performed an association study between three single nucleotide polymorphisms in the DDC gene and paranoid schizophrenia. However, in our study no significant differences were found in the genotype distributions and allele frequencies between 80 paranoid schizophrenics and 108 controls for any of the polymorphisms. Neither did the haplotypes of the single nucleotide polymorphisms show any association with paranoid schizophrenia. Therefore, we conclude that the polymorphisms studied do not play a major role in paranoid schizophrenia pathogenesis in the population investigated.

  5. DNA Barcodes of Asian Houbara Bustard (Chlamydotis undulata macqueenii)

    PubMed Central

    Arif, Ibrahim A.; Khan, Haseeb A.; Williams, Joseph B.; Shobrak, Mohammad; Arif, Waad I.

    2012-01-01

    Populations of Houbara Bustards have dramatically declined in recent years. Captive breeding and reintroduction programs have had limited success in reviving population numbers and thus new technological solutions involving molecular methods are essential for the long term survival of this species. In this study, we sequenced the 694 bp segment of COI gene of the four specimens of Asian Houbara Bustard (Chlamydotis undulata macqueenii). We also compared these sequences with earlier published barcodes of 11 individuals comprising different families of the orders Gruiformes, Ciconiiformes, Podicipediformes and Crocodylia (out group). The pair-wise sequence comparison showed a total of 254 variable sites across all the 15 sequences from different taxa. Three of the four specimens of Houbara Bustard had an identical sequence of COI gene and one individual showed a single nucleotide difference (G > A transition at position 83). Within the bustard family (Otididae), comparison among the three species (Asian Houbara Bustard, Great Bustard (Otis tarda) and the Little Bustard (Tetrax tetrax)), representing three different genera, showed 116 variable sites. For another family (Rallidae), the intra-family variable sites among the individuals of four different genera were found to be 146. The COI genetic distances among the 15 individuals varied from 0.000 to 0.431. Phylogenetic analysis using 619 bp nucleotide segment of COI clearly discriminated all the species representing different genera, families and orders. All the four specimens of Houbara Bustard formed a single clade and are clearly separated from other two individuals of the same family (Otis tarda and Tetrax tetrax). The nucleotide sequence of partial segment of COI gene effectively discriminated the closely related species. This is the first study reporting the barcodes of Houbara Bustard and would be helpful in future molecular studies, particularly for the conservation of this threatened bird in Saudi Arabia. PMID:22408462

  6. Masking as an effective quality control method for next-generation sequencing data analysis.

    PubMed

    Yun, Sajung; Yun, Sijung

    2014-12-13

    Next generation sequencing produces base calls with low quality scores that can affect the accuracy of identifying simple nucleotide variation calls, including single nucleotide polymorphisms and small insertions and deletions. Here we compare the effectiveness of two data preprocessing methods, masking and trimming, and the accuracy of simple nucleotide variation calls on whole-genome sequence data from Caenorhabditis elegans. Masking substitutes low quality base calls with 'N's (undetermined bases), whereas trimming removes low quality bases that results in a shorter read lengths. We demonstrate that masking is more effective than trimming in reducing the false-positive rate in single nucleotide polymorphism (SNP) calling. However, both of the preprocessing methods did not affect the false-negative rate in SNP calling with statistical significance compared to the data analysis without preprocessing. False-positive rate and false-negative rate for small insertions and deletions did not show differences between masking and trimming. We recommend masking over trimming as a more effective preprocessing method for next generation sequencing data analysis since masking reduces the false-positive rate in SNP calling without sacrificing the false-negative rate although trimming is more commonly used currently in the field. The perl script for masking is available at http://code.google.com/p/subn/. The sequencing data used in the study were deposited in the Sequence Read Archive (SRX450968 and SRX451773).

  7. Single Nucleotide Polymorphisms Predict Symptom Severity of Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H.

    2012-01-01

    Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs)…

  8. Single nucleotide polymorphisms in uracil-processing genes, intake of one-carbon nutrients and breast cancer risk

    USDA-ARS?s Scientific Manuscript database

    Background/Objectives: The misincorporation of uracil into DNA leads to genomic instability. In a previous study, some of us identified four common single nucleotide polymorphisms (SNPs) in uracil-processing genes (rs2029166 and rs7296239 in SMUG1, rs34259 in UNG and rs4775748 in DUT) that were asso...

  9. Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

  10. An integrated genetic linkage map of watermelon and genetic diversity based on single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers

    USDA-ARS?s Scientific Manuscript database

    Watermelon (Citrullus lanatus var. lanatus) is an important vegetable fruit throughout the world. A high number of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers should provide large coverage of the watermelon genome and high phylogenetic resolution of germplasm acces...

  11. Identification and characterization of single nucleotide polymorphisms (SNPs) in Culex theileri (Diptera: Culicidae).

    PubMed

    Demirci, Berna; Lee, Yoosook; Lanzaro, Gregory C; Alten, Bulent

    2012-05-01

    Culex theileri Theobald (Diptera: Culicidae) is one of the most common mosquito species in northeastern Turkey and serves as a vector for various zoonotic diseases including West Nile virus. Although there have been some studies on the ecology of Cx. theileri, very little genetic data has been made available. We successfully sequenced 11 gene fragments from Cx. theileri specimens collected from the northeastern part of Turkey. On average, we found a Single nucleotide polymorphism every 45 bp. Transitions outnumbered transversions, at a ratio of 2:1. This is the first report of genetic polymorphisms in Cx. theileri and Single nucleotide polymorphism discovered from this study can be used to investigate population structure and gene-environmental interactions.

  12. Ultraselective electrochemiluminescence biosensor based on locked nucleic acid modified toehold-mediated strand displacement reaction and junction-probe.

    PubMed

    Zhang, Xi; Zhang, Jing; Wu, Dongzhi; Liu, Zhijing; Cai, Shuxian; Chen, Mei; Zhao, Yanping; Li, Chunyan; Yang, Huanghao; Chen, Jinghua

    2014-12-07

    Locked nucleic acid (LNA) is applied in toehold-mediated strand displacement reaction (TMSDR) to develop a junction-probe electrochemiluminescence (ECL) biosensor for single-nucleotide polymorphism (SNP) detection in the BRCA1 gene related to breast cancer. More than 65-fold signal difference can be observed with perfectly matched target sequence to single-base mismatched sequence under the same conditions, indicating good selectivity of the ECL biosensor.

  13. Theory of single-molecule controlled rotation experiments, predictions, tests, and comparison with stalling experiments in F1-ATPase.

    PubMed

    Volkán-Kacsó, Sándor; Marcus, Rudolph A

    2016-10-25

    A recently proposed chemomechanical group transfer theory of rotary biomolecular motors is applied to treat single-molecule controlled rotation experiments. In these experiments, single-molecule fluorescence is used to measure the binding and release rate constants of nucleotides by monitoring the occupancy of binding sites. It is shown how missed events of nucleotide binding and release in these experiments can be corrected using theory, with F 1 -ATP synthase as an example. The missed events are significant when the reverse rate is very fast. Using the theory the actual rate constants in the controlled rotation experiments and the corrections are predicted from independent data, including other single-molecule rotation and ensemble biochemical experiments. The effective torsional elastic constant is found to depend on the binding/releasing nucleotide, and it is smaller for ADP than for ATP. There is a good agreement, with no adjustable parameters, between the theoretical and experimental results of controlled rotation experiments and stalling experiments, for the range of angles where the data overlap. This agreement is perhaps all the more surprising because it occurs even though the binding and release of fluorescent nucleotides is monitored at single-site occupancy concentrations, whereas the stalling and free rotation experiments have multiple-site occupancy.

  14. Genetic Variants of TPCN2 Associated with Type 2 Diabetes Risk in the Chinese Population

    PubMed Central

    Zhang, Yu; Fan, Xiaofang; Zhang, Ning; Zheng, Hui; Song, Yuping; Shen, Chunfang; Shen, Jiayi; Ren, Fengdong; Yang, Jialin

    2016-01-01

    Objective The aim of this study was to determine whether TPCN2 genetic variants are associated with type 2 diabetes and to elucidate which variants in TPCN2 confer diabetes susceptibility in the Chinese population. Research Design and Methods The sample population included 384 patients with type 2 diabetes and 1468 controls. Anthropometric parameters, glycemic and lipid profiles and insulin resistance were measured. We selected 6 TPCN2 tag single nucleotide polymorphisms (rs35264875, rs267603153, rs267603154, rs3829241, rs1551305, and rs3750965). Genotypes were determined using a Sequenom MassARRAY SNP genotyping system. Results Ultimately, we genotyped 3 single nucleotide polymorphisms (rs3750965, rs3829241, and rs1551305) in all individuals. There was a 5.1% higher prevalence of the rs1551305 variant allele in type 2 diabetes individuals (A) compared with wild-type homozygous individuals (G). The AA genotype of rs1551305 was associated with a higher diabetes risk (p<0.05). The distributions of rs3829241 and rs3750965 polymorphisms were not significantly different between the two groups. HOMA-%B of subjects harboring the AA genotype of rs1551305 decreased by 14.87% relative to the GG genotype. Conclusions TPCN2 plays a role in metabolic regulation, and the rs1551305 single nucleotide polymorphism is associated with type 2 diabetes risk. Future work will begin to unravel the underlying mechanisms. PMID:26918892

  15. Prediction of peripheral neuropathy in multiple myeloma patients receiving bortezomib and thalidomide: a genetic study based on a single nucleotide polymorphism array.

    PubMed

    García-Sanz, Ramón; Corchete, Luis Antonio; Alcoceba, Miguel; Chillon, María Carmen; Jiménez, Cristina; Prieto, Isabel; García-Álvarez, María; Puig, Noemi; Rapado, Immaculada; Barrio, Santiago; Oriol, Albert; Blanchard, María Jesús; de la Rubia, Javier; Martínez, Rafael; Lahuerta, Juan José; González Díaz, Marcos; Mateos, María Victoria; San Miguel, Jesús Fernando; Martínez-López, Joaquín; Sarasquete, María Eugenia

    2017-12-01

    Bortezomib- and thalidomide-based therapies have significantly contributed to improved survival of multiple myeloma (MM) patients. However, treatment-induced peripheral neuropathy (TiPN) is a common adverse event associated with them. Risk factors for TiPN in MM patients include advanced age, prior neuropathy, and other drugs, but there are conflicting results about the role of genetics in predicting the risk of TiPN. Thus, we carried out a genome-wide association study based on more than 300 000 exome single nucleotide polymorphisms in 172 MM patients receiving therapy involving bortezomib and thalidomide. We compared patients developing and not developing TiPN under similar treatment conditions (GEM05MAS65, NCT00443235). The highest-ranking single nucleotide polymorphism was rs45443101, located in the PLCG2 gene, but no significant differences were found after multiple comparison correction (adjusted P = .1708). Prediction analyses, cytoband enrichment, and pathway analyses were also performed, but none yielded any significant findings. A copy number approach was also explored, but this gave no significant results either. In summary, our study did not find a consistent genetic component associated with TiPN under bortezomib and thalidomide therapies that could be used for prediction, which makes clinical judgment essential in the practical management of MM treatment. Copyright © 2016 John Wiley & Sons, Ltd.

  16. [Genetic Differentiation of Sockeye Salmon Oncorhynchus nerka from Kamchatka River Basin and the Lake-River Systems of the West Coast of the Bering Sea as Inferred from Data on Single Nucleotide Polymorphism].

    PubMed

    Khrustaleva, A M; Klovach, N V; Vedischeva, E V; Seeb, J E

    2015-10-01

    The variability of 45 single nucleotide polymorphism loci (SNP) was studied in sockeye salmon from the Kamchatka River basin and four lake-river systems of the west coast of the Bering Sea. Based on the genetic differentiation estimates for the largest sockeye salmon populations of Eastern Kamchatka and Chukotka, the examined samples were combined into two regional groups represented by the population of the Kamchatka River drainage, which included numerous local subpopulations and seasonal races, and the northern population grouping from the rivers of Olutorsko-Navarinsky raion, wherein the sockeye salmon from Maynypilginskaya Lake-River system was relatively isolated. Considerable divergence was observed between the island (Sarannoe Lake, Bering Island) and continental populations. Genetic heterogeneity was revealed and groups of early- and late-maturing individuals were isolated in the sample of late-run sockeye salmon from Kamchatka River. In Apuka River, subdivision of the spawning run into two genetically distinct spatial and temporal groupings was also observed. The results suggest that the differentiation of sockeye salmon samples by single nucleotide substitution frequencies was largely due to differences in the direction and strength of local selection at some loci in the population complexes and intrapopulation groupings from the examined river basins of Eastern Kamchatka, Chukotka, and Commander Islands.

  17. Genetic associations with lipoprotein subfraction measures differ by ethnicity in the multi-ethnic study of atherosclerosis (MESA)

    USDA-ARS?s Scientific Manuscript database

    A recent genome-wide association study associated 62 single nucleotide polymorphisms (SNPs) from 43 genomic loci, with fasting lipoprotein subfractions in European–Americans (EAs) at genome-wide levels of significance across three independent samples. Whether these associations are consistent across...

  18. Computational Analysis of Single Nucleotide Polymorphisms Associated with Altered Drug Responsiveness in Type 2 Diabetes

    PubMed Central

    Costa, Valerio; Federico, Antonio; Pollastro, Carla; Ziviello, Carmela; Cataldi, Simona; Formisano, Pietro; Ciccodicola, Alfredo

    2016-01-01

    Type 2 diabetes (T2D) is one of the most frequent mortality causes in western countries, with rapidly increasing prevalence. Anti-diabetic drugs are the first therapeutic approach, although many patients develop drug resistance. Most drug responsiveness variability can be explained by genetic causes. Inter-individual variability is principally due to single nucleotide polymorphisms, and differential drug responsiveness has been correlated to alteration in genes involved in drug metabolism (CYP2C9) or insulin signaling (IRS1, ABCC8, KCNJ11 and PPARG). However, most genome-wide association studies did not provide clues about the contribution of DNA variations to impaired drug responsiveness. Thus, characterizing T2D drug responsiveness variants is needed to guide clinicians toward tailored therapeutic approaches. Here, we extensively investigated polymorphisms associated with altered drug response in T2D, predicting their effects in silico. Combining different computational approaches, we focused on the expression pattern of genes correlated to drug resistance and inferred evolutionary conservation of polymorphic residues, computationally predicting the biochemical properties of polymorphic proteins. Using RNA-Sequencing followed by targeted validation, we identified and experimentally confirmed that two nucleotide variations in the CAPN10 gene—currently annotated as intronic—fall within two new transcripts in this locus. Additionally, we found that a Single Nucleotide Polymorphism (SNP), currently reported as intergenic, maps to the intron of a new transcript, harboring CAPN10 and GPR35 genes, which undergoes non-sense mediated decay. Finally, we analyzed variants that fall into non-coding regulatory regions of yet underestimated functional significance, predicting that some of them can potentially affect gene expression and/or post-transcriptional regulation of mRNAs affecting the splicing. PMID:27347941

  19. IRF6 rs2235375 single nucleotide polymorphism is associated with isolated non-syndromic cleft palate but not with cleft lip with or without palate in south Indian population.

    PubMed

    Gurramkonda, Venkatesh Babu; Syed, Altaf Hussain; Murthy, Jyotsna; Lakkakula, Bhaskar V K S

    2017-06-26

    Transcription factors are very diverse family of proteins involved in activating or repressing the transcription of a gene at a given time. Several studies using animal models demonstrated the role of transcription factor genes in craniofacial development. We aimed to investigate the association of IRF6 intron-6 polymorphism in the non-syndromic cleft lip with or without Palate in a south Indian population. 173 unrelated nonsyndromic cleft lip with or without Palate patients and 176 controls without clefts patients were genotyped for IRF6 rs2235375 variant by allele-specific amplification using the KASPar single nucleotide polymorphism genotyping system. The association between interferon regulatory factor-6 gene intron-6 dbSNP208032210:g.G>C (rs2235375) single nucleotide polymorphism and non-syndromic cleft lip with or without palate risk was investigated by chi-square test. There were significant differences in genotype or allele frequencies of rs2235375 single nucleotide polymorphism between controls and cases with non-syndromic cleft lip with or without palate. IRF6 rs2235375 variant was significantly associated with increased risk of non-syndromic cleft lip with or without palate in co-dominant, dominant (OR: 1.19; 95% CI 1.03-2.51; p=0.034) and allelic models (OR: 1.40; 95% CI 1.04-1.90; p=0.028). When subset analysis was applied significantly increased risk was observed in cleft palate only group (OR dominant: 4.33; 95% CI 1.44-12.97; p=0.005). These results suggest that IRF6 rs2235375 SNP play a major role in the pathogenesis and risk of developing non-syndromic cleft lip with or without palate. Copyright © 2017 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.

  20. Genetic Factors Influencing Coagulation Factor XIII B-Subunit Contribute to Risk of Ischemic Stroke.

    PubMed

    Hanscombe, Ken B; Traylor, Matthew; Hysi, Pirro G; Bevan, Stephen; Dichgans, Martin; Rothwell, Peter M; Worrall, Bradford B; Seshadri, Sudha; Sudlow, Cathie; Williams, Frances M K; Markus, Hugh S; Lewis, Cathryn M

    2015-08-01

    Abnormal coagulation has been implicated in the pathogenesis of ischemic stroke, but how this association is mediated and whether it differs between ischemic stroke subtypes is unknown. We determined the shared genetic risk between 14 coagulation factors and ischemic stroke and its subtypes. Using genome-wide association study results for 14 coagulation factors from the population-based TwinsUK sample (N≈2000 for each factor), meta-analysis results from the METASTROKE consortium ischemic stroke genome-wide association study (12 389 cases, 62 004 controls), and genotype data for 9520 individuals from the WTCCC2 ischemic stroke study (3548 cases, 5972 controls-the largest METASTROKE subsample), we explored shared genetic risk for coagulation and stroke. We performed three analyses: (1) a test for excess concordance (or discordance) in single nucleotide polymorphism effect direction across coagulation and stroke, (2) an estimation of the joint effect of multiple coagulation-associated single nucleotide polymorphisms in stroke, and (3) an evaluation of common genetic risk between coagulation and stroke. One coagulation factor, factor XIII subunit B (FXIIIB), showed consistent effects in the concordance analysis, the estimation of polygenic risk, and the validation with genotype data, with associations specific to the cardioembolic stroke subtype. Effect directions for FXIIIB-associated single nucleotide polymorphisms were significantly discordant with cardioembolic disease (smallest P=5.7×10(-04)); the joint effect of FXIIIB-associated single nucleotide polymorphisms was significantly predictive of ischemic stroke (smallest P=1.8×10(-04)) and the cardioembolic subtype (smallest P=1.7×10(-04)). We found substantial negative genetic covariation between FXIIIB and ischemic stroke (rG=-0.71, P=0.01) and the cardioembolic subtype (rG=-0.80, P=0.03). Genetic markers associated with low FXIIIB levels increase risk of ischemic stroke cardioembolic subtype. © 2015 The Authors.

  1. Evidence for a Complex Class of Nonadenylated mRNA in Drosophila

    PubMed Central

    Zimmerman, J. Lynn; Fouts, David L.; Manning, Jerry E.

    1980-01-01

    The amount, by mass, of poly(A+) mRNA present in the polyribosomes of third-instar larvae of Drosophila melanogaster, and the relative contribution of the poly(A+) mRNA to the sequence complexity of total polysomal RNA, has been determined. Selective removal of poly(A+) mRNA from total polysomal RNA by use of either oligo-dT-cellulose, or poly(U)-sepharose affinity chromatography, revealed that only 0.15% of the mass of the polysomal RNA was present as poly(A+) mRNA. The present study shows that this RNA hybridized at saturation with 3.3% of the single-copy DNA in the Drosophila genome. After correction for asymmetric transcription and reactability of the DNA, 7.4% of the single-copy DNA in the Drosophila genome is represented in larval poly(A+) mRNA. This corresponds to 6.73 x 106 nucleotides of mRNA coding sequences, or approximately 5,384 diverse RNA sequences of average size 1,250 nucleotides. However, total polysomal RNA hybridizes at saturation to 10.9% of the single-copy DNA sequences. After correcting this value for asymmetric transcription and tracer DNA reactability, 24% of the single-copy DNA in Drosophila is represented in total polysomal RNA. This corresponds to 2.18 x 107 nucleotides of RNA coding sequences or 17,440 diverse RNA molecules of size 1,250 nucleotides. This value is 3.2 times greater than that observed for poly(A+) mRNA, and indicates that ≃69% of the polysomal RNA sequence complexity is contributed by nonadenylated RNA. Furthermore, if the number of different structural genes represented in total polysomal RNA is ≃1.7 x 104, then the number of genes expressed in third-instar larvae exceeds the number of chromomeres in Drosophila by about a factor of three. This numerology indicates that the number of chromomeres observed in polytene chromosomes does not reflect the number of structural gene sequences in the Drosophila genome. PMID:6777246

  2. Association of functional polymorphisms of the transforming growth factor B1 gene with survival and graft-versus-host disease after unrelated donor hematopoietic stem cell transplantation

    PubMed Central

    Berro, Mariano; Mayor, Neema P.; Maldonado-Torres, Hazael; Cooke, Louise; Kusminsky, Gustavo; Marsh, Steven G.E.; Madrigal, J. Alejandro; Shaw, Bronwen E.

    2010-01-01

    Background Many genetic factors play major roles in the outcome of hematopoietic stem cell transplants from unrelated donors. Transforming growth factor β1 is a member of a highly pleiotrophic family of growth factors involved in the regulation of numerous immunomodulatory processes. Design and Methods We investigated the impact of single nucleotide polymorphisms at codons 10 and 25 of TGFB1, the gene encoding for transforming growth factor β1, on outcomes in 427 mye-loablative-conditioned transplanted patients. In addition, transforming growth factor β1 plasma levels were measured in 263 patients and 327 donors. Results Patients homozygous for the single nucleotide polymorphism at codon 10 had increased non-relapse mortality (at 3 years: 46.8% versus 29.4%, P=0.014) and reduced overall survival (at 5 years 29.3% versus 42.2%, P=0.013); the differences remained statistically significant in multivariate analysis. Donor genotype alone had no impact, although multiple single nucleotide polymorphisms within the pair were significantly associated with higher non-relapse mortality (at 3 years: 44% versus 29%, P=0.021) and decreased overall survival (at 5 years: 33.8% versus 41.9%, P=0.033). In the 10/10 HLA matched transplants (n=280), recipients of non-wild type grafts tended to have a higher incidence of acute graft-versus-host disease grades II-IV (P=0.052). In multivariate analysis, when analyzed with patients’ genotype, the incidences of both overall and grades II-IV acute graft-versus-host disease were increased (P=0.025 and P=0.009, respectively) in non-wild-type pairs. Conclusions We conclude that increasing numbers of single nucleotide polymorphisms in codon 10 of TGFB1 in patients and donors are associated with a worse outcome following hematopoietic stem cell transplantation from unrelated donors. PMID:19713222

  3. Genetic variation and willingness to participate in epidemiologic research: data from three studies.

    PubMed

    Bhatti, Parveen; Sigurdson, Alice J; Wang, Sophia S; Chen, Jinbo; Rothman, Nathaniel; Hartge, Patricia; Bergen, Andrew W; Landi, Maria Teresa

    2005-10-01

    The differences in common genetic polymorphism frequencies by willingness to participate in epidemiologic studies are unexplored, but the same threats to internal validity operate as for studies with nongenetic information. We analyzed single nucleotide polymorphism genotypes, haplotypes, and short tandem repeats among control groups from three studies with different recruitment designs that included early, late, and never questionnaire responders, one or more participation incentives, and blood or buccal DNA collection. Among 2,955 individuals, we compared 108 genotypes, 8 haplotypes, and 9 to 15 short tandem repeats by respondent type. Among our main comparisons, single nucleotide polymorphism genotype frequencies differed significantly (P < 0.05) between respondent groups in six instances, with 13 expected by chance alone. When comparing the odds of carrying a variant among the various response groups, 19 odds ratios were /=1.40, levels that might be notably different. Among the various respondent group comparisons, haplotype and short tandem repeat frequencies were not significantly different by willingness to participate. We observed little evidence to suggest that genotype differences underlie response characteristics in molecular epidemiologic studies, but a greater variety of genes should be examined, including those related to behavioral traits potentially associated with willingness to participate. To the extent possible, investigators should evaluate their own genetic data for bias in response categories.

  4. Normalization of Complete Genome Characteristics: Application to Evolution from Primitive Organisms to Homo sapiens.

    PubMed

    Sorimachi, Kenji; Okayasu, Teiji; Ohhira, Shuji

    2015-04-01

    Normalized nucleotide and amino acid contents of complete genome sequences can be visualized as radar charts. The shapes of these charts depict the characteristics of an organism's genome. The normalized values calculated from the genome sequence theoretically exclude experimental errors. Further, because normalization is independent of both target size and kind, this procedure is applicable not only to single genes but also to whole genomes, which consist of a huge number of different genes. In this review, we discuss the applications of the normalization of the nucleotide and predicted amino acid contents of complete genomes to the investigation of genome structure and to evolutionary research from primitive organisms to Homo sapiens. Some of the results could never have been obtained from the analysis of individual nucleotide or amino acid sequences but were revealed only after the normalization of nucleotide and amino acid contents was applied to genome research. The discovery that genome structure was homogeneous was obtained only after normalization methods were applied to the nucleotide or predicted amino acid contents of genome sequences. Normalization procedures are also applicable to evolutionary research. Thus, normalization of the contents of whole genomes is a useful procedure that can help to characterize organisms.

  5. The nucleotide binding properties of human MSH2/MSH3 are lesion-dependent and distinct from those of human MSH2/MSH6

    PubMed Central

    Owen, Barbara A. L.; Lang, Walter; McMurray, Cynthia T.

    2010-01-01

    Summary Here, we report that MSH2/MSH3 maintains lesion specificity for small loops by a distinctly different mechanism than does MHSH2/MSH6 for single base mismatches. ADP and ATP have no preference for the subunits of hMSH2/MSH3. Upon lesion binding, however, hMSH2/MSH3 adopts a single “nucleotide signature” in which one ADP binds within the hMSH2 subunit and the hMSH3 subunit is empty. On the lesion, ADP-hMSH2/MSH3-empty binds and hydrolyzes ATP in the empty hMSH3 subunit, which reduces ADP affinity and increases ATP affinity for the hMSH2 subunit. ADP/ATP exchange converts (CA)4-loop-bound ADP-MSH2/MSH3-ATP into an ATP-hMSH2/MSH3-ADP intermediate in which ATP hydrolysis is inhibited in the hMSH2 subunit. We propose a model in which lesion binding converts hMSH2/MSH3 into a distinct nucleotide-bound form, and poises it to be a molecular sensor for lesion specificity. PMID:19377479

  6. The Single Nucleotide Polymorphism Consortium

    NASA Technical Reports Server (NTRS)

    Morgan, Michael

    2003-01-01

    I want to discuss both the Single Nucleotide Polymorphism (SNP) Consortium and the Human Genome Project. I am afraid most of my presentation will be thin on law and possibly too high on rhetoric. Having been engaged in a personal and direct way with these issues as a trained scientist, I find it quite difficult to be always as objective as I ought to be.

  7. Analysis of single nucleotide polymorphisms in case-control studies.

    PubMed

    Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer

    2011-01-01

    Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.

  8. A lateral flow biosensor for detection of single nucleotide polymorphism by circular strand displacement reaction.

    PubMed

    Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen

    2012-09-04

    A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.

  9. A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms

    ERIC Educational Resources Information Center

    Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.

    2016-01-01

    The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…

  10. The effects of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene on meat tenderness of yak.

    USDA-ARS?s Scientific Manuscript database

    The association of single nucleotide polymorphisms (SNPs) of calpastatin (CAST) gene with shear force of 2.54 cm steaks from M. longissimus dorsi from Gannan yaks (Bos grunniens, n=181) was studied. Yaks were harvested at 2, 3, and 4 yr of age (n=51, 59, and 71, respectively), and samples of each ya...

  11. ADOMA: A Command Line Tool to Modify ClustalW Multiple Alignment Output.

    PubMed

    Zaal, Dionne; Nota, Benjamin

    2016-01-01

    We present ADOMA, a command line tool that produces alternative outputs from ClustalW multiple alignments of nucleotide or protein sequences. ADOMA can simplify the output of alignments by showing only the different residues between sequences, which is often desirable when only small differences such as single nucleotide polymorphisms are present (e.g., between different alleles). Another feature of ADOMA is that it can enhance the ClustalW output by coloring the residues in the alignment. This tool is easily integrated into automated Linux pipelines for next-generation sequencing data analysis, and may be useful for researchers in a broad range of scientific disciplines including evolutionary biology and biomedical sciences. The source code is freely available at https://sourceforge. net/projects/adoma/. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Comparison of the genomes and transcriptomes associated with the different protease secretions of Aspergillus oryzae 100-8 and 3.042.

    PubMed

    Zhao, Guozhong; Yao, Yunping; Hou, Lihua; Wang, Chunling; Cao, Xiaohong

    2014-10-01

    Aspergillus oryzae is used to produce traditional fermented foods and beverages. A. oryzae 3.042 produces a neutral protease and an alkaline protease but rarely an acid protease, which is unfavourable to soy-sauce fermentation. A. oryzae 100-8 was obtained by N(+) ion implantation mutagenesis of A. oryzae 3.042, and the protease secretions of these two strains are different. Sequencing the genome of A. oryzae 100-8 and comparing it to the genomes of A. oryzae 100-8 and 3.042 revealed some differences, such as single nucleotide polymorphisms, nucleotide deletion or insertion. Some of these differences may reflect the ability of A. oryzae to secrete proteases. Transcriptional sequencing and analysis of the two strains during the same growth processes provided further insights into the genes and pathways involved in protease secretion.

  13. Artemisinin Resistance-Associated Polymorphisms at the K13-Propeller Locus Are Absent in Plasmodium falciparum Isolates from Haiti

    PubMed Central

    Carter, Tamar E.; Boulter, Alexis; Existe, Alexandre; Romain, Jean R.; St. Victor, Jean Yves; Mulligan, Connie J.; Okech, Bernard A.

    2015-01-01

    Antimalarial drugs are a key tool in malaria elimination programs. With the emergence of artemisinin resistance in southeast Asia, an effort to identify molecular markers for surveillance of resistant malaria parasites is underway. Non-synonymous mutations in the kelch propeller domain (K13-propeller) in Plasmodium falciparum have been associated with artemisinin resistance in samples from southeast Asia, but additional studies are needed to characterize this locus in other P. falciparum populations with different levels of artemisinin use. Here, we sequenced the K13-propeller locus in 82 samples from Haiti, where limited government oversight of non-governmental organizations may have resulted in low-level use of artemisinin-based combination therapies. We detected a single-nucleotide polymorphism (SNP) at nucleotide 1,359 in a single isolate. Our results contribute to our understanding of the global genomic diversity of the K13-propeller locus in P. falciparum populations. PMID:25646258

  14. DNAzyme based gap-LCR detection of single-nucleotide polymorphism.

    PubMed

    Zhou, Li; Du, Feng; Zhao, Yongyun; Yameen, Afshan; Chen, Haodong; Tang, Zhuo

    2013-07-15

    Fast and accurate detection of single-nucleotide polymorphism (SNP) is thought more and more important for understanding of human physiology and elucidating the molecular based diseases. A great deal of effort has been devoted to developing accurate, rapid, and cost-effective technologies for SNP analysis. However most of those methods developed to date incorporate complicated probe labeling and depend on advanced equipment. The DNAzyme based Gap-LCR detection method averts any chemical modification on probes and circumvents those problems by incorporating a short functional DNA sequence into one of LCR primers. Two kinds of exonuclease are utilized in our strategy to digest all the unreacted probes and release the DNAzymes embedded in the LCR product. The DNAzyme applied in our method is a versatile tool to report the result of SNP detection in colorimetric or fluorometric ways for different detection purposes. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Quantum-Sequencing: Biophysics of quantum tunneling through nucleic acids

    NASA Astrophysics Data System (ADS)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    Tunneling microscopy and spectroscopy has extensively been used in physical surface sciences to study quantum tunneling to measure electronic local density of states of nanomaterials and to characterize adsorbed species. Quantum-Sequencing (Q-Seq) is a new method based on tunneling microscopy for electronic sequencing of single molecule of nucleic acids. A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free single-molecule sequencing method. Here, we present the unique ``electronic fingerprints'' for all nucleotides on DNA and RNA using Q-Seq along their intrinsic biophysical parameters. We have analyzed tunneling spectra for the nucleotides at different pH conditions and analyzed the HOMO, LUMO and energy gap for all of them. In addition we show a number of biophysical parameters to further characterize all nucleobases (electron and hole transition voltage and energy barriers). These results highlight the robustness of Q-Seq as a technique for next-generation sequencing.

  16. Conformational rearrangements in the transmembrane domain of CNGA1 channels revealed by single-molecule force spectroscopy

    NASA Astrophysics Data System (ADS)

    Maity, Sourav; Mazzolini, Monica; Arcangeletti, Manuel; Valbuena, Alejandro; Fabris, Paolo; Lazzarino, Marco; Torre, Vincent

    2015-05-01

    Cyclic nucleotide-gated (CNG) channels are activated by binding of cyclic nucleotides. Although structural studies have identified the channel pore and selectivity filter, conformation changes associated with gating remain poorly understood. Here we combine single-molecule force spectroscopy (SMFS) with mutagenesis, bioinformatics and electrophysiology to study conformational changes associated with gating. By expressing functional channels with SMFS fingerprints in Xenopus laevis oocytes, we were able to investigate gating of CNGA1 in a physiological-like membrane. Force spectra determined that the S4 transmembrane domain is mechanically coupled to S5 in the closed state, but S3 in the open state. We also show there are multiple pathways for the unfolding of the transmembrane domains, probably caused by a different degree of α-helix folding. This approach demonstrates that CNG transmembrane domains have dynamic structure and establishes SMFS as a tool for probing conformational change in ion channels.

  17. Intracellular nucleotide and nucleotide sugar contents of cultured CHO cells determined by a fast, sensitive, and high-resolution ion-pair RP-HPLC.

    PubMed

    Kochanowski, N; Blanchard, F; Cacan, R; Chirat, F; Guedon, E; Marc, A; Goergen, J-L

    2006-01-15

    Analysis of intracellular nucleotide and nucleotide sugar contents is essential in studying protein glycosylation of mammalian cells. Nucleotides and nucleotide sugars are the donor substrates of glycosyltransferases, and nucleotides are involved in cellular energy metabolism and its regulation. A sensitive and reproducible ion-pair reverse-phase high-performance liquid chromatography (RP-HPLC) method has been developed, allowing the direct and simultaneous detection and quantification of some essential nucleotides and nucleotide sugars. After a perchloric acid extraction, 13 molecules (8 nucleotides and 5 nucleotide sugars) were separated, including activated sugars such as UDP-glucose, UDP-galactose, GDP-mannose, UDP-N-acetylglucosamine, and UDP-N-acetylgalactosamine. To validate the analytical parameters, the reproducibility, linearity of calibration curves, detection limits, and recovery were evaluated for standard mixtures and cell extracts. The developed method is capable of resolving picomolar quantities of nucleotides and nucleotide sugars in a single chromatographic run. The HPLC method was then applied to quantify intracellular levels of nucleotides and nucleotide sugars of Chinese hamster ovary (CHO) cells cultivated in a bioreactor batch process. Evolutions of the titers of nucleotides and nucleotide sugars during the batch process are discussed.

  18. Gold nanoparticle enhanced fluorescence anisotropy for the assay of single nucleotide polymorphisms (SNPs) based on toehold-mediated strand-displacement reaction.

    PubMed

    Wang, Xinyi; Zou, Mingjian; Huang, Hongduan; Ren, Yuqian; Li, Limei; Yang, Xiaoda; Li, Na

    2013-03-15

    We developed a highly differentiating, homogeneous gold nanoparticle (AuNP) enhanced fluorescence anisotropic method for single nucleotide polymorphism (SNP) detection at nanomolar level using toehold-mediated strand-displacement reaction. The template strand, containing a toehold domain with an allele-specific site, was immobilized on the surface of AuNPs, and the solution fluorescence anisotropy was markedly enhanced when the fluorescein-labeled blocking DNA was attached to the AuNP via hybridization. Strand-displacement by the target ssDNA strand resulted in detachment of fluorescein-labeled DNA from AuNPs, and thus decreased fluorescence anisotropy. The drastic kinetic difference in strand-displacement from toehold design was used to distinguish between the perfectly matched and the single-base mismatched strands. Free energy changes were calculated to elucidate the dependence of the differentiation ability on the mutation site in the toehold region. A solid negative signal change can be obtained for single-base mismatched strand in the dynamic range of the calibration curve, and a more than 10-fold signal difference can still be observed in a mixed solution containing 100 times the single-base mismatched strand, indicating the good specificity of the method. This proposed method can be performed with a standard spectrofluorimeter in a homogeneous and cost-effective manner, and has the potential to be extended to the application of fluorescence anisotropy method of SNP detection. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Optimization of the Divergent method for genotyping single nucleotide variations using SYBR Green-based single-tube real-time PCR.

    PubMed

    Gentilini, Fabio; Turba, Maria E

    2014-01-01

    A novel technique, called Divergent, for single-tube real-time PCR genotyping of point mutations without the use of fluorescently labeled probes has recently been reported. This novel PCR technique utilizes a set of four primers and a particular denaturation temperature for simultaneously amplifying two different amplicons which extend in opposite directions from the point mutation. The two amplicons can readily be detected using the melt curve analysis downstream to a closed-tube real-time PCR. In the present study, some critical aspects of the original method were specifically addressed to further implement the technique for genotyping the DNM1 c.G767T mutation responsible for exercise-induced collapse in Labrador retriever dogs. The improved Divergent assay was easily set up using a standard two-step real-time PCR protocol. The melting temperature difference between the mutated and the wild-type amplicons was approximately 5°C which could be promptly detected by all the thermal cyclers. The upgraded assay yielded accurate results with 157pg of genomic DNA per reaction. This optimized technique represents a flexible and inexpensive alternative to the minor grove binder fluorescently labeled method and to high resolution melt analysis for high-throughput, robust and cheap genotyping of single nucleotide variations. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. DNA Sequence-Dependent Ionic Currents in Ultra-Small Solid-State Nanopores†

    PubMed Central

    Comer, Jeffrey

    2016-01-01

    Measurements of ionic currents through nanopores partially blocked by DNA have emerged as a powerful method for characterization of the DNA nucleotide sequence. Although the effect of the nucleotide sequence on the nanopore blockade current has been experimentally demonstrated, prediction and interpretation of such measurements remain a formidable challenge. Using atomic resolution computational approaches, here we show how the sequence, molecular conformation, and pore geometry affect the blockade ionic current in model solid-state nanopores. We demonstrate that the blockade current from a DNA molecule is determined by the chemical identities and conformations of at least three consecutive nucleotides. We find the blockade currents produced by the nucleotide triplets to vary considerably with their nucleotide sequence despite having nearly identical molecular conformations. Encouragingly, we find blockade current differences as large as 25% for single-base substitutions in ultra small (1.6 nm × 1.1 nm cross section; 2 nm length) solid-state nanopores. Despite the complex dependence of the blockade current on the sequence and conformation of the DNA triplets, we find that, under many conditions, the number of thymine bases is positively correlated with the current, whereas the number of purine bases and the presence of both purine and pyrimidines in the triplet are negatively correlated with the current. Based on these observations, we construct a simple theoretical model that relates the ion current to the base content of a solid-state nanopore. Furthermore, we show that compact conformations of DNA in narrow pores provide the greatest signal-to-noise ratio for single base detection, whereas reduction of the nanopore length increases the ionic current noise. Thus, the sequence dependence of nanopore blockade current can be theoretically rationalized, although the predictions will likely need to be customized for each nanopore type. PMID:27103233

  1. The multivariate association between genomewide DNA methylation and climate across the range of Arabidopsis thaliana.

    PubMed

    Keller, Thomas E; Lasky, Jesse R; Yi, Soojin V

    2016-04-01

    Epigenetic changes can occur due to extracellular environmental conditions. Consequently, epigenetic mechanisms can play an intermediate role to translate environmental signals to intracellular changes. Such a role might be particularly important in plants, which often show strong local adaptation and have the potential for heritable epigenetic states. However, little is currently known about the role of epigenetic variation in the ecological mechanisms of adaptation. Here, we used multivariate redundancy analyses to examine genomewide associations between DNA methylation polymorphisms and climate variation in two independent panels of Arabidopsis accessions, including 122 Eurasian accessions as well as in a regional panel of 148 accessions in Sweden. At the single-nucleotide methylation level, climate and space (geographic spatial structure) explain small yet significant amount of variation in both panels. On the other hand, when viewed in a context of genomic clusters of methylated and unmethylated cytosines, climate and space variables explain much greater amounts of variation in DNA methylation than those explained by variation at the single-nucleotide level. We found that the single-nucleotide methylation polymorphisms with the strongest associations with climate were enriched in transposable elements and in potentially RNA-directed methylation contexts. When viewed in the context of genomic clusters, variation of DNA methylation at different sequence contexts exhibit distinctive segregation along different axes of variation in the redundancy analyses. Genomewide methylation showed much stronger associations with climate within the regional panel (Sweden) compared to the global (Eurasia). Together, these findings indicate that genetic and epigenetic variation across the genome may play a role in response to climate conditions and local adaptation. © 2016 John Wiley & Sons Ltd.

  2. An EPAS1 haplotype is associated with high altitude polycythemia in male Han Chinese at the Qinghai-Tibetan plateau.

    PubMed

    Chen, Yu; Jiang, Chunhua; Luo, Yongjun; Liu, Fuyu; Gao, Yuqi

    2014-12-01

    Hemoglobin concentration at high altitude is considered an important marker of high altitude adaptation, and native Tibetans in the Qinghai-Tibetan plateau show lower hemoglobin concentrations than Han people who have emigrated from plains areas. Genetic studies revealed that EPAS1 plays a key role in high altitude adaptation and is associated with the low hemoglobin concentration in Tibetans. Three single nucleotide polymorphisms (rs13419896, rs4953354, rs1868092) of noncoding regions in EPAS1 exhibited significantly different allele frequencies in the Tibetan and Han populations and were associated with low hemoglobin concentrations in Tibetans. To explore the hereditary basis of high altitude polycythemia (HAPC) and investigate the association between EPAS1 and HAPC in the Han population, these 3 single nucleotide polymorphisms were assessed in 318 male Han Chinese HAPC patients and 316 control subjects. Genotyping was performed by high resolution melting curve analysis. The G-G-G haplotype of rs13419896, rs4953354, and rs1868092 was significantly more frequent in HAPC patients than in control subjects, whereas no differences in the allele or genotype frequencies of the 3 single nucleotide polymorphisms were found between HAPC patients and control subjects. Moreover, genotypes of rs1868092 (AA) and rs4953354 (GG) that were not observed in the Chinese Han in the Beijing population were found at frequencies of 1.6% and 0.9%, respectively, in our study population of HAPC patients and control subjects. Carriers of this EPAS1 haplotype (G-G-G, rs13419896, rs4953354, and rs1868092) may have a higher risk for HAPC. These results may contribute to a better understanding of the pathogenesis of HAPC in the Han population. Copyright © 2014 Wilderness Medical Society. Published by Elsevier Inc. All rights reserved.

  3. Sequence specificity of the hammerhead ribozyme revisited; the NHH rule.

    PubMed Central

    Kore, A R; Vaish, N K; Kutzke, U; Eckstein, F

    1998-01-01

    The sequence specificity of hammerhead ribozyme cleavage has been re-evaluated with respect to the NUH rule. Contrary to previous reports it was found that substrates with GAC triplets were also cleaved. This was established in three different sequence contexts. The rate of cleavage under single turnover conditions was between 3 and 7% that of cleavage 3' of GUC. Specificity of cleavage of substrates containing a central A in the cleavable triplet can be described as NAH, where N can be any nucleotide and H any nucleotide but G. As cleavage 3' of NCH triplets has recently been described, the NUH rule can be reformulated to NHH. PMID:9722629

  4. Gender and single nucleotide polymorphisms in MTHFR, BHMT, SPTLC1, CRBP2R, and SCARB1 are significant predictors of plasma homocysteine normalized by RBC folate in healthy adults.

    USDA-ARS?s Scientific Manuscript database

    Using linear regression models, we studied the main and two-way interaction effects of the predictor variables gender, age, BMI, and 64 folate/vitamin B-12/homocysteine/lipid/cholesterol-related single nucleotide polymorphisms (SNP) on log-transformed plasma homocysteine normalized by red blood cell...

  5. Brief Report: Glutamate Transporter Gene ("SLC1A1") Single Nucleotide Polymorphism (rs301430) and Repetitive Behaviors and Anxiety in Children with Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Gadow, Kenneth D.; Roohi, Jasmin; DeVincent, Carla J.; Kirsch, Sarah; Hatchwell, Eli

    2010-01-01

    Investigated association of single nucleotide polymorphism (SNP) rs301430 in glutamate transporter gene ("SLC1A1") with severity of repetitive behaviors (obsessive-compulsive behaviors, tics) and anxiety in children with autism spectrum disorder (ASD). Mothers and/or teachers completed a validated DSM-IV-referenced rating scale for 67 children…

  6. Effect of increasing the number of single-nucleotide polymorphisms from 60,000 to 85,000 in genomic evaluation of Holsteins

    USDA-ARS?s Scientific Manuscript database

    The periodic need to restock reagent pools for genotyping chips provides an opportunity to increase the number of single-nucleotide polymorphisms (SNP) on a chip at no increase in cost. A high-density chip with >140,000 SNP has been developed by GeneSeek Inc. (Lincoln, NE) to increase accuracy of ge...

  7. Development of single-nucleotide polymorphism markers for Bromus tectorum (Poaceae) from a partially sequenced transcriptome

    Treesearch

    Keith R. Merrill; Craig E. Coleman; Susan E. Meyer; Elizabeth A. Leger; Katherine A. Collins

    2016-01-01

    Premise of the study: Bromus tectorum (Poaceae) is an annual grass species that is invasive in many areas of the world but most especially in the U.S. Intermountain West. Single-nucleotide polymorphism (SNP) markers were developed for use in investigating the geospatial and ecological diversity of B. tectorum in the Intermountain West to better understand the...

  8. A Comprehensive Experiment for Molecular Biology: Determination of Single Nucleotide Polymorphism in Human REV3 Gene Using PCR-RFLP

    ERIC Educational Resources Information Center

    Zhang, Xu; Shao, Meng; Gao, Lu; Zhao, Yuanyuan; Sun, Zixuan; Zhou, Liping; Yan, Yongmin; Shao, Qixiang; Xu, Wenrong; Qian, Hui

    2017-01-01

    Laboratory exercise is helpful for medical students to understand the basic principles of molecular biology and to learn about the practical applications of molecular biology. We have designed a lab course on molecular biology about the determination of single nucleotide polymorphism (SNP) in human REV3 gene, the product of which is a subunit of…

  9. Antibiotic Resistance and Single-Nucleotide Polymorphism Cluster Grouping Type in a Multinational Sample of Resistant Mycobacterium tuberculosis Isolates▿

    PubMed Central

    Brimacombe, M.; Hazbon, M.; Motiwala, A. S.; Alland, D.

    2007-01-01

    A single-nucleotide polymorphism-based cluster grouping (SCG) classification system for Mycobacterium tuberculosis was used to examine antibiotic resistance type and resistance mutations in relationship to specific evolutionary lineages. Drug resistance and resistance mutations were seen across all SCGs. SCG-2 had higher proportions of katG codon 315 mutations and resistance to four drugs. PMID:17846140

  10. Design and characterization of a nanopore-coupled polymerase for single-molecule DNA sequencing by synthesis on an electrode array

    PubMed Central

    Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.

    2016-01-01

    Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524

  11. Differential Single Nucleotide Polymorphism-Based Analysis of an Outbreak Caused by Salmonella enterica Serovar Manhattan Reveals Epidemiological Details Missed by Standard Pulsed-Field Gel Electrophoresis

    PubMed Central

    Scaltriti, Erika; Sassera, Davide; Comandatore, Francesco; Morganti, Marina; Mandalari, Carmen; Gaiarsa, Stefano; Bandi, Claudio; Zehender, Gianguglielmo; Bolzoni, Luca; Casadei, Gabriele

    2015-01-01

    We retrospectively analyzed a rare Salmonella enterica serovar Manhattan outbreak that occurred in Italy in 2009 to evaluate the potential of new genomic tools based on differential single nucleotide polymorphism (SNP) analysis in comparison with the gold standard genotyping method, pulsed-field gel electrophoresis. A total of 39 isolates were analyzed from patients (n = 15) and food, feed, animal, and environmental sources (n = 24), resulting in five different pulsed-field gel electrophoresis (PFGE) profiles. Isolates epidemiologically related to the outbreak clustered within the same pulsotype, SXB_BS.0003, without any further differentiation. Thirty-three isolates were considered for genomic analysis based on different sets of SNPs, core, synonymous, nonsynonymous, as well as SNPs in different codon positions, by Bayesian and maximum likelihood algorithms. Trees generated from core and nonsynonymous SNPs, as well as SNPs at the second and first plus second codon positions detailed four distinct groups of isolates within the outbreak pulsotype, discriminating outbreak-related isolates of human and food origins. Conversely, the trees derived from synonymous and third-codon-position SNPs clustered food and human isolates together, indicating that all outbreak-related isolates constituted a single clone, which was in line with the epidemiological evidence. Further experiments are in place to extend this approach within our regional enteropathogen surveillance system. PMID:25653407

  12. Differential single nucleotide polymorphism-based analysis of an outbreak caused by Salmonella enterica serovar Manhattan reveals epidemiological details missed by standard pulsed-field gel electrophoresis.

    PubMed

    Scaltriti, Erika; Sassera, Davide; Comandatore, Francesco; Morganti, Marina; Mandalari, Carmen; Gaiarsa, Stefano; Bandi, Claudio; Zehender, Gianguglielmo; Bolzoni, Luca; Casadei, Gabriele; Pongolini, Stefano

    2015-04-01

    We retrospectively analyzed a rare Salmonella enterica serovar Manhattan outbreak that occurred in Italy in 2009 to evaluate the potential of new genomic tools based on differential single nucleotide polymorphism (SNP) analysis in comparison with the gold standard genotyping method, pulsed-field gel electrophoresis. A total of 39 isolates were analyzed from patients (n=15) and food, feed, animal, and environmental sources (n=24), resulting in five different pulsed-field gel electrophoresis (PFGE) profiles. Isolates epidemiologically related to the outbreak clustered within the same pulsotype, SXB_BS.0003, without any further differentiation. Thirty-three isolates were considered for genomic analysis based on different sets of SNPs, core, synonymous, nonsynonymous, as well as SNPs in different codon positions, by Bayesian and maximum likelihood algorithms. Trees generated from core and nonsynonymous SNPs, as well as SNPs at the second and first plus second codon positions detailed four distinct groups of isolates within the outbreak pulsotype, discriminating outbreak-related isolates of human and food origins. Conversely, the trees derived from synonymous and third-codon-position SNPs clustered food and human isolates together, indicating that all outbreak-related isolates constituted a single clone, which was in line with the epidemiological evidence. Further experiments are in place to extend this approach within our regional enteropathogen surveillance system. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  13. Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

    PubMed

    Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

    2006-03-01

    Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

  14. Evidence of paired M2 muscarinic receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Potter, L.T.; Ballesteros, L.A.; Bichajian, L.H.

    Binding assays involving various antagonists, including N-(3H) methylscopolamine, (3H)quinuclidinyl benzilate, AFDX-116, pirenzepine, and propylbenzilylcholine mustard, disclosed only a single population of M2 muscarinic receptors in membranes from the rat brainstem (medulla, pons, and colliculi). However, competition curves between N-(3H)methylscopolamine and various agonists, including oxotremorine, cis-dioxolane, and acetylethylcholine mustard, showed approximately equal numbers of guanine nucleotide-sensitive high affinity (H) sites and guanine nucleotide-insensitive low affinity (L) sites. This 50% H phenomenon persisted in different buffers, at different temperatures, after the number of receptors was halved (and, thus, the remaining receptor to guanine nucleotide-binding protein ratio was doubled), after membrane solubilization withmore » digitonin, and when rabbit cardiac membranes were used instead of rat brainstem membranes. Preferential occupation of H sites with acetylethylcholine mustard, and of L sites with quinuclidinyl benzilate or either mustard, yielded residual free receptor populations showing predominantly L and H sites, respectively. Low concentrations of (3H)-oxotremorine-M labeled only H sites, and the Bmax for these sites was 49% of the Bmax found with (3H)quinuclidinyl benzilate plus guanine nucleotide. These and other results are most consistent with the idea that H and L receptor sites exist on separate but dimeric receptor molecules and with the hypothesis that only the H receptors cycle between high and low affinity, depending upon interactions between this receptor molecule and a guanine nucleotide-binding protein.« less

  15. Mouse genotypes drive the liver and adrenal gland clocks

    NASA Astrophysics Data System (ADS)

    Košir, Rok; Prosenc Zmrzljak, Uršula; Korenčič, Anja; Juvan, Peter; Ačimovič, Jure; Rozman, Damjana

    2016-08-01

    Circadian rhythms regulate a plethora of physiological processes. Perturbations of the rhythm can result in pathologies which are frequently studied in inbred mouse strains. We show that the genotype of mouse lines defines the circadian gene expression patterns. Expression of majority of core clock and output metabolic genes are phase delayed in the C56BL/6J line compared to 129S2 in the adrenal glands and the liver. Circadian amplitudes are generally higher in the 129S2 line. Experiments in dark - dark (DD) and light - dark conditions (LD), exome sequencing and data mining proposed that mouse lines differ in single nucleotide variants in the binding regions of clock related transcription factors in open chromatin regions. A possible mechanisms of differential circadian expression could be the entrainment and transmission of the light signal to peripheral organs. This is supported by the genotype effect in adrenal glands that is largest under LD, and by the high number of single nucleotide variants in the Receptor, Kinase and G-protein coupled receptor Panther molecular function categories. Different phenotypes of the two mouse lines and changed amino acid sequence of the Period 2 protein possibly contribute further to the observed differences in circadian gene expression.

  16. Using haplotypes to unravel the inheritance of Holstein coat color for a larger audience

    USDA-ARS?s Scientific Manuscript database

    Haplotype testing identifies single-nucleotide polymorphisms that bracket a group of alleles from several different genes located on a specific chromosomal section of DNA. For a trait with a limited number of genotypes and phenotypes, the rules of inheritance can be determined by matching up certain...

  17. Adaptive Mechanisms Underlying Microbial Resistance to Disinfectants

    DTIC Science & Technology

    2016-02-01

    dilution]). A clinical surrogate, Escherichia coli , was used in these studies. E. coli cells were grown in the absence or presence of Lysol. The parent... Escherichia coli RTU strength Lysol Single nucleotide polymorphism (SNP...of Escheria coli with control sets of E.coli for physiological, biochemical, and genetic differences in an attempt to understand resistance

  18. Genome-wide copy number variant analysis reveals variants associated with 10 diverse production traits in Holstein cattle

    USDA-ARS?s Scientific Manuscript database

    Copy number variation (CNV) is an important type of genetic variation contributing to phenotypic differences among mammals and may serve as an alternative molecular marker to single nucleotide polymorphism (SNP) for genome-wide association study (GWAS). Recently, GWAS analysis using CNV has been app...

  19. Identification of a novel HLA-A*02 allele, HLA-A*02:01:01:32, in a deceased Caucasoid donor.

    PubMed

    Sherrill, J B; Turner, T R; Abraham, J P; Ho, C S

    2018-06-19

    HLA-A*02:01:01:32 differs from HLA-A*02:01:01:01 by a single nucleotide substitution (G➔A) at position 2456. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  20. Single nucleotide polymorphism array karyotyping: a diagnostic and prognostic tool in myelodysplastic syndromes with unsuccessful conventional cytogenetic testing.

    PubMed

    Arenillas, Leonor; Mallo, Mar; Ramos, Fernando; Guinta, Kathryn; Barragán, Eva; Lumbreras, Eva; Larráyoz, María-José; De Paz, Raquel; Tormo, Mar; Abáigar, María; Pedro, Carme; Cervera, José; Such, Esperanza; José Calasanz, María; Díez-Campelo, María; Sanz, Guillermo F; Hernández, Jesús María; Luño, Elisa; Saumell, Sílvia; Maciejewski, Jaroslaw; Florensa, Lourdes; Solé, Francesc

    2013-12-01

    Cytogenetic aberrations identified by metaphase cytogenetics (MC) have diagnostic, prognostic, and therapeutic implications in myelodysplastic syndromes (MDS). However, in some MDS patients MC study is unsuccesful. Single nucleotide polymorphism array (SNP-A) based karyotyping could be helpful in these cases. We performed SNP-A in 62 samples from bone marrow or peripheral blood of primary MDS with an unsuccessful MC study. SNP-A analysis enabled the detection of aberrations in 31 (50%) patients. We used the copy number alteration information to apply the International Prognostic Scoring System (IPSS) and we observed differences in survival between the low/intermediate-1 and intermediate-2/high risk patients. We also saw differences in survival between very low/low/intermediate and the high/very high patients when we applied the revised IPSS (IPSS-R). In conclusion, SNP-A can be used successfully in PB samples and the identification of CNA by SNP-A improve the diagnostic and prognostic evaluation of this group of MDS patients. Copyright © 2013 Wiley Periodicals, Inc.

  1. Alpha S1-casein polymorphisms in camel (Camelus dromedarius) and descriptions of biological active peptides and allergenic epitopes.

    PubMed

    Erhardt, Georg; Shuiep, El Tahir Salih; Lisson, Maria; Weimann, Christina; Wang, Zhaoxin; El Zubeir, Ibtisam El Yas Mohamed; Pauciullo, Alfredo

    2016-06-01

    Milk samples of 193 camels (Camelus dromedarius) from different regions of Sudan were screened for casein variability by isoelectric focusing. Kappa-casein and beta-casein were monomorphic, whereas three protein patterns named αs1-casein A, C, and D were identified. The major allele A revealed frequencies of 0.79 (Lahaoi), 0.75 (Shanbali), 0.90 (Arabi Khali), and 0.88 (Arabi Gharbawi) in the different ecotypes. CSN1S1*C shows a single G > T nucleotide substitution in the exon 5, leading to a non-synonymous amino acid exchange (p.Glu30 > Asp30) in comparison to CSN1S1*A and D. At cDNA level, no further single nucleotide polymorphisms could be identified in CSN1S1* A, C, and D, whereas the variants CSN1S1*A and CSN1S1*C are characterized by missing of exon 18 compared to the already described CSN1S1*B, as consequence of DNA insertion of 11 bp at intron 17 which alter the pre-mRNA spliceosome machinery. A polymerase chain-restriction fragment length polymorphism method (PCR-RFLP) was established to type for G > T nucleotide substitution at genomic DNA level. The occurrence and differences of IgE-binding epitopes and bioactive peptides between αs1-casein A, C, and D after digestion were analyzed in silico. The amino acid substitutions and deletion affected the arising peptide pattern and thus modifications between IgE-binding epitopes and bioactive peptides of the variants were found. The allergenic potential of these different peptides will be investigated by microarray immunoassay using sera from milk-sensitized individuals, as it was already demonstrated for bovine αs1-casein variants.

  2. Identification of rs7350481 at chromosome 11q23.3 as a novel susceptibility locus for metabolic syndrome in Japanese individuals by an exome-wide association study.

    PubMed

    Yamada, Yoshiji; Sakuma, Jun; Takeuchi, Ichiro; Yasukochi, Yoshiki; Kato, Kimihiko; Oguri, Mitsutoshi; Fujimaki, Tetsuo; Horibe, Hideki; Muramatsu, Masaaki; Sawabe, Motoji; Fujiwara, Yoshinori; Taniguchi, Yu; Obuchi, Shuichi; Kawai, Hisashi; Shinkai, Shoji; Mori, Seijiro; Arai, Tomio; Tanaka, Masashi

    2017-06-13

    We have performed exome-wide association studies to identify genetic variants that influence body mass index or confer susceptibility to obesity or metabolic syndrome in Japanese. The exome-wide association study for body mass index included 12,890 subjects, and those for obesity and metabolic syndrome included 12,968 subjects (3954 individuals with obesity, 9014 controls) and 6817 subjects (3998 individuals with MetS, 2819 controls), respectively. Exome-wide association studies were performed with Illumina HumanExome-12 DNA Analysis BeadChip or Infinium Exome-24 BeadChip arrays. The relation of genotypes of single nucleotide polymorphisms to body mass index was examined by linear regression analysis, and that of allele frequencies of single nucleotide polymorphisms to obesity or metabolic syndrome was evaluated with Fisher's exact test. The exome-wide association studies identified six, 11, and 40 single nucleotide polymorphisms as being significantly associated with body mass index, obesity (P <1.21 × 10-6), or metabolic syndrome (P <1.20 × 10-6), respectively. Subsequent multivariable logistic regression analysis with adjustment for age and sex revealed that three and five single nucleotide polymorphisms were related (P < 0.05) to obesity or metabolic syndrome, respectively, with one of these latter polymorphisms-rs7350481 (C/T) at chromosome 11q23.3-also being significantly (P < 3.13 × 10-4) associated with metabolic syndrome. The polymorphism rs7350481 may thus be a novel susceptibility locus for metabolic syndrome in Japanese. In addition, single nucleotide polymorphisms in three genes (CROT, TSC1, RIN3) and at four loci (ANKK1, ZNF804B, CSRNP3, 17p11.2) were implicated as candidate determinants of obesity and metabolic syndrome, respectively.

  3. Meta-analysis of the relationship between single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease.

    PubMed

    Dai, Weiran; Ye, Ziliang; Lu, Haili; Su, Qiang; Li, Hui; Li, Lang

    2018-02-23

    The results showed that there was a certain correlation between the single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease, but there was no systematic study to verify this conclusion. Systematic review of the association between single nucleotide polymorphism of IL-10-1082G/A locus and rheumatic heart disease. Computer retrieval PubMed, EMbase, Cochrane Library, CBM, CNKI, VIP and Data WanFang, the retrieval time limit from inception to June 2017. A case control study of single nucleotide polymorphisms and rheumatic heart disease in patients with rheumatic heart disease in the IL-10-1082G/A was collected. Two researchers independently screened the literature, extracted data and evaluated the risk of bias in the study, and using RevMan5.3 software for data analysis. A total of 3 case control studies were included, including 318 patients with rheumatic heart disease and 502 controls. Meta-analysis showed that there was no correlation between IL-10-1082G/A gene polymorphism and rheumatic heart disease [AA+AG VS GG: OR = 0.62, 95% CI (0.28, 1.39), P = 0.25; AA VS AG+GG: OR = 0.73, 95% CI (0.54, 1.00), P = 0.05; AA VS GG: OR = 0.70, 95% CI(0.47, 1.05), P = 0.08; AG VS GG: OR = 0.65, 95% CI (0.22, 1.92), P = 0.43; A VS G: OR = 0.87, 95% CI (0.71, 1.06), P = 0.17]. When AA is a recessive gene, the single nucleotide polymorphism of IL-10-1082G/A is associated with the presence of rheumatic heart disease. Due to the limitations of the quantity and quality of the included literatures, the further research results were still needed.

  4. Structure-Function Model for Kissing Loop Interactions That Initiate Dimerization of Ty1 RNA

    PubMed Central

    Gamache, Eric R.; Doh, Jung H.; Ritz, Justin; Laederach, Alain; Bellaousov, Stanislav; Mathews, David H.; Curcio, M. Joan

    2017-01-01

    The genomic RNA of the retrotransposon Ty1 is packaged as a dimer into virus-like particles. The 5′ terminus of Ty1 RNA harbors cis-acting sequences required for translation initiation, packaging and initiation of reverse transcription (TIPIRT). To identify RNA motifs involved in dimerization and packaging, a structural model of the TIPIRT domain in vitro was developed from single-nucleotide resolution RNA structural data. In general agreement with previous models, the first 326 nucleotides of Ty1 RNA form a pseudoknot with a 7-bp stem (S1), a 1-nucleotide interhelical loop and an 8-bp stem (S2) that delineate two long, structured loops. Nucleotide substitutions that disrupt either pseudoknot stem greatly reduced helper-Ty1-mediated retrotransposition of a mini-Ty1, but only mutations in S2 destabilized mini-Ty1 RNA in cis and helper-Ty1 RNA in trans. Nested in different loops of the pseudoknot are two hairpins with complementary 7-nucleotide motifs at their apices. Nucleotide substitutions in either motif also reduced retrotransposition and destabilized mini- and helper-Ty1 RNA. Compensatory mutations that restore base-pairing in the S2 stem or between the hairpins rescued retrotransposition and RNA stability in cis and trans. These data inform a model whereby a Ty1 RNA kissing complex with two intermolecular kissing-loop interactions initiates dimerization and packaging. PMID:28445416

  5. Single-Molecule Counting of Point Mutations by Transient DNA Binding

    NASA Astrophysics Data System (ADS)

    Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan

    2017-03-01

    High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.

  6. Methods and kits for nucleic acid analysis using fluorescence resonance energy transfer

    DOEpatents

    Kwok, Pui-Yan; Chen, Xiangning

    1999-01-01

    A method for detecting the presence of a target nucleotide or sequence of nucleotides in a nucleic acid is disclosed. The method is comprised of forming an oligonucleotide labeled with two fluorophores on the nucleic acid target site. The doubly labeled oligonucleotide is formed by addition of a singly labeled dideoxynucleoside triphosphate to a singly labeled polynucleotide or by ligation of two singly labeled polynucleotides. Detection of fluorescence resonance energy transfer upon denaturation indicates the presence of the target. Kits are also provided. The method is particularly applicable to genotyping.

  7. Single nucleotide polymorphisms in CETP, SLC46A1, SLC19A1, CD36, BCOM1, APOA5, and ABCA1 are significant predictors of plasma HDL in healthy adults

    USDA-ARS?s Scientific Manuscript database

    In a marker-trait association study we estimated the statistical significance of 65 single nucleotide polymorphisms (SNP) in 23 candidate genes on HDL levels of two independent Caucasian populations. Each population consisted of men and women and their HDL levels were adjusted for gender and body we...

  8. Rhabdomyolysis After Out-of-Water Exercise in an Elite Adolescent Water Polo Player Carrying the IL-6 174C Allele Single-Nucleotide Polymorphism.

    PubMed

    Eliakim, Alon; Ben Zaken, Sigal; Meckel, Yoav; Yamin, Chen; Dror, Nitzan; Nemet, Dan

    2015-12-01

    We present an adolescent elite water polo player who despite a genetic predisposition to develop exercise-induced severe muscle damage due to carrying the IL-6 174C allele single-nucleotide polymorphism, developed acute rhabdomyolysis only after a vigorous out-of-water training, suggesting that water polo training may be more suitable for genetically predisposed athletes.

  9. Decreased necrotizing fasciitis capacity caused by a single nucleotide mutation that alters a multiple gene virulence axis

    PubMed Central

    Olsen, Randall J.; Sitkiewicz, Izabela; Ayeras, Ara A.; Gonulal, Vedia E.; Cantu, Concepcion; Beres, Stephen B.; Green, Nicole M.; Lei, Benfang; Humbird, Tammy; Greaver, Jamieson; Chang, Ellen; Ragasa, Willie P.; Montgomery, Charles A.; Cartwright, Joiner; McGeer, Allison; Low, Donald E.; Whitney, Adeline R.; Cagle, Philip T.; Blasdel, Terry L.; DeLeo, Frank R.; Musser, James M.

    2010-01-01

    Single-nucleotide changes are the most common cause of natural genetic variation among members of the same species, but there is remarkably little information bearing on how they alter bacterial virulence. We recently discovered a single-nucleotide mutation in the group A Streptococcus genome that is epidemiologically associated with decreased human necrotizing fasciitis (“flesh-eating disease”). Working from this clinical observation, we find that wild-type mtsR function is required for group A Streptococcus to cause necrotizing fasciitis in mice and nonhuman primates. Expression microarray analysis revealed that mtsR inactivation results in overexpression of PrsA, a chaperonin involved in posttranslational maturation of SpeB, an extracellular cysteine protease. Isogenic mutant strains that overexpress prsA or lack speB had decreased secreted protease activity in vivo and recapitulated the necrotizing fasciitis-negative phenotype of the ΔmtsR mutant strain in mice and monkeys. mtsR inactivation results in increased PrsA expression, which in turn causes decreased SpeB secreted protease activity and reduced necrotizing fasciitis capacity. Thus, a naturally occurring single-nucleotide mutation dramatically alters virulence by dysregulating a multiple gene virulence axis. Our discovery has broad implications for the confluence of population genomics and molecular pathogenesis research. PMID:20080771

  10. Decreased necrotizing fasciitis capacity caused by a single nucleotide mutation that alters a multiple gene virulence axis.

    PubMed

    Olsen, Randall J; Sitkiewicz, Izabela; Ayeras, Ara A; Gonulal, Vedia E; Cantu, Concepcion; Beres, Stephen B; Green, Nicole M; Lei, Benfang; Humbird, Tammy; Greaver, Jamieson; Chang, Ellen; Ragasa, Willie P; Montgomery, Charles A; Cartwright, Joiner; McGeer, Allison; Low, Donald E; Whitney, Adeline R; Cagle, Philip T; Blasdel, Terry L; DeLeo, Frank R; Musser, James M

    2010-01-12

    Single-nucleotide changes are the most common cause of natural genetic variation among members of the same species, but there is remarkably little information bearing on how they alter bacterial virulence. We recently discovered a single-nucleotide mutation in the group A Streptococcus genome that is epidemiologically associated with decreased human necrotizing fasciitis ("flesh-eating disease"). Working from this clinical observation, we find that wild-type mtsR function is required for group A Streptococcus to cause necrotizing fasciitis in mice and nonhuman primates. Expression microarray analysis revealed that mtsR inactivation results in overexpression of PrsA, a chaperonin involved in posttranslational maturation of SpeB, an extracellular cysteine protease. Isogenic mutant strains that overexpress prsA or lack speB had decreased secreted protease activity in vivo and recapitulated the necrotizing fasciitis-negative phenotype of the DeltamtsR mutant strain in mice and monkeys. mtsR inactivation results in increased PrsA expression, which in turn causes decreased SpeB secreted protease activity and reduced necrotizing fasciitis capacity. Thus, a naturally occurring single-nucleotide mutation dramatically alters virulence by dysregulating a multiple gene virulence axis. Our discovery has broad implications for the confluence of population genomics and molecular pathogenesis research.

  11. Genetic variants associated with the root system architecture of oilseed rape (Brassica napus L.) under contrasting phosphate supply.

    PubMed

    Wang, Xiaohua; Chen, Yanling; Thomas, Catherine L; Ding, Guangda; Xu, Ping; Shi, Dexu; Grandke, Fabian; Jin, Kemo; Cai, Hongmei; Xu, Fangsen; Yi, Bin; Broadley, Martin R; Shi, Lei

    2017-08-01

    Breeding crops with ideal root system architecture for efficient absorption of phosphorus is an important strategy to reduce the use of phosphate fertilizers. To investigate genetic variants leading to changes in root system architecture, 405 oilseed rape cultivars were genotyped with a 60K Brassica Infinium SNP array in low and high P environments. A total of 285 single-nucleotide polymorphisms were associated with root system architecture traits at varying phosphorus levels. Nine single-nucleotide polymorphisms corroborate a previous linkage analysis of root system architecture quantitative trait loci in the BnaTNDH population. One peak single-nucleotide polymorphism region on A3 was associated with all root system architecture traits and co-localized with a quantitative trait locus for primary root length at low phosphorus. Two more single-nucleotide polymorphism peaks on A5 for root dry weight at low phosphorus were detected in both growth systems and co-localized with a quantitative trait locus for the same trait. The candidate genes identified on A3 form a haplotype 'BnA3Hap', that will be important for understanding the phosphorus/root system interaction and for the incorporation into Brassica napus breeding programs. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  12. Assessment of the Geographic Origins of Pinewood Nematode Isolates via Single Nucleotide Polymorphism in Effector Genes

    PubMed Central

    Figueiredo, Joana; Simões, Maria José; Gomes, Paula; Barroso, Cristina; Pinho, Diogo; Conceição, Luci; Fonseca, Luís; Abrantes, Isabel; Pinheiro, Miguel; Egas, Conceição

    2013-01-01

    The pinewood nematode, Bursaphelenchus xylophilus, is native to North America but it only causes damaging pine wilt disease in those regions of the world where it has been introduced. The accurate detection of the species and its dispersal routes are thus essential to define effective control measures. The main goals of this study were to analyse the genetic diversity among B. xylophilus isolates from different geographic locations and identify single nucleotide polymorphism (SNPs) markers for geographic origin, through a comparative transcriptomic approach. The transcriptomes of seven B. xylophilus isolates, from Continental Portugal (4), China (1), Japan (1) and USA (1), were sequenced in the next generation platform Roche 454. Analysis of effector gene transcripts revealed inter-isolate nucleotide diversity that was validated by Sanger sequencing in the genomic DNA of the seven isolates and eight additional isolates from different geographic locations: Madeira Island (2), China (1), USA (1), Japan (2) and South Korea (2). The analysis identified 136 polymorphic positions in 10 effector transcripts. Pairwise comparison of the 136 SNPs through Neighbor-Joining and the Maximum Likelihood methods and 5-mer frequency analysis with the alignment-independent bilinear multivariate modelling approach correlated the SNPs with the isolates geographic origin. Furthermore, the SNP analysis indicated a closer proximity of the Portuguese isolates to the Korean and Chinese isolates than to the Japanese or American isolates. Each geographic cluster carried exclusive alleles that can be used as SNP markers for B. xylophilus isolate identification. PMID:24391785

  13. A genotyping system capable of simultaneously analyzing >1000 single nucleotide polymorphisms in a haploid genome.

    PubMed

    Wang, Hui-Yun; Luo, Minjie; Tereshchenko, Irina V; Frikker, Danielle M; Cui, Xiangfeng; Li, James Y; Hu, Guohong; Chu, Yi; Azaro, Marco A; Lin, Yong; Shen, Li; Yang, Qifeng; Kambouris, Manousos E; Gao, Richeng; Shih, Weichung; Li, Honghua

    2005-02-01

    A high-throughput genotyping system for scoring single nucleotide polymorphisms (SNPs) has been developed. With this system, >1000 SNPs can be analyzed in a single assay, with a sensitivity that allows the use of single haploid cells as starting material. In the multiplex polymorphic sequence amplification step, instead of attaching universal sequences to the amplicons, primers that are unlikely to have nonspecific and productive interactions are used. Genotypes of SNPs are then determined by using the widely accessible microarray technology and the simple single-base extension assay. Three SNP panels, each consisting of >1000 SNPs, were incorporated into this system. The system was used to analyze 24 human genomic DNA samples. With 5 ng of human genomic DNA, the average detection rate was 98.22% when single probes were used, and 96.71% could be detected by dual probes in different directions. When single sperm cells were used, 91.88% of the SNPs were detectable, which is comparable to the level that was reached when very few genetic markers were used. By using a dual-probe assay, the average genotyping accuracy was 99.96% for 5 ng of human genomic DNA and 99.95% for single sperm. This system may be used to significantly facilitate large-scale genetic analysis even if the amount of DNA template is very limited or even highly degraded as that obtained from paraffin-embedded cancer specimens, and to make many unpractical research projects highly realistic and affordable.

  14. Universal fluorescent tri-probe ligation equipped with capillary electrophoresis for targeting SMN1 and SMN2 genes in diagnosis of spinal muscular atrophy.

    PubMed

    Wang, Chun-Chi; Shih, Chi-Jen; Jong, Yuh-Jyh; Wu, Shou-Mei

    2014-06-23

    This is the first ligase chain reaction used for diagnosis of spinal muscular atrophy (SMA). Universal fluorescent tri-probe ligation (UFTPL), a novel strategy used for distinguishing the multi-nucleotide alternations at single base, is developed to quantitatively analyze the SMN1/SMN2 genes in diagnosis of SMA. Ligase chain reaction was performed by adding three probes including universal fluorescent probe, connecting probe and recognizing probe to differentiate single nucleotide polymorphisms in UFTPL. Our approach was based on the two UFTPL products of survival motor neuron 1 (SMN1) and SMN2 genes (the difference of 9 mer) and analyzed by capillary electrophoresis (CE). We successfully determined various gene dosages of SMN1 and SMN2 genes in homologous or heterologous subjects. By using the UFTPL-CE method, the SMN1 and SMN2 genes were fully resolved with the resolution of 2.16±0.37 (n=3). The r values of SMN1 and SMN2 regression curves over a range of 1-4 copies were above 0.9944. Of the 48 DNA samples, the data of gene dosages were corresponding to that analyzed by conformation sensitive CE and denatured high-performance liquid chromatography (DHPLC). This technique was found to be a good methodology for quantification or determination of the relative genes having multi-nucleotide variants at single base. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Comparative genomic sequence analysis of novel Helicoverpa armigera nucleopolyhedrovirus (NPV) isolated from Kenya and three other previously sequenced Helicoverpa spp. NPVs.

    PubMed

    Ogembo, Javier Gordon; Caoili, Barbara L; Shikata, Masamitsu; Chaeychomsri, Sudawan; Kobayashi, Michihiro; Ikeda, Motoko

    2009-10-01

    A newly cloned Helicoverpa armigera nucleopolyhedrovirus (HearNPV) from Kenya, HearNPV-NNg1, has a higher insecticidal activity than HearNPV-G4, which also exhibits lower insecticidal activity than HearNPV-C1. In the search for genes and/or nucleotide sequences that might be involved in the observed virulence differences among Helicoverpa spp. NPVs, the entire genome of NNg1 was sequenced and compared with previously sequenced genomes of G4, C1 and Helicoverpa zea single-nucleocapsid NPV (Hz). The NNg1 genome was 132,425 bp in length, with a total of 143 putative open reading frames (ORFs), and shared high levels of overall amino acid and nucleotide sequence identities with G4, C1 and Hz. Three NNg1 ORFs, ORF5, ORF100 and ORF124, which were shared with C1, were absent in G4 and Hz, while NNg1 and C1 were missing a homologue of G4/Hz ORF5. Another three ORFs, ORF60 (bro-b), ORF119 and ORF120, and one direct repeat sequence (dr) were unique to NNg1. Relative to the overall nucleotide sequence identity, lower sequence identities were observed between NNg1 hrs and the homologous hrs in the other three Helicoverpa spp. NPVs, despite containing the same number of hrs located at essentially the same positions on the genomes. Differences were also observed between NNg1 and each of the other three Helicoverpa spp. NPVs in the diversity of bro genes encoded on the genomes. These results indicate several putative genes and nucleotide sequences that may be responsible for the virulence differences observed among Helicoverpa spp., yet the specific genes and/or nucleotide sequences responsible have not been identified.

  16. A new class of homogeneous nucleic acid probes based on specific displacement hybridization

    PubMed Central

    Li, Qingge; Luan, Guoyan; Guo, Qiuping; Liang, Jixuan

    2002-01-01

    We have developed a new class of probes for homogeneous nucleic acid detection based on the proposed displacement hybridization. Our probes consist of two complementary oligodeoxyribonucleotides of different length labeled with a fluorophore and a quencher in close proximity in the duplex. The probes on their own are quenched, but they become fluorescent upon displacement hybridization with the target. These probes display complete discrimination between a perfectly matched target and single nucleotide mismatch targets. A comparison of double-stranded probes with corresponding linear probes confirms that the presence of the complementary strand significantly enhances their specificity. Using four such probes labeled with different color fluorophores, each designed to recognize a different target, we have demonstrated that multiple targets can be distinguished in the same solution, even if they differ from one another by as little as a single nucleotide. Double-stranded probes were used in real-time nucleic acid amplifications as either probes or as primers. In addition to its extreme specificity and flexibility, the new class of probes is simple to design and synthesize, has low cost and high sensitivity and is accessible to a wide range of labels. This class of probes should find applications in a variety of areas wherever high specificity of nucleic acid hybridization is relevant. PMID:11788731

  17. The common single-nucleotide polymorphism rs2681472 is associated with early-onset preeclampsia in Northern Han Chinese women.

    PubMed

    Wan, Ji-Peng; Wang, Hong; Li, Chang-Zhong; Zhao, Han; You, Li; Shi, Dong-Hong; Sun, Xiu-Hua; Lv, Hong; Wang, Fei; Wen, Ze-Qing; Wang, Xie-Tong; Chen, Zi-Jiang

    2014-11-01

    Preeclampsia, characterized by hypertension and proteinuria, remains a leading cause of maternal morbidity and mortality. Recently, a genome-wide association study (GWAS) identified the single-nucleotide polymorphism, rs2681472, as a new hypertension susceptibility genetic variant. The purpose of this study was to evaluate the association between preeclampsia and rs268172 in a Northern Han Chinese population. We genotyped 1218 unrelated Northern Han Chinese women, including 515 patients with preeclampsia and 703 healthy controls. No significant differences were detected in the allele frequencies between patients and controls (P = .23). When patients were divided into early-onset and late-onset preeclampsia according to gestational age of disease onset, the allele frequencies significantly differed between controls and patients with early-onset preeclampsia (P = .02). Genotype frequencies also were significantly different between controls and patients early-onset preeclampsia when data were analyzed under additive (P = .03) and dominant (P = .009) models. We replicated this association in an independent Northern Han Chinese population and observed a significant difference in the allele frequencies between patients with early-onset preeclampsia and controls (P = .011). We report that rs2681472 is associated with early-onset preeclampsia in Northern Han Chinese women. © The Author(s) 2014.

  18. Using surface-enhanced Raman spectroscopy and electrochemically driven melting to discriminate Yersinia pestis from Y. pseudotuberculosis based on single nucleotide polymorphisms within unpurified polymerase chain reaction amplicons.

    PubMed

    Papadopoulou, Evanthia; Goodchild, Sarah A; Cleary, David W; Weller, Simon A; Gale, Nittaya; Stubberfield, Michael R; Brown, Tom; Bartlett, Philip N

    2015-02-03

    The development of sensors for the detection of pathogen-specific DNA, including relevant species/strain level discrimination, is critical in molecular diagnostics with major impacts in areas such as bioterrorism and food safety. Herein, we use electrochemically driven denaturation assays monitored by surface-enhanced Raman spectroscopy (SERS) to target single nucleotide polymorphisms (SNPs) that distinguish DNA amplicons generated from Yersinia pestis, the causative agent of plague, from the closely related species Y. pseudotuberculosis. Two assays targeting SNPs within the groEL and metH genes of these two species have been successfully designed. Polymerase chain reaction (PCR) was used to produce Texas Red labeled single-stranded DNA (ssDNA) amplicons of 262 and 251 bases for the groEL and metH targets, respectively. These amplicons were used in an unpurified form to hybridize to immobilized probes then subjected to electrochemically driven melting. In all cases electrochemically driven melting was able to discriminate between fully homologous DNA and that containing SNPs. The metH assay was particularly challenging due to the presence of only a single base mismatch in the middle of the 251 base long PCR amplicon. However, manipulation of assay conditions (conducting the electrochemical experiments at 10 °C) resulted in greater discrimination between the complementary and mismatched DNA. Replicate data were collected and analyzed for each duplex on different days, using different batches of PCR product and different sphere segment void (SSV) substrates. Despite the variability introduced by these differences, the assays are shown to be reliable and robust providing a new platform for strain discrimination using unpurified PCR samples.

  19. Spontaneous Chloroplast Mutants Mostly Occur by Replication Slippage and Show a Biased Pattern in the Plastome of Oenothera[OPEN

    PubMed Central

    Massouh, Amid; Schubert, Julia; Yaneva-Roder, Liliya; Ulbricht-Jones, Elena S.; Johnson, Marc T.J.; Wright, Stephen I.; Pellizzer, Tommaso; Sobanski, Johanna; Greiner, Stephan

    2016-01-01

    Spontaneous plastome mutants have been used as a research tool since the beginning of genetics. However, technical restrictions have severely limited their contributions to research in physiology and molecular biology. Here, we used full plastome sequencing to systematically characterize a collection of 51 spontaneous chloroplast mutants in Oenothera (evening primrose). Most mutants carry only a single mutation. Unexpectedly, the vast majority of mutations do not represent single nucleotide polymorphisms but are insertions/deletions originating from DNA replication slippage events. Only very few mutations appear to be caused by imprecise double-strand break repair, nucleotide misincorporation during replication, or incorrect nucleotide excision repair following oxidative damage. U-turn inversions were not detected. Replication slippage is induced at repetitive sequences that can be very small and tend to have high A/T content. Interestingly, the mutations are not distributed randomly in the genome. The underrepresentation of mutations caused by faulty double-strand break repair might explain the high structural conservation of seed plant plastomes throughout evolution. In addition to providing a fully characterized mutant collection for future research on plastid genetics, gene expression, and photosynthesis, our work identified the spectrum of spontaneous mutations in plastids and reveals that this spectrum is very different from that in the nucleus. PMID:27053421

  20. Ewing's sarcoma: analysis of single nucleotide polymorphism in the EWS gene.

    PubMed

    Silva, Deborah S B S; Sawitzki, Fernanda R; De Toni, Elisa C; Graebin, Pietra; Picanco, Juliane B; Abujamra, Ana Lucia; de Farias, Caroline B; Roesler, Rafael; Brunetto, Algemir L; Alho, Clarice S

    2012-11-10

    We aimed to investigate single nucleotide polymorphisms (SNPs) in the EWS gene breaking region in order to analyze Ewing's sarcoma susceptibility. The SNPs were investigated in a healthy subject population and in Ewing's sarcoma patients from Southern Brazil. Genotyping was performed by TaqMan® assay for allelic discrimination using Real-Time PCR. The analysis of incidence of SNPs or different SNP-arrangements revealed a higher presence of homozygote TT-rs4820804 in Ewing's sarcoma patients (p=0.02; Chi Square Test). About 300 bp from the rs4820804 SNP lies a palindromic hexamer (5'-GCTAGC-3') and three nucleotides (GTC), which were previously identified to be in close vicinity of the breakpoint junction in both EWS and FLI1 genes. This DNA segment surrounding the rs4820804 SNP is likely to indicate a breakpoint region. If the T-rs4820804 allele predisposes a DNA fragment to breakage, homozygotes (TT-rs4820804) would have double the chance of having a chromosome break, increasing the chances for a translocation to occur. In conclusion, the TT-rs4820804 EWS genotype can be associated with Ewing's sarcoma and the SNP rs4820804 can be a candidate marker to understand Ewing's sarcoma susceptibility. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Single nucleotide polymorphism analysis of the enterocin P structural gene of Enterococcus faecium strains isolated from nonfermented animal foods.

    PubMed

    Arlindo, Samuel; Calo, Pilar; Franco, Carlos; Prado, Marta; Cepeda, Alberto; Barros-Velázquez, Jorge

    2006-12-01

    The bacteriocins produced by two lactic acid bacteria isolated from nonfermented fresh meat and fish, respectively, and exhibiting a remarkable antilisterial activity, were characterized. Bacteriocinogenic strains were identified as Enterococcus faecium and the maximum bacteriocin production by both strains was detected in the stationary phase of growth. The activity against Listeria monocytogenes was maintained in pH range of 3-7 and was stable in both strains after heating at 100 or 121 degrees C. The genes coding for enterocin P were detected, isolated, and sequenced in both E. faecium strains. They exhibited DNA/DNA homology in the 87.1-97.2% range with respect to the other four enterocin P genes reported so far. Three single nucleotide polymorphism events, silent at the amino acid level, were detected at nucleotide positions 45 (G/A), 75 (A/G), and 90 (T/C) in E. faecium LHICA 28-4 and may explain the differences reported for those loci in other enterocin P-producing E. faecium strains. This work provides the first description of enterocin P-producing E. faecium strains in nonfermented foodstuffs and, in the case of E. faecium LHICA 51, the first report of an enterocin P-producing strain isolated from fish so far.

  2. The nucleotide binding dynamics of human MSH2-MSH3 are lesion dependent.

    PubMed

    Owen, Barbara A L; H Lang, Walter; McMurray, Cynthia T

    2009-05-01

    Here we report that the human DNA mismatch complex MSH2-MSH3 recognizes small loops by a mechanism different from that of MSH2-MSH6 for single-base mismatches. The subunits MSH2 and MSH3 can bind either ADP or ATP with similar affinities. Upon binding to a DNA loop, however, MSH2-MSH3 adopts a single 'nucleotide signature', in which the MSH2 subunit is occupied by an ADP molecule and the MSH3 subunit is empty. Subsequent ATP binding and hydrolysis in the MSH3 subunit promote ADP-ATP exchange in the MSH2 subunit to yield a hydrolysis-independent ATP-MSH2-MSH3-ADP intermediate. Human MSH2-MSH3 and yeast Msh2-Msh6 both undergo ADP-ATP exchange in the Msh2 subunit but, apparently, have opposite requirements for ATP hydrolysis: ADP release from DNA-bound Msh2-Msh6 requires ATP stabilization in the Msh6 subunit, whereas ADP release from DNA-bound MSH2-MSH3 requires ATP hydrolysis in the MSH3 subunit. We propose a model in which lesion binding converts MSH2-MSH3 into a distinct nucleotide-bound form that is poised to be a molecular sensor for lesion specificity.

  3. Relationship Between Some Single-nucleotide Polymorphism and Response to Hydroxyurea Therapy in Iranian Patients With β-Thalassemia Intermedia.

    PubMed

    Karimi, Mehran; Zarei, Tahereh; Haghpanah, Sezaneh; Moghadam, Mohamad; Ebrahimi, Ahmad; Rezaei, Narges; Heidari, Ghazaleh; Vazin, Afsaneh; Khavari, Maryam; Miri, Hamid R

    2017-05-01

    To evaluate the possible relationship between hydroxyurea (HU) response and some single-nucleotide polymorphism (SNP) in patients affected by β-thalassemia intermedia. In this cross-sectional study, 100 β-thalassemia intermedia patients who were taking HU with a dose of 8 to 15 mg/kg body weight per day for a period of at least 6 months were randomly selected between February 2013 and October 2014 in southern Iran. HU response was defined based on decrease or cessation of the blood transfusion need and evaluation of Hb level. In univariate analysis, from all evaluated SNPs, only rs10837814 SNP of olfactory receptors (ORs) OR51B2 showed a significant association with HU response (P=0.038) and from laboratory characteristics, only nucleated red blood cells showed significant associations (116%±183%) in good responders versus (264%±286%) in poor responders (P=0.045). In multiple logistic regression, neither laboratory variables nor different SNPs, showed significant association with HU response. Three novel nucleotide variations (-665 [A→C], -1301 [T→G],-1199 delA) in OR51B2 gene were found in good responders. None of the evaluated SNPs in our study showed significant association with HU response. Further larger studies and evaluation of other genes are suggested.

  4. The allele frequency of two single nucleotide polymorphisms in the von Hippel-Lindau (VHL) tumor suppressor gene in the Taiwanese population.

    PubMed

    Wang, Wen-Chung; Chen, Hui-Ju; Shu, Wei-Pang; Tsai, Yi-Chang; Lai, Yen-Chein

    2011-10-01

    The von Hippel-Lindau (VHL) tumor suppressor gene located on chromosome 3p25-26 is implicated in VHL disease. Two informative single nucleotide polymorphisms are at positions 19 and 1149 on the nucleotide sequence from Gene Bank NM_000551. In this study we examined the allele frequencies at these two loci in the Taiwanese population and compared the results to those from European ethnic populations. The allele frequency was examined in 616 healthy individuals including 301 university students and 315 neonates. Both A/G polymorphisms were investigated using restriction fragment length polymorphism analysis created by restriction enzymes, BsaJ I and Acc I. Among these subjects, the allele frequencies at 19 SNP and 1149 SNP for variant G were 0.130 and 0.133, respectively. And these results were significant differences from those of the Caucasian populations. In addition, 90% of the tested subjects had identical genotypes at these two loci suggesting the existence of nonrandom association of alleles. We found that the G allele frequency at these two loci in the Taiwanese population is much lower than that in people from Western countries. This phenomenon may be attributed to ethnic effects. Copyright © 2011. Published by Elsevier B.V.

  5. A single nucleotide polymorphism at the right terminal region of Mexican papita viroid is a virulent determinant factor on tomato

    USDA-ARS?s Scientific Manuscript database

    Mexican papita viroid (MPVd), a pospiviroid, causes serious disease outbreaks on greenhouse tomato in North America. Two dominant genotypes (MPV-S and MPV-M), sharing 93.8% sequence identity, incited striking different symptom expression (severe and mild) on tomato ‘Rutgers’. To determine genetic ...

  6. RNA Expression and Post-Transcriptional Editing Analyses of Cucumber Plastids Reveals Genetic Differences Associated with Chilling Tolerance

    USDA-ARS?s Scientific Manuscript database

    Tolerance to chilling injury in cucumber (Cucumis sativus L.) is associated with three plastomic single nucleotide polymorphisms (ptSNPs) at bp positions 4,813, 56,561, and 126,349 that are co-inherited. An understanding of the genetic expression of these ptSNPs as a response to chilling is critical...

  7. Exploring the feasibility of using copy number variants as genetic markers through large-scale whole genome sequencing experiments

    USDA-ARS?s Scientific Manuscript database

    Copy number variants (CNV) are large scale duplications or deletions of genomic sequence that are caused by a diverse set of molecular phenomena that are distinct from single nucleotide polymorphism (SNP) formation. Due to their different mechanisms of formation, CNVs are often difficult to track us...

  8. Association of Cytokine Candidate Genes with Severity of Pain and Co-Occurring Symptoms in Breast Cancer Patients Receiving Chemotherapy

    DTIC Science & Technology

    2013-10-01

    identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in cytokine genes, as well demographic, clinical, and...Center. The purpose of the proposed project is to identify common genetic variations (i.e., single nucleotide polymorphisms [ SNPs ] and haplotypes) in...research team continues to meet monthly to discuss progress with regards to recruitment, enrollment, and data collection. Training in Genetics In year

  9. Single-cell analysis of intercellular heteroplasmy of mtDNA in Leber hereditary optic neuropathy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kobayashi, Y.; Sharpe, H.; Brown, N.

    1994-07-01

    The authors have investigated the distribution of mutant mtDNA molecules in single cells from a patient with Leber hereditary optic neuropathy (LHON). LHON is a maternally inherited disease that is characterized by a sudden-onset bilateral loss of central vision, which typically occurs in early adulthood. More than 50% of all LHON patients carry an mtDNA mutation at nucleotide position 11778. This nucleotide change converts a highly conserved arginine residue to histidine at codon 340 in the NADH-ubiquinone oxidoreductase subunit 4 (ND4) gene of mtDNA. In the present study, the authors used PCR amplification of mtDNA from lymphocytes to investigate mtDNAmore » heteroplasmy at the single-cell level in a LHON patient. They found that most cells were either homoplasmic normal or homoplasmic mutant at nucleotide position 11778. Some (16%) cells contained both mutant and normal mtDNA.« less

  10. Single Locked Nucleic Acid-Enhanced Nanopore Genetic Discrimination of Pathogenic Serotypes and Cancer Driver Mutations.

    PubMed

    Tian, Kai; Chen, Xiaowei; Luan, Binquan; Singh, Prashant; Yang, Zhiyu; Gates, Kent S; Lin, Mengshi; Mustapha, Azlin; Gu, Li-Qun

    2018-05-22

    Accurate and rapid detection of single-nucleotide polymorphism (SNP) in pathogenic mutants is crucial for many fields such as food safety regulation and disease diagnostics. Current detection methods involve laborious sample preparations and expensive characterizations. Here, we investigated a single locked nucleic acid (LNA) approach, facilitated by a nanopore single-molecule sensor, to accurately determine SNPs for detection of Shiga toxin producing Escherichia coli (STEC) serotype O157:H7, and cancer-derived EGFR L858R and KRAS G12D driver mutations. Current LNA applications that require incorporation and optimization of multiple LNA nucleotides. But we found that in the nanopore system, a single LNA introduced in the probe is sufficient to enhance the SNP discrimination capability by over 10-fold, allowing accurate detection of the pathogenic mutant DNA mixed in a large amount of the wild-type DNA. Importantly, the molecular mechanistic study suggests that such a significant improvement is due to the effect of the single-LNA that both stabilizes the fully matched base-pair and destabilizes the mismatched base-pair. This sensitive method, with a simplified, low cost, easy-to-operate LNA design, could be generalized for various applications that need rapid and accurate identification of single-nucleotide variations.

  11. Coupling between nucleotide excision repair and gene expression.

    PubMed

    Cambindo Botto, Adrián E; Muñoz, Juan C; Muñoz, Manuel J

    2018-05-17

    Gene expression and DNA repair are fundamental processes for life. During the last decade, accumulating experimental evidence point towards different modes of coupling between these processes. Here we discuss the molecular mechanisms by which RNAPII-dependent transcription affects repair by the Nucleotide Excision Repair system (NER) and how NER activity, through the generation of single stranded DNA intermediates and activation of the DNA damage response kinase ATR, drives gene expression in a genotoxic scenario. Since NER-dependent repair is compromised in Xeroderma Pigmentosum (XP) patients, and having in mind that these patients present a high degree of clinical heterogeneity, we speculate that some of the clinical features of XP patients can be explained by misregulation of gene expression.

  12. Electron attachment to DNA single strands: gas phase and aqueous solution.

    PubMed

    Gu, Jiande; Xie, Yaoming; Schaefer, Henry F

    2007-01-01

    The 2'-deoxyguanosine-3',5'-diphosphate, 2'-deoxyadenosine-3',5'-diphosphate, 2'-deoxycytidine-3',5'-diphosphate and 2'-deoxythymidine-3',5'-diphosphate systems are the smallest units of a DNA single strand. Exploring these comprehensive subunits with reliable density functional methods enables one to approach reasonable predictions of the properties of DNA single strands. With these models, DNA single strands are found to have a strong tendency to capture low-energy electrons. The vertical attachment energies (VEAs) predicted for 3',5'-dTDP (0.17 eV) and 3',5'-dGDP (0.14 eV) indicate that both the thymine-rich and the guanine-rich DNA single strands have the ability to capture electrons. The adiabatic electron affinities (AEAs) of the nucleotides considered here range from 0.22 to 0.52 eV and follow the order 3',5'-dTDP > 3',5'-dCDP > 3',5'-dGDP > 3',5'-dADP. A substantial increase in the AEA is observed compared to that of the corresponding nucleic acid bases and the corresponding nucleosides. Furthermore, aqueous solution simulations dramatically increase the electron attracting properties of the DNA single strands. The present investigation illustrates that in the gas phase, the excess electron is situated both on the nucleobase and on the phosphate moiety for DNA single strands. However, the distribution of the extra negative charge is uneven. The attached electron favors the base moiety for the pyrimidine, while it prefers the 3'-phosphate subunit for the purine DNA single strands. In contrast, the attached electron is tightly bound to the base fragment for the cytidine, thymidine and adenosine nucleotides, while it almost exclusively resides in the vicinity of the 3'-phosphate group for the guanosine nucleotides due to the solvent effects. The comparatively low vertical detachment energies (VDEs) predicted for 3',5'-dADP(-) (0.26 eV) and 3',5'-dGDP(-) (0.32 eV) indicate that electron detachment might compete with reactions having high activation barriers such as glycosidic bond breakage. However, the radical anions of the pyrimidine nucleotides with high VDE are expected to be electronically stable. Thus the base-centered radical anions of the pyrimidine nucleotides might be the possible intermediates for DNA single-strand breakage.

  13. A few nucleotide polymorphisms are sufficient to recruit nuclear factors differentially to the intron 1 of HPV-16 intratypic variants.

    PubMed

    López-Urrutia, Eduardo; Valdés, Jesús; Bonilla-Moreno, Raúl; Martínez-Salazar, Martha; Martínez-Garcia, Martha; Berumen, Jaime; Villegas-Sepúlveda, Nicolás

    2012-06-01

    The HPV-16 E6/E7 genes, which contain intron 1, are processed by alternative splicing and its transcripts are detected with a heterogeneous profile in tumours cells. Frequently, the HPV-16 positive carcinoma cells bear viral variants that contain single nucleotide polymorphisms into its DNA sequence. We were interested in analysing the contribution of this polymorphism to the heterogeneity in the pattern of the E6/E7 spliced transcripts. Using the E6/E7 sequences from three closely related HPV-16 variants, we have shown that a few nucleotide changes are sufficient to produce heterogeneity in the splicing profile. Furthermore, using mutants that contained a single SNP, we also showed that one nucleotide change was sufficient to reproduce the heterogeneous splicing profile. Additionally, a difference of two or three SNPs among these viral sequences was sufficient to recruit differentially several splicing factors to the polymorphic E6/E7 transcripts. Moreover, only one SNP was sufficient to alter the binding site of at least one splicing factor, changing the ability of splicing factors to bind the transcript. Finally, the factors that were differentially bound to the short form of intron 1 of one of these E6/E7 variants were identified as TIA1 and/or TIAR and U1-70k, while U2AF65, U5-52k and PTB were preferentially bound to the transcript of the other variants. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Genetic risk profiling and gene signature modeling to predict risk of complications after IPAA.

    PubMed

    Sehgal, Rishabh; Berg, Arthur; Polinski, Joseph I; Hegarty, John P; Lin, Zhenwu; McKenna, Kevin J; Stewart, David B; Poritz, Lisa S; Koltun, Walter A

    2012-03-01

    Severe pouchitis and Crohn's disease-like complications are 2 adverse postoperative complications that confound the success of the IPAA in patients with ulcerative colitis. To date, approximately 83 single nucleotide polymorphisms within 55 genes have been associated with IBD. The aim of this study was to identify single-nucleotide polymorphisms that correlate with complications after IPAA that could be utilized in a gene signature fashion to predict postoperative complications and aid in preoperative surgical decision making. One hundred forty-two IPAA patients were retrospectively classified as "asymptomatic" (n = 104, defined as no Crohn's disease-like complications or severe pouchitis for at least 2 years after IPAA) and compared with a "severe pouchitis" group (n = 12, ≥ 4 episodes pouchitis per year for 2 years including the need for long-term therapy to maintain remission) and a "Crohn's disease-like" group (n = 26, presence of fistulae, pouch inlet stricture, proximal small-bowel disease, or pouch granulomata, occurring at least 6 months after surgery). Genotyping for 83 single-nucleotide polymorphisms previously associated with Crohn's disease and/or ulcerative colitis was performed on a customized Illumina genotyping platform. The top 2 single-nucleotide polymorphisms statistically identified as being independently associated with each of Crohn's disease-like and severe pouchitis were used in a multivariate logistic regression model. These single-nucleotide polymorphisms were then used to create probability equations to predict overall chance of a positive or negative outcome for that complication. The top 2 single-nucleotide polymorphisms for Crohn's disease-like complications were in the 10q21 locus and the gene for PTGER4 (p = 0.006 and 0.007), whereas for severe pouchitis it was NOD2 and TNFSF15 (p = 0.003 and 0.011). Probability equations suggested that the risk of these 2 complications greatly increased with increasing number of risk alleles, going as high as 92% for severe pouchitis and 65% for Crohn's disease-like complications. In this IPAA patient cohort, mutations in the 10q21 locus and the PTGER4 gene were associated with Crohn's disease-like complications, whereas mutations in NOD2 and TNFSF15 correlated with severe pouchitis. Preoperative genetic analysis and use of such gene signatures hold promise for improved preoperative surgical patient selection to minimize these IPAA complications.

  15. E6 and E7 Gene Polymorphisms in Human Papillomavirus Types-58 and 33 Identified in Southwest China

    PubMed Central

    Wen, Qiang; Wang, Tao; Mu, Xuemei; Chenzhang, Yuwei; Cao, Man

    2017-01-01

    Cancer of the cervix is associated with infection by certain types of human papillomavirus (HPV). The gene variants differ in immune responses and oncogenic potential. The E6 and E7 proteins encoded by high-risk HPV play a key role in cellular transformation. HPV-33 and HPV-58 types are highly prevalent among Chinese women. To study the gene intratypic variations, polymorphisms and positive selections of HPV-33 and HPV-58 E6/E7 in southwest China, HPV-33 (E6, E7: n = 216) and HPV-58 (E6, E7: n = 405) E6 and E7 genes were sequenced and compared to others submitted to GenBank. Phylogenetic trees were constructed by Maximum-likelihood and the Kimura 2-parameters methods by MEGA 6 (Molecular Evolutionary Genetics Analysis version 6.0). The diversity of secondary structure was analyzed by PSIPred software. The selection pressures acting on the E6/E7 genes were estimated by PAML 4.8 (Phylogenetic Analyses by Maximun Likelihood version4.8) software. The positive sites of HPV-33 and HPV-58 E6/E7 were contrasted by ClustalX 2.1. Among 216 HPV-33 E6 sequences, 8 single nucleotide mutations were observed with 6/8 non-synonymous and 2/8 synonymous mutations. The 216 HPV-33 E7 sequences showed 3 single nucleotide mutations that were non-synonymous. The 405 HPV-58 E6 sequences revealed 8 single nucleotide mutations with 4/8 non-synonymous and 4/8 synonymous mutations. Among 405 HPV-58 E7 sequences, 13 single nucleotide mutations were observed with 10/13 non-synonymous mutations and 3/13 synonymous mutations. The selective pressure analysis showed that all HPV-33 and 4/6 HPV-58 E6/E7 major non-synonymous mutations were sites of positive selection. All variations were observed in sites belonging to major histocompatibility complex and/or B-cell predicted epitopes. K93N and R145 (I/N) were observed in both HPV-33 and HPV-58 E6. PMID:28141822

  16. Pre-steady-state Kinetic Analysis of a Family D DNA Polymerase from Thermococcus sp. 9°N Reveals Mechanisms for Archaeal Genomic Replication and Maintenance*

    PubMed Central

    Schermerhorn, Kelly M.; Gardner, Andrew F.

    2015-01-01

    Family D DNA polymerases (polDs) have been implicated as the major replicative polymerase in archaea, excluding the Crenarchaeota branch, and bear little sequence homology to other DNA polymerase families. Here we report a detailed kinetic analysis of nucleotide incorporation and exonuclease activity for a Family D DNA polymerase from Thermococcus sp. 9°N. Pre-steady-state single-turnover nucleotide incorporation assays were performed to obtain the kinetic parameters, kpol and Kd, for correct nucleotide incorporation, incorrect nucleotide incorporation, and ribonucleotide incorporation by exonuclease-deficient polD. Correct nucleotide incorporation kinetics revealed a relatively slow maximal rate of polymerization (kpol ∼2.5 s−1) and especially tight nucleotide binding (Kd(dNTP) ∼1.7 μm), compared with DNA polymerases from Families A, B, C, X, and Y. Furthermore, pre-steady-state nucleotide incorporation assays revealed that polD prevents the incorporation of incorrect nucleotides and ribonucleotides primarily through reduced nucleotide binding affinity. Pre-steady-state single-turnover assays on wild-type 9°N polD were used to examine 3′-5′ exonuclease hydrolysis activity in the presence of Mg2+ and Mn2+. Interestingly, substituting Mn2+ for Mg2+ accelerated hydrolysis rates >40-fold (kexo ≥110 s−1 versus ≥2.5 s−1). Preference for Mn2+ over Mg2+ in exonuclease hydrolysis activity is a property unique to the polD family. The kinetic assays performed in this work provide critical insight into the mechanisms that polD employs to accurately and efficiently replicate the archaeal genome. Furthermore, despite the unique properties of polD, this work suggests that a conserved polymerase kinetic pathway is present in all known DNA polymerase families. PMID:26160179

  17. Comprehensive thermodynamic analysis of 3′ double-nucleotide overhangs neighboring Watson–Crick terminal base pairs

    PubMed Central

    O'Toole, Amanda S.; Miller, Stacy; Haines, Nathan; Zink, M. Coleen; Serra, Martin J.

    2006-01-01

    Thermodynamic parameters are reported for duplex formation of 48 self-complementary RNA duplexes containing Watson–Crick terminal base pairs (GC, AU and UA) with all 16 possible 3′ double-nucleotide overhangs; mimicking the structures of short interfering RNAs (siRNA) and microRNAs (miRNA). Based on nearest-neighbor analysis, the addition of a second dangling nucleotide to a single 3′ dangling nucleotide increases stability of duplex formation up to 0.8 kcal/mol in a sequence dependent manner. Results from this study in conjunction with data from a previous study [A. S. O'Toole, S. Miller and M. J. Serra (2005) RNA, 11, 512.] allows for the development of a refined nearest-neighbor model to predict the influence of 3′ double-nucleotide overhangs on the stability of duplex formation. The model improves the prediction of free energy and melting temperature when tested against five oligomers with various core duplex sequences. Phylogenetic analysis of naturally occurring miRNAs was performed to support our results. Selection of the effector miR strand of the mature miRNA duplex appears to be dependent upon the identity of the 3′ double-nucleotide overhang. Thermodynamic parameters for 3′ single terminal overhangs adjacent to a UA pair are also presented. PMID:16820533

  18. Genetic diversity based on 28S rDNA sequences among populations of Culex quinquefasciatus collected at different locations in Tamil Nadu, India.

    PubMed

    Sakthivelkumar, S; Ramaraj, P; Veeramani, V; Janarthanan, S

    2015-09-01

    The basis of the present study was to distinguish the existence of any genetic variability among populations of Culex quinquefasciatus which would be a valuable tool in the management of mosquito control programmes. In the present study, population of Cx. quinquefasciatus collected at different locations in Tamil Nadu were analyzed for their genetic variation based on 28S rDNA D2 region nucleotide sequences. A high degree of genetic polymorphism was detected in the sequences of D2 region of 28S rDNA on the predicted secondary structures in spite of high nucleotide sequence similarity. The findings based on secondary structure using rDNA sequences suggested the existence of a complex genotypic diversity of Cx. quinquefasciatus population collected at different locations of Tamil Nadu, India. This complexity in genetic diversity in a single mosquito population collected at different locations is considered an important issue towards their influence and nature of vector potential of these mosquitoes.

  19. Genome-scale engineering of Saccharomyces cerevisiae with single-nucleotide precision.

    PubMed

    Bao, Zehua; HamediRad, Mohammad; Xue, Pu; Xiao, Han; Tasan, Ipek; Chao, Ran; Liang, Jing; Zhao, Huimin

    2018-07-01

    We developed a CRISPR-Cas9- and homology-directed-repair-assisted genome-scale engineering method named CHAnGE that can rapidly output tens of thousands of specific genetic variants in yeast. More than 98% of target sequences were efficiently edited with an average frequency of 82%. We validate the single-nucleotide resolution genome-editing capability of this technology by creating a genome-wide gene disruption collection and apply our method to improve tolerance to growth inhibitors.

  20. The chlorophyll-deficient golden leaf mutation in cucumber is due to a single nucleotide substitution in CsChlI for magnesium chelatase I subunit.

    PubMed

    Gao, Meiling; Hu, Liangliang; Li, Yuhong; Weng, Yiqun

    2016-10-01

    The cucumber chlorophyll-deficient golden leaf mutation is due to a single nucleotide substitution in the CsChlI gene for magnesium chelatase I subunit which plays important roles in the chlorophyll biosynthesis pathway. The Mg-chelatase catalyzes the insertion of Mg(2+) into the protoporphyrin IX in the chlorophyll biosynthesis pathway, which is a protein complex encompassing three subunits CHLI, CHLD, and CHLH. Chlorophyll-deficient mutations in genes encoding the three subunits have played important roles in understanding the structure, function and regulation of this important enzyme. In an EMS mutagenesis population, we identified a chlorophyll-deficient mutant C528 with golden leaf color throughout its development which was viable and able to set fruits and seeds. Segregation analysis in multiple populations indicated that this leaf color mutation was recessively inherited and the green color showed complete dominance over golden color. Map-based cloning identified CsChlI as the candidate gene for this mutation which encoded the CHLI subunit of cucumber Mg-chelatase. The 1757-bp CsChlI gene had three exons and a single nucleotide change (G to A) in its third exon resulted in an amino acid substitution (G269R) and the golden leaf color in C528. This mutation occurred in the highly conserved nucleotide-binding domain of the CHLI protein in which chlorophyll-deficient mutations have been frequently identified. The mutant phenotype, CsChlI expression pattern and the mutated residue in the CHLI protein suggested the mutant allele in C528 is unique among mutations identified so far in different species. This golden leaf mutant not only has its potential in cucumber breeding, but also provides a useful tool in understanding the CHLI function and its regulation in the chlorophyll biosynthesis pathway as well as chloroplast development.

  1. Single-nucleotide polymorphisms at the 9p21.3 genomic region not associated with the risk of cardiovascular disease in patients with rheumatoid arthritis.

    PubMed

    García-Bermúdez, M; López-Mejías, R; Genre, F; Castañeda, S; González-Juanatey, C; Llorca, J; Corrales, A; Miranda-Filloy, J A; Pina, T; Gómez-Vaquero, C; Rodríguez-Rodríguez, L; Fernández-Gutiérrez, B; Pascual-Salcedo, D; Balsa, A; López-Longo, F J; Carreira, P; Blanco, R; González-Álvaro, I; Martín, J; González-Gay, M A

    2013-12-01

    Rheumatoid arthritis (RA) is a chronic polygenic inflammatory disease associated with accelerated atherosclerosis and high risk of cardiovascular disease (CVD). In this study, we evaluated the potential association of 9p21.3 single-nucleotide polymorphisms (SNPs) - previously linked to coronary artery disease - and CVD risk in 2001 Spanish RA patients genotyped for 9p21.3 SNPs using TaqMan™ assays. Carotid intima media thickness (cIMT) and presence of carotid plaques were also analyzed. Cox regression model did not disclose significant differences between patients who experienced CVD and those who did not. Neither association was found between cIMT or carotid plaques and SNPs allele distribution. In conclusion, results do not support a role of rs10116277 or rs1537375 SNPs in CVD risk in Spanish RA patients. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Automated detection system of single nucleotide polymorphisms using two kinds of functional magnetic nanoparticles

    NASA Astrophysics Data System (ADS)

    Liu, Hongna; Li, Song; Wang, Zhifei; Li, Zhiyang; Deng, Yan; Wang, Hua; Shi, Zhiyang; He, Nongyue

    2008-11-01

    Single nucleotide polymorphisms (SNPs) comprise the most abundant source of genetic variation in the human genome wide codominant SNPs identification. Therefore, large-scale codominant SNPs identification, especially for those associated with complex diseases, has induced the need for completely high-throughput and automated SNP genotyping method. Herein, we present an automated detection system of SNPs based on two kinds of functional magnetic nanoparticles (MNPs) and dual-color hybridization. The amido-modified MNPs (NH 2-MNPs) modified with APTES were used for DNA extraction from whole blood directly by electrostatic reaction, and followed by PCR, was successfully performed. Furthermore, biotinylated PCR products were captured on the streptavidin-coated MNPs (SA-MNPs) and interrogated by hybridization with a pair of dual-color probes to determine SNP, then the genotype of each sample can be simultaneously identified by scanning the microarray printed with the denatured fluorescent probes. This system provided a rapid, sensitive and highly versatile automated procedure that will greatly facilitate the analysis of different known SNPs in human genome.

  3. [Association between single-nucleotide polymorphisms in the IRAK-4 gene and allergic rhinitis].

    PubMed

    Zhang, Yuan; Xi, Lin; Zhao, Yan-ming; Zhao, Li-ping; Zhang, Luo

    2012-06-01

    To investigate the genetic association pattern between single-nucleotide polymorphisms (SNP) in the interleukin-1 receptor-associated kinase 4 (IRAK-4) gene and allergic rhinitis (AR). A population of 379 patients with the diagnosis of AR and 333 healthy controls who lived in Beijing region was recruited. A total of 8 reprehensive marker SNP which were in IRAK-4 gene region were selected according to the Beijing people database from Hapmap website. The individual genotyping was performed by MassARRAY platform. SPSS 13.0 software was used for statistic analysis. Subgroup analysis for the presence of different allergen sensitivities displayed associations only in the house dust mite-allergic cohorts (rs3794262: P = 0.0034, OR = 1.7388; rs4251481: P = 0.0023, OR = 2.6593), but not in subjects who were allergic to pollens as well as mix allergens. The potential genetic contribution of the IRAK-4 gene to AR demonstrated an allergen-dependant association pattern in Chinese population.

  4. Artemisinin resistance-associated polymorphisms at the K13-propeller locus are absent in Plasmodium falciparum isolates from Haiti.

    PubMed

    Carter, Tamar E; Boulter, Alexis; Existe, Alexandre; Romain, Jean R; St Victor, Jean Yves; Mulligan, Connie J; Okech, Bernard A

    2015-03-01

    Antimalarial drugs are a key tool in malaria elimination programs. With the emergence of artemisinin resistance in southeast Asia, an effort to identify molecular markers for surveillance of resistant malaria parasites is underway. Non-synonymous mutations in the kelch propeller domain (K13-propeller) in Plasmodium falciparum have been associated with artemisinin resistance in samples from southeast Asia, but additional studies are needed to characterize this locus in other P. falciparum populations with different levels of artemisinin use. Here, we sequenced the K13-propeller locus in 82 samples from Haiti, where limited government oversight of non-governmental organizations may have resulted in low-level use of artemisinin-based combination therapies. We detected a single-nucleotide polymorphism (SNP) at nucleotide 1,359 in a single isolate. Our results contribute to our understanding of the global genomic diversity of the K13-propeller locus in P. falciparum populations. © The American Society of Tropical Medicine and Hygiene.

  5. High-throughput multiplex HLA-typing by ligase detection reaction (LDR) and universal array (UA) approach.

    PubMed

    Consolandi, Clarissa

    2009-01-01

    One major goal of genetic research is to understand the role of genetic variation in living systems. In humans, by far the most common type of such variation involves differences in single DNA nucleotides, and is thus termed single nucleotide polymorphism (SNP). The need for improvement in throughput and reliability of traditional techniques makes it necessary to develop new technologies. Thus the past few years have witnessed an extraordinary surge of interest in DNA microarray technology. This new technology offers the first great hope for providing a systematic way to explore the genome. It permits a very rapid analysis of thousands genes for the purpose of gene discovery, sequencing, mapping, expression, and polymorphism detection. We generated a series of analytical tools to address the manufacturing, detection and data analysis components of a microarray experiment. In particular, we set up a universal array approach in combination with a PCR-LDR (polymerase chain reaction-ligation detection reaction) strategy for allele identification in the HLA gene.

  6. DNA Three-Way Junction for Differentiation of Single-Nucleotide Polymorphisms with Fluorescent Copper Nanoparticles.

    PubMed

    Sun, Feifei; You, Ying; Liu, Jie; Song, Quanwei; Shen, Xiaotong; Na, Na; Ouyang, Jin

    2017-05-23

    A label- and enzyme-free fluorescent sensor for the detection of single-nucleotide polymorphisms (SNPs) at room temperature is proposed, using new copper nanoparticles (CuNPs) as fluorescent reporters. The CuNPs were constructed by using a DNA three-way junction (3WJ) template. In this assay, two complementary adenine/thymine-rich probes can hybridize with the wild-type target simultaneously to construct a 3WJ structure, serving as an efficient scaffold for the generation of CuNPs. However, the CuNPs produce weak fluorescence when the probes bind with a mutant-type target. SNPs can be identified by the difference in fluorescence intensity of the CuNPs. This SNPs detection strategy is straightforward, cost-effective, and avoids the complicated procedures of labeling or enzymatic reactions. The fluorescent sensor is versatile and can be applied to all types of mutation because the probes are programmable. Moreover, the sensor exhibits good detection performance in biological samples. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. An atypical CNG channel activated by a single cGMP molecule controls sperm chemotaxis.

    PubMed

    Bönigk, Wolfgang; Loogen, Astrid; Seifert, Reinhard; Kashikar, Nachiket; Klemm, Clementine; Krause, Eberhard; Hagen, Volker; Kremmer, Elisabeth; Strünker, Timo; Kaupp, U Benjamin

    2009-10-27

    Sperm of the sea urchin Arbacia punctulata can respond to a single molecule of chemoattractant released by an egg. The mechanism underlying this extreme sensitivity is unknown. Crucial signaling events in the response of A. punctulata sperm to chemoattractant include the rapid synthesis of the intracellular messenger guanosine 3',5'-monophosphate (cGMP) and the ensuing membrane hyperpolarization that results from the opening of potassium-selective cyclic nucleotide-gated (CNGK) channels. Here, we use calibrated photolysis of caged cGMP to show that approximately 45 cGMP molecules are generated during the response to a single molecule of chemoattractant. The CNGK channel can respond to such small cGMP changes because it is exquisitely sensitive to cGMP and activated in a noncooperative fashion. Like voltage-activated Ca(v) and Na(v) channels, the CNGK polypeptide consists of four homologous repeat sequences. Disabling each of the four cyclic nucleotide-binding sites through mutagenesis revealed that binding of a single cGMP molecule to repeat 3 is necessary and sufficient to activate the CNGK channel. Thus, CNGK has developed a mechanism of activation that is different from the activation of other CNG channels, which requires the cooperative binding of several ligands and operates in the micromolar rather than the nanomolar range.

  8. Single nucleotide polymorphism (SNP) discovery in duplicated genomes: intron-primed exon-crossing (IPEC) as a strategy for avoiding amplification of duplicated loci in Atlantic salmon (Salmo salar) and other salmonid fishes

    PubMed Central

    Ryynänen, Heikki J; Primmer, Craig R

    2006-01-01

    Background Single nucleotide polymorphisms (SNPs) represent the most abundant type of DNA variation in the vertebrate genome, and their applications as genetic markers in numerous studies of molecular ecology and conservation of natural populations are emerging. Recent large-scale sequencing projects in several fish species have provided a vast amount of data in public databases, which can be utilized in novel SNP discovery in salmonids. However, the suggested duplicated nature of the salmonid genome may hamper SNP characterization if the primers designed in conserved gene regions amplify multiple loci. Results Here we introduce a new intron-primed exon-crossing (IPEC) method in an attempt to overcome this duplication problem, and also evaluate different priming methods for SNP discovery in Atlantic salmon (Salmo salar) and other salmonids. A total of 69 loci with differing priming strategies were screened in S. salar, and 27 of these produced ~13 kb of high-quality sequence data consisting of 19 SNPs or indels (one per 680 bp). The SNP frequency and the overall nucleotide diversity (3.99 × 10-4) in S. salar was lower than reported in a majority of other organisms, which may suggest a relative young population history for Atlantic salmon. A subset of primers used in cross-species analyses revealed considerable variation in the SNP frequencies and nucleotide diversities in other salmonids. Conclusion Sequencing success was significantly higher with the new IPEC primers; thus the total number of loci to screen in order to identify one potential polymorphic site was six times less with this new strategy. Given that duplication may hamper SNP discovery in some species, the IPEC method reported here is an alternative way of identifying novel polymorphisms in such cases. PMID:16872523

  9. Equalizer reduces SNP bias in Affymetrix microarrays.

    PubMed

    Quigley, David

    2015-07-30

    Gene expression microarrays measure the levels of messenger ribonucleic acid (mRNA) in a sample using probe sequences that hybridize with transcribed regions. These probe sequences are designed using a reference genome for the relevant species. However, most model organisms and all humans have genomes that deviate from their reference. These variations, which include single nucleotide polymorphisms, insertions of additional nucleotides, and nucleotide deletions, can affect the microarray's performance. Genetic experiments comparing individuals bearing different population-associated single nucleotide polymorphisms that intersect microarray probes are therefore subject to systemic bias, as the reduction in binding efficiency due to a technical artifact is confounded with genetic differences between parental strains. This problem has been recognized for some time, and earlier methods of compensation have attempted to identify probes affected by genome variants using statistical models. These methods may require replicate microarray measurement of gene expression in the relevant tissue in inbred parental samples, which are not always available in model organisms and are never available in humans. By using sequence information for the genomes of organisms under investigation, potentially problematic probes can now be identified a priori. However, there is no published software tool that makes it easy to eliminate these probes from an annotation. I present equalizer, a software package that uses genome variant data to modify annotation files for the commonly used Affymetrix IVT and Gene/Exon platforms. These files can be used by any microarray normalization method for subsequent analysis. I demonstrate how use of equalizer on experiments mapping germline influence on gene expression in a genetic cross between two divergent mouse species and in human samples significantly reduces probe hybridization-induced bias, reducing false positive and false negative findings. The equalizer package reduces probe hybridization bias from experiments performed on the Affymetrix microarray platform, allowing accurate assessment of germline influence on gene expression.

  10. Single nucleotide polymorphisms in the bovine Histophilus somni genome; a comparison of new and old isolates.

    PubMed

    Madampage, Claudia Avis; Rawlyk, Neil; Crockford, Gordon; Van Donkersgoed, Joyce; Dorin, Craig; Potter, Andrew

    2015-07-01

    Histophilus somni, a causative agent of the bovine respiratory disease complex, can also cause a variety of systemic disorders, including bronchopneumonia, myocarditis, pericarditis, arthritis, pleuritis, and infectious thrombotic meningoencephalitis. The purpose of this study was to determine if currently circulating strains differ from those of the 1980s by identifying genomic changes. Single nucleotide polymorphisms (SNPs) and insertion and deletion (INDEL) sites were examined by whole-genome sequencing in 12 samples, 6 old and 6 new. The 31 028 SNP/INDELs recorded were compared against the reference genome sequence of the pathogenic H. somni strain 2336. The distribution of about 75% of these SNPs within a specified gene differed between old and new isolates and did not follow any particular pattern. The other 25% clustered into 2 groups containing the same SNPs in various genes: group I included 5 old isolates and 1 new isolate; group II included 5 new isolates and 1 old isolate. For putative virulence genes there were more SNPs in group I compared with strain 2336, itself an older isolate, than in group II. Although only 25% of all the SNPs formed 2 clusters, the results suggest some genetic difference in various genes between old and new strains.

  11. Single nucleotide polymorphisms in the bovine Histophilus somni genome; a comparison of new and old isolates

    PubMed Central

    Madampage, Claudia Avis; Rawlyk, Neil; Crockford, Gordon; Van Donkersgoed, Joyce; Dorin, Craig; Potter, Andrew

    2015-01-01

    Histophilus somni, a causative agent of the bovine respiratory disease complex, can also cause a variety of systemic disorders, including bronchopneumonia, myocarditis, pericarditis, arthritis, pleuritis, and infectious thrombotic meningoencephalitis. The purpose of this study was to determine if currently circulating strains differ from those of the 1980s by identifying genomic changes. Single nucleotide polymorphisms (SNPs) and insertion and deletion (INDEL) sites were examined by whole-genome sequencing in 12 samples, 6 old and 6 new. The 31 028 SNP/INDELs recorded were compared against the reference genome sequence of the pathogenic H. somni strain 2336. The distribution of about 75% of these SNPs within a specified gene differed between old and new isolates and did not follow any particular pattern. The other 25% clustered into 2 groups containing the same SNPs in various genes: group I included 5 old isolates and 1 new isolate; group II included 5 new isolates and 1 old isolate. For putative virulence genes there were more SNPs in group I compared with strain 2336, itself an older isolate, than in group II. Although only 25% of all the SNPs formed 2 clusters, the results suggest some genetic difference in various genes between old and new strains. PMID:26130851

  12. Single nucleotide primer extension (SNuPE) analysis of the G6PD gene in somatic cells and oocytes of a kangaroo (Macropus robustus).

    PubMed

    Watson, D; Jacombs, A S; Loebel, D A; Robinson, E S; Johnston, P G

    2000-06-01

    cDNA sequence analysis of the X-linked glucose-6-phosphate dehydrogenase (G6PD) gene has shown a base difference between two subspecies of the kangaroo, Macropus robustus robustus (wallaroo) and M. r. erubescens (euro). A thymine residue in the wallaroo at position 358 in exon 5 has been replaced by a cytosine residue in the euro, which accounts for the previously reported electrophoretic difference between the two subspecies. This base difference allowed use of the Single Nucleotide Primer Extension (SNuPE) technique to study allele-specific expression of G6PD at the transcriptional level. We began by examining G6PD expression in somatic cells and observed complete paternal X inactivation in all somatic tissues of adult female heterozygotes, whereas we found partial paternal allele activity in cultured fibroblasts, thus confirming previous allozyme electrophoresis studies. In late dictyate oocytes from an adult heterozygote, the assay also detected expression of both the maternal and paternal alleles at the G6PD locus, with the maternal allele showing preferential expression. Thus reactivation of the inactive paternally derived X chromosome occurs during oogenesis in M. robustus, although the exact timing of reactivation remains to be determined.

  13. Unraveling the complexity of the interactions of DNA nucleotides with gold by single molecule force spectroscopy

    NASA Astrophysics Data System (ADS)

    Bano, Fouzia; Sluysmans, Damien; Wislez, Arnaud; Duwez, Anne-Sophie

    2015-11-01

    Addressing the effect of different environmental factors on the adsorption of DNA to solid supports is critical for the development of robust miniaturized devices for applications ranging from biosensors to next generation molecular technology. Most of the time, thiol-based chemistry is used to anchor DNA on gold - a substrate commonly used in nanotechnology - and little is known about the direct interaction between DNA and gold. So far there have been no systematic studies on the direct adsorption behavior of the deoxyribonucleotides (i.e., a nitrogenous base, a deoxyribose sugar, and a phosphate group) and on the factors that govern the DNA-gold bond strength. Here, using single molecule force spectroscopy, we investigated the interaction of the four individual nucleotides, adenine, guanine, cytosine, and thymine, with gold. Experiments were performed in three salinity conditions and two surface dwell times to reveal the factors that influence nucleotide-Au bond strength. Force data show that, at physiological ionic strength, adenine-Au interactions are stronger, asymmetrical and independent of surface dwell time as compared to cytosine-Au and guanine-Au interactions. We suggest that in these conditions only adenine is able to chemisorb on gold. A decrease of the ionic strength significantly increases the bond strength for all nucleotides. We show that moderate ionic strength along with longer surface dwell period suggest weak chemisorption also for cytosine and guanine.Addressing the effect of different environmental factors on the adsorption of DNA to solid supports is critical for the development of robust miniaturized devices for applications ranging from biosensors to next generation molecular technology. Most of the time, thiol-based chemistry is used to anchor DNA on gold - a substrate commonly used in nanotechnology - and little is known about the direct interaction between DNA and gold. So far there have been no systematic studies on the direct adsorption behavior of the deoxyribonucleotides (i.e., a nitrogenous base, a deoxyribose sugar, and a phosphate group) and on the factors that govern the DNA-gold bond strength. Here, using single molecule force spectroscopy, we investigated the interaction of the four individual nucleotides, adenine, guanine, cytosine, and thymine, with gold. Experiments were performed in three salinity conditions and two surface dwell times to reveal the factors that influence nucleotide-Au bond strength. Force data show that, at physiological ionic strength, adenine-Au interactions are stronger, asymmetrical and independent of surface dwell time as compared to cytosine-Au and guanine-Au interactions. We suggest that in these conditions only adenine is able to chemisorb on gold. A decrease of the ionic strength significantly increases the bond strength for all nucleotides. We show that moderate ionic strength along with longer surface dwell period suggest weak chemisorption also for cytosine and guanine. Electronic supplementary information (ESI) available: Details of the data analysis; Fig. S1-S5 histograms of rupture lengths; histograms for Au-adenine and Au-amine interactions; Force-extension curve for MCH-Au interactions; normalized force-extension curves; theoretical length of the DNA oligomers. See DOI: 10.1039/c5nr05695k

  14. Melting analysis on microbeads in rapid temperature-gradient inside microchannels for single nucleotide polymorphisms detectiona)

    PubMed Central

    Li, Kan-Chien; Ding, Shih-Torng; Lin, En-Chung; Wang, Lon (Alex); Lu, Yen-Wen

    2014-01-01

    A continuous-flow microchip with a temperature gradient in microchannels was utilized to demonstrate spatial melting analysis on microbeads for clinical Single Nucleotide Polymorphisms (SNPs) genotyping on animal genomic DNA. The chip had embedded heaters and thermometers, which created a rapid and yet stable temperature gradient between 60 °C and 85 °C in a short distance as the detection region. The microbeads, which served as mobile supports carrying the target DNA and fluorescent dye, were transported across the temperature gradient. As the surrounding temperature increased, the fluorescence signals of the microbeads decayed with this relationship being acquired as the melting curve. Fast DNA denaturation, as a result of the improved heat transfer and thermal stability due to scaling, was also confirmed. Further, each individual microbead could potentially bear different sequences and pass through the detection region, one by one, for a series of melting analysis, with multiplex, high-throughput capability being possible. A prototype was tested with target DNA samples in different genotypes (i.e., wild and mutant types) with a SNP location from Landrace sows. The melting temperatures were obtained and compared to the ones using a traditional tube-based approach. The results showed similar levels of SNP discrimination, validating our proposed technique for scanning homozygotes and heterozygotes to distinguish single base changes for disease research, drug development, medical diagnostics, agriculture, and animal production. PMID:25553186

  15. Associations between Vocal Symptoms and Genetic Variants in the Oxytocin Receptor and Arginine Vasopressin 1A Receptor Gene

    ERIC Educational Resources Information Center

    Jämsen, Sofia Holmqvist; Johansson, Ada; Westberg, Lars; Santtila, Pekka; von der Pahlen, Bettina; Simberg, Susanna

    2017-01-01

    Purpose: Oxytocin and arginine vasopressin are associated with different aspects of the stress response. As stress is regarded as a risk factor for vocal symptoms, we wanted to explore the association between the oxytocin receptor gene ("OXTR") and arginine vasopressin 1A receptor gene ("AVPR1A") single-nucleotide polymorphisms…

  16. Differences in circadian rhythmicity in CLOCK 3111T/C genetic variants in moderate obese women as assessed by thermometry, actimetry and body position

    USDA-ARS?s Scientific Manuscript database

    Genetics is behind our circadian machinery. CLOCK (Circadian Locomotor Output Cycles Kaput) 3111T/C single-nucleotide polymorphism (SNP) has been previously related to obesity and weight loss. However, phenotypic association and functionality of CLOCK 3111 locus is still unknown. The aim of this stu...

  17. Genome-wide copy number variant analysis in Holstein cattle reveals variants associated with 10 production traits including residual feed intake and dry matter intake

    USDA-ARS?s Scientific Manuscript database

    Copy number variation (CNV) is an important type of genetic variation contributing to phenotypic differences among mammals and may serve as an alternative molecular marker to single nucleotide polymorphism (SNP) for genome-wide association study (GWAS). Recently, GWAS analysis using CNV has been app...

  18. Genetic variation of coat protein gene among the isolates of Rice tungro spherical virus from tungro-endemic states of the India.

    PubMed

    Mangrauthia, Satendra K; Malathi, P; Agarwal, Surekha; Ramkumar, G; Krishnaveni, D; Neeraja, C N; Madhav, M Sheshu; Ladhalakshmi, D; Balachandran, S M; Viraktamath, B C

    2012-06-01

    Rice tungro disease, one of the major constraints to rice production in South and Southeast Asia, is caused by a combination of two viruses: Rice tungro spherical virus (RTSV) and Rice tungro bacilliform virus (RTBV). The present study was undertaken to determine the genetic variation of RTSV population present in tungro endemic states of Indian subcontinent. Phylogenetic analysis based on coat protein sequences showed distinct divergence of Indian RTSV isolates into two groups; one consisted isolates from Hyderabad (Andhra Pradesh), Cuttack (Orissa), and Puducherry and another from West Bengal, Coimbatore (Tamil Nadu), and Kanyakumari (Tamil Nadu). The results obtained from phylogenetic study were further supported with the SNPs (single nucleotide polymorphism), INDELs (insertion and deletion) and evolutionary distance analysis. In addition, sequence difference count matrix revealed 2-68 nucleotides differences among all the Indian RTSV isolates taken in this study. However, at the protein level these differences were not significant as revealed by Ka/Ks ratio calculation. Sequence identity at nucleotide and amino acid level was 92-100% and 97-100%, respectively, among Indian isolates of RTSV. Understanding of the population structure of RTSV from tungro endemic regions of India would potentially provide insights into the molecular diversification of this virus.

  19. Paclitaxel sensitivity in relation to ABCB1 expression, efflux and single nucleotide polymorphisms in ovarian cancer.

    PubMed

    Gao, Bo; Russell, Amanda; Beesley, Jonathan; Chen, Xiao Qing; Healey, Sue; Henderson, Michelle; Wong, Mark; Emmanuel, Catherine; Galletta, Laura; Johnatty, Sharon E; Bowtell, David; Haber, Michelle; Norris, Murray; Harnett, Paul; Chenevix-Trench, Georgia; Balleine, Rosemary L; deFazio, Anna

    2014-05-09

    ABCB1 (adenosine triphosphate-binding cassette transporter B1) mediates cellular elimination of many chemotherapeutic agents including paclitaxel, which is commonly used to treat ovarian cancer. A significant association between common single nucleotide polymorphisms (SNPs) in ABCB1 and progression-free survival has been reported in patients with ovarian cancer. Variable paclitaxel clearance due to genotype specific differences in ABCB1 activity in cancer cells and/or normal tissues may underlie the association. Using cell-based models, we evaluated the correlations between ABCB1 expression, polymorphisms, transporter activity and paclitaxel sensitivity in ovarian cancer (n = 10) and lymphoblastoid (n = 19) cell lines. Close associations between ABCB1 expression, transporter function and paclitaxel sensitivity were found in lymphoblastoid cell lines, although we could not demonstrate an association with common SNPs. In ovarian cancer cell lines, ABCB1 expression was low and the association between expression and function was lost. These results suggest that ABCB1 related survival difference in ovarian cancer patients is more likely to be due to differential whole body paclitaxel clearance mediated by normal cells rather than a direct effect on cancer cells.

  20. [Relationship of Ghrelin gene polymorphism with congenital anorectal malformation and Hirschsprung disease].

    PubMed

    Gao, Hong; Wang, Dajia; Zhao, Xiangxuan; Mi, Jie; Bai, Yuzuo; Wang, Weilin

    2015-07-01

    To explore the relationship of Ghrelin gene polymorphism with the occurrence of human anorectal malformations (ARMs) and Hirschsprung disease(HSCR). PCR and DNA sequencing were used to detect the single nucleotide polymorphism (SNPs) of 3 loci (rs139684563, rs149447194, rs186599567) genotype of Ghrelin gene in 100 children with ARMs, 100 children with HSCR, and 100 healthy children (normal group). Genovariation and gene mutation were analyzed with case-control method. Three loci SNPs were in accordance with Hardy-Weinberg genetic equilibrium. No significant differences were found in rs139684563 allele and genotype frequencies between the cases and the normal groups (P>0.05). The allele and genotype frequencies of rs149447194 and rs186599567 were significantly different between cases and normal group (P<0.05). DNA sequencing results showed that wild-type homozygous deletion (176th and 191th base A deletion, respectively) were found in rs149447194 and rs186599567of ARMs and HSCR children, and single base substitution was detected in rs149447194 of ARMs children (194th codon nucleotide CCT to CTC). The rs149447194 and the rs186599567 polymorphism changes may be associated with the pathogenesis of ARMs and HSCR.

  1. Genomic variation and DNA repair associated with soybean transgenesis: a comparison to cultivars and mutagenized plants.

    PubMed

    Anderson, Justin E; Michno, Jean-Michel; Kono, Thomas J Y; Stec, Adrian O; Campbell, Benjamin W; Curtin, Shaun J; Stupar, Robert M

    2016-05-12

    The safety of mutagenized and genetically transformed plants remains a subject of scrutiny. Data gathered and communicated on the phenotypic and molecular variation induced by gene transfer technologies will provide a scientific-based means to rationally address such concerns. In this study, genomic structural variation (e.g. large deletions and duplications) and single nucleotide polymorphism rates were assessed among a sample of soybean cultivars, fast neutron-derived mutants, and five genetically transformed plants developed through Agrobacterium based transformation methods. On average, the number of genes affected by structural variations in transgenic plants was one order of magnitude less than that of fast neutron mutants and two orders of magnitude less than the rates observed between cultivars. Structural variants in transgenic plants, while rare, occurred adjacent to the transgenes, and at unlinked loci on different chromosomes. DNA repair junctions at both transgenic and unlinked sites were consistent with sequence microhomology across breakpoints. The single nucleotide substitution rates were modest in both fast neutron and transformed plants, exhibiting fewer than 100 substitutions genome-wide, while inter-cultivar comparisons identified over one-million single nucleotide polymorphisms. Overall, these patterns provide a fresh perspective on the genomic variation associated with high-energy induced mutagenesis and genetically transformed plants. The genetic transformation process infrequently results in novel genetic variation and these rare events are analogous to genetic variants occurring spontaneously, already present in the existing germplasm, or induced through other types of mutagenesis. It remains unclear how broadly these results can be applied to other crops or transformation methods.

  2. A Family-Based Association Study of CYP11A1 and CYP11B1 Gene Polymorphisms With Autism in Chinese Trios.

    PubMed

    Deng, Hong-Zhu; You, Cong; Xing, Yu; Chen, Kai-Yun; Zou, Xiao-Bing

    2016-05-01

    Autism spectrum disorder is a group of neurodevelopmental disorders with the higher prevalence in males. Our previous studies have indicated lower progesterone levels in the children with autism spectrum disorder, suggesting involvement of the cytochrome P-450scc gene (CYP11A1) and cytochrome P-45011beta gene (CYP11B1) as candidate genes in autism spectrum disorder. The aim of this study was to investigate the family-based genetic association between single-nucleotide polymorphisms, rs2279357 in the CYP11A1 gene and rs4534 and rs4541 in the CYP11B1 gene and autism spectrum disorder in Chinese children, which were selected according to the location in the coding region and 5' and 3' regions and minor allele frequencies of greater than 0.05 in the Chinese populations. The transmission disequilibrium test and case-control association analyses were performed in 100 Chinese Han autism spectrum disorder family trios. The genotype and allele frequency of the 3 single-nucleotide polymorphisms had no statistical difference between the children with autism spectrum disorder and their parents (P> .05). Transmission disequilibrium test analysis showed transmission disequilibrium of CYP11A1 gene rs2279357 single-nucleotide polymorphisms (χ(2)= 5.038,P< .001). Our findings provide further support for the hypothesis that a susceptibility gene for autism spectrum disorder exists within or near the CYP11A1 gene in the Han Chinese population. © The Author(s) 2015.

  3. Inactivation of SAM-Methyltransferase is the Mechanism of Attenuation of a Historic Louse Borne Typhus Vaccine Strain

    PubMed Central

    Liu, Yan; Wu, Bin; Weinstock, George; Walker, David H.; Yu, Xue-jie

    2014-01-01

    Louse borne typhus (also called epidemic typhus) was one of man's major scourges, and epidemics of the disease can be reignited when social, economic, or political systems are disrupted. The fear of a bioterrorist attack using the etiologic agent of typhus, Rickettsia prowazekii, was a reality. An attenuated typhus vaccine, R. prowazekii Madrid E strain, was observed to revert to virulence as demonstrated by isolation of the virulent revertant Evir strain from animals which were inoculated with Madrid E strain. The mechanism of the mutation in R. prowazekii that affects the virulence of the vaccine was not known. We sequenced the genome of the virulent revertant Evir strain and compared its genome sequence with the genome sequences of its parental strain, Madrid E. We found that only a single nucleotide in the entire genome was different between the vaccine strain Madrid E and its virulent revertant strain Evir. The mutation is a single nucleotide insertion in the methyltransferase gene (also known as PR028) in the vaccine strain that inactivated the gene. We also confirmed that the vaccine strain E did not cause fever in guinea pigs and the virulent revertant strain Evir caused fever in guinea pigs. We concluded that a single nucleotide insertion in the methyltransferase gene of R. prowazekii attenuated the R. prowazekii vaccine strain E. This suggested that an irreversible insertion or deletion mutation in the methyl transferase gene of R. prowazekii is required for Madrid E to be considered a safe vaccine. PMID:25412248

  4. Inactivation of SAM-methyltransferase is the mechanism of attenuation of a historic louse borne typhus vaccine strain.

    PubMed

    Liu, Yan; Wu, Bin; Weinstock, George; Walker, David H; Yu, Xue-Jie

    2014-01-01

    Louse borne typhus (also called epidemic typhus) was one of man's major scourges, and epidemics of the disease can be reignited when social, economic, or political systems are disrupted. The fear of a bioterrorist attack using the etiologic agent of typhus, Rickettsia prowazekii, was a reality. An attenuated typhus vaccine, R. prowazekii Madrid E strain, was observed to revert to virulence as demonstrated by isolation of the virulent revertant Evir strain from animals which were inoculated with Madrid E strain. The mechanism of the mutation in R. prowazekii that affects the virulence of the vaccine was not known. We sequenced the genome of the virulent revertant Evir strain and compared its genome sequence with the genome sequences of its parental strain, Madrid E. We found that only a single nucleotide in the entire genome was different between the vaccine strain Madrid E and its virulent revertant strain Evir. The mutation is a single nucleotide insertion in the methyltransferase gene (also known as PR028) in the vaccine strain that inactivated the gene. We also confirmed that the vaccine strain E did not cause fever in guinea pigs and the virulent revertant strain Evir caused fever in guinea pigs. We concluded that a single nucleotide insertion in the methyltransferase gene of R. prowazekii attenuated the R. prowazekii vaccine strain E. This suggested that an irreversible insertion or deletion mutation in the methyl transferase gene of R. prowazekii is required for Madrid E to be considered a safe vaccine.

  5. Asymmetric structure of five and six membered DNA hairpin loops

    NASA Technical Reports Server (NTRS)

    Baumann, U.; Chang, S.

    1995-01-01

    The tertiary structure of nucleic acid hairpins was elucidated by means of the accessibility of the single-strand-specific nuclease from mung bean. This molecular probe has proven especially useful in determining details of the structural arrangement of the nucleotides within a loop. In this study 3'-labeling is introduced to complement previously used 5'-labeling in order to assess and to exclude possible artifacts of the method. Both labeling procedures result in mutually consistent cleavage patterns. Therefore, methodological artifacts can be excluded and the potential of the nuclease as structural probe is increased. DNA hairpins with five and six membered loops reveal an asymmetric loop structure with a sharp bend of the phosphate-ribose backbone between the second and third nucleotide on the 3'-side of a loop. These hairpin structures differ from smaller loops with 3 or 4 members, which reveal this type of bend between the first and second 3' nucleotide, and resemble with respect to the asymmetry anticodon loops of tRNA.

  6. Genome characterization of Turkey Rotavirus G strains from the United States identifies potential recombination events with human Rotavirus B strains.

    PubMed

    Chen, Fangzhou; Knutson, Todd P; Porter, Robert E; Ciarlet, Max; Mor, Sunil Kumar; Marthaler, Douglas G

    2017-12-01

    Rotavirus G (RVG) strains have been detected in a variety of avian species, but RVG genomes have been published from only a single pigeon and two chicken strains. Two turkey RVG strains were identified and characterized, one in a hatchery with no reported health issues and the other in a hatchery with high embryo/poult mortality. The two turkey RVG strains shared only an 85.3 % nucleotide sequence identity in the VP7 gene while the other genes possessed high nucleotide identity among them (96.3-99.9 %). Low nucleotide percentage identities (31.6-87.3 %) occurred among the pigeon and chicken RVG strains. Interestingly, potential recombination events were detected between our RVG strains and a human RVB strain, in the VP6 and NSP3 segments. The epidemiology of RVG in avian flocks and the pathogenicity of the two different RVG strains should be further investigated to understand the ecology and impact of RVG in commercial poultry flocks.

  7. Single-nucleotide polymorphisms associated with symptomatic infection and differential human gene expression in healthy seropositive persons each implicate the cytoskeleton, integrin signaling, and oncosuppression in the pathogenesis of human parvovirus B19 infection.

    PubMed

    Kerr, Jonathan R; Kaushik, Narendra; Fear, David; Baldwin, Don A; Nuwaysir, Emile F; Adcock, Ian M

    2005-07-15

    This study was undertaken to further examine the role of the host response to parvovirus B19 in the development of symptoms and consequences of viral persistence. Genomic DNA from 42 patients with symptomatic B19 infection was analyzed using the HuSNP assay (Affymetrix), and the results were compared with those from analysis of 53 healthy control individuals. Fifty-seven single-nucleotide polymorphisms were identified that were significantly associated with symptomatic infection. Total RNA from peripheral blood mononuclear cells from 57 B19-seropositive and 13 B19-seronegative donors was analyzed by hybridization to a single-color microarray representing 9522 human genes. Ninety-two genes were shown to be differentially expressed. Differential expression was confirmed in 6 of 38 genes (SKIP, MACF1, SPAG7, FLOT1, c6orf48, and RASSF5) tested using real-time quantitative polymerase chain reaction in a different group of healthy subjects. Genes identified in both studies play a functional role in the cytoskeleton, integrin signaling, and oncosuppression, themes that have been shown to be important in parvovirus infections.

  8. Novel applications of array comparative genomic hybridization in molecular diagnostics.

    PubMed

    Cheung, Sau W; Bi, Weimin

    2018-05-31

    In 2004, the implementation of array comparative genomic hybridization (array comparative genome hybridization [CGH]) into clinical practice marked a new milestone for genetic diagnosis. Array CGH and single-nucleotide polymorphism (SNP) arrays enable genome-wide detection of copy number changes in a high resolution, and therefore microarray has been recognized as the first-tier test for patients with intellectual disability or multiple congenital anomalies, and has also been applied prenatally for detection of clinically relevant copy number variations in the fetus. Area covered: In this review, the authors summarize the evolution of array CGH technology from their diagnostic laboratory, highlighting exonic SNP arrays developed in the past decade which detect small intragenic copy number changes as well as large DNA segments for the region of heterozygosity. The applications of array CGH to human diseases with different modes of inheritance with the emphasis on autosomal recessive disorders are discussed. Expert commentary: An exonic array is a powerful and most efficient clinical tool in detecting genome wide small copy number variants in both dominant and recessive disorders. However, whole-genome sequencing may become the single integrated platform for detection of copy number changes, single-nucleotide changes as well as balanced chromosomal rearrangements in the near future.

  9. Heat-transfer resistance at solid-liquid interfaces: a tool for the detection of single-nucleotide polymorphisms in DNA.

    PubMed

    van Grinsven, Bart; Vanden Bon, Natalie; Strauven, Hannelore; Grieten, Lars; Murib, Mohammed; Monroy, Kathia L Jiménez; Janssens, Stoffel D; Haenen, Ken; Schöning, Michael J; Vermeeren, Veronique; Ameloot, Marcel; Michiels, Luc; Thoelen, Ronald; De Ceuninck, Ward; Wagner, Patrick

    2012-03-27

    In this article, we report on the heat-transfer resistance at interfaces as a novel, denaturation-based method to detect single-nucleotide polymorphisms in DNA. We observed that a molecular brush of double-stranded DNA grafted onto synthetic diamond surfaces does not notably affect the heat-transfer resistance at the solid-to-liquid interface. In contrast to this, molecular brushes of single-stranded DNA cause, surprisingly, a substantially higher heat-transfer resistance and behave like a thermally insulating layer. This effect can be utilized to identify ds-DNA melting temperatures via the switching from low- to high heat-transfer resistance. The melting temperatures identified with this method for different DNA duplexes (29 base pairs without and with built-in mutations) correlate nicely with data calculated by modeling. The method is fast, label-free (without the need for fluorescent or radioactive markers), allows for repetitive measurements, and can also be extended toward array formats. Reference measurements by confocal fluorescence microscopy and impedance spectroscopy confirm that the switching of heat-transfer resistance upon denaturation is indeed related to the thermal on-chip denaturation of DNA. © 2012 American Chemical Society

  10. Demonstration of Protein-Based Human Identification Using the Hair Shaft Proteome

    PubMed Central

    Leppert, Tami; Anex, Deon S.; Hilmer, Jonathan K.; Matsunami, Nori; Baird, Lisa; Stevens, Jeffery; Parsawar, Krishna; Durbin-Johnson, Blythe P.; Rocke, David M.; Nelson, Chad; Fairbanks, Daniel J.; Wilson, Andrew S.; Rice, Robert H.; Woodward, Scott R.; Bothner, Brian; Hart, Bradley R.; Leppert, Mark

    2016-01-01

    Human identification from biological material is largely dependent on the ability to characterize genetic polymorphisms in DNA. Unfortunately, DNA can degrade in the environment, sometimes below the level at which it can be amplified by PCR. Protein however is chemically more robust than DNA and can persist for longer periods. Protein also contains genetic variation in the form of single amino acid polymorphisms. These can be used to infer the status of non-synonymous single nucleotide polymorphism alleles. To demonstrate this, we used mass spectrometry-based shotgun proteomics to characterize hair shaft proteins in 66 European-American subjects. A total of 596 single nucleotide polymorphism alleles were correctly imputed in 32 loci from 22 genes of subjects’ DNA and directly validated using Sanger sequencing. Estimates of the probability of resulting individual non-synonymous single nucleotide polymorphism allelic profiles in the European population, using the product rule, resulted in a maximum power of discrimination of 1 in 12,500. Imputed non-synonymous single nucleotide polymorphism profiles from European–American subjects were considerably less frequent in the African population (maximum likelihood ratio = 11,000). The converse was true for hair shafts collected from an additional 10 subjects with African ancestry, where some profiles were more frequent in the African population. Genetically variant peptides were also identified in hair shaft datasets from six archaeological skeletal remains (up to 260 years old). This study demonstrates that quantifiable measures of identity discrimination and biogeographic background can be obtained from detecting genetically variant peptides in hair shaft protein, including hair from bioarchaeological contexts. PMID:27603779

  11. Recombination-dependent replication and gene conversion homogenize repeat sequences and diversify plastid genome structure.

    PubMed

    Ruhlman, Tracey A; Zhang, Jin; Blazier, John C; Sabir, Jamal S M; Jansen, Robert K

    2017-04-01

    There is a misinterpretation in the literature regarding the variable orientation of the small single copy region of plastid genomes (plastomes). The common phenomenon of small and large single copy inversion, hypothesized to occur through intramolecular recombination between inverted repeats (IR) in a circular, single unit-genome, in fact, more likely occurs through recombination-dependent replication (RDR) of linear plastome templates. If RDR can be primed through both intra- and intermolecular recombination, then this mechanism could not only create inversion isomers of so-called single copy regions, but also an array of alternative sequence arrangements. We used Illumina paired-end and PacBio single-molecule real-time (SMRT) sequences to characterize repeat structure in the plastome of Monsonia emarginata (Geraniaceae). We used OrgConv and inspected nucleotide alignments to infer ancestral nucleotides and identify gene conversion among repeats and mapped long (>1 kb) SMRT reads against the unit-genome assembly to identify alternative sequence arrangements. Although M. emarginata lacks the canonical IR, we found that large repeats (>1 kilobase; kb) represent ∼22% of the plastome nucleotide content. Among the largest repeats (>2 kb), we identified GC-biased gene conversion and mapping filtered, long SMRT reads to the M. emarginata unit-genome assembly revealed alternative, substoichiometric sequence arrangements. We offer a model based on RDR and gene conversion between long repeated sequences in the M. emarginata plastome and provide support that both intra-and intermolecular recombination between large repeats, particularly in repeat-rich plastomes, varies unit-genome structure while homogenizing the nucleotide sequence of repeats. © 2017 Botanical Society of America.

  12. Quantitative Analysis of Single-Nucleotide Polymorphism for Rapid Detection of TR34/L98H- and TR46/Y121F/T289A-Positive Aspergillus fumigatus Isolates Obtained from Patients in Iran from 2010 to 2014

    PubMed Central

    Mohammadi, Faezeh; Hashemi, Seyed Jamal; Zoll, Jan; Melchers, Willem J. G.; Rafati, Haleh; Dehghan, Parvin; Rezaie, Sasan; Tolooe, Ali; Tamadon, Yalda; van der Lee, Henrich A.; Verweij, Paul E.

    2015-01-01

    We employed an endpoint genotyping method to update the prevalence rate of positivity for the TR34/L98H mutation (a 34-bp tandem repeat mutation in the promoter region of the cyp51A gene in combination with a substitution at codon L98) and the TR46/Y121F/T289A mutation (a 46-bp tandem repeat mutation in the promoter region of the cyp51A gene in combination with substitutions at codons Y121 and T289) among clinical Aspergillus fumigatus isolates obtained from different regions of Iran over a recent 5-year period (2010 to 2014). The antifungal activities of itraconazole, voriconazole, and posaconazole against 172 clinical A. fumigatus isolates were investigated using the European Committee on Antimicrobial Susceptibility Testing (EUCAST) broth microdilution method. For the isolates with an azole resistance phenotype, the cyp51A gene and its promoter were amplified and sequenced. In addition, using a LightCycler 480 real-time PCR system, a novel endpoint genotyping analysis method targeting single-nucleotide polymorphisms was evaluated to detect the L98H and Y121F mutations in the cyp51A gene of all isolates. Of the 172 A. fumigatus isolates tested, the MIC values of itraconazole (≥16 mg/liter) and voriconazole (>4 mg/liter) were high for 6 (3.5%). Quantitative analysis of single-nucleotide polymorphisms showed the TR34/L98H mutation in the cyp51A genes of six isolates. No isolates harboring the TR46/Y121F/T289A mutation were detected. DNA sequencing of the cyp51A gene confirmed the results of the novel endpoint genotyping method. By microsatellite typing, all of the azole-resistant isolates had genotypes different from those previously recovered from Iran and from the Dutch TR34/L98H controls. In conclusion, there was not a significant increase in the prevalence of azole-resistant A. fumigatus isolates harboring the TR34/L98H resistance mechanism among isolates recovered over a recent 5-year period (2010 to 2014) in Iran. A quantitative assay detecting a single-nucleotide polymorphism in the cyp51A gene of A. fumigatus is a reliable tool for the rapid screening and monitoring of TR34/L98H- and TR46/Y121F/T289A-positive isolates and can easily be incorporated into clinical mycology algorithms. PMID:26525787

  13. Sequence of a cDNA encoding pancreatic preprosomatostatin-22.

    PubMed Central

    Magazin, M; Minth, C D; Funckes, C L; Deschenes, R; Tavianini, M A; Dixon, J E

    1982-01-01

    We report the nucleotide sequence of a precursor to somatostatin that upon proteolytic processing may give rise to a hormone of 22 amino acids. The nucleotide sequence of a cDNA from the channel catfish (Ictalurus punctatus) encodes a precursor to somatostatin that is 105 amino acids (Mr, 11,500). The cDNA coding for somatostatin-22 consists of 36 nucleotides in the 5' untranslated region, 315 nucleotides that code for the precursor to somatostatin-22, 269 nucleotides at the 3' untranslated region, and a variable length of poly(A). The putative preprohormone contains a sequence of hydrophobic amino acids at the amino terminus that has the properties of a "signal" peptide. A connecting sequence of approximately 57 amino acids is followed by a single Arg-Arg sequence, which immediately precedes the hormone. Somatostatin-22 is homologous to somatostatin-14 in 7 of the 14 amino acids, including the Phe-Trp-Lys sequence. Hybridization selection of mRNA, followed by its translation in a wheat germ cell-free system, resulted in the synthesis of a single polypeptide having a molecular weight of approximately 10,000 as estimated on Na-DodSO4/polyacrylamide gels. Images PMID:6127673

  14. Association of MAP4K4 gene single nucleotide polymorphism with mastitis and milk traits in Chinese Holstein cattle.

    PubMed

    Bhattarai, Dinesh; Chen, Xing; Ur Rehman, Zia; Hao, Xingjie; Ullah, Farman; Dad, Rahim; Talpur, Hira Sajjad; Kadariya, Ishwari; Cui, Lu; Fan, Mingxia; Zhang, Shujun

    2017-02-01

    The objective of the studies presented in this Research Communication was to investigate the association of single nucleotide polymorphisms present in the MAP4K4 gene with different milk traits in dairy cows. Based on previous QTL fine mapping results on bovine chromosome 11, the MAP4K4 gene was selected as a candidate gene to evaluate its effect on somatic cell count and milk traits in ChineseHolstein cows. Milk production traits including milk yield, fat percentage, and protein percentage of each cow were collected using 305 d lactation records. Association between MAP4K4 genotype and different traits and Somatic Cell Score (SCS) was performed using General Linear Regression Model of R. Two SNPs at exon 18 (c.2061T > G and c.2196T > C) with genotype TT in both SNPs were found significantly higher for somatic SCS. We found the significant effect of exon 18 (c.2061T > G) on protein percentage, milk yield and SCS. We identified SNPs at different location of MAP4K4 gene of the cattle and several of them were significantly associated with the somatic cell score and other different milk traits. Thus, MAP4K4 gene could be a useful candidate gene for selection of dairy cattle against mastitis and the identified polymorphisms might potentially be strong genetic markers.

  15. Primate TNF Promoters Reveal Markers of Phylogeny and Evolution of Innate Immunity

    PubMed Central

    Baena, Andres; Ligeiro, Filipa; Diop, Ousmane M.; Brieva, Claudia; Gagneux, Pascal; O'Brien, Stephen J.; Ryder, Oliver A.; Goldfeld, Anne E.

    2007-01-01

    Background Tumor necrosis factor (TNF) is a critical cytokine in the immune response whose transcriptional activation is controlled by a proximal promoter region that is highly conserved in mammals and, in particular, primates. Specific single nucleotide polymorphisms (SNPs) upstream of the proximal human TNF promoter have been identified, which are markers of human ancestry. Methodology/Principal findings Using a comparative genomics approach we show that certain fixed genetic differences in the TNF promoter serve as markers of primate speciation. We also demonstrate that distinct alleles of most human TNF promoter SNPs are identical to fixed nucleotides in primate TNF promoters. Furthermore, we identify fixed genetic differences within the proximal TNF promoters of Asian apes that do not occur in African ape or human TNF promoters. Strikingly, protein-DNA binding assays and gene reporter assays comparing these Asian ape TNF promoters to African ape and human TNF promoters demonstrate that, unlike the fixed differences that we define that are associated with primate phylogeny, these Asian ape-specific fixed differences impair transcription factor binding at an Sp1 site and decrease TNF transcription induced by bacterial stimulation of macrophages. Conclusions/significance Here, we have presented the broadest interspecies comparison of a regulatory region of an innate immune response gene to date. We have characterized nucleotide positions in Asian ape TNF promoters that underlie functional changes in cell type- and stimulus-specific activation of the TNF gene. We have also identified ancestral TNF promoter nucleotide states in the primate lineage that correspond to human SNP alleles. These findings may reflect evolution of Asian and African apes under a distinct set of infectious disease pressures involving the innate immune response and TNF. PMID:17637837

  16. Simultaneous determination of nucleotide sugars with ion-pair reversed-phase HPLC.

    PubMed

    Nakajima, Kazuki; Kitazume, Shinobu; Angata, Takashi; Fujinawa, Reiko; Ohtsubo, Kazuaki; Miyoshi, Eiji; Taniguchi, Naoyuki

    2010-07-01

    Nucleotide sugars are important in determining cell surface glycoprotein glycosylation, which can modulate cellular properties such as growth and arrest. We have developed a conventional HPLC method for simultaneous determination of nucleotide sugars. A mixture of nucleotide sugars (CMP-NeuAc, UDP-Gal, UDP-Glc, UDP-GalNAc, UDP-GlcNAc, GDP-Man, GDP-Fuc and UDP-GlcUA) and relevant nucleotides were perfectly separated in an optimized ion-pair reversed-phase mode using Inertsil ODS-4 and ODS-3 columns. The newly developed method enabled us to determine the nucleotide sugars in cellular extracts from 1 x 10(6) cells in a single run. We applied this method to characterize nucleotide sugar levels in breast and pancreatic cancer cell lines and revealed that the abundance of UDP-GlcNAc, UDP-GalNAc, UDP-GlcUA and GDP-Fuc were a cell-type-specific feature. To determine the physiological significance of changes in nucleotide sugar levels, we analyzed their changes by glucose deprivation and found that the determination of nucleotide sugar levels provided us with valuable information with respect to studying the overview of cellular glycosylation status.

  17. Generalization of Associations of Kidney-Related Genetic Loci to American Indians

    PubMed Central

    Haack, Karin; Almasy, Laura; Laston, Sandra; Lee, Elisa T.; Best, Lyle G.; Fabsitz, Richard R.; MacCluer, Jean W.; Howard, Barbara V.; Umans, Jason G.; Cole, Shelley A.

    2014-01-01

    Summary Background and objectives CKD disproportionally affects American Indians, who similar to other populations, show genetic susceptibility to kidney outcomes. Recent studies have identified several loci associated with kidney traits, but their relevance in American Indians is unknown. Design, setting, participants, & measurements This study used data from a large, family-based genetic study of American Indians (the Strong Heart Family Study), which includes 94 multigenerational families enrolled from communities located in Oklahoma, the Dakotas, and Arizona. Individuals were recruited from the Strong Heart Study, a population-based study of cardiovascular disease in American Indians. This study selected 25 single nucleotide polymorphisms in 23 loci identified from recently published kidney-related genome-wide association studies in individuals of European ancestry to evaluate their associations with kidney function (estimated GFR; individuals 18 years or older, up to 3282 individuals) and albuminuria (urinary albumin to creatinine ratio; n=3552) in the Strong Heart Family Study. This study also examined the association of single nucleotide polymorphisms in the APOL1 region with estimated GFR in 1121 Strong Heart Family Study participants. GFR was estimated using the abbreviated Modification of Diet in Renal Disease Equation. Additive genetic models adjusted for age and sex were used. Results This study identified significant associations of single nucleotide polymorphisms with estimated GFR in or nearby PRKAG2, SLC6A13, UBE2Q2, PIP5K1B, and WDR72 (P<2.1 × 10-3 to account for multiple testing). Single nucleotide polymorphisms in these loci explained 2.2% of the estimated GFR total variance and 2.9% of its heritability. An intronic variant of BCAS3 was significantly associated with urinary albumin to creatinine ratio. APOL1 single nucleotide polymorphisms were not associated with estimated GFR in a single variant test or haplotype analyses, and the at-risk variants identified in individuals with African ancestry were not detected in DNA sequencing of American Indians. Conclusion This study extends the genetic associations of loci affecting kidney function to American Indians, a population at high risk of kidney disease, and provides additional support for a potential biologic relevance of these loci across ancestries. PMID:24311711

  18. Adolescent idiopathic scoliosis and the single-nucleotide polymorphism of the growth hormone receptor and IGF-1 genes.

    PubMed

    Yang, Yong; Wu, Zhihong; Zhao, Taimao; Wang, Hai; Zhao, Dong; Zhang, Jianguo; Wang, Yipeng; Ding, Yaozhong; Qiu, Guixing

    2009-06-01

    The etiology of adolescent idiopathic scoliosis is undetermined despite years of research. A number of hypotheses have been postulated to explain its development, including growth abnormalities. The irregular expression of growth hormone and insulin-like growth factor-1 (IGF-1) may disturb hormone metabolism, result in a gross asymmetry, and promote the progress of adolescent idiopathic scoliosis. Initial association studies in complex diseases have demonstrated the power of candidate gene association. Prior to our study, 1 study in this field had a negative result. A replicable study is vital for reliability. To determine the relationship of growth hormone receptor and IGF-1 genes with adolescent idiopathic scoliosis, a population-based association study was performed. Single nucleotide polymorphisms with potential function were selected from candidate genes and a distribution analysis was performed. A conclusion was made confirming the insufficiency of an association between adolescent idiopathic scoliosis and the single-nucleotide polymorphism of the growth hormone receptor and IGF-1 genes in Han Chinese.

  19. A single splice site mutation in human-specific ARHGAP11B causes basal progenitor amplification

    PubMed Central

    Florio, Marta; Namba, Takashi; Pääbo, Svante; Hiller, Michael; Huttner, Wieland B.

    2016-01-01

    The gene ARHGAP11B promotes basal progenitor amplification and is implicated in neocortex expansion. It arose on the human evolutionary lineage by partial duplication of ARHGAP11A, which encodes a Rho guanosine triphosphatase–activating protein (RhoGAP). However, a lack of 55 nucleotides in ARHGAP11B mRNA leads to loss of RhoGAP activity by GAP domain truncation and addition of a human-specific carboxy-terminal amino acid sequence. We show that these 55 nucleotides are deleted by mRNA splicing due to a single C→G substitution that creates a novel splice donor site. We reconstructed an ancestral ARHGAP11B complementary DNA without this substitution. Ancestral ARHGAP11B exhibits RhoGAP activity but has no ability to increase basal progenitors during neocortex development. Hence, a single nucleotide substitution underlies the specific properties of ARHGAP11B that likely contributed to the evolutionary expansion of the human neocortex. PMID:27957544

  20. Spontaneous Chloroplast Mutants Mostly Occur by Replication Slippage and Show a Biased Pattern in the Plastome of Oenothera.

    PubMed

    Massouh, Amid; Schubert, Julia; Yaneva-Roder, Liliya; Ulbricht-Jones, Elena S; Zupok, Arkadiusz; Johnson, Marc T J; Wright, Stephen I; Pellizzer, Tommaso; Sobanski, Johanna; Bock, Ralph; Greiner, Stephan

    2016-04-01

    Spontaneous plastome mutants have been used as a research tool since the beginning of genetics. However, technical restrictions have severely limited their contributions to research in physiology and molecular biology. Here, we used full plastome sequencing to systematically characterize a collection of 51 spontaneous chloroplast mutants in Oenothera (evening primrose). Most mutants carry only a single mutation. Unexpectedly, the vast majority of mutations do not represent single nucleotide polymorphisms but are insertions/deletions originating from DNA replication slippage events. Only very few mutations appear to be caused by imprecise double-strand break repair, nucleotide misincorporation during replication, or incorrect nucleotide excision repair following oxidative damage. U-turn inversions were not detected. Replication slippage is induced at repetitive sequences that can be very small and tend to have high A/T content. Interestingly, the mutations are not distributed randomly in the genome. The underrepresentation of mutations caused by faulty double-strand break repair might explain the high structural conservation of seed plant plastomes throughout evolution. In addition to providing a fully characterized mutant collection for future research on plastid genetics, gene expression, and photosynthesis, our work identified the spectrum of spontaneous mutations in plastids and reveals that this spectrum is very different from that in the nucleus. © 2016 American Society of Plant Biologists. All rights reserved.

  1. Allelic variation of the Waxy gene in foxtail millet [Setaria italica (L.) P. Beauv.] by single nucleotide polymorphisms.

    PubMed

    Van, K; Onoda, S; Kim, M Y; Kim, K D; Lee, S-H

    2008-03-01

    The Waxy (Wx) gene product controls the formation of a straight chain polymer of amylose in the starch pathway. Dominance/recessiveness of the Wx allele is associated with amylose content, leading to non-waxy/waxy phenotypes. For a total of 113 foxtail millet accessions, agronomic traits and the molecular differences of the Wx gene were surveyed to evaluate genetic diversities. Molecular types were associated with phenotypes determined by four specific primer sets (non-waxy, Type I; low amylose, Type VI; waxy, Type IV or V). Additionally, the insertion of transposable element in waxy was confirmed by ex1/TSI2R, TSI2F/ex2, ex2int2/TSI7R and TSI7F/ex4r. Seventeen single nucleotide polymorphims (SNPs) were observed from non-coding regions, while three SNPs from coding regions were non-synonymous. Interestingly, the phenotype of No. 88 was still non-waxy, although seven nucleotides (AATTGGT) insertion at 2,993 bp led to 78 amino acids shorter. The rapid decline of r (2) in the sequenced region (exon 1-intron 1-exon 2) suggested a low level of linkage disequilibrium and limited haplotype structure. K (s) values and estimation of evolutionary events indicate early divergence of S. italica among cereal crops. This study suggested the Wx gene was one of the targets in the selection process during domestication.

  2. Predicted stem-loop structures and variation in nucleotide sequence of 3' noncoding regions among animal calicivirus genomes.

    PubMed

    Seal, B S; Neill, J D; Ridpath, J F

    1994-07-01

    Caliciviruses are nonenveloped with a polyadenylated genome of approximately 7.6 kb and a single capsid protein. The "RNA Fold" computer program was used to analyze 3'-terminal noncoding sequences of five feline calicivirus (FCV), rabbit hemorrhagic disease virus (RHDV), and two San Miguel sea lion virus (SMSV) isolates. The FCV 3'-terminal sequences are 40-46 nucleotides in length and 72-91% similar. The FCV sequences were predicted to contain two possible duplex structures and one stem-loop structure with free energies of -2.1 to -18.2 kcal/mole. The RHDV genomic 3'-terminal RNA sequences are 54 nucleotides in length and share 49% sequence similarity to homologous regions of the FCV genome. The RHDV sequence was predicted to form two duplex structures in the 3'-terminal noncoding region with a single stem-loop structure, resembling that of FCV. In contrast, the SMSV 1 and 4 genomic 3'-terminal noncoding sequences were 185 and 182 nucleotides in length, respectively. Ten possible duplex structures were predicted with an average structural free energy of -35 kcal/mole. Sequence similarity between the two SMSV isolates was 75%. Furthermore, extensive cloverleaflike structures are predicted in the 3' noncoding region of the SMSV genome, in contrast to the predicted single stem-loop structures of FCV or RHDV.

  3. SNPGenie: estimating evolutionary parameters to detect natural selection using pooled next-generation sequencing data.

    PubMed

    Nelson, Chase W; Moncla, Louise H; Hughes, Austin L

    2015-11-15

    New applications of next-generation sequencing technologies use pools of DNA from multiple individuals to estimate population genetic parameters. However, no publicly available tools exist to analyse single-nucleotide polymorphism (SNP) calling results directly for evolutionary parameters important in detecting natural selection, including nucleotide diversity and gene diversity. We have developed SNPGenie to fill this gap. The user submits a FASTA reference sequence(s), a Gene Transfer Format (.GTF) file with CDS information and a SNP report(s) in an increasing selection of formats. The program estimates nucleotide diversity, distance from the reference and gene diversity. Sites are flagged for multiple overlapping reading frames, and are categorized by polymorphism type: nonsynonymous, synonymous, or ambiguous. The results allow single nucleotide, single codon, sliding window, whole gene and whole genome/population analyses that aid in the detection of positive and purifying natural selection in the source population. SNPGenie version 1.2 is a Perl program with no additional dependencies. It is free, open-source, and available for download at https://github.com/hugheslab/snpgenie. nelsoncw@email.sc.edu or austin@biol.sc.edu Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  4. Base Preferences in Non-Templated Nucleotide Incorporation by MMLV-Derived Reverse Transcriptases

    PubMed Central

    Zajac, Pawel; Islam, Saiful; Hochgerner, Hannah; Lönnerberg, Peter; Linnarsson, Sten

    2013-01-01

    Reverse transcriptases derived from Moloney Murine Leukemia Virus (MMLV) have an intrinsic terminal transferase activity, which causes the addition of a few non-templated nucleotides at the 3´ end of cDNA, with a preference for cytosine. This mechanism can be exploited to make the reverse transcriptase switch template from the RNA molecule to a secondary oligonucleotide during first-strand cDNA synthesis, and thereby to introduce arbitrary barcode or adaptor sequences in the cDNA. Because the mechanism is relatively efficient and occurs in a single reaction, it has recently found use in several protocols for single-cell RNA sequencing. However, the base preference of the terminal transferase activity is not known in detail, which may lead to inefficiencies in template switching when starting from tiny amounts of mRNA. Here, we used fully degenerate oligos to determine the exact base preference at the template switching site up to a distance of ten nucleotides. We found a strong preference for guanosine at the first non-templated nucleotide, with a greatly reduced bias at progressively more distant positions. Based on this result, and a number of careful optimizations, we report conditions for efficient template switching for cDNA amplification from single cells. PMID:24392002

  5. Nucleotide Substitution in 3' Arm of Bovine MIR-2467 in Five Cattle Breeds.

    PubMed

    Łukaszewicz, Aneta; Basiak, Szymon; Proskura, Witold Stanisław; Dybus, Andrzej

    2015-01-01

    The T > C single nucleotide polymorphism (SNP) in the MIR2467 gene was investigated in order to confirm its presence in cattle genome and to check for possible differences in its genotype distribution among different breeds. Additional purpose of the study was to investigate in silico potential effect of that substitution on the structure and stability of precursor mir-2467. The study involved 634 individuals of five cattle breeds: Angus, Hereford, Holstein-Friesian, Jersey, and Limousin, which were genotyped using PCR-RFLP assay. In this study, the presence of T > C polymorphism at position 24 was observed in all the cattle breeds excepting Hereford. In addition, the differences in the genotype distribution among analyzed breeds were indicated. On the basis of minimum free energy structure prediction, the C allele was indicated to have possible impact on decreasing the stability of the pre-mir-2467, thus altering its ability to regulate target genes expression.

  6. Pooled genome wide association detects association upstream of FCRL3 with Graves' disease.

    PubMed

    Khong, Jwu Jin; Burdon, Kathryn P; Lu, Yi; Laurie, Kate; Leonardos, Lefta; Baird, Paul N; Sahebjada, Srujana; Walsh, John P; Gajdatsy, Adam; Ebeling, Peter R; Hamblin, Peter Shane; Wong, Rosemary; Forehan, Simon P; Fourlanos, Spiros; Roberts, Anthony P; Doogue, Matthew; Selva, Dinesh; Montgomery, Grant W; Macgregor, Stuart; Craig, Jamie E

    2016-11-18

    Graves' disease is an autoimmune thyroid disease of complex inheritance. Multiple genetic susceptibility loci are thought to be involved in Graves' disease and it is therefore likely that these can be identified by genome wide association studies. This study aimed to determine if a genome wide association study, using a pooling methodology, could detect genomic loci associated with Graves' disease. Nineteen of the top ranking single nucleotide polymorphisms including HLA-DQA1 and C6orf10, were clustered within the Major Histo-compatibility Complex region on chromosome 6p21, with rs1613056 reaching genome wide significance (p = 5 × 10 -8 ). Technical validation of top ranking non-Major Histo-compatablity complex single nucleotide polymorphisms with individual genotyping in the discovery cohort revealed four single nucleotide polymorphisms with p ≤ 10 -4 . Rs17676303 on chromosome 1q23.1, located upstream of FCRL3, showed evidence of association with Graves' disease across the discovery, replication and combined cohorts. A second single nucleotide polymorphism rs9644119 downstream of DPYSL2 showed some evidence of association supported by finding in the replication cohort that warrants further study. Pooled genome wide association study identified a genetic variant upstream of FCRL3 as a susceptibility locus for Graves' disease in addition to those identified in the Major Histo-compatibility Complex. A second locus downstream of DPYSL2 is potentially a novel genetic variant in Graves' disease that requires further confirmation.

  7. Association of glutathione S-transferase pi isoform single-nucleotide polymorphisms with exudative age-related macular degeneration in a Chinese population.

    PubMed

    Gu, Hong; Sun, Erdan; Cui, Lei; Yang, Xiufen; Lim, Apiradee; Xu, Jun; Snellingen, Torkel; Liu, Xipu; Wang, Ningli; Liu, Ningpu

    2012-10-01

    To investigate the association between single-nucleotide polymorphisms in the pi isoform of glutathione S-transferase (GSTP1) gene and the risk of exudative age-related macular degeneration (AMD) in a Chinese case-control cohort. A total of 131 Chinese patients with exudative AMD and 138 control individuals were recruited. Genomic DNA was extracted from venous blood leukocytes. Two common nonsynonymous single-nucleotide polymorphisms in GSTP1 (rs1695 and rs1138272) were genotyped by polymerase chain reaction followed by allele-specific restriction enzyme digestion and direct sequencing. Significant association with exudative AMD was detected for single-nucleotide polymorphism, rs1695 (P = 0.019). The risk G allele frequencies were 21.8% in AMD patients and 12.7% in control subjects (P = 0.007). Compared with the wild-type AA genotype, odds ratio for the risk of AMD was 1.91 (95% confidence interval, 1.09-3.35) for the heterozygous AG genotype and 2.52 (95% confidence interval, 0.6-10.61) for the homozygous GG genotype. In contrast, rs1138272 was not associated with exudative AMD (P = 1.00). The risk G allele frequencies of rs1138272 were 0.4% in AMD patients and 0.4% in control subjects (P = 1.00). Our data suggest that the GSTP1 variant rs1695 moderately increases the risk of exudative AMD. The variant rs1138272 was rare and was not associated with exudative AMD in this Chinese cohort.

  8. Contribution of 20 single nucleotide polymorphisms of 13 genes to dyslipidemia associated with antiretroviral therapy.

    PubMed

    Arnedo, Mireia; Taffé, Patrick; Sahli, Roland; Furrer, Hansjakob; Hirschel, Bernard; Elzi, Luigia; Weber, Rainer; Vernazza, Pietro; Bernasconi, Enos; Darioli, Roger; Bergmann, Sven; Beckmann, Jacques S; Telenti, Amalio; Tarr, Philip E

    2007-09-01

    HIV-1 infected individuals have an increased cardiovascular risk which is partially mediated by dyslipidemia. Single nucleotide polymorphisms in multiple genes involved in lipid transport and metabolism are presumed to modulate the risk of dyslipidemia in response to antiretroviral therapy. The contribution to dyslipidemia of 20 selected single nucleotide polymorphisms of 13 genes reported in the literature to be associated with plasma lipid levels (ABCA1, ADRB2, APOA5, APOC3, APOE, CETP, LIPC, LIPG, LPL, MDR1, MTP, SCARB1, and TNF) was assessed by longitudinally modeling more than 4400 plasma lipid determinations in 438 antiretroviral therapy-treated participants during a median period of 4.8 years. An exploratory genetic score was tested that takes into account the cumulative contribution of multiple gene variants to plasma lipids. Variants of ABCA1, APOA5, APOC3, APOE, and CETP contributed to plasma triglyceride levels, particularly in the setting of ritonavir-containing antiretroviral therapy. Variants of APOA5 and CETP contributed to high-density lipoprotein-cholesterol levels. Variants of CETP and LIPG contributed to non-high-density lipoprotein-cholesterol levels, a finding not reported previously. Sustained hypertriglyceridemia and low high-density lipoprotein-cholesterol during the study period was significantly associated with the genetic score. Single nucleotide polymorphisms of ABCA1, APOA5, APOC3, APOE, and CETP contribute to plasma triglyceride and high-density lipoprotein-cholesterol levels during antiretroviral therapy exposure. Genetic profiling may contribute to the identification of patients at risk for antiretroviral therapy-related dyslipidemia.

  9. Evaluation of single-nucleotide polymorphisms as internal controls in prenatal diagnosis of fetal blood groups.

    PubMed

    Doescher, Andrea; Petershofen, Eduard K; Wagner, Franz F; Schunter, Markus; Müller, Thomas H

    2013-02-01

    Determination of fetal blood groups in maternal plasma samples critically depends on adequate amplification of fetal DNA. We evaluated the routine inclusion of 52 single-nucleotide polymorphisms (SNPs) as internal reference in our polymerase chain reaction (PCR) settings to obtain a positive internal control for fetal DNA. DNA from 223 plasma samples of pregnant women was screened for RHD Exons 3, 4, 5, and 7 in a multiplex PCR including 52 SNPs divided into four primer pools. Amplicons were analyzed by single-base extension and the GeneScan method in a genetic analyzer. Results of D screening were compared to standard RHD genotyping of amniotic fluid or real-time PCR of fetal DNA from maternal plasma. The vast majority of all samples (97.8%) demonstrated differences in maternal and fetal SNP patterns when tested with four primer pools. These differences were not observed in less than 2.2% of the samples most probably due to an extraction failure for adequate amounts of fetal DNA. Comparison of the fetal genotypes with independent results did not reveal a single false-negative case among samples (n = 42) with positive internal control and negative fetal RHD typing. Coamplification of 52 SNPs with RHD-specific sequences for fetal blood group determination introduces a valid positive control for the amplification of fetal DNA to avoid false-negative results. This new approach does not require a paternal blood sample. It may also be applicable to other assays for fetal genotyping in maternal blood samples. © 2012 American Association of Blood Banks.

  10. Electron attachment to DNA single strands: gas phase and aqueous solution

    PubMed Central

    Gu, Jiande; Xie, Yaoming; Schaefer, Henry F.

    2007-01-01

    The 2′-deoxyguanosine-3′,5′-diphosphate, 2′-deoxyadenosine-3′,5′-diphosphate, 2′-deoxycytidine-3′,5′-diphosphate and 2′-deoxythymidine-3′,5′-diphosphate systems are the smallest units of a DNA single strand. Exploring these comprehensive subunits with reliable density functional methods enables one to approach reasonable predictions of the properties of DNA single strands. With these models, DNA single strands are found to have a strong tendency to capture low-energy electrons. The vertical attachment energies (VEAs) predicted for 3′,5′-dTDP (0.17 eV) and 3′,5′-dGDP (0.14 eV) indicate that both the thymine-rich and the guanine-rich DNA single strands have the ability to capture electrons. The adiabatic electron affinities (AEAs) of the nucleotides considered here range from 0.22 to 0.52 eV and follow the order 3′,5′-dTDP > 3′,5′-dCDP > 3′,5′-dGDP > 3′,5′-dADP. A substantial increase in the AEA is observed compared to that of the corresponding nucleic acid bases and the corresponding nucleosides. Furthermore, aqueous solution simulations dramatically increase the electron attracting properties of the DNA single strands. The present investigation illustrates that in the gas phase, the excess electron is situated both on the nucleobase and on the phosphate moiety for DNA single strands. However, the distribution of the extra negative charge is uneven. The attached electron favors the base moiety for the pyrimidine, while it prefers the 3′-phosphate subunit for the purine DNA single strands. In contrast, the attached electron is tightly bound to the base fragment for the cytidine, thymidine and adenosine nucleotides, while it almost exclusively resides in the vicinity of the 3′-phosphate group for the guanosine nucleotides due to the solvent effects. The comparatively low vertical detachment energies (VDEs) predicted for 3′,5′-dADP− (0.26 eV) and 3′,5′-dGDP− (0.32 eV) indicate that electron detachment might compete with reactions having high activation barriers such as glycosidic bond breakage. However, the radical anions of the pyrimidine nucleotides with high VDE are expected to be electronically stable. Thus the base-centered radical anions of the pyrimidine nucleotides might be the possible intermediates for DNA single-strand breakage. PMID:17660189

  11. Analysis of the Highly Diverse Gene Borders in Ebola Virus Reveals a Distinct Mechanism of Transcriptional Regulation

    PubMed Central

    Brauburger, Kristina; Boehmann, Yannik; Tsuda, Yoshimi; Hoenen, Thomas; Olejnik, Judith; Schümann, Michael; Ebihara, Hideki

    2014-01-01

    ABSTRACT Ebola virus (EBOV) belongs to the group of nonsegmented negative-sense RNA viruses. The seven EBOV genes are separated by variable gene borders, including short (4- or 5-nucleotide) intergenic regions (IRs), a single long (144-nucleotide) IR, and gene overlaps, where the neighboring gene end and start signals share five conserved nucleotides. The unique structure of the gene overlaps and the presence of a single long IR are conserved among all filoviruses. Here, we sought to determine the impact of the EBOV gene borders during viral transcription. We show that readthrough mRNA synthesis occurs in EBOV-infected cells irrespective of the structure of the gene border, indicating that the gene overlaps do not promote recognition of the gene end signal. However, two consecutive gene end signals at the VP24 gene might improve termination at the VP24-L gene border, ensuring efficient L gene expression. We further demonstrate that the long IR is not essential for but regulates transcription reinitiation in a length-dependent but sequence-independent manner. Mutational analysis of bicistronic minigenomes and recombinant EBOVs showed no direct correlation between IR length and reinitiation rates but demonstrated that specific IR lengths not found naturally in filoviruses profoundly inhibit downstream gene expression. Intriguingly, although truncation of the 144-nucleotide-long IR to 5 nucleotides did not substantially affect EBOV transcription, it led to a significant reduction of viral growth. IMPORTANCE Our current understanding of EBOV transcription regulation is limited due to the requirement for high-containment conditions to study this highly pathogenic virus. EBOV is thought to share many mechanistic features with well-analyzed prototype nonsegmented negative-sense RNA viruses. A single polymerase entry site at the 3′ end of the genome determines that transcription of the genes is mainly controlled by gene order and cis-acting signals found at the gene borders. Here, we examined the regulatory role of the structurally unique EBOV gene borders during viral transcription. Our data suggest that transcriptional regulation in EBOV is highly complex and differs from that in prototype viruses and further the understanding of this most fundamental process in the filovirus replication cycle. Moreover, our results with recombinant EBOVs suggest a novel role of the long IR found in all filovirus genomes during the viral replication cycle. PMID:25142600

  12. Analysis of the highly diverse gene borders in Ebola virus reveals a distinct mechanism of transcriptional regulation.

    PubMed

    Brauburger, Kristina; Boehmann, Yannik; Tsuda, Yoshimi; Hoenen, Thomas; Olejnik, Judith; Schümann, Michael; Ebihara, Hideki; Mühlberger, Elke

    2014-11-01

    Ebola virus (EBOV) belongs to the group of nonsegmented negative-sense RNA viruses. The seven EBOV genes are separated by variable gene borders, including short (4- or 5-nucleotide) intergenic regions (IRs), a single long (144-nucleotide) IR, and gene overlaps, where the neighboring gene end and start signals share five conserved nucleotides. The unique structure of the gene overlaps and the presence of a single long IR are conserved among all filoviruses. Here, we sought to determine the impact of the EBOV gene borders during viral transcription. We show that readthrough mRNA synthesis occurs in EBOV-infected cells irrespective of the structure of the gene border, indicating that the gene overlaps do not promote recognition of the gene end signal. However, two consecutive gene end signals at the VP24 gene might improve termination at the VP24-L gene border, ensuring efficient L gene expression. We further demonstrate that the long IR is not essential for but regulates transcription reinitiation in a length-dependent but sequence-independent manner. Mutational analysis of bicistronic minigenomes and recombinant EBOVs showed no direct correlation between IR length and reinitiation rates but demonstrated that specific IR lengths not found naturally in filoviruses profoundly inhibit downstream gene expression. Intriguingly, although truncation of the 144-nucleotide-long IR to 5 nucleotides did not substantially affect EBOV transcription, it led to a significant reduction of viral growth. Our current understanding of EBOV transcription regulation is limited due to the requirement for high-containment conditions to study this highly pathogenic virus. EBOV is thought to share many mechanistic features with well-analyzed prototype nonsegmented negative-sense RNA viruses. A single polymerase entry site at the 3' end of the genome determines that transcription of the genes is mainly controlled by gene order and cis-acting signals found at the gene borders. Here, we examined the regulatory role of the structurally unique EBOV gene borders during viral transcription. Our data suggest that transcriptional regulation in EBOV is highly complex and differs from that in prototype viruses and further the understanding of this most fundamental process in the filovirus replication cycle. Moreover, our results with recombinant EBOVs suggest a novel role of the long IR found in all filovirus genomes during the viral replication cycle. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  13. Associations between single nucleotide polymorphisms in folate uptake and metabolizing genes with blood folate, homocysteine and DNA uracil concentrations

    USDA-ARS?s Scientific Manuscript database

    Background: Folate is an essential nutrient which supports nucleotide synthesis and biological methylation reactions. Diminished folate status results in chromosome breakage and is associated with several diseases including colorectal cancer. Folate status is also inversely related to plasma homocys...

  14. Base-By-Base: single nucleotide-level analysis of whole viral genome alignments.

    PubMed

    Brodie, Ryan; Smith, Alex J; Roper, Rachel L; Tcherepanov, Vasily; Upton, Chris

    2004-07-14

    With ever increasing numbers of closely related virus genomes being sequenced, it has become desirable to be able to compare two genomes at a level more detailed than gene content because two strains of an organism may share the same set of predicted genes but still differ in their pathogenicity profiles. For example, detailed comparison of multiple isolates of the smallpox virus genome (each approximately 200 kb, with 200 genes) is not feasible without new bioinformatics tools. A software package, Base-By-Base, has been developed that provides visualization tools to enable researchers to 1) rapidly identify and correct alignment errors in large, multiple genome alignments; and 2) generate tabular and graphical output of differences between the genomes at the nucleotide level. Base-By-Base uses detailed annotation information about the aligned genomes and can list each predicted gene with nucleotide differences, display whether variations occur within promoter regions or coding regions and whether these changes result in amino acid substitutions. Base-By-Base can connect to our mySQL database (Virus Orthologous Clusters; VOCs) to retrieve detailed annotation information about the aligned genomes or use information from text files. Base-By-Base enables users to quickly and easily compare large viral genomes; it highlights small differences that may be responsible for important phenotypic differences such as virulence. It is available via the Internet using Java Web Start and runs on Macintosh, PC and Linux operating systems with the Java 1.4 virtual machine.

  15. Universal digital high-resolution melt: a novel approach to broad-based profiling of heterogeneous biological samples.

    PubMed

    Fraley, Stephanie I; Hardick, Justin; Masek, Billie J; Jo Masek, Billie; Athamanolap, Pornpat; Rothman, Richard E; Gaydos, Charlotte A; Carroll, Karen C; Wakefield, Teresa; Wang, Tza-Huei; Yang, Samuel

    2013-10-01

    Comprehensive profiling of nucleic acids in genetically heterogeneous samples is important for clinical and basic research applications. Universal digital high-resolution melt (U-dHRM) is a new approach to broad-based PCR diagnostics and profiling technologies that can overcome issues of poor sensitivity due to contaminating nucleic acids and poor specificity due to primer or probe hybridization inaccuracies for single nucleotide variations. The U-dHRM approach uses broad-based primers or ligated adapter sequences to universally amplify all nucleic acid molecules in a heterogeneous sample, which have been partitioned, as in digital PCR. Extensive assay optimization enables direct sequence identification by algorithm-based matching of melt curve shape and Tm to a database of known sequence-specific melt curves. We show that single-molecule detection and single nucleotide sensitivity is possible. The feasibility and utility of U-dHRM is demonstrated through detection of bacteria associated with polymicrobial blood infection and microRNAs (miRNAs) associated with host response to infection. U-dHRM using broad-based 16S rRNA gene primers demonstrates universal single cell detection of bacterial pathogens, even in the presence of larger amounts of contaminating bacteria; U-dHRM using universally adapted Lethal-7 miRNAs in a heterogeneous mixture showcases the single copy sensitivity and single nucleotide specificity of this approach.

  16. 3'-End labeling of nucleic acids by a polymerase ribozyme.

    PubMed

    Samanta, Biswajit; Horning, David P; Joyce, Gerald F

    2018-06-13

    A polymerase ribozyme can be used to label the 3' end of RNA or DNA molecules by incorporating a variety of functionalized nucleotide analogs. Guided by a complementary template, the ribozyme adds a single nucleotide that may contain a fluorophore, biotin, azide or alkyne moiety, thus enabling the detection and/or capture of selectively labeled materials. Employing a variety of commercially available nucleotide analogs, efficient labeling was demonstrated for model RNAs and DNAs, human microRNAs and natural tRNA.

  17. Efficiency and Fidelity of Human DNA Polymerases λ and β during Gap-Filling DNA Synthesis

    PubMed Central

    Brown, Jessica A.; Pack, Lindsey R.; Sanman, Laura E.; Suo, Zucai

    2010-01-01

    The base excision repair (BER) pathway coordinates the replacement of 1 to 10 nucleotides at sites of single-base lesions. This process generates DNA substrates with various gap sizes which can alter the catalytic efficiency and fidelity of a DNA polymerase during gap-filling DNA synthesis. Here, we quantitatively determined the substrate specificity and base substitution fidelity of human DNA polymerase λ (Pol λ), an enzyme proposed to support the known BER DNA polymerase β (Pol β), as it filled 1- to 10-nucleotide gaps at 1-nucleotide intervals. Pol λ incorporated a correct nucleotide with relatively high efficiency until the gap size exceeded 9 nucleotides. Unlike Pol λ, Pol β did not have an absolute threshold on gap size as the catalytic efficiency for a correct dNTP gradually decreased as the gap size increased from 2 to 10 nucleotides and then recovered for non-gapped DNA. Surprisingly, an increase in gap size resulted in lower polymerase fidelity for Pol λ, and this downregulation of fidelity was controlled by its non-enzymatic N-terminal domains. Overall, Pol λ was up to 160-fold more error-prone than Pol β, thereby suggesting Pol λ would be more mutagenic during long gap-filling DNA synthesis. In addition, dCTP was the preferred misincorporation for Pol λ and its N-terminal domain truncation mutants. This nucleotide preference was shown to be dependent upon the identity of the adjacent 5′-template base. Our results suggested that both Pol λ and Pol β would catalyze nucleotide incorporation with the highest combination of efficiency and accuracy when the DNA substrate contains a single-nucleotide gap. Thus, Pol λ, like Pol β, is better suited to catalyze gap-filling DNA synthesis during short-patch BER in vivo, although, Pol λ may play a role in long-patch BER. PMID:20961817

  18. Partial AZFc duplications not deletions are associated with male infertility in the Yi population of Yunnan Province, China.

    PubMed

    Ye, Jun-jie; Ma, Li; Yang, Li-juan; Wang, Jin-huan; Wang, Yue-li; Guo, Hai; Gong, Ning; Nie, Wen-hui; Zhao, Shu-hua

    2013-09-01

    There are many reports on associations between spermatogenesis and partial azoospermia factor c (AZFc) deletions as well as duplications; however, results are conflicting, possibly due to differences in methodology and ethnic background. The purpose of this study is to investigate the association of AZFc polymorphisms and male infertility in the Yi ethnic population, residents within Yunnan Province, China. A total of 224 infertile patients and 153 fertile subjects were selected in the Yi ethnic population. The study was performed by sequence-tagged site plus/minus (STS+/-) analysis followed by gene dosage and gene copy definition analysis. Y haplotypes of 215 cases and 115 controls were defined by 12 binary markers using single nucleotide polymorphism on Y chromosome (Y-SNP) multiplex assays based on single base primer extension technology. The distribution of Y haplotypes was not significantly different between the case and control groups. The frequencies of both gr/gr (7.6% vs. 8.5%) and b2/b3 (6.3% vs. 8.5%) deletions do not show significant differences. Similarly, single nucleotide variant (SNV) analysis shows no significant difference of gene copy definition between the cases and controls. However, the frequency of partial duplications in the infertile group (4.0%) is significantly higher than that in the control group (0.7%). Further, we found a case with sY1206 deletion which had two CDY1 copies but removed half of DAZ genes. Our results show that male infertility is associated with partial AZFc duplications, but neither gr/gr nor b2/b3 deletions, suggesting that partial AZFc duplications rather than deletions are risk factors for male infertility in Chinese-Yi population.

  19. Detecting and Analyzing Genetic Recombination Using RDP4.

    PubMed

    Martin, Darren P; Murrell, Ben; Khoosal, Arjun; Muhire, Brejnev

    2017-01-01

    Recombination between nucleotide sequences is a major process influencing the evolution of most species on Earth. The evolutionary value of recombination has been widely debated and so too has its influence on evolutionary analysis methods that assume nucleotide sequences replicate without recombining. When nucleic acids recombine, the evolution of the daughter or recombinant molecule cannot be accurately described by a single phylogeny. This simple fact can seriously undermine the accuracy of any phylogenetics-based analytical approach which assumes that the evolutionary history of a set of recombining sequences can be adequately described by a single phylogenetic tree. There are presently a large number of available methods and associated computer programs for analyzing and characterizing recombination in various classes of nucleotide sequence datasets. Here we examine the use of some of these methods to derive and test recombination hypotheses using multiple sequence alignments.

  20. BDNF Polymorphism Predicts General Intelligence after Penetrating Traumatic Brain Injury

    PubMed Central

    Rostami, Elham; Krueger, Frank; Zoubak, Serguei; Dal Monte, Olga; Raymont, Vanessa; Pardini, Matteo; Hodgkinson, Colin A.; Goldman, David; Risling, Mårten; Grafman, Jordan

    2011-01-01

    Neuronal plasticity is a fundamental factor in cognitive outcome following traumatic brain injury. Brain-derived neurotrophic factor (BDNF), a member of the neurotrophin family, plays an important role in this process. While there are many ways to measure cognitive outcome, general cognitive intelligence is a strong predictor of everyday decision-making, occupational attainment, social mobility and job performance. Thus it is an excellent measure of cognitive outcome following traumatic brain injury (TBI). Although the importance of the single-nucleotide polymorphisms polymorphism on cognitive function has been previously addressed, its role in recovery of general intelligence following TBI is unknown. We genotyped male Caucasian Vietnam combat veterans with focal penetrating TBI (pTBI) (n = 109) and non-head injured controls (n = 38) for 7 BDNF single-nucleotide polymorphisms. Subjects were administrated the Armed Forces Qualification Test (AFQT) at three different time periods: pre-injury on induction into the military, Phase II (10–15 years post-injury, and Phase III (30–35 years post-injury). Two single-nucleotide polymorphisms, rs7124442 and rs1519480, were significantly associated with post-injury recovery of general cognitive intelligence with the most pronounced effect at the Phase II time point, indicating lesion-induced plasticity. The genotypes accounted for 5% of the variance of the AFQT scores, independently of other significant predictors such as pre-injury intelligence and percentage of brain volume loss. These data indicate that genetic variations in BDNF play a significant role in lesion-induced recovery following pTBI. Identifying the underlying mechanism of this brain-derived neurotrophic factor effect could provide insight into an important aspect of post-traumatic cognitive recovery. PMID:22087305

  1. [Association of single nucleotide polymorphism at interleukin-10 gene 1082 nt with the risk of gastric cancer in Chinese population].

    PubMed

    Zhou, Shao-zhang; Zhu, Wei-liang; Li, Ming-ying; Li, Hong-yi; Zhang, Ji-ren

    2008-08-01

    To study the association of single nucleotide polymorphism at interleukin-10 gene 1082 locus with Helicobacter pylori (Hp) infection and the risk of gastric cancer in high prevalent region (Shaanxi Province)aand low prevalence region (Guangdong Province) in China. The genomic DNA was extracted from the peripheral blood of 104 healthy individuals, 104 gastric cancer patients from Guangdong Province, and from 102 healthy volunteers and 102 gastric cancer patients in Shaanxi Province, China. The single nucleotide polymorphism at IL-10 gene 1082 locus was analyzed by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP). The serum levels of anit-Hp IgG was measured by enzyme-linked immunosorbent assay. The frequencies of IL-10-1082 A/A, A/G and G/G genotypes in the 412 subjects were 86.7%, 10.7% and 2.4%, respectively. In the low prevalence region, the number of carriers of IL-10-1082 G* was much greater in the cancer patients than in the healthy controls (14.4% vs 7.7%, Chi2=4.02, P<0.05, OR=1.01, 95% CI=1.08-3.10). The presence of IL-10-1082 G* was associated with significantly increased risk of gastric cancer following Hp infection (Chi(2)=5.36, P<0.05, OR=6.0, 95% CI=1.23-17.52). In the high prevalence region, the frequency of IL-10-1082 G* was slightly higher among the cancer patients than in the healthy controls, but this difference was not statistically significant (12.7% vs 16.6%, P>0.05). The G* genotype of IL-10 gene 1082 locus may be associated with increased risk of gastric cancer in China.

  2. Polygenic Overlap Between C-Reactive Protein, Plasma Lipids, and Alzheimer Disease.

    PubMed

    Desikan, Rahul S; Schork, Andrew J; Wang, Yunpeng; Thompson, Wesley K; Dehghan, Abbas; Ridker, Paul M; Chasman, Daniel I; McEvoy, Linda K; Holland, Dominic; Chen, Chi-Hua; Karow, David S; Brewer, James B; Hess, Christopher P; Williams, Julie; Sims, Rebecca; O'Donovan, Michael C; Choi, Seung Hoan; Bis, Joshua C; Ikram, M Arfan; Gudnason, Vilmundur; DeStefano, Anita L; van der Lee, Sven J; Psaty, Bruce M; van Duijn, Cornelia M; Launer, Lenore; Seshadri, Sudha; Pericak-Vance, Margaret A; Mayeux, Richard; Haines, Jonathan L; Farrer, Lindsay A; Hardy, John; Ulstein, Ingun Dina; Aarsland, Dag; Fladby, Tormod; White, Linda R; Sando, Sigrid B; Rongve, Arvid; Witoelar, Aree; Djurovic, Srdjan; Hyman, Bradley T; Snaedal, Jon; Steinberg, Stacy; Stefansson, Hreinn; Stefansson, Kari; Schellenberg, Gerard D; Andreassen, Ole A; Dale, Anders M

    2015-06-09

    Epidemiological findings suggest a relationship between Alzheimer disease (AD), inflammation, and dyslipidemia, although the nature of this relationship is not well understood. We investigated whether this phenotypic association arises from a shared genetic basis. Using summary statistics (P values and odds ratios) from genome-wide association studies of >200 000 individuals, we investigated overlap in single-nucleotide polymorphisms associated with clinically diagnosed AD and C-reactive protein (CRP), triglycerides, and high- and low-density lipoprotein levels. We found up to 50-fold enrichment of AD single-nucleotide polymorphisms for different levels of association with C-reactive protein, low-density lipoprotein, high-density lipoprotein, and triglyceride single-nucleotide polymorphisms using a false discovery rate threshold <0.05. By conditioning on polymorphisms associated with the 4 phenotypes, we identified 55 loci associated with increased AD risk. We then conducted a meta-analysis of these 55 variants across 4 independent AD cohorts (total: n=29 054 AD cases and 114 824 healthy controls) and discovered 2 genome-wide significant variants on chromosome 4 (rs13113697; closest gene, HS3ST1; odds ratio=1.07; 95% confidence interval=1.05-1.11; P=2.86×10(-8)) and chromosome 10 (rs7920721; closest gene, ECHDC3; odds ratio=1.07; 95% confidence interval=1.04-1.11; P=3.38×10(-8)). We also found that gene expression of HS3ST1 and ECHDC3 was altered in AD brains compared with control brains. We demonstrate genetic overlap between AD, C-reactive protein, and plasma lipids. By conditioning on the genetic association with the cardiovascular phenotypes, we identify novel AD susceptibility loci, including 2 genome-wide significant variants conferring increased risk for AD. © 2015 American Heart Association, Inc.

  3. Single Nucleotide Variants Associated With Polygenic Hypercholesterolemia in Families Diagnosed Clinically With Familial Hypercholesterolemia.

    PubMed

    Lamiquiz-Moneo, Itziar; Pérez-Ruiz, María Rosario; Jarauta, Estíbaliz; Tejedor, María Teresa; Bea, Ana M; Mateo-Gallego, Rocío; Pérez-Calahorra, Sofía; Baila-Rueda, Lucía; Marco-Benedí, Victoria; de Castro-Orós, Isabel; Cenarro, Ana; Civeira, Fernando

    2018-05-01

    Approximately 20% to 40% of clinically defined familial hypercholesterolemia cases do not show a causative mutation in candidate genes, and some of them may have a polygenic origin. A cholesterol gene risk score for the diagnosis of polygenic hypercholesterolemia has been demonstrated to be valuable to differentiate polygenic and monogenic hypercholesterolemia. The aim of this study was to determine the contribution to low-density lipoprotein cholesterol (LDL-C) of the single nucleotide variants associated with polygenic hypercholesterolemia in probands with genetic hypercholesterolemia without mutations in candidate genes (nonfamilial hypercholesterolemia genetic hypercholesterolemia) and the genetic score in cascade screening in their family members. We recruited 49 nonfamilial hypercholesterolemia genetic hypercholesterolemia families (294 participants) and calculated cholesterol gene scores, derived from single nucleotide variants in SORT1, APOB, ABCG8, APOE and LDLR and lipoprotein(a) plasma concentration. Risk alleles in SORT1, ABCG8, APOE, and LDLR showed a statistically significantly higher frequency in blood relatives than in the 1000 Genomes Project. However, there were no differences between affected and nonaffected members. The contribution of the cholesterol gene score to LDL-C was significantly higher in affected than in nonaffected participants (P = .048). The percentage of the LDL-C variation explained by the score was 3.1%, and this percentage increased to 6.9% in those families with the highest genetic score in the proband. Nonfamilial hypercholesterolemia genetic hypercholesterolemia families concentrate risk alleles for high LDL-C. Their contribution varies greatly among families, indicating the complexity and heterogeneity of these forms of hypercholesterolemias. The gene score explains a small percentage of LDL-C, which limits its use in diagnosis. Copyright © 2017 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All rights reserved.

  4. Association between polymorphisms in prostanoid receptor genes and aspirin-intolerant asthma.

    PubMed

    Kim, Sang-Heon; Kim, Yoon-Keun; Park, Heung-Woo; Jee, Young-Koo; Kim, Sang-Hoon; Bahn, Joon-Woo; Chang, Yoon-Seok; Kim, Seung-Hyun; Ye, Young-Min; Shin, Eun-Soon; Lee, Jong-Eun; Park, Hae-Sim; Min, Kyung-Up

    2007-04-01

    Genetic predisposition is linked to the pathogenesis of aspirin-intolerant asthma. Most candidate gene approaches have focused on leukotriene-related pathways, whereas there have been relatively few studies evaluating the effects of polymorphisms in prostanoid receptor genes on the development of aspirin-intolerant asthma. Therefore, we investigated the potential association between prostanoid receptor gene polymorphisms and the aspirin-intolerant asthma phenotype. We screened for genetic variations in the prostanoid receptor genes PTGER1, PTGER2, PTGER3, PTGER4, PTGDR, PTGIR, PTGFR, and TBXA2R using direct sequencing, and selected 32 tagging single nucleotide polymorphisms among the 77 polymorphisms with frequencies >0.02 based on linkage disequilibrium for genotyping. We compared the genotype distributions and allele frequencies of three participant groups (108 patients with aspirin-intolerant asthma, 93 patients with aspirin-tolerant asthma, and 140 normal controls). Through association analyses studies of the 32 single nucleotide polymorphisms, the following single nucleotide polymorphisms were found to have significant associations with the aspirin-intolerant asthma phenotype: -616C>G (P=0.038) and -166G>A (P=0.023) in PTGER2; -1709T>A (P=0.043) in PTGER3; -1254A>G (P=0.018) in PTGER4; 1915T>C (P=0.015) in PTGIR; and -4684C>T (P=0.027), and 795T>C (P=0.032) in TBXA2R. In the haplotype analysis of each gene, the frequency of PTGIR ht3[G-G-C-C], which includes 1915T>C, differed significantly between the aspirin-intolerant asthma patients and aspirin-tolerant asthma patients (P=0.015). These findings suggest that genetic polymorphisms in PTGER2, PTGER3, PTGER4, PTGIR, and TBXA2R play important roles in the pathogenesis of aspirin-intolerant asthma.

  5. Exploring genetic variants predisposing to diabetes mellitus and their association with indicators of socioeconomic status.

    PubMed

    Schmidt, Börge; Dragano, Nico; Scherag, André; Pechlivanis, Sonali; Hoffmann, Per; Nöthen, Markus M; Erbel, Raimund; Jöckel, Karl-Heinz; Moebus, Susanne

    2014-06-16

    The relevance of disease-related genetic variants for the explanation of social inequalities in complex diseases is unclear and empirical analyses are largely missing. The aim of our study was to examine whether genetic variants predisposing to diabetes mellitus are associated with socioeconomic status in a population-based cohort. We genotyped 11 selected diabetes-related single nucleotide polymorphisms in 4655 participants (age 45-75 years) of the Heinz Nixdorf Recall study. Diabetes status was self-reported or defined by blood glucose levels. Education, income and paternal occupation were assessed as indicators of socioeconomic status. Multiple regression analyses were used to examine the association of socioeconomic status and diabetes by estimating sex-specific and age-adjusted prevalence ratios and their corresponding 95%-confidence intervals. To explore the relationship between individual single nucleotide polymorphisms and socioeconomic status sex- and age-adjusted odds ratios were computed. We adjusted the alpha-level for multiple testing of 11 single nucleotide polymorphisms using Bonferroni's method (α(BF) ~ 0.005). In addition, we explored the association of a genetic risk score with socioeconomic status. Social inequalities in diabetes were observed for all indicators of socioeconomic status. However, there were no significant associations between individual diabetes-related risk alleles and socioeconomic status with odds ratios ranging from 0.87 to 1.23. Similarly, the genetic risk score analysis revealed no evidence for an association. Our data provide no evidence for an association between 11 diabetes-related risk alleles and different indicators of socioeconomic status in a population-based cohort, suggesting that the explored genetic variants do not contribute to health inequalities in diabetes.

  6. Single-nucleotide polymorphism in the human mu opioid receptor gene alters beta-endorphin binding and activity: possible implications for opiate addiction.

    PubMed

    Bond, C; LaForge, K S; Tian, M; Melia, D; Zhang, S; Borg, L; Gong, J; Schluger, J; Strong, J A; Leal, S M; Tischfield, J A; Kreek, M J; Yu, L

    1998-08-04

    Opioid drugs play important roles in the clinical management of pain, as well as in the development and treatment of drug abuse. The mu opioid receptor is the primary site of action for the most commonly used opioids, including morphine, heroin, fentanyl, and methadone. By sequencing DNA from 113 former heroin addicts in methadone maintenance and 39 individuals with no history of drug or alcohol abuse or dependence, we have identified five different single-nucleotide polymorphisms (SNPs) in the coding region of the mu opioid receptor gene. The most prevalent SNP is a nucleotide substitution at position 118 (A118G), predicting an amino acid change at a putative N-glycosylation site. This SNP displays an allelic frequency of approximately 10% in our study population. Significant differences in allele distribution were observed among ethnic groups studied. The variant receptor resulting from the A118G SNP did not show altered binding affinities for most opioid peptides and alkaloids tested. However, the A118G variant receptor binds beta-endorphin, an endogenous opioid that activates the mu opioid receptor, approximately three times more tightly than the most common allelic form of the receptor. Furthermore, beta-endorphin is approximately three times more potent at the A118G variant receptor than at the most common allelic form in agonist-induced activation of G protein-coupled potassium channels. These results show that SNPs in the mu opioid receptor gene can alter binding and signal transduction in the resulting receptor and may have implications for normal physiology, therapeutics, and vulnerability to develop or protection from diverse diseases including the addictive diseases.

  7. A noncoding melanophilin gene (MLPH) SNP at the splice donor of exon 1 represents a candidate causal mutation for coat color dilution in dogs.

    PubMed

    Drögemüller, Cord; Philipp, Ute; Haase, Bianca; Günzel-Apel, Anne-Rose; Leeb, Tosso

    2007-01-01

    Coat color dilution in several breeds of dog is characterized by a specific pigmentation phenotype and sometimes accompanied by hair loss and recurrent skin inflammation, the so-called color dilution alopecia or black hair follicular dysplasia. Coat color dilution (d) is inherited as a Mendelian autosomal recessive trait. In a previous study, MLPH polymorphisms showed perfect cosegregation with the dilute phenotype within breeds. However, different dilute haplotypes were found in different breeds, and no single polymorphism was identified in the coding sequence that was likely to be causative for the dilute phenotype. We resequenced the 5'-region of the canine MLPH gene and identified a strong candidate single nucleotide polymorphism within the nontranslated exon 1, which showed perfect association to the dilute phenotype in 65 dilute dogs from 7 different breeds. The A/G polymorphism is located at the last nucleotide of exon 1 and the mutant A-allele is predicted to reduce splicing efficiency 8-fold. An MLPH mRNA expression study using quantitative reverse transcriptase-polymerase chain reaction confirmed that dd animals had only about approximately 25% of the MLPH transcript compared with DD animals. These results provide preliminary evidence that the reported regulatory MLPH mutation might represent a causal mutation for coat color dilution in dogs.

  8. Geographically Distinct and Domain-Specific Sequence Variations in the Alleles of Rice Blast Resistance Gene Pib

    PubMed Central

    Vasudevan, Kumar; Vera Cruz, Casiana M.; Gruissem, Wilhelm; Bhullar, Navreet K.

    2016-01-01

    Rice blast is caused by Magnaporthe oryzae, which is the most destructive fungal pathogen affecting rice growing regions worldwide. The rice blast resistance gene Pib confers broad-spectrum resistance against Southeast Asian M. oryzae races. We investigated the allelic diversity of Pib in rice germplasm originating from 12 major rice growing countries. Twenty-five new Pib alleles were identified that have unique single nucleotide polymorphisms (SNPs), insertions and/or deletions, in addition to the polymorphic nucleotides that are shared between the different alleles. These partially or completely shared polymorphic nucleotides indicate frequent sequence exchange events between the Pib alleles. In some of the new Pib alleles, nucleotide diversity is high in the LRR domain, whereas, in others it is distributed among the NB-ARC and LRR domains. Most of the polymorphic amino acids in LRR and NB-ARC2 domains are predicted as solvent-exposed. Several of the alleles and the unique SNPs are country specific, suggesting a diversifying selection of alleles in various geographical locations in response to the locally prevalent M. oryzae population. Together, the new Pib alleles are an important genetic resource for rice blast resistance breeding programs and provide new information on rice-M. oryzae interactions at the molecular level. PMID:27446145

  9. Novel avian paramyxovirus (APMV-15) isolated from a migratory bird in South America.

    PubMed

    Thomazelli, Luciano Matsumiya; de Araújo, Jansen; Fabrizio, Thomas; Walker, David; Reischak, Dilmara; Ometto, Tatiana; Barbosa, Carla Meneguin; Petry, Maria Virginia; Webby, Richard J; Durigon, Edison Luiz

    2017-01-01

    A novel avian paramyxovirus (APMV) isolated from a migratory bird cloacal swab obtained during active surveillance in April 2012 in the Lagoa do Peixe National Park, Rio Grande do Sul state, South of Brazil was biologically and genetically characterized. The nucleotide sequence of the full viral genome was completed using a next-generation sequencing approach. The genome was 14,952 nucleotides (nt) long, with six genes (3'-NP-P-M-F-HN-L-5') encoding 7 different proteins, typical of APMV. The fusion (F) protein gene of isolate RS-1177 contained 1,707 nucleotides in a single open reading frame encoding a protein of 569 amino acids. The F protein cleavage site contained two basic amino acids (VPKER↓L), typical of avirulent strains. Phylogenetic analysis of the whole genome indicated that the virus is related to APMV-10, -2 and -8, with 60.1% nucleotide sequence identity to the closest APMV-10 virus, 58.7% and 58.5% identity to the closest APMV-8 and APMV-2 genome, respectively, and less than 52% identity to representatives of the other APMVs groups. Such distances are comparable to the distances observed among other previously identified APMVs serotypes. These results suggest that unclassified/calidris_fuscicollis/Brazil/RS-1177/2012 is the prototype strain of a new APMV serotype, APMV-15.

  10. Extension of the COG and arCOG databases by amino acid and nucleotide sequences

    PubMed Central

    Meereis, Florian; Kaufmann, Michael

    2008-01-01

    Background The current versions of the COG and arCOG databases, both excellent frameworks for studies in comparative and functional genomics, do not contain the nucleotide sequences corresponding to their protein or protein domain entries. Results Using sequence information obtained from GenBank flat files covering the completely sequenced genomes of the COG and arCOG databases, we constructed NUCOCOG (nucleotide sequences containing COG databases) as an extended version including all nucleotide sequences and in addition the amino acid sequences originally utilized to construct the current COG and arCOG databases. We make available three comprehensive single XML files containing the complete databases including all sequence information. In addition, we provide a web interface as a utility suitable to browse the NUCOCOG database for sequence retrieval. The database is accessible at . Conclusion NUCOCOG offers the possibility to analyze any sequence related property in the context of the COG and arCOG framework simply by using script languages such as PERL applied to a large but single XML document. PMID:19014535

  11. From milk to diet: feed recognition for milk authenticity.

    PubMed

    Ponzoni, E; Gianì, S; Mastromauro, F; Breviario, D

    2009-11-01

    The presence of plastidial DNA fragments of plant origin in animal milk samples has been confirmed. An experimental plan was arranged with 4 groups of goats, each provided with a different monophytic diet: 3 fresh forages (oats, ryegrass, and X-triticosecale) and one 2-wk-old silage (X-triticosecale). Feed-derived rubisco (ribulose bisphosphate carboxylase, rbcL) DNA fragments were detected in 100% of the analyzed goat milk samples, and the nucleotide sequence of the PCR-amplified fragments was found to be 100% identical to the corresponding fragments amplified from the plant species consumed in the diet. Two additional chloroplast-based molecular markers were used to set up an assay for distinctiveness, conveniently based on a simple PCR. In one case, differences in single nucleotides occurring within the gene encoding for plant maturase K (matK) were exploited. In the other, plant species recognition was based on the difference in the length of the intron present within the transfer RNA leucine (trnL) gene. The presence of plastidial plant DNA, ascertained by the PCR-based amplification of the rbcL fragment, was also assessed in raw cow milk samples collected directly from stock farms or taken from milk sold on the commercial market. In this case, the nucleotide sequence of the amplified DNA fragments reflected the multiple forages present in the diet fed to the animals.

  12. Genotypic relationships between Taenia saginata, Taenia asiatica and their hybrids.

    PubMed

    Yamane, Kanako; Yanagida, Tetsuya; Li, Tiaoying; Chen, Xingwang; Dekumyoy, Paron; Waikagul, Jitra; Nkouawa, Agathe; Nakao, Minoru; Sako, Yasuhito; Ito, Akira; Sato, Hiroshi; Okamoto, Munehiro

    2013-11-01

    Partial sequences of the DNA polymerase delta (pold) gene from Taenia saginata-like adult worms were sequenced. Phylogenetic analysis revealed that pold gene sequences were clearly divided into two clades, differing from each other in five to seven nucleotides. There is little doubt that T. saginata and Taenia asiatica were once separated into two distinct taxa as has been concluded in previous studies. On the other hand, most of the adult worms, which were identified as T. asiatica using mitochondrial DNA, were homozygous for an allele that originated from the allele of T. saginata via single nucleotide substitution. These results indicate that most of the adult worms, which had been called T. asiatica, are not actually 'pure T. asiatica' but instead originated from the hybridization of 'pure T. saginata' and 'pure T. asiatica'.

  13. Obesity-Related Genomic Loci Are Associated with Type 2 Diabetes in a Han Chinese Population

    PubMed Central

    Zhao, Qi; He, Jiang; Chen, Li; Zhao, Zhigang; Li, Qiang; Ge, Jiapu; Chen, Gang; Guo, Xiaohui; Lu, Juming; Weng, Jianping; Jia, Weiping; Ji, Linong; Xiao, Jianzhong; Shan, Zhongyan; Liu, Jie; Tian, Haoming; Ji, Qiuhe; Zhu, Dalong; Zhou, Zhiguang; Shan, Guangliang; Yang, Wenying

    2014-01-01

    Background and Aims Obesity is a well-known risk factor for type 2 diabetes. Genome-wide association studies have identified a number of genetic loci associated with obesity. The aim of this study is to examine the contribution of obesity-related genomic loci to type 2 diabetes in a Chinese population. Methods We successfully genotyped 18 obesity-related single nucleotide polymorphisms among 5338 type 2 diabetic patients and 4663 controls. Both individual and joint effects of these single nucleotide polymorphisms on type 2 diabetes and quantitative glycemic traits (assessing β-cell function and insulin resistance) were analyzed using logistic and linear regression models, respectively. Results Two single nucleotide polymorphisms near MC4R and GNPDA2 genes were significantly associated with type 2 diabetes before adjusting for body mass index and waist circumference (OR (95% CI) = 1.14 (1.06, 1.22) for the A allele of rs12970134, P = 4.75×10−4; OR (95% CI) = 1.10 (1.03, 1.17) for the G allele of rs10938397, P = 4.54×10−3). When body mass index and waist circumference were further adjusted, the association of MC4R with type 2 diabetes remained significant (P = 1.81×10−2) and that of GNPDA2 was attenuated (P = 1.26×10−1), suggesting the effect of the locus including GNPDA2 on type 2 diabetes may be mediated through obesity. Single nucleotide polymorphism rs2260000 within BAT2 was significantly associated with type 2 diabetes after adjusting for body mass index and waist circumference (P = 1.04×10−2). In addition, four single nucleotide polymorphisms (near or within SEC16B, BDNF, MAF and PRL genes) showed significant associations with quantitative glycemic traits in controls even after adjusting for body mass index and waist circumference (all P values<0.05). Conclusions This study indicates that obesity-related genomic loci were associated with type 2 diabetes and glycemic traits in the Han Chinese population. PMID:25093408

  14. SRD5A1 and SRD5A2 are associated with treatment for benign prostatic hyperplasia with the combination of 5α-reductase inhibitors and α-adrenergic receptor antagonists.

    PubMed

    Gu, Xin; Na, Rong; Huang, Tao; Wang, Li; Tao, Sha; Tian, Lu; Chen, Zhuo; Jiao, Yang; Kang, Jian; Zheng, Siqun; Xu, Jianfeng; Sun, Jielin; Qi, Jun

    2013-08-01

    Common treatments for benign prostatic hyperplasia include 5α-reductase inhibitors and α-adrenergic receptor antagonists. However, these treatments can only partially decrease the risk of benign prostatic hyperplasia progression. SRD5A1 and SRD5A2 are 5α-reductase inhibitor targets. We investigated the association between drug efficacy and single nucleotide polymorphisms in the SRD5A1 and SRD5A2 genes in a Chinese population. We genotyped 11 tagging single nucleotide polymorphisms in the SRD5A1 and SRD5A2 genes in a total of 426 benign prostatic hyperplasia cases and 1,008 controls from Xinhua Hospital, Shanghai, People's Republic of China. Cases were treated with type II 5α-reductase inhibitors and α-adrenergic receptor antagonists. We tested the association of tagging single nucleotide polymorphisms with benign prostatic hyperplasia risk/progression, clinical characteristics at baseline, including the I-PSS (International Prostate Symptom Score) and total prostate volume, and changes in clinical characteristics after treatment. The 11 tagging single nucleotide polymorphisms were not significantly associated with benign prostatic hyperplasia risk or progression (each p >0.05). In the SRD5A1 gene rs6884552 and rs3797177 were significantly associated with baseline I-PSS (p = 0.04 and 0.003, respectively). In the SRD5A2 gene rs523349 (V89L) and rs9332975 were significantly associated with baseline total prostate volume (p = 0.01 and 0.001, respectively). In SRD5A1 rs166050 was significantly associated with the posttreatment change in total prostate volume (p = 0.04). In SRD5A2 rs523349 and rs612224 were significantly associated with the posttreatment I-PSS change (p = 0.03 and 0.009, respectively). SRD5A1 and SRD5A2 single nucleotide polymorphisms are significantly associated with the clinical characteristics of benign prostatic hyperplasia and the efficacy of benign prostatic hyperplasia treatment. Copyright © 2013 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  15. Polymorphism in the GALNT1 Gene and Epithelial Ovarian Cancer in Non-Hispanic White Women: The Ovarian Cancer Association Consortium

    PubMed Central

    Phelan, Catherine M.; Tsai, Ya-Yu; Goode, Ellen L.; Vierkant, Robert A.; Fridley, Brooke L.; Beesley, Jonathan; Chen, Xiao Qing; Webb, Penelope M.; Chanock, Stephen; Cramer, Daniel W.; Moysich, Kirsten; Edwards, Robert P.; Chang-Claude, Jenny; Garcia-Closas, Montserrat; Yang, Hannah; Wang-Gohrke, Shan; Hein, Rebecca; Green, Adele C.; Lissowska, Jolanta; Carney, Michael E.; Lurie, Galina; Wilkens, Lynne R.; Ness, Roberta B.; Pearce, Celeste Leigh; Wu, Anna H.; Van Den Berg, David J.; Stram, Daniel O.; Terry, Kathryn L.; Whiteman, David C.; Whittemore, Alice S.; DiCioccio, Richard A.; McGuire, Valerie; Doherty, Jennifer A.; Rossing, Mary Anne; Anton-Culver, Hoda; Ziogas, Argyrios; Hogdall, Claus; Hogdall, Estrid; Kjaer, Susanne Krüger; Blaakaer, Jan; Quaye, Lydia; Ramus, Susan J.; Jacobs, Ian; Song, Honglin; Pharoah, Paul D.P.; Iversen, Edwin S.; Marks, Jeffrey R.; Pike, Malcolm C.; Gayther, Simon A.; Cunningham, Julie M.; Goodman, Marc T.; Schildkraut, Joellen M.; Chenevix-Trench, Georgia; Berchuck, Andrew; Sellers, Thomas A.

    2010-01-01

    Aberrant glycosylation is a well-described hallmark of cancer. In a previous ovarian cancer case control study that examined polymorphisms in 26 glycosylation-associated genes, we found strong statistical evidence (P = 0.00017) that women who inherited two copies of a single-nucleotide polymorphism in the UDP-N-acetylgalactosamine:polypeptide N-acetylgalactosaminyltransferase, GALNT1, had decreased ovarian cancer risk. The current study attempted to replicate this observation. The GALNT1 single-nucleotide polymorphism rs17647532 was genotyped in 6,965 cases and 8,377 controls from 14 studies forming the Ovarian Cancer Association Consortium. The fixed effects estimate per rs17647532 allele was null (odds ratio, 0.99; 95% confidence interval, 0.92–1.07). When a recessive model was fit, the results were unchanged. Test for hetero geneity of the odds ratios revealed consistency across the 14 replication sites but significant differences compared with the original study population (P = 0.03). This study underscores the need for replication of putative findings in genetic association studies. PMID:20142253

  16. Could single nucleotide polymorphisms influence on the efficacy of platelet-rich plasma in the treatment of sport injuries?

    PubMed Central

    Pruna, Ricard; Til, Lluis; Artells, Rosa

    2014-01-01

    Summary Platelet-rich plasma (PRP) is a new powerful biological tool in sports medicine, when used to treat tendon, ligament and muscle injuries. PRP is a fraction of autologous whole blood containing an increased number of platelets and a wide variety of cytokines that can improve and accelerate the healing of various tissues. An analysis of the literature shows promising pre-clinical results for PRP treatment, but there is a lack of solid clinical proof to support its use in sports medicine, and in fact, clinical findings on individual responses to PRP treatment are contradictory. These contradictions may be due to interindividual differences in the presence of single nucleotide polymorphisms (SNPs) in genes related to PRPs and/or their receptors. These SNPs can determine a greater or lesser response to this treatment and consequently a shorter or longer recovery time. We have focused our attention in the study of genes related to PRP with the aim to develope a genetic profile that will identify the individuals and injuries most likely to benefit from PRP treatment. PMID:24932449

  17. [Correlation analysis between single nucleotide polymorphism of FGF5 gene and wool yield in rabbits].

    PubMed

    Li, Chun-Xiao; Jiang, Mei-Shan; Chen, Shi-Yi; Lai, Song-Jia

    2008-07-01

    Single nucleotide polymorphism (SNP) in exon 1 and 3 of fibroblast growth factor (FGF5) gene was studied by DNA sequencing in Yingjing angora rabbit, Tianfu black rabbit and California rabbit. A frameshift mutation (TCT insert) at base position 217 (site A) of exon 1 and a T/C missense mutation at base position 59 (site B) of exon 3 were found in Yingjing angora rabbit with a high frequency; a T/C same-sense mutation at base position 3 (site C) of exon 3 was found with similar frequency in three rabbit breeds. Least square analysis showed that different genotypes had no significant association with wool yield in site A, and had high significant association with wool yield in site B (P<0.01) and significant association with wool yield in site C (P<0.05). It was concluded from the results that FGF5 gene could be the potential major gene affecting wool yield or link with the major gene, and polymorphic loci B and C may be used as molecular markers for im-proving wool yield in angora rabbits.

  18. Experimental Review of DNA-Based Methods for Wine Traceability and Development of a Single-Nucleotide Polymorphism (SNP) Genotyping Assay for Quantitative Varietal Authentication.

    PubMed

    Catalano, Valentina; Moreno-Sanz, Paula; Lorenzi, Silvia; Grando, Maria Stella

    2016-09-21

    The genetic varietal authentication of wine was investigated according to DNA isolation procedures reported for enological matrices and also by testing 11 commercial extraction kits and various protocol modifications. Samples were collected at different stages of the winemaking process of renowned Italian wines Brunello di Montalcino, Lambruschi Modenesi, and Trento DOC. Results demonstrated not only that grape DNA loss is produced by the fermentation process but also that clarification and stabilization operations contribute to the reduction of double-stranded DNA content on wine. Despite the presence of inhibitors, downstream PCR genotyping yielded reliable nuclear and chloroplast SSR markers for must samples, whereas no amplification or inconsistent results were obtained at later stages of the vinification. In addition, a TaqMan genotyping assay based on cultivar-specific single-nucleotide polymorphisms (SNPs) was designed, which allowed assessment of grapevine DNA mixtures. Once the wine matrix limitations are overcome, this sensitive tool may be implemented for the relative quantification of cultivars used for blend wines or frauds.

  19. Using PCR-RFLP technology to teach single nucleotide polymorphism for undergraduates.

    PubMed

    Zhang, Bo; Wang, Yan; Xu, Xiaofeng; Guan, Xingying; Bai, Yun

    2013-01-01

    Recent studies indicated that the aberrant gene expression of peroxiredoxin-6 (prdx6) was found in various kinds of cancers. Because of its biochemical function and gene expression pattern in cancer cells, the association between genetic polymorphism of Prdx6 and cancer onset is interesting. In this report, we have developed and implemented a serial experiment in molecular biology laboratory course to teach single nucleotide polymorphism (SNP) to undergraduate students majoring in molecular biology or genetics. The flanking sequence of rs4382766 was located in Prdx6 gene, which contained a restriction site of SspI, and was used as a target in this lab course. The students could mimic real research by integrating different techniques, such as database retrieving, genomic DNA isolation, PCR, and restriction enzyme assay. This serial experiment of PCR-RFLP helps students set up intact idea of molecular biology and understand the relation among individual experiments. Students were found to be more enthusiastic during the laboratory classes than those in the former curriculum. Copyright © 2013 Wiley Periodicals, Inc.

  20. Polycystic ovary syndrome: association of a C/T single nucleotide polymorphism at tyrosine kinase domain of insulin receptor gene with pathogenesis among lean Japanese women.

    PubMed

    Kashima, Katsunori; Yahata, Tetsuro; Fujita, Kazuyuki; Tanaka, Kenichi

    2013-01-01

    To assess whether the insulin receptor (INSR) gene contributes to genetic susceptibility to polycystic ovary syndrome (PCOS) in a Japanese population. We ex-amined the frequency of the His 1058 C/T single nucleotide polymorphism (SNP) found in exon 17 of the INSR gene in 61 Japanese PCOS patients and 99 Japanese healthy controls. In addition, we analyzed the association between the genotype of this SNP and the clinical phenotypes. The frequency of the C/C genotype was not significantly different between all PCOS patients (47.5%) and controls (35.4%). However, among the lean cases (body mass index < or = 20 kg/m2) the frequency of the C/C genotype was significantly increased (p < 0.05) in PCOS patients (65.0%) as compared with controls (36.6%). We concluded that the His 1058 C/T polymorphism at the tyrosine kinase domain of the INSR gene had a relationship to the pathogenesis of lean PCOS patients in a Japanese population.

  1. Word Reading Fluency: Role of Genome-Wide Single-Nucleotide Polymorphisms in Developmental Stability and Correlations with Print Exposure

    ERIC Educational Resources Information Center

    Harlaar, Nicole; Trzaskowski, Maciej; Dale, Philip S.; Plomin, Robert

    2014-01-01

    The genetic effects on individual differences in reading development were examined using genome-wide complex trait analysis (GCTA) in a twin sample. In unrelated individuals (one twin per pair, n = 2,942), the GCTA-based heritability of reading fluency was ~20%-29% at ages 7 and 12. GCTA bivariate results showed that the phenotypic stability of…

  2. Association of the IL4R single-nucleotide polymorphism I50V with recurrent spontaneous abortion (RSA).

    PubMed

    Tavasolian, Fataneh; Abdollahi, Elham; Samadi, Morteza

    2014-07-01

    Recurrent spontaneous abortion (RSA) is defined as three or more consecutive abortions before the 20th week of gestation. There is increasing evidence to support an immunological mechanism for the occurrence of RSA. The purpose of our study was to examine whether single-nucleotide polymorphisms (SNPs) of the interleukin-4 receptor gene IL4R influence susceptibility to, recurrent spontaneous abortion. This is a case-control study. We recruited 200 patients with RSA (case group) using established diagnostic criteria and 200, normal individuals (control group) at the fertility and infertility center in Yazd city and Isfahan city during 2012 to 2013. We screened the I50V variant in IL-4R in patients and controls by PCR-RFLF method, and we performed an association analysis between I50V variant and RSA.the data was analyzed by spss 16 software using Chi-square test. No differences in the genotype and allele frequencies of the I50V SNPs were identified between patients with RSA and healthy controls. The frequency of SNP in IL-4 receptor (I50V) in patients with recurrent spontaneous abortion did not differ significantly compared with the control group. Analysis of IL4R SNP haplotypes or complex alleles suggested no dominant protection in patients with RSA.

  3. Lupin nad9 and nad6 genes and their expression: 5' termini of the nad9 gene transcripts differentiate lupin species.

    PubMed

    Rurek, Michał; Nuc, Katarzyna; Raczyńska, Katarzyna Dorota; Augustyniak, Halina

    2003-10-02

    The mitochondrial nad9 and nad6 genes were analyzed in four lupin species: Lupinus luteus, Lupinus angustifolius, Lupinus albus and Lupinus mutabilis. The nucleotide sequence of these genes confirmed their high conservation, however, higher number of nucleotide substitution was observed in the L. albus genes. Southern hybridizations confirmed the presence of single copy number of these genes in L. luteus, L. albus and L. angustifolius. The expression of nad9 and nad6 genes was analyzed by Northern in different tissue types of analyzed lupin species. Transcription analyses of the two nad genes displayed single predominant mRNA species of about 0.6 kb in L. luteus and L. angustifolius. The L. albus transcripts were larger in size. The nad9 and nad6 transcripts were modified by RNA editing at 8 and 11 positions, in L. luteus and L. angustifolius, respectively. The gene order, rps3-rpl16-nad9, found in Arabidopsis thaliana is also conserved in L. luteus and L. angustifolius mitochondria. L. luteus and L. angustifolius showed some variability in the sequence of the nad9 promoter region. The last feature along with the differences observed in nad9 mRNA 5' termini of two lupins differentiate L. luteus and L. angustifolius species.

  4. A Perfect Match Genomic Landscape Provides a Unified Framework for the Precise Detection of Variation in Natural and Synthetic Haploid Genomes

    PubMed Central

    Palacios-Flores, Kim; García-Sotelo, Jair; Castillo, Alejandra; Uribe, Carina; Aguilar, Luis; Morales, Lucía; Gómez-Romero, Laura; Reyes, José; Garciarubio, Alejandro; Boege, Margareta; Dávila, Guillermo

    2018-01-01

    We present a conceptually simple, sensitive, precise, and essentially nonstatistical solution for the analysis of genome variation in haploid organisms. The generation of a Perfect Match Genomic Landscape (PMGL), which computes intergenome identity with single nucleotide resolution, reveals signatures of variation wherever a query genome differs from a reference genome. Such signatures encode the precise location of different types of variants, including single nucleotide variants, deletions, insertions, and amplifications, effectively introducing the concept of a general signature of variation. The precise nature of variants is then resolved through the generation of targeted alignments between specific sets of sequence reads and known regions of the reference genome. Thus, the perfect match logic decouples the identification of the location of variants from the characterization of their nature, providing a unified framework for the detection of genome variation. We assessed the performance of the PMGL strategy via simulation experiments. We determined the variation profiles of natural genomes and of a synthetic chromosome, both in the context of haploid yeast strains. Our approach uncovered variants that have previously escaped detection. Moreover, our strategy is ideally suited for further refining high-quality reference genomes. The source codes for the automated PMGL pipeline have been deposited in a public repository. PMID:29367403

  5. A Bayesian hierarchical model to detect differentially methylated loci from single nucleotide resolution sequencing data

    PubMed Central

    Feng, Hao; Conneely, Karen N.; Wu, Hao

    2014-01-01

    DNA methylation is an important epigenetic modification that has essential roles in cellular processes including gene regulation, development and disease and is widely dysregulated in most types of cancer. Recent advances in sequencing technology have enabled the measurement of DNA methylation at single nucleotide resolution through methods such as whole-genome bisulfite sequencing and reduced representation bisulfite sequencing. In DNA methylation studies, a key task is to identify differences under distinct biological contexts, for example, between tumor and normal tissue. A challenge in sequencing studies is that the number of biological replicates is often limited by the costs of sequencing. The small number of replicates leads to unstable variance estimation, which can reduce accuracy to detect differentially methylated loci (DML). Here we propose a novel statistical method to detect DML when comparing two treatment groups. The sequencing counts are described by a lognormal-beta-binomial hierarchical model, which provides a basis for information sharing across different CpG sites. A Wald test is developed for hypothesis testing at each CpG site. Simulation results show that the proposed method yields improved DML detection compared to existing methods, particularly when the number of replicates is low. The proposed method is implemented in the Bioconductor package DSS. PMID:24561809

  6. Clinical evaluation, biochemistry and genetic polymorphism analysis for the diagnosis of lactose intolerance in a population from northeastern Brazil.

    PubMed

    Ponte, Paulo Roberto Lins; de Medeiros, Pedro Henrique Quintela Soares; Havt, Alexandre; Caetano, Joselany Afio; Cid, David A C; Prata, Mara de Moura Gondim; Soares, Alberto Melo; Guerrant, Richard L; Mychaleckyj, Josyf; Lima, Aldo Ângelo Moreira

    2016-02-01

    This work aimed to evaluate and correlate symptoms, biochemical blood test results and single nucleotide polymorphisms for lactose intolerance diagnosis. A cross-sectional study was conducted in Fortaleza, Ceará, Brazil, with a total of 119 patients, 54 of whom were lactose intolerant. Clinical evaluation and biochemical blood tests were conducted after lactose ingestion and blood samples were collected for genotyping evaluation. In particular, the single nucleotide polymorphisms C>T-13910 and G>A-22018 were analyzed by restriction fragment length polymorphism/polymerase chain reaction and validated by DNA sequencing. Lactose-intolerant patients presented with more symptoms of flatulence (81.4%), bloating (68.5%), borborygmus (59.3%) and diarrhea (46.3%) compared with non-lactose-intolerant patients (p<0.05). We observed a significant association between the presence of the alleles T-13910 and A-22018 and the lactose-tolerant phenotype (p<0.05). After evaluation of the biochemical blood test results for lactose, we found that the most effective cutoff for glucose levels obtained for lactose malabsorbers was <15 mg/dL, presenting an area under the receiver operating characteristic curve greater than 80.3%, with satisfactory values for sensitivity and specificity. These data corroborate the association of these single nucleotide polymorphisms (C>T-13910 and G>A-22018) with lactose tolerance in this population and suggest clinical management for patients with lactose intolerance that considers single nucleotide polymorphism detection and a change in the biochemical blood test cutoff from <25 mg/dL to <15 mg/dL.

  7. 17q25 Locus Is Associated With White Matter Hyperintensity Volume in Ischemic Stroke, But Not With Lacunar Stroke Status

    PubMed Central

    Adib-Samii, Poneh; Rost, Natalia; Traylor, Matthew; Devan, William; Biffi, Alessandro; Lanfranconi, Silvia; Fitzpatrick, Kaitlin; Bevan, Steve; Kanakis, Allison; Valant, Valerie; Gschwendtner, Andreas; Malik, Rainer; Richie, Alexa; Gamble, Dale; Segal, Helen; Parati, Eugenio A.; Ciusani, Emilio; Holliday, Elizabeth G.; Maguire, Jane; Wardlaw, Joanna; Worrall, Bradford; Bis, Joshua; Wiggins, Kerri L.; Longstreth, Will; Kittner, Steve J.; Cheng, Yu-Ching; Mosley, Thomas; Falcone, Guido J.; Furie, Karen L.; Leiva-Salinas, Carlos; Lau, Benison C.; Khan, Muhammed Saleem; Sharma, Pankaj; Fornage, Myriam; Mitchell, Braxton D.; Psaty, Bruce M.; Sudlow, Cathie; Levi, Christopher; Boncoraglio, Giorgio B.; Rothwell, Peter M.; Meschia, James; Dichgans, Martin; Rosand, Jonathan; Markus, Hugh S.

    2013-01-01

    Background and Purpose Recently, a novel locus at 17q25 was associated with white matter hyperintensities (WMH) on MRI in stroke-free individuals. We aimed to replicate the association with WMH volume (WMHV) in patients with ischemic stroke. If the association acts by promoting a small vessel arteriopathy, it might be expected to also associate with lacunar stroke. Methods We quantified WMH on MRI in the stroke-free hemisphere of 2588 ischemic stroke cases. Association between WMHV and 6 single-nucleotide polymorphisms at chromosome 17q25 was assessed by linear regression. These single-nucleotide polymorphisms were also investigated for association with lacunar stroke in 1854 cases and 51 939 stroke-free controls from METASTROKE. Meta-analyses with previous reports and a genetic risk score approach were applied to identify other novel WMHV risk variants and uncover shared genetic contributions to WMHV in community participants without stroke and ischemic stroke. Results Single-nucleotide polymorphisms at 17q25 were associated with WMHV in ischemic stroke, the most significant being rs9894383 (P=0.0006). In contrast, there was no association between any single-nucleotide polymorphism and lacunar stroke. A genetic risk score analysis revealed further genetic components to WMHV shared between community participants without stroke and ischemic stroke. Conclusions This study provides support for an association between the 17q25 locus and WMH. In contrast, it is not associated with lacunar stroke, suggesting that the association does not act by promoting small-vessel arteriopathy or the same arteriopathy responsible for lacunar infarction. PMID:23674528

  8. Clinical evaluation, biochemistry and genetic polymorphism analysis for the diagnosis of lactose intolerance in a population from northeastern Brazil

    PubMed Central

    Ponte, Paulo Roberto Lins; de Medeiros, Pedro Henrique Quintela Soares; Havt, Alexandre; Caetano, Joselany Afio; Cid, David A C; de Moura Gondim Prata, Mara; Soares, Alberto Melo; Guerrant, Richard L; Mychaleckyj, Josyf; Lima, Aldo Ângelo Moreira

    2016-01-01

    OBJECTIVE: This work aimed to evaluate and correlate symptoms, biochemical blood test results and single nucleotide polymorphisms for lactose intolerance diagnosis. METHOD: A cross-sectional study was conducted in Fortaleza, Ceará, Brazil, with a total of 119 patients, 54 of whom were lactose intolerant. Clinical evaluation and biochemical blood tests were conducted after lactose ingestion and blood samples were collected for genotyping evaluation. In particular, the single nucleotide polymorphisms C>T-13910 and G>A-22018 were analyzed by restriction fragment length polymorphism/polymerase chain reaction and validated by DNA sequencing. RESULTS: Lactose-intolerant patients presented with more symptoms of flatulence (81.4%), bloating (68.5%), borborygmus (59.3%) and diarrhea (46.3%) compared with non-lactose-intolerant patients (p<0.05). We observed a significant association between the presence of the alleles T-13910 and A-22018 and the lactose-tolerant phenotype (p<0.05). After evaluation of the biochemical blood test results for lactose, we found that the most effective cutoff for glucose levels obtained for lactose malabsorbers was <15 mg/dL, presenting an area under the receiver operating characteristic curve greater than 80.3%, with satisfactory values for sensitivity and specificity. CONCLUSIONS: These data corroborate the association of these single nucleotide polymorphisms (C>T-13910 and G>A-22018) with lactose tolerance in this population and suggest clinical management for patients with lactose intolerance that considers single nucleotide polymorphism detection and a change in the biochemical blood test cutoff from <25 mg/dL to <15 mg/dL. PMID:26934237

  9. Short double-stranded RNAs with an overhanging 5' ppp-nucleotide, as found in arenavirus genomes, act as RIG-I decoys.

    PubMed

    Marq, Jean-Baptiste; Hausmann, Stéphane; Veillard, Nicolas; Kolakofsky, Daniel; Garcin, Dominique

    2011-02-25

    Arenavirus RNA genomes are initiated by a "prime and realign" mechanism, such that the initiating GTP is found as a single unpaired (overhanging) nucleotide when the complementary genome ends anneal to form double-stranded (ds) RNA panhandle structures. dsRNAs modeled on these structures do not induce interferon (IFN), as opposed to blunt-ended (5' ppp)dsRNA. This study examines whether these viral structures can also act as decoys, by trapping RIG-I in inactive dsRNA complexes. We examined the ability of various dsRNAs to activate the RIG-I ATPase (presumably a measure of helicase translocation on dsRNA) relative to their ability to induce IFN. We found that there is no simple relationship between these two properties, as if RIG-I can translocate on short dsRNAs without inducing IFN. Moreover, we found that (5' ppp)dsRNAs with a single unpaired 5' ppp-nucleotide can in fact competitively inhibit the ability of blunt-ended (5' ppp)dsRNAs to induce IFN when co-transfected into cells and that this inhibition is strongly dependent on the presence of the 5' ppp. In contrast, (5' ppp)dsRNAs with a single unpaired 5' ppp-nucleotide does not inhibit poly(I-C)-induced IFN activation, which is independent of the presence of a 5' ppp group.

  10. Gut metagenomes of type 2 diabetic patients have characteristic single-nucleotide polymorphism distribution in Bacteroides coprocola.

    PubMed

    Chen, Yaowen; Li, Zongcheng; Hu, Shuofeng; Zhang, Jian; Wu, Jiaqi; Shao, Ningsheng; Bo, Xiaochen; Ni, Ming; Ying, Xiaomin

    2017-02-01

    Gut microbes play a critical role in human health and disease, and researchers have begun to characterize their genomes, the so-called gut metagenome. Thus far, metagenomics studies have focused on genus- or species-level composition and microbial gene sets, while strain-level composition and single-nucleotide polymorphism (SNP) have been overlooked. The gut metagenomes of type 2 diabetes (T2D) patients have been found to be enriched with butyrate-producing bacteria and sulfate reduction functions. However, it is not known whether the gut metagenomes of T2D patients have characteristic strain patterns or SNP distributions. We downloaded public gut metagenome datasets from 170 T2D patients and 174 healthy controls and performed a systematic comparative analysis of their metagenome SNPs. We found that Bacteroides coprocola, whose relative abundance did not differ between the groups, had a characteristic distribution of SNPs in the T2D patient group. We identified 65 genes, all in B. coprocola, that had remarkably different enrichment of SNPs. The first and sixth ranked genes encode glycosyl hydrolases (GenBank accession EDU99824.1 and EDV02301.1). Interestingly, alpha-glucosidase, which is also a glycosyl hydrolase located in the intestine, is an important drug target of T2D. These results suggest that different strains of B. coprocola may have different roles in human gut and a specific set of B. coprocola strains are correlated with T2D.

  11. Molecular Diagnostics in Transfusion Medicine: In Capillary, on a Chip, in Silico, or in Flight?

    PubMed Central

    Garritsen, Henk S.P.; Xiu-Cheng Fan, Alex; Lenz, Daniela; Hannig, Horst; Yan Zhong, Xiao; Geffers, Robert; Lindenmaier, Werner; Dittmar, Kurt E.J.; Wörmann, Bernhard

    2009-01-01

    Summary Serology, defined as antibody-based diagnostics, has been regarded as the diagnostic gold standard in transfusion medicine. Nowadays however the impact of molecular diagnostics in transfusion medicine is rapidly growing. Molecular diagnostics can improve tissue typing (HLA typing), increase safety of blood products (NAT testing of infectious diseases), and enable blood group typing in difficult situations (after transfusion of blood products or prenatal non-invasive RhD typing). Most of the molecular testing involves the determination of the presence of single nucleotide polymorphisms (SNPs). Antigens (e.g. blood group antigens) mostly result from single nucleotide differences in critical positions. However, most blood group systems cannot be determined by looking at a single SNP. To identify members of a blood group system a number of critical SNPs have to be taken into account. The platforms which are currently used to perform molecular diagnostics are mostly gel-based, requiring time-consuming multiple manual steps. To implement molecular methods in transfusion medicine in the future the development of higher-throughput SNP genotyping non-gel-based platforms which allow a rapid, cost-effective screening are essential. Because of its potential for automation, high throughput and cost effectiveness the special focus of this paper is a relative new technique: SNP genotyping by MALDI-TOF MS analysis. PMID:21113259

  12. Technologies in the Whole-Genome Age: MALDI-TOF-Based Genotyping.

    PubMed

    Vogel, Nicolas; Schiebel, Katrin; Humeny, Andreas

    2009-01-01

    With the decipherment of the human genome, new questions have moved into the focus of today's research. One key aspect represents the discovery of DNA variations capable to influence gene transcription, RNA splicing, or regulating processes, and their link to pathology. Matrix-assisted laser desorption/ionization-time of flight mass spectrometry (MALDI-TOF-MS) is a powerful tool for the qualitative investigation and relative quantification of variations like single nucleotide polymorphisms, DNA methylation, microsatellite instability, or loss of heterozygosity. After its introduction into proteomics, efforts were made to adopt this technique to DNA analysis. Initially intended for peptide/protein analysis, it held several difficulties for application to nucleic acids. Today, MALDI-TOF-MS has reached worldwide acceptance and application in nucleic acid research, with a wide spectrum of methods being available. One of the most versatile approaches relies on primer extension to genotype single alleles, microsatellite repeat lengths or the methylation status of a given cytosine. Optimized methods comprising intelligent primer design and proper nucleotide selection for primer extension enabled multiplexing of reactions, rendering the analysis more economic due to parallel genotyping of several alleles in a single experiment. Laboratories equipped with MALDI-TOF-MS possess a universal technical platform for the analysis of a large variety of different molecules.

  13. Discriminating DNA mismatches by electrochemical and gravimetric techniques.

    PubMed

    Mazouz, Zouhour; Fourati, Najla; Zerrouki, Chouki; Ommezine, Asma; Rebhi, Lamia; Yaakoubi, Nourdin; Kalfat, Rafik; Othmane, Ali

    2013-10-15

    A silicon nitride functionalized electrode and a 104 MHz lithium tantalate (LiTaO₃) surface acoustic wave (SAW) sensor have been used to investigate target-probe recognition processes. Electrochemical and gravimetric measurements have been considered to monitor hybridization of single base mismatch (SBM) in synthetic oligonucleotides and single-nucleotide polymorphisms ApoE in real clinical genotypes. Obvious discrimination of SBM in nucleotides has been shown by both gravimetric and electrochemical techniques, without labeling nor amplification. Investigations on mismatches nature and position have also been considered. For guanine-adenine (GA), guanine-thymine (GT) and guanine-guanine (GG) mismatches, the sensors responses present a dependence upon positions. Considering the capacitance variations and hybridization rates, results showed that gravimetric transduction is more sensitive than electrochemical one. Moreover, the highest value of GT hybridization rate (in the middle position) was found in accordance with the nearest-neighbor model, where the considered configuration appears as the most thermodynamically stable. For the real samples, where the electrochemical transduction, by combining capacitance and flat-band potential measurements, were found more sensitive, the results show that the realized sensor permits an unambiguous discrimination of recognition between fully complementary, non-complementary and single base mismatched targets, and even between the combination of differently matched strands. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Genetics of Oxidative Stress in Obesity

    PubMed Central

    Rupérez, Azahara I.; Gil, Angel; Aguilera, Concepción M.

    2014-01-01

    Obesity is a multifactorial disease characterized by the excessive accumulation of fat in adipose tissue and peripheral organs. Its derived metabolic complications are mediated by the associated oxidative stress, inflammation and hypoxia. Oxidative stress is due to the excessive production of reactive oxygen species or diminished antioxidant defenses. Genetic variants, such as single nucleotide polymorphisms in antioxidant defense system genes, could alter the efficacy of these enzymes and, ultimately, the risk of obesity; thus, studies investigating the role of genetic variations in genes related to oxidative stress could be useful for better understanding the etiology of obesity and its metabolic complications. The lack of existing literature reviews in this field encouraged us to gather the findings from studies focusing on the impact of single nucleotide polymorphisms in antioxidant enzymes, oxidative stress-producing systems and transcription factor genes concerning their association with obesity risk and its phenotypes. In the future, the characterization of these single nucleotide polymorphisms (SNPs) in obese patients could contribute to the development of controlled antioxidant therapies potentially beneficial for the treatment of obesity-derived metabolic complications. PMID:24562334

  15. Genetics of oxidative stress in obesity.

    PubMed

    Rupérez, Azahara I; Gil, Angel; Aguilera, Concepción M

    2014-02-20

    Obesity is a multifactorial disease characterized by the excessive accumulation of fat in adipose tissue and peripheral organs. Its derived metabolic complications are mediated by the associated oxidative stress, inflammation and hypoxia. Oxidative stress is due to the excessive production of reactive oxygen species or diminished antioxidant defenses. Genetic variants, such as single nucleotide polymorphisms in antioxidant defense system genes, could alter the efficacy of these enzymes and, ultimately, the risk of obesity; thus, studies investigating the role of genetic variations in genes related to oxidative stress could be useful for better understanding the etiology of obesity and its metabolic complications. The lack of existing literature reviews in this field encouraged us to gather the findings from studies focusing on the impact of single nucleotide polymorphisms in antioxidant enzymes, oxidative stress-producing systems and transcription factor genes concerning their association with obesity risk and its phenotypes. In the future, the characterization of these single nucleotide polymorphisms (SNPs) in obese patients could contribute to the development of controlled antioxidant therapies potentially beneficial for the treatment of obesity-derived metabolic complications.

  16. Noninvasive Prenatal Diagnosis of Single-Gene Disorders by Use of Droplet Digital PCR.

    PubMed

    Camunas-Soler, Joan; Lee, Hojae; Hudgins, Louanne; Hintz, Susan R; Blumenfeld, Yair J; El-Sayed, Yasser Y; Quake, Stephen R

    2018-02-01

    Prenatal diagnosis in pregnancies at risk of single-gene disorders is currently performed using invasive methods such as chorionic villus sampling and amniocentesis. This is in contrast with screening for common aneuploidies, for which noninvasive methods with a single maternal blood sample have become standard clinical practice. We developed a protocol for noninvasive prenatal diagnosis of inherited single-gene disorders using droplet digital PCR from circulating cell-free DNA (cfDNA) in maternal plasma. First, the amount of cfDNA and fetal fraction is determined using a panel of TaqMan assays targeting high-variability single-nucleotide polymorphisms. Second, the ratio of healthy and diseased alleles in maternal plasma is quantified using TaqMan assays targeting the mutations carried by the parents. Two validation approaches of the mutation assay are presented. We collected blood samples from 9 pregnancies at risk for different single-gene disorders, including common conditions and rare metabolic disorders. We measured cases at risk of hemophilia, ornithine transcarbamylase deficiency, cystic fibrosis, β-thalassemia, mevalonate kinase deficiency, acetylcholine receptor deficiency, and DFNB1 nonsyndromic hearing loss. We correctly differentiated affected and unaffected pregnancies (2 affected, 7 unaffected), confirmed by neonatal testing. We successfully measured an affected pregnancy as early as week 11 and with a fetal fraction as low as 3.7% (0.3). Our method detects single-nucleotide mutations of autosomal recessive diseases as early as the first trimester of pregnancy. This is of importance for metabolic disorders in which early diagnosis can affect management of the disease and reduce complications and anxiety related to invasive testing. © 2017 American Association for Clinical Chemistry.

  17. Binding of DNA hairpins to an assembler-strand as part of a primordial translation device

    NASA Astrophysics Data System (ADS)

    Baumann, Ulrich

    1987-09-01

    A crucial event in the process leading to the origin of life is the emergence of a simple translation device. To approach experimental realization of this device the binding ability of short DNA hairpins to complementary oligonucleotides fixed on a solid support was investigated. The binding is achieved by base pairing between the loop nucleotides of the hairpins containing different numbers of adenosine residues and oligothymidylates covalently linked to cellulose. The loop has to consist of at least five nucleotides to achieve binding. The exact number of established base pairs was determined in two ways. First, the elution temperatures of hairpins and those of oligoadenylates which had the length of the loop were compared. Secondly, the architecture of the loop was analyzed by means of the single-strand-specific nuclease from mung bean acting as structural probe. Onlyn-2 of n loop nucleotides of a hairpin are able to form base pairs. Therefore, a strong evidence for the formation of a triplet of base pairs between primeval tRNA and mRNA sufficient to stabilize the complex enzyme-free is given.

  18. Expansion of inverted repeat does not decrease substitution rates in Pelargonium plastid genomes.

    PubMed

    Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K

    2017-04-01

    For species with minor inverted repeat (IR) boundary changes in the plastid genome (plastome), nucleotide substitution rates were previously shown to be lower in the IR than the single copy regions (SC). However, the impact of large-scale IR expansion/contraction on plastid nucleotide substitution rates among closely related species remains unclear. We included plastomes from 22 Pelargonium species, including eight newly sequenced genomes, and used both pairwise and model-based comparisons to investigate the impact of the IR on sequence evolution in plastids. Ten types of plastome organization with different inversions or IR boundary changes were identified in Pelargonium. Inclusion in the IR was not sufficient to explain the variation of nucleotide substitution rates. Instead, the rate heterogeneity in Pelargonium plastomes was a mixture of locus-specific, lineage-specific and IR-dependent effects. Our study of Pelargonium plastomes that vary in IR length and gene content demonstrates that the evolutionary consequences of retaining these repeats are more complicated than previously suggested. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  19. The complete genome sequence and genetic analysis of ΦCA82 a novel uncultured microphage from the turkey gastrointestinal system

    PubMed Central

    2011-01-01

    The genomic DNA sequence of a novel enteric uncultured microphage, ΦCA82 from a turkey gastrointestinal system was determined utilizing metagenomics techniques. The entire circular, single-stranded nucleotide sequence of the genome was 5,514 nucleotides. The ΦCA82 genome is quite different from other microviruses as indicated by comparisons of nucleotide similarity, predicted protein similarity, and functional classifications. Only three genes showed significant similarity to microviral proteins as determined by local alignments using BLAST analysis. ORF1 encoded a predicted phage F capsid protein that was phylogenetically most similar to the Microviridae ΦMH2K member's major coat protein. The ΦCA82 genome also encoded a predicted minor capsid protein (ORF2) and putative replication initiation protein (ORF3) most similar to the microviral bacteriophage SpV4. The distant evolutionary relationship of ΦCA82 suggests that the divergence of this novel turkey microvirus from other microviruses may reflect unique evolutionary pressures encountered within the turkey gastrointestinal system. PMID:21714899

  20. WEB-server for search of a periodicity in amino acid and nucleotide sequences

    NASA Astrophysics Data System (ADS)

    E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

    2017-12-01

    A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

  1. Quantum-Sequencing: Fast electronic single DNA molecule sequencing

    NASA Astrophysics Data System (ADS)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

  2. Conformational Smear Characterization and Binning of Single-Molecule Conductance Measurements for Enhanced Molecular Recognition.

    PubMed

    Korshoj, Lee E; Afsari, Sepideh; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-01

    Electronic conduction or charge transport through single molecules depends primarily on molecular structure and anchoring groups and forms the basis for a wide range of studies from molecular electronics to DNA sequencing. Several high-throughput nanoelectronic methods such as mechanical break junctions, nanopores, conductive atomic force microscopy, scanning tunneling break junctions, and static nanoscale electrodes are often used for measuring single-molecule conductance. In these measurements, "smearing" due to conformational changes and other entropic factors leads to large variances in the observed molecular conductance, especially in individual measurements. Here, we show a method for characterizing smear in single-molecule conductance measurements and demonstrate how binning measurements according to smear can significantly enhance the use of individual conductance measurements for molecular recognition. Using quantum point contact measurements on single nucleotides within DNA macromolecules, we demonstrate that the distance over which molecular junctions are maintained is a measure of smear, and the resulting variance in unbiased single measurements depends on this smear parameter. Our ability to identify individual DNA nucleotides at 20× coverage increases from 81.3% accuracy without smear analysis to 93.9% with smear characterization and binning (SCRIB). Furthermore, merely 7 conductance measurements (7× coverage) are needed to achieve 97.8% accuracy for DNA nucleotide recognition when only low molecular smear measurements are used, which represents a significant improvement over contemporary sequencing methods. These results have important implications in a broad range of molecular electronics applications from designing robust molecular switches to nanoelectronic DNA sequencing.

  3. Invasive Cyprinid Fish in Europe Originate from the Single Introduction of an Admixed Source Population Followed by a Complex Pattern of Spread

    PubMed Central

    Simon, Andrea; Britton, Robert; Gozlan, Rodolphe; van Oosterhout, Cock; Volckaert, Filip A. M.; Hänfling, Bernd

    2011-01-01

    The Asian cyprinid fish, the topmouth gudgeon (Pseudorasbora parva), was introduced into Europe in the 1960s. A highly invasive freshwater fish, it is currently found in at least 32 countries outside its native range. Here we analyse a 700 base pair fragment of the mitochondrial cytochrome b gene to examine different models of colonisation and spread within the invasive range, and to investigate the factors that may have contributed to their invasion success. Haplotype and nucleotide diversity of the introduced populations from continental Europe was higher than that of the native populations, although two recently introduced populations from the British Isles showed low levels of variability. Based on coalescent theory, all introduced and some native populations showed a relative excess of nucleotide diversity compared to haplotype diversity. This suggests that these populations are not in mutation-drift equilibrium, but rather that the relative inflated level of nucleotide diversity is consistent with recent admixture. This study elucidates the colonisation patterns of P. parva in Europe and provides an evolutionary framework of their invasion. It supports the hypothesis that their European colonisation was initiated by their introduction to a single location or small geographic area with subsequent complex pattern of spread including both long distance and stepping-stone dispersal. Furthermore, it was preceded by, or associated with, the admixture of genetically diverse source populations that may have augmented its invasive-potential. PMID:21674031

  4. Ultra-Deep Sequencing Analysis of the Hepatitis A Virus 5'-Untranslated Region among Cases of the Same Outbreak from a Single Source

    PubMed Central

    Wu, Shuang; Nakamoto, Shingo; Kanda, Tatsuo; Jiang, Xia; Nakamura, Masato; Miyamura, Tatsuo; Shirasawa, Hiroshi; Sugiura, Nobuyuki; Takahashi-Nakaguchi, Azusa; Gonoi, Tohru; Yokosuka, Osamu

    2014-01-01

    Hepatitis A virus (HAV) is a causative agent of acute viral hepatitis for which an effective vaccine has been developed. Here we describe ultra-deep pyrosequences (UDPSs) of HAV 5'-untranslated region (5'UTR) among cases of the same outbreak, which arose from a single source, associated with a revolving sushi bar. We determined the reference sequence from HAV-derived clone from an attendant by the Sanger method. Sixteen UDPSs from this outbreak and one from another sporadic case were compared with this reference. Nucleotide errors yielded a UDPS error rate of < 1%. This study confirmed that nucleotide substitutions of this region are transition mutations in outbreak cases, that insertion was observed only in non-severe cases, and that these nucleotide substitutions were different from those of the sporadic case. Analysis of UDPSs detected low-prevalence HAV variations in 5'UTR, but no specific mutations associated with severity in these outbreak cases. To our surprise, HAV strains in this outbreak conserved HAV IRES sequence even if we performed analysis of UDPSs. UDPS analysis of HAV 5'UTR gave us no association between the disease severity of hepatitis A and HAV 5'UTR substitutions. It might be more interesting to perform ultra-deep sequencing of full length HAV genome in order to reveal possible unknown genomic determinants associated with disease severity. Further studies will be needed. PMID:24396287

  5. Translational genomics for abiotic stress in sorghum: transcriptional profiling and validation of SNP markers between germplasm with differential cold tolerance

    USDA-ARS?s Scientific Manuscript database

    One focus of the Sorghum Translational Genomics Lab (part of sorghum CRIS, PSGD, CSRL, USDA-ARS, Lubbock TX) is to utilize nucleotide variation between sorghum germplasm such as those derived from RNA seq for translation and validation of Single Nucleotide Polymorphism (SNP) into easy access DNA m...

  6. A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms.

    PubMed

    Zeng, Lingwen; Xiao, Zhuo

    2017-01-01

    A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.

  7. Microarray study of single nucleotide polymorphisms and expression of ATP-binding cassette genes in breast tumors

    NASA Astrophysics Data System (ADS)

    Tsyganov, M. M.; Ibragimova, M. K.; Karabut, I. V.; Freydin, M. B.; Choinzonov, E. L.; Litvyakov, N. V.

    2015-11-01

    Our previous research establishes that changes of expression of the ATP-binding cassette genes family is connected with the neoadjuvant chemotherapy effect. However, the mechanism of regulation of resistance gene expression remains unclear. As many researchers believe, single nucleotide polymorphisms can be involved in this process. Thereupon, microarray analysis is used to study polymorphisms in ATP-binding cassette genes. It is thus found that MDR gene expression is connected with 5 polymorphisms, i.e. rs241432, rs241429, rs241430, rs3784867, rs59409230, which participate in the regulation of expression of own genes.

  8. Trichomonas vaginalis Metronidazole Resistance Is Associated with Single Nucleotide Polymorphisms in the Nitroreductase Genes ntr4Tv and ntr6Tv

    PubMed Central

    Paulish-Miller, Teresa E.; Augostini, Peter; Schuyler, Jessica A.; Smith, William L.; Mordechai, Eli; Adelson, Martin E.; Gygax, Scott E.; Secor, William E.

    2014-01-01

    Metronidazole resistance in the sexually transmitted parasite Trichomonas vaginalis is a problematic public health issue. We have identified single nucleotide polymorphisms (SNPs) in two nitroreductase genes (ntr4Tv and ntr6Tv) associated with resistance. These SNPs were associated with one of two distinct T. vaginalis populations identified by multilocus sequence typing, yet one SNP (ntr6Tv A238T), which results in a premature stop codon, was associated with resistance independent of population structure and may be of diagnostic value. PMID:24550324

  9. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    PubMed

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  10. Mining of haplotype-based expressed sequence tag single nucleotide polymorphisms in citrus

    PubMed Central

    2013-01-01

    Background Single nucleotide polymorphisms (SNPs), the most abundant variations in a genome, have been widely used in various studies. Detection and characterization of citrus haplotype-based expressed sequence tag (EST) SNPs will greatly facilitate further utilization of these gene-based resources. Results In this paper, haplotype-based SNPs were mined out of publicly available citrus expressed sequence tags (ESTs) from different citrus cultivars (genotypes) individually and collectively for comparison. There were a total of 567,297 ESTs belonging to 27 cultivars in varying numbers and consequentially yielding different numbers of haplotype-based quality SNPs. Sweet orange (SO) had the most (213,830) ESTs, generating 11,182 quality SNPs in 3,327 out of 4,228 usable contigs. Summed from all the individually mining results, a total of 25,417 quality SNPs were discovered – 15,010 (59.1%) were transitions (AG and CT), 9,114 (35.9%) were transversions (AC, GT, CG, and AT), and 1,293 (5.0%) were insertion/deletions (indels). A vast majority of SNP-containing contigs consisted of only 2 haplotypes, as expected, but the percentages of 2 haplotype contigs varied widely in these citrus cultivars. BLAST of the 25,417 25-mer SNP oligos to the Clementine reference genome scaffolds revealed 2,947 SNPs had “no hits found”, 19,943 had 1 unique hit / alignment, 1,571 had one hit and 2+ alignments per hit, and 956 had 2+ hits and 1+ alignment per hit. Of the total 24,293 scaffold hits, 23,955 (98.6%) were on the main scaffolds 1 to 9, and only 338 were on 87 minor scaffolds. Most alignments had 100% (25/25) or 96% (24/25) nucleotide identities, accounting for 93% of all the alignments. Considering almost all the nucleotide discrepancies in the 24/25 alignments were at the SNP sites, it served well as in silico validation of these SNPs, in addition to and consistent with the rate (81%) validated by sequencing and SNaPshot assay. Conclusions High-quality EST-SNPs from different citrus genotypes were detected, and compared to estimate the heterozygosity of each genome. All the SNP oligo sequences were aligned with the Clementine citrus genome to determine their distribution and uniqueness and for in silico validation, in addition to SNaPshot and sequencing validation of selected SNPs. PMID:24175923

  11. CNG and HCN channels: two peas, one pod.

    PubMed

    Craven, Kimberley B; Zagotta, William N

    2006-01-01

    Cyclic nucleotide-activated ion channels play a fundamental role in a variety of physiological processes. By opening in response to intracellular cyclic nucleotides, they translate changes in concentrations of signaling molecules to changes in membrane potential. These channels belong to two families: the cyclic nucleotide-gated (CNG) channels and the hyperpolarization-activated cyclic nucleotide-modulated (HCN) channels. The two families exhibit high sequence similarity and belong to the superfamily of voltage-gated potassium channels. Whereas HCN channels are activated by voltage and CNG channels are virtually voltage independent, both channels are activated by cyclic nucleotide binding. Furthermore, the channels are thought to have similar channel structures, leading to similar mechanisms of activation by cyclic nucleotides. However, although these channels are structurally and behaviorally similar, they have evolved to perform distinct physiological functions. This review describes the physiological roles and biophysical behavior of CNG and HCN channels. We focus on how similarities in structure and activation mechanisms result in common biophysical models, allowing CNG and HCN channels to be viewed as a single genre.

  12. Structure of a eukaryotic cyclic nucleotide-gated channel

    PubMed Central

    Li, Minghui; Zhou, Xiaoyuan; Wang, Shu; Michailidis, Ioannis; Gong, Ye; Su, Deyuan; Li, Huan; Li, Xueming; Yang, Jian

    2018-01-01

    Summary Cyclic nucleotide-gated (CNG) channels are essential for vision and olfaction. They belong to the voltage-gated ion channel superfamily but their activities are controlled by intracellular cyclic nucleotides instead of transmembrane voltage. Here we report a 3.5 Å-resolution single-particle electron cryomicroscopy structure of a CNG channel from C. elegans in the cGMP-bound open state. The channel has an unusual voltage-sensor-like domain (VSLD), accounting for its deficient voltage dependence. A C-terminal linker connecting S6 and the cyclic nucleotide-binding domain interacts directly with both the VSLD and pore domain, forming a gating ring that couples conformational changes triggered by cyclic nucleotide binding to the gate. The selectivity filter is lined by the carboxylate side chains of a functionally important glutamate and three rings of backbone carbonyls. This structure provides a new framework for understanding mechanisms of ion permeation, gating and channelopathy of CNG channels and cyclic nucleotide modulation of related channels. PMID:28099415

  13. Analysis of transitions at two-fold redundant sites in mammalian genomes. Transition redundant approach-to-equilibrium (TREx) distance metrics

    PubMed Central

    Li, Tang; Chamberlin, Stephen G; Caraco, M Daniel; Liberles, David A; Gaucher, Eric A; Benner, Steven A

    2006-01-01

    Background The exchange of nucleotides at synonymous sites in a gene encoding a protein is believed to have little impact on the fitness of a host organism. This should be especially true for synonymous transitions, where a pyrimidine nucleotide is replaced by another pyrimidine, or a purine is replaced by another purine. This suggests that transition redundant exchange (TREx) processes at the third position of conserved two-fold codon systems might offer the best approximation for a neutral molecular clock, serving to examine, within coding regions, theories that require neutrality, determine whether transition rate constants differ within genes in a single lineage, and correlate dates of events recorded in genomes with dates in the geological and paleontological records. To date, TREx analysis of the yeast genome has recognized correlated duplications that established a new metabolic strategies in fungi, and supported analyses of functional change in aromatases in pigs. TREx dating has limitations, however. Multiple transitions at synonymous sites may cause equilibration and loss of information. Further, to be useful to correlate events in the genomic record, different genes within a genome must suffer transitions at similar rates. Results A formalism to analyze divergence at two fold redundant codon systems is presented. This formalism exploits two-state approach-to-equilibrium kinetics from chemistry. This formalism captures, in a single equation, the possibility of multiple substitutions at individual sites, avoiding any need to "correct" for these. The formalism also connects specific rate constants for transitions to specific approximations in an underlying evolutionary model, including assumptions that transition rate constants are invariant at different sites, in different genes, in different lineages, and at different times. Therefore, the formalism supports analyses that evaluate these approximations. Transitions at synonymous sites within two-fold redundant coding systems were examined in the mouse, rat, and human genomes. The key metric (f2), the fraction of those sites that holds the same nucleotide, was measured for putative ortholog pairs. A transition redundant exchange (TREx) distance was calculated from f2 for these pairs. Pyrimidine-pyrimidine transitions at these sites occur approximately 14% faster than purine-purine transitions in various lineages. Transition rate constants were similar in different genes within the same lineages; within a set of orthologs, the f2 distribution is only modest overdispersed. No correlation between disparity and overdispersion is observed. In rodents, evidence was found for greater conservation of TREx sites in genes on the X chromosome, accounting for a small part of the overdispersion, however. Conclusion The TREx metric is useful to analyze the history of transition rate constants within these mammals over the past 100 million years. The TREx metric estimates the extent to which silent nucleotide substitutions accumulate in different genes, on different chromosomes, with different compositions, in different lineages, and at different times. PMID:16545144

  14. Single nucleotide editing without DNA cleavage using CRISPR/Cas9-deaminase in the sea urchin embryo.

    PubMed

    Shevidi, Saba; Uchida, Alicia; Schudrowitz, Natalie; Wessel, Gary M; Yajima, Mamiko

    2017-12-01

    A single base pair mutation in the genome can result in many congenital disorders in humans. The recent gene editing approach using CRISPR/Cas9 has rapidly become a powerful tool to replicate or repair such mutations in the genome. These approaches rely on cleaving DNA, while presenting unexpected risks. In this study, we demonstrate a modified CRISPR/Cas9 system fused to cytosine deaminase (Cas9-DA), which induces a single nucleotide conversion in the genome. Cas9-DA was introduced into sea urchin eggs with sgRNAs targeted for SpAlx1, SpDsh, or SpPks, each of which is critical for skeletogenesis, embryonic axis formation, or pigment formation, respectively. We found that both Cas9 and Cas9-DA edit the genome, and cause predicted phenotypic changes at a similar efficiency. Cas9, however, resulted in significant deletions in the genome centered on the gRNA target sequence, whereas Cas9-DA resulted in single or double nucleotide editing of C to T conversions within the gRNA target sequence. These results suggest that the Cas9-DA approach may be useful for manipulating gene activity with decreased risks of genomic aberrations. Developmental Dynamics 246:1036-1046, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  15. Analysis of mutational changes at the HLA locus in single human sperm.

    PubMed

    Huang, M M; Erlich, H A; Goodman, M F; Arnheim, N

    1995-01-01

    Using a simple and efficient single sperm PCR and direct sequencing method, we screened for HLA-DPB1 gene mutations that may give rise to new alleles at this highly polymorphic locus. More than 800 single sperm were studied from a heterozygous individual whose two alleles carried 16 nucleotide sequence differences clustered in six polymorphic regions. A potential microgene conversion event was detected. Unrepaired heteroduplex DNA similar to that which gives rise to postmeiotic segregation events in yeast was observed in three cases. Control experiments also revealed unusual sperm from DPB1 homozygous individuals. The data may help explain allelic diversity in the MHC and suggest that a possible source of human mosaicism may be incomplete DNA mismatch repair during gametogenesis.

  16. Germline contamination and leakage in whole genome somatic single nucleotide variant detection.

    PubMed

    Sendorek, Dorota H; Caloian, Cristian; Ellrott, Kyle; Bare, J Christopher; Yamaguchi, Takafumi N; Ewing, Adam D; Houlahan, Kathleen E; Norman, Thea C; Margolin, Adam A; Stuart, Joshua M; Boutros, Paul C

    2018-01-31

    The clinical sequencing of cancer genomes to personalize therapy is becoming routine across the world. However, concerns over patient re-identification from these data lead to questions about how tightly access should be controlled. It is not thought to be possible to re-identify patients from somatic variant data. However, somatic variant detection pipelines can mistakenly identify germline variants as somatic ones, a process called "germline leakage". The rate of germline leakage across different somatic variant detection pipelines is not well-understood, and it is uncertain whether or not somatic variant calls should be considered re-identifiable. To fill this gap, we quantified germline leakage across 259 sets of whole-genome somatic single nucleotide variant (SNVs) predictions made by 21 teams as part of the ICGC-TCGA DREAM Somatic Mutation Calling Challenge. The median somatic SNV prediction set contained 4325 somatic SNVs and leaked one germline polymorphism. The level of germline leakage was inversely correlated with somatic SNV prediction accuracy and positively correlated with the amount of infiltrating normal cells. The specific germline variants leaked differed by tumour and algorithm. To aid in quantitation and correction of leakage, we created a tool, called GermlineFilter, for use in public-facing somatic SNV databases. The potential for patient re-identification from leaked germline variants in somatic SNV predictions has led to divergent open data access policies, based on different assessments of the risks. Indeed, a single, well-publicized re-identification event could reshape public perceptions of the values of genomic data sharing. We find that modern somatic SNV prediction pipelines have low germline-leakage rates, which can be further reduced, especially for cloud-sharing, using pre-filtering software.

  17. Genetic variation in Pythium myriotylum based on SNP typing and development of a PCR-RFLP detection of isolates recovered from Pythium soft rot ginger.

    PubMed

    Le, D P; Smith, M K; Aitken, E A B

    2017-10-01

    Pythium myriotylum is responsible for severe losses in both capsicum and ginger crops in Australia under different regimes. Intraspecific genomic variation within the pathogen might explain the differences in aggressiveness and pathogenicity on diverse hosts. In this study, whole genome data of four P. myriotylum isolates recovered from three hosts and one Pythium zingiberis isolate were derived and analysed for sequence diversity based on single nucleotide polymorphisms (SNPs). A higher number of true and unique SNPs occurred in P. myriotylum isolates obtained from ginger with symptoms of Pythium soft rot (PSR) in Australia compared to other P. myriotylum isolates. Overall, SNPs were discovered more in the mitochondrial genome than those in the nuclear genome. Among the SNPs, a single substitution from the cytosine (C) to the thymine (T) in the partially sequenced CoxII gene of 14 representatives of PSR P. myriotylum isolates was within a restriction site of HinP1I enzyme which was used in the PCR-RFLP for detection and identification of the isolates without sequencing. The PCR-RFLP was also sensitive to detect PSR P. myriotylum strains from artificially infected ginger without the need for isolation for pure cultures. This is the first study of intraspecific variants of Pythium myriotylum isolates recovered from different hosts and origins based on single nucleotide polymorphism (SNP) genotyping of multiple genes. The SNPs discovered provide valuable makers for detection and identification of P. myriotylum strains initially isolated from Pythium soft rot (PSR) ginger by using PCR-RFLP of the CoxII locus. The PCR-RFLP was also sensitive to detect P. myriotylum directly from PSR ginger sampled from pot trials without the need of isolation for pure cultures. © 2017 The Society for Applied Microbiology.

  18. Evaluation of the reliability of maize reference assays for GMO quantification.

    PubMed

    Papazova, Nina; Zhang, David; Gruden, Kristina; Vojvoda, Jana; Yang, Litao; Buh Gasparic, Meti; Blejec, Andrej; Fouilloux, Stephane; De Loose, Marc; Taverniers, Isabel

    2010-03-01

    A reliable PCR reference assay for relative genetically modified organism (GMO) quantification must be specific for the target taxon and amplify uniformly along the commercialised varieties within the considered taxon. Different reference assays for maize (Zea mays L.) are used in official methods for GMO quantification. In this study, we evaluated the reliability of eight existing maize reference assays, four of which are used in combination with an event-specific polymerase chain reaction (PCR) assay validated and published by the Community Reference Laboratory (CRL). We analysed the nucleotide sequence variation in the target genomic regions in a broad range of transgenic and conventional varieties and lines: MON 810 varieties cultivated in Spain and conventional varieties from various geographical origins and breeding history. In addition, the reliability of the assays was evaluated based on their PCR amplification performance. A single base pair substitution, corresponding to a single nucleotide polymorphism (SNP) reported in an earlier study, was observed in the forward primer of one of the studied alcohol dehydrogenase 1 (Adh1) (70) assays in a large number of varieties. The SNP presence is consistent with a poor PCR performance observed for this assay along the tested varieties. The obtained data show that the Adh1 (70) assay used in the official CRL NK603 assay is unreliable. Based on our results from both the nucleotide stability study and the PCR performance test, we can conclude that the Adh1 (136) reference assay (T25 and Bt11 assays) as well as the tested high mobility group protein gene assay, which also form parts of CRL methods for quantification, are highly reliable. Despite the observed uniformity in the nucleotide sequence of the invertase gene assay, the PCR performance test reveals that this target sequence might occur in more than one copy. Finally, although currently not forming a part of official quantification methods, zein and SSIIb assays are found to be highly reliable in terms of nucleotide stability and PCR performance and are proposed as good alternative targets for a reference assay for maize.

  19. Visualizing polynucleotide polymerase machines at work

    PubMed Central

    Steitz, Thomas A

    2006-01-01

    The structures of T7 RNA polymerase (T7 RNAP) captured in the initiation and elongation phases of transcription, that of φ29 DNA polymerase bound to a primer protein and those of the multisubunit RNAPs bound to initiating factors provide insights into how these proteins can initiate RNA synthesis and synthesize 6–10 nucleotides while remaining bound to the site of initiation. Structural insight into the translocation of the product transcript and the separation of the downstream duplex DNA is provided by the structures of the four states of nucleotide incorporation. Single molecule and biochemical studies show a distribution of primer terminus positions that is altered by the binding of NTP and PPi ligands. This article reviews the insights that imaging the structure of polynucleotide polymerases at different steps of the polymerization reaction has provided on the mechanisms of the polymerization reaction. Movies are shown that allow the direct visualization of the conformational changes that the polymerases undergo during the different steps of polymerization. PMID:16900098

  20. [Identification and polymorphism of pectinase genes PGU in the Saccharomyces bayanus complex].

    PubMed

    Shalamitskiy, M Yu; Naumov, G I

    2016-05-01

    Pectinase (endo-polygalacturonase) is the key enzyme splitting plant pectin. The corresponding single gene PGU1 is documented for the yeast S. cerevisiae. On the basis of phylogenetic analysis of the PGU nucleotide sequence available in the GenBank, a family of divergent PGU genes is found in the species complex S. bayanus: S. bayanus var. uvarum, S. eubayanus, and hybrid taxon S. pastorianus. The PGU genes have different chromosome localization.

  1. Genome-wide patterns of recombination, linkage disequilibrium and nucleotide diversity from pooled resequencing and single nucleotide polymorphism genotyping unlock the evolutionary history of Eucalyptus grandis.

    PubMed

    Silva-Junior, Orzenil B; Grattapaglia, Dario

    2015-11-01

    We used high-density single nucleotide polymorphism (SNP) data and whole-genome pooled resequencing to examine the landscape of population recombination (ρ) and nucleotide diversity (ϴw ), assess the extent of linkage disequilibrium (r(2) ) and build the highest density linkage maps for Eucalyptus. At the genome-wide level, linkage disequilibrium (LD) decayed within c. 4-6 kb, slower than previously reported from candidate gene studies, but showing considerable variation from absence to complete LD up to 50 kb. A sharp decrease in the estimate of ρ was seen when going from short to genome-wide inter-SNP distances, highlighting the dependence of this parameter on the scale of observation adopted. Recombination was correlated with nucleotide diversity, gene density and distance from the centromere, with hotspots of recombination enriched for genes involved in chemical reactions and pathways of the normal metabolic processes. The high nucleotide diversity (ϴw = 0.022) of E. grandis revealed that mutation is more important than recombination in shaping its genomic diversity (ρ/ϴw = 0.645). Chromosome-wide ancestral recombination graphs allowed us to date the split of E. grandis (1.7-4.8 million yr ago) and identify a scenario for the recent demographic history of the species. Our results have considerable practical importance to Genome Wide Association Studies (GWAS), while indicating bright prospects for genomic prediction of complex phenotypes in eucalypt breeding. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  2. Genetic diversity of tyrosine hydroxylase (TH) and dopamine β-hydroxylase (DBH) genes in cattle breeds

    PubMed Central

    Lourenco-Jaramillo, Diana Lelidett; Sifuentes-Rincón, Ana María; Parra-Bracamonte, Gaspar Manuel; de la Rosa-Reyna, Xochitl Fabiola; Segura-Cabrera, Aldo; Arellano-Vera, Williams

    2012-01-01

    DNA from four cattle breeds was used to re-sequence all of the exons and 56% of the introns of the bovine tyrosine hydroxylase (TH) gene and 97% and 13% of the bovine dopamine β-hydroxylase (DBH) coding and non-coding sequences, respectively. Two novel single nucleotide polymorphisms (SNPs) and a microsatellite motif were found in the TH sequences. The DBH sequences contained 62 nucleotide changes, including eight non-synonymous SNPs (nsSNPs) that are of particular interest because they may alter protein function and therefore affect the phenotype. These DBH nsSNPs resulted in amino acid substitutions that were predicted to destabilize the protein structure. Six SNPs (one from TH and five from DBH non-synonymous SNPs) were genotyped in 140 animals; all of them were polymorphic and had a minor allele frequency of > 9%. There were significant differences in the intra- and inter-population haplotype distributions. The haplotype differences between Brahman cattle and the three B. t. taurus breeds (Charolais, Holstein and Lidia) were interesting from a behavioural point of view because of the differences in temperament between these breeds. PMID:22888292

  3. Differences in a ribosomal DNA sequence of Strongylus species allows identification of single eggs.

    PubMed

    Campbell, A J; Gasser, R B; Chilton, N B

    1995-03-01

    In the current study, molecular techniques were evaluated for the species identification of individual strongyle eggs. Adult worms of Strongylus edentatus, S. equinus and S. vulgaris were collected at necropsy from horses from Australia and the U.S.A. Genomic DNA was isolated and a ribosomal transcribed spacer (ITS-2) amplified and sequenced using polymerase chain reaction (PCR) techniques. The length of the ITS-2 sequence of S. edentatus, S. equinus and S. vulgaris ranged between 217 and 235 nucleotides. Extensive sequence analysis demonstrated a low degree (0-0.9%) of intraspecific variation in the ITS-2 for the Strongylus species examined, whereas the levels of interspecific differences (13-29%) were significantly greater. Interspecific differences in the ITS-2 sequences allowed unequivocal species identification of single worms and eggs using PCR-linked restriction fragment length polymorphism. These results demonstrate the potential of the ribosomal spacers as genetic markers for species identification of single strongyle eggs from horse faeces.

  4. The coherence of synthetic telomeres.

    PubMed Central

    Acevedo, O L; Dickinson, L A; Macke, T J; Thomas, C A

    1991-01-01

    The chromosomal telomeres of Oxytricha were synthesized and their ability to cohere examined on non-denaturing acrylamide gels containing the stabilizing cation K+. At least 5 different mobility species were observed, in addition to that of the monomeric telomere. By cohering synthetic telomeres containing different lengths of subtelomeric DNA, we showed that each of the different mobility species was a dimer of two telomeres. Since the different mobility species did not differ in numbers or sequences of nucleotides, they must correspond to different molecular shapes probably caused by different degrees of bending of the dimer. Paradoxically, telomeres with longer subtelomeric stems cohered more efficiently. In the presence of K+, solutions had to be heated to over 90 degrees before the telomeres separated. Various synthetic constructs, restriction endonuclease and dimethyl sulfate protection experiments showed that the only nucleotides involved in the cohered structures were the 16 base 'tails' of sequence 3'G4T4G4T4. Extension of this motif was actually inimical to coherence. Oligomers containing 2 G4T4 motifs protected their GN7 positions by forming dimers, those with 5 G4T4 could do so by internal folding, but the 3' terminal group of G4 was left unprotected. This suggests that only four groups of G4 are necessary for the cohered structure. Single-chain specific nuclease, S1, as well as osmium tetroxide, which oxidizes the thymine residues of single chains, reacted less efficiently with the cohered structures. Synthetic telomeres containing inosine replacing guanosine were not observed to cohere, indicating that the C2-NH2 is strongly stabilizing. The cohered structures appear to be unusually compact and sturdy units in which four G4 blocks form quadruplexes stabilized by K+. A new model for the cohered structure is presented. Images PMID:1648206

  5. Molecular characterization and expression profiling of BMP 3 gene in broiler and layer chicken.

    PubMed

    Divya, Devara; Bhattacharya, Tarun Kumar; Gnana Prakash, Manthani; Chatterjee, R N; Shukla, Renu; Guru Vishnu, Pothana Boyina; Vinoth, Amirthalingam; Dushyanth, Kotha

    2018-04-10

    A study was carried out to characterize and explore the expression profile of BMP 3 gene in control broiler and control layer chicken. The total open reading frame of BMP 3 (1389 bp) was cloned and sequenced. The control broiler and control layer chicken showed variation at nucleotide and amino acid level with reference gene (Gallus gallus, NCBI Acc. No. NM_001034819). When compared to reference gene, the control broiler showed four nucleotide differences (c.192A>G, c.519C>T, 903G>A and 960C>G), while, control layer showed variation at c.33G>C, 192A>G, 858G>A, 904G>A, 960C>G and 1257C>T making six differences in total. However, between control broiler and control layer lines, nucleotide differences was observed at c.33G>C, 519T>C, 858G>A, 903A>G, 904G>A and 1257C>T. The change at amino acid level between reference and control broiler was p.D320N and with control layer chicken, it was p.D302N and p.D320N. On the other hand, a single amino acid difference (p.D302N) was observed between the control broiler and control layer chicken lines. The phylogenetic study displayed a close relationship between broiler and layer lines and reference gene and also with other avian species resulting in a cluster formation. These cluster in turn displayed a distant link with the mammalian species. The expression profile of BMP 3 gene exhibited a variation at different stages of embryonic development and also at post embryonic period among the lines with control layer showing higher expression than that of broiler chicken. The protein was also detected in bone marrow tissue of broiler and layer lines by western blotting. It is concluded that the BMP 3 gene sequence differed at nucleotide and amino acid level among the lines and the gene expressed differentially at different periods of embryonic development and also at post hatch period.

  6. Effect of single DNA lesions on in vitro replication with DNA polymerase III holoenzyme. Comparison with other polymerases.

    PubMed

    Belguise-Valladier, P; Maki, H; Sekiguchi, M; Fuchs, R P

    1994-02-11

    In the present work, we have studied in vitro replication of N-2-acetylaminofluorene (AAF) or cis-diamminedichloroplatinum II (cis-DDP) single modified DNA templates. We used the holoenzyme (pol III HE) or the alpha subunit of DNA polymerase III, which is involved in SOS mutagenesis, and other DNA polymerases in order to compare enzymes having different biological roles and properties. Single-stranded oligonucleotides (63-mer) bearing a single AAF adduct at one of the different guanine residues of the NarI sequence (-G1G2CG3CC-) have been used in primer extension assays. Site-specifically platinated 5'd(ApG) or 5'd(GpG) oligonucleotides were constructed and similarly used in primer extension assays. In all cases, irrespective of both the chemical nature of the lesion (i.e. AAF or cis-DDP) and its local sequence context (i.e. the 3 different sites for AAF adducts within the NarI site) replication by pol III HE and pol I Klenow fragment (pol I Kf) stops one base prior to the adduct site. Removal of the 3'-->5' proofreading activity alone was not sufficient to trigger bypass of DNA lesions. Indeed, when proofreading activity of pol I is inactivated by a point mutation (pol I Kf (exo-)), the major replication product corresponds to the position opposite the adduct site showing that incorporation across from the AAF adduct is possible. These results suggest that a polymerase with proofreading activity is actually found to stop one nucleotide before the adduct not because it is unable to insert a nucleotide opposite the adduct but most likely because elongation past the adduct is strongly impaired, giving thus an increased time frame for the proofreading exonuclease to remove the base inserted across from the adduct. These results are discussed in terms of their implications for error-free and error-prone bypass in vivo.

  7. Demonstration of protein-based human identification using the hair shaft proteome [Protein-based human identification: A proof of concept using the hair shaft proteome

    DOE PAGES

    Parker, Glendon J.; Leppert, Tami; Anex, Deon S.; ...

    2016-09-07

    Human identification from biological material is largely dependent on the ability to characterize genetic polymorphisms in DNA. Unfortunately, DNA can degrade in the environment, sometimes below the level at which it can be amplified by PCR. Protein however is chemically more robust than DNA and can persist for longer periods. Protein also contains genetic variation in the form of single amino acid polymorphisms. These can be used to infer the status of non-synonymous single nucleotide polymorphism alleles. To demonstrate this, we used mass spectrometry-based shotgun proteomics to characterize hair shaft proteins in 66 European-American subjects. A total of 596 singlemore » nucleotide polymorphism alleles were correctly imputed in 32 loci from 22 genes of subjects’ DNA and directly validated using Sanger sequencing. Estimates of the probability of resulting individual non-synonymous single nucleotide polymorphism allelic profiles in the European population, using the product rule, resulted in a maximum power of discrimination of 1 in 12,500. Imputed non-synonymous single nucleotide polymorphism profiles from European–American subjects were considerably less frequent in the African population (maximum likelihood ratio = 11,000). The converse was true for hair shafts collected from an additional 10 subjects with African ancestry, where some profiles were more frequent in the African population. Genetically variant peptides were also identified in hair shaft datasets from six archaeological skeletal remains (up to 260 years old). Furthermore, this study demonstrates that quantifiable measures of identity discrimination and biogeographic background can be obtained from detecting genetically variant peptides in hair shaft protein, including hair from bioarchaeological contexts.« less

  8. Association of α-, β-, and γ-Synuclein With Diffuse Lewy Body Disease

    PubMed Central

    Nishioka, Kenya; Wider, Christian; Vilariño-Güell, Carles; Soto-Ortolaza, Alexandra I.; Lincoln, Sarah J.; Kachergus, Jennifer M.; Jasinska-Myga, Barbara; Ross, Owen A.; Rajput, Alex; Robinson, Christopher A.; Ferman, Tanis J.; Wszolek, Zbigniew K.; Dickson, Dennis W.; Farrer, Matthew J.

    2016-01-01

    Objective To determine the association of the genes that encode α-, β-, and γ-synuclein (SNCA, SNCB, and SNCG, respectively) with diffuse Lewy body disease (DLBD). Design Case-control study. Subjects A total of 172 patients with DLBD consistent with a clinical diagnosis of Parkinson disease dementia/dementia with Lewy bodies and 350 clinically and 97 pathologically normal controls. Interventions Sequencing of SNCA, SNCB, and SNCG and genotyping of single-nucleotide polymorphisms performed on an Applied Biosystems capillary sequencer and a Sequenom MassArray pLEX platform, respectively. Associations were determined using χ2 or Fisher exact tests. Results Initial sequencing studies of the coding regions of each gene in 89 patients with DLBD did not detect any pathogenic substitutions. Nevertheless, genotyping of known polymorphic variability in sequence-conserved regions detected several single-nucleotide polymorphisms in the SNCA and SNCG genes that were significantly associated with disease (P=.05 to <.001). Significant association was also observed for 3 single-nucleotide polymorphisms located in SNCB when comparing DLBD cases and pathologically confirmed normal controls (P=.03-.01); however, this association was not significant for the clinical controls alone or the combined clinical and pathological controls (P>.05). After correction for multiple testing, only 1 single-nucleotide polymorphism in SNCG (rs3750823) remained significant in all of the analyses (P=.05-.009). Conclusion These findings suggest that variants in all 3 members of the synuclein gene family, particularly SNCA and SNCG, affect the risk of developing DLBD and warrant further investigation in larger, pathologically defined data sets as well as clinically diagnosed Parkinson disease/dementia with Lewy bodies case-control series. PMID:20697047

  9. Demonstration of protein-based human identification using the hair shaft proteome [Protein-based human identification: A proof of concept using the hair shaft proteome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Parker, Glendon J.; Leppert, Tami; Anex, Deon S.

    Human identification from biological material is largely dependent on the ability to characterize genetic polymorphisms in DNA. Unfortunately, DNA can degrade in the environment, sometimes below the level at which it can be amplified by PCR. Protein however is chemically more robust than DNA and can persist for longer periods. Protein also contains genetic variation in the form of single amino acid polymorphisms. These can be used to infer the status of non-synonymous single nucleotide polymorphism alleles. To demonstrate this, we used mass spectrometry-based shotgun proteomics to characterize hair shaft proteins in 66 European-American subjects. A total of 596 singlemore » nucleotide polymorphism alleles were correctly imputed in 32 loci from 22 genes of subjects’ DNA and directly validated using Sanger sequencing. Estimates of the probability of resulting individual non-synonymous single nucleotide polymorphism allelic profiles in the European population, using the product rule, resulted in a maximum power of discrimination of 1 in 12,500. Imputed non-synonymous single nucleotide polymorphism profiles from European–American subjects were considerably less frequent in the African population (maximum likelihood ratio = 11,000). The converse was true for hair shafts collected from an additional 10 subjects with African ancestry, where some profiles were more frequent in the African population. Genetically variant peptides were also identified in hair shaft datasets from six archaeological skeletal remains (up to 260 years old). Furthermore, this study demonstrates that quantifiable measures of identity discrimination and biogeographic background can be obtained from detecting genetically variant peptides in hair shaft protein, including hair from bioarchaeological contexts.« less

  10. Transient state kinetics of transcription elongation by T7 RNA polymerase.

    PubMed

    Anand, Vasanti Subramanian; Patel, Smita S

    2006-11-24

    The single subunit DNA-dependent RNA polymerase (RNAP) from bacteriophage T7 catalyzes both promoter-dependent transcription initiation and promoter-independent elongation. Using a promoter-free substrate, we have dissected the kinetic pathway of single nucleotide incorporation during elongation. We show that T7 RNAP undergoes a slow conformational change (0.01-0.03 s(-1)) to form an elongation competent complex with the promoter-free substrate (dissociation constant (Kd) of 96 nM). The complex binds to a correct NTP (Kd of 80 microM) and incorporates the nucleoside monophosphate (NMP) into RNA primer very efficiently (220 s(-1) at 25 degrees C). An overall free energy change (-5.5 kcal/mol) and internal free energy change (-3.7 kcal/mol) of single NMP incorporation was calculated from the measured equilibrium constants. In the presence of inorganic pyrophosphate (PPi), the elongation complex catalyzes the reverse pyrophosphorolysis reaction at a maximum rate of 0.8 s(-1) with PPi Kd of 1.2 mM. Several experiments were designed to investigate the rate-limiting step in the pathway of single nucleotide addition. Acid-quench and pulse-chase kinetics indicated that an isomerization step before chemistry is rate-limiting. The very similar rate constants of sequential incorporation of two nucleotides indicated that the steps after chemistry are fast. Based on available data, we propose that the preinsertion to insertion isomerization of NTP observed in the crystallographic studies of T7 RNAP is a likely candidate for the rate-limiting step. The studies here provide a kinetic framework to investigate structure-function and fidelity of RNA synthesis and to further explore the role of the conformational change in nucleotide selection during RNA synthesis.

  11. Combined use of a new SNP-based assay and multilocus SSR markers to assess genetic diversity of Xylella fastidiosa subsp. pauca infecting citrus and coffee plants.

    PubMed

    Montes-Borrego, Miguel; Lopes, Joao R S; Jiménez-Díaz, Rafael M; Landa, Blanca B

    2015-03-01

    Two haplotypes of Xylella fastidiosa subsp. pauca (Xfp) that correlated with their host of origin were identified in a collection of 90 isolates infecting citrus and coffee plants in Brazil, based on a single-nucleotide polymorphism in the gyrB sequence. A new single-nucleotide primer extension (SNuPE) protocol was designed for rapid identification of Xfp according to the host source. The protocol proved to be robust for the prediction of the Xfp host source in blind tests using DNA from cultures of the bacterium, infected plants, and insect vectors allowed to feed on Xfp-infected citrus plants. AMOVA and STRUCTURE analyses of microsatellite data separated most Xfp populations on the basis of their host source, indicating that they were genetically distinct. The combined use of the SNaPshot protocol and three previously developed multilocus SSR markers showed that two haplotypes and distinct isolates of Xfp infect citrus and coffee in Brazil and that multiple, genetically different isolates can be present in a single orchard or infect a single tree. This combined approach will be very useful in studies of the epidemiology of Xfp-induced diseases, host specificity of bacterial genotypes, the occurrence of Xfp host jumping, vector feeding habits, etc., in economically important cultivated plants or weed host reservoirs of Xfp in Brazil and elsewhere. Copyright© by the Spanish Society for Microbiology and Institute for Catalan Studies.

  12. Performance of Single Nucleotide Polymorphisms versus Haplotypes for Genome-Wide Association Analysis in Barley

    PubMed Central

    Jannink, Jean-Luc

    2010-01-01

    Genome-wide association studies (GWAS) may benefit from utilizing haplotype information for making marker-phenotype associations. Several rationales for grouping single nucleotide polymorphisms (SNPs) into haplotype blocks exist, but any advantage may depend on such factors as genetic architecture of traits, patterns of linkage disequilibrium in the study population, and marker density. The objective of this study was to explore the utility of haplotypes for GWAS in barley (Hordeum vulgare) to offer a first detailed look at this approach for identifying agronomically important genes in crops. To accomplish this, we used genotype and phenotype data from the Barley Coordinated Agricultural Project and constructed haplotypes using three different methods. Marker-trait associations were tested by the efficient mixed-model association algorithm (EMMA). When QTL were simulated using single SNPs dropped from the marker dataset, a simple sliding window performed as well or better than single SNPs or the more sophisticated methods of blocking SNPs into haplotypes. Moreover, the haplotype analyses performed better 1) when QTL were simulated as polymorphisms that arose subsequent to marker variants, and 2) in analysis of empirical heading date data. These results demonstrate that the information content of haplotypes is dependent on the particular mutational and recombinational history of the QTL and nearby markers. Analysis of the empirical data also confirmed our intuition that the distribution of QTL alleles in nature is often unlike the distribution of marker variants, and hence utilizing haplotype information could capture associations that would elude single SNPs. We recommend routine use of both single SNP and haplotype markers for GWAS to take advantage of the full information content of the genotype data. PMID:21124933

  13. Discriminating a Single Nucleotide Difference for Enhanced miRNA Detection Using Tunable Graphene and Oligonucleotide Nanodevices.

    PubMed

    Robertson, Neil M; Hizir, Mustafa Salih; Balcioglu, Mustafa; Wang, Rui; Yavuz, Mustafa Selman; Yumak, Hasan; Ozturk, Birol; Sheng, Jia; Yigit, Mehmet V

    2015-09-15

    In this study we have reported our efforts to address some of the challenges in the detection of miRNAs using water-soluble graphene oxide and DNA nanoassemblies. Purposefully inserting mismatches at specific positions in our DNA (probe) strands shows increasing specificity against our target miRNA, miR-10b, over miR-10a which varies by only a single nucleotide. This increased specificity came at a loss of signal intensity within the system, but we demonstrated that this could be addressed with the use of DNase I, an endonuclease capable of cleaving the DNA strands of the RNA/DNA heteroduplex and recycling the RNA target to hybridize to another probe strand. As we previously demonstrated, this enzymatic signal also comes with an inherent activity of the enzyme on the surface-adsorbed probe strands. To remove this activity of DNase I and the steady nonspecific increase in the fluorescence signal without compromising the recovered signal, we attached a thermoresponsive PEGMA polymer (poly(ethylene glycol) methyl ether methacrylate) to nGO. This smart polymer is able to shield the probes adsorbed on the nGO surface from the DNase I activity and is capable of tuning the detection capacity of the nGO nanoassembly with a thermoswitch at 39 °C. By utilizing probes with multiple mismatches, DNase I cleavage of the DNA probe strands, and the attachment of PEGMA polymers to graphene oxide to block undesired DNase I activity, we were able to detect miR-10b from liquid biopsy mimics and breast cancer cell lines. Overall we have reported our efforts to improve the specificity, increase the sensitivity, and eliminate the undesired enzymatic activity of DNase I on surface-adsorbed probes for miR-10b detection using water-soluble graphene nanodevices. Even though we have demonstrated only the discrimination of miR-10b from miR-10a, our approach can be extended to other short RNA molecules which differ by a single nucleotide.

  14. Dimeric PROP1 binding to diverse palindromic TAAT sequences promotes its transcriptional activity.

    PubMed

    Nakayama, Michie; Kato, Takako; Susa, Takao; Sano, Akiko; Kitahara, Kousuke; Kato, Yukio

    2009-08-13

    Mutations in the Prop1 gene are responsible for murine Ames dwarfism and human combined pituitary hormone deficiency with hypogonadism. Recently, we reported that PROP1 is a possible transcription factor for gonadotropin subunit genes through plural cis-acting sites composed of AT-rich sequences containing a TAAT motif which differs from its consensus binding sequence known as PRDQ9 (TAATTGAATTA). This study aimed to verify the binding specificity and sequence of PROP1 by applying the method of SELEX (Systematic Evolution of Ligands by EXponential enrichment), EMSA (electrophoretic mobility shift assay) and transient transfection assay. SELEX, after 5, 7 and 9 generations of selection using a random sequence library, showed that nucleotides containing one or two TAAT motifs were accumulated and accounted for 98.5% at the 9th generation. Aligned sequences and EMSA demonstrated that PROP1 binds preferentially to 11 nucleotides composed of an inverted TAAT motif separated by 3 nucleotides with variation in the half site of palindromic TAAT motifs and with preferential requirement of T at the nucleotide number 5 immediately 3' to a TAAT motif. Transient transfection assay demonstrated first that dimeric binding of PROP1 to an inverted TAAT motif and its cognates resulted in transcriptional activation, whereas monomeric binding of PROP1 to a single TAAT motif and an inverted ATTA motif did not mediate activation. Thus, this study demonstrated that dimeric binding of PROP1 is able to recognize diverse palindromic TAAT sequences separated by 3 nucleotides and to exhibit its transcriptional activity.

  15. Single nucleotide polymorphism-specific regulation of matrix metalloproteinase-9 by multiple miRNAs targeting the coding exon

    PubMed Central

    Duellman, Tyler; Warren, Christopher; Yang, Jay

    2014-01-01

    Microribonucleic acids (miRNAs) work with exquisite specificity and are able to distinguish a target from a non-target based on a single nucleotide mismatch in the core nucleotide domain. We questioned whether miRNA regulation of gene expression could occur in a single nucleotide polymorphism (SNP)-specific manner, manifesting as a post-transcriptional control of expression of genetic polymorphisms. In our recent study of the functional consequences of matrix metalloproteinase (MMP)-9 SNPs, we discovered that expression of a coding exon SNP in the pro-domain of the protein resulted in a profound decrease in the secreted protein. This missense SNP results in the N38S amino acid change and a loss of an N-glycosylation site. A systematic study demonstrated that the loss of secreted protein was due not to the loss of an N-glycosylation site, but rather an SNP-specific targeting by miR-671-3p and miR-657. Bioinformatics analysis identified 41 SNP-specific miRNA targeting MMP-9 SNPs, mostly in the coding exon and an extension of the analysis to chromosome 20, where the MMP-9 gene is located, suggesting that SNP-specific miRNAs targeting the coding exon are prevalent. This selective post-transcriptional regulation of a target messenger RNA harboring genetic polymorphisms by miRNAs offers an SNP-dependent post-transcriptional regulatory mechanism, allowing for polymorphic-specific differential gene regulation. PMID:24627221

  16. Reconstructing population histories from single nucleotide polymorphism data.

    PubMed

    Sirén, Jukka; Marttinen, Pekka; Corander, Jukka

    2011-01-01

    Population genetics encompasses a strong theoretical and applied research tradition on the multiple demographic processes that shape genetic variation present within a species. When several distinct populations exist in the current generation, it is often natural to consider the pattern of their divergence from a single ancestral population in terms of a binary tree structure. Inference about such population histories based on molecular data has been an intensive research topic in the recent years. The most common approach uses coalescent theory to model genealogies of individuals sampled from the current populations. Such methods are able to compare several different evolutionary scenarios and to estimate demographic parameters. However, their major limitation is the enormous computational complexity associated with the indirect modeling of the demographies, which limits the application to small data sets. Here, we propose a novel Bayesian method for inferring population histories from unlinked single nucleotide polymorphisms, which is applicable also to data sets harboring large numbers of individuals from distinct populations. We use an approximation to the neutral Wright-Fisher diffusion to model random fluctuations in allele frequencies. The population histories are modeled as binary rooted trees that represent the historical order of divergence of the different populations. A combination of analytical, numerical, and Monte Carlo integration techniques are utilized for the inferences. A particularly important feature of our approach is that it provides intuitive measures of statistical uncertainty related with the estimates computed, which may be entirely lacking for the alternative methods in this context. The potential of our approach is illustrated by analyses of both simulated and real data sets.

  17. Rapid Genotyping of Single Nucleotide Polymorphisms Influencing Warfarin Drug Response by Surface-Enhanced Laser Desorption and Ionization Time-of-Flight (SELDI-TOF) Mass Spectrometry

    PubMed Central

    Yang, Shangbin; Xu, LiHui; Wu, Haifeng M.

    2010-01-01

    Warfarin exhibits significant interindividual variability in dosing requirements. Different drug responses are partly attributed to the single nucleotide polymorphisms (SNPs) that influence either drug action or drug metabolism. Rapid genotyping of these SNPs helps clinicians to choose appropriate initial doses to quickly achieve anticoagulation effects and to prevent complications. We report a novel application of surface-enhanced laser desorption and ionization time-of-flight mass spectrometry (SELDI-TOF MS) in the rapid genotyping of SNPs that impact warfarin efficacy. The SNPs were first amplified by PCR and then underwent single base extension to generate the specific SNP product. Next, genetic variants displaying different masses were bound to Q10 anionic proteinChips and then genotyped by using SELDI-TOF MS in a multiplex fashion. SELDI-TOF MS offered unique properties of on-chip sample enrichment and clean-ups, which streamlined the testing procedures and eliminated many tedious experimental steps required by the conventional MS-based method. The turn-around time for genotyping three known warfarin-related SNPs, CYP2C9*2, CYP2C9*3, and VKORC1 3673G>A by SELDI-TOF MS was less than 5 hours. The analytical accuracy of this method was confirmed both by bidirectional DNA sequencing and by comparing the genotype results (n = 189) obtained by SELDI-TOF MS to reports from a clinical reference laboratory. This new multiplex genotyping method provides an excellent clinical laboratory platform to promote personalized medicine in warfarin therapy. PMID:20075209

  18. Rapid genotyping of single nucleotide polymorphisms influencing warfarin drug response by surface-enhanced laser desorption and ionization time-of-flight (SELDI-TOF) mass spectrometry.

    PubMed

    Yang, Shangbin; Xu, LiHui; Wu, Haifeng M

    2010-03-01

    Warfarin exhibits significant interindividual variability in dosing requirements. Different drug responses are partly attributed to the single nucleotide polymorphisms (SNPs) that influence either drug action or drug metabolism. Rapid genotyping of these SNPs helps clinicians to choose appropriate initial doses to quickly achieve anticoagulation effects and to prevent complications. We report a novel application of surface-enhanced laser desorption and ionization time-of-flight mass spectrometry (SELDI-TOF MS) in the rapid genotyping of SNPs that impact warfarin efficacy. The SNPs were first amplified by PCR and then underwent single base extension to generate the specific SNP product. Next, genetic variants displaying different masses were bound to Q10 anionic proteinChips and then genotyped by using SELDI-TOF MS in a multiplex fashion. SELDI-TOF MS offered unique properties of on-chip sample enrichment and clean-ups, which streamlined the testing procedures and eliminated many tedious experimental steps required by the conventional MS-based method. The turn-around time for genotyping three known warfarin-related SNPs, CYP2C9*2, CYP2C9*3, and VKORC1 3673G>A by SELDI-TOF MS was less than 5 hours. The analytical accuracy of this method was confirmed both by bidirectional DNA sequencing and by comparing the genotype results (n = 189) obtained by SELDI-TOF MS to reports from a clinical reference laboratory. This new multiplex genotyping method provides an excellent clinical laboratory platform to promote personalized medicine in warfarin therapy.

  19. Single-Nucleotide Polymorphisms Associated with Skin Naphthyl–Keratin Adduct Levels in Workers Exposed to Naphthalene

    PubMed Central

    Jiang, Rong; French, John E.; Stober, Vandy P.; Kang-Sickel, Juei-Chuan C.; Zou, Fei

    2012-01-01

    Background: Individual genetic variation that results in differences in systemic response to xenobiotic exposure is not accounted for as a predictor of outcome in current exposure assessment models. Objective: We developed a strategy to investigate individual differences in single-nucleotide polymorphisms (SNPs) as genetic markers associated with naphthyl–keratin adduct (NKA) levels measured in the skin of workers exposed to naphthalene. Methods: The SNP-association analysis was conducted in PLINK using candidate-gene analysis and genome-wide analysis. We identified significant SNP–NKA associations and investigated the potential impact of these SNPs along with personal and workplace factors on NKA levels using a multiple linear regression model and the Pratt index. Results: In candidate-gene analysis, a SNP (rs4852279) located near the CYP26B1 gene contributed to the 2-naphthyl–keratin adduct (2NKA) level. In the multiple linear regression model, the SNP rs4852279, dermal exposure, exposure time, task replacing foam, age, and ethnicity all were significant predictors of 2NKA level. In genome-wide analysis, no single SNP reached genome-wide significance for NKA levels (all p ≥ 1.05 × 10–5). Pathway and network analyses of SNPs associated with NKA levels were predicted to be involved in the regulation of cellular processes and homeostasis. Conclusions: These results provide evidence that a quantitative biomarker can be used as an intermediate phenotype when investigating the association between genetic markers and exposure–dose relationship in a small, well-characterized exposed worker population. PMID:22391508

  20. Regions of conservation and divergence in the 3' untranslated sequences of genomic RNA from Ross River virus isolates.

    PubMed

    Faragher, S G; Dalgarno, L

    1986-07-20

    The 3' untranslated (UT) sequences of the genomic RNAs of five geographic variants of the alphavirus Ross River virus (RRV) were determined and compared with the 3' UT sequence of RRV T48, the prototype strain. Part of the 3' UT region of Getah virus, a close serological relative of RRV, was also sequenced. The RRV 3' UT region varies markedly in length between variants. Large deletions or insertions, sequence rearrangements and single nucleotide substitutions are observed. A sequence tract of 49 to 58 nucleotides, which is repeated as four blocks in the RRV T48 3' UT region, occurs only once in the 3' UT region of one RRV strain (NB5092), indicating that the existence of repeat sequence blocks is not essential for RRV replication. However, the precise sequence of the 3' proximal copy of the repeat block and its position relative to the poly(A) tail were identical in all RRV isolates examined, suggesting that it has an important role in RRV replication. Nucleotide substitutions between RRV variants are distributed non-randomly along the length of the 3' UT region. The sequence of 120 to 130 nucleotides adjacent to the poly(A) tail is strongly conserved. Getah virus RNA contains three repeat sequence blocks in the 3' UT region. These are similar in sequence to those in RRV RNA but differ in their arrangement. Homology between the RRV and Getah 3' UT sequences is greatest in the 3' proximal repeat sequence block that shows three differences in 49 nucleotides. The 3' proximal repeat in Getah RNA occurs at the same position, relative to the poly(A) tail, as in all RRV variants. The RRV and Getah virus 3' UT sequences show extensive homology in the region between the 3' proximal repeat and the poly(A) tail but, apart from the repeat blocks themselves, they show no significant homology elsewhere.

  1. Decreased Nucleotide and Expression Diversity and Modified Coexpression Patterns Characterize Domestication in the Common Bean[W][OPEN

    PubMed Central

    Bellucci, Elisa; Bitocchi, Elena; Ferrarini, Alberto; Benazzo, Andrea; Biagetti, Eleonora; Klie, Sebastian; Minio, Andrea; Rau, Domenico; Rodriguez, Monica; Panziera, Alex; Venturini, Luca; Attene, Giovanna; Albertini, Emidio; Jackson, Scott A.; Nanni, Laura; Fernie, Alisdair R.; Nikoloski, Zoran; Bertorelle, Giorgio; Delledonne, Massimo; Papa, Roberto

    2014-01-01

    Using RNA sequencing technology and de novo transcriptome assembly, we compared representative sets of wild and domesticated accessions of common bean (Phaseolus vulgaris) from Mesoamerica. RNA was extracted at the first true-leaf stage, and de novo assembly was used to develop a reference transcriptome; the final data set consists of ∼190,000 single nucleotide polymorphisms from 27,243 contigs in expressed genomic regions. A drastic reduction in nucleotide diversity (∼60%) is evident for the domesticated form, compared with the wild form, and almost 50% of the contigs that are polymorphic were brought to fixation by domestication. In parallel, the effects of domestication decreased the diversity of gene expression (18%). While the coexpression networks for the wild and domesticated accessions demonstrate similar seminal network properties, they show distinct community structures that are enriched for different molecular functions. After simulating the demographic dynamics during domestication, we found that 9% of the genes were actively selected during domestication. We also show that selection induced a further reduction in the diversity of gene expression (26%) and was associated with 5-fold enrichment of differentially expressed genes. While there is substantial evidence of positive selection associated with domestication, in a few cases, this selection has increased the nucleotide diversity in the domesticated pool at target loci associated with abiotic stress responses, flowering time, and morphology. PMID:24850850

  2. Telbivudine, a nucleoside analog inhibitor of HBV polymerase, has a different in vitro cross-resistance profile than the nucleotide analog inhibitors adefovir and tenofovir.

    PubMed

    Seifer, Maria; Patty, April; Serra, Ilaria; Li, Bin; Standring, David N

    2009-02-01

    Telbivudine, a nucleoside analog inhibitor of the viral polymerase of hepatitis B virus (HBV), has been approved for the treatment of chronic HBV infection, along with the nucleoside inhibitors lamivudine and entecavir, and the nucleotide inhibitors adefovir and tenofovir. The resistance profiles of these agents were investigated via drug treatment of HepG2 cells stably transfected with wild-type or mutant HBV genomes bearing known resistance mutations. Telbivudine was not active against HBV strains bearing lamivudine mutations L180M/M204V/I but remained active against the M204V single mutant in vitro, potentially explaining the difference in resistance profiles between telbivudine and lamivudine. Against HBV genomes with known telbivudine-resistance mutations, M204I and L80I/M204I, telbivudine, lamivudine and entecavir lost 353- to >1000-fold activity whereas adefovir and tenofovir exhibited no more than 3-5-fold change. Conversely, against HBV cell lines expressing adefovir resistance mutations N236T and A181V, or the A194T mutant associated with resistance to tenofovir, telbivudine remained active as shown by respective fold-changes of 0.5 (N236T) and 1.0 (A181V and A194T). These in vitro results indicate that nucleoside and nucleotide drugs have different cross-resistance profiles. The addition of telbivudine to ongoing adefovir therapy could provide effective antiviral therapy to patients who develop adefovir resistance.

  3. Evaluation of targeted exome sequencing for 28 protein-based blood group systems, including the homologous gene systems, for blood group genotyping.

    PubMed

    Schoeman, Elizna M; Lopez, Genghis H; McGowan, Eunike C; Millard, Glenda M; O'Brien, Helen; Roulis, Eileen V; Liew, Yew-Wah; Martin, Jacqueline R; McGrath, Kelli A; Powley, Tanya; Flower, Robert L; Hyland, Catherine A

    2017-04-01

    Blood group single nucleotide polymorphism genotyping probes for a limited range of polymorphisms. This study investigated whether massively parallel sequencing (also known as next-generation sequencing), with a targeted exome strategy, provides an extended blood group genotype and the extent to which massively parallel sequencing correctly genotypes in homologous gene systems, such as RH and MNS. Donor samples (n = 28) that were extensively phenotyped and genotyped using single nucleotide polymorphism typing, were analyzed using the TruSight One Sequencing Panel and MiSeq platform. Genes for 28 protein-based blood group systems, GATA1, and KLF1 were analyzed. Copy number variation analysis was used to characterize complex structural variants in the GYPC and RH systems. The average sequencing depth per target region was 66.2 ± 39.8. Each sample harbored on average 43 ± 9 variants, of which 10 ± 3 were used for genotyping. For the 28 samples, massively parallel sequencing variant sequences correctly matched expected sequences based on single nucleotide polymorphism genotyping data. Copy number variation analysis defined the Rh C/c alleles and complex RHD hybrids. Hybrid RHD*D-CE-D variants were correctly identified, but copy number variation analysis did not confidently distinguish between D and CE exon deletion versus rearrangement. The targeted exome sequencing strategy employed extended the range of blood group genotypes detected compared with single nucleotide polymorphism typing. This single-test format included detection of complex MNS hybrid cases and, with copy number variation analysis, defined RH hybrid genes along with the RHCE*C allele hitherto difficult to resolve by variant detection. The approach is economical compared with whole-genome sequencing and is suitable for a red blood cell reference laboratory setting. © 2017 AABB.

  4. Association between lower frequency of R381Q variant (rs11209026) in IL-23 receptor gene and increased risk of recurrent spontaneous abortion (RSA).

    PubMed

    Abdollahi, Elham; Tavasolian, Fataneh; Ghasemi, Nasrin; Mirghanizadeh, Seyed Ali; Azizi, Mohammdareza; Ghoryani, Mohsen; Samadi, Morteza

    2015-01-01

    Recurrent spontaneous abortion (RSA) is defined as three or more consecutive spontaneous abortions before the 20th week of gestation. The purpose of the present study was to investigate the association between a functional single nucleotide polymorphism (SNP) in the interleukin (IL)-23 receptor gene (IL-23R; rs11209026, 1142 G wild type → A reduced function, Arg381Gln, R381Q) and RSA. For the study, 200 RSA patients (confirmed using established diagnostic criteria) and 200 normal individuals in fertility and infertility centers in the cities of Yazd and Isfahan were recruited during a period from 2012-2013. Using PCR-RFLP, the R381Q variant was screened for in the IL-23R gene of the patients and controls. The results indicated there were significant differences in the frequency of this genetic variant in the patients versus the healthy controls, i.e. 2% and 7.5%, respectively (p value = 0.01; odds ratio = 0.25; CI = 95%). No significant difference was found for the G allelic frequency in patients with RSA and in the control group (p = 0.60). The A allelic frequency was significantly different between the two groups (p = 0.01). Based on these findings, it is concluded that the frequency of single nucleotide polymorphism in the IL-23 receptor (R381Q) in patients with recurrent spontaneous abortion (RSA) is less than that found in normal control women.

  5. Single Nucleotide Polymorphisms Can Create Alternative Polyadenylation Signals and Affect Gene Expression through Loss of MicroRNA-Regulation

    PubMed Central

    Thomas, Laurent F.; Sætrom, Pål

    2012-01-01

    Alternative polyadenylation (APA) can for example occur when a protein-coding gene has several polyadenylation (polyA) signals in its last exon, resulting in messenger RNAs (mRNAs) with different 3′ untranslated region (UTR) lengths. Different 3′UTR lengths can give different microRNA (miRNA) regulation such that shortened transcripts have increased expression. The APA process is part of human cells' natural regulatory processes, but APA also seems to play an important role in many human diseases. Although altered APA in disease can have many causes, we reasoned that mutations in DNA elements that are important for the polyA process, such as the polyA signal and the downstream GU-rich region, can be one important mechanism. To test this hypothesis, we identified single nucleotide polymorphisms (SNPs) that can create or disrupt APA signals (APA-SNPs). By using a data-integrative approach, we show that APA-SNPs can affect 3′UTR length, miRNA regulation, and mRNA expression—both between homozygote individuals and within heterozygote individuals. Furthermore, we show that a significant fraction of the alleles that cause APA are strongly and positively linked with alleles found by genome-wide studies to be associated with disease. Our results confirm that APA-SNPs can give altered gene regulation and that APA alleles that give shortened transcripts and increased gene expression can be important hereditary causes for disease. PMID:22915998

  6. Genomic and phylogenetic evidence that Maize rough dwarf and Rice black-streaked dwarf fijiviruses should be classified as different geographic strains of a single species.

    PubMed

    Xie, L; Lv, M-F; Yang, J; Chen, J-P; Zhang, H-M

    Maize rough dwarf disease (MRDD) has long been known as one of the most devastating viral diseases of maize worldwide and is caused by single or complex infection by four fijiviruses: Maize rough dwarf virus (MRDV) in Europe and the Middle East, Mal de Rio Cuarto virus (MRCV) in South America, rice black-streaked dwarf virus (RBSDV), and Southern rice black-streaked dwarf virus (SRBSDV or Rice black-streaked dwarf virus 2, RBSDV-2) in East Asia. These are currently classified as four distinct species in the genus Fijivirus, family Reoviridae, but their taxonomic status has been questioned. To help resolve this, the nucleotide sequences of the ten genomic segments of an Italian isolate of MRDV have been determined, providing the first complete genomic sequence of this virus. Its genome has 29144 nucleotides and is similar in organization to those of RBSDV, SRBSDV, and MRCV. The 13 ORFs always share highest identities (81.3-97.2%) with the corresponding ORFs of RBSDV and phylogenetic analyses of the different genome segments and ORFs all confirm that MRDV clusters most closely with RBSDV and that MRCV and SRBSDV are slightly more distantly related. The results suggest that MRDV and RBSDV should be classified as different geographic strains of the same virus species and we suggest the name cereal black-streaked dwarf fijivirus (CBSDV) for consideration.

  7. Identification of single nucleotide polymorphisms in hematopoietic cell transplant patients affecting early recognition of, and response to, endotoxin.

    PubMed

    Guinan, Eva C; Palmer, Christine D; Mancuso, Christy J; Brennan, Lisa; Stoler-Barak, Liat; Kalish, Leslie A; Suter, Eugenie E; Gallington, Leighanne C; Huhtelin, David P; Mansilla, Maria; Schumann, Ralf R; Murray, Jeffrey C; Weiss, Jerrold; Levy, Ofer

    2014-10-01

    Hematopoietic cell transplant (HCT) is a life-saving therapy for many malignant and non-malignant bone marrow diseases. Associated morbidities are often due to transplant-related toxicities and infections, exacerbated by regimen-induced immune suppression and systemic incursion of bacterial products. Patients undergoing myeloablative conditioning for HCT become endotoxemic and display blood/plasma changes consistent with lipopolysaccharide (LPS)-induced systemic innate immune activation. Herein, we addressed whether patients scheduled for HCT display differences in recognition/response to LPS ex vivo traceable to specific single nucleotide polymorphisms (SNPs). Two SNPs of LPS binding protein (LBP) were associated with changes in plasma LBP levels, with one LBP SNP also associating with differences in efficiency of extraction and transfer of endotoxin to myeloid differentiation factor-2 (MD-2), a step needed for activation of TLR4. None of the examined SNPs of CD14, bactericidal/permeability-increasing protein (BPI), TLR4 or MD-2 were associated with corresponding protein plasma levels or endotoxin delivery to MD-2, but CD14 and BPI SNPs significantly associated with differences in LPS-induced TNF-α release ex vivo and infection frequency, respectively. These findings suggest that specific LBP, CD14 and BPI SNPs might be contributory assessments in studies where clinical outcome may be affected by host response to endotoxin and bacterial infection. © The Author(s) 2013 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  8. Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level

    PubMed Central

    Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.

    2012-01-01

    Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804

  9. TNF-alpha SNP haplotype frequencies in equidae.

    PubMed

    Brown, J J; Ollier, W E R; Thomson, W; Matthews, J B; Carter, S D; Binns, M; Pinchbeck, G; Clegg, P D

    2006-05-01

    Tumour necrosis factor alpha (TNF-alpha) is a pro-inflammatory cytokine that plays a crucial role in the regulation of inflammatory and immune responses. In all vertebrate species the genes encoding TNF-alpha are located within the major histocompatability complex. In the horse TNF-alpha has been ascribed a role in a variety of important disease processes. Previously two single nucleotide polymorphisms (SNPs) have been reported within the 5' un-translated region of the equine TNF-alpha gene. We have examined the equine TNF-alpha promoter region further for additional SNPs by analysing DNA from 131 horses (Equus caballus), 19 donkeys (E. asinus), 2 Grant's zebras (E. burchellii boehmi) and one onager (E. hemionus). Two further SNPs were identified at nucleotide positions 24 (T/G) and 452 (T/C) relative to the first nucleotide of the 522 bp polymerase chain reaction product. A sequence variant at position 51 was observed between equidae. SNaPSHOT genotyping assays for these and the two previously reported SNPs were performed on 457 horses comprising seven different breeds and 23 donkeys to determine the gene frequencies. SNP frequencies varied considerably between different horse breeds and also between the equine species. In total, nine different TNF-alpha promoter SNP haplotypes and their frequencies were established amongst the various equidae examined, with some haplotypes being found only in horses and others only in donkeys or zebras. The haplotype frequencies observed varied greatly between different horse breeds. Such haplotypes may relate to levels of TNF-alpha production and disease susceptibility and further investigation is required to identify associations between particular haplotypes and altered risk of disease.

  10. [The joint applications of DNA chips and single nucleotide polymorphisms in forensic science].

    PubMed

    Bai, Peng; Tian, Li; Zhou, Xue-ping

    2005-05-01

    DNA chip technology, being a new high-technology, shows its vigorous life and rapid growth. Single Nucleotide Polymorphisms (SNPs) is the most common diversity in the human genome. It provides suitable genetic markers which play a key role in disease linkage study, pharmacogenomics, forensic medicine, population evolution and immigration study. Their advantage such as being analyzed with DNA chips technology, is predicted to play an important role in the field of forensic medicine, especially in paternity test and individual identification. This report mainly reviews the characteristics of DNA chip and SNPs, and their joint applications in the practice of forensic medicine.

  11. Testing for genetic association taking into account phenotypic information of relatives.

    PubMed

    Uh, Hae-Won; Wijk, Henk Jan van der; Houwing-Duistermaat, Jeanine J

    2009-12-15

    We investigated efficient case-control association analysis using family data. The outcome of interest was coronary heart disease. We employed existing and new methods that take into account the correlations among related individuals to obtain the proper type I error rates. The methods considered for autosomal single-nucleotide polymorphisms were: 1) generalized estimating equations-based methods, 2) variance-modified Cochran-Armitage (MCA) trend test incorporating kinship coefficients, and 3) genotypic modified quasi-likelihood score test. Additionally, for X-linked single-nucleotide polymorphisms we proposed a two-degrees-of-freedom test. Performance of these methods was tested using Framingham Heart Study 500 k array data.

  12. Simultaneous genotyping of single-nucleotide polymorphisms in alcoholism-related genes using duplex and triplex allele-specific PCR with two-step thermal cycles.

    PubMed

    Shirasu, Naoto; Kuroki, Masahide

    2014-01-01

    We developed a time- and cost-effective multiplex allele-specific polymerase chain reaction (AS-PCR) method based on the two-step PCR thermal cycles for genotyping single-nucleotide polymorphisms in three alcoholism-related genes: alcohol dehydrogenase 1B, aldehyde dehydrogenase 2 and μ-opioid receptor. Applying MightyAmp(®) DNA polymerase with optimized AS-primers and PCR conditions enabled us to achieve effective and selective amplification of the target alleles from alkaline lysates of a human hair root, and simultaneously to determine the genotypes within less than 1.5 h using minimal lab equipment.

  13. Allelic imbalance of multiple sclerosis susceptibility genes IKZF3 and IQGAP1 in human peripheral blood.

    PubMed

    Keshari, Pankaj K; Harbo, Hanne F; Myhr, Kjell-Morten; Aarseth, Jan H; Bos, Steffan D; Berge, Tone

    2016-04-14

    Multiple sclerosis is a chronic inflammatory, demyelinating disease of the central nervous system. Recent genome-wide studies have revealed more than 110 single nucleotide polymorphisms as associated with susceptibility to multiple sclerosis, but their functional contribution to disease development is mostly unknown. Consistent allelic imbalance was observed for rs907091 in IKZF3 and rs11609 in IQGAP1, which are in strong linkage disequilibrium with the multiple sclerosis associated single nucleotide polymorphisms rs12946510 and rs8042861, respectively. Using multiple sclerosis patients and healthy controls heterozygous for rs907091 and rs11609, we showed that the multiple sclerosis risk alleles at IKZF3 and IQGAP1 are expressed at higher levels as compared to the protective allele. Furthermore, individuals homozygous for the multiple sclerosis risk allele at IQGAP1 had a significantly higher total expression of IQGAP1 compared to individuals homozygous for the protective allele. Our data indicate a possible regulatory role for the multiple sclerosis-associated IKZF3 and IQGAP1 variants. We suggest that such cis-acting mechanisms may contribute to the multiple sclerosis association of single nucleotide polymorphisms at IKZF3 and IQGAP1.

  14. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms

    PubMed Central

    Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

    2015-01-01

    Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450

  15. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

    PubMed

    Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

    2015-01-01

    Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

  16. Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms.

    PubMed

    Zhang, Wei; Qi, Weihong; Albert, Thomas J; Motiwala, Alifiya S; Alland, David; Hyytia-Trees, Eija K; Ribot, Efrain M; Fields, Patricia I; Whittam, Thomas S; Swaminathan, Bala

    2006-06-01

    Infections by Shiga toxin-producing Escherichia coli O157:H7 (STEC O157) are the predominant cause of bloody diarrhea and hemolytic uremic syndrome in the United States. In silico comparison of the two complete STEC O157 genomes (Sakai and EDL933) revealed a strikingly high level of sequence identity in orthologous protein-coding genes, limiting the use of nucleotide sequences to study the evolution and epidemiology of this bacterial pathogen. To systematically examine single nucleotide polymorphisms (SNPs) at a genome scale, we designed comparative genome sequencing microarrays and analyzed 1199 chromosomal genes (a total of 1,167,948 bp) and 92,721 bp of the large virulence plasmid (pO157) of eleven outbreak-associated STEC O157 strains. We discovered 906 SNPs in 523 chromosomal genes and observed a high level of DNA polymorphisms among the pO157 plasmids. Based on a uniform rate of synonymous substitution for Escherichia coli and Salmonella enterica (4.7x10(-9) per site per year), we estimate that the most recent common ancestor of the contemporary beta-glucuronidase-negative, non-sorbitolfermenting STEC O157 strains existed ca. 40 thousand years ago. The phylogeny of the STEC O157 strains based on the informative synonymous SNPs was compared to the maximum parsimony trees inferred from pulsed-field gel electrophoresis and multilocus variable numbers of tandem repeats analysis. The topological discrepancies indicate that, in contrast to the synonymous mutations, parts of STEC O157 genomes have evolved through different mechanisms with highly variable divergence rates. The SNP loci reported here will provide useful genetic markers for developing high-throughput methods for fine-resolution genotyping of STEC O157. Functional characterization of nucleotide polymorphisms should shed new insights on the evolution, epidemiology, and pathogenesis of STEC O157 and related pathogens.

  17. Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms

    PubMed Central

    Zhang, Wei; Qi, Weihong; Albert, Thomas J.; Motiwala, Alifiya S.; Alland, David; Hyytia-Trees, Eija K.; Ribot, Efrain M.; Fields, Patricia I.; Whittam, Thomas S.; Swaminathan, Bala

    2006-01-01

    Infections by Shiga toxin-producing Escherichia coli O157:H7 (STEC O157) are the predominant cause of bloody diarrhea and hemolytic uremic syndrome in the United States. In silico comparison of the two complete STEC O157 genomes (Sakai and EDL933) revealed a strikingly high level of sequence identity in orthologous protein-coding genes, limiting the use of nucleotide sequences to study the evolution and epidemiology of this bacterial pathogen. To systematically examine single nucleotide polymorphisms (SNPs) at a genome scale, we designed comparative genome sequencing microarrays and analyzed 1199 chromosomal genes (a total of 1,167,948 bp) and 92,721 bp of the large virulence plasmid (pO157) of eleven outbreak-associated STEC O157 strains. We discovered 906 SNPs in 523 chromosomal genes and observed a high level of DNA polymorphisms among the pO157 plasmids. Based on a uniform rate of synonymous substitution for Escherichia coli and Salmonella enterica (4.7 × 10−9 per site per year), we estimate that the most recent common ancestor of the contemporary β-glucuronidase-negative, non-sorbitolfermenting STEC O157 strains existed ca. 40 thousand years ago. The phylogeny of the STEC O157 strains based on the informative synonymous SNPs was compared to the maximum parsimony trees inferred from pulsed-field gel electrophoresis and multilocus variable numbers of tandem repeats analysis. The topological discrepancies indicate that, in contrast to the synonymous mutations, parts of STEC O157 genomes have evolved through different mechanisms with highly variable divergence rates. The SNP loci reported here will provide useful genetic markers for developing high-throughput methods for fine-resolution genotyping of STEC O157. Functional characterization of nucleotide polymorphisms should shed new insights on the evolution, epidemiology, and pathogenesis of STEC O157 and related pathogens. PMID:16606700

  18. Genome-wide single nucleotide polymorphisms reveal population history and adaptive divergence in wild guppies.

    PubMed

    Willing, Eva-Maria; Bentzen, Paul; van Oosterhout, Cock; Hoffmann, Margarete; Cable, Joanne; Breden, Felix; Weigel, Detlef; Dreyer, Christine

    2010-03-01

    Adaptation of guppies (Poecilia reticulata) to contrasting upland and lowland habitats has been extensively studied with respect to behaviour, morphology and life history traits. Yet population history has not been studied at the whole-genome level. Although single nucleotide polymorphisms (SNPs) are the most abundant form of variation in many genomes and consequently very informative for a genome-wide picture of standing natural variation in populations, genome-wide SNP data are rarely available for wild vertebrates. Here we use genetically mapped SNP markers to comprehensively survey genetic variation within and among naturally occurring guppy populations from a wide geographic range in Trinidad and Venezuela. Results from three different clustering methods, Neighbor-net, principal component analysis (PCA) and Bayesian analysis show that the population substructure agrees with geographic separation and largely with previously hypothesized patterns of historical colonization. Within major drainages (Caroni, Oropouche and Northern), populations are genetically similar, but those in different geographic regions are highly divergent from one another, with some indications of ancient shared polymorphisms. Clear genomic signatures of a previous introduction experiment were seen, and we detected additional potential admixture events. Headwater populations were significantly less heterozygous than downstream populations. Pairwise F(ST) values revealed marked differences in allele frequencies among populations from different regions, and also among populations within the same region. F(ST) outlier methods indicated some regions of the genome as being under directional selection. Overall, this study demonstrates the power of a genome-wide SNP data set to inform for studies on natural variation, adaptation and evolution of wild populations.

  19. Two cloned β thalassemia genes are associated with amber mutations at codon 39

    PubMed Central

    Pergolizzi, Robert; Spritz, Richard A.; Spence, Sally; Goossens, Michel; Kan, Yuet Wai; Bank, Arthur

    1981-01-01

    Two β globin genes from patients with the β+ thalassemia phenotype have been cloned and sequenced. A single nucleotide change from CAG to TAG (an amber mutation) at codon 39 is the only difference from normal in both genes analyzed. The results are consistent with the assumption that both patients are doubly heterozygous for β+ and β° thalassemia, and that we have isolated and analyzed the β° thalassemia gene. Images PMID:6278453

  20. Fluorescent signatures for variable DNA sequences

    PubMed Central

    Rice, John E.; Reis, Arthur H.; Rice, Lisa M.; Carver-Brown, Rachel K.; Wangh, Lawrence J.

    2012-01-01

    Life abounds with genetic variations writ in sequences that are often only a few hundred nucleotides long. Rapid detection of these variations for identification of genetic diseases, pathogens and organisms has become the mainstay of molecular science and medicine. This report describes a new, highly informative closed-tube polymerase chain reaction (PCR) strategy for analysis of both known and unknown sequence variations. It combines efficient quantitative amplification of single-stranded DNA targets through LATE-PCR with sets of Lights-On/Lights-Off probes that hybridize to their target sequences over a broad temperature range. Contiguous pairs of Lights-On/Lights-Off probes of the same fluorescent color are used to scan hundreds of nucleotides for the presence of mutations. Sets of probes in different colors can be combined in the same tube to analyze even longer single-stranded targets. Each set of hybridized Lights-On/Lights-Off probes generates a composite fluorescent contour, which is mathematically converted to a sequence-specific fluorescent signature. The versatility and broad utility of this new technology is illustrated in this report by characterization of variant sequences in three different DNA targets: the rpoB gene of Mycobacterium tuberculosis, a sequence in the mitochondrial cytochrome C oxidase subunit 1 gene of nematodes and the V3 hypervariable region of the bacterial 16 s ribosomal RNA gene. We anticipate widespread use of these technologies for diagnostics, species identification and basic research. PMID:22879378

  1. A Perfect Match Genomic Landscape Provides a Unified Framework for the Precise Detection of Variation in Natural and Synthetic Haploid Genomes.

    PubMed

    Palacios-Flores, Kim; García-Sotelo, Jair; Castillo, Alejandra; Uribe, Carina; Aguilar, Luis; Morales, Lucía; Gómez-Romero, Laura; Reyes, José; Garciarubio, Alejandro; Boege, Margareta; Dávila, Guillermo

    2018-04-01

    We present a conceptually simple, sensitive, precise, and essentially nonstatistical solution for the analysis of genome variation in haploid organisms. The generation of a Perfect Match Genomic Landscape (PMGL), which computes intergenome identity with single nucleotide resolution, reveals signatures of variation wherever a query genome differs from a reference genome. Such signatures encode the precise location of different types of variants, including single nucleotide variants, deletions, insertions, and amplifications, effectively introducing the concept of a general signature of variation. The precise nature of variants is then resolved through the generation of targeted alignments between specific sets of sequence reads and known regions of the reference genome. Thus, the perfect match logic decouples the identification of the location of variants from the characterization of their nature, providing a unified framework for the detection of genome variation. We assessed the performance of the PMGL strategy via simulation experiments. We determined the variation profiles of natural genomes and of a synthetic chromosome, both in the context of haploid yeast strains. Our approach uncovered variants that have previously escaped detection. Moreover, our strategy is ideally suited for further refining high-quality reference genomes. The source codes for the automated PMGL pipeline have been deposited in a public repository. Copyright © 2018 by the Genetics Society of America.

  2. Population structure of pigs determined by single nucleotide polymorphisms observed in assembled expressed sequence tags.

    PubMed

    Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi

    2012-01-01

    We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.

  3. Standardization of PCR-RFLP analysis of nsSNP rs1468384 of NPC1L1 gene

    PubMed Central

    Balgir, Praveen P.; Khanna, Divya; Kaur, Gurlovleen

    2008-01-01

    Niemann-Pick C1-like 1 (NPC1L1) protein, a newly identified sterol influx transporter, located at the apical membrane of the enterocyte, which may actively facilitate the uptake of cholesterol by promoting the passage of sterols across the brush border membrane of the enterocyte. It effects intestinal cholesterol absorption and intracellular transport and as such is an integral part of complex process of cholesterol homeostasis. The study of population data for the distribution of these single nucleotide polymorphisms (SNP) of NPC1L1 has lead to the identification of six non-synonymous single nucleotide polymorphisms (nsSNP). The in vitro analysis using the software MuPro and StructureSNP shows that nsSNP M510I (rs1468384), which involves A→G base pair change leads to decrease in the stability of the protein. A reproducible and a cost-effective PCR-RFLP based assay was developed to screen for the SNP among population data. This SNP has been studied in Caucasian, Asian, and African American populations. Till date, no data is available on Indian population. The distribution of M510I NPC1L1 genotype was estimated in the North Western Indian Population as a test case. The allele distribution in Indian Population differs significantly from that of other populations. The methodology thus proved to be robust enough to bring out these differences. PMID:20300301

  4. Using of methods of speckle optics for Chlamydia trachomatis typing

    NASA Astrophysics Data System (ADS)

    Ulyanov, Sergey S.; Zaytsev, Sergey S.; Ulianova, Onega V.; Saltykov, Yury V.; Feodorova, Valentina A.

    2017-03-01

    Specific method of transformation of nucleotide of gene into speckle pattern is suggested. Reference speckle pattern of omp1 gene of typical wild strains of Chlamydia trachomatis of genovars D, E, F, G, J and K and Chlamydia psittaci as well is generated. Perspectives of proposed technique in the gene identification and detection of natural genetic mutations as single nucleotide polymorphism (SNP) are demonstrated.

  5. High-resolution genetic map for understanding the effect of genome-wide recombination rate, selection sweep and linkage disequilibrium on nucleotide diversity in watermelon

    USDA-ARS?s Scientific Manuscript database

    Genotyping by sequencing (GBS) technology was used to identify a set of 9,933 single nucleotide polymorphism (SNP) markers for constructing a high-resolution genetic map of 1,087 cM for watermelon. The genome-wide variation of recombination rate (GWRR) across the map was evaluated and a positive co...

  6. Inflammasome activation causes dual recruitment of NLRC4 and NLRP3 to the same macromolecular complex.

    PubMed

    Man, Si Ming; Hopkins, Lee J; Nugent, Eileen; Cox, Susan; Glück, Ivo M; Tourlomousis, Panagiotis; Wright, John A; Cicuta, Pietro; Monie, Tom P; Bryant, Clare E

    2014-05-20

    Pathogen recognition by nucleotide-binding oligomerization domain-like receptor (NLR) results in the formation of a macromolecular protein complex (inflammasome) that drives protective inflammatory responses in the host. It is thought that the number of inflammasome complexes forming in a cell is determined by the number of NLRs being activated, with each NLR initiating its own inflammasome assembly independent of one another; however, we show here that the important foodborne pathogen Salmonella enterica serovar Typhimurium (S. Typhimurium) simultaneously activates at least two NLRs, whereas only a single inflammasome complex is formed in a macrophage. Both nucleotide-binding domain and leucine-rich repeat caspase recruitment domain 4 and nucleotide-binding domain and leucine-rich repeat pyrin domain 3 are simultaneously present in the same inflammasome, where both NLRs are required to drive IL-1β processing within the Salmonella-infected cell and to regulate the bacterial burden in mice. Superresolution imaging of Salmonella-infected macrophages revealed a macromolecular complex with an outer ring of apoptosis-associated speck-like protein containing a caspase activation and recruitment domain and an inner ring of NLRs, with active caspase effectors containing the pro-IL-1β substrate localized internal to the ring structure. Our data reveal the spatial localization of different components of the inflammasome and how different members of the NLR family cooperate to drive robust IL-1β processing during Salmonella infection.

  7. Molecular variation and distribution of Anopheles fluviatilis (Diptera: Culicidae) complex in Iran.

    PubMed

    Naddaf, Saied Reza; Razavi, Mohammad Reza; Bahramali, Golnaz

    2010-09-01

    Anopheles fluviatilis James (Diptera: Culicidae) is one of the known malaria vectors in south and southeastern Iran. Earlier ITS2 sequences analysis of specimens from Iran demonstrated only a single genotype that was identical to species Y in India, which is also the same as species T. We identified 2 haplotypes in the An. fluviatilis populations of Iran based on differences in nucleotide sequences of D3 domain of the 28S locus of ribosomal DNA (rDNA). Comparison of sequence data from 44 Iranian specimens with those publicly available in the Genbank database showed that all of the 28S-D3 sequences from Kazeroun and Khesht regions in Fars Province were identical to the database entry representing species U in India. In other regions, all the individuals showed heterozygosity at the single nucleotide position, which identifies species U and T. It is argued that the 2 species may co-occur in some regions and hybridize; however, the heterozygosity in the 28S-D3 locus was not reflected in ITS2 sequences and this locus for all individuals was identical to species T. This study shows that in a newly diverged species, like members of An. fluviatilis complex, a single molecular marker may not be sufficiently discriminatory to identify all the taxa over a vast geographical area. In addition, other molecular markers may provide more reliable information for species discrimination.

  8. Denoising DNA deep sequencing data—high-throughput sequencing errors and their correction

    PubMed Central

    Laehnemann, David; Borkhardt, Arndt

    2016-01-01

    Characterizing the errors generated by common high-throughput sequencing platforms and telling true genetic variation from technical artefacts are two interdependent steps, essential to many analyses such as single nucleotide variant calling, haplotype inference, sequence assembly and evolutionary studies. Both random and systematic errors can show a specific occurrence profile for each of the six prominent sequencing platforms surveyed here: 454 pyrosequencing, Complete Genomics DNA nanoball sequencing, Illumina sequencing by synthesis, Ion Torrent semiconductor sequencing, Pacific Biosciences single-molecule real-time sequencing and Oxford Nanopore sequencing. There is a large variety of programs available for error removal in sequencing read data, which differ in the error models and statistical techniques they use, the features of the data they analyse, the parameters they determine from them and the data structures and algorithms they use. We highlight the assumptions they make and for which data types these hold, providing guidance which tools to consider for benchmarking with regard to the data properties. While no benchmarking results are included here, such specific benchmarks would greatly inform tool choices and future software development. The development of stand-alone error correctors, as well as single nucleotide variant and haplotype callers, could also benefit from using more of the knowledge about error profiles and from (re)combining ideas from the existing approaches presented here. PMID:26026159

  9. Homogeneous real-time detection of single-nucleotide polymorphisms by strand displacement amplification on the BD ProbeTec ET system.

    PubMed

    Wang, Sha-Sha; Thornton, Keith; Kuhn, Andrew M; Nadeau, James G; Hellyer, Tobin J

    2003-10-01

    The BD ProbeTec ET System is based on isothermal strand displacement amplification (SDA) of target nucleic acid coupled with homogeneous real-time detection using fluorescent probes. We have developed a novel, rapid method using this platform that incorporates a universal detection format for identification of single-nucleotide polymorphisms (SNPs) and other genotypic variations. The system uses a common pair of fluorescent Detector Probes in conjunction with unlabeled allele-specific Adapter Primers and a universal buffer chemistry to permit analysis of multiple SNP loci under generic assay conditions. We used Detector Probes labeled with different dyes to facilitate differentiation of two alternative alleles in a single reaction with no postamplification manipulation. We analyzed six SNPs within the human beta(2)-adrenergic receptor (beta(2)AR) gene, using whole blood, buccal swabs, and urine samples, and compared results with those obtained by DNA sequencing. Unprocessed whole blood was successfully genotyped with as little as 0.1-1 micro L of sample per reaction. All six beta(2)AR assays were able to accommodate >/==" BORDER="0">20 micro L of unprocessed whole blood. For the 14 individuals tested, genotypes determined with the six beta(2)AR assays agreed with DNA sequencing results. SDA-based allelic differentiation on the BD ProbeTec ET System can detect SNPs rapidly, using whole blood, buccal swabs, or urine.

  10. Single Nucleobase Identification Using Biophysical Signatures from Nanoelectronic Quantum Tunneling.

    PubMed

    Korshoj, Lee E; Afsari, Sepideh; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-03-01

    Nanoelectronic DNA sequencing can provide an important alternative to sequencing-by-synthesis by reducing sample preparation time, cost, and complexity as a high-throughput next-generation technique with accurate single-molecule identification. However, sample noise and signature overlap continue to prevent high-resolution and accurate sequencing results. Probing the molecular orbitals of chemically distinct DNA nucleobases offers a path for facile sequence identification, but molecular entropy (from nucleotide conformations) makes such identification difficult when relying only on the energies of lowest-unoccupied and highest-occupied molecular orbitals (LUMO and HOMO). Here, nine biophysical parameters are developed to better characterize molecular orbitals of individual nucleobases, intended for single-molecule DNA sequencing using quantum tunneling of charges. For this analysis, theoretical models for quantum tunneling are combined with transition voltage spectroscopy to obtain measurable parameters unique to the molecule within an electronic junction. Scanning tunneling spectroscopy is then used to measure these nine biophysical parameters for DNA nucleotides, and a modified machine learning algorithm identified nucleobases. The new parameters significantly improve base calling over merely using LUMO and HOMO frontier orbital energies. Furthermore, high accuracies for identifying DNA nucleobases were observed at different pH conditions. These results have significant implications for developing a robust and accurate high-throughput nanoelectronic DNA sequencing technique. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Multiple-strand displacement and identification of single nucleotide polymorphisms as markers of genotypic variation of Pasteuria penetrans biotypes infecting root-knot nematodes.

    PubMed

    Nong, Guang; Chow, Virginia; Schmidt, Liesbeth M; Dickson, Don W; Preston, James F

    2007-08-01

    Pasteuria species are endospore-forming obligate bacterial parasites of soil-inhabiting nematodes and water-inhabiting cladocerans, e.g. water fleas, and are closely related to Bacillus spp. by 16S rRNA gene sequence. As naturally occurring bacteria, biotypes of Pasteuria penetrans are attractive candidates for the biocontrol of various Meloidogyne spp. (root-knot nematodes). Failure to culture these bacteria outside their hosts has prevented isolation of genomic DNA in quantities sufficient for identification of genes associated with host recognition and virulence. We have applied multiple-strand displacement amplification (MDA) to generate DNA for comparative genomics of biotypes exhibiting different host preferences. Using the genome of Bacillus subtilis as a paradigm, MDA allowed quantitative detection and sequencing of 12 marker genes from 2000 cells. Meloidogyne spp. infected with P. penetrans P20 or B4 contained single nucleotide polymorphisms (SNPs) in the spoIIAB gene that did not change the amino acid sequence, or that substituted amino acids with similar chemical properties. Individual nematodes infected with P. penetrans P20 or B4 contained SNPs in the spoIIAB gene sequenced in MDA-generated products. Detection of SNPs in the spoIIAB gene in a nematode indicates infection by more than one genotype, supporting the need to sequence genomes of Pasteuria spp. derived from single spore isolates.

  12. IGF-I gene variability is associated with an increased risk for AD.

    PubMed

    Vargas, Teo; Martinez-Garcia, Ana; Antequera, Desiree; Vilella, Elisabet; Clarimon, Jordi; Mateo, Ignacio; Sanchez-Juan, Pascual; Rodriguez-Rodriguez, Eloy; Frank, Ana; Rosich-Estrago, Marcel; Lleo, Alberto; Molina-Porcel, Laura; Blesa, Rafael; Gomez-Isla, Teresa; Combarros, Onofre; Bermejo-Pareja, Felix; Valdivieso, Fernando; Bullido, Maria Jesus; Carro, Eva

    2011-03-01

    Insulin-like growth factor I (IGF-I), a neuroprotective factor with a wide spectrum of actions in the adult brain, is involved in the pathogenesis of Alzheimer's disease (AD). Circulating levels of IGF-I change in AD patients and are implicated in the clearance of brain amyloid beta (Aβ) complexes. To investigate this hypothesis, we screened the IGF-I gene for various well known single nucleotide polymorphisms (SNPs) covering % of the gene variability in a population of 2352 individuals. Genetic analysis indicated different distribution of genotypes of 1 single nucleotide polymorphism, and 1 extended haplotype in the AD population compared with healthy control subjects. In particular, the frequency of rs972936 GG genotype was significantly greater in AD patients than in control subjects (63% vs. 55%). The rs972936 GG genotype was associated with an increased risk for disease, independently of apolipoprotein E genotype, and with enhanced circulating levels of IGF-I. These findings suggest that polymorphisms within the IGF-I gene could infer greater risk for AD through their effect on IGF-I levels, and confirm the physiological role IGF-I in the pathogenesis of AD. Copyright © 2011 IBRO. Published by Elsevier Inc. All rights reserved.

  13. regSNPs-splicing: a tool for prioritizing synonymous single-nucleotide substitution.

    PubMed

    Zhang, Xinjun; Li, Meng; Lin, Hai; Rao, Xi; Feng, Weixing; Yang, Yuedong; Mort, Matthew; Cooper, David N; Wang, Yue; Wang, Yadong; Wells, Clark; Zhou, Yaoqi; Liu, Yunlong

    2017-09-01

    While synonymous single-nucleotide variants (sSNVs) have largely been unstudied, since they do not alter protein sequence, mounting evidence suggests that they may affect RNA conformation, splicing, and the stability of nascent-mRNAs to promote various diseases. Accurately prioritizing deleterious sSNVs from a pool of neutral ones can significantly improve our ability of selecting functional genetic variants identified from various genome-sequencing projects, and, therefore, advance our understanding of disease etiology. In this study, we develop a computational algorithm to prioritize sSNVs based on their impact on mRNA splicing and protein function. In addition to genomic features that potentially affect splicing regulation, our proposed algorithm also includes dozens structural features that characterize the functions of alternatively spliced exons on protein function. Our systematical evaluation on thousands of sSNVs suggests that several structural features, including intrinsic disorder protein scores, solvent accessible surface areas, protein secondary structures, and known and predicted protein family domains, show significant differences between disease-causing and neutral sSNVs. Our result suggests that the protein structure features offer an added dimension of information while distinguishing disease-causing and neutral synonymous variants. The inclusion of structural features increases the predictive accuracy for functional sSNV prioritization.

  14. Development of a single nucleotide polymorphism DNA microarray for the detection and genotyping of the SARS coronavirus.

    PubMed

    Guo, Xi; Geng, Peng; Wang, Quan; Cao, Boyang; Liu, Bin

    2014-10-01

    Severe acute respiratory syndrome (SARS), a disease that spread widely in the world during late 2002 to 2004, severely threatened public health. Although there have been no reported infections since 2004, the extremely pathogenic SARS coronavirus (SARS-CoV), as the causative agent of SARS, has recently been identified in animals, showing the potential for the re-emergence of this disease. Previous studies showed that 27 single nucleotide polymorphism (SNP) mutations among the spike (S) gene of this virus are correlated closely with the SARS pathogenicity and epidemicity. We have developed a SNP DNA microarray in order to detect and genotype these SNPs, and to obtain related information on the pathogenicity and epidemicity of a given strain. The microarray was hybridized with PCR products amplified from cDNAs obtained from different SARS-CoV strains. We were able to detect 24 SNPs and determine the type of a given strain. The hybridization profile showed that 19 samples were detected and genotyped correctly by using our microarray, with 100% accuracy. Our microarray provides a novel method for the detection and epidemiological surveillance of SARS-CoV.

  15. Functional single nucleotide polymorphisms of matrix metalloproteinase 7 and 12 genes in idiopathic recurrent spontaneous abortion.

    PubMed

    Barišić, Anita; Pereza, Nina; Hodžić, Alenka; Kapović, Miljenko; Peterlin, Borut; Ostojić, Saša

    2017-03-01

    The aim of this study was to investigate the potential association of matrix metalloproteinase 7 (MMP7) -181 A/G and MMP12 -82 A/G functional single nucleotide polymorphisms (SNP) with idiopathic recurrent spontaneous abortion (IRSA) in Slovenian reproductive couples. A case-control study was conducted on 149 couples with 3 or more consecutive idiopathic spontaneous pregnancy loses and 149 women and men with at least 2 live births and no history of pregnancy complications. Genotyping of MMP7 -181 A/G and MMP12 -82 A/G SNPs was performed using polymerase chain reaction and restriction fragment length polymorphism methods. There were no statistically significant differences in the distribution of MMP7 -181 A/G and MMP12 -82 A/G genotype, allele, or haplotype frequencies between IRSA patients and controls, as well as patients' primary and secondary IRSA. We also found no association of MMP7 -181 A/G and MMP12 -82 A/G genotypes, alleles, and haplotypes with IRSA. We found no evidence to support the association between IRSA and MMP7 -181 A/G and MMP12 -82 A/G SNPs in Slovenian reproductive couples.

  16. Integrated analyses using RNA-Seq data reveal viral genomes, single nucleotide variations, the phylogenetic relationship, and recombination for Apple stem grooving virus.

    PubMed

    Jo, Yeonhwa; Choi, Hoseong; Kim, Sang-Min; Kim, Sun-Lim; Lee, Bong Choon; Cho, Won Kyong

    2016-08-09

    Next-generation sequencing (NGS) provides many possibilities for plant virology research. In this study, we performed integrated analyses using plant transcriptome data for plant virus identification using Apple stem grooving virus (ASGV) as an exemplar virus. We used 15 publicly available transcriptome libraries from three different studies, two mRNA-Seq studies and a small RNA-Seq study. We de novo assembled nearly complete genomes of ASGV isolates Fuji and Cuiguan from apple and pear transcriptomes, respectively, and identified single nucleotide variations (SNVs) of ASGV within the transcriptomes. We demonstrated the application of NGS raw data to confirm viral infections in the plant transcriptomes. In addition, we compared the usability of two de novo assemblers, Trinity and Velvet, for virus identification and genome assembly. A phylogenetic tree revealed that ASGV and Citrus tatter leaf virus (CTLV) are the same virus, which was divided into two clades. Recombination analyses identified six recombination events from 21 viral genomes. Taken together, our in silico analyses using NGS data provide a successful application of plant transcriptomes to reveal extensive information associated with viral genome assembly, SNVs, phylogenetic relationships, and genetic recombination.

  17. Genetic diversity and population structure analysis of spinach by single-nucleotide polymorphisms identified through genotyping-by-sequencing.

    PubMed

    Shi, Ainong; Qin, Jun; Mou, Beiquan; Correll, James; Weng, Yuejin; Brenner, David; Feng, Chunda; Motes, Dennis; Yang, Wei; Dong, Lingdi; Bhattarai, Gehendra; Ravelombola, Waltram

    2017-01-01

    Spinach (Spinacia oleracea L., 2n = 2x = 12) is an economically important vegetable crop worldwide and one of the healthiest vegetables due to its high concentrations of nutrients and minerals. The objective of this research was to conduct genetic diversity and population structure analysis of a collection of world-wide spinach genotypes using single nucleotide polymorphisms (SNPs) markers. Genotyping by sequencing (GBS) was used to discover SNPs in spinach genotypes. Three sets of spinach genotypes were used: 1) 268 USDA GRIN spinach germplasm accessions originally collected from 30 countries; 2) 45 commercial spinach F1 hybrids from three countries; and 3) 30 US Arkansas spinach cultivars/breeding lines. The results from this study indicated that there was genetic diversity among the 343 spinach genotypes tested. Furthermore, the genetic background in improved commercial F1 hybrids and in Arkansas cultivars/lines had a different structured populations from the USDA germplasm. In addition, the genetic diversity and population structures were associated with geographic origin and germplasm from the US Arkansas breeding program had a unique genetic background. These data could provide genetic diversity information and the molecular markers for selecting parents in spinach breeding programs.

  18. Genetic diversity and population structure analysis of spinach by single-nucleotide polymorphisms identified through genotyping-by-sequencing

    PubMed Central

    Qin, Jun; Mou, Beiquan; Correll, James; Weng, Yuejin; Brenner, David; Feng, Chunda; Motes, Dennis; Yang, Wei; Dong, Lingdi; Bhattarai, Gehendra; Ravelombola, Waltram

    2017-01-01

    Spinach (Spinacia oleracea L., 2n = 2x = 12) is an economically important vegetable crop worldwide and one of the healthiest vegetables due to its high concentrations of nutrients and minerals. The objective of this research was to conduct genetic diversity and population structure analysis of a collection of world-wide spinach genotypes using single nucleotide polymorphisms (SNPs) markers. Genotyping by sequencing (GBS) was used to discover SNPs in spinach genotypes. Three sets of spinach genotypes were used: 1) 268 USDA GRIN spinach germplasm accessions originally collected from 30 countries; 2) 45 commercial spinach F1 hybrids from three countries; and 3) 30 US Arkansas spinach cultivars/breeding lines. The results from this study indicated that there was genetic diversity among the 343 spinach genotypes tested. Furthermore, the genetic background in improved commercial F1 hybrids and in Arkansas cultivars/lines had a different structured populations from the USDA germplasm. In addition, the genetic diversity and population structures were associated with geographic origin and germplasm from the US Arkansas breeding program had a unique genetic background. These data could provide genetic diversity information and the molecular markers for selecting parents in spinach breeding programs. PMID:29190770

  19. Nucleotide sequence analysis establishes the role of endogenous murine leukemia virus DNA segments in formation of recombinant mink cell focus-forming murine leukemia viruses.

    PubMed Central

    Khan, A S

    1984-01-01

    The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017

  20. Greater numbers of nucleotide substitutions are introduced into the genomic RNA of bovine viral diarrhea virus during acute infections of pregnant cattle than of non-pregnant cattle.

    PubMed

    Neill, John D; Newcomer, Benjamin W; Marley, Shonda D; Ridpath, Julia F; Givens, M Daniel

    2012-08-06

    Bovine viral diarrhea virus (BVDV) strains circulating in livestock herds show significant sequence variation. Conventional wisdom states that most sequence variation arises during acute infections in response to immune or other environmental pressures. A recent study showed that more nucleotide changes were introduced into the BVDV genomic RNA during the establishment of a single fetal persistent infection than following a series of acute infections of naïve cattle. However, it was not known if nucleotide changes were introduce when the virus crossed the placenta and infected the fetus or during the acute infection of the dam. The sequence of the open reading frame (ORF) from viruses isolated from four acutely infected pregnant heifers following exposure to persistently infected (PI) calves was compared to the sequences of the virus from the progenitor PI calf and the virus from the resulting progeny PI calf to determine when genetic change was introduced. This was compared to genetic change found in viruses isolated from a pregnant PI cow and its PI calf, and in three viruses isolated from acutely infected, non-pregnant cattle exposed to PI calves. Most genetic changes previously identified between the progenitor and progeny PI viruses were in place in the acute phase viruses isolated from the dams six days post-exposure to the progenitor PI calf. Additionally, each progeny PI virus had two to three unique nucleotide substitutions that were introduced in crossing the placenta and infection of the fetus. The nucleotide sequence of two acute phase viruses isolated from steers exposed to PI calves revealed that six and seven nucleotide changes were introduced during the acute infection. The sequence of the BVDV-2 virus isolated from an acute infection of a PI calf (BVDV-1a) co-housed with a BVDV-2 PI calf had ten nucleotides that were different from the progenitor PI virus. Finally, twenty nucleotide changes were identified in the PI virus of a calf born to a PI dam. These results demonstrate that nucleotide changes are introduced into the BVDV infecting pregnant cattle at rates of 2.3 to 8 fold higher then during the acute infection of non-pregnant animals.

  1. 2'-Bispyrene-modified 2'-O-methyl RNA probes as useful tools for the detection of RNA: synthesis, fluorescent properties, and duplex stability.

    PubMed

    Krasheninina, Olga A; Novopashina, Darya S; Lomzov, Alexander A; Venyaminova, Alya G

    2014-09-05

    The synthesis and properties two series of new 2'-O-methyl RNA probes, each containing a single insertion of a 2'-bispyrenylmethylphosphorodiamidate derivative of a nucleotide (U, C, A, and G), are described. As demonstrated by UV melting studies, the probes form stable complexes with model RNAs and DNAs. Significant increases (up to 21-fold) in pyrene excimer fluorescence intensity were observed upon binding of most of the probes with complementary RNAs, but not with DNAs. The fluorescence spectra are independent of the nature of the modified nucleotides. The nucleotides on the 5'-side of the modified nucleotide have no effect on the fluorescence spectra, whereas the natures of the two nucleotides on the 3'-side are important: CC, CG, and UC dinucleotide units on the 3'-side of the modified nucleotide provide the maximum increases in excimer fluorescence intensity. This study suggests that these 2'-bispyrene-labeled 2'-O-methyl RNA probes might be useful tools for detection of RNAs. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Hannaella phyllophila sp. nov., a basidiomycetous yeast species associated with plants in Thailand and Taiwan.

    PubMed

    Surussawadee, Janjira; Jindamorakot, Sasitorn; Nakase, Takashi; Lee, Ching-Fu; Limtong, Savitree

    2015-07-01

    Five strains representing one novel anamorphic yeast species were isolated from plant leaves collected in Thailand (strains DMKU-SP186(T), ST-111 and ST-201) and Taiwan (strains FN20L02 and SM13L16). On the basis of morphological, biochemical, physiological and chemotaxonomic characteristics and sequence analysis of the D1/D2 region of the large subunit (LSU) rRNA gene and the internal transcribed spacer (ITS) region, they were assigned to a single novel species of the genus Hannaella. The sequences of the D1/D2 regions of the LSU rRNA genes of four of the strains (DMKU-SP186(T), ST-111, FN20L02 and SM13L16) were identical, while differing from strain ST-201 by 2 substitutions and 2 gaps. The nucleotide sequence of the ITS regions of the five strains differed from each other by between 0 and 3 nucleotide substitutions. The novel species was most closely related to Hannaella luteola, but showed 1.0-1.3% nucleotide substitutions (between 6 substitutions out of 568-606 nt and 8 substitutions, and 2 gaps out of 597 nt) in the D1/D2 region of the LSU rRNA gene and 1.4-2.0% nucleotide substitutions (6-9 substitutions out of 435 nt) in the ITS region. Ballistospores were produced by three of the strains on cornmeal agar at 15 and 20 °C after 4 weeks, while H. luteola did not produce ballistospores. The name Hannaella phyllophila sp. nov. is proposed. The type strain is DMKU-SP186(T) ( = BCC 69500(T) = NBRC 110428(T) = CBS 13921(T)).

  3. Developing single nucleotide polymorphism markers for the identification of pineapple (Ananas comosus) germplasm.

    PubMed

    Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng

    2015-01-01

    Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. 'Cayenne', 'Spanish', 'Queen') was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops.

  4. Genetic variants of human serum cholinesterase influence metabolism of the muscle relaxant succinylcholine.

    PubMed

    Lockridge, O

    1990-01-01

    People with genetic variants of cholinesterase respond abnormally to succinylcholine, experiencing substantial prolongation of muscle paralysis with apnea rather than the usual 2-6 min. The structure of usual cholinesterase has been determined including the complete amino acid and nucleotide sequence. This has allowed identification of altered amino acids and nucleotides. The variant most frequently found in patients who respond abnormally to succinylcholine is atypical cholinesterase, which occurs in homozygous form in 1 out of 3500 Caucasians. Atypical cholinesterase has a single substitution at nucleotide 209 which changes aspartic acid 70 to glycine. This suggests that Asp 70 is part of the anionic site, and that the absence of this negatively charged amino acid explains the reduced affinity of atypical cholinesterase for positively charged substrates and inhibitors. The clinical consequence of reduced affinity for succinylcholine is that none of the succinylcholine is hydrolyzed in blood and a large overdose reaches the nerve-muscle junction where it causes prolonged muscle paralysis. Silent cholinesterase has a frame shift mutation at glycine 117 which prematurely terminates protein synthesis and yields no active enzyme. The K variant, named in honor of W. Kalow, has threonine in place of alanine 539. The K variant is associated with 33% lower activity. All variants arise from a single locus as there is only one gene for human cholinesterase (EC 3.1.1.8). Comparison of amino acid sequences of esterases and proteases shows that cholinesterase belongs to a new family of serine esterases which is different from the serine proteases.

  5. Detection of single nucleotide polymorphisms (SNP) in equine coat color genes using SNaPshotTM multiplex kit or pluronic F-108 tri-block copolymer and capillary electrophoresis.

    PubMed

    Martin, Lauren; Damaso, Natalie; Mills, DeEtta

    2016-10-01

    Molecular methods for the detection of mammalian coat color phenotypes have expanded greatly within the past decade. Many phenotypes are associated with a single nucleotide polymorphism mutation in the genetic sequence. Traditionally, these mutations are detected through sequencing, hybridization assays or mini-sequencing. However, these techniques can be expensive and tedious. Previously, CE-SSCP using the F-108 polymer was able to distinguish SNPs for the melanocortin-1 receptor (mc1r) coat color gene in horses (Equus caballus) that differed by one nucleotide substitution. The objective of this study was to expand the detection of coat color SNPs in horses. The genes for the solute carrier family member 2 (slc45a2/matp), type III receptor protein-tyrosine kinase (kit) and mc1r genes using CE-SSCP and F-108 polymer were compared to mini-sequencing with the SNaPshot TM kit. The F-108 polymer reproducibly resolved homozygous and heterozygous individuals for the mc1r and kit markers, but was unable to resolve heterozygous individuals for slc45a2 at 38ºC. The need for temperatures <15ºC, the SNP position being close to the 5'-end, and conformational structures/free energy with similar values resulted in the inability to resolve the secondary structures. Despite this limitation, the CE-SSCP method could be used to provide a rapid phenotypic description for equine forensic investigations. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Associations between single nucleotide polymorphisms in multiple candidate genes and body weight in rabbits

    PubMed Central

    El-Sabrout, Karim; Aggag, Sarah A.

    2017-01-01

    Aim: In this study, we examined parts of six growth genes (growth hormone [GH], melanocortin 4 receptor [MC4R], growth hormone receptor [GHR], phosphorglycerate mutase [PGAM], myostatin [MSTN], and fibroblast growth factor [FGF]) as specific primers for two rabbit lines (V-line, Alexandria) using nucleotide sequence analysis, to investigate association between detecting single nucleotide polymorphism (SNP) of these genes and body weight (BW) at market. Materials and Methods: Each line kits were grouped into high and low weight rabbits to identify DNA markers useful for association studies with high BW. DNA from blood samples of each group was extracted to amplify the six growth genes. SNP technique was used to study the associate polymorphism in the six growth genes and marketing BW (at 63 days) in the two rabbit lines. The purified polymerase chain reaction products were sequenced in those had the highest and lowest BW in each line. Results: Alignment of sequence data from each group revealed the following SNPs: At nucleotide 23 (A-C) and nucleotide 35 (T-G) in MC4R gene (sense mutation) of Alexandria and V-line high BW. Furthermore, we detected the following SNPs variation between the two lines: A SNP (T-C) at nucleotide 27 was identified by MC4R gene (sense mutation) and another one (A-C) at nucleotide 14 was identified by GHR gene (nonsense mutation) of Alexandria line. The results of individual BW at market (63 days) indicated that Alexandria rabbits had significantly higher BW compared with V-line rabbits. MC4R polymorphism showed significant association with high BW in rabbits. Conclusion: The results of polymorphism demonstrate the possibility to detect an association between BW in rabbits and the efficiency of the used primers to predict through the genetic specificity using the SNP of MC4R. PMID:28246458

  7. Probing Gαi1 Protein Activation at Single Amino Acid Resolution

    PubMed Central

    Sun, Dawei; Maeda, Shoji; Matkovic, Milos; Mendieta, Sandro; Mayer, Daniel; Dawson, Roger; Schertler, Gebhard F.X.; Madan Babu, M.; Veprintsev, Dmitry B.

    2016-01-01

    We present comprehensive single amino acid resolution maps of the residues stabilising the human Gαi1 subunit in nucleotide- and receptor-bound states. We generated these maps by measuring the effects of alanine mutations on the stability of Gαi1 and of the rhodopsin-Gαi1 complex. We identified stabilization clusters in the GTPase and helical domains responsible for structural integrity and the conformational changes associated with activation. In activation cluster I, helices α1 and α5 pack against strands β1-3 to stabilize the nucleotide-bound states. In the receptor-bound state, these interactions are replaced by interactions between α5 and strands β4-6. Key residues in this cluster are Y320, crucial for the stabilization of the receptor-bound state, and F336, which stabilizes nucleotide-bound states. Destabilization of helix α1, caused by rearrangement of this activation cluster, leads to the weakening of the inter-domain interface and release of GDP. PMID:26258638

  8. Chloroplast DNA Structural Variation, Phylogeny, and Age of Divergence among Diploid Cotton Species.

    PubMed

    Chen, Zhiwen; Feng, Kun; Grover, Corrinne E; Li, Pengbo; Liu, Fang; Wang, Yumei; Xu, Qin; Shang, Mingzhao; Zhou, Zhongli; Cai, Xiaoyan; Wang, Xingxing; Wendel, Jonathan F; Wang, Kunbo; Hua, Jinping

    2016-01-01

    The cotton genus (Gossypium spp.) contains 8 monophyletic diploid genome groups (A, B, C, D, E, F, G, K) and a single allotetraploid clade (AD). To gain insight into the phylogeny of Gossypium and molecular evolution of the chloroplast genome in this group, we performed a comparative analysis of 19 Gossypium chloroplast genomes, six reported here for the first time. Nucleotide distance in non-coding regions was about three times that of coding regions. As expected, distances were smaller within than among genome groups. Phylogenetic topologies based on nucleotide and indel data support for the resolution of the 8 genome groups into 6 clades. Phylogenetic analysis of indel distribution among the 19 genomes demonstrates contrasting evolutionary dynamics in different clades, with a parallel genome downsizing in two genome groups and a biased accumulation of insertions in the clade containing the cultivated cottons leading to large (for Gossypium) chloroplast genomes. Divergence time estimates derived from the cpDNA sequence suggest that the major diploid clades had diverged approximately 10 to 11 million years ago. The complete nucleotide sequences of 6 cpDNA genomes are provided, offering a resource for cytonuclear studies in Gossypium.

  9. Chloroplast DNA Structural Variation, Phylogeny, and Age of Divergence among Diploid Cotton Species

    PubMed Central

    Li, Pengbo; Liu, Fang; Wang, Yumei; Xu, Qin; Shang, Mingzhao; Zhou, Zhongli; Cai, Xiaoyan; Wang, Xingxing; Wendel, Jonathan F.; Wang, Kunbo

    2016-01-01

    The cotton genus (Gossypium spp.) contains 8 monophyletic diploid genome groups (A, B, C, D, E, F, G, K) and a single allotetraploid clade (AD). To gain insight into the phylogeny of Gossypium and molecular evolution of the chloroplast genome in this group, we performed a comparative analysis of 19 Gossypium chloroplast genomes, six reported here for the first time. Nucleotide distance in non-coding regions was about three times that of coding regions. As expected, distances were smaller within than among genome groups. Phylogenetic topologies based on nucleotide and indel data support for the resolution of the 8 genome groups into 6 clades. Phylogenetic analysis of indel distribution among the 19 genomes demonstrates contrasting evolutionary dynamics in different clades, with a parallel genome downsizing in two genome groups and a biased accumulation of insertions in the clade containing the cultivated cottons leading to large (for Gossypium) chloroplast genomes. Divergence time estimates derived from the cpDNA sequence suggest that the major diploid clades had diverged approximately 10 to 11 million years ago. The complete nucleotide sequences of 6 cpDNA genomes are provided, offering a resource for cytonuclear studies in Gossypium. PMID:27309527

  10. Detection of nucleotide-specific CRISPR/Cas9 modified alleles using multiplex ligation detection

    PubMed Central

    KC, R.; Srivastava, A.; Wilkowski, J. M.; Richter, C. E.; Shavit, J. A.; Burke, D. T.; Bielas, S. L.

    2016-01-01

    CRISPR/Cas9 genome-editing has emerged as a powerful tool to create mutant alleles in model organisms. However, the precision with which these mutations are created has introduced a new set of complications for genotyping and colony management. Traditional gene-targeting approaches in many experimental organisms incorporated exogenous DNA and/or allele specific sequence that allow for genotyping strategies based on binary readout of PCR product amplification and size selection. In contrast, alleles created by non-homologous end-joining (NHEJ) repair of double-stranded DNA breaks generated by Cas9 are much less amenable to such strategies. Here we describe a novel genotyping strategy that is cost effective, sequence specific and allows for accurate and efficient multiplexing of small insertion-deletions and single-nucleotide variants characteristic of CRISPR/Cas9 edited alleles. We show that ligation detection reaction (LDR) can be used to generate products that are sequence specific and uniquely detected by product size and/or fluorescent tags. The method works independently of the model organism and will be useful for colony management as mutant alleles differing by a few nucleotides become more prevalent in experimental animal colonies. PMID:27557703

  11. The SNP g.1311T>C associated with the absence of β-casein in goat milk influences CSN2 promoter activity.

    PubMed

    Cosenza, G; Iannaccone, M; Pico, B A; Ramunno, L; Capparelli, R

    2016-10-01

    Quantitative individual differences in the amount of β-casein in goat milk are determined by at least nine alleles. In particular, two alleles (CSN2(0) and CSN2(01) ) are associated with an undetectable amount of this protein in milk. The CSN2(01) allele is characterized by a single nucleotide substitution at position 373 of the seventh exon (AJ011018:g.8915C>T), responsible for the formation of a premature stop codon at the 182 position. Herein, we report the contribution of the SNP g.1311T>C, which demonstrates a linkage with the SNP AJ011018:g.8915C>T, to the promoter transcriptional activity. Particularly, we indicate that the nucleotide C at position 1311 negatively affects the promoter activity of the CSN2 gene. © 2016 Stichting International Foundation for Animal Genetics.

  12. Synergistic effect of ATP for RuvA-RuvB-Holliday junction DNA complex formation.

    PubMed

    Iwasa, Takuma; Han, Yong-Woon; Hiramatsu, Ryo; Yokota, Hiroaki; Nakao, Kimiko; Yokokawa, Ryuji; Ono, Teruo; Harada, Yoshie

    2015-12-14

    The Escherichia coli RuvB hexameric ring motor proteins, together with RuvAs, promote branch migration of Holliday junction DNA. Zero mode waveguides (ZMWs) constitute of nanosized holes and enable the visualization of a single fluorescent molecule under micromolar order of the molecules, which is applicable to characterize the formation of RuvA-RuvB-Holliday junction DNA complex. In this study, we used ZMWs and counted the number of RuvBs binding to RuvA-Holliday junction DNA complex. Our data demonstrated that different nucleotide analogs increased the amount of Cy5-RuvBs binding to RuvA-Holliday junction DNA complex in the following order: no nucleotide, ADP, ATPγS, and mixture of ADP and ATPγS. These results suggest that not only ATP binding to RuvB but also ATP hydrolysis by RuvB facilitates a stable RuvA-RuvB-Holliday junction DNA complex formation.

  13. Amino acid sequence of the Amur tiger prion protein.

    PubMed

    Wu, Changde; Pang, Wanyong; Zhao, Deming

    2006-10-01

    Prion diseases are fatal neurodegenerative disorders in human and animal associated with conformational conversion of a cellular prion protein (PrP(C)) into the pathologic isoform (PrP(Sc)). Various data indicate that the polymorphisms within the open reading frame (ORF) of PrP are associated with the susceptibility and control the species barrier in prion diseases. In the present study, partial Prnp from 25 Amur tigers (tPrnp) were cloned and screened for polymorphisms. Four single nucleotide polymorphisms (T423C, A501G, C511A, A610G) were found; the C511A and A610G nucleotide substitutions resulted in the amino acid changes Lysine171Glutamine and Alanine204Threoine, respectively. The tPrnp amino acid sequence is similar to house cat (Felis catus ) and sheep, but differs significantly from other two cat Prnp sequences that were previously deposited in GenBank.

  14. Association between methylenetetrahydrofolate reductase polymorphism C677T and risk of chronic myeloid leukemia in Serbian population.

    PubMed

    Jakovljevic, Ksenija; Malisic, Emina; Cavic, Milena; Radulovic, Sinisa; Jankovic, Radmila

    2012-07-01

    Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme regulating the intracellular folate metabolism which plays an important role in carcinogenesis through DNA methylation and nucleotide synthesis. The common MTHFR single nucleotide polymorphism C677T has been reported to be associated with reduced enzymatic activity. In order to investigate the influence of this polymorphism on the risk of chronic myeloid leukemia (CML), we performed a case-control study in a Serbian population of 52 patients with CML and 53 healthy control subjects. MTHFR C677T polymorphism genotyping was assessed using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. The results demonstrated no statistical difference in MTHFR 677 frequency distribution between patient and control groups. Our findings suggest that MTHFR 677 gene variants have no significant influence on the susceptibility to CML in a Serbian population.

  15. How immunogenetically different are domestic pigs from wild boars: a perspective from single-nucleotide polymorphisms of 19 immunity-related candidate genes.

    PubMed

    Chen, Shanyuan; Gomes, Rui; Costa, Vânia; Santos, Pedro; Charneca, Rui; Zhang, Ya-ping; Liu, Xue-hong; Wang, Shao-qing; Bento, Pedro; Nunes, Jose-Luis; Buzgó, József; Varga, Gyula; Anton, István; Zsolnai, Attila; Beja-Pereira, Albano

    2013-10-01

    The coexistence of wild boars and domestic pigs across Eurasia makes it feasible to conduct comparative genetic or genomic analyses for addressing how genetically different a domestic species is from its wild ancestor. To test whether there are differences in patterns of genetic variability between wild and domestic pigs at immunity-related genes and to detect outlier loci putatively under selection that may underlie differences in immune responses, here we analyzed 54 single-nucleotide polymorphisms (SNPs) of 19 immunity-related candidate genes on 11 autosomes in three pairs of wild boar and domestic pig populations from China, Iberian Peninsula, and Hungary. Our results showed no statistically significant differences in allele frequency and heterozygosity across SNPs between three pairs of wild and domestic populations. This observation was more likely due to the widespread and long-lasting gene flow between wild boars and domestic pigs across Eurasia. In addition, we detected eight coding SNPs from six genes as outliers being under selection consistently by three outlier tests (BayeScan2.1, FDIST2, and Arlequin3.5). Among four non-synonymous outlier SNPs, one from TLR4 gene was identified as being subject to positive (diversifying) selection and three each from CD36, IFNW1, and IL1B genes were suggested as under balancing selection. All of these four non-synonymous variants were predicted as being benign by PolyPhen-2. Our results were supported by other independent lines of evidence for positive selection or balancing selection acting on these four immune genes (CD36, IFNW1, IL1B, and TLR4). Our study showed an example applying a candidate gene approach to identify functionally important mutations (i.e., outlier loci) in wild and domestic pigs for subsequent functional experiments.

  16. Single-Molecule Methods for Nucleotide Excision Repair: Building a System to Watch Repair in Real Time.

    PubMed

    Kong, Muwen; Beckwitt, Emily C; Springall, Luke; Kad, Neil M; Van Houten, Bennett

    2017-01-01

    Single-molecule approaches to solving biophysical problems are powerful tools that allow static and dynamic real-time observations of specific molecular interactions of interest in the absence of ensemble-averaging effects. Here, we provide detailed protocols for building an experimental system that employs atomic force microscopy and a single-molecule DNA tightrope assay based on oblique angle illumination fluorescence microscopy. Together with approaches for engineering site-specific lesions into DNA substrates, these complementary biophysical techniques are well suited for investigating protein-DNA interactions that involve target-specific DNA-binding proteins, such as those engaged in a variety of DNA repair pathways. In this chapter, we demonstrate the utility of the platform by applying these techniques in the studies of proteins participating in nucleotide excision repair. © 2017 Elsevier Inc. All rights reserved.

  17. Reciprocal uniparental disomy in yeast.

    PubMed

    Andersen, Sabrina L; Petes, Thomas D

    2012-06-19

    In the diploid cells of most organisms, including humans, each chromosome is usually distinguishable from its partner homolog by multiple single-nucleotide polymorphisms. One common type of genetic alteration observed in tumor cells is uniparental disomy (UPD), in which a pair of homologous chromosomes are derived from a single parent, resulting in loss of heterozygosity for all single-nucleotide polymorphisms while maintaining diploidy. Somatic UPD events are usually explained as reflecting two consecutive nondisjunction events. Here we report a previously undescribed mode of chromosome segregation in Saccharomyces cerevisiae in which one cell division produces daughter cells with reciprocal UPD for the same pair of chromosomes without an aneuploid intermediate. One pair of sister chromatids is segregated into one daughter cell and the other pair is segregated into the other daughter cell, mimicking a meiotic chromosome segregation pattern. We term this process "reciprocal uniparental disomy."

  18. Adsorption of nucleotides onto ferromagnesian phyllosilicates: Significance for the origin of life

    NASA Astrophysics Data System (ADS)

    Pedreira-Segade, Ulysse; Feuillie, Cécile; Pelletier, Manuel; Michot, Laurent J.; Daniel, Isabelle

    2016-03-01

    The concentration of prebiotic organic building blocks may have promoted the formation of biopolymers in the environment of the early Earth. We therefore studied the adsorption of RNA monomers AMP, GMP, CMP, and UMP, and DNA monomers dGMP, dCMP, and TMP, on minerals that were abundant in the early Earth environment as the result of aqueous or hydrothermal alteration of the primitive oceanic crust. We focused our study on swelling clays, i.e. nontronite and montmorillonite, and non-swelling phyllosilicates, i.e. pyrophyllite, chlorite, lizardite and chrysotile suspended in an aqueous saline solution analog to seawater. In this reference study, adsorption experiments were carried out under standard conditions of pressure and temperature and controlled pH. Under such conditions, this work is also relevant to the preservation of nucleic acids in Fe-Mg-rich terrestrial and Martian soils. We compared the adsorption of the different monomers on individual minerals, as well as the adsorption of single monomers on the whole suite of minerals. We found that DNA monomers adsorb much more strongly than RNA monomers, and that any monomer containing the G nucleobase adsorbed more strongly than one containing the C nucleobase. At high surface loadings (greater than about 1 mM monomer in aqueous solution) we also found a dramatic increase in the slope of adsorption isotherm on the swelling clays, leading to large increases in the amounts adsorbed. Data were processed in order to understand the adsorption mechanism of nucleotides onto mineral surfaces. We infer that all nucleotides behave as homologous molecules in regard to their adsorption onto the studied mineral surfaces. At low to moderate surface loadings, their adsorption is best explained by a single mechanism common to the suite of minerals of the present study. At pH 7, adsorption certainly proceeds by ligand exchange between the phosphate group and the hydroxyls of the broken edges of phyllosilicates leading to the saturation of lateral surfaces. Below pH 4, swelling clays also adsorb nucleotides through cation exchange on basal surfaces, whereas non-swelling phyllosilicates do not. However, at high surface loadings an additional mechanism stabilizing adsorption occurs. Given the proposed adsorption mechanisms, the possibility of a favorable polymerization at the mineral-water interface is discussed. We propose that Fe-Mg rich phyllosilicates tightly bind nucleotides, under ambient conditions, and concentrate them up to 1000 times the solution concentration upon saturation. Nontronites have the most diverse and favorable adsorption behaviors and could have helped to the concentration and polymerization of nucleotides under primitive Earth-like conditions.

  19. New chloroplast microsatellite markers suitable for assessing genetic diversity of Lolium perenne and other related grass species

    PubMed Central

    Diekmann, Kerstin; Hodkinson, Trevor R.; Barth, Susanne

    2012-01-01

    Background and Aims Lolium perenne (perennial ryegrass) is the most important forage grass species of temperate regions. We have previously released the chloroplast genome sequence of L. perenne ‘Cashel’. Here nine chloroplast microsatellite markers are published, which were designed based on knowledge about genetically variable regions within the L. perenne chloroplast genome. These markers were successfully used for characterizing the genetic diversity in Lolium and different grass species. Methods Chloroplast genomes of 14 Poaceae taxa were screened for mononucleotide microsatellite repeat regions and primers designed for their amplification from nine loci. The potential of these markers to assess genetic diversity was evaluated on a set of 16 Irish and 15 European L. perenne ecotypes, nine L. perenne cultivars, other Lolium taxa and other grass species. Key Results All analysed Poaceae chloroplast genomes contained more than 200 mononucleotide repeats (chloroplast simple sequence repeats, cpSSRs) of at least 7 bp in length, concentrated mainly in the large single copy region of the genome. Nucleotide composition varied considerably among subfamilies (with Pooideae biased towards poly A repeats). The nine new markers distinguish L. perenne from all non-Lolium taxa. TeaCpSSR28 was able to distinguish between all Lolium species and Lolium multiflorum due to an elongation of an A8 mononucleotide repeat in L. multiflorum. TeaCpSSR31 detected a considerable degree of microsatellite length variation and single nucleotide polymorphism. TeaCpSSR27 revealed variation within some L. perenne accessions due to a 44-bp indel and was hence readily detected by simple agarose gel electrophoresis. Smaller insertion/deletion events or single nucleotide polymorphisms detected by these new markers could be visualized by polyacrylamide gel electrophoresis or DNA sequencing, respectively. Conclusions The new markers are a valuable tool for plant breeding companies, seed testing agencies and the wider scientific community due to their ability to monitor genetic diversity within breeding pools, to trace maternal inheritance and to distinguish closely related species. PMID:22419761

  20. New chloroplast microsatellite markers suitable for assessing genetic diversity of Lolium perenne and other related grass species.

    PubMed

    Diekmann, Kerstin; Hodkinson, Trevor R; Barth, Susanne

    2012-11-01

    Lolium perenne (perennial ryegrass) is the most important forage grass species of temperate regions. We have previously released the chloroplast genome sequence of L. perenne 'Cashel'. Here nine chloroplast microsatellite markers are published, which were designed based on knowledge about genetically variable regions within the L. perenne chloroplast genome. These markers were successfully used for characterizing the genetic diversity in Lolium and different grass species. Chloroplast genomes of 14 Poaceae taxa were screened for mononucleotide microsatellite repeat regions and primers designed for their amplification from nine loci. The potential of these markers to assess genetic diversity was evaluated on a set of 16 Irish and 15 European L. perenne ecotypes, nine L. perenne cultivars, other Lolium taxa and other grass species. All analysed Poaceae chloroplast genomes contained more than 200 mononucleotide repeats (chloroplast simple sequence repeats, cpSSRs) of at least 7 bp in length, concentrated mainly in the large single copy region of the genome. Nucleotide composition varied considerably among subfamilies (with Pooideae biased towards poly A repeats). The nine new markers distinguish L. perenne from all non-Lolium taxa. TeaCpSSR28 was able to distinguish between all Lolium species and Lolium multiflorum due to an elongation of an A(8) mononucleotide repeat in L. multiflorum. TeaCpSSR31 detected a considerable degree of microsatellite length variation and single nucleotide polymorphism. TeaCpSSR27 revealed variation within some L. perenne accessions due to a 44-bp indel and was hence readily detected by simple agarose gel electrophoresis. Smaller insertion/deletion events or single nucleotide polymorphisms detected by these new markers could be visualized by polyacrylamide gel electrophoresis or DNA sequencing, respectively. The new markers are a valuable tool for plant breeding companies, seed testing agencies and the wider scientific community due to their ability to monitor genetic diversity within breeding pools, to trace maternal inheritance and to distinguish closely related species.

  1. Evaluation and identification of damaged single nucleotide polymorphisms in COL1A1 gene involved in osteoporosis

    PubMed Central

    Alsaif, Mohammed A.; Al Shammari, Sulaiman A.; Alhamdan, Adel A.

    2012-01-01

    Introduction Single-nucleotide polymorphisms (SNPs) are biomarkers for exploring the genetic basis of many complex human diseases. The prediction of SNPs is promising in modern genetic analysis but it is still a great challenge to identify the functional SNPs in a disease-related gene. The computational approach has overcome this challenge and an increase in the successful rate of genetic association studies and reduced cost of genotyping have been achieved. The objective of this study is to identify deleterious non-synonymous SNPs (nsSNPs) associated with the COL1A1 gene. Material and methods The SNPs were retrieved from the Single Nucleotide Polymorphism Database (dbSNP). Using I-Mutant, protein stability change was calculated. The potentially functional nsSNPs and their effect on proteins were predicted by PolyPhen and SIFT respectively. FASTSNP was used for estimation of risk score. Results Our analysis revealed 247 SNPs as non-synonymous, out of which 5 nsSNPs were found to be least stable by I-Mutant 2.0 with a DDG value of > –1.0. Four nsSNPs, namely rs17853657, rs17857117, rs57377812 and rs1059454, showed a highly deleterious tolerance index score of 0.00 with a change in their physicochemical properties by the SIFT server. Seven nsSNPs, namely rs1059454, rs8179178, rs17853657, rs17857117, rs72656340, rs72656344 and rs72656351, were found to be probably damaging with a PSIC score difference between 2.0 and 3.5 by the PolyPhen server. Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, were found to be highly polymorphic with a risk score of 3-4 with a possible effect of non-conservative change and splicing regulation by FASTSNP. Conclusions Three nsSNPs, namely rs1059454, rs17853657 and rs17857117, are potential functional polymorphisms that are likely to have a functional impact on the COL1A1 gene. PMID:24273577

  2. Human leukocyte antigen and cytokine receptor gene polymorphisms associated with heterogeneous immune responses to mumps viral vaccine.

    PubMed

    Ovsyannikova, Inna G; Jacobson, Robert M; Dhiman, Neelam; Vierkant, Robert A; Pankratz, V Shane; Poland, Gregory A

    2008-05-01

    Mumps outbreaks continue to occur throughout the world, including in highly vaccinated populations. Vaccination against mumps has been successful; however, humoral and cellular immune responses to mumps vaccines vary significantly from person to person. We set out to assess whether HLA and cytokine gene polymorphisms are associated with variations in the immune response to mumps viral vaccine. To identify genetic factors that might contribute to variations in mumps vaccine-induced immune responses, we performed HLA genotyping in a group of 346 healthy schoolchildren (12-18 years of age) who previously received 2 doses of live mumps vaccine. Single-nucleotide polymorphisms (minor allele frequency of >5%) in cytokine and cytokine receptor genes were genotyped for a subset of 118 children. Median values for mumps-specific antibody titers and lymphoproliferative stimulation indices were 729 IU/mL and 4.8, respectively. Girls demonstrated significantly higher mumps antibody titers than boys, indicating gender-linked genetic differences in humoral immune response. Significant associations were found between the HLA-DQB1*0303 alleles and lower mumps-specific antibody titers. An interesting finding was the association of several HLA class II alleles with mumps-specific lymphoproliferation. Alleles of the DRB1 (*0101, *0301, *0801, *1001, *1201, and *1302), DQA1 (*0101, *0105, *0401, and *0501), and DQB1 (*0201, *0402, and *0501) loci were associated with significant variations in lymphoproliferative immune responses to mumps vaccine. Additional associations were observed with single-nucleotide polymorphisms in the interleukin-10RA, interleukin-12RB1, and interleukin-12RB2 cytokine receptor genes. Minor alleles for 4 single-nucleotide polymorphisms within interleukin-10RA and interleukin-12RB genes were associated with variations in humoral and cellular immune responses to mumps vaccination. These data suggest the important role of HLA and immunoregulatory cytokine receptor gene polymorphisms in explaining variations in mumps vaccine-induced immune responses.

  3. Human Leukocyte Antigen and Cytokine Receptor Gene Polymorphisms Associated With Heterogeneous Immune Responses to Mumps Viral Vaccine

    PubMed Central

    Ovsyannikova, Inna G.; Jacobson, Robert M.; Dhiman, Neelam; Vierkant, Robert A.; Pankratz, V. Shane; Poland, Gregory A.

    2009-01-01

    OBJECTIVES Mumps outbreaks continue to occur throughout the world, including in highly vaccinated populations. Vaccination against mumps has been successful; however, humoral and cellular immune responses to mumps vaccines vary significantly from person to person. We set out to assess whether HLA and cytokine gene polymorphisms are associated with variations in the immune response to mumps viral vaccine. METHODS To identify genetic factors that might contribute to variations in mumps vaccine–induced immune responses, we performed HLA genotyping in a group of 346 healthy schoolchildren (12–18 years of age) who previously received 2 doses of live mumps vaccine. Single-nucleotide polymorphisms (minor allele frequency of >5%) in cytokine and cytokine receptor genes were genotyped for a subset of 118 children. RESULTS Median values for mumps-specific antibody titers and lymphoproliferative stimulation indices were 729 IU/mL and 4.8, respectively. Girls demonstrated significantly higher mumps antibody titers than boys, indicating gender-linked genetic differences in humoral immune response. Significant associations were found between the HLA-DQB1*0303 alleles and lower mumps-specific antibody titers. An interesting finding was the association of several HLA class II alleles with mumps-specific lymphoproliferation. Alleles of the DRB1 (*0101, *0301, *0801, *1001, *1201, and *1302), DQA1 (*0101, *0105, *0401, and *0501), and DQB1 (*0201, *0402, and *0501) loci were associated with significant variations in lymphoproliferative immune responses to mumps vaccine. Additional associations were observed with single-nucleotide polymorphisms in the interleukin-10RA, interleukin-12RB1, and interleukin-12RB2 cytokine receptor genes. Minor alleles for 4 single-nucleotide polymorphisms within interleukin-10RA and interleukin-12RB genes were associated with variations in humoral and cellular immune responses to mumps vaccination. CONCLUSIONS These data suggest the important role of HLA and immunoregulatory cytokine receptor gene polymorphisms in explaining variations in mumps vaccine–induced immune responses. PMID:18450852

  4. A Single Nucleotide Polymorphism in 3′-Untranslated Region Contributes to the Regulation of Toll-like Receptor 4 Translation*

    PubMed Central

    Sato, Kayo; Yoshimura, Atsutoshi; Kaneko, Takashi; Ukai, Takashi; Ozaki, Yukio; Nakamura, Hirotaka; Li, Xinyue; Matsumura, Hiroyoshi; Hara, Yoshitaka; Ogata, Yorimasa

    2012-01-01

    We have previously shown that a single nucleotide polymorphism rs11536889 in the 3′-untranslated region (UTR) of TLR4 was associated with periodontitis. In this study the effects of this single nucleotide polymorphism on Toll-like receptor (TLR) 4 expression were investigated. Monocytes from subjects with the C/C genotype expressed higher levels of TLR4 on their surfaces than those from subjects with the other genotypes. Peripheral blood mononuclear cells (PBMCs) from the C/C and G/C subjects secreted higher levels of IL-8 in response to lipopolysaccharide (LPS), a TLR4 ligand, than the cells from the G/G subjects. However, there was no significant difference in TLR4 mRNA levels in PBMCs from the subjects with each genotype. After stimulation with tripalmitoylated CSK4 (Pam3CSK4), TLR4 mRNA levels increased in PBMCs from both the C/C and G/G subjects, whereas TLR4 protein levels increased in PBMCs from the C/C but not G/G subjects. Transient transfection of a series of chimeric luciferase constructs revealed that a fragment of 3′-UTR containing rs11536889 G allele, but not C allele, suppressed luciferase activity induced by LPS or IL-6. Two microRNAs, hsa-miR-1236 and hsa-miR-642a, were predicted to bind to rs11536889 G allele. Inhibition of these microRNAs reversed the suppressed luciferase activity. These microRNA inhibitors also up-regulated endogenous TLR4 protein on THP-1 cells (the G/G genotype) after LPS stimulation. Furthermore, mutant microRNAs that bind to the C allele inhibited the luciferase activity of the construct containing the C allele. These results indicate that genetic variation of rs11536889 contributes to translational regulation of TLR4, possibly by binding to microRNAs. PMID:22661708

  5. Do genetic modifiers of high-density lipoprotein cholesterol and triglyceride levels also modify their response to a lifestyle intervention in the setting of obesity and type-2 diabetes mellitus?: The Action for Health in Diabetes (Look AHEAD) study.

    PubMed

    Huggins, Gordon S; Papandonatos, George D; Erar, Bahar; Belalcazar, L Maria; Brautbar, Ariel; Ballantyne, Christie; Kitabchi, Abbas E; Wagenknecht, Lynne E; Knowler, William C; Pownall, Henry J; Wing, Rena R; Peter, Inga; McCaffery, Jeanne M

    2013-08-01

    High-density lipoprotein cholesterol (HDL-C) and triglycerides are cardiovascular risk factors susceptible to lifestyle behavior modification and genetics. We hypothesized that genetic variants identified by genome-wide association studies as associated with HDL-C or triglyceride levels modify 1-year treatment response to an intensive lifestyle intervention, relative to a usual care of diabetes mellitus support and education. We evaluated 82 single-nucleotide polymorphisms, which represent 31 loci demonstrated by genome-wide association studies to be associated with HDL-C and triglycerides, in 3561 participants who consented for genetic studies and met eligibility criteria. Variants associated with higher baseline HDL-C levels, cholesterol ester transfer protein (CETP) rs3764261 and hepatic lipase (LIPC) rs8034802, were found to be associated with HDL-C increases with intensive lifestyle intervention (P=0.0038 and 0.013, respectively) and had nominally significant treatment interactions (P=0.047 and 0.046, respectively). The fatty acid desaturase-2 rs1535 variant, associated with low baseline HDL-C (P=0.017), was associated with HDL-C increases with intensive lifestyle intervention (0.0037) and had a nominal treatment interaction (P=0.035). Apolipoprotein B (rs693) and LIPC (rs8034802) single-nucleotide polymorphisms showed nominally significant associations with HDL-C and triglyceride changes with intensive lifestyle intervention and a treatment interaction (P<0.05). Phosphatidylglycerophosphate synthase-1 single-nucleotide polymorphisms (rs4082919) showed the most significant triglyceride treatment interaction in the full cohort (P=0.0009). This is the first study to identify genetic variants modifying lipid responses to a randomized lifestyle behavior intervention in overweight or obese individuals with diabetes mellitus. The effects of genetic factors on lipid changes may differ from the effects on baseline lipids and are modifiable by behavioral intervention.

  6. A polymorphism in the bovine gamma-S-crystallin gene revealed by allele-specific amplification.

    PubMed

    Kemp, S J; Maillard, J C; Teale, A J

    1993-04-01

    A polymorphism was detected in the 3' untranslated region of the bovine gamma-S-crystallin gene by direct sequencing of polymerase chain reaction (PCR) products from genomic DNA of an N'Dama bull and a Boran cow. A set of three PCR primers was designed to detect this difference and thus give allele-specific amplification. The two allele-specific primers differ in length by 20 nucleotides so that the allelic products may be distinguished by simple agarose gel electrophoresis following a single PCR reaction. This provides a simple and rapid assay for this polymorphism.

  7. Functional asymmetry in the lysyl-tRNA synthetase explored by molecular dynamics, free energy calculations and experiment

    PubMed Central

    Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R

    2003-01-01

    Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471

  8. Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

    PubMed

    Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

    2009-10-28

    GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.

  9. Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum

    PubMed Central

    Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe

    2017-01-01

    Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1–3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the Ganoderma industry. PMID:28056060

  10. Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum.

    PubMed

    Zhang, Xiuqing; Xu, Zhangyang; Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe

    2017-01-01

    Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1-3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the Ganoderma industry.

  11. The two single nucleotide polymorphisms in the H37/RBM5 tumour suppressor gene at 3p21.3 correlated with different subtypes of non-small cell lung cancers

    PubMed Central

    Oh, Juliana J.; Koegel, Ashley; Phan, Diana T.; Razfar, Ali; Slamon, Dennis J.

    2007-01-01

    Summary Allele loss and genetic alteration in chromosome 3p, particularly in 3p21.3 region, are the most frequent and the earliest genomic abnormalities found in lung cancer. Multiple 3p21.3 genes exhibit various degrees of tumour suppression activity suggesting that 3p21.3 genes may function as an integrated tumour suppressor region through their diverse biological activities. We have previously demonstrated growth inhibitory effects and tumour suppression mechanism of the H37/RBM5 gene which is one of the 19 genes residing in the 370kb minimal overlap region at 3p21.3. In the current study, in an attempt to find, if any, mutations in the H37 coding region in lung cancer cells, we compared nucleotide sequences of the entire H37 gene in tumour vs. adjacent normal tissues from 17 non-small cell lung cancer (NSCLC) patients. No mutations were detected, instead, we found the two silent single nucleotide polymorphisms (SNPs), C1138T and C2185T, within the coding region of the H37 gene. In addition, we found that specific allele types at these SNP positions are correlated with different histological subtypes of NSCLC; tumours containing heterozygous alleles (C+T) at these SNP positions are more likely to be associated with adenocarcinoma (AC) whereas homozygous alleles (either C or T) are associated with squamous cell carcinoma (SCC) (p=0.0098). We postulate that, these two silent polymorphisms may be in linkage disequilibrium (LD) with a disease causative allele in the 3p21.3 tumour suppressor region which is packed with a large number of important genes affecting lung cancer development. In addition, because of prevalent loss of heterozygosity (LOH) detected at 3p21.3 which precedes lung cancer initiation, these SNPs may be developed into a marker screening for the high risk individuals. PMID:17606309

  12. Biochemical and Genetic Markers in Aggressiveness and Recurrence of Prostate Cancer: Race-Specific Links to Inflammation and Insulin Resistance

    DTIC Science & Technology

    2013-07-01

    as a statistical graphic, and Pearson product moment correlation coefficients as measures of the strength of linear association; 4) performing SNP ...determine if there are differences in single nucleotide polymorphisms ( SNPs ) in selected candidate genes implicated in metabolic syndrome, obesity, chronic...samples for the serum and SNP analyses. We have reached a target of 500 patients at the end of year 2; however, some of the patients turned out to be

  13. N-acetyltransferase single nucleotide polymorphisms: Emerging concepts serve as a paradigm for understanding complexities of personalized medicine

    PubMed Central

    Hein, David W.

    2009-01-01

    Arylamine N-acetyltransferase 1 (NAT1) and 2 (NAT2) exhibit single nucleotide polymorphisms (SNPs) in human populations that modify drug and carcinogen metabolism. This paper updates the identity, location, and functional effects of these SNPs and then follows with emerging concepts for understanding why pharmacogenetic findings may not be replicated consistently. Using this paradigm as an example, laboratory-based mechanistic analyses can reveal complexities such that genetic polymorphisms become biologically and medically relevant when confounding factors are more fully understood and considered. As medical care moves to a more personalized approach, the implications of these confounding factors will be important in understanding the complexities of personalized medicine. PMID:19379125

  14. Single nucleotide polymorphisms in multiple sclerosis: disease susceptibility and treatment response biomarkers.

    PubMed

    Pravica, Vera; Popadic, Dusan; Savic, Emina; Markovic, Milos; Drulovic, Jelena; Mostarica-Stojkovic, Marija

    2012-04-01

    Multiple sclerosis (MS) is a chronic inflammatory demyelinating and neurodegenerative disease of the central nervous system characterized by unpredictable and variable clinical course. Etiology of MS involves both genetic and environmental factors. New technologies identified genetic polymorphisms associated with MS susceptibility among which immunologically relevant genes are significantly overrepresented. Although individual genes contribute only a small part to MS susceptibility, they might be used as biomarkers, thus helping to identify accurate diagnosis, predict clinical disease course and response to therapy. This review focuses on recent progress in research on MS genetics with special emphasis on the possibility to use single nucleotide polymorphism of candidate genes as biomarkers of susceptibility to disease and response to therapy.

  15. Fixed-Gap Tunnel Junction for Reading DNA Nucleotides

    PubMed Central

    2015-01-01

    Previous measurements of the electronic conductance of DNA nucleotides or amino acids have used tunnel junctions in which the gap is mechanically adjusted, such as scanning tunneling microscopes or mechanically controllable break junctions. Fixed-junction devices have, at best, detected the passage of whole DNA molecules without yielding chemical information. Here, we report on a layered tunnel junction in which the tunnel gap is defined by a dielectric layer, deposited by atomic layer deposition. Reactive ion etching is used to drill a hole through the layers so that the tunnel junction can be exposed to molecules in solution. When the metal electrodes are functionalized with recognition molecules that capture DNA nucleotides via hydrogen bonds, the identities of the individual nucleotides are revealed by characteristic features of the fluctuating tunnel current associated with single-molecule binding events. PMID:25380505

  16. Statistical method to compare massive parallel sequencing pipelines.

    PubMed

    Elsensohn, M H; Leblay, N; Dimassi, S; Campan-Fournier, A; Labalme, A; Roucher-Boulez, F; Sanlaville, D; Lesca, G; Bardel, C; Roy, P

    2017-03-01

    Today, sequencing is frequently carried out by Massive Parallel Sequencing (MPS) that cuts drastically sequencing time and expenses. Nevertheless, Sanger sequencing remains the main validation method to confirm the presence of variants. The analysis of MPS data involves the development of several bioinformatic tools, academic or commercial. We present here a statistical method to compare MPS pipelines and test it in a comparison between an academic (BWA-GATK) and a commercial pipeline (TMAP-NextGENe®), with and without reference to a gold standard (here, Sanger sequencing), on a panel of 41 genes in 43 epileptic patients. This method used the number of variants to fit log-linear models for pairwise agreements between pipelines. To assess the heterogeneity of the margins and the odds ratios of agreement, four log-linear models were used: a full model, a homogeneous-margin model, a model with single odds ratio for all patients, and a model with single intercept. Then a log-linear mixed model was fitted considering the biological variability as a random effect. Among the 390,339 base-pairs sequenced, TMAP-NextGENe® and BWA-GATK found, on average, 2253.49 and 1857.14 variants (single nucleotide variants and indels), respectively. Against the gold standard, the pipelines had similar sensitivities (63.47% vs. 63.42%) and close but significantly different specificities (99.57% vs. 99.65%; p < 0.001). Same-trend results were obtained when only single nucleotide variants were considered (99.98% specificity and 76.81% sensitivity for both pipelines). The method allows thus pipeline comparison and selection. It is generalizable to all types of MPS data and all pipelines.

  17. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

    PubMed Central

    Kondo, Jiro; Westhof, Eric

    2011-01-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  18. Noncoding somatic and inherited single-nucleotide variants converge to promote ESR1 expression in breast cancer.

    PubMed

    Bailey, Swneke D; Desai, Kinjal; Kron, Ken J; Mazrooei, Parisa; Sinnott-Armstrong, Nicholas A; Treloar, Aislinn E; Dowar, Mark; Thu, Kelsie L; Cescon, David W; Silvester, Jennifer; Yang, S Y Cindy; Wu, Xue; Pezo, Rossanna C; Haibe-Kains, Benjamin; Mak, Tak W; Bedard, Philippe L; Pugh, Trevor J; Sallari, Richard C; Lupien, Mathieu

    2016-10-01

    Sustained expression of the estrogen receptor-α (ESR1) drives two-thirds of breast cancer and defines the ESR1-positive subtype. ESR1 engages enhancers upon estrogen stimulation to establish an oncogenic expression program. Somatic copy number alterations involving the ESR1 gene occur in approximately 1% of ESR1-positive breast cancers, suggesting that other mechanisms underlie the persistent expression of ESR1. We report significant enrichment of somatic mutations within the set of regulatory elements (SRE) regulating ESR1 in 7% of ESR1-positive breast cancers. These mutations regulate ESR1 expression by modulating transcription factor binding to the DNA. The SRE includes a recurrently mutated enhancer whose activity is also affected by rs9383590, a functional inherited single-nucleotide variant (SNV) that accounts for several breast cancer risk-associated loci. Our work highlights the importance of considering the combinatorial activity of regulatory elements as a single unit to delineate the impact of noncoding genetic alterations on single genes in cancer.

  19. The origin of multiple clones in the parthenogenetic lizard species Darevskia rostombekowi.

    PubMed

    Ryskov, Alexey P; Osipov, Fedor A; Omelchenko, Andrey V; Semyenova, Seraphima K; Girnyk, Anastasiya E; Korchagin, Vitaly I; Vergun, Andrey A; Murphy, Robert W

    2017-01-01

    The all-female Caucasian rock lizard Darevskia rostombekowi and other unisexual species of this genus reproduce normally via true parthenogenesis. Typically, diploid parthenogenetic reptiles exhibit some amount of clonal diversity. However, allozyme data from D. rostombekowi have suggested that this species consists of a single clone. Herein, we test this hypothesis by evaluating variation at three variable microsatellite loci for 42 specimens of D. rostombekowi from four populations in Armenia. Analyses based on single nucleotide polymorphisms of each locus reveal five genotypes or presumptive clones in this species. All individuals are heterozygous at the loci. The major clone occurs in 24 individuals and involves three populations. Four rare clones involve one or several individuals from one or two populations. Most variation owes to parent-specific single nucleotide polymorphisms, which occur as heterozygotes. This result fails to reject the hypothesis of a single hybridization founder event that resulted in the initial formation of one major clone. The other clones appear to have originated via post-formation microsatellite mutations of the major clone.

  20. Rapid single nucleotide polymorphism detection for personalized medicine applications using planar waveguide fluorescence sensors

    NASA Astrophysics Data System (ADS)

    Herron, James N.; Tolley, Samuel E.; Smith, Richard; Christensen, Douglas A.

    2006-02-01

    Personalized medicine is an emerging field in which clinical diagnostics information about a patient's genotype or phenotype is used to optimize his/her pharmacotherapy. This article evaluates whether planar waveguide fluorescent sensors are suitable for determining such information from patient testing in point-of-care (POC) settings. The model system was Long QT Syndrome, a congenital disease associated with single nucleotide polymorphisms (SNPs) in genes encoding for cardiac ion channels. Three different SNP assay formats were examined: DNA/DNA hybridization, DNA/PNA hybridization (PNA: "peptide nucleic acid"), and single base extension (SBEX). Although DNA/DNA hybridization produced a strong intensity-time response for both wildtype and SNP analytes in a 5-min assay at 32°C, their hybridization rates differed by only 32.7%, which was insufficient for clinical decision-making. Much better differentiation of the two rates was observed at 53°C, where the wildtype's hybridization rate was two-thirds of its maximum value, while that of the SNP was essentially zero. Such all-or-nothing resolution would be adequate for clinical decision-making; however, the elevated temperature and precise temperature control would be hard to achieve in a POC setting. Results from DNA/PNA hybridization studies were more promising. Nearly 20-fold discrimination between wildtype and SNP hybridization rates was observed in a 5-min assay at 30°C, although the low ionic strength conditions required necessitated a de-salting step between sample preparation and SNP detection. SBEX was the most promising of the three, determining the absolute identity of the suspected polymorphism in a 5-min assay at 40°C.

  1. Genetic differences in ChTLR15 gene polymorphism and expression involved in Salmonella enterica natural and artificial infection respectively, of Chinese native chicken breeds, with a focus on sexual dimorphism.

    PubMed

    Hu, Y; Chen, W W; Liu, H X; Shan, Y J; Zhu, C H; Li, H F; Zou, J M

    2016-01-01

    Chicken Toll-like receptor 15 (ChTLR15) has been shown to participate in immune activation in response to various pathogens and in the innate defence against infection. Two genetically distinct Chinese breeds of chicken (Qinyuan Partridge and Baier breeds) were used to study the correlation between ChTLR15 single nucleotide polymorphisms and the natural infection status of salmonella in hens, and also to examine genetic and sex-specific effects on ChTLR15 mRNA expression in heterophils and spleen during acute infection with Salmonella enterica serovar Enteritidis (SE) from 1 to 10 days after experimental infection. Three single-nucleotide polymorphisms (G168A, C726T and A1166G) in a single exon of ChTLR15 were identified in the two breeds, but only C726T showed a significant association with salmonella infection. Compared with layer-type Baier chicks, meat-type Qingyuan chicks showed a higher tolerance for capture stress and (SE) infection, as measured, respectively, by the modified body weight of chicks in the control group and in the infection group. Meanwhile, ChTLR15 down-regulation in heterophils and up-regulation in spleen were involved in the response to pathogenic SE colonization during the acute infection period. These significant genetic effects in females led to greater differences in both innate and adaptive immune responses than those exhibited in males. These results suggest that genetics, time and gender play important roles in the modulation of ChTLR15 mRNA level elicited by the SE-mediated immune response differentially in the two genetically distinct breeds, with a focus on sexual dimorphism.

  2. Bison PRNP genotyping and potential association with Brucella spp. seroprevalence

    USGS Publications Warehouse

    Seabury, C.M.; Halbert, N.D.; Gogan, P.J.P.; Templeton, J.W.; Derr, J.N.

    2005-01-01

    The implication that host cellular prion protein (PrPC) may function as a cell surface receptor and/or portal protein for Brucella abortus in mice prompted an evaluation of nucleotide and amino acid variation within exon 3 of the prion protein gene (PRNP) for six US bison populations. A non-synonymous single nucleotide polymorphism (T50C), resulting in the predicted amino acid replacement M17T (Met ??? Thr), was identified in each population. To date, no variation (T50: Met) has been detected at the corresponding exon 3 nucleotide and/or amino acid position for domestic cattle. Notably, 80% (20 of 25) of the Yellowstone National Park bison possessing the C/C genotype were Brucella spp. seropositive, representing a significant (P = 0.021) association between seropositivity and the C/C genotypic class. Moreover, significant differences in the distribution of PRNP exon 3 alleles and genotypes were detected between Yellowstone National Park bison and three bison populations that were either founded from seronegative stock or previously subjected to test-and-slaughter management to eradicate brucellosis. Unlike domestic cattle, no indel polymorphisms were detected within the corresponding regions of the putative bison PRNP promoter, intron 1, octapeptide repeat region or 3???-untranslated region for any population examined. This study provides the first evidence of a potential association between nucleotide variation within PRNP exon 3 and the presence of Brucella spp. antibodies in bison, implicating PrPC in the natural resistance of bison to brucellosis infection. ?? 2005 International Society for Animal Genetics.

  3. Oligotyping analysis of the human oral microbiome

    PubMed Central

    Eren, A. Murat; Borisy, Gary G.; Huse, Susan M.; Mark Welch, Jessica L.

    2014-01-01

    The Human Microbiome Project provided a census of bacterial populations in healthy individuals, but an understanding of the biomedical significance of this census has been hindered by limited taxonomic resolution. A high-resolution method termed oligotyping overcomes this limitation by evaluating individual nucleotide positions using Shannon entropy to identify the most information-rich nucleotide positions, which then define oligotypes. We have applied this method to comprehensively analyze the oral microbiome. Using Human Microbiome Project 16S rRNA gene sequence data for the nine sites in the oral cavity, we identified 493 oligotypes from the V1-V3 data and 360 oligotypes from the V3-V5 data. We associated these oligotypes with species-level taxon names by comparison with the Human Oral Microbiome Database. We discovered closely related oligotypes, differing sometimes by as little as a single nucleotide, that showed dramatically different distributions among oral sites and among individuals. We also detected potentially pathogenic taxa in high abundance in individual samples. Numerous oligotypes were preferentially located in plaque, others in keratinized gingiva or buccal mucosa, and some oligotypes were characteristic of habitat groupings such as throat, tonsils, tongue dorsum, hard palate, and saliva. The differing habitat distributions of closely related oligotypes suggest a level of ecological and functional biodiversity not previously recognized. We conclude that the Shannon entropy approach of oligotyping has the capacity to analyze entire microbiomes, discriminate between closely related but distinct taxa and, in combination with habitat analysis, provide deep insight into the microbial communities in health and disease. PMID:24965363

  4. Combined hairpin-antisense compositions and methods for modulating expression

    DOEpatents

    Shanklin, John; Nguyen, Tam

    2014-08-05

    A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.

  5. Combined hairpin-antisense compositions and methods for modulating expression

    DOEpatents

    Shanklin, John; Nguyen, Tam Huu

    2015-11-24

    A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.

  6. Genotype-Phenotype Study of the Middle Gangetic Plain in India Shows Association of rs2470102 with Skin Pigmentation.

    PubMed

    Mishra, Anshuman; Nizammuddin, Sheikh; Mallick, Chandana Basu; Singh, Sakshi; Prakash, Satya; Siddiqui, Niyamat Ali; Rai, Niraj; Carlus, S Justin; Sudhakar, Digumarthi V S; Tripathi, Vishnu P; Möls, Märt; Kim-Howard, Xana; Dewangan, Hemlata; Mishra, Abhishek; Reddy, Alla G; Roy, Biswajit; Pandey, Krishna; Chaubey, Gyaneshwer; Das, Pradeep; Nath, Swapan K; Singh, Lalji; Thangaraj, Kumarasamy

    2017-03-01

    Our understanding of the genetics of skin pigmentation has been largely skewed towards populations of European ancestry, imparting less attention to South Asian populations, who behold huge pigmentation diversity. Here, we investigate skin pigmentation variation in a cohort of 1,167 individuals in the Middle Gangetic Plain of the Indian subcontinent. Our data confirm the association of rs1426654 with skin pigmentation among South Asians, consistent with previous studies, and also show association for rs2470102 single nucleotide polymorphism. Our haplotype analyses further help us delineate the haplotype distribution across social categories and skin color. Taken together, our findings suggest that the social structure defined by the caste system in India has a profound influence on the skin pigmentation patterns of the subcontinent. In particular, social category and associated single nucleotide polymorphisms explain about 32% and 6.4%, respectively, of the total phenotypic variance. Phylogeography of the associated single nucleotide polymorphisms studied across 52 diverse populations of the Indian subcontinent shows wide presence of the derived alleles, although their frequencies vary across populations. Our results show that both polymorphisms (rs1426654 and rs2470102) play an important role in the skin pigmentation diversity of South Asians. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  7. Screening of reproduction-related single-nucleotide variations from MeDIP-seq data in sheep.

    PubMed

    Cao, Jiaxue; Wei, Caihong; Zhang, Shuzhen; Capellini, Terence D; Zhang, Li; Zhao, Fuping; Li, Li; Zhong, Tao; Wang, Linjie; Du, Lixin; Zhang, Hongping

    2016-11-01

    Extensive variation in reproduction has arisen in Chinese Mongolian sheep during recent domestication. Hu and Small-tailed Han sheep, for example, have become non-seasonal breeders and exhibit higher fecundity than Tan and Ujumqin breeds. We therefore scanned reproduction-related single-nucleotide variations from methylated DNA-immunoprecipitation sequencing data generated from each of those four breeds to uncover potential mechanisms underlying this breed variation. We generated a high-quality map of single nucleotide variations (SNVs) in DNA methylation enriched regions, and found that the majority of variants are located within non-coding regions. We identified 359 SNVs within the Sheep Quantitative Trait Locus (QTL) database. Nineteen of these SNVs associated with the Aseasonal Reproduction QTL, and 10 out of the 19 reside close to genes with known reproduction functions. We also identified the well-known FecB mutation in high-fecundity sheep (Hu and Small-tailed Han sheep). When we applied these FecB finding to our breeding system, we improved lambing rate by 175%. In summary, this study provided strong candidate SNVs associated with sheep fecundity that can serve as targets for functional testing and to enhance selective breeding strategies. Mol. Reprod. Dev. 83: 958-967, 2016 © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  8. Allele-specific locus binding and genome editing by CRISPR at the p16INK4a locus.

    PubMed

    Fujita, Toshitsugu; Yuno, Miyuki; Fujii, Hodaka

    2016-07-28

    The clustered regularly interspaced short palindromic repeats (CRISPR) system has been adopted for a wide range of biological applications including genome editing. In some cases, dissection of genome functions requires allele-specific genome editing, but the use of CRISPR for this purpose has not been studied in detail. In this study, using the p16INK4a gene in HCT116 as a model locus, we investigated whether chromatin states, such as CpG methylation, or a single-nucleotide gap form in a target site can be exploited for allele-specific locus binding and genome editing by CRISPR in vivo. First, we showed that allele-specific locus binding and genome editing could be achieved by targeting allele-specific CpG-methylated regions, which was successful for one, but not all guide RNAs. In this regard, molecular basis underlying the success remains elusive at this stage. Next, we demonstrated that an allele-specific single-nucleotide gap form could be employed for allele-specific locus binding and genome editing by CRISPR, although it was important to avoid CRISPR tolerance of a single nucleotide mismatch brought about by mismatched base skipping. Our results provide information that might be useful for applications of CRISPR in studies of allele-specific functions in the genomes.

  9. DNA detection and single nucleotide mutation identification using SERS for molecular diagnostics and global health

    NASA Astrophysics Data System (ADS)

    Ngo, Hoan T.; Gandra, Naveen; Fales, Andrew M.; Taylor, Steve M.; Vo-Dinh, Tuan

    2017-02-01

    Nucleic acid-based molecular diagnostics at the point-of-care (POC) and in resource-limited settings is still a challenge. We present a sensitive yet simple DNA detection method with single nucleotide polymorphism (SNP) identification capability. The detection scheme involves sandwich hybridization of magnetic beads conjugated with capture probes, target sequences, and ultrabright surface-enhanced Raman Scattering (SERS) nanorattles conjugated with reporter probes. Upon hybridization, the sandwich probes are concentrated at the detection focus controlled by a magnetic system for SERS measurements. The ultrabright SERS nanorattles, consisting of a core and a shell with resonance Raman reporters loaded in the gap space between the core and the shell, serve as SERS tags for ultrasensitive signal detection. Specific DNA sequences of the malaria parasite Plasmodium falciparum and dengue virus 1 (DENV1) were used as the model marker system. Detection limit of approximately 100 attomoles was achieved. Single nucleotide polymorphism (SNP) discrimination of wild type malaria DNA and mutant malaria DNA, which confers resistance to artemisinin drugs, was also demonstrated. The results demonstrate the molecular diagnostic potential of the nanorattle-based method to both detect and genotype infectious pathogens. The method's simplicity makes it a suitable candidate for molecular diagnosis at the POC and in resource-limited settings.

  10. Scanning the Effects of Ethyl Methanesulfonate on the Whole Genome of Lotus japonicus Using Second-Generation Sequencing Analysis

    PubMed Central

    Mohd-Yusoff, Nur Fatihah; Ruperao, Pradeep; Tomoyoshi, Nurain Emylia; Edwards, David; Gresshoff, Peter M.; Biswas, Bandana; Batley, Jacqueline

    2015-01-01

    Genetic structure can be altered by chemical mutagenesis, which is a common method applied in molecular biology and genetics. Second-generation sequencing provides a platform to reveal base alterations occurring in the whole genome due to mutagenesis. A model legume, Lotus japonicus ecotype Miyakojima, was chemically mutated with alkylating ethyl methanesulfonate (EMS) for the scanning of DNA lesions throughout the genome. Using second-generation sequencing, two individually mutated third-generation progeny (M3, named AM and AS) were sequenced and analyzed to identify single nucleotide polymorphisms and reveal the effects of EMS on nucleotide sequences in these mutant genomes. Single-nucleotide polymorphisms were found in every 208 kb (AS) and 202 kb (AM) with a bias mutation of G/C-to-A/T changes at low percentage. Most mutations were intergenic. The mutation spectrum of the genomes was comparable in their individual chromosomes; however, each mutated genome has unique alterations, which are useful to identify causal mutations for their phenotypic changes. The data obtained demonstrate that whole genomic sequencing is applicable as a high-throughput tool to investigate genomic changes due to mutagenesis. The identification of these single-point mutations will facilitate the identification of phenotypically causative mutations in EMS-mutated germplasm. PMID:25660167

  11. Sequence Variation of the tRNALeu Intron as a Marker for Genetic Diversity and Specificity of Symbiotic Cyanobacteria in Some Lichens

    PubMed Central

    Paulsrud, Per; Lindblad, Peter

    1998-01-01

    We examined the genetic diversity of Nostoc symbionts in some lichens by using the tRNALeu (UAA) intron as a genetic marker. The nucleotide sequence was analyzed in the context of the secondary structure of the transcribed intron. Cyanobacterial tRNALeu (UAA) introns were specifically amplified from freshly collected lichen samples without previous DNA extraction. The lichen species used in the present study were Nephroma arcticum, Peltigera aphthosa, P. membranacea, and P. canina. Introns with different sizes around 300 bp were consistently obtained. Multiple clones from single PCRs were screened by using their single-stranded conformational polymorphism pattern, and the nucleotide sequence was determined. No evidence for sample heterogenity was found. This implies that the symbiont in situ is not a diverse community of cyanobionts but, rather, one Nostoc strain. Furthermore, each lichen thallus contained only one intron type, indicating that each thallus is colonized only once or that there is a high degree of specificity. The same cyanobacterial intron sequence was also found in samples of one lichen species from different localities. In a phylogenetic analysis, the cyanobacterial lichen sequences grouped together with the sequences from two free-living Nostoc strains. The size differences in the intron were due to insertions and deletions in highly variable regions. The sequence data were used in discussions concerning specificity and biology of the lichen symbiosis. It is concluded that the tRNALeu (UAA) intron can be of great value when examining cyanobacterial diversity. PMID:9435083

  12. Increased genomic prediction accuracy in wheat breeding through spatial adjustment of field trial data.

    PubMed

    Lado, Bettina; Matus, Ivan; Rodríguez, Alejandra; Inostroza, Luis; Poland, Jesse; Belzile, François; del Pozo, Alejandro; Quincke, Martín; Castro, Marina; von Zitzewitz, Jarislav

    2013-12-09

    In crop breeding, the interest of predicting the performance of candidate cultivars in the field has increased due to recent advances in molecular breeding technologies. However, the complexity of the wheat genome presents some challenges for applying new technologies in molecular marker identification with next-generation sequencing. We applied genotyping-by-sequencing, a recently developed method to identify single-nucleotide polymorphisms, in the genomes of 384 wheat (Triticum aestivum) genotypes that were field tested under three different water regimes in Mediterranean climatic conditions: rain-fed only, mild water stress, and fully irrigated. We identified 102,324 single-nucleotide polymorphisms in these genotypes, and the phenotypic data were used to train and test genomic selection models intended to predict yield, thousand-kernel weight, number of kernels per spike, and heading date. Phenotypic data showed marked spatial variation. Therefore, different models were tested to correct the trends observed in the field. A mixed-model using moving-means as a covariate was found to best fit the data. When we applied the genomic selection models, the accuracy of predicted traits increased with spatial adjustment. Multiple genomic selection models were tested, and a Gaussian kernel model was determined to give the highest accuracy. The best predictions between environments were obtained when data from different years were used to train the model. Our results confirm that genotyping-by-sequencing is an effective tool to obtain genome-wide information for crops with complex genomes, that these data are efficient for predicting traits, and that correction of spatial variation is a crucial ingredient to increase prediction accuracy in genomic selection models.

  13. Transcriptome and Complexity-Reduced, DNA-Based Identification of Intraspecies Single-Nucleotide Polymorphisms in the Polyploid Gossypium hirsutum L.

    PubMed Central

    Zhu, Qian-Hao; Spriggs, Andrew; Taylor, Jennifer M.; Llewellyn, Danny; Wilson, Iain

    2014-01-01

    Varietal single nucleotide polymorphisms (SNPs) are the differences within one of the two subgenomes between different tetraploid cotton varieties and have not been practically used in cotton genetics and breeding because they are difficult to identify due to low genetic diversity and very high sequence identity between homeologous genes in cotton. We have used transcriptome and restriction site−associated DNA sequencing to identify varietal SNPs among 18 G. hirsutum varieties based on the rationale that varietal SNPs can be more confidently called when flanked by subgenome-specific SNPs. Using transcriptome data, we successfully identified 37,413 varietal SNPs and, of these, 22,121 did not have an additional varietal SNP within their 20-bp flanking regions so can be used in most SNP genotyping assays. From restriction site−associated DNA sequencing data, we identified an additional 3090 varietal SNPs between two of the varieties. Of the 1583 successful SNP assays achieved using different genotyping platforms, 1363 were verified. Many of the SNPs behaved as dominant markers because of coamplification from homeologous loci, but the number of SNPs acting as codominant markers increased when one or more subgenome-specific SNP(s) were incorporated in their assay primers, giving them greater utility for breeding applications. A G. hirsutum genetic map with 1244 SNP markers was constructed covering 5557.42 centiMorgan and used to map qualitative and quantitative traits. This collection of G. hirsutum varietal SNPs complements existing intra-specific SNPs and provides the cotton community with a valuable marker resource applicable to genetic analyses and breeding programs. PMID:25106949

  14. Rapid discrimination between Anopheles gambiae s.s. and Anopheles arabiensis by High-Resolution Melt (HRM) analysis.

    PubMed

    Zianni, Michael R; Nikbakhtzadeh, Mahmood R; Jackson, Bryan T; Panescu, Jenny; Foster, Woodbridge A

    2013-04-01

    There is a need for more cost-effective options to more accurately discriminate among members of the Anopheles gambiae complex, particularly An. gambiae and Anopheles arabiensis. These species are morphologically indistinguishable in the adult stage, have overlapping distributions, but are behaviorally and ecologically different, yet both are efficient vectors of malaria in equatorial Africa. The method described here, High-Resolution Melt (HRM) analysis, takes advantage of minute differences in DNA melting characteristics, depending on the number of incongruent single nucleotide polymorphisms in an intragenic spacer region of the X-chromosome-based ribosomal DNA. The two species in question differ by an average of 13 single-nucleotide polymorphisms giving widely divergent melting curves. A real-time PCR system, Bio-Rad CFX96, was used in combination with a dsDNA-specific dye, EvaGreen, to detect and measure the melting properties of the amplicon generated from leg-extracted DNA of selected mosquitoes. Results with seven individuals from pure colonies of known species, as well as 10 field-captured individuals unambiguously identified by DNA sequencing, demonstrated that the method provided a high level of accuracy. The method was used to identify 86 field mosquitoes through the assignment of each to the two common clusters with a high degree of certainty. Each cluster was defined by individuals from pure colonies. HRM analysis is simpler to use than most other methods and provides comparable or more accurate discrimination between the two sibling species but requires a specialized melt-analysis instrument and software.

  15. Rapid Discrimination between Anopheles gambiae s.s. and Anopheles arabiensis by High-Resolution Melt (HRM) Analysis

    PubMed Central

    Zianni, Michael R.; Nikbakhtzadeh, Mahmood R.; Jackson, Bryan T.; Panescu, Jenny; Foster, Woodbridge A.

    2013-01-01

    There is a need for more cost-effective options to more accurately discriminate among members of the Anopheles gambiae complex, particularly An. gambiae and Anopheles arabiensis. These species are morphologically indistinguishable in the adult stage, have overlapping distributions, but are behaviorally and ecologically different, yet both are efficient vectors of malaria in equatorial Africa. The method described here, High-Resolution Melt (HRM) analysis, takes advantage of minute differences in DNA melting characteristics, depending on the number of incongruent single nucleotide polymorphisms in an intragenic spacer region of the X-chromosome-based ribosomal DNA. The two species in question differ by an average of 13 single-nucleotide polymorphisms giving widely divergent melting curves. A real-time PCR system, Bio-Rad CFX96, was used in combination with a dsDNA-specific dye, EvaGreen, to detect and measure the melting properties of the amplicon generated from leg-extracted DNA of selected mosquitoes. Results with seven individuals from pure colonies of known species, as well as 10 field-captured individuals unambiguously identified by DNA sequencing, demonstrated that the method provided a high level of accuracy. The method was used to identify 86 field mosquitoes through the assignment of each to the two common clusters with a high degree of certainty. Each cluster was defined by individuals from pure colonies. HRM analysis is simpler to use than most other methods and provides comparable or more accurate discrimination between the two sibling species but requires a specialized melt-analysis instrument and software. PMID:23543777

  16. Splicing-related single nucleotide polymorphism of RAB, member of RAS oncogene family like 2B (RABL2B) jeopardises semen quality in Chinese Holstein bulls.

    PubMed

    Wang, Xiuge; Cui, Xiaohui; Zhang, Yan; Hao, Haisheng; Ju, Zhihua; Liu, Deyu; Jiang, Qiang; Yang, Chunhong; Sun, Yan; Wang, Changfa; Huang, Jinming; Zhu, Huabin

    2017-11-01

    RAB, member of RAS oncogene family like 2B (RABL2B) is a member of a poorly characterised clade of the RAS GTPase superfamily, which plays an essential role in male fertility, sperm intraflagellar transport and tail assembly. In the present study, we identified a novel RABL2B splice variant in bovine testis and spermatozoa. This splice variant, designated RABL2B-TV, is characterised by exon 2 skipping. Moreover, a single nucleotide polymorphism (SNP), namely c.125G>A, was found within the exonic splicing enhancer (ESE) motif, indicating that the SNP caused the production of the RABL2B-TV aberrant splice variant. This was demonstrated by constructing a pSPL3 exon capturing vector with different genotypes and transfecting these vectors into murine Leydig tumour cell line (MLTC-1) cells. Expression of the RABL2B-TV transcript was lower in semen from high- versus low-performance bulls. Association analysis showed that sperm deformity rate was significantly lower in Chinese Holstein bulls with the GG or GA genotype than in bulls with the AA genotype (P<0.05). In addition, initial sperm motility was significantly higher in individuals with the GG or GA genotype than in individuals with the AA genotype (P<0.05). The findings of the present study suggest that the difference in semen quality in bulls with different RABL2B genotypes is generated via an alternative splicing mechanism caused by a functional SNP within the ESE motif.

  17. Prediction of Adult Dyslipidemia Using Genetic and Childhood Clinical Risk Factors: The Cardiovascular Risk in Young Finns Study.

    PubMed

    Nuotio, Joel; Pitkänen, Niina; Magnussen, Costan G; Buscot, Marie-Jeanne; Venäläinen, Mikko S; Elo, Laura L; Jokinen, Eero; Laitinen, Tomi; Taittonen, Leena; Hutri-Kähönen, Nina; Lyytikäinen, Leo-Pekka; Lehtimäki, Terho; Viikari, Jorma S; Juonala, Markus; Raitakari, Olli T

    2017-06-01

    Dyslipidemia is a major modifiable risk factor for cardiovascular disease. We examined whether the addition of novel single-nucleotide polymorphisms for blood lipid levels enhances the prediction of adult dyslipidemia in comparison to childhood lipid measures. Two thousand four hundred and twenty-two participants of the Cardiovascular Risk in Young Finns Study who had participated in 2 surveys held during childhood (in 1980 when aged 3-18 years and in 1986) and at least once in a follow-up study in adulthood (2001, 2007, and 2011) were included. We examined whether inclusion of a lipid-specific weighted genetic risk score based on 58 single-nucleotide polymorphisms for low-density lipoprotein cholesterol, 71 single-nucleotide polymorphisms for high-density lipoprotein cholesterol, and 40 single-nucleotide polymorphisms for triglycerides improved the prediction of adult dyslipidemia compared with clinical childhood risk factors. Adjusting for age, sex, body mass index, physical activity, and smoking in childhood, childhood lipid levels, and weighted genetic risk scores were associated with an increased risk of adult dyslipidemia for all lipids. Risk assessment based on 2 childhood lipid measures and the lipid-specific weighted genetic risk scores improved the accuracy of predicting adult dyslipidemia compared with the approach using only childhood lipid measures for low-density lipoprotein cholesterol (area under the receiver-operating characteristic curve 0.806 versus 0.811; P =0.01) and triglycerides (area under the receiver-operating characteristic curve 0.740 versus area under the receiver-operating characteristic curve 0.758; P <0.01). The overall net reclassification improvement and integrated discrimination improvement were significant for all outcomes. The inclusion of weighted genetic risk scores to lipid-screening programs in childhood could modestly improve the identification of those at highest risk of dyslipidemia in adulthood. © 2017 American Heart Association, Inc.

  18. Single-Nucleotide Polymorphism-Microarray Ploidy Analysis of Paraffin-Embedded Products of Conception in Recurrent Pregnancy Loss Evaluations.

    PubMed

    Maslow, Bat-Sheva L; Budinetz, Tara; Sueldo, Carolina; Anspach, Erica; Engmann, Lawrence; Benadiva, Claudio; Nulsen, John C

    2015-07-01

    To compare the analysis of chromosome number from paraffin-embedded products of conception using single-nucleotide polymorphism (SNP) microarray with the recommended screening for the evaluation of couples presenting with recurrent pregnancy loss who do not have previous fetal cytogenetic data. We performed a retrospective cohort study including all women who presented for a new evaluation of recurrent pregnancy loss over a 2-year period (January 1, 2012, to December 31, 2013). All participants had at least two documented first-trimester losses and both the recommended screening tests and SNP microarray performed on at least one paraffin-embedded products of conception sample. Single-nucleotide polymorphism microarray identifies all 24 chromosomes (22 autosomes, X, and Y). Forty-two women with a total of 178 losses were included in the study. Paraffin-embedded products of conception from 62 losses were sent for SNP microarray. Single-nucleotide polymorphism microarray successfully diagnosed fetal chromosome number in 71% (44/62) of samples, of which 43% (19/44) were euploid and 57% (25/44) were noneuploid. Seven of 42 (17%) participants had abnormalities on recurrent pregnancy loss screening. The per-person detection rate for a cause of pregnancy loss was significantly higher in the SNP microarray (0.50; 95% confidence interval [CI] 0.36-0.64) compared with recurrent pregnancy loss evaluation (0.17; 95% CI 0.08-0.31) (P=.002). Participants with one or more euploid loss identified on paraffin-embedded products of conception were significantly more likely to have an abnormality on recurrent pregnancy loss screening than those with only noneuploid results (P=.028). The significance remained when controlling for age, number of losses, number of samples, and total pregnancies. These results suggest that SNP microarray testing of paraffin-embedded products of conception is a valuable tool for the evaluation of recurrent pregnancy loss in patients without prior fetal cytogenetic results. Recommended recurrent pregnancy loss screening was unnecessary in almost half the patients in our study. II.

  19. Three Substrains of the Cyanobacterium Anabaena sp. Strain PCC 7120 Display Divergence in Genomic Sequences and hetC Function.

    PubMed

    Wang, Yali; Gao, Yuan; Li, Chao; Gao, Hong; Zhang, Cheng-Cai; Xu, Xudong

    2018-07-01

    Anabaena sp. strain PCC 7120 is a model strain for molecular studies of cell differentiation and patterning in heterocyst-forming cyanobacteria. Subtle differences in heterocyst development have been noticed in different laboratories working on the same organism. In this study, 360 mutations, including single nucleotide polymorphisms (SNPs), small insertion/deletions (indels; 1 to 3 bp), fragment deletions, and transpositions, were identified in the genomes of three substrains. Heterogeneous/heterozygous bases were also identified due to the polyploidy nature of the genome and the multicellular morphology but could be completely segregated when plated after filament fragmentation by sonication. hetC is a gene upregulated in developing cells during heterocyst formation in Anabaena sp. strain PCC 7120 and found in approximately half of other heterocyst-forming cyanobacteria. Inactivation of hetC in 3 substrains of Anabaena sp. PCC 7120 led to different phenotypes: the formation of heterocysts, differentiating cells that keep dividing, or the presence of both heterocysts and dividing differentiating cells. The expression of P hetZ - gfp in these hetC mutants also showed different patterns of green fluorescent protein (GFP) fluorescence. Thus, the function of hetC is influenced by the genomic background and epistasis and constitutes an example of evolution under way. IMPORTANCE Our knowledge about the molecular genetics of heterocyst formation, an important cell differentiation process for global N 2 fixation, is mostly based on studies with Anabaena sp. strain PCC 7120. Here, we show that rapid microevolution is under way in this strain, leading to phenotypic variations for certain genes related to heterocyst development, such as hetC This study provides an example for ongoing microevolution, marked by multiple heterogeneous/heterozygous single nucleotide polymorphisms (SNPs), in a multicellular multicopy-genome microorganism. Copyright © 2018 American Society for Microbiology.

  20. SNPchiMp v.3: integrating and standardizing single nucleotide polymorphism data for livestock species.

    PubMed

    Nicolazzi, Ezequiel L; Caprera, Andrea; Nazzicari, Nelson; Cozzi, Paolo; Strozzi, Francesco; Lawley, Cindy; Pirani, Ali; Soans, Chandrasen; Brew, Fiona; Jorjani, Hossein; Evans, Gary; Simpson, Barry; Tosser-Klopp, Gwenola; Brauning, Rudiger; Williams, John L; Stella, Alessandra

    2015-04-10

    In recent years, the use of genomic information in livestock species for genetic improvement, association studies and many other fields has become routine. In order to accommodate different market requirements in terms of genotyping cost, manufacturers of single nucleotide polymorphism (SNP) arrays, private companies and international consortia have developed a large number of arrays with different content and different SNP density. The number of currently available SNP arrays differs among species: ranging from one for goats to more than ten for cattle, and the number of arrays available is increasing rapidly. However, there is limited or no effort to standardize and integrate array- specific (e.g. SNP IDs, allele coding) and species-specific (i.e. past and current assemblies) SNP information. Here we present SNPchiMp v.3, a solution to these issues for the six major livestock species (cow, pig, horse, sheep, goat and chicken). Original data was collected directly from SNP array producers and specific international genome consortia, and stored in a MySQL database. The database was then linked to an open-access web tool and to public databases. SNPchiMp v.3 ensures fast access to the database (retrieving within/across SNP array data) and the possibility of annotating SNP array data in a user-friendly fashion. This platform allows easy integration and standardization, and it is aimed at both industry and research. It also enables users to easily link the information available from the array producer with data in public databases, without the need of additional bioinformatics tools or pipelines. In recognition of the open-access use of Ensembl resources, SNPchiMp v.3 was officially credited as an Ensembl E!mpowered tool. Availability at http://bioinformatics.tecnoparco.org/SNPchimp.

  1. Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome

    PubMed Central

    Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

    2014-01-01

    Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield. PMID:25333064

  2. Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome.

    PubMed

    Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

    2014-09-01

    Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.

  3. TALEN-mediated single-base-pair editing identification of an intergenic mutation upstream of BUB1B as causative of PCS (MVA) syndrome

    PubMed Central

    Ochiai, Hiroshi; Miyamoto, Tatsuo; Kanai, Akinori; Hosoba, Kosuke; Sakuma, Tetsushi; Kudo, Yoshiki; Asami, Keiko; Ogawa, Atsushi; Watanabe, Akihiro; Kajii, Tadashi; Yamamoto, Takashi; Matsuura, Shinya

    2014-01-01

    Cancer-prone syndrome of premature chromatid separation with mosaic variegated aneuploidy [PCS (MVA) syndrome] is a rare autosomal recessive disorder characterized by constitutional aneuploidy and a high risk of childhood cancer. We previously reported monoallelic mutations in the BUB1B gene (encoding BUBR1) in seven Japanese families with the syndrome. No second mutation was found in the opposite allele of any of the families studied, although a conserved BUB1B haplotype and a decreased transcript were identified. To clarify the molecular pathology of the second allele, we extended our mutational search to a candidate region surrounding BUB1B. A unique single nucleotide substitution, G > A at ss802470619, was identified in an intergenic region 44 kb upstream of a BUB1B transcription start site, which cosegregated with the disorder. To examine whether this is the causal mutation, we designed a transcription activator-like effector nuclease–mediated two-step single-base pair editing strategy and biallelically introduced this substitution into cultured human cells. The cell clones showed reduced BUB1B transcripts, increased PCS frequency, and MVA, which are the hallmarks of the syndrome. We also encountered a case of a Japanese infant with PCS (MVA) syndrome carrying a homozygous single nucleotide substitution at ss802470619. These results suggested that the nucleotide substitution identified was the causal mutation of PCS (MVA) syndrome. PMID:24344301

  4. Dietary nitrogen alters codon bias and genome composition in parasitic microorganisms.

    PubMed

    Seward, Emily A; Kelly, Steven

    2016-11-15

    Genomes are composed of long strings of nucleotide monomers (A, C, G and T) that are either scavenged from the organism's environment or built from metabolic precursors. The biosynthesis of each nucleotide differs in atomic requirements with different nucleotides requiring different quantities of nitrogen atoms. However, the impact of the relative availability of dietary nitrogen on genome composition and codon bias is poorly understood. Here we show that differential nitrogen availability, due to differences in environment and dietary inputs, is a major determinant of genome nucleotide composition and synonymous codon use in both bacterial and eukaryotic microorganisms. Specifically, low nitrogen availability species use nucleotides that require fewer nitrogen atoms to encode the same genes compared to high nitrogen availability species. Furthermore, we provide a novel selection-mutation framework for the evaluation of the impact of metabolism on gene sequence evolution and show that it is possible to predict the metabolic inputs of related organisms from an analysis of the raw nucleotide sequence of their genes. Taken together, these results reveal a previously hidden relationship between cellular metabolism and genome evolution and provide new insight into how genome sequence evolution can be influenced by adaptation to different diets and environments.

  5. Interactions between genetic variants associated with adiposity traits and soft drinks in relation to longitudinal changes in body weight and waist circumference.

    PubMed

    Olsen, Nanna J; Ängquist, Lars; Larsen, Sofus C; Linneberg, Allan; Skaaby, Tea; Husemoen, Lise Lotte N; Toft, Ulla; Tjønneland, Anne; Halkjær, Jytte; Hansen, Torben; Pedersen, Oluf; Overvad, Kim; Ahluwalia, Tarunveer S; Sørensen, Thorkild Ia; Heitmann, Berit L

    2016-09-01

    Intake of sugar-sweetened beverages is associated with obesity, and this association may be modified by a genetic predisposition to obesity. We examined the interactions between a molecular genetic predisposition to various aspects of obesity and the consumption of soft drinks, which are a major part of sugar-sweetened beverages, in relation to changes in adiposity measures. A total of 4765 individuals were included in the study. On the basis of 50 obesity-associated single nucleotide polymorphisms that are associated with body mass index (BMI), waist circumference (WC), or the waist-to-hip ratio adjusted for BMI (WHRBMI), the following 4 genetic predisposition scores (GRSs) were constructed: a complete genetic predisposition score including all 50 single nucleotide polymorphisms (GRSComplete), a genetic predisposition score including BMI-associated single nucleotide polymorphisms (GRSBMI), a genetic predisposition score including waist circumference-associated single nucleotide polymorphisms (GRSWC), and a genetic predisposition score including the waist-to-hip ratio adjusted for BMI-associated single nucleotide polymorphisms (GRSWHR). Associations between soft drink intake and the annual change (Δ) in body weight (BW), WC, or waist circumference adjusted for BMI (WCBMI) and possible interactions with the GRSs were examined with the use of linear regression analyses and meta-analyses. For each soft drink serving per day, soft drink consumption was significantly associated with a higher ΔBW of 0.07 kg/y (95% CI: 0.01, 0.13 kg/y; P = 0.020) but not with the ΔWC or ΔWCBMI In analyses of the ΔBW, we showed an interaction only with the GRSWC (per risk allele for each soft drink serving per day: -0.06 kg/y; 95% CI: -0.10, -0.02 kg/y; P = 0.006). In analyses of the ΔWC, we showed interactions only with the GRSBMI and GRSComplete [per risk allele for each soft drink serving per day: 0.05 cm/y (95% CI: 0.02, 0.09 cm/y; P = 0.001) and 0.05 cm/y (95% CI: 0.02, 0.07 cm/y; P = 0.001), respectively]. Nearly identical results were observed in analyses of the ΔWCBMI CONCLUSIONS: A genetic predisposition to a high WC may attenuate the association between soft drink intake and BW gain. A genetic predisposition to high BMI as well as a genetic predisposition to high BMI, WC, and WHRBMI combined may strengthen the association between soft drink intake and WC gain. However, the public health impact may be limited. © 2016 American Society for Nutrition.

  6. Detection of single-nucleotide polymorphisms using gold nanoparticles and single-strand-specific nucleases.

    PubMed

    Chen, Yen-Ting; Hsu, Chiao-Ling; Hou, Shao-Yi

    2008-04-15

    The current study reports an assay approach that can detect single-nucleotide polymorphisms (SNPs) and identify the position of the point mutation through a single-strand-specific nuclease reaction and a gold nanoparticle assembly. The assay can be implemented via three steps: a single-strand-specific nuclease reaction that allows the enzyme to truncate the mutant DNA; a purification step that uses capture probe-gold nanoparticles and centrifugation; and a hybridization reaction that induces detector probe-gold nanoparticles, capture probe-gold nanoparticles, and the target DNA to form large DNA-linked three-dimensional aggregates of gold nanoparticles. At high temperature (63 degrees C in the current case), the purple color of the perfect match solution would not change to red, whereas a mismatched solution becomes red as the assembled gold nanoparticles separate. Using melting analysis, the position of the point mutation could be identified. This assay provides a convenient colorimetric detection that enables point mutation identification without the need for expensive mass spectrometry. To our knowledge, this is the first report concerning SNP detection based on a single-strand-specific nuclease reaction and a gold nanoparticle assembly.

  7. Radiogenomics Consortium (RGC)

    Cancer.gov

    The Radiogenomics Consortium's hypothesis is that a cancer patient's likelihood of developing toxicity to radiation therapy is influenced by common genetic variations, such as single nucleotide polymorphisms (SNPs).

  8. Whole exome sequencing to estimate alloreactivity potential between donors and recipients in stem cell transplantation

    PubMed Central

    Sampson, Juliana K.; Sheth, Nihar U.; Koparde, Vishal N.; Scalora, Allison F.; Serrano, Myrna G.; Lee, Vladimir; Roberts, Catherine H.; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H.; Buck, Gregory A.; Neale, Michael C.; Toor, Amir A.

    2016-01-01

    Summary Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. PMID:24749631

  9. Labeled Nucleoside Triphosphates with Reversibly Terminating Aminoalkoxyl Groups

    PubMed Central

    Hutter, Daniel; Kim, Myong-Jung; Karalkar, Nilesh; Leal, Nicole A.; Chen, Fei; Guggenheim, Evan; Visalakshi, Visa; Olejnik, Jerzy; Gordon, Steven; Benner, Steven A.

    2013-01-01

    Nucleoside triphosphates having a 3′-ONH2 blocking group have been prepared with and without fluorescent tags on their nucleobases. DNA polymerases were identified that accepted these, adding a single nucleotide to the 3′-end of a primer in a template-directed extension reaction that then stops. Nitrite chemistry was developed to cleave the 3′-ONH2 group under mild conditions to allow continued primer extension. Extension-cleavage-extension cycles in solution were demonstrated with untagged nucleotides and mixtures of tagged and untagged nucleotides. Multiple extension-cleavage-extension cycles were demonstrated on an Intelligent Bio-Systems Sequencer, showing the potential of the 3′-ONH2 blocking group in “next generation sequencing”. PMID:21128174

  10. sigReannot: an oligo-set re-annotation pipeline based on similarities with the Ensembl transcripts and Unigene clusters.

    PubMed

    Casel, Pierrot; Moreews, François; Lagarrigue, Sandrine; Klopp, Christophe

    2009-07-16

    Microarray is a powerful technology enabling to monitor tens of thousands of genes in a single experiment. Most microarrays are now using oligo-sets. The design of the oligo-nucleotides is time consuming and error prone. Genome wide microarray oligo-sets are designed using as large a set of transcripts as possible in order to monitor as many genes as possible. Depending on the genome sequencing state and on the assembly state the knowledge of the existing transcripts can be very different. This knowledge evolves with the different genome builds and gene builds. Once the design is done the microarrays are often used for several years. The biologists working in EADGENE expressed the need of up-to-dated annotation files for the oligo-sets they share including information about the orthologous genes of model species, the Gene Ontology, the corresponding pathways and the chromosomal location. The results of SigReannot on a chicken micro-array used in the EADGENE project compared to the initial annotations show that 23% of the oligo-nucleotide gene annotations were not confirmed, 2% were modified and 1% were added. The interest of this up-to-date annotation procedure is demonstrated through the analysis of real data previously published. SigReannot uses the oligo-nucleotide design procedure criteria to validate the probe-gene link and the Ensembl transcripts as reference for annotation. It therefore produces a high quality annotation based on reference gene sets.

  11. Genetic diversity and classification of Tibetan yak populations based on the mtDNA COIII gene.

    PubMed

    Song, Q Q; Chai, Z X; Xin, J W; Zhao, S J; Ji, Q M; Zhang, C F; Ma, Z J; Zhong, J C

    2015-03-13

    To determine the level of genetic diversity and phylogenetic relationships among Tibetan yak populations, the mitochondrial DNA cytochrome c oxidase subunit 3 (COIII) genes of 378 yak individuals from 16 populations were analyzed in this study. The results showed that the length of cytochrome c oxidase subunit 3 gene sequences was 781 bp, with nucleotide frequencies of 29.2, 29.4, 26.1, and 15.2% for T, C, A, and G, respectively. A total of 26 haplotypes were identified, with 69 polymorphic sites, including 11 parsimony-informative sites and 58 single-nucleotide polymorphism sites. No deletions/insertions were found in sequence comparison, indicating that nucleotide mutation types were transitions and transversions. Haplotype and nucleotide diversities were 0.562 and 0.00138, respectively, indicating a high level of genetic diversity in Tibetan yak populations. Phylogenetic relationship analysis indicated that Tibetan yak populations are divided into 2 groups.

  12. Direct activation of the olfactory cyclic nucleotide-gated channel through modification of sulfhydryl groups by NO compounds.

    PubMed

    Broillet, M C; Firestein, S

    1996-02-01

    The activation of a cyclic nucleotide-gated channel is the final step in sensory transduction in olfaction. Normally, this channel is opened by the intracellular cyclic nucleotide second messenger cAMP or cGMP. However, in single channel recordings we found that donors of nitric oxide, a putative intercellular messenger, could directly activate the native olfactory neuron channel. Its action was independent of the presence of the normal ligand and did not involve the cyclic nucleotide binding site, suggesting an alternate site on the molecule that is critical in channel gating. The biochemical pathway appears to utilize nitric oxide in one of its alternate redox states, the nitrosonium ion, transnitrosylating a free sulfhydryl group belonging to a cysteine residue tentatively identified as being in the region linking the S6 transmembrane domain to the ligand binding domain.

  13. Characterization of the 2′,3′ cyclic phosphodiesterase activities of Clostridium thermocellum polynucleotide kinase-phosphatase and bacteriophage λ phosphatase

    PubMed Central

    Keppetipola, Niroshika; Shuman, Stewart

    2007-01-01

    Clostridium thermocellum polynucleotide kinase-phosphatase (CthPnkp) catalyzes 5′ and 3′ end-healing reactions that prepare broken RNA termini for sealing by RNA ligase. The central phosphatase domain of CthPnkp belongs to the dinuclear metallophosphoesterase superfamily exemplified by bacteriophage λ phosphatase (λ-Pase). CthPnkp is a Ni2+/Mn2+-dependent phosphodiesterase-monoesterase, active on nucleotide and non-nucleotide substrates, that can be transformed toward narrower metal and substrate specificities via mutations of the active site. Here we characterize the Mn2+-dependent 2′,3′ cyclic nucleotide phosphodiesterase activity of CthPnkp, the reaction most relevant to RNA repair pathways. We find that CthPnkp prefers a 2′,3′ cyclic phosphate to a 3′,5′ cyclic phosphate. A single H189D mutation imposes strict specificity for a 2′,3′ cyclic phosphate, which is cleaved to form a single 2′-NMP product. Analysis of the cyclic phosphodiesterase activities of mutated CthPnkp enzymes illuminates the active site and the structural features that affect substrate affinity and kcat. We also characterize a previously unrecognized phosphodiesterase activity of λ-Pase, which catalyzes hydrolysis of bis-p-nitrophenyl phosphate. λ-Pase also has cyclic phosphodiesterase activity with nucleoside 2′,3′ cyclic phosphates, which it hydrolyzes to yield a mixture of 2′-NMP and 3′-NMP products. We discuss our results in light of available structural and functional data for other phosphodiesterase members of the binuclear metallophosphoesterase family and draw inferences about how differences in active site composition influence catalytic repertoire. PMID:17986465

  14. Global Phylogeny of Mycobacterium tuberculosis Based on Single Nucleotide Polymorphism (SNP) Analysis: Insights into Tuberculosis Evolution, Phylogenetic Accuracy of Other DNA Fingerprinting Systems, and Recommendations for a Minimal Standard SNP Set†

    PubMed Central

    Filliol, Ingrid; Motiwala, Alifiya S.; Cavatore, Magali; Qi, Weihong; Hazbón, Manzour Hernando; Bobadilla del Valle, Miriam; Fyfe, Janet; García-García, Lourdes; Rastogi, Nalin; Sola, Christophe; Zozio, Thierry; Guerrero, Marta Inírida; León, Clara Inés; Crabtree, Jonathan; Angiuoli, Sam; Eisenach, Kathleen D.; Durmaz, Riza; Joloba, Moses L.; Rendón, Adrian; Sifuentes-Osornio, José; Ponce de León, Alfredo; Cave, M. Donald; Fleischmann, Robert; Whittam, Thomas S.; Alland, David

    2006-01-01

    We analyzed a global collection of Mycobacterium tuberculosis strains using 212 single nucleotide polymorphism (SNP) markers. SNP nucleotide diversity was high (average across all SNPs, 0.19), and 96% of the SNP locus pairs were in complete linkage disequilibrium. Cluster analyses identified six deeply branching, phylogenetically distinct SNP cluster groups (SCGs) and five subgroups. The SCGs were strongly associated with the geographical origin of the M. tuberculosis samples and the birthplace of the human hosts. The most ancestral cluster (SCG-1) predominated in patients from the Indian subcontinent, while SCG-1 and another ancestral cluster (SCG-2) predominated in patients from East Asia, suggesting that M. tuberculosis first arose in the Indian subcontinent and spread worldwide through East Asia. Restricted SCG diversity and the prevalence of less ancestral SCGs in indigenous populations in Uganda and Mexico suggested a more recent introduction of M. tuberculosis into these regions. The East African Indian and Beijing spoligotypes were concordant with SCG-1 and SCG-2, respectively; X and Central Asian spoligotypes were also associated with one SCG or subgroup combination. Other clades had less consistent associations with SCGs. Mycobacterial interspersed repetitive unit (MIRU) analysis provided less robust phylogenetic information, and only 6 of the 12 MIRU microsatellite loci were highly differentiated between SCGs as measured by GST. Finally, an algorithm was devised to identify two minimal sets of either 45 or 6 SNPs that could be used in future investigations to enable global collaborations for studies on evolution, strain differentiation, and biological differences of M. tuberculosis. PMID:16385065

  15. Structure variations of TBA G-quadruplex induced by 2'-O-methyl nucleotide in K+ and Ca2+ environments.

    PubMed

    Zhao, Xiaoyang; Liu, Bo; Yan, Jing; Yuan, Ying; An, Liwen; Guan, Yifu

    2014-10-01

    Thrombin binding aptamer (TBA), a 15-mer oligonucleotide of d(GGTTGGTGTGGTTGG) sequence, folds into a chair-type antiparallel G-quadruplex in the K(+) environment, and each of two G-tetrads is characterized by a syn-anti-syn-anti glycosidic conformation arrangement. To explore its folding topology and structural stability, 2'-O-methyl nucleotide (OMe) with the C3'-endo sugar pucker conformation and anti glycosidic angle was used to selectively substitute for the guanine residues of G-tetrads of TBA, and these substituted TBAs were characterized using a circular dichroism spectrum, thermally differential spectrum, ultraviolet stability analysis, electrophoresis mobility shift assay, and thermodynamic analysis in K(+) and Ca(2+) environments. Results showed that single substitutions for syn-dG residues destabilized the G-quadruplex structure, while single substitutions for anti-dG residues could preserve the G-quadruplex in the K(+) environment. When one or two G-tetrads were modified with OMe, TBA became unstructured. In contrast, in Ca(2+) environment, the native TBA appeared to be unstructured. When two G-tetrads were substituted with OMe, TBA seemed to become a more stable parallel G-4 structure. Further thermodynamic data suggested that OMe-substitutions were an enthalpy-driven event. The results in this study enrich our understanding about the effects of nucleotide derivatives on the G-quadruplex structure stability in different ionic environments, which will help to design G-quadruplex for biological and medical applications. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

  16. Single nucleotide polymorphisms in the mitochondrial displacement loop and outcome of esophageal squamous cell carcinoma.

    PubMed

    Zhang, Ruixing; Wang, Rui; Zhang, Fengbin; Wu, Chensi; Fan, Haiyan; Li, Yan; Wang, Cuiju; Guo, Zhanjun

    2010-11-26

    Accumulation of single nucleotide polymorphisms (SNPs) in the displacement loop (D-loop) of mitochondrial DNA (mtDNA) has been described for different types of cancers and might be associated with cancer risk and disease outcome. We used a population-based series of esophageal squamous cell carcinoma (ESCC) patients for investigating the prediction power of SNPs in mitochondrial D-loop. The D-loop region of mtDNA was sequenced for 60 ESCC patients recorded in the Fourth Hospital of Hebei Medical University between 2003 and 2004. The 5 year survival curve were calculated with the Kaplan-Meier method and compared by the log-rank test at each SNP site, a multivariate survival analysis was also performed with the Cox proportional hazards method. The SNP sites of nucleotides 16274G/A, 16278C/T and 16399A/G were identified for prediction of post-operational survival by the log-rank test. In an overall multivariate analysis, the 16278 and 16399 alleles were identified as independent predictors of ESCC outcome. The length of survival of patients with the minor allele 16278T genotype was significantly shorter than that of patients with 16278C at the 16278 site (relative risk, 3.001; 95% CI, 1.029 - 8.756; p = 0.044). The length of survival of patients with the minor allele 16399G genotype was significantly shorter than that of patients with the more frequent allele 16399A at the 16399 site in ESCC patients (relative risk, 3.483; 95% CI, 1.068 - 11.359; p = 0.039). Genetic polymorphisms in the D-loop are independent prognostic markers for patients with ESCC. Accordingly, the analysis of genetic polymorphisms in the mitochondrial D-loop can help identify patient subgroups at high risk of a poor disease outcome.

  17. Developing single nucleotide polymorphism markers for the identification of pineapple (Ananas comosus) germplasm

    PubMed Central

    Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng

    2015-01-01

    Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. ‘Cayenne’, ‘Spanish’, ‘Queen’) was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops. PMID:26640697

  18. An empirical strategy to detect bacterial transcript structure from directional RNA-seq transcriptome data.

    PubMed

    Wang, Yejun; MacKenzie, Keith D; White, Aaron P

    2015-05-07

    As sequencing costs are being lowered continuously, RNA-seq has gradually been adopted as the first choice for comparative transcriptome studies with bacteria. Unlike microarrays, RNA-seq can directly detect cDNA derived from mRNA transcripts at a single nucleotide resolution. Not only does this allow researchers to determine the absolute expression level of genes, but it also conveys information about transcript structure. Few automatic software tools have yet been established to investigate large-scale RNA-seq data for bacterial transcript structure analysis. In this study, 54 directional RNA-seq libraries from Salmonella serovar Typhimurium (S. Typhimurium) 14028s were examined for potential relationships between read mapping patterns and transcript structure. We developed an empirical method, combined with statistical tests, to automatically detect key transcript features, including transcriptional start sites (TSSs), transcriptional termination sites (TTSs) and operon organization. Using our method, we obtained 2,764 TSSs and 1,467 TTSs for 1331 and 844 different genes, respectively. Identification of TSSs facilitated further discrimination of 215 putative sigma 38 regulons and 863 potential sigma 70 regulons. Combining the TSSs and TTSs with intergenic distance and co-expression information, we comprehensively annotated the operon organization in S. Typhimurium 14028s. Our results show that directional RNA-seq can be used to detect transcriptional borders at an acceptable resolution of ±10-20 nucleotides. Technical limitations of the RNA-seq procedure may prevent single nucleotide resolution. The automatic transcript border detection methods, statistical models and operon organization pipeline that we have described could be widely applied to RNA-seq studies in other bacteria. Furthermore, the TSSs, TTSs, operons, promoters and unstranslated regions that we have defined for S. Typhimurium 14028s may constitute valuable resources that can be used for comparative analyses with other Salmonella serotypes.

  19. Comparison of semi-automated commercial rep-PCR fingerprinting, spoligotyping, 12-locus MIRU-VNTR typing and single nucleotide polymorphism analysis of the embB gene as molecular typing tools for Mycobacterium bovis.

    PubMed

    Armas, Federica; Camperio, Cristina; Coltella, Luana; Selvaggini, Serena; Boniotti, Maria Beatrice; Pacciarini, Maria Lodovica; Di Marco Lo Presti, Vincenzo; Marianelli, Cinzia

    2017-08-04

    Highly discriminatory genotyping strategies are essential in molecular epidemiological studies of tuberculosis. In this study we evaluated, for the first time, the efficacy of the repetitive sequence-based PCR (rep-PCR) DiversiLab Mycobacterium typing kit over spoligotyping, 12-locus mycobacterial interspersed repetitive unit-variable number tandem repeat (MIRU-VNTR) typing and embB single nucleotide polymorphism (SNP) analysis for Mycobacterium bovis typing. A total of 49 M. bovis animal isolates were used. DNA was extracted and genomic DNA was amplified using the DiversiLab Mycobacterium typing kit. The amplified fragments were separated and detected using a microfluidics chip with Agilent 2100. The resulting rep-PCR-based DNA fingerprints were uploaded to and analysed using web-based DiversiLab software through Pearson's correlation coefficient. Rep-PCR DiversiLab grouped M. bovis isolates into ten different clusters. Most isolates sharing identical spoligotype, MIRU-VNTR profile or embB gene polymorphism were grouped into different rep-PCR clusters. Rep-PCR DiversiLab displayed greater discriminatory power than spoligotyping and embB SNP analysis but a lower resolution power than the 12-locus MIRU-VNTR analysis. MIRU-VNTR confirmed that it is superior to the other PCR-based methods tested here. In combination with spoligotyping and 12-locus MIRU-VNTR analysis, rep-PCR improved the discriminatory power for M. bovis typing.

  20. The impact of single nucleotide polymorphisms on patterns of non-contact musculoskeletal soft tissue injuries in a football player population according to ethnicity.

    PubMed

    Pruna, Ricard; Ribas, Jordi; Montoro, Jose Bruno; Artells, Rosa

    2015-02-02

    The prevention, diagnosis, and management of non-contact musculoskeletal soft tissue injuries (NCMSTIs) related to participation in sports are key components of sport and exercise medicine. Epidemiological data have demonstrated the existence of interindividual differences in the severity of NCMSTIs, indicating that these injuries occur as a consequence of both extrinsic and intrinsic factors, including genetic variations. We have collected data on NCMSTIs suffered by 73 elite players of White, black African and Hispanic ethnicity of European football over the course of three consecutive seasons. We have also examined eight single nucleotide polymorphisms (SNPs) in genes related to tissue recovery and tissue repair in blood drawn from the players and correlated our findings with type and severity of injuries in each ethnic group. The frequency of the SNPs varied among the three ethnic sub-groups (p<0.0001). Among Whites, a significant relationship was observed between ligament injuries and ELN (p=0.001) and between tendinous injuries and ELN (p=0.05) and IGF2 (p=0.05). Among Hispanics, there was a significant relation between muscle injuries and ELN (p=0.032) and IGF2 (p=0.016). Interracial genotypic differences may be important in the study of NCMSTIs. A genetic profile based on SNPs may be useful tool to describe each individual's injuribility risk and provide specific treatment and preventive care for football players. Copyright © 2013 Elsevier España, S.L.U. All rights reserved.

  1. Association Genetics of Wood Physical Traits in the Conifer White Spruce and Relationships With Gene Expression

    PubMed Central

    Beaulieu, Jean; Doerksen, Trevor; Boyle, Brian; Clément, Sébastien; Deslauriers, Marie; Beauseigle, Stéphanie; Blais, Sylvie; Poulin, Pier-Luc; Lenz, Patrick; Caron, Sébastien; Rigault, Philippe; Bicho, Paul; Bousquet, Jean; MacKay, John

    2011-01-01

    Marker-assisted selection holds promise for highly influencing tree breeding, especially for wood traits, by considerably reducing breeding cycles and increasing selection accuracy. In this study, we used a candidate gene approach to test for associations between 944 single-nucleotide polymorphism markers from 549 candidate genes and 25 wood quality traits in white spruce. A mixed-linear model approach, including a weak but nonsignificant population structure, was implemented for each marker–trait combination. Relatedness among individuals was controlled using a kinship matrix estimated either from the known half-sib structure or from the markers. Both additive and dominance effect models were tested. Between 8 and 21 single-nucleotide polymorphisms (SNPs) were found to be significantly associated (P ≤ 0.01) with each of earlywood, latewood, or total wood traits. After controlling for multiple testing (Q ≤ 0.10), 13 SNPs were still significant across as many genes belonging to different families, each accounting for between 3 and 5% of the phenotypic variance in 10 wood characters. Transcript accumulation was determined for genes containing SNPs associated with these traits. Significantly different transcript levels (P ≤ 0.05) were found among the SNP genotypes of a 1-aminocyclopropane-1-carboxylate oxidase, a β-tonoplast intrinsic protein, and a long-chain acyl-CoA synthetase 9. These results should contribute toward the development of efficient marker-assisted selection in an economically important tree species. PMID:21385726

  2. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  3. Common variants of the EPDR1 gene and the risk of Dupuytren’s disease.

    PubMed

    Dębniak, T; Żyluk, A; Puchalski, P; Serrano-Fernandez, P

    2013-10-01

    The object of this study was the investigation of 3 common variants of single nucleotide polymorphisms of the ependymin-related gene 1 and its association with the occurrence of Dupuytren's disease. DNA samples were obtained from the peripheral blood of 508 consecutive patients. The control group comprised 515 healthy adults who were age-matched with the Dupuytren's patients. 3 common variants were analysed using TaqMan® genotyping assays and sequencing. The differences in the frequencies of variants of single nucleotide polymorphisms in patients and the control group were statistically tested. Additionally, haplotype frequency and linkage disequilibrium were analysed for these variants. A statistically significant association was noted between rs16879765_CT, rs16879765_TT and rs13240429_AA variants and Dupuytren's disease. 2 haplotypes: rs2722280_C+rs13240429_A+rs16879765_C and rs2722280_C+rs13240429_G+rs16879765_T were found to be statistically significantly associated with Dupuytren's disease. Moreover, we found that rs13240429 and rs16879765 variants were in strong linkage disequilibrium, while rs2722280 was only in moderate linkage disequilibrium. No significant differences were found in the frequencies of the variants of the gene between the groups with a positive and negative familial history of Dupuytren's disease. In conclusion, results of this study suggest that EPDR1 gene can be added to a growing list of genes associated with Dupuytren's disease development. © Georg Thieme Verlag KG Stuttgart · New York.

  4. Association of candidate genes with drought tolerance traits in diverse perennial ryegrass accessions

    PubMed Central

    Jiang, Yiwei

    2013-01-01

    Drought is a major environmental stress limiting growth of perennial grasses in temperate regions. Plant drought tolerance is a complex trait that is controlled by multiple genes. Candidate gene association mapping provides a powerful tool for dissection of complex traits. Candidate gene association mapping of drought tolerance traits was conducted in 192 diverse perennial ryegrass (Lolium perenne L.) accessions from 43 countries. The panel showed significant variations in leaf wilting, leaf water content, canopy and air temperature difference, and chlorophyll fluorescence under well-watered and drought conditions across six environments. Analysis of 109 simple sequence repeat markers revealed five population structures in the mapping panel. A total of 2520 expression-based sequence readings were obtained for a set of candidate genes involved in antioxidant metabolism, dehydration, water movement across membranes, and signal transduction, from which 346 single nucleotide polymorphisms were identified. Significant associations were identified between a putative LpLEA3 encoding late embryogenesis abundant group 3 protein and a putative LpFeSOD encoding iron superoxide dismutase and leaf water content, as well as between a putative LpCyt Cu-ZnSOD encoding cytosolic copper-zinc superoxide dismutase and chlorophyll fluorescence under drought conditions. Four of these identified significantly associated single nucleotide polymorphisms from these three genes were also translated to amino acid substitutions in different genotypes. These results indicate that allelic variation in these genes may affect whole-plant response to drought stress in perennial ryegrass. PMID:23386684

  5. Analysis of TLR2, TLR4, and TLR9 single nucleotide polymorphisms in children with bacterial meningitis and their healthy family members.

    PubMed

    Gowin, Ewelina; Świątek-Kościelna, Bogna; Kałużna, Ewelina; Nowak, Jerzy; Michalak, Michał; Wysocki, Jacek; Januszkiewicz-Lewandowska, Danuta

    2017-07-01

    The aim was to analyse TLR2 rs5743708, TLR2 rs4696480, TLR4 rs4986790, TLR9 rs5743836, and TLR9 rs352140 single nucleotide polymorphisms (SNPs) in children with pneumococcal and meningococcal meningitis and their family members. The study group consisted of 39 children with bacterial meningitis (25 with meningococcal meningitis and 14 with pneumococcal meningitis) and 49 family members. Laboratory test results and the course of the diseases were analyzed. Genomic DNA was extracted from 1.2ml of peripheral blood in order to analyze the five SNPs. Patients with pneumococcal and meningococcal meningitis showed a similar male/female ratio, mean age, and duration of symptoms. There were no statistically significant differences in biochemical markers between the two groups. All patients possessed at least one polymorphic variant of the analyzed SNPs. The most common SNP was TLR9 rs352140, detected in 89.7% of patients. No significant differences in SNP frequency were found between patients, family members, and the general population. The allele frequencies in the population studied are in accordance with the literature data. The study did not find an association between the analyzed SNPs and susceptibility to bacterial meningitis. The role of SNPs in genes coding toll-like receptors and the interactions between them in controlling inflammation in the central nervous system needs further evaluation. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  6. Detection of mandarin in orange juice by single-nucleotide polymorphism qPCR assay.

    PubMed

    Aldeguer, Miriam; López-Andreo, María; Gabaldón, José A; Puyet, Antonio

    2014-02-15

    A dual-probe real time PCR (qPCR) DNA-based analysis was devised for the identification of mandarin in orange juice. A single nucleotide polymorphism at the trnL-trnF intergenic region of the chloroplast chromosome was confirmed in nine orange (Citrus sinensis) and thirteen commercial varieties of mandarin, including Citrus reticulata and Citrus unshiu species and a mandarin × tangelo hybrid. Two short minor-groove binding fluorescent probes targeting the polymorphic sequence were used in the dual-probe qPCR, which allowed the detection of both species in single-tube reactions. The similarity of PCR efficiencies allowed a simple estimation of the ratio mandarin/orange in the juice samples, which correlated to the measured difference of threshold cycle values for both probes. The limit of detection of the assay was 5% of mandarin in orange juice, both when the juice was freshly prepared (not from concentrate) or reconstituted from concentrate, which would allow the detection of fraudulently added mandarin juice. The possible use of the dual-probe system for quantitative measurements was also tested on fruit juice mixtures. qPCR data obtained from samples containing equal amounts of mandarin and orange juice revealed that the mandarin target copy number was approximately 2.6-fold higher than in orange juice. The use of a matrix-adapted control as calibrator to compensate the resulting C(T) bias allowed accurate quantitative measurements to be obtained. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. Association between norepinephrine transporter gene (SLC6A2) polymorphisms and suicide in patients with major depressive disorder.

    PubMed

    Kim, Yong-Ku; Hwang, Jung-A; Lee, Heon-Jeong; Yoon, Ho-Kyoung; Ko, Young-Hoon; Lee, Bun-Hee; Jung, Han-Yong; Hahn, Sang-Woo; Na, Kyoung-Sae

    2014-04-01

    Although several studies have investigated possible associations between norepinephrine neurotransmitter transporter gene (SLC6A2) polymorphisms and depression, few studies have examined associations between SLC6A2 polymorphisms and suicide. Three single-nucleotide polymorphisms (rs2242446, rs28386840, and rs5569) were measured in 550 patients: 201 with major depressive disorder (MDD) and suicide attempt/s, 160 with MDD without suicide attempts, and 189 healthy controls. Analysis of single-nucleotide polymorphisms (SNPs) and haplotype was conducted for the three groups. Subsequently, multivariate logistic regression analysis adjusting for age and gender was conducted to identify independent influences of each SNP. A possible association between suicide lethality and SLC6A2 polymorphisms was also investigated. In the genotype and allele frequency analysis, there were significant differences in rs28386840 between suicidal MDD patients and healthy controls. In the haplotype analysis, TAA (rs2242446-rs28386840-rs5569, from left to right) was associated with suicide attempts in MDD, although the significance (p=0.043) disappeared after Bonferroni correction. There were no relationships between lethality scores and SLC6A2 polymorphisms in suicidal MDD. Modest sample size and a single type of neurotransmitter analyzed (norepinephrine) are the primary limitations. Our results suggest that SLC6A2 polymorphisms were associated with suicide risk in patients with MDD. Future studies are warranted to elucidate possible mechanisms by which SLC6A2 polymorphisms influence suicide risk. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Human Mitochondrial RNA Polymerase: Evaluation of the Single-Nucleotide-Addition Cycle on Synthetic RNA/DNA Scaffolds

    PubMed Central

    Smidansky, Eric D.; Arnold, Jamie J.; Reynolds, Shelley L.; Cameron, Craig E.

    2013-01-01

    The human mitochondrial RNA polymerase (h-mtRNAP) serves as both the transcriptase for expression and the primase for replication of mitochondrial DNA. As such, the enzyme is of fundamental importance to cellular energy metabolism, and defects in its function may be related to human disease states. Here we describe in vitro analysis of the h-mtRNAP kinetic mechanism for single, correct nucleotide incorporation. This was made possible by the development of efficient methods for expression and purification of h-mtRNAP using a bacterial system and by utilization of assays that rely on simple, synthetic RNA/DNA scaffolds without the need for mitochondrial transcription accessory proteins. We find that h-mtRNAP accomplishes single-nucleotide incorporation by using the same core steps, including conformational change steps before and after chemistry, that are prototypical for most types of nucleic acid polymerases. The polymerase binds to scaffolds via a two-step mechanism consisting of a fast initial-encounter step followed by a much slower isomerization that leads to catalytic competence. A substantial solvent deuterium kinetic isotope effect was observed for the forward reaction, but none was detectable for the reverse reaction, suggesting that chemistry is at least partially rate-limiting in the forward direction but not in the reverse. h-mtRNAP appears to exercise much more stringent surveillance over base than over sugar in determining the correctness of a nucleotide. The utility of developing the robust in vitro assays described here and of establishing a baseline of kinetic performance for the wild-type enzyme is that biological questions concerning h-mtRNAP may now begin to be addressed. PMID:21548588

  9. Use of causative variants and SNP weighting in a single-step GBLUP context

    USDA-ARS?s Scientific Manuscript database

    Much effort has been recently put into identifying causative quantitative trait nucleotides (QTN) in animal breeding, aiming genomic prediction. Among the genomic methods available, single-step GBLUP (ssGBLUP) became the choice because of its simplicity and potentially higher accuracy. When QTN are ...

  10. Institutional Protocol to Manage Consanguinity Detected by Genetic Testing in Pregnancy in a Minor

    PubMed Central

    Chen, Laura P.; Beck, Anita E.; Tsuchiya, Karen D.; Chow, Penny M.; Mirzaa, Ghayda M.; Wiester, Rebecca T.

    2015-01-01

    Single-nucleotide polymorphism arrays and other types of genetic tests have the potential to detect first-degree consanguinity and uncover parental rape in cases of minor teenage pregnancy. We present 2 cases in which genetic testing identified parental rape of a minor teenager. In case 1, single-nucleotide polymorphism array in a patient with multiple developmental abnormalities demonstrated multiple long stretches of homozygosity, revealing parental rape of a teenage mother. In case 2, a vague maternal sexual assault history and diagnosis of Pompe disease by direct gene sequencing identified parental rape of a minor. Given the medical, legal, and ethical implications of such revelations, a protocol was developed at our institution to manage consanguinity identified via genetic testing. PMID:25687148

  11. Identification of single-nucleotide polymorphisms of the prion protein gene in sika deer (Cervus nippon laiouanus)

    PubMed Central

    Jeong, Hyun-Jeong; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Kim, Bo-Sook; Rho, Jung-Rae; Yoo, Mi-Hyun; Jeong, Byung-Hoon; Kim, Yong-Sun

    2007-01-01

    Polymorphisms of the prion protein gene (PRNP) have been detected in several cervid species. In order to confirm the genetic variations, this study examined the DNA sequences of the PRNP obtained from 33 captive sika deer (Cervus nippon laiouanus) in Korea. A total of three single-nucleotide polymorphisms (SNPs) at codons 100, 136 and 226 in the PRNP of the sika deer were identified. The polymorphic site located at codon 100 has not been reported. The SNPs detected at codons 100 and 226 induced amino acid substitutions. The SNP at codon 136 was a silent mutation that does not induce any amino acid change. The genotype and allele frequencies were determined for each of the SNPs. PMID:17679779

  12. Reference genotype and exome data from an Australian Aboriginal population for health-based research

    PubMed Central

    Tang, Dave; Anderson, Denise; Francis, Richard W.; Syn, Genevieve; Jamieson, Sarra E.; Lassmann, Timo; Blackwell, Jenefer M.

    2016-01-01

    Genetic analyses, including genome-wide association studies and whole exome sequencing (WES), provide powerful tools for the analysis of complex and rare genetic diseases. To date there are no reference data for Aboriginal Australians to underpin the translation of health-based genomic research. Here we provide a catalogue of variants called after sequencing the exomes of 72 Aboriginal individuals to a depth of 20X coverage in ∼80% of the sequenced nucleotides. We determined 320,976 single nucleotide variants (SNVs) and 47,313 insertions/deletions using the Genome Analysis Toolkit. We had previously genotyped a subset of the Aboriginal individuals (70/72) using the Illumina Omni2.5 BeadChip platform and found ~99% concordance at overlapping sites, which suggests high quality genotyping. Finally, we compared our SNVs to six publicly available variant databases, such as dbSNP and the Exome Sequencing Project, and 70,115 of our SNVs did not overlap any of the single nucleotide polymorphic sites in all the databases. Our data set provides a useful reference point for genomic studies on Aboriginal Australians. PMID:27070114

  13. Reference genotype and exome data from an Australian Aboriginal population for health-based research.

    PubMed

    Tang, Dave; Anderson, Denise; Francis, Richard W; Syn, Genevieve; Jamieson, Sarra E; Lassmann, Timo; Blackwell, Jenefer M

    2016-04-12

    Genetic analyses, including genome-wide association studies and whole exome sequencing (WES), provide powerful tools for the analysis of complex and rare genetic diseases. To date there are no reference data for Aboriginal Australians to underpin the translation of health-based genomic research. Here we provide a catalogue of variants called after sequencing the exomes of 72 Aboriginal individuals to a depth of 20X coverage in ∼80% of the sequenced nucleotides. We determined 320,976 single nucleotide variants (SNVs) and 47,313 insertions/deletions using the Genome Analysis Toolkit. We had previously genotyped a subset of the Aboriginal individuals (70/72) using the Illumina Omni2.5 BeadChip platform and found ~99% concordance at overlapping sites, which suggests high quality genotyping. Finally, we compared our SNVs to six publicly available variant databases, such as dbSNP and the Exome Sequencing Project, and 70,115 of our SNVs did not overlap any of the single nucleotide polymorphic sites in all the databases. Our data set provides a useful reference point for genomic studies on Aboriginal Australians.

  14. Mining the transcriptomes of four commercially important shellfish species for single nucleotide polymorphisms within biomineralization genes.

    PubMed

    Vendrami, David L J; Shah, Abhijeet; Telesca, Luca; Hoffman, Joseph I

    2016-06-01

    Transcriptional profiling not only provides insights into patterns of gene expression, but also generates sequences that can be mined for molecular markers, which in turn can be used for population genetic studies. As part of a large-scale effort to better understand how commercially important European shellfish species may respond to ocean acidification, we therefore mined the transcriptomes of four species (the Pacific oyster Crassostrea gigas, the blue mussel Mytilus edulis, the great scallop Pecten maximus and the blunt gaper Mya truncata) for single nucleotide polymorphisms (SNPs). Illumina data for C. gigas, M. edulis and P. maximus and 454 data for M. truncata were interrogated using GATK and SWAP454 respectively to identify between 8267 and 47,159 high quality SNPs per species (total=121,053 SNPs residing within 34,716 different contigs). We then annotated the transcripts containing SNPs to reveal homology to diverse genes. Finally, as oceanic pH affects the ability of organisms to incorporate calcium carbonate, we honed in on genes implicated in the biomineralization process to identify a total of 1899 SNPs in 157 genes. These provide good candidates for biomarkers with which to study patterns of selection in natural or experimental populations. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Population Genetics of Verticillium dahliae in Iran Based on Microsatellite and Single Nucleotide Polymorphism Markers.

    PubMed

    Rafiei, Vahideh; Banihashemi, Ziaeddin; Bautista-Jalon, Laura S; Del Mar Jiménez-Gasco, Maria; Turgeon, B Gillian; Milgroom, Michael G

    2018-06-01

    Verticillium dahliae is a plant pathogenic fungus that reproduces asexually and its population structure is highly clonal. In the present study, 78 V. dahliae isolates from Iran were genotyped for mating type, single nucleotide polymorphisms (SNPs), and microsatellites to assign them to clonal lineages and to determine population genetic structure in Iran. The mating type of all isolates was MAT1-2. Based on neighbor-joining analysis and minimum spanning networks constructed from SNPs and microsatellite genotypes, respectively, all but four isolates were assigned to lineage 2B 824 ; four isolates were assigned to lineage 4B. The inferred coalescent genealogy of isolates in lineage 2B 824 showed a clear divergence into two clades that corresponded to geographic origin and host. Haplotypes of cotton and pistachio isolates sampled from central Iran were in one clade, and those of isolates from Prunus spp. sampled from northwestern Iran were in the other. The strong divergence in haplotypes between the two clades suggests that there were at least two separate introductions of lineage 2B 824 to different parts of Iran. Given the history of cotton and pistachio cultivation and Verticillium wilt in Iran, these results are consistent with the hypothesis that cotton was historically a likely source inoculum causing Verticillium wilt in pistachio.

  16. Oxytocin Receptor (OXTR) Single Nucleotide Polymorphisms Indirectly Predict Prosocial Behavior Through Perspective Taking and Empathic Concern.

    PubMed

    Christ, Christa C; Carlo, Gustavo; Stoltenberg, Scott F

    2016-04-01

    Engaging in prosocial behavior can provide positive outcomes for self and others. Prosocial tendencies contribute to the propensity to engage in prosocial behavior. The oxytocin receptor gene (OXTR) has also been associated with prosocial tendencies and behaviors. There has been little research, however, investigating whether the relationship between OXTR and prosocial behaviors is mediated by prosocial tendencies. This relationship may also vary among different types of prosocial behavior. The current study examines the relationship between OXTR, gender, prosocial tendencies, and both altruistic and public prosocial behavior endorsement. Students at a midwestern university (N = 398; 89.2% Caucasian; Mage  = 20.76; 26.6% male) provided self-report measures of prosocial tendencies and behaviors and buccal cells for genotyping OXTR polymorphisms. Results indicated that OXTR single nucleotide polymorphism (SNP) rs2268498 genotype significantly predicted empathic concern, whereas gender moderated the association between several other OXTR SNPs and prosocial tendencies. Increased prosocial tendencies predicted increased altruistic prosocial behavior endorsement and decreased public prosocial behavior endorsement. Our findings suggest an association between genetic variation in OXTR and endorsement of prosocial behavior indirectly through prosocial tendencies, and that the pathway is dependent on the type of prosocial behavior and gender. © 2014 Wiley Periodicals, Inc.

  17. Comparative genomics of the mimicry switch in Papilio dardanus.

    PubMed

    Timmermans, Martijn J T N; Baxter, Simon W; Clark, Rebecca; Heckel, David G; Vogel, Heiko; Collins, Steve; Papanicolaou, Alexie; Fukova, Iva; Joron, Mathieu; Thompson, Martin J; Jiggins, Chris D; ffrench-Constant, Richard H; Vogler, Alfried P

    2014-07-22

    The African Mocker Swallowtail, Papilio dardanus, is a textbook example in evolutionary genetics. Classical breeding experiments have shown that wing pattern variation in this polymorphic Batesian mimic is determined by the polyallelic H locus that controls a set of distinct mimetic phenotypes. Using bacterial artificial chromosome (BAC) sequencing, recombination analyses and comparative genomics, we show that H co-segregates with an interval of less than 500 kb that is collinear with two other Lepidoptera genomes and contains 24 genes, including the transcription factor genes engrailed (en) and invected (inv). H is located in a region of conserved gene order, which argues against any role for genomic translocations in the evolution of a hypothesized multi-gene mimicry locus. Natural populations of P. dardanus show significant associations of specific morphs with single nucleotide polymorphisms (SNPs), centred on en. In addition, SNP variation in the H region reveals evidence of non-neutral molecular evolution in the en gene alone. We find evidence for a duplication potentially driving physical constraints on recombination in the lamborni morph. Absence of perfect linkage disequilibrium between different genes in the other morphs suggests that H is limited to nucleotide positions in the regulatory and coding regions of en. Our results therefore support the hypothesis that a single gene underlies wing pattern variation in P. dardanus.

  18. Identification of a New Single-nucleotide Polymorphism within the Apolipoprotein A5 Gene, Which is Associated with Metabolic Syndrome.

    PubMed

    Salehi, Samaneh; Emadi-Baygi, Modjtaba; Rezaei, Majdaddin; Kelishadi, Roya; Nikpour, Parvaneh

    2017-01-01

    Metabolic syndrome (MetS) is a common disorder which is a constellation of clinical features including abdominal obesity, increased level of serum triglycerides (TGs) and decrease of serum high-density lipoprotein-cholesterol (HDL-C), elevated blood pressure, and glucose intolerance. The apolipoprotein A5 (APOA5) is involved in lipid metabolism, influencing the level of plasma TG and HDL-C. In the present study, we aimed to investigate the associations between four INDEL variants of APOA5 gene and the MetS risk. In this case-control study, we genotyped 116 Iranian children and adolescents with/without MetS by using Sanger sequencing method for these INDELs. Then, we explored the association of INDELs with MetS risk and their clinical components by logistic regression and one-way analysis of variance analyses. We identified a novel insertion polymorphism, c. *282-283 insAG/c. *282-283 insG variant, which appears among case and control groups. rs72525532 showed a significant difference for TG levels between various genotype groups. In addition, there were significant associations between newly identified single-nucleotide polymorphism (SNP) and rs72525532 with MetS risk. These results show that rs72525532 and the newly identified SNP may influence the susceptibility of the individuals to MetS.

  19. Lactoferrin gene promoter variants and their association with clinical and subclinical mastitis in indigenous and crossbred cattle.

    PubMed

    Chopra, A; Gupta, I D; Verma, A; Chakravarty, A K; Vohra, V

    2015-01-01

    Lactoferrin (Lf) gene promoter was screened for the presence of single nucleotide polymphism in indigenous and crossbred cattle from North India and to evaluate its association with Mastitis. Study revealed the presence of genetic variation in regulatory region of bovine Lactoferrin gene using PCR-RFLP technique. Three genotypes namely GG, GH and HH were identified. A single nucleotide change, from guanine to adenine at 25th position was found to be significantly associated (p<0.05) with clinical mastitis in indigenous Sahiwal and crossbred Karan Fries cattle maintained at organised herd of National Dairy Research Institute, Karnal. A non-significant association was observed between subclinical mastitis, somatic cell score (SCS), and GG genotype in Karan Fries cattle, however, a lower SCS was observed in animals having GG genotype. Overall a lower incidence of clinical mastitis was recorded in those animals having GG genotype of Lf in Sahiwal and Karan Fries (KF) cattle. The SNP identified in the promoter region may effect expression lactoferrin protein, which may lead to different levels of antibacterial and anti-inflammatory activity of Lf gene. Results from this study indicated the probable role played by Lactoferrin promoter to serve as candidate gene for mastitis susceptibility among indigenous and crossbred milch cattle.

  20. Rapid Identification of Echinococcus granulosus and E. canadensis Using High-Resolution Melting (HRM) Analysis by Focusing on a Single Nucleotide Polymorphism.

    PubMed

    Safa, Ahmad Hosseini; Harandi, Majid Fasihi; Tajaddini, Mohammadhasan; Rostami-Nejad, Mohammad; Mohtashami-Pour, Mehdi; Pestehchian, Nader

    2016-07-22

    High-resolution melting (HRM) is a reliable and sensitive scanning method to detect variation in DNA sequences. We used this method to better understand the epidemiology and transmission of Echinococcus granulosus. We tested the use of HRM to discriminate the genotypes of E. granulosus and E. canadensis. One hundred forty-one hydatid cysts were collected from slaughtered animals in different parts of Isfahan-Iran in 2013. After DNA extraction, the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene was amplified using PCR coupled with the HRM curve. The result of HRM analysis using partial the sequences of cox1 gene revealed that 93, 35, and 2 isolates were identified as G1, G3, and G6 genotypes, respectively. A single nucleotide polymorphism (SNP) was found in locus 9867 of the cox1 gene. This is a critical locus for the differentiation between the G6 and G7 genotypes. In the phylogenic tree, the sample with a SNP was located between the G6 and G7 genotypes, which suggest that this isolate has a G6/G7 genotype. The HRM analysis developed in the present study provides a powerful technique for molecular and epidemiological studies on echinococcosis in humans and animals.

Top