Rapid and Sensitive Isothermal Detection of Nucleic-acid Sequence by Multiple Cross Displacement Amplification.

PubMed

Wang, Yi; Wang, Yan; Ma, Ai-Jing; Li, Dong-Xun; Luo, Li-Juan; Liu, Dong-Xin; Jin, Dong; Liu, Kai; Ye, Chang-Yun

2015-07-08

We have devised a novel amplification strategy based on isothermal strand-displacement polymerization reaction, which was termed multiple cross displacement amplification (MCDA). The approach employed a set of ten specially designed primers spanning ten distinct regions of target sequence and was preceded at a constant temperature (61-65 °C). At the assay temperature, the double-stranded DNAs were at dynamic reaction environment of primer-template hybrid, thus the high concentration of primers annealed to the template strands without a denaturing step to initiate the synthesis. For the subsequent isothermal amplification step, a series of primer binding and extension events yielded several single-stranded DNAs and single-stranded single stem-loop DNA structures. Then, these DNA products enabled the strand-displacement reaction to enter into the exponential amplification. Three mainstream methods, including colorimetric indicators, agarose gel electrophoresis and real-time turbidity, were selected for monitoring the MCDA reaction. Moreover, the practical application of the MCDA assay was successfully evaluated by detecting the target pathogen nucleic acid in pork samples, which offered advantages on quick results, modest equipment requirements, easiness in operation, and high specificity and sensitivity. Here we expounded the basic MCDA mechanism and also provided details on an alternative (Single-MCDA assay, S-MCDA) to MCDA technique.

Development and validation of microsatellite markers for Brachiaria ruziziensis obtained by partial genome assembly of Illumina single-end reads

PubMed Central

2013-01-01

Background Brachiaria ruziziensis is one of the most important forage species planted in the tropics. The application of genomic tools to aid the selection of superior genotypes can provide support to B. ruziziensis breeding programs. However, there is a complete lack of information about the B. ruziziensis genome. Also, the availability of genomic tools, such as molecular markers, to support B. ruziziensis breeding programs is rather limited. Recently, next-generation sequencing technologies have been applied to generate sequence data for the identification of microsatellite regions and primer design. In this study, we present a first validated set of SSR markers for Brachiaria ruziziensis, selected from a de novo partial genome assembly of single-end Illumina reads. Results A total of 85,567 perfect microsatellite loci were detected in contigs with a minimum 10X coverage. We selected a set of 500 microsatellite loci identified in contigs with minimum 100X coverage for primer design and synthesis, and tested a subset of 269 primer pairs, 198 of which were polymorphic on 11 representative B. ruziziensis accessions. Descriptive statistics for these primer pairs are presented, as well as estimates of marker transferability to other relevant brachiaria species. Finally, a set of 11 multiplex panels containing the 30 most informative markers was validated and proposed for B. ruziziensis genetic analysis. Conclusions We show that the detection and development of microsatellite markers from genome assembled Illumina single-end DNA sequences is highly efficient. The developed markers are readily suitable for genetic analysis and marker assisted selection of Brachiaria ruziziensis. The use of this approach for microsatellite marker development is promising for species with limited genomic information, whose breeding programs would benefit from the use of genomic tools. To our knowledge, this is the first set of microsatellite markers developed for this important species. PMID:23324172

An Efficient Approach for the Development of Locus Specific Primers in Bread Wheat (Triticum aestivum L.) and Its Application to Re-Sequencing of Genes Involved in Frost Tolerance

PubMed Central

Babben, Steve; Perovic, Dragan; Koch, Michael; Ordon, Frank

2015-01-01

Recent declines in costs accelerated sequencing of many species with large genomes, including hexaploid wheat (Triticum aestivum L.). Although the draft sequence of bread wheat is known, it is still one of the major challenges to developlocus specific primers suitable to be used in marker assisted selection procedures, due to the high homology of the three genomes. In this study we describe an efficient approach for the development of locus specific primers comprising four steps, i.e. (i) identification of genomic and coding sequences (CDS) of candidate genes, (ii) intron- and exon-structure reconstruction, (iii) identification of wheat A, B and D sub-genome sequences and primer development based on sequence differences between the three sub-genomes, and (iv); testing of primers for functionality, correct size and localisation. This approach was applied to single, low and high copy genes involved in frost tolerance in wheat. In summary for 27 of these genes for which sequences were derived from Triticum aestivum, Triticum monococcum and Hordeum vulgare, a set of 119 primer pairs was developed and after testing on Nulli-tetrasomic (NT) lines, a set of 65 primer pairs (54.6%), corresponding to 19 candidate genes, turned out to be specific. Out of these a set of 35 fragments was selected for validation via Sanger's amplicon re-sequencing. All fragments, with the exception of one, could be assigned to the original reference sequence. The approach presented here showed a much higher specificity in primer development in comparison to techniques used so far in bread wheat and can be applied to other polyploid species with a known draft sequence. PMID:26565976

Isolation and characterization of microsatellite markers for Jasminum sambac (Oleaceae) using Illumina shotgun sequencing.

PubMed

Li, Yong; Zhang, Weirui

2015-10-01

Microsatellite markers of Jasminum sambac (Oleaceae) were isolated to investigate wild germplasm resources and provide markers for breeding. Illumina sequencing was used to isolate microsatellite markers from the transcriptome of J. sambac. A total of 1322 microsatellites were identified from 49,772 assembled unigenes. One hundred primer pairs were randomly selected to verify primer amplification efficiency. Out of these tested primer pairs, 31 were successfully amplified: 18 primer pairs yielded a single allele, seven exhibited fixed heterozygosity with two alleles, and only six displayed polymorphisms. This study obtained the first set of microsatellite markers for J. sambac, which will be helpful for the assessment of wild germplasm resources and the development of molecular marker-assisted breeding.

Simultaneous Genotyping of the rs4762 and rs699 Polymorphisms in Angiotensinogen Gene and Correlation with Iranian CAD Patients with Novel Hexa-primer ARMS-PCR

PubMed Central

KHATAMI, Mehri; HEIDARI, Mohammad Mehdi; HADADZADEH, Mehdi; SCHEIBER-MOJDEHKAR, Barbara; BITARAF SANI, Morteza; HOUSHMAND, Massoud

2017-01-01

Background: A significant role of Renin-angiotensin system (RAS) genetic variants in the pathogenesis of essential hypertension and cardiovascular diseases has been proved. This study aimed to develop a new, fast and cheap method for the simultaneous detection of two missense single nucleotide polymorphisms (T207M or rs4762 and M268T orrs699) of angiotensinogen (AGT) in single-step Multiplex Hexa-Primer Amplification Refractory Mutation System - polymerase chain reaction (H-ARMS-PCR). Methods: In this case-control study, 148 patients with coronary artery disease (CAD) and 135 controls were included. The patients were referred to cardiac centers in Afshar Hospital (Yazd, Iran) from 2012 to 2015. Two sets of inner primer (for each SNP) and one set outer primer pairs were designed for genotyping of rs4762 and rs699 in single tube H-ARMS-PCR. Direct sequencing of all samples was also performed to assess the accuracy of this method. DNA sequencing method validated the results of single tube H-ARMS-PCR. Results: We found full accordance for genotype adscription by sequencing method. The frequency of the AGT T521 and C702 alleles was significantly higher in CAD patients than in the control group (OR: 0.551, 95% CI: 0.359–0.846, P=0.008 and OR: 0.629, 95% CI: 0.422–0.936, P=0.028, respectively). Conclusion: This is the first work describing a rapid, low-cost, high-throughput simultaneous detection of rs4762 and rs699 polymorphisms in AGT gene, used in large clinical studies. PMID:28828324

Linkage analysis with multiplexed short tandem repeat polymorphisms using infrared fluorescence and M13 tailed primers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oetting, W.S.; Lee, H.K.; Flanders, D.J.

The use of short tandem repeat polymorphisms (STRPs) as marker loci for linkage analysis is becoming increasingly important due to their large numbers in the human genome and their high degree of polymorphism. Fluorescence-based detection of the STRP pattern with an automated DNA sequencer has improved the efficiency of this technique by eliminating the need for radioactivity and producing a digitized autoradiogram-like image that can be used for computer analysis. In an effort to simplify the procedure and to reduce the cost of fluorescence STRP analysis, we have developed a technique known as multiplexing STRPs with tailed primers (MSTP) usingmore » primers that have a 19-bp extension, identical to the sequence of an M13 sequencing primer, on the 5{prime} end of the forward primer in conjunction with multiplexing several primer pairs in a single polymerase chain reaction (PCR) amplification. The banding pattern is detected with the addition of the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye, eliminating the need for direct conjugation of the infrared fluorescent dye to the STRP primers. The use of MSTP for linkage analysis greatly reduces the number of PCR reactions. Up to five primer pairs can be multiplexed together in the same reaction. At present, a set of 148 STRP markers spaced at an average genetic distance of 28 cM throughout the autosomal genome can be analyzed in 37 sets of multiplexed amplification reactions. We have automated the analysis of these patterns for linkage using software that both detects the STRP banding pattern and determines their sizes. This information can then be exported in a user-defined format from a database manager for linkage analysis. 15 refs., 2 figs., 4 tabs.« less

Isolation and characterization of microsatellite markers for Jasminum sambac (Oleaceae) using Illumina shotgun sequencing1

PubMed Central

Li, Yong; Zhang, Weirui

2015-01-01

Premise of the study: Microsatellite markers of Jasminum sambac (Oleaceae) were isolated to investigate wild germplasm resources and provide markers for breeding. Methods and Results: Illumina sequencing was used to isolate microsatellite markers from the transcriptome of J. sambac. A total of 1322 microsatellites were identified from 49,772 assembled unigenes. One hundred primer pairs were randomly selected to verify primer amplification efficiency. Out of these tested primer pairs, 31 were successfully amplified: 18 primer pairs yielded a single allele, seven exhibited fixed heterozygosity with two alleles, and only six displayed polymorphisms. Conclusions: This study obtained the first set of microsatellite markers for J. sambac, which will be helpful for the assessment of wild germplasm resources and the development of molecular marker–assisted breeding. PMID:26504683

Quantitative real-time polymerase chain reaction for the verification of genomic imbalances detected by microarray-based comparative genomic hybridization.

PubMed

Yu, Shihui; Kielt, Matthew; Stegner, Andrew L; Kibiryeva, Nataliya; Bittel, Douglas C; Cooley, Linda D

2009-12-01

The American College of Medical Genetics guidelines for microarray analysis for constitutional cytogenetic abnormalities require abnormal or ambiguous results from microarray-based comparative genomic hybridization (aCGH) analysis be confirmed by an alternative method. We employed quantitative real-time polymerase chain reaction (qPCR) technology using SYBR Green I reagents for confirmation of 93 abnormal aCGH results (50 deletions and 43 duplications) and 54 parental samples. A novel qPCR protocol using DNA sequences coding for X-linked lethal diseases in males for designing reference primers was established. Of the 81 sets of test primers used for confirmation of 93 abnormal copy number variants (CNVs) in 80 patients, 71 sets worked after the initial primer design (88%), 9 sets were redesigned once, and 1 set twice because of poor amplification. Fifty-four parental samples were tested using 33 sets of test primers to follow up 34 CNVs in 30 patients. Nineteen CNVs were confirmed as inherited, 13 were negative in both parents, and 2 were inconclusive due to a negative result in a single parent. The qPCR assessment clarified aCGH results in two cases and corrected a fluorescence in situ hybridization result in one case. Our data illustrate that qPCR methodology using SYBR Green I reagents is accurate, highly sensitive, specific, rapid, and cost-effective for verification of chromosomal imbalances detected by aCGH in the clinical setting.

Sequetyping: Serotyping Streptococcus pneumoniae by a Single PCR Sequencing Strategy

PubMed Central

Leung, Marcus H.; Bryson, Kevin; Freystatter, Kathrin; Pichon, Bruno; Edwards, Giles; Gillespie, Stephen H.

2012-01-01

The introduction of pneumococcal conjugate vaccines necessitates continued monitoring of circulating strains to assess vaccine efficacy and replacement serotypes. Conventional serological methods are costly, labor-intensive, and prone to misidentification, while current DNA-based methods have limited serotype coverage requiring multiple PCR primers. In this study, a computer algorithm was developed to interrogate the capsulation locus (cps) of vaccine serotypes to locate primer pairs in conserved regions that border variable regions and could differentiate between serotypes. In silico analysis of cps from 92 serotypes indicated that a primer pair spanning the regulatory gene cpsB could putatively amplify 84 serotypes and differentiate 46. This primer set was specific to Streptococcus pneumoniae, with no amplification observed for other species, including S. mitis, S. oralis, and S. pseudopneumoniae. One hundred thirty-eight pneumococcal strains covering 48 serotypes were tested. Of 23 vaccine serotypes included in the study, most (19/22, 86%) were identified correctly at least to the serogroup level, including all of the 13-valent conjugate vaccine and other replacement serotypes. Reproducibility was demonstrated by the correct sequetyping of different strains of a serotype. This novel sequence-based method employing a single PCR primer pair is cost-effective and simple. Furthermore, it has the potential to identify new serotypes that may evolve in the future. PMID:22553238

Evaluation of suitable DNA regions for molecular identification of high value medicinal plants in genus Kaempferia.

PubMed

Osathanunkul, Maslin; Dheeranupattana, Srisulak; Rotarayanont, Siriphron; Sookkhee, Siriwoot; Osathanunkul, Khukrit; Madesis, Panagiotis

2017-12-02

DNA barcoding coupled high resolution melting (Bar-HRM) is an emerging method for species discrimination based on DNA dissociation kinetics. The aim of this work was to evaluate the suitability of different primer sets, derived from selected DNA regions, for Bar-HRM analysis of species in Kaempferia (Zingiberaceae). Four primer pairs were evaluated (rbcL, rpoC, trnL and ITS1). It was observed that the ITS1 barcode was the most useful DNA barcoding region overall for species discrimination out of all of the regions and primers assessed. Thus, the primer pair derived from the ITS1 region was the single most effective region for the identification of the tested species, whereas the rbcL primer pair gave the lowest resolution. Our Bar-HRM developed here would not only be useful for identification of Kaempferia plant specimens lacking essential parts for morphological identification but will be useful for authenticating products in powdered form of a high value medicinal species Kaempferia parviflora, in particular.

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

NASA Astrophysics Data System (ADS)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

A Study of Mercury Methylation Genetics: Qualitative and Quantitative Analysis of hgcAB in Pure Culture

NASA Astrophysics Data System (ADS)

Christensen, G. A.; Wymore, A. M.; King, A. J.; Podar, M.; Hurt, R. A., Jr.; Santillan, E. F. U.; Gilmour, C. C.; Brandt, C. C.; Brown, S. D.; Palumbo, A. V.; Elias, D. A.

2015-12-01

Two proteins (HgcA and HgcB) have been determined to be essential for mercury (Hg)-methylation and either one alone is not sufficient for this process. Detection and quantification of these genes to determine at risk environments is critical. Universal degenerate polymerase chain reaction (PCR) primers spanning hgcAB were developed to ascertain organismal diversity and validate that both genes were present as an established prerequisite for Hg-methylation. To confirm this approach, an extensive set of pure cultures with published genomes (including methylators and non-methylators: 13 Deltaproteobacteria, 9 Firmicutes, and 10 methanogenic Archaea) were assayed with the newly designed universal hgcAB primer set. A single band within an agarose gel was observed for the majority of the cultures with known hgcAB and confirmed via Sanger sequencing. For environmental applications, once the potential for Hg-methylation is established from PCR amplification with the universal hgcAB primer set, quantification of clade-specific hgcAB gene abundance is desirable. We developed quantitative polymerase chain reaction (qPCR) degenerate primers targeting hgcA from each of the three dominate clades (Deltaproteobacteria, Firmicutes and methanogenic Archaea) known to be associated with anaerobic Hg-methylation. The qPCR primers amplify virtually all hgcA positive cultures overall and are specific for their designed clade. Finally, to ensure the procedure is robust and sensitive in complex environmental matrices, cells from all clades were mixed in different combinations and ratios to assess qPCR primer specificity. The development and validation of these high fidelity quantitative molecular tools now allows for rapid and accurate risk management assessment in any environment.

Molecular diagnosis of malaria by photo-induced electron transfer fluorogenic primers: PET-PCR.

PubMed

Lucchi, Naomi W; Narayanan, Jothikumar; Karell, Mara A; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J; Hill, Vincent; Udhayakumar, Venkatachalam

2013-01-01

There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs.

Multiplex real-time PCR assay for Legionella species.

PubMed

Kim, Seung Min; Jeong, Yoojung; Sohn, Jang Wook; Kim, Min Ja

2015-12-01

Legionella pneumophila serogroup 1 (sg1) accounts for the majority of infections in humans, but other Legionella species are also associated with human disease. In this study, a new SYBR Green I-based multiplex real-time PCR assay in a single reaction was developed to allow the rapid detection and differentiation of Legionella species by targeting specific gene sequences. Candidate target genes were selected, and primer sets were designed by referring to comparative genomic hybridization data of Legionella species. The Legionella species-specific groES primer set successfully detected all 30 Legionella strains tested. The xcpX and rfbA primers specifically detected L. pneumophila sg1-15 and L. pneumophila sg1, respectively. In addition, this assay was validated by testing clinical samples and isolates. In conclusion, this novel multiplex real-time PCR assay might be a useful diagnostic tool for the rapid detection and differentiation of Legionella species in both clinical and epidemiological studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

A flexible and economical barcoding approach for highly multiplexed amplicon sequencing of diverse target genes

PubMed Central

Herbold, Craig W.; Pelikan, Claus; Kuzyk, Orest; Hausmann, Bela; Angel, Roey; Berry, David; Loy, Alexander

2015-01-01

High throughput sequencing of phylogenetic and functional gene amplicons provides tremendous insight into the structure and functional potential of complex microbial communities. Here, we introduce a highly adaptable and economical PCR approach to barcoding and pooling libraries of numerous target genes. In this approach, we replace gene- and sequencing platform-specific fusion primers with general, interchangeable barcoding primers, enabling nearly limitless customized barcode-primer combinations. Compared to barcoding with long fusion primers, our multiple-target gene approach is more economical because it overall requires lower number of primers and is based on short primers with generally lower synthesis and purification costs. To highlight our approach, we pooled over 900 different small-subunit rRNA and functional gene amplicon libraries obtained from various environmental or host-associated microbial community samples into a single, paired-end Illumina MiSeq run. Although the amplicon regions ranged in size from approximately 290 to 720 bp, we found no significant systematic sequencing bias related to amplicon length or gene target. Our results indicate that this flexible multiplexing approach produces large, diverse, and high quality sets of amplicon sequence data for modern studies in microbial ecology. PMID:26236305

Next-Generation DNA Sequencing of VH/VL Repertoires: A Primer and Guide to Applications in Single-Domain Antibody Discovery.

PubMed

Henry, Kevin A

2018-01-01

Immunogenetic analyses of expressed antibody repertoires are becoming increasingly common experimental investigations and are critical to furthering our understanding of autoimmunity, infectious disease, and cancer. Next-generation DNA sequencing (NGS) technologies have now made it possible to interrogate antibody repertoires to unprecedented depths, typically by sequencing of cDNAs encoding immunoglobulin variable domains. In this chapter, we describe simple, fast, and reliable methods for producing and sequencing multiplex PCR amplicons derived from the variable regions (V H , V H H or V L ) of rearranged immunoglobulin heavy and light chain genes using the Illumina MiSeq platform. We include complete protocols and primer sets for amplicon sequencing of V H /V H H/V L repertoires directly from human, mouse, and llama lymphocytes as well as from phage-displayed V H /V H H/V L libraries; these can be easily be adapted to other types of amplicons with little modification. The resulting amplicons are diverse and representative, even using as few as 10 3 input B cells, and their generation is relatively inexpensive, requiring no special equipment and only a limited set of primers. In the absence of heavy-light chain pairing, single-domain antibodies are uniquely amenable to NGS analyses. We present a number of applications of NGS technology useful in discovery of single-domain antibodies from phage display libraries, including: (i) assessment of library functionality; (ii) confirmation of desired library randomization; (iii) estimation of library diversity; and (iv) monitoring the progress of panning experiments. While the case studies presented here are of phage-displayed single-domain antibody libraries, the principles extend to other types of in vitro display libraries.

Multiplex PCR method to discriminate Artemisia iwayomogi from other Artemisia plants.

PubMed

Doh, Eui Jeong; Oh, Seung-Eun

2012-01-01

Some plants in the genus Artemisia have been used for medicinal purposes. Among them, Artemisia iwayomogi, commonly referred to as "Haninjin," is one of the major medicinal materials used in traditional Korean medicine. By contrast, Artemisia capillaris and both Artemisia argyi and Artemisia princeps, referred to as "Injinho" and "Aeyup," respectively, are used to treat diseases different from those for which "Haninjin" is prescribed. Therefore, the development of a reliable method to differentiate each Artemisia herb is necessary. We found that a random amplified polymorphic DNA (RAPD) method can be used to efficiently discriminate a few Artemisia plants from one another. To improve the reliability of RAPD amplification, we designed primer sets based on the nucleotide sequences of RAPD products to amplify a sequence-characterized amplified region (SCAR) marker of A. iwayomogi. In addition, we designed two other primer sets to amplify SCAR markers of "Aeyup" (A. argyi and A. princeps) along with "Injinho" (A. capillaris) and Artemisia japonica, which are also traded in Korean herbal markets. Using these three primer sets, we developed a multiplex PCR method concurrently not only to discriminate A. iwayomogi from other Artemisia plants, but also to identify Artemisia plants using a single PCR process.

Molecular Diagnosis of Malaria by Photo-Induced Electron Transfer Fluorogenic Primers: PET-PCR

PubMed Central

Lucchi, Naomi W.; Narayanan, Jothikumar; Karell, Mara A.; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J.; Hill, Vincent; Udhayakumar, Venkatachalam

2013-01-01

There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs. PMID:23437209

Assay Design Affects the Interpretation of T-Cell Receptor Gamma Gene Rearrangements

PubMed Central

Cushman-Vokoun, Allison M.; Connealy, Solomon; Greiner, Timothy C.

2010-01-01

Interpretation of capillary electrophoresis results derived from multiplexed fluorochrome-labeled primer sets can be complicated by small peaks, which may be incorrectly interpreted as clonal T-cell receptor-γ gene rearrangements. In this report, different assay designs were used to illustrate how design may adversely affect specificity. Ten clinical cases, with subclonal peaks containing one of the two infrequently used joining genes, were identified with a tri-color, one-tube assay. The DNA was amplified with the same NED fluorochrome on all three joining primers, first combined (one-color assay) and then amplified separately using a single NED-labeled joining primer. The single primer assay design shows how insignificant peaks could easily be wrongly interpreted as clonal T-cell receptor-γ gene rearrangements. Next, the performance of the one-tube assay was compared with the two-tube BIOMED-2-based TCRG Gene Clonality Assay in a series of 44 cases. Whereas sensitivity was similar between the two methods (92.9% vs. 96.4%; P = 0.55), specificity was significantly less in the BIOMED-2 assay (87.5% vs. 56.3%; P = 0.049) when a 2× ratio was used to define clonality. Specificity was improved to 81.3% by the use of a 5× peak height ratio (P = 0.626). These findings illustrate how extra caution is needed in interpreting a design with multiple, separate distributions, which is more difficult to interpret than a single distribution assay. PMID:20959612

A polymorphism in the bovine gamma-S-crystallin gene revealed by allele-specific amplification.

PubMed

Kemp, S J; Maillard, J C; Teale, A J

1993-04-01

A polymorphism was detected in the 3' untranslated region of the bovine gamma-S-crystallin gene by direct sequencing of polymerase chain reaction (PCR) products from genomic DNA of an N'Dama bull and a Boran cow. A set of three PCR primers was designed to detect this difference and thus give allele-specific amplification. The two allele-specific primers differ in length by 20 nucleotides so that the allelic products may be distinguished by simple agarose gel electrophoresis following a single PCR reaction. This provides a simple and rapid assay for this polymorphism.

Laboratory Protocol for Genetic Gut Content Analyses of Aquatic Macroinvertebrates Using Group-specific rDNA Primers.

PubMed

Koester, Meike; Gergs, René

2017-10-05

Analyzing food webs is essential for a better understanding of ecosystems. For example, food web interactions can undergo severe changes caused by the invasion of non-indigenous species. However, an exact identification of field predator-prey interactions is difficult in many cases. These analyses are often based on a visual evaluation of gut content or the analysis of stable isotope ratios (δ 15 N and δ 13 C). Such methods require comprehensive knowledge about, respectively, morphologic diversity or isotopic signature from individual prey organisms, leading to obstacles in the exact identification of prey organisms. Visual gut content analyses especially underestimate soft bodied prey organisms, because maceration, ingestion and digestion of prey organisms make identification of specific species difficult. Hence, polymerase chain reaction (PCR) based strategies, for example the use of group-specific primer sets, provide a powerful tool for the investigation of food web interactions. Here, we describe detailed protocols to investigate the gut contents of macroinvertebrate consumers from the field using group-specific primer sets for nuclear ribosomal deoxyribonucleic acid (rDNA). DNA can be extracted either from whole specimens (in the case of small taxa) or out of gut contents of specimens collected in the field. Presence and functional efficiency of the DNA templates need to be confirmed directly from the tested individual using universal primer sets targeting the respective subunit of DNA. We also demonstrate that consumed prey can be determined further down to species level via PCR with unmodified group-specific primers combined with subsequent single strand conformation polymorphism (SSCP) analyses using polyacrylamide gels. Furthermore, we show that the use of different fluorescent dyes as labels enables parallel screening for DNA fragments of different prey groups from multiple gut content samples via automated fragment analysis.

Comparison of Primer Sets for Use in Automated Ribosomal Intergenic Spacer Analysis of Aquatic Bacterial Communities: an Ecological Perspective▿

PubMed Central

Jones, Stuart E.; Shade, Ashley L.; McMahon, Katherine D.; Kent, Angela D.

2007-01-01

Two primer sets for automated ribosomal intergenic spacer analysis (ARISA) were used to assess the bacterial community composition (BCC) in Lake Mendota, Wisconsin, over 3 years. Correspondence analysis revealed differences in community profiles generated by different primer sets, but overall ecological patterns were conserved in each case. ARISA is a powerful tool for evaluating BCC change through space and time, regardless of the specific primer set used. PMID:17122397

[Construction of thr461 --> Asn461 and Ile462 --> Val462 mutation vector of P4501A1 gene].

PubMed

Wei, Qing; Liu, Yi-Min; Wang, Hui; Zhao, Xiao-Lin; Ren, Tie-ling; Xiao, Yong-mei

2006-09-01

To construct Thr461 --> Asn461 and Ile462 --> Val462 mutation vector of P4501A1 gene and to provide scientific base for deeply researching on the function of cytochrome 1A1 gene (CYP1A1) and the mechanism of carcinogenesis. According to cDNA sequence of human CYP1A1 gene, universal primers (Pm3/Pm4) and mutant primers (Pt15/Pt16 and Pt17/Pt18) containing restriction enzyme site and mutation site were designed. The first set of primers involving Pm3/Pt16 and Pm3/Pt18 amplified a forward 1.5kb fragment from pGEM-T-CYP1A1 plasmid. The second set of primers involving Pt15/Pm4 and Pt17/Pm4 amplified a reverse 177-bp fragment from 10ng pGEM-T-CYP1A1 plasmid. The third set of primers involving Pm3/Pm4 amplified a 1.5kb fragment from the fomer PCR amplifications. The third PCR products were separated, purified and recovered from 1% agarose gel, then inserted into pMD-T vector. Subsequently the conjunct products were transformed into E. coil strain DH-5alpha., then the single clone was screened out and plasmids were extracted from such clone finally verified by restriction endonuclease analysis and sequencing. A 1.5kb fragment of tricycle PCR amplifications were digested by restriction endonucleases (BamHI and SailI) and sequenced bidirectionally by universal primers(T7p and SP6). The results verified that the cloned fragment including Asn461 and Val462 mutant site had 99.9% homology with the human cDNA of CYP1A1 gene in Genebank. The objective fragment containing Asn461 and Va462 mutant site with cDNA of the CYP1A1 gene has been successfully constructed in this experiment.

Hexon based PCRs combined with restriction enzyme analysis for rapid detection and differentiation of fowl adenoviruses and egg drop syndrome virus.

PubMed

Raue, R; Hess, M

1998-08-01

Three different polymerase chain reactions (PCRs), two of them combined with restriction enzyme analysis (REA), were developed for detection and differentiation of all 12 fowl adenovirus (FAV) serotypes and the egg drop syndrome (EDS) virus. For primer construction FAV1, FAV10 and EDS virus hexon proteins were aligned and conserved and variable regions were determined. Two primer sets (H1/H2 and H3/H4) for single use were constructed which hybridize in three conserved regions of hexon genes. Each primer pair amplifies approximately half of the hexon gene including two loop regions. An amplification product was detected with both primer sets using purified DNA from all FAV1-12 reference strains. Viral EDS DNA was negative using the H1/H2 or H3/H4 primer pair. HaeII digestion of the H1/H2 amplification products differentiates between all viruses except FAV4 and FAV5. In comparison, much more clustering among genomic closely related FAV serotypes was seen after HpaII digestion of the H3/H4 PCR products. Oligonucleotides H5/H6 located in the variable regions of EDS virus hexon gene do not detect any of the FAV serotypes. The PCRs and REA described are suitable to detect all avian adenoviruses infecting chickens, to distinguish all 12 FAV reference strains and to differentiate FAVs from the EDS virus.

Primer selection impacts specific population abundances but not community dynamics in a monthly time-series 16S rRNA gene amplicon analysis of coastal marine bacterioplankton.

PubMed

Wear, Emma K; Wilbanks, Elizabeth G; Nelson, Craig E; Carlson, Craig A

2018-03-09

Primers targeting the 16S small subunit ribosomal RNA marker gene, used to characterize bacterial and archaeal communities, have recently been re-evaluated for marine planktonic habitats. To investigate whether primer selection affects the ecological interpretation of bacterioplankton populations and community dynamics, amplicon sequencing with four primer sets targeting several hypervariable regions of the 16S rRNA gene was conducted on both mock communities constructed from cloned 16S rRNA genes and a time-series of DNA samples from the temperate coastal Santa Barbara Channel. Ecological interpretations of community structure (delineation of depth and seasonality, correlations with environmental factors) were similar across primer sets, while population dynamics varied. We observed substantial differences in relative abundances of taxa known to be poorly resolved by some primer sets, such as Thaumarchaeota and SAR11, and unexpected taxa including Roseobacter clades. Though the magnitude of relative abundances of common OTUs differed between primer sets, the relative abundances of the OTUs were nonetheless strongly correlated. We do not endorse one primer set but rather enumerate strengths and weaknesses to facilitate selection appropriate to a system or experimental goal. While 16S rRNA gene primer bias suggests caution in assessing quantitative population dynamics, community dynamics appear robust across studies using different primers. © 2018 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

Development of duplex PCR for simultaneous detection of Theileria spp. and Anaplasma spp. in sheep and goats.

PubMed

Cui, Yanyan; Zhang, Yan; Jian, Fuchun; Zhang, Longxian; Wang, Rongjun; Cao, Shuxuan; Wang, Xiaoxing; Yan, Yaqun; Ning, Changshen

2017-05-01

Theileria spp. and Anaplasma spp., which are important tick-borne pathogens (TBPs), impact the health of humans and animals in tropical and subtropical areas. Theileria and Anaplasma co-infections are common in sheep and goats. Following alignment of the relevant DNA sequences, two primer sets were designed to specifically target the Theileria spp. 18S rRNA and Anaplasma spp. 16S rRNA gene sequences. Genomic DNA from the two genera was serially diluted tenfold for testing the sensitivities of detection of the primer sets. The specificities of the primer sets were confirmed when DNA from Anaplasma and Theileria (positive controls), other related hematoparasites (negative controls) and ddH 2 O were used as templates. Fifty field samples were also used to evaluate the utility of single PCR and duplex PCR assays, and the detection results were compared with those of the PCR methods previously published. An optimized duplex PCR assay was established from the two primer sets based on the relevant genes from the two TBPs, and this assay generated products of 298-bp (Theileria spp.) and 139-bp (Anaplasma spp.). The detection limit of the assay was 29.4 × 10 -3  ng per μl, and there was no cross-reaction with the DNA from other hematoparasites. The results showed that the newly developed duplex PCR assay had an efficiency of detection (P > 0.05) similar to other published PCR methods. In this study, a duplex PCR assay was developed that can simultaneously identify Theileria spp. and Anaplasma spp. in sheep and goats. This duplex PCR is a potentially valuable assay for epidemiological studies of TBPs in that it can detect cases of mixed infections of the pathogens. Copyright © 2017 Elsevier Inc. All rights reserved.

Detection of Helicobacter pylori DNA in inflamed dental pulp specimens from Japanese children and adolescents.

PubMed

Ogaya, Yuko; Nomura, Ryota; Watanabe, Yoshiyuki; Nakano, Kazuhiko

2015-01-01

The oral cavity has been implicated as a source of Helicobacter pylori infection in childhood. Various PCR methods have been used to detect H. pylori DNA in oral specimens with various detection rates reported. Such disparity in detection rates complicates the estimation of the true infection rate of H. pylori in the oral cavity. In the present study, we constructed a novel PCR system for H. pylori detection and used it to analyse oral specimens. Firstly, the nucleotide alignments of genes commonly used for H. pylori detection were compared using the complete genome information for 48 strains registered in the GenBank database. Candidate primer sets with an estimated amplification size of approximately 300-400 bp were selected, and the specificity and sensitivity of the detection system using each primer set were evaluated. Five sets of primers targeting ureA were considered appropriate, of which a single primer set was chosen for inclusion in the PCR system. The sensitivity of the system was considered appropriate and its detection limit established as one to ten cells per reaction. The novel PCR system was used to examine H. pylori distribution in oral specimens (40 inflamed pulp tissues, 40 saliva samples) collected from Japanese children, adolescents and young adults. PCR analysis revealed that the detection rate of H. pylori in inflamed pulp was 15 %, whereas no positive reaction was found in any of the saliva specimens. Taken together, our novel PCR system was found to be reliable for detecting H. pylori. The results obtained showed that H. pylori was detected in inflamed pulp but not saliva specimens, indicating that an infected root canal may be a reservoir for H. pylori. © 2015 The Authors.

Plastid 16S rRNA gene diversity among eukaryotic picophytoplankton sorted by flow cytometry from the South Pacific Ocean.

PubMed

Shi, Xiao Li; Lepère, Cécile; Scanlan, David J; Vaulot, Daniel

2011-04-28

The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX), which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image.

Apolipoprotein E genotyping by multiplex tetra-primer amplification refractory mutation system PCR in single reaction tube.

PubMed

Yang, Young Geun; Kim, Jong Yeol; Park, Su Jeong; Kim, Suhng Wook; Jeon, Ok-Hee; Kim, Doo-Sik

2007-08-31

Apolipoprotein E (APOE) plays a critical role in lipoprotein metabolism by binding to both low-density lipoprotein and APOE receptors. The APOE gene has three allelic forms, epsilon2, epsilon3, and epsilon4, which encode different isoforms of the APOE protein. In this study, we have developed a new genotyping method for APOE. Our multiplex tetra-primer amplification refractory mutation system (multiplex T-ARMS) polymerase chain reaction (PCR) was performed in a single reaction tube with six primers consisting of two common primers and two specific primers for each of two single nucleotide polymorphism (SNP) sites. We obtained definitive electropherograms that showed three (epsilon2/epsilon2, epsilon3/epsilon3, and epsilon4/epsilon4), four (epsilon2/epsilon3 and epsilon3/epsilon4), and five (epsilon2/epsilon4) amplicons by multiplex T-ARMS PCR in a single reaction tube. Multiplex T-ARMS PCR for APOE genotyping is a simple and accurate method that requires only a single PCR reaction, without any another treatments or expensive instrumentation, to simultaneously identify two sites of single nucleotide polymorphisms.

Multiplex primer prediction software for divergent targets

PubMed Central

Gardner, Shea N.; Hiddessen, Amy L.; Williams, Peter L.; Hara, Christine; Wagner, Mark C.; Colston, Bill W.

2009-01-01

We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets to amplify all members of large, diverse and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers (∼3700 18-mers or ∼2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus (FMDV), hemagglutinin (HA) and neuraminidase (NA) segments of influenza A virus, Norwalk virus, and HIV-1. We empirically demonstrated the application of the software with a multiplex set of 16 short (10 nt) primers designed to amplify the Poxviridae family to produce a specific amplicon from vaccinia virus. PMID:19759213

Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

PubMed

Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

2015-04-01

Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

Improved Selection of Internal Transcribed Spacer-Specific Primers Enables Quantitative, Ultra-High-Throughput Profiling of Fungal Communities

PubMed Central

Bokulich, Nicholas A.

2013-01-01

Ultra-high-throughput sequencing (HTS) of fungal communities has been restricted by short read lengths and primer amplification bias, slowing the adoption of newer sequencing technologies to fungal community profiling. To address these issues, we evaluated the performance of several common internal transcribed spacer (ITS) primers and designed a novel primer set and work flow for simultaneous quantification and species-level interrogation of fungal consortia. Primer comparison and validation were predicted in silico and by sequencing a “mock community” of mixed yeast species to explore the challenges of amplicon length and amplification bias for reconstructing defined yeast community structures. The amplicon size and distribution of this primer set are smaller than for all preexisting ITS primer sets, maximizing sequencing coverage of hypervariable ITS domains by very-short-amplicon, high-throughput sequencing platforms. This feature also enables the optional integration of quantitative PCR (qPCR) directly into the HTS preparatory work flow by substituting qPCR with these primers for standard PCR, yielding quantification of individual community members. The complete work flow described here, utilizing any of the qualified primer sets evaluated, can rapidly profile mixed fungal communities and capably reconstructed well-characterized beer and wine fermentation fungal communities. PMID:23377949

swga: a primer design toolkit for selective whole genome amplification.

PubMed

Clarke, Erik L; Sundararaman, Sesh A; Seifert, Stephanie N; Bushman, Frederic D; Hahn, Beatrice H; Brisson, Dustin

2017-07-15

Population genomic analyses are often hindered by difficulties in obtaining sufficient numbers of genomes for analysis by DNA sequencing. Selective whole-genome amplification (SWGA) provides an efficient approach to amplify microbial genomes from complex backgrounds for sequence acquisition. However, the process of designing sets of primers for this method has many degrees of freedom and would benefit from an automated process to evaluate the vast number of potential primer sets. Here, we present swga , a program that identifies primer sets for SWGA and evaluates them for efficiency and selectivity. We used swga to design and test primer sets for the selective amplification of Wolbachia pipientis genomic DNA from infected Drosophila melanogaster and Mycobacterium tuberculosis from human blood. We identify primer sets that successfully amplify each against their backgrounds and describe a general method for using swga for arbitrary targets. In addition, we describe characteristics of primer sets that correlate with successful amplification, and present guidelines for implementation of SWGA to detect new targets. Source code and documentation are freely available on https://www.github.com/eclarke/swga . The program is implemented in Python and C and licensed under the GNU Public License. ecl@mail.med.upenn.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

Indel Group in Genomes (IGG) Molecular Genetic Markers1[OPEN

PubMed Central

Burkart-Waco, Diana; Kuppu, Sundaram; Britt, Anne; Chetelat, Roger

2016-01-01

Genetic markers are essential when developing or working with genetically variable populations. Indel Group in Genomes (IGG) markers are primer pairs that amplify single-locus sequences that differ in size for two or more alleles. They are attractive for their ease of use for rapid genotyping and their codominant nature. Here, we describe a heuristic algorithm that uses a k-mer-based approach to search two or more genome sequences to locate polymorphic regions suitable for designing candidate IGG marker primers. As input to the IGG pipeline software, the user provides genome sequences and the desired amplicon sizes and size differences. Primer sequences flanking polymorphic insertions/deletions are produced as output. IGG marker files for three sets of genomes, Solanum lycopersicum/Solanum pennellii, Arabidopsis (Arabidopsis thaliana) Columbia-0/Landsberg erecta-0 accessions, and S. lycopersicum/S. pennellii/Solanum tuberosum (three-way polymorphic) are included. PMID:27436831

A quantitative and direct PCR assay for the subspecies-specific detection of Clavibacter michiganensis subsp. michiganensis based on a ferredoxin reductase gene.

PubMed

Cho, Min Seok; Lee, Jang Ha; Her, Nam Han; Kim, Changkug; Seol, Young-Joo; Hahn, Jang Ho; Baeg, Ji Hyoun; Kim, Hong Gi; Park, Dong Suk

2012-06-01

The Gram-positive bacterium Clavibacter michiganensis subsp. michiganensis is the causal agent of canker disease in tomato. Because it is very important to control newly introduced inoculum sources from commercial materials, the specific detection of this pathogen in seeds and seedlings is essential for effective disease control. In this study, a novel and efficient assay for the detection and quantitation of C. michiganensis subsp. michiganensis in symptomless tomato and red pepper seeds was developed. A pair of polymerase chain reaction (PCR) primers (Cmm141F/R) was designed to amplify a specific 141 bp fragment on the basis of a ferredoxin reductase gene of C. michiganensis subsp. michiganensis NCPPB 382. The specificity of the primer set was evaluated using purified DNA from 16 isolates of five C. michiganensis subspecies, one other Clavibacter species, and 17 other reference bacteria. The primer set amplified a single band of expected size from the genomic DNA obtained from the C. michiganensis subsp. michiganensis strains but not from the other C. michiganensis subspecies or from other Clavibacter species. The detection limit was a single cloned copy of the ferredoxin reductase gene of C. michiganensis subsp. michiganensis. In conclusion, this quantitative direct PCR assay can be applied as a practical diagnostic method for epidemiological research and the sanitary management of seeds and seedlings with a low level or latent infection of C. michiganensis subsp. michiganensis.

Multiplex Real-Time PCR Assays that Measure the Abundance of Extremely Rare Mutations Associated with Cancer

PubMed Central

Vargas, Diana Y.; Kramer, Fred Russell; Tyagi, Sanjay; Marras, Salvatore A. E.

2016-01-01

We describe the use of “SuperSelective” primers that enable the detection and quantitation of somatic mutations whose presence relates to cancer diagnosis, prognosis, and therapy, in real-time PCR assays that can potentially analyze rare DNA fragments present in blood samples (liquid biopsies). The design of these deoxyribonucleotide primers incorporates both a relatively long “5' anchor sequence” that hybridizes strongly to target DNA fragments, and a very short, physically and functionally separate, “3' foot sequence” that is perfectly complementary to the mutant target sequence, but mismatches the wild-type sequence. As few as ten mutant fragments can reliably be detected in the presence of 1,000,000 wild-type fragments, even when the difference between the mutant and the wild type is only a single nucleotide polymorphism. Multiplex PCR assays employing a set of SuperSelective primers, and a corresponding set of differently colored molecular beacon probes, can be used in situations where the different mutations, though occurring in different cells, are located in the same codon. These non-symmetric real-time multiplex PCR assays contain limited concentrations of each SuperSelective primer, thereby enabling the simultaneous determination of each mutation’s abundance by comparing its threshold value to the threshold value of a reference gene present in the sample. PMID:27244445

Effectiveness of the standard and an alternative set of Streptococcus pneumoniae multi locus sequence typing primers.

PubMed

Adamiak, Paul; Vanderkooi, Otto G; Kellner, James D; Schryvers, Anthony B; Bettinger, Julie A; Alcantara, Joenel

2014-06-03

Multi-locus sequence typing (MLST) is a portable, broadly applicable method for classifying bacterial isolates at an intra-species level. This methodology provides clinical and scientific investigators with a standardized means of monitoring evolution within bacterial populations. MLST uses the DNA sequences from a set of genes such that each unique combination of sequences defines an isolate's sequence type. In order to reliably determine the sequence of a typing gene, matching sequence reads for both strands of the gene must be obtained. This study assesses the ability of both the standard, and an alternative set of, Streptococcus pneumoniae MLST primers to completely sequence, in both directions, the required typing alleles. The results demonstrated that for five (aroE, recP, spi, xpt, ddl) of the seven S. pneumoniae typing alleles, the standard primers were unable to obtain the complete forward and reverse sequences. This is due to the standard primers annealing too closely to the target regions, and current sequencing technology failing to sequence the bases that are too close to the primer. The alternative primer set described here, which includes a combination of primers proposed by the CDC and several designed as part of this study, addresses this limitation by annealing to highly conserved segments further from the target region. This primer set was subsequently employed to sequence type 105 S. pneumoniae isolates collected by the Canadian Immunization Monitoring Program ACTive (IMPACT) over a period of 18 years. The inability of several of the standard S. pneumoniae MLST primers to fully sequence the required region was consistently observed and is the result of a shift in sequencing technology occurring after the original primers were designed. The results presented here introduce clear documentation describing this phenomenon into the literature, and provide additional guidance, through the introduction of a widely validated set of alternative primers, to research groups seeking to undertake S. pneumoniae MLST based studies.

Multiplexing Short Primers for Viral Family PCR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gardner, S N; Hiddessen, A L; Hara, C A

We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and formore » several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.« less

Detection and identification of Brettanomyces/Dekkera sp. yeasts with a loop-mediated isothermal amplification method.

PubMed

Hayashi, Nobuyuki; Arai, Ritsuko; Tada, Setsuzo; Taguchi, Hiroshi; Ogawa, Yutaka

2007-01-01

Primer sets for a loop-mediated isothermal amplification (LAMP) method were developed to specifically identify each of the four Brettanomyces/Dekkera species, Dekkera anomala, Dekkera bruxellensis, Dekkera custersiana and Brettanomyces naardenensis. Each primer set was designed with target sequences in the ITS region of the four species and could specifically amplify the target DNA of isolates from beer, wine and soft drinks. Furthermore, the primer sets differentiated strains of the target species from strains belonging to other species, even within the genus Brettanomyces/Dekkera. Moreover, the LAMP method with these primer sets could detect about 1 x 10(1) cfu/ml of Brettanomyces/Dekkera yeasts from suspensions in distilled water, wine and beer. This LAMP method with primer sets for the identification of Brettanomyces/Dekkera yeasts is advantageous in terms of specificity, sensitivity and ease of operation compared with standard PCR methods.

Fast-Acting Rubber-To-Coated-Aluminum Adhesive

NASA Technical Reports Server (NTRS)

Comer, Dawn A.; Novak, Howard; Vazquez, Mark

1991-01-01

Cyanoacrylate adhesive used to join rubber to coated aluminum easier to apply and more effective. One-part material applied in single coat to aluminum treated previously with epoxy primer and top coat. Parts mated as soon as adhesive applied; no drying necessary. Sets in 5 minutes. Optionally, accelerator brushed onto aluminum to reduce setting time to 30 seconds. Clamping parts together unnecessary. Adhesive comes in four formulations, all based on ethyl cyanoacrylate with various amounts of ethylene copolymer rubber, poly(methyl methacrylate), silicon dioxide, hydroquinone, and phthalic anhydride.

Validation and Application of a PCR Primer Set to Quantify Fungal Communities in the Soil Environment by Real-Time Quantitative PCR

PubMed Central

Chemidlin Prévost-Bouré, Nicolas; Christen, Richard; Dequiedt, Samuel; Mougel, Christophe; Lelièvre, Mélanie; Jolivet, Claudy; Shahbazkia, Hamid Reza; Guillou, Laure; Arrouays, Dominique; Ranjard, Lionel

2011-01-01

Fungi constitute an important group in soil biological diversity and functioning. However, characterization and knowledge of fungal communities is hampered because few primer sets are available to quantify fungal abundance by real-time quantitative PCR (real-time Q-PCR). The aim in this study was to quantify fungal abundance in soils by incorporating, into a real-time Q-PCR using the SYBRGreen® method, a primer set already used to study the genetic structure of soil fungal communities. To satisfy the real-time Q-PCR requirements to enhance the accuracy and reproducibility of the detection technique, this study focused on the 18S rRNA gene conserved regions. These regions are little affected by length polymorphism and may provide sufficiently small targets, a crucial criterion for enhancing accuracy and reproducibility of the detection technique. An in silico analysis of 33 primer sets targeting the 18S rRNA gene was performed to select the primer set with the best potential for real-time Q-PCR: short amplicon length; good fungal specificity and coverage. The best consensus between specificity, coverage and amplicon length among the 33 sets tested was the primer set FR1 / FF390. This in silico analysis of the specificity of FR1 / FF390 also provided additional information to the previously published analysis on this primer set. The specificity of the primer set FR1 / FF390 for Fungi was validated in vitro by cloning - sequencing the amplicons obtained from a real time Q-PCR assay performed on five independent soil samples. This assay was also used to evaluate the sensitivity and reproducibility of the method. Finally, fungal abundance in samples from 24 soils with contrasting physico-chemical and environmental characteristics was examined and ranked to determine the importance of soil texture, organic carbon content, C∶N ratio and land use in determining fungal abundance in soils. PMID:21931659

Development of genomic microsatellite multiplex PCR using dye-labeled universal primer and its validation in pedigree analysis of Pacific oyster ( Crassostrea gigas)

NASA Astrophysics Data System (ADS)

Liu, Ting; Li, Qi; Song, Junlin; Yu, Hong

2017-02-01

There is an increasing requirement for traceability of aquaculture products, both for consumer protection and for food safety. There are high error rates in the conventional traceability systems depending on physical labels. Genetic traceability technique depending on DNA-based tracking system can overcome this problem. Genealogy information is essential for genetic traceability, and microsatellite DNA marker is a good choice for pedigree analysis. As increasing genotyping throughput of microsatellites, microsatellite multiplex PCR has become a fast and cost-effective technique. As a commercially important cultured aquatic species, Pacific oyster Crassostrea gigas has the highest global production. The objective of this study was to develop microsatellite multiplex PCR panels with dye-labeled universal primer for pedigree analysis in C. gigas, and these multiplex PCRs were validated using 12 full-sib families with known pedigrees. Here we developed six informative multiplex PCRs using 18 genomic microsatellites in C. gigas. Each multiplex panel contained a single universal primer M13(-21) used as a tail on each locus-specific forward primer and a single universal primer M13(-21) labeled with fluorophores. The polymorphisms of the markers were moderate, with an average of 10.3 alleles per locus and average polymorphic information content of 0.740. The observed heterozygosity per locus ranged from 0.492 to 0.822. Cervus simulations revealed that the six panels would still be of great value when massive families were analysed. Pedigree analysis of real offspring demonstrated that 100% of the offspring were unambiguously allocated to their parents when two multiplex PCRs were used. The six sets of multiplex PCRs can be an important tool for tracing cultured individuals, population genetic analysis, and selective breeding program in C. gigas.

Quenching of Unincorporated Amplification Signal Reporters in Reverse-Transcription Loop-Mediated Isothermal Amplification Enabling Bright, Single-Step, Closed-Tube, and Multiplexed Detection of RNA Viruses.

PubMed

Ball, Cameron S; Light, Yooli K; Koh, Chung-Yan; Wheeler, Sarah S; Coffey, Lark L; Meagher, Robert J

2016-04-05

Reverse-transcription-loop-mediated isothermal amplification (RT-LAMP) has frequently been proposed as an enabling technology for simplified diagnostic tests for RNA viruses. However, common detection techniques used for LAMP and RT-LAMP have drawbacks, including poor discrimination capability, inability to multiplex targets, high rates of false positives, and (in some cases) the requirement of opening reaction tubes postamplification. Here, we present a simple technique that allows closed-tube, target-specific detection, based on inclusion of a dye-labeled primer that is incorporated into a target-specific amplicon if the target is present. A short, complementary quencher hybridizes to unincorporated primer upon cooling down at the end of the reaction, thereby quenching fluorescence of any unincorporated primer. Our technique, which we term QUASR (for quenching of unincorporated amplification signal reporters, read "quasar"), does not significantly reduce the amplification efficiency or sensitivity of RT-LAMP. Equipped with a simple LED excitation source and a colored plastic gel filter, the naked eye or a camera can easily discriminate between positive and negative QUASR reactions, which produce a difference in signal of approximately 10:1 without background subtraction. We demonstrate that QUASR detection is compatible with complex sample matrices such as human blood, using a novel LAMP primer set for bacteriophage MS2 (a model RNA virus particle). Furthermore, we demonstrate single-tube duplex detection of West Nile virus (WNV) and chikungunya virus (CHIKV) RNA.

A screening method for the detection of the 35S promoter and the nopaline synthase terminator in genetically modified organisms in a real-time multiplex polymerase chain reaction using high-resolution melting-curve analysis.

PubMed

Akiyama, Hiroshi; Nakamura, Fumi; Yamada, Chihiro; Nakamura, Kosuke; Nakajima, Osamu; Kawakami, Hiroshi; Harikai, Naoki; Furui, Satoshi; Kitta, Kazumi; Teshima, Reiko

2009-11-01

To screen for unauthorized genetically modified organisms (GMO) in the various crops, we developed a multiplex real-time polymerase chain reaction high-resolution melting-curve analysis method for the simultaneous qualitative detection of 35S promoter sequence of cauliflower mosaic virus (35SP) and the nopaline synthase terminator (NOST) in several crops. We selected suitable primer sets for the simultaneous detection of 35SP and NOST and designed the primer set for the detection of spiked ColE1 plasmid to evaluate the validity of the polymerase chain reaction (PCR) analyses. In addition, we optimized the multiplex PCR conditions using the designed primer sets and EvaGreen as an intercalating dye. The contamination of unauthorized GMO with single copy similar to NK603 maize can be detected as low as 0.1% in a maize sample. Furthermore, we showed that the present method would be applicable in identifying GMO in various crops and foods like authorized GM soybean, authorized GM potato, the biscuit which is contaminated with GM soybeans and the rice which is contaminated with unauthorized GM rice. We consider this method to be a simple and reliable assay for screening for unauthorized GMO in crops and the processing food products.

A simplified strategy for sensitive detection of Rose rosette virus compatible with three RT-PCR chemistries.

PubMed

Dobhal, Shefali; Olson, Jennifer D; Arif, Mohammad; Garcia Suarez, Johnny A; Ochoa-Corona, Francisco M

2016-06-01

Rose rosette disease is a disorder associated with infection by Rose rosette virus (RRV), a pathogen of roses that causes devastating effects on most garden cultivated varieties, and the wild invasive rose especially Rosa multiflora. Reliable and sensitive detection of this disease in early phases is needed to implement proper control measures. This study assesses a single primer-set based detection method for RRV and demonstrates its application in three different chemistries: Endpoint RT-PCR, TaqMan-quantitative RT-PCR (RT-qPCR) and SYBR Green RT-qPCR with High Resolution Melting analyses. A primer set (RRV2F/2R) was designed from consensus sequences of the nucleocapsid protein gene p3 located in the RNA 3 region of RRV. The specificity of primer set RRV2F/2R was validated in silico against published GenBank sequences and in-vitro against infected plant samples and an exclusivity panel of near-neighbor and other viruses that commonly infect Rosa spp. The developed assay is sensitive with a detection limit of 1fg from infected plant tissue. Thirty rose samples from 8 different states of the United States were tested using the developed methods. The developed methods are sensitive and reliable, and can be used by diagnostic laboratories for routine testing and disease management decisions. Copyright © 2016 Elsevier B.V. All rights reserved.

A New Primer Set to Amplify the Mitochondrial Cytochrome C Oxidase Subunit I (COI) Gene in the DHA-Rich Microalgae, the Genus Aurantiochytrium.

PubMed

Nishitani, Goh; Yoshida, Masaki

2018-06-01

This study was performed in order to develop a primer set for mitochondrial cytochrome c oxidase subunit I (COI) in the DHA-rich microalgae of the genus Aurantiochytrium. The performance of the primer set was tested using 12 Aurantiochytrium strains and other thraustochytrid species. There were no genetic polymorphisms in the mitochondrial sequences from the Aurantiochytrium strains, in contrast to the nuclear 18S rRNA gene sequence. This newly developed primer set amplified sequences from Aurantiochytrium and closely related genera, and may be useful for species identification and clarifying the genetic diversity of Aurantiochytrium in the field.

Microsatellite markers for Vellozia gigantea (Velloziaceae), a narrowly endemic species to the Brazilian campos rupestres.

PubMed

Martins, Ana Paula V; Proite, Karina; Kalapothakis, Evanguedes; Santos, Fabrício R; Chaves, Anderson V; Borba, Eduardo L

2012-07-01

Microsatellite primers were developed for the first time in Velloziaceae, in the endangered species Vellozia gigantea. Using two different protocols, seven primer sets were characterized in three populations of V. gigantea. The primers amplified di- and trinucleotide repeats with six to 12 alleles per locus. These revealed high levels of genetic variation, presenting an average observed heterozygosity of 0.508 in V. gigantea. The seven primers were tested for cross-amplification in three Vellozia species. All primers successfully amplified in V. auriculata. Six primers amplified in V. compacta and three in V. hirsuta. The new marker set described here will be useful for studies of population genetics of V. gigantea. The cross-amplification results indicate the utility of primers for studies in other Vellozia species.

A fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp.

PubMed

Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

2011-06-01

The present study aimed to establish a fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus-specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were analyzed by capillary electrophoresis under non-denaturing conditions (F-PCR-SSCP). Capillary electrophoresis analysis of the fluorescence-labelled DNA fragments displayed three different peak profiles that allowed the accurate identification of Fasciola species: one single peak specific for either Fasciola hepatica or Fasciola gigantica and a doublet peak corresponding to the "intermediate" Fasciola. Validation of our novel method was performed using Fasciola specimens from different host animals from China, Spain, Nigeria, and Egypt. This F-PCR-SSCP assay provides a rapid, simple, and robust tool for the identification and differentiation between Fasciola spp.

Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

PubMed

Yofe, Ido; Schuldiner, Maya

2014-02-01

The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

Dye shift: a neglected source of genotyping error in molecular ecology.

PubMed

Sutton, Jolene T; Robertson, Bruce C; Jamieson, Ian G

2011-05-01

Molecular ecologists must be vigilant in detecting and accounting for genotyping error, yet potential errors stemming from dye-induced mobility shift (dye shift) may be frequently neglected and largely unknown to researchers who employ 3-primer systems with automated genotyping. When left uncorrected, dye shift can lead to mis-scoring alleles and even to falsely calling new alleles if different dyes are used to genotype the same locus in subsequent reactions. When we used four different fluorophore labels from a standard dye set to genotype the same set of loci, differences in the resulting size estimates for a single allele ranged from 2.07 bp to 3.68 bp. The strongest effects were associated with the fluorophore PET, and relative degree of dye shift was inversely related to locus size. We found little evidence in the literature that dye shift is regularly accounted for in 3-primer studies, despite knowledge of this phenomenon existing for over a decade. However, we did find some references to erroneous standard correction factors for the same set of dyes that we tested. We thus reiterate the need for strict quality control when attempting to reduce possible sources of genotyping error, and in cases where different dyes are applied to a single locus, perhaps mistakenly, we strongly discourage researchers from assuming generic correction patterns. © 2011 Blackwell Publishing Ltd.

Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction

PubMed Central

2012-01-01

Background Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. Results We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. Conclusions We describe a robust and fully implemented general purpose primer design tool that designs target-specific PCR primers. Primer-BLAST offers flexible options to adjust the specificity threshold and other primer properties. This tool is publicly available at http://www.ncbi.nlm.nih.gov/tools/primer-blast. PMID:22708584

Improved Efficiency and Robustness in qPCR and Multiplex End-Point PCR by Twisted Intercalating Nucleic Acid Modified Primers

PubMed Central

Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm

2012-01-01

We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5′-end. In qPCR, the 5′-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5′-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5′-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5′-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5′-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5′-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions. PMID:22701644

Identification of spider-mite species and their endosymbionts using multiplex PCR.

PubMed

Zélé, Flore; Weill, Mylène; Magalhães, Sara

2018-02-01

Spider mites of the genus Tetranychidae are severe crop pests. In the Mediterranean a few species coexist, but they are difficult to identify based on morphological characters. Additionally, spider mites often harbour several species of endosymbiotic bacteria, which may affect the biology of their hosts. Here, we propose novel, cost-effective, multiplex diagnostic methods allowing a quick identification of spider-mite species as well as of the endosymbionts they carry. First, we developed, and successfully multiplexed in a single PCR, primers to identify Tetranychus urticae, T. evansi and T. ludeni, some of the most common tetranychids found in southwest Europe. Moreover, we demonstrated that this method allows detecting multiple species in a single pool, even at low frequencies (up to 1/100), and can be used on entire mites without DNA extraction. Second, we developed another set of primers to detect spider-mite endosymbionts, namely Wolbachia, Cardinium and Rickettsia in a multiplex PCR, along with a generalist spider-mite primer to control for potential failure of DNA amplification in each PCR. Overall, our method represents a simple, cost-effective and reliable method to identify spider-mite species and their symbionts in natural field populations, as well as to detect contaminations in laboratory rearings. This method may easily be extended to other species.

Detection of HbsAg and hATIII genetically modified goats (Caprahircus) by loop-mediated isothermal amplification.

PubMed

Tao, Chenyu; Zhang, Qingde; Zhai, Shanli; Liu, Bang

2013-11-01

In this study, sensitive and rapid detection systems were designed using a loop-mediated isothermal amplification (LAMP) method to detect the genetically modified goats. A set of 4 primers were designed for each exogenous nucleic acids HBsAg and hATIII. The DNA samples were first amplified with the outer and inner primers and released a single-stranded DNA,of which both ends were stem-loop structure. Then one inner primer hybridized with the loop, and initiated displacement synthesis in less than 1 h. The result could be visualized by both agarose gel electrophoresis and unaided eyes directly after adding SYBR GREEN 1. The detection limit of LAMP was ten copies of target molecules, indicating that LAMP was tenfold more sensitive than the classical PCR. Furthermore, all the samples of genetically modified goats were tested positively by LAMP, and the results demonstrated that the LAMP was a rapid and sensitive method for detecting the genetically modified organism.

An Undergraduate Laboratory Experiment for Upper-Level Forensic Science, Biochemistry, or Molecular Biology Courses: Human DNA Amplification Using STR Single Locus Primers by Real-Time PCR with SYBR Green Detection

ERIC Educational Resources Information Center

Elkins, Kelly M.; Kadunc, Raelynn E.

2012-01-01

In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…

Novel ITS1 Fungal Primers for Characterization of the Mycobiome

PubMed Central

Usyk, Mykhaylo; Zolnik, Christine P.; Patel, Hitesh; Levi, Michael H.

2017-01-01

ABSTRACT Studies of the human microbiome frequently omit characterization of fungal communities (the mycobiome), which limits our ability to investigate how fungal communities influence human health. The internal transcribed spacer 1 (ITS1) region of the eukaryotic ribosomal cluster has features allowing for wide taxonomic coverage and has been recognized as a suitable barcode region for species-level identification of fungal organisms. We developed custom ITS1 primer sets using iterative alignment refinement. Primer performance was evaluated using in silico testing and experimental testing of fungal cultures and human samples. Using an expanded novel reference database, SIS (18S-ITS1-5.8S), the newly designed primers showed an average in silico taxonomic coverage of 79.9% ± 7.1% compared to a coverage of 44.6% ± 13.2% using previously published primers (P = 0.05). The newly described primer sets recovered an average of 21,830 ± 225 fungal reads from fungal isolate culture samples, whereas the previously published primers had an average of 3,305 ± 1,621 reads (P = 0.03). Of note was an increase in the taxonomic coverage of the Candida genus, which went from a mean coverage of 59.5% ± 13% to 100.0% ± 0.0% (P = 0.0015) comparing the previously described primers to the new primers, respectively. The newly developed ITS1 primer sets significantly improve general taxonomic coverage of fungal communities infecting humans and increased read depth by an order of magnitude over the best-performing published primer set tested. The overall best-performing primer pair in terms of taxonomic coverage and read recovery, ITS1-30F/ITS1-217R, will aid in advancing research in the area of the human mycobiome. IMPORTANCE The mycobiome constitutes all the fungal organisms within an environment or biological niche. The fungi are eukaryotes, are extremely heterogeneous, and include yeasts and molds that colonize humans as part of the microbiome. In addition, fungi can also infect humans and cause disease. Characterization of the bacterial component of the microbiome was revolutionized by 16S rRNA gene fragment amplification, next-generation sequencing technologies, and bioinformatics pipelines. Characterization of the mycobiome has often not been included in microbiome studies because of limitations in amplification systems. This report revisited the selection of PCR primers that amplify the fungal ITS1 region. We have identified primers with superior identification of fungi present in the database. We have compared the new primer sets against those previously used in the literature and show a significant improvement in read count and taxon identification. These primers should facilitate the study of fungi in human physiology and disease states. PMID:29242834

Development of Strain-Specific Primers for Identification of Bifidobacterium bifidum BGN4.

PubMed

Youn, So Youn; Ji, Geun Eog; Han, Yoo Ri; Park, Myeong Soo

2017-05-28

Bifidobacterium bifidum BGN4 (BGN4) has many proven beneficial effects, including antiallergy and anticancer properties. It has been commercialized and used in several probiotic products, and thus strain-specific identification of this strain is very valuable for further strain-dependent physiological study. For this purpose, we developed novel multiplex polymerase chain reaction (PCR) primer sets for strain-specific detection of BGN4 in commercial products and fecal samples of animal models. The primer set was tested on seven strains of B. bifidum and 75 strains of the other Bifidobacterium species. The BGN4-specific regions were derived using megaBLAST against genome sequences of various B. bifidum databases and four sets of primers were designed. As a result, only BGN4 produced four PCR products simultaneously whereas the other strains did not. The PCR detection limit using BGN4-specific primer sets was 2.8 × 10 1 CFU/ml of BGN4. Those primer sets also detected and identified BGN4 in the probiotic products containing BNG4 and fecal samples from a BGN4-fed animal model with high specificity. Our results indicate that the PCR assay from this study is an efficient tool for the simple, rapid, and reliable identification of BGN4, for which probiotic strains are known.

High-utility conserved avian microsatellite markers enable parentage and population studies across a wide range of species

PubMed Central

2013-01-01

Background Microsatellites are widely used for many genetic studies. In contrast to single nucleotide polymorphism (SNP) and genotyping-by-sequencing methods, they are readily typed in samples of low DNA quality/concentration (e.g. museum/non-invasive samples), and enable the quick, cheap identification of species, hybrids, clones and ploidy. Microsatellites also have the highest cross-species utility of all types of markers used for genotyping, but, despite this, when isolated from a single species, only a relatively small proportion will be of utility. Marker development of any type requires skill and time. The availability of sufficient “off-the-shelf” markers that are suitable for genotyping a wide range of species would not only save resources but also uniquely enable new comparisons of diversity among taxa at the same set of loci. No other marker types are capable of enabling this. We therefore developed a set of avian microsatellite markers with enhanced cross-species utility. Results We selected highly-conserved sequences with a high number of repeat units in both of two genetically distant species. Twenty-four primer sets were designed from homologous sequences that possessed at least eight repeat units in both the zebra finch (Taeniopygia guttata) and chicken (Gallus gallus). Each primer sequence was a complete match to zebra finch and, after accounting for degenerate bases, at least 86% similar to chicken. We assessed primer-set utility by genotyping individuals belonging to eight passerine and four non-passerine species. The majority of the new Conserved Avian Microsatellite (CAM) markers amplified in all 12 species tested (on average, 94% in passerines and 95% in non-passerines). This new marker set is of especially high utility in passerines, with a mean 68% of loci polymorphic per species, compared with 42% in non-passerine species. Conclusions When combined with previously described conserved loci, this new set of conserved markers will not only reduce the necessity and expense of microsatellite isolation for a wide range of genetic studies, including avian parentage and population analyses, but will also now enable comparisons of genetic diversity among different species (and populations) at the same set of loci, with no or reduced bias. Finally, the approach used here can be applied to other taxa in which appropriate genome sequences are available. PMID:23497230

Characterization of a Methanogenic Community within an Algal Fed Anaerobic Digester

PubMed Central

Ellis, Joshua T.; Tramp, Cody; Sims, Ronald C.; Miller, Charles D.

2012-01-01

The microbial diversity and metabolic potential of a methanogenic consortium residing in a 3785-liter anaerobic digester, fed with wastewater algae, was analyzed using 454 pyrosequencing technology. DNA was extracted from anaerobic sludge material and used in metagenomic analysis through PCR amplification of the methyl-coenzyme M reductase α subunit (mcrA) gene using primer sets ML, MCR, and ME. The majority of annotated mcrA sequences were assigned taxonomically to the genera Methanosaeta in the order Methanosarcinales. Methanogens from the genus Methanosaeta are obligate acetotrophs, suggesting this genus plays a dominant role in methane production from the analyzed fermentation sample. Numerous analyzed sequences within the algae fed anaerobic digester were unclassified and could not be assigned taxonomically. Relative amplicon frequencies were determined for each primer set to determine the utility of each in pyrosequencing. Primer sets ML and MCR performed better quantitatively (representing the large majority of analyzed sequences) than primer set ME. However, each of these primer sets was shown to provide a quantitatively unique community structure, and thus they are of equal importance in mcrA metagenomic analysis. PMID:23724331

URPD: a specific product primer design tool

PubMed Central

2012-01-01

Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312

URPD: a specific product primer design tool.

PubMed

Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong

2012-06-19

Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR.

PubMed

Chaumeau, V; Andolina, C; Fustec, B; Tuikue Ndam, N; Brengues, C; Herder, S; Cerqueira, D; Chareonviriyaphap, T; Nosten, F; Corbel, V

2016-01-01

Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies.

Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR

PubMed Central

Chaumeau, V.; Andolina, C.; Fustec, B.; Tuikue Ndam, N.; Brengues, C.; Herder, S.; Cerqueira, D.; Chareonviriyaphap, T.; Nosten, F.; Corbel, V.

2016-01-01

Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies. PMID:27441839

A New Single-Step PCR Assay for the Detection of the Zoonotic Malaria Parasite Plasmodium knowlesi

PubMed Central

Lucchi, Naomi W.; Poorak, Mitra; Oberstaller, Jenna; DeBarry, Jeremy; Srinivasamoorthy, Ganesh; Goldman, Ira; Xayavong, Maniphet; da Silva, Alexandre J.; Peterson, David S.; Barnwell, John W.; Kissinger, Jessica; Udhayakumar, Venkatachalam

2012-01-01

Background Recent studies in Southeast Asia have demonstrated substantial zoonotic transmission of Plasmodium knowlesi to humans. Microscopically, P. knowlesi exhibits several stage-dependent morphological similarities to P. malariae and P. falciparum. These similarities often lead to misdiagnosis of P. knowlesi as either P. malariae or P. falciparum and PCR-based molecular diagnostic tests are required to accurately detect P. knowlesi in humans. The most commonly used PCR test has been found to give false positive results, especially with a proportion of P. vivax isolates. To address the need for more sensitive and specific diagnostic tests for the accurate diagnosis of P. knowlesi, we report development of a new single-step PCR assay that uses novel genomic targets to accurately detect this infection. Methodology and Significant Findings We have developed a bioinformatics approach to search the available malaria parasite genome database for the identification of suitable DNA sequences relevant for molecular diagnostic tests. Using this approach, we have identified multi-copy DNA sequences distributed in the P. knowlesi genome. We designed and tested several novel primers specific to new target sequences in a single-tube, non-nested PCR assay and identified one set of primers that accurately detects P. knowlesi. We show that this primer set has 100% specificity for the detection of P. knowlesi using three different strains (Nuri, H, and Hackeri), and one human case of malaria caused by P. knowlesi. This test did not show cross reactivity with any of the four human malaria parasite species including 11 different strains of P. vivax as well as 5 additional species of simian malaria parasites. Conclusions The new PCR assay based on novel P. knowlesi genomic sequence targets was able to accurately detect P. knowlesi. Additional laboratory and field-based testing of this assay will be necessary to further validate its utility for clinical diagnosis of P. knowlesi. PMID:22363751

Quenching of unincorporated amplification signal reporters in reverse-transcription loop-mediated isothermal amplification enabling bright, single-step, closed-tube, and multiplexed detection of RNA viruses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ball, Cameron S.; Light, Yooli K.; Koh, Chung -Yan

Reverse-transcription-loop-mediated isothermal amplification (RT-LAMP) has frequently been proposed as an enabling technology for simplified diagnostic tests for RNA viruses. However, common detection techniques used for LAMP and RT-LAMP have drawbacks, including poor discrimination capability, inability to multiplex targets, high rates of false positives, and (in some cases) the requirement of opening reaction tubes postamplification. Here, we present a simple technique that allows closed-tube, target-specific detection, based on inclusion of a dye-labeled primer that is incorporated into a target-specific amplicon if the target is present. A short, complementary quencher hybridizes to unincorporated primer upon cooling down at the end of themore » reaction, thereby quenching fluorescence of any unincorporated primer. Our technique, which we term QUASR (for quenching of unincorporated amplification signal reporters, read “quasar”), does not significantly reduce the amplification efficiency or sensitivity of RT-LAMP. Equipped with a simple LED excitation source and a colored plastic gel filter, the naked eye or a camera can easily discriminate between positive and negative QUASR reactions, which produce a difference in signal of approximately 10:1 without background subtraction. We demonstrate that QUASR detection is compatible with complex sample matrices such as human blood, using a novel LAMP primer set for bacteriophage MS2 (a model RNA virus particle). As a result, we demonstrate single-tube duplex detection of West Nile virus (WNV) and chikungunya virus (CHIKV) RNA.« less

Quenching of unincorporated amplification signal reporters in reverse-transcription loop-mediated isothermal amplification enabling bright, single-step, closed-tube, and multiplexed detection of RNA viruses

DOE PAGES

Ball, Cameron S.; Light, Yooli K.; Koh, Chung -Yan; ...

2016-03-16

Reverse-transcription-loop-mediated isothermal amplification (RT-LAMP) has frequently been proposed as an enabling technology for simplified diagnostic tests for RNA viruses. However, common detection techniques used for LAMP and RT-LAMP have drawbacks, including poor discrimination capability, inability to multiplex targets, high rates of false positives, and (in some cases) the requirement of opening reaction tubes postamplification. Here, we present a simple technique that allows closed-tube, target-specific detection, based on inclusion of a dye-labeled primer that is incorporated into a target-specific amplicon if the target is present. A short, complementary quencher hybridizes to unincorporated primer upon cooling down at the end of themore » reaction, thereby quenching fluorescence of any unincorporated primer. Our technique, which we term QUASR (for quenching of unincorporated amplification signal reporters, read “quasar”), does not significantly reduce the amplification efficiency or sensitivity of RT-LAMP. Equipped with a simple LED excitation source and a colored plastic gel filter, the naked eye or a camera can easily discriminate between positive and negative QUASR reactions, which produce a difference in signal of approximately 10:1 without background subtraction. We demonstrate that QUASR detection is compatible with complex sample matrices such as human blood, using a novel LAMP primer set for bacteriophage MS2 (a model RNA virus particle). As a result, we demonstrate single-tube duplex detection of West Nile virus (WNV) and chikungunya virus (CHIKV) RNA.« less

Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.

Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

De-MetaST-BLAST: A Tool for the Validation of Degenerate Primer Sets and Data Mining of Publicly Available Metagenomes

PubMed Central

Gulvik, Christopher A.; Effler, T. Chad; Wilhelm, Steven W.; Buchan, Alison

2012-01-01

Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies). Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s) and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI’s BLAST (De-MetaST-BLAST), the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications. PMID:23189198

Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

DOE PAGES

Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; ...

2014-01-01

Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

Specific PCR detection of Fusarium oxysporum f. sp. raphani: a causal agent of Fusarium wilt on radish plants.

PubMed

Kim, H; Hwang, S-M; Lee, J H; Oh, M; Han, J W; Choi, G J

2017-08-01

Fusarium oxysporum, a causal agent of Fusarium wilt, is one of the most important fungal pathogens worldwide, and detection of F. oxysporum DNA at the forma specialis level is crucial for disease diagnosis and control. In this study, two novel F. oxysporum f. sp. raphani (For)-specific primer sets were designed, FOR1-F/FOR1-R and FOR2-F/FOR2-R, to target FOQG_17868 and FOQG_17869 ORFs, respectively, which were selected based on the genome comparison of other formae speciales of F. oxysporum including conglutinans, cubense, lycopersici, melonis, and pisi. The primer sets FOR1-F/FOR1-R and FOR2-F/FOR2-R that amplified a 610- and 425-bp DNA fragment, respectively, were specific to For isolates which was confirmed using a total of 40 F. oxysporum isolates. From infected plants, the FOR2-F/FOR2-R primer set directly detected the DNA fragment of For isolates even when the radish plants were collected in their early stage of disease development. Although the loci targeted by the For-specific primer sets were not likely involved in the pathogenesis, the primer set FOR2-F/FOR2-R is available for the determination of pathogenicity of radish-infecting F. oxysporum isolates. This study is the first report providing novel primer sets to detect F. oxysporum f. sp. raphani. Because plant pathogenic Fusarium oxysporum has been classified into special forms based on its host specificity, identification of F. oxysporum usually requires a pathogenicity assay as well as knowledge of the morphological characteristics. For rapid and reliable diagnosis, this study provides PCR primer sets that specifically detect Fusarium oxysporum f. sp. raphani (For) which is a devastating pathogen of radish plants. Because one of the primer sets directly detected the DNA fragment of For isolates from infected plants, the specific PCR method demonstrated in this study will provide a foundation for integrated disease management practices in commodity crops. © 2017 The Society for Applied Microbiology.

Opening the treasure chest: A DNA-barcoding primer set for most higher taxa of Central European birds and mammals from museum collections

PubMed Central

Schäffer, Sylvia; Zachos, Frank E.

2017-01-01

DNA-barcoding is a rapidly developing method for efficiently identifying samples to species level by means of short standard DNA sequences. However, reliable species assignment requires the availability of a comprehensive DNA barcode reference library, and hence numerous initiatives aim at generating such barcode databases for particular taxa or geographic regions. Historical museum collections represent a potentially invaluable source for the DNA-barcoding of many taxa. This is particularly true for birds and mammals, for which collecting fresh (voucher) material is often very difficult to (nearly) impossible due to the special animal welfare and conservation regulations that apply to vertebrates in general, and birds and mammals in particular. Moreover, even great efforts might not guarantee sufficiently complete sampling of fresh material in a short period of time. DNA extracted from historical samples is usually degraded, such that only short fragments can be amplified, rendering the recovery of the barcoding region as a single fragment impossible. Here, we present a new set of primers that allows the efficient amplification and sequencing of the entire barcoding region in most higher taxa of Central European birds and mammals in six overlapping fragments, thus greatly increasing the value of historical museum collections for generating DNA barcode reference libraries. Applying our new primer set in recently established NGS protocols promises to further increase the efficiency of barcoding old bird and mammal specimens. PMID:28358863

Specific Detection of Clavibacter michiganensis subsp. sepedonicus by Amplification of Three Unique DNA Sequences Isolated by Subtraction Hybridization.

PubMed

Mills, D; Russell, B W; Hanus, J W

1997-08-01

ABSTRACT Three single-copy, unique DNA fragments, designated Cms50, Cms72, and Cms85, were isolated from strain CS3 of Clavibacter michiganensis subsp. sepedonicus by subtraction hybridization using driver DNA from C. michiganensis subsp. insidiosus, C. michiganensis subsp. michiganensis, and Rhodococcus facians. Radio-labeled probes made of these fragments and used in Southern blot analysis revealed each to be absolutely specific to all North American C. michiganensis subsp. sepedonicus strains tested, including plasmidless and nonmucoid strains. The probes have no homology with genomic DNA from related C. michiganensis subspecies insidiosus, michiganensis, and tessellarius, nor with DNA from 11 additional bacterial species and three unidentified strains, some of which have been previously reported to display cross-reactivity with C. michiganensis subsp. sepedonicus-specific antisera. The three fragments shared no homology, and they appeared to be separated from each other by at least 20 kbp in the CS3 genome. Internal primer sets permitted amplification of each fragment by the polymerase chain reaction (PCR) only from C. michiganensis subsp. sepedonicus DNA. In a PCR-based sensitivity assay using a primer set that amplifies Cms85, the lowest level of detection of C. michiganensis subsp. sepedonicus was 100 CFU per milliliter when cells were added to potato core fluid. Erroneous results that may arise from PCR artifacts and mutational events are, therefore, minimized by the redundancy of the primer sets, and the products should be verifiable with unique capture probes in sequence-based detection systems.

Opening the treasure chest: A DNA-barcoding primer set for most higher taxa of Central European birds and mammals from museum collections.

PubMed

Schäffer, Sylvia; Zachos, Frank E; Koblmüller, Stephan

2017-01-01

DNA-barcoding is a rapidly developing method for efficiently identifying samples to species level by means of short standard DNA sequences. However, reliable species assignment requires the availability of a comprehensive DNA barcode reference library, and hence numerous initiatives aim at generating such barcode databases for particular taxa or geographic regions. Historical museum collections represent a potentially invaluable source for the DNA-barcoding of many taxa. This is particularly true for birds and mammals, for which collecting fresh (voucher) material is often very difficult to (nearly) impossible due to the special animal welfare and conservation regulations that apply to vertebrates in general, and birds and mammals in particular. Moreover, even great efforts might not guarantee sufficiently complete sampling of fresh material in a short period of time. DNA extracted from historical samples is usually degraded, such that only short fragments can be amplified, rendering the recovery of the barcoding region as a single fragment impossible. Here, we present a new set of primers that allows the efficient amplification and sequencing of the entire barcoding region in most higher taxa of Central European birds and mammals in six overlapping fragments, thus greatly increasing the value of historical museum collections for generating DNA barcode reference libraries. Applying our new primer set in recently established NGS protocols promises to further increase the efficiency of barcoding old bird and mammal specimens.

Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

PubMed Central

Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

2002-01-01

AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

Simultaneous Detection of Four Foodborne Viruses in Food Samples Using a One-Step Multiplex Reverse Transcription PCR.

PubMed

Lee, Shin-Young; Kim, Mi-Ju; Kim, Hyun-Joong; Jeong, KwangCheol Casey; Kim, Hae-Yeong

2018-02-28

A one-step multiplex reverse transcription PCR (RT-PCR) method comprising six primer sets (for the detection of norovirus GI and GII, hepatitis A virus, rotavirus, and astrovirus) was developed to simultaneously detect four kinds of pathogenic viruses. The size of the PCR products for norovirus GI and GII, hepatitis A virus (VP3/VP1 and P2A regions), rotavirus, and astrovirus were 330, 164, 244, 198, 629, and 449 bp, respectively. The RT-PCR with the six primer sets showed specificity for the pathogenic viruses. The detection limit of the developed multiplex RT-PCR, as evaluated using serially diluted viral RNAs, was comparable to that of one-step single RT-PCR. Moreover, this multiplex RT-PCR was evaluated using food samples such as water, oysters, lettuce, and vegetable product. These food samples were artificially spiked with the four kinds of viruses in diverse combinations, and the spiked viruses in all food samples were detected successfully.

PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gardner, S. N.

2013-08-08

Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

Detection of giardine gene in local isolates of Giardia duodenalis by polymerase chain reaction (PCR).

PubMed

Latifah, I; Teoh, K Y; Wan, K L; Rahmah, M; Normaznah, Y; Rohani, A

2005-12-01

Giardia duodenalis is an intestinal parasite that causes diarrhoea and malabsorption in children. The parasite also infects AIDS patients with a weak immune system. A study was carried out on six local isolates of Giardia duodenalis (110, 7304, 6304, M007, 2002 and 6307) from faeces of Orang Asli patients admitted to the Gombak Hospital. WB, a reference pathogenic strain from human and G. muris from a wild mouse, were commercially obtained from the American Type Culture Collection (ATCC). All the isolates were cultured axenically in TYI-S-33 medium. Two sets of primers were used for the techniques: primers LP1 and RP1 and primers LP2 and RP2. The sets of primers amplified giardine gene of 171 bp and 218 bp in sizes respectively. The study showed that the two sets of primers could detect G. duodenalis to the genus and species level specifically.

Molecular diagnosis of cryptococcal meningitis in cerebrospinal fluid: comparison of primer sets for Cryptococcus neoformans and Cryptococcus gattii species complex.

PubMed

Martins, Marilena dos Anjos; Brighente, Kate Bastos Santos; Matos, Terezinha Aparecida de; Vidal, Jose Ernesto; Hipólito, Daise Damaris Carnietto de; Pereira-Chioccola, Vera Lucia

2015-01-01

This study evaluated the use of polymerase chain reaction for cryptococcal meningitis diagnosis in clinical samples. The sensitivity and specificity of the methodology were evaluated using eight Cryptococcus neoformans/C. gattii species complex reference strains and 165 cerebrospinal fluid samples from patients with neurological diseases divided into two groups: 96 patients with cryptococcal meningitis and AIDS; and 69 patients with other neurological opportunistic diseases (CRL/AIDS). Two primer sets were tested (CN4-CN5 and the multiplex CNa70S-CNa70A/CNb49S-CNb-49A that amplify a specific product for C. neoformans and another for C. gattii). CN4-CN5 primer set was positive in all Cryptococcus standard strains and in 94.8% in DNA samples from cryptococcal meningitis and AIDS group. With the multiplex, no 448-bp product of C. gattii was observed in the clinical samples of either group. The 695bp products of C. neoformans were observed only in 64.6% of the cryptococcal meningitis and AIDS group. This primer set was negative for two standard strains. The specificity based on the negative samples from the CTL/AIDS group was 98.5% in both primer sets. These data suggest that the CN4/CN5 primer set was highly sensitive for the identification of C. neoformans/C. gattii species complex in cerebrospinal fluid samples from patients with clinical suspicion of cryptococcal meningitis. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants.

PubMed

Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da

2016-07-15

Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.

Development of a Multiplex PCR Method to Detect Fungal Pathogens for Quarantine on Exported Cacti

PubMed Central

Cho, Hyun ji; Hong, Seong Won; Kim, Hyun-ju; Kwak, Youn-Sig

2016-01-01

Major diseases in grafted cacti have been reported and Fusarium oxysporum, Bipolaris cactivora, Phytophthora spp. and Collectotrichum spp. are known as causal pathogens. These pathogens can lead to plant death after infection. Therefore, some European countries have quarantined imported cacti that are infected with specific fungal pathogens. Consequently, we developed PCR detection methods to identify four quarantined fungal pathogens and reduce export rejection rates of Korean grafted cacti. The pathogen specific primer sets F.oF-F.oR, B.CF-B.CR, P.nF-P.nR, and P.cF-P.CR were tested for F. oxysporum, B. cactivora, P. nicotinae, and P. cactorum, respectively. The F.oF-F.oR primer set was designed from the Fusarium ITS region; the B.CF-B.CR and P.nF-P.nR primers respectively from Bipolaris and Phytophthora ITS1; and the P.cF-P.CR primer set from the Ypt1protein gene region. The quarantine fungal pathogen primer pairs were amplified to the specific number of base pairs in each of the following fungal pathogens: 210-bp (F. oxysporum), 510-bp (B. cactivora), 313-bp (P. nicotinae), and 447-bp (P. cactorum). The detection limit for the mono- and multiplex PCR primer sets was 0.1 ng of template DNA under in vitro conditions. Therefore, each primer set successfully diagnosed contamination of quarantine pathogens in export grafted cacti. Consequently, our methodology is a viable tool to screen contamination of the fungal pathogen in exported grafted cacti. PMID:26889115

Novel priming and crosslinking systems for use with isocyanatomethacrylate dental adhesives.

PubMed

Chappelow, C C; Power, M D; Bowles, C Q; Miller, R G; Pinzino, C S; Eick, J D

2000-11-01

(a) to design, formulate and evaluate prototype primers and a crosslinking agent for use with isocyanatomethacrylate-based comonomer adhesives and (b) to establish correlations between bond strength and solubility parameter differences between the adhesives and etched dentin, and the permeability coefficients of the adhesives. Equimolar mixtures of 2-isocyanatoethyl methacrylate (IEM) and a methacrylate comonomer were formulated with tri-n-butyl borane oxide (TBBO) as the free radical initiator to have cure times of 6-10 min. Shear bond strengths to dentin were determined for each adhesive mixture (n = 7) using standard testing protocols. Shear bond strengths for the three systems were also determined after application of "reactive primers" to the dentin surface. The "reactive primers" contained 10-20 parts by weight of the respective comonomer mixture and 3.5 parts by weight TBBO in acetone. Solubility parameters difference values (delta delta) and permeability coefficients (P) were approximated for each adhesive system and correlated with shear bond strength values. Additionally, a crosslinking agent was prepared by bulk reaction of an equimolar mixture containing IEM and a methacrylate comonomer. The effects of crosslinker addition on: (a) the setting time of IEM; and (b) the setting times and initiator requirements of selected IEM/comonomer mixtures were determined. Shear bond strength values (MPa): IEM/HEMA 13.6 +/- 2.0 (no primer), 20.1 +/- 2.0 (with primer); IEM/HETMA 9.3 +/- 3.3 (no primer), 20.8 +/- 8.1 (with primer); IEM/AAEMA 13.6 +/- 1.9 (no primer), 17.3 +/- 3.2 (with primer). Also, approximated permeability coefficients showed a significant correlation (r = +0.867, p < 0.001) with shear bond strength values. Crosslinker addition studies with IEM/4-META: (a) at 5-9 mol% reduced the setting time of IEM polymerization by 79%; and (b) at 6 mol% reduced initiator level requirements 60-70% to achieve a comparable setting time, and decreased setting times by ca. 75% for a given initiator level with selected IEM/methacrylate adhesive systems. The shear bond strengths of isocyanatomethacrylate-based dental adhesives can be enhanced by using reactive primers; their setting times and initiator requirements can be improved using a dimethacrylate crosslinker. Approximated permeability coefficients may be useful as indicators of bonding performance for dentin adhesive systems.

Evaluation of new gyrB-based real-time PCR system for the detection of B. fragilis as an indicator of human-specific fecal contamination.

PubMed

Lee, Chang Soo; Lee, Jiyoung

2010-09-01

A rapid and specific gyrB-based real-time PCR system has been developed for detecting Bacteroides fragilis as a human-specific marker of fecal contamination. Its specificity and sensitivity was evaluated by comparison with other 16S rRNA gene-based primers using closely related Bacteroides and Prevotella. Many studies have used 16S rRNA gene-based method targeting Bacteroides because this genus is relatively abundant in human feces and is useful for microbial source tracking. However, 16S rRNA gene-based primers are evolutionarily too conserved among taxa to discriminate between human-specific species of Bacteroides and other closely related genera, such as Prevotella. Recently, one of the housekeeping genes, gyrB, has been used as an alternative target in multilocus sequence analysis (MLSA) to provide greater phylogenetic resolution. In this study, a new B. fragilis-specific primer set (Bf904F/Bf958R) was designed by alignments of 322 gyrB genes and was compared with the performance of the 16S rRNA gene-based primers in the presence of B. fragilis, Bacteroides ovatus and Prevotella melaninogenica. Amplicons were sequenced and a phylogenetic tree was constructed to confirm the specificity of the primers to B. fragilis. The gyrB-based primers successfully discriminated B. fragilis from B. ovatus and P. melaninogenica. Real-time PCR results showed that the gyrB primer set had a comparable sensitivity in the detection of B. fragilis when compared with the 16S rRNA primer set. The host-specificity of our gyrB-based primer set was validated with human, pig, cow, and dog fecal samples. The gyrB primer system had superior human-specificity. The gyrB-based system can rapidly detect human-specific fecal source and can be used for improved source tracking of human contamination. (c) 2010 Elsevier B.V. All rights reserved.

Use of Sequence-Independent, Single-Primer-Amplification (SISPA) for rapid detection, identification, and characterization of avian RNA viruses

USDA-ARS?s Scientific Manuscript database

Current technologies with next generation sequencing have revolutionized metagenomics analysis of clinical samples. To achieve the non-selective amplification and recovery of low abundance genetic sequences, a simplified Sequence-Independent, Single-Primer Amplification (SISPA) technique in combinat...

Forensic SNP genotyping with SNaPshot: Technical considerations for the development and optimization of multiplexed SNP assays.

PubMed

Fondevila, M; Børsting, C; Phillips, C; de la Puente, M; Consortium, Euroforen-NoE; Carracedo, A; Morling, N; Lareu, M V

2017-01-01

This review explores the key factors that influence the optimization, routine use, and profile interpretation of the SNaPshot single-base extension (SBE) system applied to forensic single-nucleotide polymorphism (SNP) genotyping. Despite being a mainly complimentary DNA genotyping technique to routine STR profiling, use of SNaPshot is an important part of the development of SNP sets for a wide range of forensic applications with these markers, from genotyping highly degraded DNA with very short amplicons to the introduction of SNPs to ascertain the ancestry and physical characteristics of an unidentified contact trace donor. However, this technology, as resourceful as it is, displays several features that depart from the usual STR genotyping far enough to demand a certain degree of expertise from the forensic analyst before tackling the complex casework on which SNaPshot application provides an advantage. In order to provide the basis for developing such expertise, we cover in this paper the most challenging aspects of the SNaPshot technology, focusing on the steps taken to design primer sets, optimize the PCR and single-base extension chemistries, and the important features of the peak patterns observed in typical forensic SNP profiles using SNaPshot. With that purpose in mind, we provide guidelines and troubleshooting for multiplex-SNaPshot-oriented primer design and the resulting capillary electrophoresis (CE) profile interpretation (covering the most commonly observed artifacts and expected departures from the ideal conditions). Copyright © 2017 Central Police University.

Development of universal genetic markers based on single-copy orthologous (COSII) genes in Poaceae.

PubMed

Liu, Hailan; Guo, Xiaoqin; Wu, Jiasheng; Chen, Guo-Bo; Ying, Yeqing

2013-03-01

KEY MESSAGE : We develop a set of universal genetic markers based on single-copy orthologous (COSII) genes in Poaceae. Being evolutionary conserved, single-copy orthologous (COSII) genes are particularly useful in comparative mapping and phylogenetic investigation among species. In this study, we identified 2,684 COSII genes based on five sequenced Poaceae genomes including rice, maize, sorghum, foxtail millet, and brachypodium, and then developed 1,072 COSII markers whose transferability and polymorphism among five bamboo species were further evaluated with 46 pairs of randomly selected primers. 91.3 % of the 46 primers obtained clear amplification in at least one bamboo species, and 65.2 % of them produced polymorphism in more than one species. We also used 42 of them to construct the phylogeny for the five bamboo species, and it might reflect more precise evolutionary relationship than the one based on the vegetative morphology. The results indicated a promising prospect of applying these markers to the investigation of genetic diversity and the classification of Poaceae. To ease and facilitate access of the information of common interest to readers, a web-based database of the COSII markers is provided ( http://www.sicau.edu.cn/web/yms/PCOSWeb/PCOS.html ).

Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

PubMed

Cheng, Yu-Huei

2014-12-01

Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

Combined in vitro transcription and reverse transcription to amplify and label complex synthetic oligonucleotide probe libraries.

PubMed

Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-Ting; Gulari, Erdogan; Rouillard, Jean-Marie

2015-06-01

Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection-based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization.

A comparative genomics strategy for targeted discovery of single-nucleotide polymorphisms and conserved-noncoding sequences in orphan crops.

PubMed

Feltus, F A; Singh, H P; Lohithaswa, H C; Schulze, S R; Silva, T D; Paterson, A H

2006-04-01

Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species.

A Comparative Genomics Strategy for Targeted Discovery of Single-Nucleotide Polymorphisms and Conserved-Noncoding Sequences in Orphan Crops1[W

PubMed Central

Feltus, F.A.; Singh, H.P.; Lohithaswa, H.C.; Schulze, S.R.; Silva, T.D.; Paterson, A.H.

2006-01-01

Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species. PMID:16607031

Development of a quantitative fluorescence single primer isothermal amplification-based method for the detection of Salmonella.

PubMed

Wang, Jianchang; Li, Rui; Hu, Lianxia; Sun, Xiaoxia; Wang, Jinfeng; Li, Jing

2016-02-16

Food-borne disease caused by Salmonella has long been, and continues to be, an important global public health problem, necessitating rapid and accurate detection of Salmonella in food. Real time PCR is the most recently developed approach for Salmonella detection. Single primer isothermal amplification (SPIA), a novel gene amplification technique, has emerged as an attractive microbiological testing method. SPIA is performed under a constant temperature, eliminating the need for an expensive thermo-cycler. In addition, SPIA reactions can be accomplished in 30 min, faster than real time PCR that usually takes over 2h. We developed a quantitative fluorescence SPIA-based method for the detection of Salmonella. Using Salmonella Typhimurium genomic DNA as template and a primer targeting Salmonella invA gene, we showed the detection limit of SPIA was 2.0 × 10(1)fg DNA. Its successful amplification of different serotypic Salmonella genomic DNA but not non-Salmonella bacterial DNA demonstrated the specificity of SPIA. Furthermore, this method was validated with artificially contaminated beef. In conclusion, we showed high sensitivity and specificity of SPIA in the detection of Salmonella, comparable to real time PCR. In addition, SPIA is faster and more cost-effective (non-use of expensive cyclers), making it a potential alternative for field detection of Salmonella in resource-limited settings that are commonly encountered in developing countries. Copyright © 2015 Elsevier B.V. All rights reserved.

Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays.

PubMed

Kimura, Yasumasa; Soma, Takahiro; Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J L; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias

2016-01-01

Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download.

Pitfalls in genetic testing: a case of a SNP in primer-annealing region leading to allele dropout in BRCA1.

PubMed

Silva, Felipe Carneiro; Torrezan, Giovana Tardin; Brianese, Rafael Canfield; Stabellini, Raquel; Carraro, Dirce Maria

2017-07-01

Hereditary breast and ovarian cancer is characterized by mutations in BRCA1 or BRCA2 genes and PCR-based screening techniques, such as capillary sequencing and next-generation sequencing (NGS), are considered gold standard methods for detection of pathogenic mutations in these genes. Single-nucleotide polymorphisms (SNPs) constitute a vast source of variation in the human genome and represent a risk for misdiagnosis in genetic testing, since the presence of a SNP in primer-annealing sites may cause false negative results due to allele dropout. However, few reports are available and the frequency of this phenomenon in diagnostic assays remains unknown. In this article, we investigated the causes of a false negative capillary sequencing result in BRCA1 involving a mother-daughter dyad. Using several molecular strategies, including different DNA polymerases, primer redesign, allele-specific PCR and NGS, we established that the initial misdiagnosis was caused by a SNP located in the primer-annealing region, leading to allele dropout of the mutated allele. Assuming that this problem can also occur in any PCR-based method that are widely used in diagnostic settings, the clinical report presented here draws attention for one of the limitations of genetic testing in general, for which medical and laboratory communities need to be aware.

Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays

PubMed Central

Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J. L.; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias

2016-01-01

Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download. PMID:26863543

Molecular method for determining sex of walruses

USGS Publications Warehouse

Fischbach, Anthony S.; Jay, C.V.; Jackson, J.V.; Andersen, L.W.; Sage, G.K.; Talbot, S.L.

2008-01-01

We evaluated the ability of a set of published trans-species molecular sexing primers and a set of walrus-specific primers, which we developed, to accurately identify sex of 235 Pacific walruses (Odobenus rosmarus divergens). The trans-species primers were developed for mammals and targeted the X- and Y-gametologs of the zinc finger protein genes (ZFX, ZFY). We extended this method by using these primers to obtain sequence from Pacific and Atlantic walrus (0. r. rosmarus) ZFX and ZFY genes to develop new walrus-specific primers, which yield polymerase chain reaction products of distinct lengths (327 and 288 base pairs from the X- and Y-chromosome, respectively), allowing them to be used for sex determination. Both methods yielded a determination of sex in all but 1-2% of samples with an accuracy of 99.6-100%. Our walrus-specific primers offer the advantage of small fragment size and facile application to automated electrophoresis and visualization.

Detection and characterization of recombinant DNA expressing vip3A-type insecticidal gene in GMOs--standard single, multiplex and construct-specific PCR assays.

PubMed

Singh, Chandra K; Ojha, Abhishek; Bhatanagar, Raj K; Kachru, Devendra N

2008-01-01

Vegetative insecticidal protein (Vip), a unique class of insecticidal protein, is now part of transgenic plants for conferring resistance against lepidopteron pests. In order to address the imminent regulatory need for detection and labeling of vip3A carrying genetically modified (GM) products, we have developed a standard single PCR and a multiplex PCR assay. As far as we are aware, this is the first report on PCR-based detection of a vip3A-type gene (vip-s) in transgenic cotton and tobacco. Our assay involves amplification of a 284-bp region of the vip-s gene. This assay can possibly detect as many as 20 natural wild-type isolates bearing a vip3A-like gene and two synthetic genes of vip3A in transgenic plants. The limit of detection as established by our assay for GM trait (vip-s) is 0.1%. Spiking with nontarget DNA originating from diverse plant sources had no inhibitory effect on vip-s detection. Since autoclaving of vip-s bearing GM leaf samples showed no deterioration/interference in detection efficacy, the assay seems to be suitable for processed food products as well. The vip-s amplicon identity was reconfirmed by restriction endonuclease assay. The primer set for vip-s was equally effective in a multiplex PCR assay format (duplex, triplex and quadruplex), used in conjunction with the primer sets for the npt-II selectable marker gene, Cauliflower mosaic virus 35S promoter and nopaline synthetase terminator, enabling concurrent detection of the transgene, regulatory sequences and marker gene. Further, the entire transgene construct was amplified using the forward primer of the promoter and the reverse primer of the terminator. The resultant amplicon served as a template for nested PCR to confirm the construct integrity. The method is suitable for screening any vip3A-carrying GM plant and food. The availability of a reliable PCR assay method prior to commercial release of vip3A-based transgenic crops and food would facilitate rapid and efficient regulatory compliance.

A novel archaeal group in the phylum Crenarchaeota found unexpectedly in an eukaryotic survey in the Cariaco Basin.

PubMed

Jeon, Sun-Ok; Ahn, Tae-Seok; Hong, Sun-Hee

2008-02-01

Archaea have been found in many more diverse habitats than previously believed due in part to modern molecular approaches to discovering microbial diversity. We report here an unexpected expansion of the habitat diversity of the Archaea in the Cariaco Basin we found using a primer set designed for 18S eukaryotic rDNA sequence analysis. The results presented here expand the originally identified 9 archaeal clones reported in this environment using bacterial/archaeal primers to 152 archaeal clones: 67 (18 OTU) of these clones were found at a depth of 900 m of station A while 71 (9 OTU) of them were at a depth of between 300 approximately 335 m of station B&C depending upon which location the samples were taken. We used three phylogenetic analysis methods and detected 20 phylotypes belonging to a single previously unreported group distantly related to the Crenarchaeota. Also, we determined that the original nine sequences did not fall into any of the known phyla of the Archaea suggesting that they may represent a novel group within the Kingdom Archaea. Thus, from these two studies, we suggest that Archaea in the Cariaco Basin could be unique; however, further studies using archaeal-specific primers and the design of new primers as well as the systematic use of several different primer combinations may improve the chances of understanding the archeal diversity in the Cariaco Basin.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meagher, Robert J.; Ball, Cameron Scott; Langevin, Stanley A.

In this study, collection of mosquitoes and testing for vector-borne viruses is a key surveillance activity that directly influences the vector control efforts of public health agencies, including determining when and where to apply insecticides. Vector control districts in California routinely monitor for three human pathogenic viruses including West Nile virus (WNV), Western equine encephalitis virus (WEEV), and St. Louis encephalitis virus (SLEV). Reverse transcription quantitative polymerase chain reaction (RT-qPCR) offers highly sensitive and specific detection of these three viruses in a single multiplex reaction, but this technique requires costly, specialized equipment that is generally only available in centralized publicmore » health laboratories. We report the use of reverse transcription loop-mediated isothermal amplification (RT-LAMP) to detect WNV, WEEV, and SLEV RNA extracted from pooled mosquito samples collected in California, including novel primer sets for specific detection of WEEV and SLEV, targeting the nonstructural protein 4 (nsP4) gene of WEEV and the 3’ untranslated region (3’-UTR) of SLEV. Our WEEV and SLEV RT-LAMP primers allowed detection of <0.1 PFU/reaction of their respective targets in <30 minutes, and exhibited high specificity without cross reactivity when tested against a panel of alphaviruses and flaviviruses. Furthermore, the SLEV primers do not cross-react with WNV, despite both viruses being closely related members of the Japanese encephalitis virus complex. The SLEV and WEEV primers can also be combined in a single RT-LAMP reaction, with discrimination between amplicons by melt curve analysis. Although RT-qPCR is approximately one order of magnitude more sensitive than RT-LAMP for all three targets, the RT-LAMP technique is less instrumentally intensive than RT-qPCR and provides a more cost-effective method of vector-borne virus surveillance.« less

Surveillance for Western Equine Encephalitis, St. Louis Encephalitis, and West Nile Viruses Using Reverse Transcription Loop-Mediated Isothermal Amplification

PubMed Central

Wheeler, Sarah S.; Ball, Cameron S.; Langevin, Stanley A.; Fang, Ying; Coffey, Lark L.; Meagher, Robert J.

2016-01-01

Collection of mosquitoes and testing for vector-borne viruses is a key surveillance activity that directly influences the vector control efforts of public health agencies, including determining when and where to apply insecticides. Vector control districts in California routinely monitor for three human pathogenic viruses including West Nile virus (WNV), Western equine encephalitis virus (WEEV), and St. Louis encephalitis virus (SLEV). Reverse transcription quantitative polymerase chain reaction (RT-qPCR) offers highly sensitive and specific detection of these three viruses in a single multiplex reaction, but this technique requires costly, specialized equipment that is generally only available in centralized public health laboratories. We report the use of reverse transcription loop-mediated isothermal amplification (RT-LAMP) to detect WNV, WEEV, and SLEV RNA extracted from pooled mosquito samples collected in California, including novel primer sets for specific detection of WEEV and SLEV, targeting the nonstructural protein 4 (nsP4) gene of WEEV and the 3’ untranslated region (3’-UTR) of SLEV. Our WEEV and SLEV RT-LAMP primers allowed detection of <0.1 PFU/reaction of their respective targets in <30 minutes, and exhibited high specificity without cross reactivity when tested against a panel of alphaviruses and flaviviruses. Furthermore, the SLEV primers do not cross-react with WNV, despite both viruses being closely related members of the Japanese encephalitis virus complex. The SLEV and WEEV primers can also be combined in a single RT-LAMP reaction, with discrimination between amplicons by melt curve analysis. Although RT-qPCR is approximately one order of magnitude more sensitive than RT-LAMP for all three targets, the RT-LAMP technique is less instrumentally intensive than RT-qPCR and provides a more cost-effective method of vector-borne virus surveillance. PMID:26807734

Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

PubMed

Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

2004-10-15

This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

In-planta detection and monitorization of endophytic colonization by a Beauveria bassiana strain using a new-developed nested and quantitative PCR-based assay and confocal laser scanning microscopy.

PubMed

Landa, B B; López-Díaz, C; Jiménez-Fernández, D; Montes-Borrego, M; Muñoz-Ledesma, F J; Ortiz-Urquiza, A; Quesada-Moraga, E

2013-10-01

Beauveria bassiana strain 04/01-Tip obtained from larvae of the opium poppy stem gall Iraella luteipes endophytically colonizes opium poppy plants and protect it against this pest. Development of a specific, rapid and sensitive technique that allows accurately determining the process and factors leading to the establishment of this strain in opium poppy plants would be essential to achieve its efficient control in a large field scale. For that purpose in the present study, species-specific primers that can be used in conventional or quantitative PCR protocols were developed for specifically identification and detection of B. bassiana in plant tissues. The combination of the designed BB.fw/BB.rv primer set with the universal ITS1-F/ITS4 primer set in a two-step nested-PCR approach, has allowed the amplification of up to 10fg of B. bassiana. This represented an increase in sensitivity of 10000- and 1000-fold of detection than when using the BB.fw/BB.rv primers in a single or single-tube semi-nested PCR approaches, respectively. The BB.fw and BB.rv primer set were subsequently optimized to be used in real time quantitative PCR assays and allowed to accurately quantify B. bassiana DNA in different plant DNA backgrounds (leaves and seeds) without losing accuracy and efficiency. The qPCR protocol was used to monitor the endophytic colonization of opium poppy leaves byB. bassiana after inoculation with the strain EABb 04/01-Tip, detecting as low as 26fg of target DNA in leaves and a decrease in fungal biomass over time. PCR quantification data were supported in parallel with CLMS by the monitoring of spatial and temporal patterns of leaf and stem colonization using a GFP-tagged transformant of the B. bassiana EABb 04/01-Tip strain, which enabled to demonstrate that B. bassiana effectively colonizes aerial tissues of opium poppy plants mainly through intercellular spaces and even leaf trichomes. A decline in endophytic colonization was also observed by the last sampling times, i.e. from 10 to 15days after inoculation, although fungal structures still remained present in the leaf tissues. These newly developed molecular protocols should facilitate the detection, quantification and monitoring of endophytic B. bassiana strains in different tissues and host plants and would help to unravel the factors and process governing the specific endophytic association between opium poppy and strain EABb 04/01-Tip providing key insights to formulate a sustainable strategy for I. luteipes management in the host. Copyright © 2013 Elsevier Inc. All rights reserved.

Cytochrome cd1-containing nitrite reductase encoding gene nirS as a new functional biomarker for detection of anaerobic ammonium oxidizing (Anammox) bacteria.

PubMed

Li, Meng; Ford, Tim; Li, Xiaoyan; Gu, Ji-Dong

2011-04-15

A newly designed primer set (AnnirS), together with a previously published primer set (ScnirS), was used to detect anammox bacterial nirS genes from sediments collected from three marine environments. Phylogenetic analysis demonstrated that all retrieved sequences were clearly different from typical denitrifiers' nirS, but do group together with the known anammox bacterial nirS. Sequences targeted by ScnirS are closely related to Scalindua nirS genes recovered from the Peruvian oxygen minimum zone (OMZ), whereas sequences targeted by AnnirS are more closely affiliated with the nirS of Candidatus 'Kuenenia stuttgartiensis' and even form a new phylogenetic nirS clade, which might be related to other genera of the anammox bacteria. Analysis demonstrated that retrieved sequences had higher sequence identities (>60%) with known anammox bacterial nirS genes than with denitrifiers' nirS, on both nucleotide and amino acid levels. Compared to the 16S rRNA and hydrazine oxidoreductase (hzo) genes, the anammox bacterial nirS not only showed consistent phylogenetic relationships but also demonstrated more reliable quantification of anammox bacteria because of the single copy of the nirS gene in the anammox bacterial genome and the specificity of PCR primers for different genera of anammox bacteria, thus providing a suitable functional biomarker for investigation of anammox bacteria.

Transcriptome-Mining for Single-Copy Nuclear Markers in Ferns

PubMed Central

Rothfels, Carl J.; Larsson, Anders; Li, Fay-Wei; Sigel, Erin M.; Huiet, Layne; Burge, Dylan O.; Ruhsam, Markus; Graham, Sean W.; Stevenson, Dennis W.; Wong, Gane Ka-Shu; Korall, Petra; Pryer, Kathleen M.

2013-01-01

Background Molecular phylogenetic investigations have revolutionized our understanding of the evolutionary history of ferns—the second-most species-rich major group of vascular plants, and the sister clade to seed plants. The general absence of genomic resources available for this important group of plants, however, has resulted in the strong dependence of these studies on plastid data; nuclear or mitochondrial data have been rarely used. In this study, we utilize transcriptome data to design primers for nuclear markers for use in studies of fern evolutionary biology, and demonstrate the utility of these markers across the largest order of ferns, the Polypodiales. Principal Findings We present 20 novel single-copy nuclear regions, across 10 distinct protein-coding genes: ApPEFP_C, cryptochrome 2, cryptochrome 4, DET1, gapCpSh, IBR3, pgiC, SQD1, TPLATE, and transducin. These loci, individually and in combination, show strong resolving power across the Polypodiales phylogeny, and are readily amplified and sequenced from our genomic DNA test set (from 15 diploid Polypodiales species). For each region, we also present transcriptome alignments of the focal locus and related paralogs—curated broadly across ferns—that will allow researchers to develop their own primer sets for fern taxa outside of the Polypodiales. Analyses of sequence data generated from our genomic DNA test set reveal strong effects of partitioning schemes on support levels and, to a much lesser extent, on topology. A model partitioned by codon position is strongly favored, and analyses of the combined data yield a Polypodiales phylogeny that is well-supported and consistent with earlier studies of this group. Conclusions The 20 single-copy regions presented here more than triple the single-copy nuclear regions available for use in ferns. They provide a much-needed opportunity to assess plastid-derived hypotheses of relationships within the ferns, and increase our capacity to explore aspects of fern evolution previously unavailable to scientific investigation. PMID:24116189

Design and Evaluation of PCR Primers for Analysis of Bacterial Populations in Wine by Denaturing Gradient Gel Electrophoresis

PubMed Central

Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.

2003-01-01

Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643

DNA sequencing with pyrophosphatase

DOEpatents

Tabor, S.; Richardson, C.C.

1996-03-12

A kit or solution is disclosed for use in extension of an oligonucleotide primer having a first single-stranded region on a template molecule and having a second single-stranded region homologous to the first single-stranded region. The first agent is able to cause extension of the first single-stranded region of the primer on the second single-stranded region of the template in a reaction mixture. The second agent is able to reduce the amount of pyrophosphate in the reaction mixture below the amount produced during the extension in the absence of the second agent.

DNA sequencing with pyrophosphatase

DOEpatents

Tabor, Stanley; Richardson, Charles C.

1996-03-12

A kit or solution for use in extension of an oligonucleotide primer having a first single-stranded region on a template molecule having a second single-stranded region homologous to the first single-stranded region, comprising a first agent able to cause extension of the first single-stranded region of the primer on the second single-stranded region of the template in a reaction mixture, and a second agent able to reduce the amount of pyrophosphate in the reaction mixture below the amount produced during the extension in the absence of the second agent.

Development of a Novel, Rapid Multiplex Polymerase Chain Reaction Assay for the Detection and Differentiation of Salmonella enterica Serovars Enteritidis and Typhimurium Using Ultra-Fast Convection Polymerase Chain Reaction.

PubMed

Kim, Tae-Hoon; Hwang, Hyun Jin; Kim, Jeong Hee

2017-10-01

Salmonella enterica serovars Enteritidis and Typhimurium are the most common causative agents of human nontyphoidal salmonellosis. The rapid detection and timely treatment of salmonellosis are important to increase the curative ratio and prevent spreading of the disease. In this study, we developed a rapid multiplex convection polymerase chain reaction (PCR) method to detect Salmonella spp. and differentiate Salmonella Enteritidis and Salmonella Typhimurium. We used the invA gene for Salmonella spp. detection. Salmonella Enteritidis-specific primers and Salmonella Typhimurium-specific primers were designed using the insertion element (IE) and spy genes, respectively. The primer set for Salmonella spp. detection clearly detected both Salmonella Enteritidis and Salmonella Typhimurium after a 21-min amplification reaction. Serovar-specific primer sets for Salmonella Enteritidis and Salmonella Typhimurium specifically detected each target species in a 21-min amplification reaction. We were able to detect Salmonella spp. at a single copy level in the singleplex mode. The limits of detection for Salmonella Enteritidis and Salmonella Typhimurium were 30 copies in both the singleplex and multiplex modes. The PCR run time could be reduced to 10.5 min/15 cycles. The multiplex convection PCR method developed in this study could detect the Salmonella spp. Salmonella Enteritidis and Salmonella Typhimurium in artificially contaminated milk with as few as 10 0 colony-forming unit/mL after 4-h enrichment. The PCR assay developed in this study provides a rapid, specific, and sensitive method for the detection of Salmonella spp. and the differentiation of Salmonella Enteritidis and Salmonella Typhimurium.

Use of a Hierarchical Oligonucleotide Primer Extension Approach for Multiplexed Relative Abundance Analysis of Methanogens in Anaerobic Digestion Systems

PubMed Central

Chuang, Hui-Ping; Hsu, Mao-Hsuan; Chen, Wei-Yu

2013-01-01

In this study, we established a rapid multiplex method to detect the relative abundances of amplified 16S rRNA genes from known cultivatable methanogens at hierarchical specificities in anaerobic digestion systems treating industrial wastewater and sewage sludge. The method was based on the hierarchical oligonucleotide primer extension (HOPE) technique and combined with a set of 27 primers designed to target the total archaeal populations and methanogens from 22 genera within 4 taxonomic orders. After optimization for their specificities and detection sensitivity under the conditions of multiple single-nucleotide primer extension reactions, the HOPE approach was applied to analyze the methanogens in 19 consortium samples from 7 anaerobic treatment systems (i.e., 513 reactions). Among the samples, the methanogen populations detected with order-level primers accounted for >77.2% of the PCR-amplified 16S rRNA genes detected using an Archaea-specific primer. The archaeal communities typically consisted of 2 to 7 known methanogen genera within the Methanobacteriales, Methanomicrobiales, and Methanosarcinales and displayed population dynamic and spatial distributions in anaerobic reactor operations. Principal component analysis of the HOPE data further showed that the methanogen communities could be clustered into 3 distinctive groups, in accordance with the distribution of the Methanosaeta, Methanolinea, and Methanomethylovorans, respectively. This finding suggested that in addition to acetotrophic and hydrogenotrophic methanogens, the methylotrophic methanogens might play a key role in the anaerobic treatment of industrial wastewater. Overall, the results demonstrated that the HOPE approach is a specific, rapid, and multiplexing platform to determine the relative abundances of targeted methanogens in PCR-amplified 16S rRNA gene products. PMID:24077716

Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

PubMed

Galkiewicz, Julia P; Kellogg, Christina A

2008-12-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

PubMed Central

Galkiewicz, Julia P.; Kellogg, Christina A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

Sensitivity of different Trypanosoma vivax specific primers for the diagnosis of livestock trypanosomosis using different DNA extraction methods.

PubMed

Gonzales, J L; Loza, A; Chacon, E

2006-03-15

There are several T. vivax specific primers developed for PCR diagnosis. Most of these primers were validated under different DNA extraction methods and study designs leading to heterogeneity of results. The objective of the present study was to validate PCR as a diagnostic test for T. vivax trypanosomosis by means of determining the test sensitivity of different published specific primers with different sample preparations. Four different DNA extraction methods were used to test the sensitivity of PCR with four different primer sets. DNA was extracted directly from whole blood samples, blood dried on filter papers or blood dried on FTA cards. The results showed that the sensitivity of PCR with each primer set was highly dependant of the sample preparation and DNA extraction method. The highest sensitivities for all the primers tested were determined using DNA extracted from whole blood samples, while the lowest sensitivities were obtained when DNA was extracted from filter paper preparations. To conclude, the obtained results are discussed and a protocol for diagnosis and surveillance for T. vivax trypanosomosis is recommended.

Design factors that influence PCR amplification success of cross-species primers among 1147 mammalian primer pairs

PubMed Central

Housley, Donna JE; Zalewski, Zachary A; Beckett, Stephanie E; Venta, Patrick J

2006-01-01

Background Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported), we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species) used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. Results The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6–8% decrease per mismatch in a primer pair), the GC-content within the amplified region (for the dog, GC ≥ 50%, 56.9% amplified; GC<50%, 74.2% amplified), the degree of protein conservation (R2 = 0.14) and the relatedness of the target species to the index species. For the dog, 598 products of 930 primer pairs (64.3%) (excluding primers in which dog was an index species) were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9%) produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. Conclusion The most important factors influencing the proportion of successful amplifications are the number of index species mismatches, GC-richness of the target amplimer, and the relatedness of the target species to the index species, at least under the single PCR condition used. The 1147 cross-species primer pairs can be used in a high throughput manner to generate data for studies on the genetics and genomics of non-sequenced mammalian genomes. PMID:17029642

[Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene].

PubMed

Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong

2014-06-01

To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

Evaluation of different PCR primers for denaturing gradient gel electrophoresis (DGGE) analysis of fungal community structure in traditional fermentation starters used for Hong Qu glutinous rice wine.

PubMed

Lv, Xu-Cong; Jiang, Ya-Jun; Liu, Jie; Guo, Wei-Ling; Liu, Zhi-Bin; Zhang, Wen; Rao, Ping-Fan; Ni, Li

2017-08-16

Denaturing gradient gel electrophoresis (DGGE) has become a widely used tool to examine microbial community structure. However, when DGGE is applied to evaluate the fungal community of traditional fermentation starters, the choice of hypervariable ribosomal RNA gene regions is still controversial. In the current study, several previously published fungal PCR primer sets were compared and evaluated using PCR-DGGE, with the purpose of screening a suitable primer set to study the fungal community of traditional fermentation starters for Hong Qu glutinous rice wine. Firstly, different primer sets were used to amplify different hypervariable regions from pure fungal cultures. Except NS1/FR1+ and ITS1fGC/ITS4, other primer sets (NL1+/LS2R, NL3A/NL4GC, FF390/FR1+, NS1/GCFung, NS3+/YM951r and ITS1fGC/ITS2r) amplified the target DNA sequences successfully. Secondly, the selected primer sets were further evaluated based on their resolution to distinguish different fungal cultures through DGGE fingerprints. Three primer sets (NL1+/LS2R, NS1/GCFung and ITS1fGC/ITS2r) were finally selected for investigating the fungal community structure of different traditional fermentation starters for Hong Qu glutinous rice wine. The internal transcribed spacer (ITS) region amplified by ITS1fGC/ITS2r, which is more hypervariable than the 18S rRNA gene and 26S rRNA gene, provides an excellent tool to separate amplification products of different fungal species. Results indicated that PCR-DGGE profile using ITS1fGC/ITS2r showed more abundant fungal species than that using NL1+/LS2R and NS1/GCFung. Therefore, ITS1fGC/ITS2r is the most suitable primer set for PCR-DGGE analysis of fungal community structure in traditional fermentation starters for Hong Qu glutinous rice wine. DGGE profiles based on ITS1fGC/ITS2r revealed the presence of twenty-four fungal species in traditional fermentation starter. A significant difference of fungal community can be observed directly from DGGE fingerprints and principal component analysis. The statistical analysis results based on the band intensities of fungal DGGE profile showed that Saccharomyces cerevisiae, Saccharomycopsis fibuligera, Rhizopus oryzae, Monascus purpureus and Aspergillus niger were the dominant fungal species. In conclusion, the comparison of several primer sets for fungal PCR-DGGE would be useful to enrich our knowledge of the fungal community structures associated with traditional fermentation starters, which may facilitate the development of better starter cultures for manufacturing Chinese Hong Qu glutinous rice wine. Copyright © 2017 Elsevier B.V. All rights reserved.

Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

PubMed

Kalendar, Ruslan; Lee, David; Schulman, Alan H

2011-08-01

The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.

Detection of fumonisin producing Fusarium verticillioides in paddy (Oryza sativa L.) using polymerase chain reaction (PCR)

PubMed Central

Maheshwar, P.K.; Moharram, S. Ahmed; Janardhana, G.R.

2009-01-01

The study reports the occurrence of fumonisin producing Fusarium verticillioides in 90 samples of stored paddy (Oryza sativa L.) collected from different geographical regions of Karnataka, India. Fumonisin producing F. verticillioides was identified based on micromorphological characteristics and PCR using two sets of primers. One set of primers was F. verticillioides species specific, which selectively amplified the intergenic space region of rDNA. The other set of primers was specific to fumonisin producing F. verticillioides. Eight paddy samples were positive for F. verticillioides. Eleven isolates obtained from these samples were capable of producing fumonisin. PMID:24031332

A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms

PubMed Central

Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.

2003-01-01

A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708

Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

PubMed

Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

2009-10-28

GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.

Rapid detection of avian influenza virus a and subtype H5N1 by single step multiplex reverse transcription-polymerase chain reaction.

PubMed

Wei, Hui-Ling; Bai, Gui-Rong; Mweene, Aaron S; Zhou, Ying-Chun; Cong, Yan-Long; Pu, Juan; Wang, Shuai; Kida, Hiroshi; Liu, Jin-Hua

2006-06-01

Outbreaks of H5N1 highly pathogenic avian influenza (HPAI) virus caused great economic losses to the poultry industry and resulted in human deaths in Thailand and Viet Nam in 2004. Rapid typing and subtyping of H5N1 viruses, especially from clinical specimens, are desirable for taking prompt control measures to prevent the spread of the disease. Here, we developed a set of oligonucleotide primers able to detect, type and subtype H5 and N1 influenza viruses in a single step multiplex reverse transcription-polymerase chain reaction (RT-PCR). RNA was extracted from allantoic fluid or from specimens with guanidinium isothiocyanate reagent. Reverse transcription and PCR were carried out with a mixture of primers specific for influenza viruses of type A, subtype H5 and N1 in a single reaction system under identical conditions. The amplified DNA fragments were analyzed by agarose gel electrophoresis. All the H5N1 viruses tested in the study and the experimental specimens presented three specific bands by the method established here. The results presented here suggest that the method described below is rapid and specific and, therefore, could be valuable in the rapid detection of H5N1 influenza viruses in clinics.

Null alleles and sequence variations at primer binding sites of STR loci within multiplex typing systems.

PubMed

Yao, Yining; Yang, Qinrui; Shao, Chengchen; Liu, Baonian; Zhou, Yuxiang; Xu, Hongmei; Zhou, Yueqin; Tang, Qiqun; Xie, Jianhui

2018-01-01

Rare variants are widely observed in human genome and sequence variations at primer binding sites might impair the process of PCR amplification resulting in dropouts of alleles, named as null alleles. In this study, 5 cases from routine paternity testing using PowerPlex ® 21 System for STR genotyping were considered to harbor null alleles at TH01, FGA, D5S818, D8S1179, and D16S539, respectively. The dropout of alleles was confirmed by using alternative commercial kits AGCU Expressmarker 22 PCR amplification kit and AmpFℓSTR ® . Identifiler ® Plus Kit, and sequencing results revealed a single base variation at the primer binding site of each STR locus. Results from the collection of previous reports show that null alleles at D5S818 were frequently observed in population detected by two PowerPlex ® typing systems and null alleles at D19S433 were mostly observed in Japanese population detected by two AmpFℓSTR™ typing systems. Furthermore, the most popular mutation type appeared the transition from C to T with G to A, which might have a potential relationship with DNA methylation. Altogether, these results can provide helpful information in forensic practice to the elimination of genotyping discrepancy and the development of primer sets. Copyright © 2017 Elsevier B.V. All rights reserved.

Alignment-free design of highly discriminatory diagnostic primer sets for Escherichia coli O104:H4 outbreak strains.

PubMed

Pritchard, Leighton; Holden, Nicola J; Bielaszewska, Martina; Karch, Helge; Toth, Ian K

2012-01-01

An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS) technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC) E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 'positive' E. coli O104:H4 outbreak and 32 'negative' non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high throughput primer design strategies will enable faster, more precise responses to future disease outbreaks of bacterial origin, and help to mitigate their societal impact.

Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

USGS Publications Warehouse

Galkiewicz, J.P.; Kellogg, C.A.

2008-01-01

PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

Software-supported USER cloning strategies for site-directed mutagenesis and DNA assembly.

PubMed

Genee, Hans Jasper; Bonde, Mads Tvillinggaard; Bagger, Frederik Otzen; Jespersen, Jakob Berg; Sommer, Morten O A; Wernersson, Rasmus; Olsen, Lars Rønn

2015-03-20

USER cloning is a fast and versatile method for engineering of plasmid DNA. We have developed a user friendly Web server tool that automates the design of optimal PCR primers for several distinct USER cloning-based applications. Our Web server, named AMUSER (Automated DNA Modifications with USER cloning), facilitates DNA assembly and introduction of virtually any type of site-directed mutagenesis by designing optimal PCR primers for the desired genetic changes. To demonstrate the utility, we designed primers for a simultaneous two-position site-directed mutagenesis of green fluorescent protein (GFP) to yellow fluorescent protein (YFP), which in a single step reaction resulted in a 94% cloning efficiency. AMUSER also supports degenerate nucleotide primers, single insert combinatorial assembly, and flexible parameters for PCR amplification. AMUSER is freely available online at http://www.cbs.dtu.dk/services/AMUSER/.

VizPrimer: a web server for visualized PCR primer design based on known gene structure.

PubMed

Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

2011-12-15

The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

Colorimetric molecular diagnosis of the HIV gag gene using DNAzyme and a complementary DNA-extended primer.

PubMed

Kim, Seong U; Batule, Bhagwan S; Mun, Hyoyoung; Byun, Ju-Young; Shim, Won-Bo; Kim, Min-Gon

2018-02-07

We have developed a novel strategy for the colorimetric detection of PCR products by utilizing a target-specific primer modified at the 5'-end with an anti-DNAzyme sequence. A single-stranded DNAzyme sequence folds into a G-quadruplex structure with hemin and shows strong peroxidase activity. When the complementary strand binds to the DNAzyme sequence, it blocks the formation of the G-quadraduplex structure and loses its peroxidase activity. In the presence of the target gene, PCR amplification proceeds, and anti-DNAzyme sequence modified primers present in the reaction mixture form a double strand through primer extension. Therefore, it does not block the DNAzyme sequence. Further, a colorimetric signal is generated by the addition of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and H 2 O 2 at the end of the reaction. We have successfully detected a single copy of the HIV type 1 gag gene in buffer and 10 copies in human serum. The strategy developed could be used to detect DNA and RNA in complex biological samples by simple primer designing that includes DNAzyme and a DNA extended primer.

Characterization of polymorphic microsatellites for the invasive grass Microstegium vimineum (Poaceae).

PubMed

Novy, Ari; Flory, S Luke; Honig, Joshua A; Bonos, Stacy; Hartman, Jean Marie

2012-02-01

Microsatellite markers were developed for the invasive plant Microstegium vimineum (Poaceae) to assess its population structure and to facilitate tracking of invasion expansion. Using 454 sequencing, 11 polymorphic and six monomorphic microsatellite primer sets were developed for M. vimineum. The primer sets were tested on individuals sampled from six populations in the United States and China. The polymorphic primers amplified di-, tri-, and tetranucleotide repeats with three to 10 alleles per locus. These markers will be useful for a variety of applications including tracking of invasion dynamics and population genetics studies.

Comparative analysis of Edwardsiella isolates from fish in the eastern United States identifies two distinct genetic taxa amongst organisms phenotypically classified as E. tarda

USGS Publications Warehouse

Griffin, Matt J.; Quiniou, Sylvie M.; Cody, Theresa; Tabuchi, Maki; Ware, Cynthia; Cipriano, Rocco C.; Mauel, Michael J.; Soto, Esteban

2013-01-01

Edwardsiella tarda, a Gram-negative member of the family Enterobacteriaceae, has been implicated in significant losses in aquaculture facilities worldwide. Here, we assessed the intra-specific variability of E. tarda isolates from 4 different fish species in the eastern United States. Repetitive sequence mediated PCR (rep-PCR) using 4 different primer sets (ERIC I & II, ERIC II, BOX, and GTG5) and multi-locus sequence analysis of 16S SSU rDNA, groEl, gyrA, gyrB, pho, pgi, pgm, and rpoA gene fragments identified two distinct genotypes of E. tarda (DNA group I; DNA group II). Isolates that fell into DNA group II demonstrated more similarity to E. ictaluri than DNA group I, which contained the reference E. tarda strain (ATCC #15947). Conventional PCR analysis using published E. tarda-specific primer sets yielded variable results, with several primer sets producing no observable amplification of target DNA from some isolates. Fluorometric determination of G + C content demonstrated 56.4% G + C content for DNA group I, 60.2% for DNA group II, and 58.4% for E. ictaluri. Surprisingly, these isolates were indistinguishable using conventional biochemical techniques, with all isolates demonstrating phenotypic characteristics consistent with E. tarda. Analysis using two commercial test kits identified multiple phenotypes, although no single metabolic characteristic could reliably discriminate between genetic groups. Additionally, anti-microbial susceptibility and fatty acid profiles did not demonstrate remarkable differences between groups. The significant genetic variation (<90% similarity at gyrA, gyrB, pho, phi and pgm; <40% similarity by rep-PCR) between these groups suggests organisms from DNA group II may represent an unrecognized, genetically distinct taxa of Edwardsiella that is phenotypically indistinguishable from E. tarda.

Development of multiplex PCR assay for authentication of Cornu Cervi Pantotrichum in traditional Chinese medicine based on cytochrome b and C oxidase subunit 1 genes.

PubMed

Gao, Lijun; Xia, Wei; Ai, Jinxia; Li, Mingcheng; Yuan, Guanxin; Niu, Jiamu; Fu, Guilian; Zhang, Lihua

2016-07-01

This study describes a method for discriminating the true Cervus antlers from its counterfeits using multiplex PCR. Bioinformatics were carried out to design the specific alleles primers for mitochondrial (mt) cytochrome b (Cyt b) and cytochrome C oxidase subunit 1 (Cox 1) genes. The mt DNA and genomic DNA were extracted from Cervi Cornu Pantotrichum through the modified alkaline and the salt-extracting method in addition to its counterfeits, respectively. Sufficient DNA templates were extracted from all samples used in two methods, and joint fragments of 354 bp and 543 bp that were specifically amplified from both of true Cervus antlers served as a standard control. The data revealed that the multiplex PCR-based assays using two primer sets can be used for forensic and quantitative identification of original Cervus deer products from counterfeit antlers in a single step.

PrecisePrimer: an easy-to-use web server for designing PCR primers for DNA library cloning and DNA shuffling.

PubMed

Pauthenier, Cyrille; Faulon, Jean-Loup

2014-07-01

PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Simple Identification of Human Taenia Species by Multiplex Loop-Mediated Isothermal Amplification in Combination with Dot Enzyme-Linked Immunosorbent Assay

PubMed Central

Nkouawa, Agathe; Sako, Yasuhito; Okamoto, Munehiro; Ito, Akira

2016-01-01

For differential detection of Taenia solium, Taenia saginata, and Taenia asiatica, loop-mediated isothermal amplification (LAMP) assay targeting the cytochrome c oxidase subunit 1 gene has been recently developed and shown to be sensitive, specific, and effective. However, to achieve differential identification, one specimen requires three reaction mixtures containing a primer set of each Taenia species separately, which is complex and time consuming and increases the risk of cross-contamination. In this study, we developed a simple differential identification of human Taenia species using multiplex LAMP (mLAMP) in combination with dot enzyme-linked immunosorbent assay (dot-ELISA). Forward inner primers of T. solium, T. saginata, and T. asiatica labeled with fluorescein isothiocyanate (FITC), digoxigenin (DIG), and tetramethylrhodamine (TAMRA), respectively, and biotin-labeled backward inner primers were used in mLAMP. The mLAMP assay succeeded in specific amplification of each respective target gene in a single tube. Furthermore, the mLAMP product from each species was easily distinguished by dot-ELISA with an antibody specific for FITC, DIG, or TAMRA. The mLAMP assay in combination with dot-ELISA will make identification of human Taenia species simpler, easier, and more practical. PMID:27044566

Primer-independent RNA sequencing with bacteriophage phi6 RNA polymerase and chain terminators.

PubMed

Makeyev, E V; Bamford, D H

2001-05-01

Here we propose a new general method for directly determining RNA sequence based on the use of the RNA-dependent RNA polymerase from bacteriophage phi6 and the chain terminators (RdRP sequencing). The following properties of the polymerase render it appropriate for this application: (1) the phi6 polymerase can replicate a number of single-stranded RNA templates in vitro. (2) In contrast to the primer-dependent DNA polymerases utilized in the sequencing procedure by Sanger et al. (Proc Natl Acad Sci USA, 1977, 74:5463-5467), it initiates nascent strand synthesis without a primer, starting the polymerization on the very 3'-terminus of the template. (3) The polymerase can incorporate chain-terminating nucleotide analogs into the nascent RNA chain to produce a set of base-specific termination products. Consequently, 3' proximal or even complete sequence of many target RNA molecules can be rapidly deduced without prior sequence information. The new technique proved useful for sequencing several synthetic ssRNA templates. Furthermore, using genomic segments of the bluetongue virus we show that RdRP sequencing can also be applied to naturally occurring dsRNA templates. This suggests possible uses of the method in the RNA virus research and diagnostics.

Multiplex real-time PCR assays for the identification of the potato cyst and tobacco cyst nematodes

USDA-ARS?s Scientific Manuscript database

TaqMan primer-probe sets were developed for the detection and identification of potato cyst nematodes (PCN) Globodera pallida and G. rostochiensis using two-tube, multiplex real-time PCR. One tube contained a primer-probe set specific for G. pallida (pale cyst nematode) multiplexed with another prim...

Novel Primer Sets for Next Generation Sequencing-Based Analyses of Water Quality

PubMed Central

Lee, Elvina; Khurana, Maninder S.; Whiteley, Andrew S.; Monis, Paul T.; Bath, Andrew; Gordon, Cameron; Ryan, Una M.; Paparini, Andrea

2017-01-01

Next generation sequencing (NGS) has rapidly become an invaluable tool for the detection, identification and relative quantification of environmental microorganisms. Here, we demonstrate two new 16S rDNA primer sets, which are compatible with NGS approaches and are primarily for use in water quality studies. Compared to 16S rRNA gene based universal primers, in silico and experimental analyses demonstrated that the new primers showed increased specificity for the Cyanobacteria and Proteobacteria phyla, allowing increased sensitivity for the detection, identification and relative quantification of toxic bloom-forming microalgae, microbial water quality bioindicators and common pathogens. Significantly, Cyanobacterial and Proteobacterial sequences accounted for ca. 95% of all sequences obtained within NGS runs (when compared to ca. 50% with standard universal NGS primers), providing higher sensitivity and greater phylogenetic resolution of key water quality microbial groups. The increased selectivity of the new primers allow the parallel sequencing of more samples through reduced sequence retrieval levels required to detect target groups, potentially reducing NGS costs by 50% but still guaranteeing optimal coverage and species discrimination. PMID:28118368

DOE Office of Scientific and Technical Information (OSTI.GOV)

Walters, William; Hyde, Embriette R.; Berg-Lyons, Donna

ABSTRACT Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of data sets amplified with varied primers requires attention. Here, we examined the performance of modified 16S rRNA gene and internal transcribed spacer (ITS) primers for archaea/bacteria and fungi, respectively, with nonaquatic samples. We moved primer bar codes to the 5′ end, allowing for a range of different 3′ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4 and 5 of the 16S rRNA gene. We additionally demonstrated that modifications tomore » the 515f/806r (variable region 4) 16S primer pair, which improves detection ofThaumarchaeotaand clade SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies. ImportanceWe continue to uncover a wealth of information connecting microbes in important ways to human and environmental ecology. As our scientific knowledge and technical abilities improve, the tools used for microbiome surveys can be modified to improve the accuracy of our techniques, ensuring that we can continue to identify groundbreaking connections between microbes and the ecosystems they populate, from ice caps to the human body. It is important to confirm that modifications to these tools do not cause new, detrimental biases that would inhibit the field rather than continue to move it forward. We therefore demonstrated that two recently modified primer pairs that target taxonomically discriminatory regions of bacterial and fungal genomic DNA do not introduce new biases when used on a variety of sample types, from soil to human skin. This confirms the utility of these primers for maintaining currently recommended microbiome research techniques as the state of the art.« less

A Hamiltonian approach to the planar optimization of mid-course corrections

NASA Astrophysics Data System (ADS)

Iorfida, E.; Palmer, P. L.; Roberts, M.

2016-04-01

Lawden's primer vector theory gives a set of necessary conditions that characterize the optimality of a transfer orbit, defined accordingly to the possibility of adding mid-course corrections. In this paper a novel approach is proposed where, through a polar coordinates transformation, the primer vector components decouple. Furthermore, the case when transfer, departure and arrival orbits are coplanar is analyzed using a Hamiltonian approach. This procedure leads to approximate analytic solutions for the in-plane components of the primer vector. Moreover, the solution for the circular transfer case is proven to be the Hill's solution. The novel procedure reduces the mathematical and computational complexity of the original case study. It is shown that the primer vector is independent of the semi-major axis of the transfer orbit. The case with a fixed transfer trajectory and variable initial and final thrust impulses is studied. The acquired related optimality maps are presented and analyzed and they express the likelihood of a set of trajectories to be optimal. Furthermore, it is presented which kind of requirements have to be fulfilled by a set of departure and arrival orbits to have the same profile of primer vector.

Properties of an unusual DNA primase from an archaeal plasmid

PubMed Central

Beck, Kirsten; Lipps, Georg

2007-01-01

Primases are specialized DNA-dependent RNA polymerases that synthesize a short oligoribonucleotide complementary to single-stranded template DNA. In the context of cellular DNA replication, primases are indispensable since DNA polymerases are not able to start DNA polymerization de novo. The primase activity of the replication protein from the archaeal plasmid pRN1 synthesizes a rather unusual mixed primer consisting of a single ribonucleotide at the 5′ end followed by seven deoxynucleotides. Ribonucleotides and deoxynucleotides are strictly required at the respective positions within the primer. Furthermore, in contrast to other archaeo-eukaryotic primases, the primase activity is highly sequence-specific and requires the trinucleotide motif GTG in the template. Primer synthesis starts outside of the recognition motif, immediately 5′ to the recognition motif. The fidelity of the primase synthesis is high, as non-complementary bases are not incorporated into the primer. PMID:17709343

A simplified Sanger sequencing method for full genome sequencing of multiple subtypes of human influenza A viruses.

PubMed

Deng, Yi-Mo; Spirason, Natalie; Iannello, Pina; Jelley, Lauren; Lau, Hilda; Barr, Ian G

2015-07-01

Full genome sequencing of influenza A viruses (IAV), including those that arise from annual influenza epidemics, is undertaken to determine if reassorting has occurred or if other pathogenic traits are present. Traditionally IAV sequencing has been biased toward the major surface glycoproteins haemagglutinin and neuraminidase, while the internal genes are often ignored. Despite the development of next generation sequencing (NGS), many laboratories are still reliant on conventional Sanger sequencing to sequence IAV. To develop a minimal and robust set of primers for Sanger sequencing of the full genome of IAV currently circulating in humans. A set of 13 primer pairs was designed that enabled amplification of the six internal genes of multiple human IAV subtypes including the recent avian influenza A(H7N9) virus from China. Specific primers were designed to amplify the HA and NA genes of each IAV subtype of interest. Each of the primers also incorporated a binding site at its 5'-end for either a forward or reverse M13 primer, such that only two M13 primers were required for all subsequent sequencing reactions. This minimal set of primers was suitable for sequencing the six internal genes of all currently circulating human seasonal influenza A subtypes as well as the avian A(H7N9) viruses that have infected humans in China. This streamlined Sanger sequencing protocol could be used to generate full genome sequence data more rapidly and easily than existing influenza genome sequencing protocols. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Comparison of nine PCR primer sets designed to detect Pantoea stewartii subsp. stewartii in maize

USDA-ARS?s Scientific Manuscript database

Pantoea stewartii subsp. stewartii, the causal agent of Stewart's bacterial wilt of maize, is a major quarantine pest in maize seed. Verifying freedom from P. stewartii remains a significant hurdle in exporting corn seed from the U.S. Several PCR primer sets have been developed and suggested as bein...

Bi-parentally inherited species-specific markers identify hybridization between rainbow trout and cutthroat trout subspecies

USGS Publications Warehouse

Ostberg, C.O.; Rodriguez, R.J.

2004-01-01

Eight polymerase chain reaction primer sets amplifying bi-parentally inherited species-specific markers were developed that differentiate between rainbow trout (Oncorhynchus mykiss) and various cutthroat trout (O. clarki) subspecies. The primers were tested within known F1 and first generation hybrid backcrosses and were shown to amplify codominantly within hybrids. Heterozygous individuals also amplified a slower migrating band that was a heteroduplex, caused by the annealing of polymerase chain reaction products from both species. These primer sets have numerous advantages for native cutthroat trout conservation including statistical genetic analyses of known crosses and simple hybrid identification.

MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

PubMed

Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

2012-11-05

Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

PubMed Central

2012-01-01

Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base. PMID:23126469

Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

PubMed

Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

2017-02-01

To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

RNA-templated single-base mutation detection based on T4 DNA ligase and reverse molecular beacon.

PubMed

Tang, Hongxing; Yang, Xiaohai; Wang, Kemin; Tan, Weihong; Li, Huimin; He, Lifang; Liu, Bin

2008-06-15

A novel RNA-templated single-base mutation detection method based on T4 DNA ligase and reverse molecular beacon (rMB) has been developed and successfully applied to identification of single-base mutation in codon 273 of the p53 gene. The discrimination was carried out using allele-specific primers, which flanked the variable position in the target RNA and was ligated using T4 DNA ligase only when the primers perfectly matched the RNA template. The allele-specific primers also carried complementary stem structures with end-labels (fluorophore TAMRA, quencher DABCYL), which formed a molecular beacon after RNase H digestion. One-base mismatch can be discriminated by analyzing the change of fluorescence intensity before and after RNase H digestion. This method has several advantages for practical applications, such as direct discrimination of single-base mismatch of the RNA extracted from cell; no requirement of PCR amplification; performance of homogeneous detection; and easily design of detection probes.

Surveillance for Western equine encephalitis St. Louis encephalitis and West Nile viruses using reverse transcription loop-mediated isothermal amplification

DOE PAGES

Meagher, Robert J.; Ball, Cameron Scott; Langevin, Stanley A.; ...

2016-01-25

In this study, collection of mosquitoes and testing for vector-borne viruses is a key surveillance activity that directly influences the vector control efforts of public health agencies, including determining when and where to apply insecticides. Vector control districts in California routinely monitor for three human pathogenic viruses including West Nile virus (WNV), Western equine encephalitis virus (WEEV), and St. Louis encephalitis virus (SLEV). Reverse transcription quantitative polymerase chain reaction (RT-qPCR) offers highly sensitive and specific detection of these three viruses in a single multiplex reaction, but this technique requires costly, specialized equipment that is generally only available in centralized publicmore » health laboratories. We report the use of reverse transcription loop-mediated isothermal amplification (RT-LAMP) to detect WNV, WEEV, and SLEV RNA extracted from pooled mosquito samples collected in California, including novel primer sets for specific detection of WEEV and SLEV, targeting the nonstructural protein 4 (nsP4) gene of WEEV and the 3’ untranslated region (3’-UTR) of SLEV. Our WEEV and SLEV RT-LAMP primers allowed detection of <0.1 PFU/reaction of their respective targets in <30 minutes, and exhibited high specificity without cross reactivity when tested against a panel of alphaviruses and flaviviruses. Furthermore, the SLEV primers do not cross-react with WNV, despite both viruses being closely related members of the Japanese encephalitis virus complex. The SLEV and WEEV primers can also be combined in a single RT-LAMP reaction, with discrimination between amplicons by melt curve analysis. Although RT-qPCR is approximately one order of magnitude more sensitive than RT-LAMP for all three targets, the RT-LAMP technique is less instrumentally intensive than RT-qPCR and provides a more cost-effective method of vector-borne virus surveillance.« less

Development of Species-specific Primers for Rapid Detection of Phellinus linteus and P. baumii

PubMed Central

Kim, Mun-Ok; Kim, Gi-Young; Nam, Byung-Hyouk; Jin, Cheng-Yun; Lee, Ki-Won; Park, Jae-Min; Lee, Sang-Joon

2005-01-01

Genus Phellinus taxonomically belongs to Aphyllophorales and some species of this genus have been used as a medicinal ingredients and Indian folk medicines. Especially, P. linteus and morphological-related species are well-known medicinal fungi that have various biological activities such as humoral and cell-mediated, anti-mutagenic, and anti-cancer activities. However, little is known about the rapid detection for complex Phellinus species. Therefore, this study was carried out to develop specific primers for the rapid detection of P. linteus and other related species. Designing the species-specific primers was done based on internal transcribed spacer sequence data. Each primer set detected specifically P. linteus (PL2/PL5R) and P. baumii (PB1/PB4R). These primer sets could be useful for the rapid detection of specific-species among unidentified Phellinus species. Moreover, restriction fragment length polymorphism analysis of the ITS region with HaeIII was also useful for clarifying the relationship between each 5 Phellinus species. PMID:24049482

Alignment-Free Design of Highly Discriminatory Diagnostic Primer Sets for Escherichia coli O104:H4 Outbreak Strains

PubMed Central

Bielaszewska, Martina; Karch, Helge; Toth, Ian K.

2012-01-01

Background An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS) technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC) E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. Methodology/Principal Findings Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 ‘positive’ E. coli O104:H4 outbreak and 32 ‘negative’ non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. Conclusions/Significance Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high throughput primer design strategies will enable faster, more precise responses to future disease outbreaks of bacterial origin, and help to mitigate their societal impact. PMID:22496820

Rapid PCR-mediated synthesis of competitor molecules for accurate quantification of beta(2) GABA(A) receptor subunit mRNA.

PubMed

Vela, J; Vitorica, J; Ruano, D

2001-12-01

We describe a fast and easy method for the synthesis of competitor molecules based on non-specific conditions of PCR. RT-competitive PCR is a sensitive technique that allows quantification of very low quantities of mRNA molecules in small tissue samples. This technique is based on the competition established between the native and standard templates for nucleotides, primers or other factors during PCR. Thus, the most critical parameter is the use of good internal standards to generate a standard curve from which the amount of native sequences can be properly estimated. At the present time different types of internal standards and methods for their synthesis have been described. Normally, most of these methods are time-consuming and require the use of different sets of primers, different rounds of PCR or specific modifications, such as site-directed mutagenesis, that need subsequent analysis of the PCR products. Using our method, we obtained in a single round of PCR and with the same primer pair, competitor molecules that were successfully used in RT-competitive PCR experiments. The principal advantage of this method is high versatility and economy. Theoretically it is possible to synthesize a specific competitor molecule for each primer pair used. Finally, using this method we have been able to quantify the increase in the expression of the beta(2) GABA(A) receptor subunit mRNA that occurs during rat hippocampus development.

Highly specific and efficient primers for in-house multiplex PCR detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum

PubMed Central

2014-01-01

Background Although sophisticated methodologies are available, the use of endpoint polymerase chain reaction (PCR) to detect 16S rDNA genes remains a good approach for estimating the incidence and prevalence of specific infections and for monitoring infections. Considering the importance of the early diagnosis of sexually transmitted infections (STIs), the development of a sensitive and affordable method for identifying pathogens in clinical samples is needed. Highly specific and efficient primers for a multiplex polymerase chain reaction (m-PCR) system were designed in silico to detect the 16S rDNA genes of four bacteria that cause genital infections, and the PCR method was developed. Methods The Genosensor Probe Designer (GPD) (version 1.0a) software was initially used to design highly specific and efficient primers for in-house m-PCR. Single-locus PCR reactions were performed and standardised, and then primers for each locus in turn were added individually in subsequent amplifications until m-PCR was achieved. Amplicons of the expected size were obtained from each of the four bacterial gene fragments. Finally, the analytical specificity and limits of detection were tested. Results Because they did not amplify any product from non-STI tested species, the primers were specific. The detection limits for the Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum primer sets were 5.12 × 105, 3.9 × 103, 61.19 × 106 and 6.37 × 105 copies of a DNA template, respectively. Conclusions The methodology designed and standardised here could be applied satisfactorily for the simultaneous or individual detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum. This method is at least as efficient as other previously described methods; however, this method is more affordable for low-income countries. PMID:24997675

Detection of canine distemper virus (CDV) through one step RT-PCR combined with nested PCR.

PubMed

Kim, Y H; Cho, K W; Youn, H Y; Yoo, H S; Han, H R

2001-04-01

A one step reverse transcription PCR (RT-PCR) combined nested PCR was set up to increase efficiency in the diagnosis of canine distemper virus (CDV) infection after developement of nested PCR. Two PCR primer sets were designed based on the sequence of nucleocapsid gene of CDV Onderstepoort strain. One-step RT-PCR with the outer primer pair was revealed to detect 10(2) PFU/ml. The sensitivity was increased hundredfold using the one-step RT-PCR combined with the nested PCR. Specificity of the PCR was also confirmed using other related canine virus and peripheral blood mononuclear cells (PBMC) and body secretes of healthy dogs. Of the 51 blood samples from dogs clinically suspected of CD, 45 samples were revealed as positive by one-step RT-PCR combined with nested PCR. However, only 15 samples were identified as positive with a single one step RT-PCR. Therefore approximately 60% increase in the efficiency of the diagnosis was observed by the combined method. These results suggested that one step RT-PCR combined with nested PCR could be a sensitive, specific, and practical method for diagnosis of CDV infection.

A PCR primer bank for quantitative gene expression analysis.

PubMed

Wang, Xiaowei; Seed, Brian

2003-12-15

Although gene expression profiling by microarray analysis is a useful tool for assessing global levels of transcriptional activity, variability associated with the data sets usually requires that observed differences be validated by some other method, such as real-time quantitative polymerase chain reaction (real-time PCR). However, non-specific amplification of non-target genes is frequently observed in the latter, confounding the analysis in approximately 40% of real-time PCR attempts when primer-specific labels are not used. Here we present an experimentally validated algorithm for the identification of transcript-specific PCR primers on a genomic scale that can be applied to real-time PCR with sequence-independent detection methods. An online database, PrimerBank, has been created for researchers to retrieve primer information for their genes of interest. PrimerBank currently contains 147 404 primers encompassing most known human and mouse genes. The primer design algorithm has been tested by conventional and real-time PCR for a subset of 112 primer pairs with a success rate of 98.2%.

Development and use of tuf gene-based primers for the multiplex PCR detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum in commercial dairy products.

PubMed

Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang

2009-01-01

PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.

Does fingerprinting truly represent the diversity of wine yeasts? A case study with interdelta genotyping of Saccharomyces cerevisiae strains.

PubMed

Pfliegler, W P; Sipiczki, M

2016-12-01

Simple and efficient genotyping methods are widely used to assess the diversity of a large number of microbial strains, e.g. wine yeasts isolated from a specific geographical area or a vintage. Such methods are often also the first to be applied, to decrease the number of strains deemed interesting for a more time-consuming physiological characterization. Here, we aimed to use a physiologically characterized strain collection of 69 Saccharomyces cerevisiae strains from Hungarian wine regions to determine whether geographical origin or physiological similarity can be recovered by clustering the strains with one or two simultaneously used variations of interdelta genotyping. Our results indicate that although a detailed clustering with high resolution can be achieved with this method, the clustering of strains is largely contrasting when different primer sets are used and it does not recover geographical or physiological groups. Genotyping is routinely used for assessing the diversity of a large number of isolates/strains of a single species, e.g. a collection of wine yeasts. We tested the efficiency of interdelta genotyping on a collection of Saccharomyces wine yeasts from four wine regions of Hungary that was previously characterized physiologically. Interdelta fingerprinting recovered neither physiological nor geographical similarities, and in addition, the two different primer pairs widely used for this method showed conflicting and barely comparable results. Thus, this method does not necessarily represent the true diversity of a strain collection, but detailed clustering may be achieved by the combined use of primer sets. © 2016 The Society for Applied Microbiology.

Real-time PCR detection of Vibrio vulnificus in oysters: comparison of oligonucleotide primers and probes targeting vvhA.

PubMed

Panicker, Gitika; Bej, Asim K

2005-10-01

We compared three sets of oligonucleotide primers and two probes designed for Vibrio vulnificus hemolysin A gene (vvhA) for TaqMan-based real-time PCR method enabling specific detection of Vibrio vulnificus in oysters. Two of three sets of primers with a probe were specific for the detection of all 81 V. vulnificus isolates by TaqMan PCR. The 25 nonvibrio and 12 other vibrio isolates tested were negative. However, the third set of primers, F-vvh1059 and R-vvh1159, with the P-vvh1109 probe, although positive for all V. vulnificus isolates, also exhibited positive cycle threshold (C(T)) values for other Vibrio spp. Optimization of the TaqMan PCR assay using F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and the P-vvh874 probe detected 1 pg of purified DNA and 10(3) V. vulnificus CFU/ml in pure cultures. The enriched oyster tissue homogenate did not exhibit detectable inhibition to the TaqMan PCR amplification of vvhA. Detection of 3 x 10(3) CFU V. vulnificus, resulting from a 5-h enrichment of an initial inoculum of 1 CFU/g of oyster tissue homogenate, was achieved with F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and P-vvh875 probe. The application of the TaqMan PCR using these primers and probe, exhibited detection of V. vulnificus on 5-h-enriched natural oysters harvested from the Gulf of Mexico. Selection of appropriate primers and a probe on vvhA for TaqMan-PCR-based detection of V. vulnificus in post-harvest-treated oysters would help avoid false-positive results, thus ensuring a steady supply of safe oysters to consumers and reducing V. vulnificus-related illnesses and deaths.

Gemi: PCR Primers Prediction from Multiple Alignments

PubMed Central

Sobhy, Haitham; Colson, Philippe

2012-01-01

Designing primers and probes for polymerase chain reaction (PCR) is a preliminary and critical step that requires the identification of highly conserved regions in a given set of sequences. This task can be challenging if the targeted sequences display a high level of diversity, as frequently encountered in microbiologic studies. We developed Gemi, an automated, fast, and easy-to-use bioinformatics tool with a user-friendly interface to design primers and probes based on multiple aligned sequences. This tool can be used for the purpose of real-time and conventional PCR and can deal efficiently with large sets of sequences of a large size. PMID:23316117

Developmental validation of the MiSeq FGx Forensic Genomics System for Targeted Next Generation Sequencing in Forensic DNA Casework and Database Laboratories.

PubMed

Jäger, Anne C; Alvarez, Michelle L; Davis, Carey P; Guzmán, Ernesto; Han, Yonmee; Way, Lisa; Walichiewicz, Paulina; Silva, David; Pham, Nguyen; Caves, Glorianna; Bruand, Jocelyne; Schlesinger, Felix; Pond, Stephanie J K; Varlaro, Joe; Stephens, Kathryn M; Holt, Cydne L

2017-05-01

Human DNA profiling using PCR at polymorphic short tandem repeat (STR) loci followed by capillary electrophoresis (CE) size separation and length-based allele typing has been the standard in the forensic community for over 20 years. Over the last decade, Next-Generation Sequencing (NGS) matured rapidly, bringing modern advantages to forensic DNA analysis. The MiSeq FGx™ Forensic Genomics System, comprised of the ForenSeq™ DNA Signature Prep Kit, MiSeq FGx™ Reagent Kit, MiSeq FGx™ instrument and ForenSeq™ Universal Analysis Software, uses PCR to simultaneously amplify up to 231 forensic loci in a single multiplex reaction. Targeted loci include Amelogenin, 27 common, forensic autosomal STRs, 24 Y-STRs, 7 X-STRs and three classes of single nucleotide polymorphisms (SNPs). The ForenSeq™ kit includes two primer sets: Amelogenin, 58 STRs and 94 identity informative SNPs (iiSNPs) are amplified using DNA Primer Set A (DPMA; 153 loci); if a laboratory chooses to generate investigative leads using DNA Primer Set B, amplification is targeted to the 153 loci in DPMA plus 22 phenotypic informative (piSNPs) and 56 biogeographical ancestry SNPs (aiSNPs). High-resolution genotypes, including detection of intra-STR sequence variants, are semi-automatically generated with the ForenSeq™ software. This system was subjected to developmental validation studies according to the 2012 Revised SWGDAM Validation Guidelines. A two-step PCR first amplifies the target forensic STR and SNP loci (PCR1); unique, sample-specific indexed adapters or "barcodes" are attached in PCR2. Approximately 1736 ForenSeq™ reactions were analyzed. Studies include DNA substrate testing (cotton swabs, FTA cards, filter paper), species studies from a range of nonhuman organisms, DNA input sensitivity studies from 1ng down to 7.8pg, two-person human DNA mixture testing with three genotype combinations, stability analysis of partially degraded DNA, and effects of five commonly encountered PCR inhibitors. Calculations from ForenSeq™ STR and SNP repeatability and reproducibility studies (1ng template) indicate 100.0% accuracy of the MiSeq FGx™ System in allele calling relative to CE for STRs (1260 samples), and >99.1% accuracy relative to bead array typing for SNPs (1260 samples for iiSNPs, 310 samples for aiSNPs and piSNPs), with >99.0% and >97.8% precision, respectively. Call rates of >99.0% were observed for all STRs and SNPs amplified with both ForenSeq™ primer mixes. Limitations of the MiSeq FGx™ System are discussed. Results described here demonstrate that the MiSeq FGx™ System meets forensic DNA quality assurance guidelines with robust, reliable, and reproducible performance on samples of various quantities and qualities. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Design of a species-specific PCR method for the detection of the heat-resistant fungi Talaromyces macrosporus and Talaromyces trachyspermus.

PubMed

Yamashita, S; Nakagawa, H; Sakaguchi, T; Arima, T-H; Kikoku, Y

2018-01-01

Heat-resistant fungi occur sporadically and are a continuing problem for the food and beverage industry. The genus Talaromyces, as a typical fungus, is capable of producing the heat-resistant ascospores responsible for the spoilage of processed food products. Isocitrate lyase, a signature enzyme of the glyoxylate cycle, is required for the metabolism of non-fermentable carbon compounds, like acetate and ethanol. Here, species-specific primer sets for detection and identification of DNA derived from Talaromyces macrosporus and Talaromyces trachyspermus were designed based on the nucleotide sequences of their isocitrate lyase genes. Polymerase chain reaction (PCR) using a species-specific primer set amplified products specific to T. macrosporus and T. trachyspermus. Other fungal species, such as Byssochlamys fulva and Hamigera striata, which cause food spoilage, were not detected using the Talaromyces-specific primer sets. The detection limit for each species-specific primer set was determined as being 50 pg of template DNA, without using a nested PCR method. The specificity of each species-specific primer set was maintained in the presence of 1,000-fold amounts of genomic DNA from other fungi. The method also detected fungal DNA extracted from blueberry inoculated with T. macrosporus. This PCR method provides a quick, simple, powerful and reliable way to detect T. macrosporus and T. trachyspermus. Polymerase chain reaction (PCR)-based detection is rapid, convenient and sensitive compared with traditional methods of detecting heat-resistant fungi. In this study, a PCR-based method was developed for the detection and identification of amplification products from Talaromyces macrosporus and Talaromyces trachyspermus using primer sets that target the isocitrate lyase gene. This method could be used for the on-site detection of T. macrosporus and T. trachyspermus in the near future, and will be helpful in the safety control of raw materials and in food and beverage production. © 2017 The Authors. Letters in Applied Microbiology published by John Wiley & Sons Ltd on behalf of The Society for Applied Microbiology.

A Real-Time PCR Assay to Identify and Discriminate Among Wild-Type and Vaccine Strains of Varicella-Zoster Virus and Herpes Simplex Virus in Clinical Specimens, and Comparison With the Clinical Diagnoses

PubMed Central

Harbecke, Ruth; Oxman, Michael N.; Arnold, Beth A.; Ip, Charlotte; Johnson, Gary R.; Levin, Myron J.; Gelb, Lawrence D.; Schmader, Kenneth E.; Straus, Stephen E.; Wang, Hui; Wright, Peter F.; Pachucki, Constance T.; Gershon, Anne A.; Arbeit, Robert D.; Davis, Larry E.; Simberkoff, Michael S.; Weinberg, Adriana; Williams, Heather M.; Cheney, Carol; Petrukhin, Luba; Abraham, Katalin G.; Shaw, Alan; Manoff, Susan; Antonello, Joseph M.; Green, Tina; Wang, Yue; Tan, Charles; Keller, Paul M.

2014-01-01

A real-time PCR assay was developed to identify varicella-zoster virus (VZV) and herpes simplex virus (HSV) DNA in clinical specimens from subjects with suspected herpes zoster (HZ; shingles). Three sets of primers and probes were used in separate PCR reactions to detect and discriminate among wild-type VZV (VZV-WT), Oka vaccine strain VZV (VZV-Oka), and HSV DNA, and the reaction for each virus DNA was multiplexed with primers and probe specific for the human β-globin gene to assess specimen adequacy. Discrimination of all VZV-WT strains, including Japanese isolates and the Oka parent strain, from VZV-Oka was based upon a single nucleotide polymorphism at position 106262 in ORF 62, resulting in preferential amplification by the homologous primer pair. The assay was highly sensitive and specific for the target virus DNA, and no cross-reactions were detected with any other infectious agent. With the PCR assay as the gold standard, the sensitivity of virus culture was 53% for VZV and 77% for HSV. There was 92% agreement between the clinical diagnosis of HZ by the Clinical Evaluation Committee and the PCR assay results. PMID:19475609

Molecular analysis of RAPD DNA based markers: their potential use for the detection of genetic variability in jojoba (Simmondsia chinensis L Schneider).

PubMed

Amarger, V; Mercier, L

1995-01-01

We have applied the recently developed technique of random amplified polymorphic DNA (RAPD) for the discrimination between two jojoba clones at the genomic level. Among a set of 30 primers tested, a simple reproducible pattern with three distinct fragments for clone D and two distinct fragments for clone E was obtained with primer OPB08. Since RAPD products are the results of arbitrarily priming events and because a given primer can amplify a number of non-homologous sequences, we wondered whether or not RAPD bands, even those of similar size, were derived from different loci in the two clones. To answer this question, two complementary approaches were used: i) cloning and sequencing of the amplification products from clone E; and ii) complementary Southern analysis of RAPD gels using cloned or amplified fragments (directly recovered from agarose gels) as RFLP probes. The data reported here show that the RAPD reaction generates multiple amplified fragments. Some fragments, although resolved as a single band on agarose gels, contain different DNA species of the same size. Furthermore, it appears that the cloned RAPD products of known sequence that do not target repetitive DNA can be used as hybridization probes in RFLP to detect a polymorphism among individuals.

Genetic relationships among strains of Xanthomonas fragariae based on random amplified polymorphic DNA PCR, repetitive extragenic palindromic PCR, and enterobacterial repetitive intergenic consensus PCR data and generation of multiplexed PCR primers useful for the identification of this phytopathogen.

PubMed Central

Pooler, M R; Ritchie, D F; Hartung, J S

1996-01-01

Genetic relationships among 25 isolates of Xanthomonas fragariae from diverse geographic regions were determined by three PCR methods that rely on different amplification priming strategies: random amplified polymorphic DNA (RAPD) PCR, repetitive extragenic palindromic (REP) PCR, and enterobacterial repetitive intergenic consensus (ERIC) PCR. The results of these assays are mutually consistent and indicate that pathogenic strains are very closely related to each other. RAPD, ERIC, and REP PCR assays identified nine, four, and two genotypes, respectively, within X. fragariae isolates. A single nonpathogenic isolate of X. fragariae was not distinguishable by these methods. The results of the PCR assays were also fully confirmed by physiological tests. There was no correlation between DNA amplification product patterns and geographic sites of isolation, suggesting that this bacterium has spread largely through exchange of infected plant germ plasm. Sequences identified through the RAPD assays were used to develop three primer pairs for standard PCR assays to identify X. fragariae. In addition, we developed a stringent multiplexed PCR assay to identify X. fragariae by simultaneously using the three independently derived sets of primers specific for pathogenic strains of the bacteria. PMID:8795198

Simple Identification of Human Taenia Species by Multiplex Loop-Mediated Isothermal Amplification in Combination with Dot Enzyme-Linked Immunosorbent Assay.

PubMed

Nkouawa, Agathe; Sako, Yasuhito; Okamoto, Munehiro; Ito, Akira

2016-06-01

For differential detection of Taenia solium, Taenia saginata, and Taenia asiatica, loop-mediated isothermal amplification (LAMP) assay targeting the cytochrome c oxidase subunit 1 gene has been recently developed and shown to be sensitive, specific, and effective. However, to achieve differential identification, one specimen requires three reaction mixtures containing a primer set of each Taenia species separately, which is complex and time consuming and increases the risk of cross-contamination. In this study, we developed a simple differential identification of human Taenia species using multiplex LAMP (mLAMP) in combination with dot enzyme-linked immunosorbent assay (dot-ELISA). Forward inner primers of T. solium, T. saginata, and T. asiatica labeled with fluorescein isothiocyanate (FITC), digoxigenin (DIG), and tetramethylrhodamine (TAMRA), respectively, and biotin-labeled backward inner primers were used in mLAMP. The mLAMP assay succeeded in specific amplification of each respective target gene in a single tube. Furthermore, the mLAMP product from each species was easily distinguished by dot-ELISA with an antibody specific for FITC, DIG, or TAMRA. The mLAMP assay in combination with dot-ELISA will make identification of human Taenia species simpler, easier, and more practical. © The American Society of Tropical Medicine and Hygiene.

Development of a Prokaryotic Universal Primer for Simultaneous Analysis of Bacteria and Archaea Using Next-Generation Sequencing

PubMed Central

Takahashi, Shunsuke; Tomita, Junko; Nishioka, Kaori; Hisada, Takayoshi; Nishijima, Miyuki

2014-01-01

For the analysis of microbial community structure based on 16S rDNA sequence diversity, sensitive and robust PCR amplification of 16S rDNA is a critical step. To obtain accurate microbial composition data, PCR amplification must be free of bias; however, amplifying all 16S rDNA species with equal efficiency from a sample containing a large variety of microorganisms remains challenging. Here, we designed a universal primer based on the V3-V4 hypervariable region of prokaryotic 16S rDNA for the simultaneous detection of Bacteria and Archaea in fecal samples from crossbred pigs (Landrace×Large white×Duroc) using an Illumina MiSeq next-generation sequencer. In-silico analysis showed that the newly designed universal prokaryotic primers matched approximately 98.0% of Bacteria and 94.6% of Archaea rRNA gene sequences in the Ribosomal Database Project database. For each sequencing reaction performed with the prokaryotic universal primer, an average of 69,330 (±20,482) reads were obtained, of which archaeal rRNA genes comprised approximately 1.2% to 3.2% of all prokaryotic reads. In addition, the detection frequency of Bacteria belonging to the phylum Verrucomicrobia, including members of the classes Verrucomicrobiae and Opitutae, was higher in the NGS analysis using the prokaryotic universal primer than that performed with the bacterial universal primer. Importantly, this new prokaryotic universal primer set had markedly lower bias than that of most previously designed universal primers. Our findings demonstrate that the prokaryotic universal primer set designed in the present study will permit the simultaneous detection of Bacteria and Archaea, and will therefore allow for a more comprehensive understanding of microbial community structures in environmental samples. PMID:25144201

Uncoupling primer and releaser responses to pheromone in honey bees

NASA Astrophysics Data System (ADS)

Grozinger, Christina M.; Fischer, Patrick; Hampton, Jacob E.

2007-05-01

Pheromones produce dramatic behavioral and physiological responses in a wide variety of species. Releaser pheromones elicit rapid responses within seconds or minutes, while primer pheromones produce long-term changes which may take days to manifest. Honeybee queen mandibular pheromone (QMP) elicits multiple distinct behavioral and physiological responses in worker bees, as both a releaser and primer, and thus produces responses on vastly different time scales. In this study, we demonstrate that releaser and primer responses to QMP can be uncoupled. First, treatment with the juvenile hormone analog methoprene leaves a releaser response (attraction to QMP) intact, but modulates QMP’s primer effects on sucrose responsiveness. Secondly, two components of QMP (9-ODA and 9-HDA) do not elicit a releaser response (attraction) but are as effective as QMP at modulating a primer response, downregulation of foraging-related brain gene expression. These results suggest that different responses to a single pheromone may be produced via distinct pathways.

Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi.

PubMed

Lee, Jaikoo; Lee, Sangsun; Young, J Peter W

2008-08-01

A set of PCR primers that should amplify all subgroups of arbuscular mycorrhizal fungi (AMF, Glomeromycota), but exclude sequences from other organisms, was designed to facilitate rapid detection and identification directly from field-grown plant roots. The small subunit rRNA gene was targeted for the new primers (AML1 and AML2) because phylogenetic relationships among the Glomeromycota are well understood for this gene. Sequence comparisons indicate that the new primers should amplify all published AMF sequences except those from Archaeospora trappei. The specificity of the new primers was tested using 23 different AMF spore morphotypes from trap cultures and Miscanthus sinensis, Glycine max and Panax ginseng roots sampled from the field. Non-AMF DNA of 14 plants, 14 Basidiomycota and 18 Ascomycota was also tested as negative controls. Sequences amplified from roots using the new primers were compared with those obtained using the established NS31 and AM1 primer combination. The new primers have much better specificity and coverage of all known AMF groups.

Detection and differentiation of Fusarium oxysporum f. sp. lycopersici race 1 using loop-mediated isothermal amplification with three primer sets.

PubMed

Ayukawa, Y; Komatsu, K; Kashiwa, T; Akai, K; Yamada, M; Teraoka, T; Arie, T

2016-09-01

Fusarium oxysporum f. sp. lycopersici (Fol) causes tomato wilt. Based on the difference in pathogenicity towards tomato cultivars, Fol is classified into three races. In this study, a rapid method is developed for the detection and discrimination of Fol race 1 using a loop-mediated isothermal amplification (LAMP) assay with two primer sets targeting a region of the nucleotide sequence of the SIX4 gene specific for race 1 and a primer set targeting the SIX5 gene, conserved in all known Fol isolates. Upon LAMP reaction, amplification using all three primer sets was observed only when DNA of Fol race 1 was used as a template, and not when DNA of other Fol races or other fungal species was used. This method could detect 300 fg of Fol race 1 DNA, a 100-fold higher sensitivity than that obtained by conventional PCR. The method can also detect DNA extracted from soil artificially infested with Fol race 1. It is now possible to detect Fol race 1 in colonies and infected tomato stems without DNA isolation. This method is a rapid and simple tool for discrimination of Fol race 1. This study developed a loop-mediated isothermal amplification (LAMP) assay for detection and differentiation of Fusarium oxysporum f. sp. lycopersici (Fol) race 1 by using three primer sets targeting for the SIX4 and SIX5 genes. These genes are present together only in Fol race 1. This method can detect Fol race 1 in infected tomato stems without DNA extraction, affording an efficient diagnosis of Fusarium wilt on tomatoes in the field. © 2016 The Society for Applied Microbiology.

Deconstructing the Polymerase Chain Reaction: Understanding and Correcting Bias Associated with Primer Degeneracies and Primer-Template Mismatches

PubMed Central

Green, Stefan J.; Venkatramanan, Raghavee; Naqib, Ankur

2015-01-01

The polymerase chain reaction (PCR) is sensitive to mismatches between primer and template, and mismatches can lead to inefficient amplification of targeted regions of DNA template. In PCRs in which a degenerate primer pool is employed, each primer can behave differently. Therefore, inefficiencies due to different primer melting temperatures within a degenerate primer pool, in addition to mismatches between primer binding sites and primers, can lead to a distortion of the true relative abundance of targets in the original DNA pool. A theoretical analysis indicated that a combination of primer-template and primer-amplicon interactions during PCR cycles 3–12 is potentially responsible for this distortion. To test this hypothesis, we developed a novel amplification strategy, entitled “Polymerase-exonuclease (PEX) PCR”, in which primer-template interactions and primer-amplicon interactions are separated. The PEX PCR method substantially and significantly improved the evenness of recovery of sequences from a mock community of known composition, and allowed for amplification of templates with introduced mismatches near the 3’ end of the primer annealing sites. When the PEX PCR method was applied to genomic DNA extracted from complex environmental samples, a significant shift in the observed microbial community was detected. Furthermore, the PEX PCR method provides a mechanism to identify which primers in a primer pool are annealing to target gDNA. Primer utilization patterns revealed that at high annealing temperatures in the PEX PCR method, perfect match annealing predominates, while at lower annealing temperatures, primers with up to four mismatches with templates can contribute substantially to amplification. The PEX PCR method is simple to perform, is limited to PCR mixes and a single exonuclease step which can be performed without reaction cleanup, and is recommended for reactions in which degenerate primer pools are used or when mismatches between primers and template are possible. PMID:25996930

A primer on standards setting as it applies to surgical education and credentialing.

PubMed

Cendan, Juan; Wier, Daryl; Behrns, Kevin

2013-07-01

Surgical technological advances in the past three decades have led to dramatic reductions in the morbidity associated with abdominal procedures and permanently altered the surgical practice landscape. Significant changes continue apace including surgical robotics, natural orifice-based surgery, and single-incision approaches. These disruptive technologies have on occasion been injurious to patients, and high-stakes assessment before adoption of new technologies would be reasonable. We reviewed the drivers for well-established psychometric techniques available for the standards-setting process. We present a series of examples that are relevant in the surgical domain including standards setting for knowledge and skills assessments. Defensible standards for knowledge and procedural skills will likely become part of surgical clinical practice. Understanding the methodology for determining standards should position the surgical community to assist in the process and lead within their clinical settings as standards are considered that may affect patient safety and physician credentialing.

Phylum- and Class-Specific PCR Primers for General Microbial Community Analysis

PubMed Central

Blackwood, Christopher B.; Oaks, Adam; Buyer, Jeffrey S.

2005-01-01

Amplification of a particular DNA fragment from a mixture of organisms by PCR is a common first step in methods of examining microbial community structure. The use of group-specific primers in community DNA profiling applications can provide enhanced sensitivity and phylogenetic detail compared to domain-specific primers. Other uses for group-specific primers include quantitative PCR and library screening. The purpose of the present study was to develop several primer sets targeting commonly occurring and important groups. Primers specific for the 16S ribosomal sequences of Alphaproteobacteria, Betaproteobacteria, Bacilli, Actinobacteria, and Planctomycetes and for parts of both the 18S ribosomal sequence and the internal transcribed spacer region of Basidiomycota were examined. Primers were tested by comparison to sequences in the ARB 2003 database, and chosen primers were further tested by cloning and sequencing from soil community DNA. Eighty-five to 100% of the sequences obtained from clone libraries were found to be placed with the groups intended as targets, demonstrating the specificity of the primers under field conditions. It will be important to reevaluate primers over time because of the continual growth of sequence databases and revision of microbial taxonomy. PMID:16204538

Evaluating detection limits of next-generation sequencing for the surveillance and monitoring of international marine pests.

PubMed

Pochon, Xavier; Bott, Nathan J; Smith, Kirsty F; Wood, Susanna A

2013-01-01

Most surveillance programmes for marine invasive species (MIS) require considerable taxonomic expertise, are laborious, and are unable to identify species at larval or juvenile stages. Therefore, marine pests may go undetected at the initial stages of incursions when population densities are low. In this study, we evaluated the ability of the benchtop GS Junior™ 454 pyrosequencing system to detect the presence of MIS in complex sample matrices. An initial in-silico evaluation of the mitochondrial cytochrome c oxidase subunit I (COI) and the nuclear small subunit ribosomal DNA (SSU) genes, found that multiple primer sets (targeting a ca. 400 base pair region) would be required to obtain species level identification within the COI gene. In contrast a single universal primer set was designed to target the V1-V3 region of SSU, allowing simultaneous PCR amplification of a wide taxonomic range of MIS. To evaluate the limits of detection of this method, artificial contrived communities (10 species from 5 taxonomic groups) were created using varying concentrations of known DNA samples and PCR products. Environmental samples (water and sediment) spiked with one or five 160 hr old Asterias amurensis larvae were also examined. Pyrosequencing was able to recover DNA/PCR products of individual species present at greater than 0.64% abundance from all tested contrived communities. Additionally, single A. amurensis larvae were detected from both water and sediment samples despite the co-occurrence of a large array of environmental eukaryotes, indicating an equivalent sensitivity to quantitative PCR. NGS technology has tremendous potential for the early detection of marine invasive species worldwide.

Evaluation of single-nucleotide polymorphisms as internal controls in prenatal diagnosis of fetal blood groups.

PubMed

Doescher, Andrea; Petershofen, Eduard K; Wagner, Franz F; Schunter, Markus; Müller, Thomas H

2013-02-01

Determination of fetal blood groups in maternal plasma samples critically depends on adequate amplification of fetal DNA. We evaluated the routine inclusion of 52 single-nucleotide polymorphisms (SNPs) as internal reference in our polymerase chain reaction (PCR) settings to obtain a positive internal control for fetal DNA. DNA from 223 plasma samples of pregnant women was screened for RHD Exons 3, 4, 5, and 7 in a multiplex PCR including 52 SNPs divided into four primer pools. Amplicons were analyzed by single-base extension and the GeneScan method in a genetic analyzer. Results of D screening were compared to standard RHD genotyping of amniotic fluid or real-time PCR of fetal DNA from maternal plasma. The vast majority of all samples (97.8%) demonstrated differences in maternal and fetal SNP patterns when tested with four primer pools. These differences were not observed in less than 2.2% of the samples most probably due to an extraction failure for adequate amounts of fetal DNA. Comparison of the fetal genotypes with independent results did not reveal a single false-negative case among samples (n = 42) with positive internal control and negative fetal RHD typing. Coamplification of 52 SNPs with RHD-specific sequences for fetal blood group determination introduces a valid positive control for the amplification of fetal DNA to avoid false-negative results. This new approach does not require a paternal blood sample. It may also be applicable to other assays for fetal genotyping in maternal blood samples. © 2012 American Association of Blood Banks.

Two different PCR approaches for universal diagnosis of brown rot and identification of Monilinia spp. in stone fruit trees.

PubMed

Gell, I; Cubero, J; Melgarejo, P

2007-12-01

To design a protocol for the universal diagnosis of brown rot by polymerase chain reaction (PCR) in plant material and subsequently Monilinia spp. identification. Primers for discrimination of Monilinia spp. from other fungal genera by PCR were designed following a ribosomal DNA analysis. Discrimination among species of Monilinia was subsequently achieved by developing primers using SCAR (Sequence Characterised Amplified Region) markers obtained after a random amplified polymorphic DNA study. In addition, an internal control (IC) based on the utilization of a mimic plasmid was designed to be used in the diagnostic protocol of brown rot to recognize false negatives due to the inhibition of PCR. The four sets of primers designed allowed detection and discrimination of all Monilinia spp. causing brown rot in fruit trees. Addition of an IC in each PCR reaction performed increased the reliability of the diagnostic protocol. The detection protocol presented here, that combined a set of universal primers and the inclusion of the plasmid pGMON as an IC for diagnosis of all Monilinia spp., and three sets of primers to discriminate the most important species of Monilinia, could be an useful and valuable tool for epidemiological studies. The method developed could be used in programmes to avoid the spread and introduction of this serious disease in new areas.

One step screening of retroviral producer clones by real time quantitative PCR.

PubMed

Towers, G J; Stockholm, D; Labrousse-Najburg, V; Carlier, F; Danos, O; Pagès, J C

1999-01-01

Recombinant retroviruses are obtained from either stably or transiently transfected retrovirus producer cells. In the case of stably producing lines, a large number of clones must be screened in order to select the one with the highest titre. The multi-step selection of high titre producing clones is time consuming and expensive. We have taken advantage of retroviral endogenous reverse transcription to develop a quantitative PCR assay on crude supernatant from producing clones. We used Taqman PCR technology, which, by using fluorescence measurement at each cycle of amplification, allows PCR product quantification. Fluorescence results from specific degradation of a probe oligonucleotide by the Taq polymerase 3'-5' exonuclease activity. Primers and probe sequences were chosen to anneal to the viral strong stop species, which is the first DNA molecule synthesised during reverse transcription. The protocol consists of a single real time PCR, using as template filtered viral supernatant without any other pre-treatment. We show that the primers and probe described allow quantitation of serially diluted plasmid to as few as 15 plasmid molecules. We then test 200 GFP-expressing retroviral-producing clones either by FACS analysis of infected cells or by using the quantitative PCR. We confirm that the Taqman protocol allows the detection of virus in supernatant and selection of high titre clones. Furthermore, we can determine infectious titre by quantitative PCR on genomic DNA from infected cells, using an additional set of primers and probe to albumin to normalise for the genomic copy number. We demonstrate that real time quantitative PCR can be used as a powerful and reliable single step, high throughput screen for high titre retroviral producer clones.

Detection and identification of genetically modified EE-1 brinjal (Solanum melongena) by single, multiplex and SYBR® real-time PCR.

PubMed

Ballari, Rajashekhar V; Martin, Asha; Gowda, Lalitha R

2013-01-01

Brinjal is an important vegetable crop. Major crop loss of brinjal is due to insect attack. Insect-resistant EE-1 brinjal has been developed and is awaiting approval for commercial release. Consumer health concerns and implementation of international labelling legislation demand reliable analytical detection methods for genetically modified (GM) varieties. End-point and real-time polymerase chain reaction (PCR) methods were used to detect EE-1 brinjal. In end-point PCR, primer pairs specific to 35S CaMV promoter, NOS terminator and nptII gene common to other GM crops were used. Based on the revealed 3' transgene integration sequence, primers specific for the event EE-1 brinjal were designed. These primers were used for end-point single, multiplex and SYBR-based real-time PCR. End-point single PCR showed that the designed primers were highly specific to event EE-1 with a sensitivity of 20 pg of genomic DNA, corresponding to 20 copies of haploid EE-1 brinjal genomic DNA. The limits of detection and quantification for SYBR-based real-time PCR assay were 10 and 100 copies respectively. The prior development of detection methods for this important vegetable crop will facilitate compliance with any forthcoming labelling regulations. Copyright © 2012 Society of Chemical Industry.

Influenza Risk Management: Lessons Learned from an A(H1N1) pdm09 Outbreak Investigation in an Operational Military Setting

DTIC Science & Technology

2013-07-10

of the virus in Spain was detected during an outbreak investigation of influenza -like illness (ILI) in soldiers from an engineering military academy...SwInfA primer and probe set) and specific A(H1N1) pdm09 influenza A viruses using SwH1 primer and probe set developed by CDC, Atlanta (WHO...CY062374, CY062375 and CY062376. Viral culture Influenza viruses were isolated from clinical samples by infecting Madin Darby Canine Kidney (MDCK

Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

PubMed

Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

2014-08-01

The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

Evaluation of the PCR method for identification of Bifidobacterium species.

PubMed

Youn, S Y; Seo, J M; Ji, G E

2008-01-01

Bifidobacterium species are known for their beneficial effects on health and their wide use as probiotics. Although various polymerase chain reaction (PCR) methods for the identification of Bifidobacterium species have been published, the reliability of these methods remains open to question. In this study, we evaluated 37 previously reported PCR primer sets designed to amplify 16S rDNA, 23S rDNA, intergenic spacer regions, or repetitive DNA sequences of various Bifidobacterium species. Ten of 37 experimental primer sets showed specificity for B. adolescentis, B. angulatum, B. pseudocatenulatum, B. breve, B. bifidum, B. longum, B. longum biovar infantis and B. dentium. The results suggest that published Bifidobacterium primer sets should be re-evaluated for both reproducibility and specificity for the identification of Bifidobacterium species using PCR. Improvement of existing PCR methods will be needed to facilitate identification of other Bifidobacterium strains, such as B. animalis, B. catenulatum, B. thermophilum and B. subtile.

Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

PubMed

Wang, Deguo; Liu, Yanhong

2015-05-26

Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

Detection of the genetic variation of polygalacturonase-inhibiting protein gene 2 in autotetraploid alfalfa (Medicago sativa) using an improved SSCP technique.

PubMed

Gui, Z; Liu, H Q; Wang, Y; Yuan, Q H; Xin, N; Zhang, X; Li, X L; Pi, Y S; Gao, J M

2014-12-04

In this study, 2 approaches were adopted to obtain good single-strand conformation polymorphism (SSCP) data for autotetraploid alfalfa; primers were added to PCR products, and fluorescent-labeled primers were utilized. PCR-SSCP conditions for a 331-bp fragment in the coding region of polygalacturonase-inhibiting protein gene 2 in alfalfa (MsPGIP2) were optimized, and the results showed that the best SSCP gel pattern could be obtained when the loading mixture was made by mixing 1 μL PCR products, 0.2 to 0.8 μL unlabeled primers (50 μM) and 4 to 16 μL loading buffer. Furthermore, the use of the fluorescent-labeled primers resulted in 2 separated electrophoresis images from 2 complementary single DNA strands, thus making the determination of alleles and idiotypes a relatively easy task. In addition, the results of sequencing prove that the determination of alleles and idiotypes were accurate based on SSCP analysis. Finally, a total of 9 alleles with 18 SNP sites were identified for MsPGIP2 in the alfalfa variety 'Algonquin'. In conclusion, MsPGIP2 possessed great genetic variation, and the addition of primers to the PCR products in combination with the fluorescent labeling of primers could significantly improve the sensitivity and resolution of SSCP analysis. This technique could be used for genetic diversity detection and marker-assisted breeding of useful genes in autopolyploid species such as alfalfa.

High resolution melting (HRM) analysis as a new tool for rapid identification of Salmonella enterica serovar Gallinarum biovars Pullorum and Gallinarum.

PubMed

Ren, Xingxing; Fu, Ying; Xu, Chenggang; Feng, Zhou; Li, Miao; Zhang, Lina; Zhang, Jianmin; Liao, Ming

2017-05-01

Salmonella enterica serovar Gallinarum biovars Pullorum and Gallinarum represent the most common causative agents of chicken salmonellosis, which result in high mortality and morbidity throughout the world. It is difficult and laborious to discriminate these diseases based on biochemical or phenotypic methods. Herein, we report the development of a single nucleotide polymorphism (SNP) PCR-high resolution melt (PCR-HRM) assay for the detection and discrimination of both S. Pullorum and S. Gallinarun. The gene rfbS, which encodes a factor involved in the biosynthesis of ADP paratose in serogroup D of Salmonella, has been identified as a robust genetic marker for the identification of S. Pullorum and S. Gallinarun based on polymorphisms at positions 237 and 598. Therefore, PCR-HRM analyses were used to characterize this gene. A total of 15 reference and 33 clinical isolates of Salmonella and related Gram-negative bacteria were detected using 2 sets of primers. Our PCR-HRM assay could distinguish S. Pullorum from S. Gallinarun and other strains using the primer pair SP-237F/237R. Similarly, S. Gallinarun could be distinguished from S. Pullorum and other strains using primer set SG-598F/598R. These 2 assays showed high specificity (100%) for both S. Pullorum and S. Gallinarun; the sensitivity of these 2 assays was at least 100-fold greater than that of the allele-specific PCR assay. This present study demonstrated that HRM analysis represents a potent, simple, and economic tool for the rapid, specific, and sensitive detection of S. Pullorum and S. Gallinarun. Our approach also may aid efforts for purification of Avian Salmonella disease. © 2016 Poultry Science Association Inc.

Development of a one-run real-time PCR detection system for pathogens associated with bovine respiratory disease complex.

PubMed

Kishimoto, Mai; Tsuchiaka, Shinobu; Rahpaya, Sayed Samim; Hasebe, Ayako; Otsu, Keiko; Sugimura, Satoshi; Kobayashi, Suguru; Komatsu, Natsumi; Nagai, Makoto; Omatsu, Tsutomu; Naoi, Yuki; Sano, Kaori; Okazaki-Terashima, Sachiko; Oba, Mami; Katayama, Yukie; Sato, Reiichiro; Asai, Tetsuo; Mizutani, Tetsuya

2017-03-18

Bovine respiratory disease complex (BRDC) is frequently found in cattle worldwide. The etiology of BRDC is complicated by infections with multiple pathogens, making identification of the causal pathogen difficult. Here, we developed a detection system by applying TaqMan real-time PCR (Dembo respiratory-PCR) to screen a broad range of microbes associated with BRDC in a single run. We selected 16 bovine respiratory pathogens (bovine viral diarrhea virus, bovine coronavirus, bovine parainfluenza virus 3, bovine respiratory syncytial virus, influenza D virus, bovine rhinitis A virus, bovine rhinitis B virus, bovine herpesvirus 1, bovine adenovirus 3, bovine adenovirus 7, Mannheimia haemolytica, Pasteurella multocida, Histophilus somni, Trueperella pyogenes, Mycoplasma bovis and Ureaplasma diversum) as detection targets and designed novel specific primer-probe sets for nine of them. The assay performance was assessed using standard curves from synthesized DNA. In addition, the sensitivity of the assay was evaluated by spiking solutions extracted from nasal swabs that were negative by Dembo respiratory-PCR for nucleic acids of pathogens or synthesized DNA. All primer-probe sets showed high sensitivity. In this study, a total of 40 nasal swab samples from cattle on six farms were tested by Dembo respiratory-PCR. Dembo respiratory-PCR can be applied as a screening system with wide detection targets.

A new cultivation independent approach to detect and monitor common Trichoderma species in soils.

PubMed

Hagn, Alexandra; Wallisch, Stefanie; Radl, Viviane; Charles Munch, Jean; Schloter, Michael

2007-04-01

A set of primers was developed for the detection, identification and quantification of common Trichoderma species in soil samples. Based on a broad range master alignment primers were derived to amplify an approximate 540 bp fragment comprising the internal transcribed spacer region 1 (ITS 1), 5.8S rDNA and internal transcribed spacer region 2 (ITS 2) from all taxonomic Clades of the genus Trichoderma. The primer set was applied to test strains as well as community DNA isolated from arable and forest soil. For all tested isolates the corresponding internal transcribed spacer regions of Trichoderma spp. strains were amplified, but none of non-Trichoderma origin. PCR with community DNA from soil yielded products of the expected size. Analysis of a clone library established for an arable site showed that all amplified sequences originated exclusively from Trichoderma species mainly being representatives of the Clades Hamatum, Harzianum and Pachybasioides and comprising most of the species known for biocontrol ability. In a realtime PCR approach the primer set uTf/uTr also proved to be a suitable system to quantify DNA of Trichoderma spp. in soils.

A Genetic Linkage Map of Longleaf Pine (Pinus palustris Mill.) Based on Random Amplified Polymorphic DNAs

Treesearch

C.D. Nelson; Thomas L. Kubisiak; M. Stine; W.L. Nance

1994-01-01

Eight megagametophyte DNA samples from a single longleaf pine (Pinus palustris Mill.) tree were used to screen 576 oligonucleotide primers for random amplified polymorphic DNA (RAPD) fragments. Primers amplifying repeatable polymorphic fragments were further characterized within a sample of 72 megagametophytes from the same tree. Fragments...

Mining for sensitive and reliable species-specific primers for PCR for detection of Cronobacter sakazakii by a bioinformatics approach.

PubMed

Qiming, Chen; Tingting, Tao; Xiaomei, Bie; Yingjian, Lu; Fengxia, Lu; Ligong, Zhai; Zhaoxin, Lu

2015-08-01

Although several studies have reported PCR assays for distinguishing Cronobacter sakazakii from other species in the genus, reports regarding assay sensitivity and specificity, as well as applications for food testing, are lacking. Hence, the objective of this study was to develop a sensitive and reliable PCR-based method for detection of C. sakazakii by screening for specific target genes. The genome sequence of C. sakazakii in the GenBank database was compared with that of other organisms using BLAST. Thirty-eight DNA fragments unique to C. sakazakii were identified, and primers targeting these sequences were designed. Finally, 3 primer sets (CS14, CS21, and CS38) were found to be specific for C. sakazakii by PCR verification. The detection limit of PCR assays using the 3 pairs of primers was 1.35 pg/μL, 135 fg/μL, and 135 fg/μL, respectively, for genomic DNA, and 5.5×10(5), 5.5×10(3), 5.5×10(3) cfu/mL, respectively, using pure cultures of the bacteria, compared with 13.5 pg/μLand 5.5×10(5) cfu/mLfor primer set SpeCronsaka, which has been previously described. Cronobacter sakazakii were detected in artificially contaminated powdered infant formula (PIF) by PCR using primer sets CS21 and CS38 after 8h of enrichment. The detection limit was 5.5×10(-1) cfu/10g of PIF. Thus, the PCR assay can be used for rapid and sensitive detection of C. sakazakii in PIF. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Isolation of Fungal Pathogens to an Edible Mushroom, Pleurotus eryngii, and Development of Specific ITS Primers

PubMed Central

Kim, Sang-Woo; Kim, Sinil; Lee, Hyun-Jun; Park, Ju-Wan

2013-01-01

Fungal pathogens have caused severe damage to the commercial production of Pleurotus eryngii, the king oyster mushroom, by reducing production yield, causing deterioration of commercial value, and shortening shelf-life. Four strains of pathogenic fungi, including Trichoderma koningiopsis DC3, Phomopsis sp. MP4, Mucor circinelloides MP5, and Cladosporium bruhnei MP6, were isolated from the bottle culture of diseased P. eryngii. A species-specific primer set was designed for each fungus from the ITS1-5.8S rDNA-ITS2 sequences. PCR using the ITS primer set yielded a unique DNA band for each fungus without any cross-reaction, proving the validity of our method in detection of mushroom fungal pathogens. PMID:24493949

A universal procedure for primer labelling of amplicons.

PubMed Central

Neilan, B A; Wilton, A N; Jacobs, D

1997-01-01

Detection and visualisation of nucleic acids is integral to genome analyses. Exponential amplification procedures have provided the means for the manipulation of nucleic acid sequences, which were otherwise inaccessible. We describe the development and application of a universal method for the labelling of any PCR product using a single end-labelled primer. Amplification was performed in a single reaction with the resulting amplicon labelled to a high specific activity. The method was adapted to a wide range of PCRs and significantly reduced the expense of such analyses. PMID:9207046

Back to Basics--The Influence of DNA Extraction and Primer Choice on Phylogenetic Analysis of Activated Sludge Communities.

PubMed

Albertsen, Mads; Karst, Søren M; Ziegler, Anja S; Kirkegaard, Rasmus H; Nielsen, Per H

2015-01-01

DNA extraction and primer choice have a large effect on the observed community structure in all microbial amplicon sequencing analyses. Although the biases are well known, no comprehensive analysis has been conducted in activated sludge communities. In this study we systematically explored the impact of a number of parameters on the observed microbial community: bead beating intensity, primer choice, extracellular DNA removal, and various PCR settings. In total, 176 samples were subjected to 16S rRNA amplicon sequencing, and selected samples were investigated through metagenomics and metatranscriptomics. Quantitative fluorescence in situ hybridization was used as a DNA extraction-independent method for qualitative comparison. In general, an effect on the observed community was found on all parameters tested, although bead beating and primer choice had the largest effect. The effect of bead beating intensity correlated with cell-wall strength as seen by a large increase in DNA from Gram-positive bacteria (up to 400%). However, significant differences were present at lower phylogenetic levels within the same phylum, suggesting that additional factors are at play. The best primer set based on in silico analysis was found to underestimate a number of important bacterial groups. For 16S rRNA gene analysis in activated sludge we recommend using the FastDNA SPIN Kit for Soil with four times the normal bead beating and V1-3 primers.

Development, validation and application of specific primers for analyzing the clostridial diversity in dark fermentation pit mud by PCR-DGGE.

PubMed

Hu, Xiao-Long; Wang, Hai-Yan; Wu, Qun; Xu, Yan

2014-07-01

In this study, a Clostridia-specific primer set SJ-F and SJ-R, based on the available 16S rRNA genes sequences from database, was successfully designed and authenticated by theoretical and experimental evaluations. It targeted 19 clostridial families and unclassified_Clostridia with different coverage rates. The specificity and universality of novel primer set was tested again using the dark fermentation pit mud (FPM). It was demonstrated that a total of 13 closest relatives including 12 species were affiliated with 7 clostridial genera, respectively. Compared to the well-accepted bacterial universal primer pair P2/P3, five unexpected clostridial genera including Roseburia, Tissierella, Sporanaerobacter, Alkalibacter and Halothermothrix present in the FPM were also revealed. Therefore, this study could provide a good alternative to investigate the clostridial diversity and monitor their population dynamics rapidly and efficiently in various anaerobic environments and dark fermentation systems in future. Copyright © 2014 Elsevier Ltd. All rights reserved.

Authentication of medicinal herbs using PCR-amplified ITS2 with specific primers.

PubMed

Chiou, Shu-Jiau; Yen, Jui-Hung; Fang, Cheng-Li; Chen, Hui-Ling; Lin, Tsai-Yun

2007-10-01

Different parts of medicinal herbs have long been used as traditional Chinese drugs for treating many diseases, whereas materials of similar morphology and chemical fingerprints are often misidentified. Analyses of sequence variations in the nuclear ribosomal DNA (rDNA) internal transcribed spacer (ITS) have become a valid method for authentication of medicinal herbs at the intergenic and interspecific levels. DNA extracted from processed materials is usually severely degraded or contaminated by microorganisms, thus generates no or unexpected PCR products. The goal of this study is to apply the ITS fragments selectively amplified with two designed primer sets for efficient and precise authentication of medicinal herbs. The designed primers led to an accurate PCR product of the specific region in ITS2, which was confirmed with DNA extracted from 55 processed medicinal herbs belonging to 48 families. Moreover, the selectively amplified ITS2 authenticated five sets of easily confusable Chinese herbal materials. The designed primers were proven to be suitable for a broad application in the authentication of herbal materials.

MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments

PubMed Central

Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

2016-01-01

Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. PMID:27154272

Rapid real-time diagnostic PCR for Trichophyton rubrum and Trichophyton mentagrophytes in patients with tinea unguium and tinea pedis using specific fluorescent probes.

PubMed

Miyajima, Yoshiharu; Satoh, Kazuo; Uchida, Takao; Yamada, Tsuyoshi; Abe, Michiko; Watanabe, Shin-ichi; Makimura, Miho; Makimura, Koichi

2013-03-01

Trichophyton rubrum and Trichophyton mentagrophytes human-type (synonym, Trichophyton interdigitale (anthropophilic)) are major causative pathogens of tinea unguium. For suitable diagnosis and treatment, rapid and accurate identification of etiologic agents in clinical samples using reliable molecular based method is required. For identification of organisms causing tinea unguium, we developed a new real-time polymerase chain reaction (PCR) with a pan-fungal primer set and probe, as well as specific primer sets and probes for T. rubrum and T. mentagrophytes human-type. We designed two sets of primers from the internal transcribed spacer 1 (ITS1) region of fungal ribosomal DNA (rDNA) and three quadruple fluorescent probes, one for detection wide range pathogenic fungi and two for classification of T. rubrum and T. mentagrophytes by specific binding to different sites in the ITS1 region. We investigated the specificity of these primer sets and probes using fungal genomic DNA, and also examined 42 clinical specimens with our real-time PCR. The primers and probes specifically detected T. rubrum, T. mentagrophytes, and a wide range of pathogenic fungi. The causative pathogens were identified in 42 nail and skin samples from 32 patients. The total time required for identification of fungal species in each clinical specimen was about 3h. The copy number of each fungal DNA in the clinical specimens was estimated from the intensity of fluorescence simultaneously. This PCR system is one of the most rapid and sensitive methods available for diagnosing dermatophytosis, including tinea unguium and tinea pedis. Copyright © 2012 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

Universal digital high-resolution melt: a novel approach to broad-based profiling of heterogeneous biological samples.

PubMed

Fraley, Stephanie I; Hardick, Justin; Masek, Billie J; Jo Masek, Billie; Athamanolap, Pornpat; Rothman, Richard E; Gaydos, Charlotte A; Carroll, Karen C; Wakefield, Teresa; Wang, Tza-Huei; Yang, Samuel

2013-10-01

Comprehensive profiling of nucleic acids in genetically heterogeneous samples is important for clinical and basic research applications. Universal digital high-resolution melt (U-dHRM) is a new approach to broad-based PCR diagnostics and profiling technologies that can overcome issues of poor sensitivity due to contaminating nucleic acids and poor specificity due to primer or probe hybridization inaccuracies for single nucleotide variations. The U-dHRM approach uses broad-based primers or ligated adapter sequences to universally amplify all nucleic acid molecules in a heterogeneous sample, which have been partitioned, as in digital PCR. Extensive assay optimization enables direct sequence identification by algorithm-based matching of melt curve shape and Tm to a database of known sequence-specific melt curves. We show that single-molecule detection and single nucleotide sensitivity is possible. The feasibility and utility of U-dHRM is demonstrated through detection of bacteria associated with polymicrobial blood infection and microRNAs (miRNAs) associated with host response to infection. U-dHRM using broad-based 16S rRNA gene primers demonstrates universal single cell detection of bacterial pathogens, even in the presence of larger amounts of contaminating bacteria; U-dHRM using universally adapted Lethal-7 miRNAs in a heterogeneous mixture showcases the single copy sensitivity and single nucleotide specificity of this approach.

Universal primers for amplification of the complete mitochondrial control region in marine fish species.

PubMed

Cheng, Y Z; Xu, T J; Jin, X X; Tang, D; Wei, T; Sun, Y Y; Meng, F Q; Shi, G; Wang, R X

2012-01-01

Through multiple alignment analysis of mitochondrial tRNA-Thr and tRNA-Phe sequences from 161 fishes, new universal primers specially targeting the entire mitochondrial control region were designed. This new primer set successfully amplified the expected PCR products from various kinds of marine fish species, belonging to various families, and the amplified segments were confirmed to be the control region by sequencing. These primers provide a useful tool to study the control region diversity in economically important fish species, the possible mechanism of control region evolution, and the functions of the conserved motifs in the control region.

Genetic heterogeneity of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks collected in Belgium.

PubMed

Misonne, M C; Van Impe, G; Hoet, P P

1998-11-01

Borrelia burgdorferi sensu lato (s.l.), the etiological agent of Lyme disease, is transmitted by the bite of Ixodes ricinus. Four hundred eighty-nine ticks, collected in four locations of a region of southern Belgium where Lyme disease is endemic, were examined for the presence of the spirochete. In a PCR test with primers that recognize a chromosomal gene of all strains, 23% of the ticks were found to be infected. The species B. burgdorferi s.l. comprises at least three pathogenic genomospecies, B. burgdorferi sensu stricto (s.s.), Borrelia garinii, and Borrelia afzelii, which could be distinguished in PCR tests with species-specific primers that correspond to distinct plasmid sequences. B. garinii was most prevalent (53% of infected ticks), followed by B. burgdorferi s.s. (38%) and B. afzelii (9%). Of the infected ticks, 40% were infected with a single species, 40% were infected with two species, and 5% were infected with all three species. For 15% of the ticks, the infecting species could not be identified. No difference in rates of prevalence was observed among the four locations, which had similar ground covers, even though they belonged to distinct biogeographic regions. A greater heterogeneity of spirochetal DNA in ticks than in cultured reference DNA was suggested by a comparison of the results of PCRs with two different sets of species-specific primer sequences.

Discovery of variant infectious salmon anaemia virus (ISAV) of European genotype in British Columbia, Canada.

PubMed

Kibenge, Molly Jt; Iwamoto, Tokinori; Wang, Yingwei; Morton, Alexandra; Routledge, Richard; Kibenge, Frederick Sb

2016-01-06

Infectious salmon anaemia (ISA) virus (ISAV) belongs to the genus Isavirus, family Orthomyxoviridae. ISAV occurs in two basic genotypes, North American and European. The European genotype is more widespread and shows greater genetic variation and greater virulence variation than the North American genotype. To date, all of the ISAV isolates from the clinical disease, ISA, have had deletions in the highly polymorphic region (HPR) on ISAV segment 6 (ISAV-HPRΔ) relative to ISAV-HPR0, named numerically from ISAV-HPR1 to over ISAV-HPR30. ISA outbreaks have only been reported in farmed Atlantic salmon, although ISAV has been detected by RT-PCR in wild fish. It is recognized that asymptomatically ISAV-infected fish exist. There is no universally accepted ISAV RT-qPCR TaqMan® assay. Most diagnostic laboratories use the primer-probe set targeting a 104 bp-fragment on ISAV segment 8. Some laboratories and researchers have found a primer-probe set targeting ISAV segment 7 to be more sensitive. Other researchers have published different ISAV segment 8 primer-probe sets that are highly sensitive. In this study, we tested 1,106 fish tissue samples collected from (i) market-bought farmed salmonids and (ii) wild salmon from throughout British Columbia (BC), Canada, for ISAV using real time RT-qPCR targeting segment 8 and/or conventional RT-PCR with segment 8 primers and segment 6 HPR primers, and by virus isolation attempts using Salmon head kidney (SHK-1 and ASK-2) cell line monolayers. The sequences from the conventional PCR products were compared by multiple alignment and phylogenetic analyses. Seventy-nine samples were "non-negative" with at least one of these tests in one or more replicates. The ISAV segment 6 HPR sequences from the PCR products matched ISAV variants, HPR5 on 29 samples, one sample had both HPR5 and HPR7b and one matched HPR0. All sequences were of European genotype. In addition, alignment of sequences of the conventional PCR product segment 8 showed they had a single nucleotide mutation in the region of the probe sequence and a 9-nucleotide overlap with the reverse primer sequence of the real time RT-qPCR assay. None of the classical ISAV segment 8 sequences in the GenBank have this mutation in the probe-binding site of the assay, suggesting the presence of a novel ISAV variant in BC. A phylogenetic tree of these sequences showed that some ISAV sequences diverted early from the classical European genotype sequences, while others have evolved separately. All virus isolation attempts on the samples were negative, and thus the samples were considered "negative" in terms of the threshold trigger set for Canadian federal regulatory action; i.e., successful virus isolation in cell culture. This is the first published report of the detection of ISAV sequences in fish from British Columbia, Canada. The sequences detected, both of ISAV-HPRΔ and ISAV-HPR0 are of European genotype. These sequences are different from the classical ISAV segment 8 sequences, and this difference suggests the presence of a new ISAV variant of European genotype in BC. Our results further suggest that ISAV-HPRΔ strains can be present without clinical disease in farmed fish and without being detected by virus isolation using fish cell lines.

A rapid and efficient newly established method to detect COL1A1-PDGFB gene fusion in dermatofibrosarcoma protuberans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yokoyama, Yoko; Shimizu, Akira; Okada, Etsuko

Highlights: Black-Right-Pointing-Pointer We developed new method to rapidly identify COL1A1-PDGFB fusion in DFSP. Black-Right-Pointing-Pointer New PCR method using a single primer pair detected COL1A1-PDGFB fusion in DFSP. Black-Right-Pointing-Pointer This is the first report of DFSP with a novel COL1A1 breakpoint in exon 5. -- Abstract: The detection of fusion transcripts of the collagen type 1{alpha}1 (COL1A1) and platelet-derived growth factor-BB (PDGFB) genes by genetic analysis has recognized as a reliable and valuable molecular tool for the diagnosis of dermatofibrosarcoma protuberans (DFSP). To detect the COL1A1-PDGFB fusion, almost previous reports performed reverse transcription polymerase chain reaction (RT-PCR) using multiplex forward primersmore » from COL1A1. However, it has possible technical difficulties with respect to the handling of multiple primers and reagents in the procedure. The objective of this study is to establish a rapid, easy, and efficient one-step method of PCR using only a single primer pair to detect the fusion transcripts of the COL1A1 and PDGFB in DFSP. To validate new method, we compared the results of RT-PCR in five patients of DFSP between the previous method using multiplex primers and our established one-step RT-PCR using a single primer pair. In all cases of DFSP, the COL1A1-PDGFB fusion was detected by both previous method and newly established one-step PCR. Importantly, we detected a novel COL1A1 breakpoint in exon 5. The newly developed method is valuable to rapidly identify COL1A1-PDGFB fusion transcripts in DFSP.« less

Development and Evaluation of a Single-Step Duplex PCR for Simultaneous Detection of Fasciola hepatica and Fasciola gigantica (Family Fasciolidae, Class Trematoda, Phylum Platyhelminthes)

PubMed Central

Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van

2012-01-01

A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap. PMID:22692744

Development and evaluation of a single-step duplex PCR for simultaneous detection of Fasciola hepatica and Fasciola gigantica (family Fasciolidae, class Trematoda, phylum Platyhelminthes).

PubMed

Le, Thanh Hoa; Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van

2012-08-01

A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap.

PCR amplification and genetic analysis in a microwell cell culturing chip.

PubMed

Lindström, Sara; Hammond, Maria; Brismar, Hjalmar; Andersson-Svahn, Helene; Ahmadian, Afshin

2009-12-21

We have previously described a microwell chip designed for high throughput, long-term single-cell culturing and clonal analysis in individual wells providing a controlled way of studying high numbers of individual adherent or non-adherent cells. Here we present a method for the genetic analysis of cells cultured on-chip by PCR and minisequencing, demonstrated using two human adherent cell lines: one wild type and one with a single-base mutation in the p53 gene. Five wild type or mutated cells were seeded per well (in a defined set of wells, each holding 500 nL of culture medium) in a 672-microwell chip. The cell chip was incubated overnight, or cultured for up to five days, depending on the desired colony size, after which the cells were lysed and subjected to PCR directly in the wells. PCR products were detected, in the wells, using a biotinylated primer and a fluorescently labelled primer, allowing the products to be captured on streptavidin-coated magnetic beads and detected by a fluorescence microscope. In addition, to enable genetic analysis by minisequencing, the double-stranded PCR products were denatured and the immobilized strands were kept in the wells by applying a magnetic field from the bottom of the wells while the wells were washed, a minisequencing reaction mixture was added, and after incubation in appropriate conditions the expected genotypes were detected in the investigated microwells, simultaneously, by an array scanner. We anticipate that the technique could be used in mutation frequency screening, providing the ability to correlate cells' proliferative heterogeneity to their genetic heterogeneity, in hundreds of samples simultaneously. The presented method of single-cell culture and DNA amplification thus offers a potentially powerful alternative to single-cell PCR, with advantageous robustness and sensitivity.

Evaluating Detection Limits of Next-Generation Sequencing for the Surveillance and Monitoring of International Marine Pests

PubMed Central

Pochon, Xavier; Bott, Nathan J.; Smith, Kirsty F.; Wood, Susanna A.

2013-01-01

Most surveillance programmes for marine invasive species (MIS) require considerable taxonomic expertise, are laborious, and are unable to identify species at larval or juvenile stages. Therefore, marine pests may go undetected at the initial stages of incursions when population densities are low. In this study, we evaluated the ability of the benchtop GS Junior™ 454 pyrosequencing system to detect the presence of MIS in complex sample matrices. An initial in-silico evaluation of the mitochondrial cytochrome c oxidase subunit I (COI) and the nuclear small subunit ribosomal DNA (SSU) genes, found that multiple primer sets (targeting a ca. 400 base pair region) would be required to obtain species level identification within the COI gene. In contrast a single universal primer set was designed to target the V1–V3 region of SSU, allowing simultaneous PCR amplification of a wide taxonomic range of MIS. To evaluate the limits of detection of this method, artificial contrived communities (10 species from 5 taxonomic groups) were created using varying concentrations of known DNA samples and PCR products. Environmental samples (water and sediment) spiked with one or five 160 hr old Asterias amurensis larvae were also examined. Pyrosequencing was able to recover DNA/PCR products of individual species present at greater than 0.64% abundance from all tested contrived communities. Additionally, single A. amurensis larvae were detected from both water and sediment samples despite the co-occurrence of a large array of environmental eukaryotes, indicating an equivalent sensitivity to quantitative PCR. NGS technology has tremendous potential for the early detection of marine invasive species worldwide. PMID:24023913

Multiplex real-time PCR using temperature sensitive primer-supplying hydrogel particles and its application for malaria species identification

PubMed Central

Byoun, Mun Sub; Yoo, Changhoon; Sim, Sang Jun; Lim, Chae Seung; Kim, Sung Woo

2018-01-01

Real-time PCR, also called quantitative PCR (qPCR), has been powerful analytical tool for detection of nucleic acids since it developed. Not only for biological research but also for diagnostic needs, qPCR technique requires capacity to detect multiple genes in recent years. Solid phase PCR (SP-PCR) where one or two directional primers are immobilized on solid substrates could analyze multiplex genetic targets. However, conventional SP-PCR was subjected to restriction of application for lack of PCR efficiency and quantitative resolution. Here we introduce an advanced qPCR with primer-incorporated network (PIN). One directional primers are immobilized in the porous hydrogel particle by covalent bond and the other direction of primers are temporarily immobilized at so-called 'Supplimers'. Supplimers released the primers to aqueous phase in the hydrogel at the thermal cycling of PCR. It induced the high PCR efficiency over 92% with high reliability. It reduced the formation of primer dimers and improved the selectivity of qPCR thanks to the strategy of 'right primers supplied to right place only'. By conducting a six-plex qPCR of 30 minutes, we analyzed DNA samples originated from malaria patients and successfully identified malaria species in a single reaction. PMID:29293604

MRPrimerV: a database of PCR primers for RNA virus detection

PubMed Central

Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Kim, Doyun; Koo, JaeHyung; Kim, Min-Soo

2017-01-01

Many infectious diseases are caused by viral infections, and in particular by RNA viruses such as MERS, Ebola and Zika. To understand viral disease, detection and identification of these viruses are essential. Although PCR is widely used for rapid virus identification due to its low cost and high sensitivity and specificity, very few online database resources have compiled PCR primers for RNA viruses. To effectively detect viruses, the MRPrimerV database (http://MRPrimerV.com) contains 152 380 247 PCR primer pairs for detection of 1818 viruses, covering 7144 coding sequences (CDSs), representing 100% of the RNA viruses in the most up-to-date NCBI RefSeq database. Due to rigorous similarity testing against all human and viral sequences, every primer in MRPrimerV is highly target-specific. Because MRPrimerV ranks CDSs by the penalty scores of their best primer, users need only use the first primer pair for a single-phase PCR or the first two primer pairs for two-phase PCR. Moreover, MRPrimerV provides the list of genome neighbors that can be detected using each primer pair, covering 22 192 variants of 532 RefSeq RNA viruses. We believe that the public availability of MRPrimerV will facilitate viral metagenomics studies aimed at evaluating the variability of viruses, as well as other scientific tasks. PMID:27899620

Use of PCR-Based Methods for Rapid Differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis

PubMed Central

Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco

1999-01-01

Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412T, which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains. PMID:10508059

Use of PCR-based methods for rapid differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis.

PubMed

Torriani, S; Zapparoli, G; Dellaglio, F

1999-10-01

Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412(T), which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains.

Review of "A School Privatization Primer for Michigan School Officials, Media and Residents"

ERIC Educational Resources Information Center

Belfield, Clive

2008-01-01

Issued by the Mackinac Center for Public Policy, "A School Privatization Primer for Michigan School Officials, Media and Residents" examines the "contracting out" of public school support services--specifically food, transportation, and custodial services. The report describes the prevalence of contracting out and sets forth…

Primers As Socializing Agents in American and Finnish Schools.

ERIC Educational Resources Information Center

Hyona, Jukka; And Others

1995-01-01

Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

DNA barcoding amphibians and reptiles.

PubMed

Vences, Miguel; Nagy, Zoltán T; Sonet, Gontran; Verheyen, Erik

2012-01-01

Only a few major research programs are currently targeting COI barcoding of amphibians and reptiles (including chelonians and crocodiles), two major groups of tetrapods. Amphibian and reptile species are typically old, strongly divergent, and contain deep conspecific lineages which might lead to problems in species assignment with incomplete reference databases. As far as known, there is no single pair of COI primers that will guarantee a sufficient rate of success across all amphibian and reptile taxa, or within major subclades of amphibians and reptiles, which means that the PCR amplification strategy needs to be adjusted depending on the specific research question. In general, many more amphibian and reptile taxa have been sequenced for 16S rDNA, which for some purposes may be a suitable complementary marker, at least until a more comprehensive COI reference database becomes available. DNA barcoding has successfully been used to identify amphibian larval stages (tadpoles) in species-rich tropical assemblages. Tissue sampling, DNA extraction, and amplification of COI is straightforward in amphibians and reptiles. Single primer pairs are likely to have a failure rate between 5 and 50% if taxa of a wide taxonomic range are targeted; in such cases the use of primer cocktails or subsequent hierarchical usage of different primer pairs is necessary. If the target group is taxonomically limited, many studies have followed a strategy of designing specific primers which then allow an easy and reliable amplification of all samples.

Evaluation of Different Oligonucleotide Base Substitutions at CpG Binding sites in Multiplex Bisulfite-PCR sequencing.

PubMed

Lu, Jennifer; Ru, Kelin; Candiloro, Ida; Dobrovic, Alexander; Korbie, Darren; Trau, Matt

2017-03-22

Multiplex bisulfite-PCR sequencing is a convenient and scalable method for the quantitative determination of the methylation state of target DNA regions. A challenge of this application is the presence of CpGs in the same region where primers are being placed. A common solution to the presence of CpGs within a primer-binding region is to substitute a base degeneracy at the cytosine position. However, the efficacy of different substitutions and the extent to which bias towards methylated or unmethylated templates may occur has never been evaluated in bisulfite multiplex sequencing applications. In response, we examined the performance of four different primer substitutions at the cytosine position of CpG's contained within the PCR primers. In this study, deoxyinosine-, 5-nitroindole-, mixed-base primers and primers with an abasic site were evaluated across a series of methylated controls. Primers that contained mixed- or deoxyinosine- base modifications performed most robustly. Mixed-base primers were further selected to determine the conditions that induce bias towards methylated templates. This identified an optimized set of conditions where the methylated state of bisulfite DNA templates can be accurately assessed using mixed-base primers, and expands the scope of bisulfite resequencing assays when working with challenging templates.

Long distance PCR in detection of inversion mutations of F8C gene in hemophilia A patients.

PubMed

Poláková, H; Zmetáková, I; Kádasi, L'

2003-06-01

In the present paper, the experience with detection of intron 22 inversion of F8C gene in severe hemophilia A patients using a recently described long-distance PCR (LD-PCR) method was reported. To test the sensitivity and the specifity of the LD-PCR, analysis of 46 DNA samples of patients and their family members, previously tested by Southern hybridization, was performed. In addition, 16 DNA samples of severe hemophilia A patients in which causative mutation was unknown, were included in analysis. Four-primers, P, Q, A&B, which are able to differentiate between the affected males with or without the inversion, and in female carriers, were used in LD-PCR. Two primers, P&Q, are located within the F8C gene flanking int22h1. Two further primers, A&B, flank int22h2 and int22h3, extragene homologs of int22h1. Nine combinations of four primers were used to identify the optimal one. Four-primers (P, Q, A&B), three-primers (P,Q & B;P, A & B; A, B & Q;P, Q & A) and two-primers (A & B; P & Q; A & Q; P & B) PCR amplifications were performed in the hemophilia A patients as well as in obligate carriers DNA samples. Successful amplification required introduction of some modifications of the original protocol. The most reproducible and uniform results were obtained using two-primers PCR, performed in four single reactions. Thus, a total of 46 DNA samples, 22 were hemizygous for inversion, 6 without the inversion, 14 carriers and 4 non-carriers of inversion. Perfect correlation between genotypes determined using Southern hybridization and LD-PCR was achieved. The optimalized two-primers LD-PCR protocol was used for analysis of 16 DNA samples of severe hemophilia A patients with unknown mutation. Ten cases of inversions and six cases without them were detected. Thus in additional 10 severe hemophilic patients DNA diagnosis was completed. The most successful and reproducible results were obtained performing four single LD-PCR reactions with combinations of two-primers A & B; P & Q; A&Q, and P&B in each DNA sample and this approach is recommended for routine using in clinical practice.

MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments.

PubMed

Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

2016-07-08

Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Single Cell Total RNA Sequencing through Isothermal Amplification in Picoliter-Droplet Emulsion.

PubMed

Fu, Yusi; Chen, He; Liu, Lu; Huang, Yanyi

2016-11-15

Prevalent single cell RNA amplification and sequencing chemistries mainly focus on polyadenylated RNAs in eukaryotic cells by using oligo(dT) primers for reverse transcription. We develop a new RNA amplification method, "easier-seq", to reverse transcribe and amplify the total RNAs, both with and without polyadenylate tails, from a single cell for transcriptome sequencing with high efficiency, reproducibility, and accuracy. By distributing the reverse transcribed cDNA molecules into 1.5 × 10 5 aqueous droplets in oil, the cDNAs are isothermally amplified using random primers in each of these 65-pL reactors separately. This new method greatly improves the ease of single-cell RNA sequencing by reducing the experimental steps. Meanwhile, with less chance to induce errors, this method can easily maintain the quality of single-cell sequencing. In addition, this polyadenylate-tail-independent method can be seamlessly applied to prokaryotic cell RNA sequencing.

Development of single-copy nuclear intron markers for species-level phylogenetics: Case study with Paullinieae (Sapindaceae).

PubMed

Chery, Joyce G; Sass, Chodon; Specht, Chelsea D

2017-09-01

We developed a bioinformatic pipeline that leverages a publicly available genome and published transcriptomes to design primers in conserved coding sequences flanking targeted introns of single-copy nuclear loci. Paullinieae (Sapindaceae) is used to demonstrate the pipeline. Transcriptome reads phylogenetically closer to the lineage of interest are aligned to the closest genome. Single-nucleotide polymorphisms are called, generating a "pseudoreference" closer to the lineage of interest. Several filters are applied to meet the criteria of single-copy nuclear loci with introns of a desired size. Primers are designed in conserved coding sequences flanking introns. Using this pipeline, we developed nine single-copy nuclear intron markers for Paullinieae. This pipeline is highly flexible and can be used for any group with available genomic and transcriptomic resources. This pipeline led to the development of nine variable markers for phylogenetic study without generating sequence data de novo.

Rapid detection of Streptococcus pneumoniae by real-time fluorescence loop-mediated isothermal amplification

PubMed Central

Guo, Xu-Guang; Zhou, Shan

2014-01-01

Background and aim of study A significant human pathogenic bacterium, Streptococcus pneumoniae was recognized as a major cause of pneumonia, and is the subject of many humoral immunity studies. Diagnosis is generally made based on clinical suspicion along with a positive culture from a sample from virtually any place in the body. But the testing time is too long. This study is to establish a rapid diagnostic method to identification of Streptococcus pneumoniae. Methods Our laboratory has recently developed a new platform called real-amp, which combines loop-mediated isothermal amplification (LAMP) with a portable tube scanner real-time isothermal instrument for the rapid detection of Streptococcus pneumonia. Two pairs of amplification primers required for this method were derived from a conserved DNA sequence unique to the Streptococcus pneumoniae. The amplification was carried out at 63 degree Celsius using SYBR Green for 60 minutes with the tube scanner set to collect fluorescence signals. Clinical samples of Streptococcus pneumoniae and other bacteria were used to determine the sensitivity and specificity of the primers by comparing with traditional culture method. Results The new set of primers consistently detected in laboratory-maintained isolates of Streptococcus pneumoniae from our hospital. The new primers also proved to be more sensitive than the published species-specific primers specifically developed for the LAMP method in detecting Streptococcus pneumoniae. Conclusions This study demonstrates that the Streptococcus pneumoniae LAMP primers developed here have the ability to accurately detect Streptococcus pneumoniae infections by real-time fluorescence LAMP. PMID:25276360

Pathotypic characterization of Newcastle disease virus isolated from vaccinated chicken in West Java, Indonesia.

PubMed

Putri, Dwi Desmiyeni; Handharyani, Ekowati; Soejoedono, Retno Damajanti; Setiyono, Agus; Mayasari, Ni Luh Putu Ika; Poetri, Okti Nadia

2017-04-01

This research was conducted to differentiate and characterize eight Newcastle disease virus (NDV) isolates collected from vaccinated chicken at commercial flocks in West Java, Indonesia, in 2011, 2014 and 2015 by pathotype specific primers. A total of eight NDV isolates collected from clinical outbreaks among commercial vaccinated flocks in West Java, Indonesia, in 2011, 2014, and 2015 were used in this study. Reverse transcription-polymerase chain reaction was used to detect and differentiate virulence of NDV strains, using three sets of primers targeting their M and F gene. First primers were universal primers to detect NDV targeting matrix (M) gene. Other two sets of primers were specific for the fusion (F) gene cleavage site sequence of virulent and avirulent NDV strains. Our results showed that three isolates belong to NDV virulent strains, and other five isolates belong to NDV avirulent strains. The nucleotide sequence of the F protein cleavage site showed 112 K/R-R-Q/R-K-R/G-F 117 on NDV virulent strains and 112 G-K/R-Q-G-R-L 117 on NDV avirulent strain. Result from the current study suggested that NDV virulent strain were circulating among vaccinated chickens in West Java, Indonesia; this might possess a risk of causing ND outbreaks and causing economic losses within the poultry industry.

Development of a single-tube loop-mediated isothermal amplification assay for detection of four pathogens of bacterial meningitis.

PubMed

Huy, Nguyen Tien; Hang, Le Thi Thuy; Boamah, Daniel; Lan, Nguyen Thi Phuong; Van Thanh, Phan; Watanabe, Kiwao; Huong, Vu Thi Thu; Kikuchi, Mihoko; Ariyoshi, Koya; Morita, Kouichi; Hirayama, Kenji

2012-12-01

Several loop-mediated isothermal amplification (LAMP) assays have been developed to detect common causative pathogens of bacterial meningitis (BM). However, no LAMP assay is reported to detect Streptococcus agalactiae and Streptococcus suis, which are also among common pathogens of BM. Moreover, it is laborious and expensive by performing multiple reactions for each sample to detect bacterial pathogen. Thus, we aimed to design and develop a single-tube LAMP assay capable of detecting multiple bacterial species, based on the nucleotide sequences of the 16S rRNA genes of the bacteria. The nucleotide sequences of the 16S rRNA genes of main pathogens involved in BM were aligned to identify conserved regions, which were further used to design broad range specific LAMP assay primers. We successfully designed a set of broad range specific LAMP assay primers for simultaneous detection of four species including Staphylococcus aureus, Streptococcus pneumoniae, S. suis and S. agalactiae. The broad range LAMP assay was highly specific without cross-reactivity with other bacteria including Haemophilus influenzae, Neisseria meningitidis and Escherichia coli. The sensitivity of our LAMP assay was 100-1000 times higher compared with the conventional PCR assay. The bacterial species could be identified after digestion of the LAMP products with restriction endonuclease DdeI and HaeIII. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Genotyping and Molecular Identification of Date Palm Cultivars Using Inter-Simple Sequence Repeat (ISSR) Markers.

PubMed

Ayesh, Basim M

2017-01-01

Molecular markers are credible for the discrimination of genotypes and estimation of the extent of genetic diversity and relatedness in a set of genotypes. Inter-simple sequence repeat (ISSR) markers rapidly reveal high polymorphic fingerprints and have been used frequently to determine the genetic diversity among date palm cultivars. This chapter describes the application of ISSR markers for genotyping of date palm cultivars. The application involves extraction of genomic DNA from the target cultivars with reliable quality and quantity. Subsequently the extracted DNA serves as a template for amplification of genomic regions flanked by inverted simple sequence repeats using a single primer. The similarity of each pair of samples is measured by calculating the number of mono- and polymorphic bands revealed by gel electrophoresis. Matrices constructed for similarity and genetic distance are used to build a phylogenetic tree and cluster analysis, to determine the molecular relatedness of cultivars. The protocol describes 3 out of 9 tested primers consistently amplified 31 loci in 6 date palm cultivars, with 28 polymorphic loci.

Development of a multiplex PCR assay for the detection and differentiation of Burkholderia pseudomallei, Burkholderia mallei, Burkholderia thailandensis, and Burkholderia cepacia complex.

PubMed

Zakharova, Irina; Teteryatnikova, Natalya; Toporkov, Andrey; Viktorov, Dmitry

2017-10-01

Two species of Burkholderia pseudomallei complex (Bpc), B. pseudomallei and B. mallei, can cause severe life-threatening infections. Rapidly discerning individual species within the group and separating them from other opportunistic pathogens of the Burkholderia cepacia complex (Bcc) is essential to establish a correct diagnosis and for epidemiological surveillance. In this study, a multiplex PCR assay based on the detection of an individual set of chromosomal beta-lactamase genes for single-step identification and differentiation of B. pseudomallei, B. mallei, B. thailandensis, and Bcc was developed. Two pairs of primers specific to a distinct class of B metallo-beta-lactamase genes and a pair of primers specific to the oxacillin-hydrolyzing class D beta-lactamase gene were demonstrated to successfully discriminate species within Bpc and from Bcc. The assay sensitivity was 9561 genomic equivalents (GE) for B. pseudomallei, 7827 GE for B. mallei, 8749 GE for B. thailandensis and 6023 GE for B. cepacia. Copyright © 2017 Elsevier B.V. All rights reserved.

No Child Left Behind Primer. Second Printing. Peter Lang Primer Volume 11

ERIC Educational Resources Information Center

Hess, Frederick M.; Petrilli, Michael J.

2007-01-01

No Child Left Behind (NCLB) is the single most influential piece of federal education legislation in American history, and Hess and Petrilli provide a concise yet comprehensive look at this important and controversial act. Signed into law in 2002, NCLB seeks to ensure that all American students are proficient in math, reading, and science by 2014.…

Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

PubMed Central

Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

2012-01-01

DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

Initialization of Formation Flying Using Primer Vector Theory

NASA Technical Reports Server (NTRS)

Mailhe, Laurie; Schiff, Conrad; Folta, David

2002-01-01

In this paper, we extend primer vector analysis to formation flying. Optimization of the classical rendezvous or free-time transfer problem between two orbits using primer vector theory has been extensively studied for one spacecraft. However, an increasing number of missions are now considering flying a set of spacecraft in close formation. Missions such as the Magnetospheric MultiScale (MMS) and Leonardo-BRDF (Bidirectional Reflectance Distribution Function) need to determine strategies to transfer each spacecraft from the common launch orbit to their respective operational orbit. In addition, all the spacecraft must synchronize their states so that they achieve the same desired formation geometry over each orbit. This periodicity requirement imposes constraints on the boundary conditions that can be used for the primer vector algorithm. In this work we explore the impact of the periodicity requirement in optimizing each spacecraft transfer trajectory using primer vector theory. We first present our adaptation of primer vector theory to formation flying. Using this method, we then compute the AV budget for each spacecraft subject to different formation endpoint constraints.

Assessing the performance of a Loop Mediated Isothermal Amplification (LAMP) assay for the detection and subtyping of high-risk suptypes of Human Papilloma Virus (HPV) for Oropharyngeal Squamous Cell Carcinoma (OPSCC) without DNA purification.

PubMed

Rohatensky, Mitchell G; Livingstone, Devon M; Mintchev, Paul; Barnes, Heather K; Nakoneshny, Steven C; Demetrick, Douglas J; Dort, Joseph C; van Marle, Guido

2018-02-08

Oropharyngeal Squamous Cell Carcinoma (OPSCC) is increasing in incidence despite a decline in traditional risk factors. Human Papilloma Virus (HPV), specifically subtypes 16, 18, 31 and 35, has been implicated as the high-risk etiologic agent. HPV positive cancers have a significantly better prognosis than HPV negative cancers of comparable stage, and may benefit from different treatment regimens. Currently, HPV related carcinogenesis is established indirectly through Immunohistochemistry (IHC) staining for p16, a tumour suppressor gene, or polymerase chain reaction (PCR) that directly tests for HPV DNA in biopsied tissue. Loop mediated isothermal amplification (LAMP) is more accurate than IHC, more rapid than PCR and is significantly less costly. In previous work we showed that a subtype specific HPV LAMP assay performed similar to PCR on purified DNA. In this study we examined the performance of this LAMP assay without DNA purification. We used LAMP assays using established primers for HPV 16 and 18, and new primers for HPV 31 and 35. LAMP reaction conditions were tested on serial dilutions of plasmid HPV DNA to confirm minimum viral copy number detection thresholds. LAMP was then performed directly on different human cell line samples without DNA purification. Our LAMP assays could detect 10 5 , 10 3 , 10 4 , and 10 5 copies of plasmid DNA for HPV 16, 18, 31, and 35, respectively. All primer sets were subtype specific, with no cross-amplification. Our LAMP assays also reliably amplified subtype specific HPV DNA from samples without requiring DNA isolation and purification. The high risk OPSCC HPV subtype specific LAMP primer sets demonstrated, excellent clinically relevant, minimum copy number detection thresholds with an easy readout system. Amplification directly from samples without purification illustrated the robust nature of the assay, and the primers used. This lends further support HPV type specific LAMP assays, and these specific primer sets and assays can be further developed to test for HPV in OPSCC in resource and lab limited settings, or even bedside testing.

Real-time loop-mediated isothermal amplification (RealAmp) for the species-specific identification of Plasmodium vivax.

PubMed

Patel, Jaymin C; Oberstaller, Jenna; Xayavong, Maniphet; Narayanan, Jothikumar; DeBarry, Jeremy D; Srinivasamoorthy, Ganesh; Villegas, Leopoldo; Escalante, Ananias A; DaSilva, Alexandre; Peterson, David S; Barnwell, John W; Kissinger, Jessica C; Udhayakumar, Venkatachalam; Lucchi, Naomi W

2013-01-01

Plasmodium vivax infections remain a major source of malaria-related morbidity and mortality. Early and accurate diagnosis is an integral component of effective malaria control programs. Conventional molecular diagnostic methods provide accurate results but are often resource-intensive, expensive, have a long turnaround time and are beyond the capacity of most malaria-endemic countries. Our laboratory has recently developed a new platform called RealAmp, which combines loop-mediated isothermal amplification (LAMP) with a portable tube scanner real-time isothermal instrument for the rapid detection of malaria parasites. Here we describe new primers for the detection of P. vivax using the RealAmp method. Three pairs of amplification primers required for this method were derived from a conserved DNA sequence unique to the P. vivax genome. The amplification was carried out at 64°C using SYBR Green or SYTO-9 intercalating dyes for 90 minutes with the tube scanner set to collect fluorescence signals at 1-minute intervals. Clinical samples of P. vivax and other human-infecting malaria parasite species were used to determine the sensitivity and specificity of the primers by comparing with an 18S ribosomal RNA-based nested PCR as the gold standard. The new set of primers consistently detected laboratory-maintained isolates of P. vivax from different parts of the world. The primers detected P. vivax in the clinical samples with 94.59% sensitivity (95% CI: 87.48-98.26%) and 100% specificity (95% CI: 90.40-100%) compared to the gold standard nested-PCR method. The new primers also proved to be more sensitive than the published species-specific primers specifically developed for the LAMP method in detecting P. vivax.

A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis

PubMed Central

Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

2012-01-01

In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223

Improving qPCR methodology for detection of foaming bacteria by analysis of broad-spectrum primers and a highly specific probe for quantification of Nocardia spp. in activated sludge.

PubMed

Asvapathanagul, P; Olson, B H

2017-01-01

To develop qPCR broad-spectrum primers combined with a Nocardia genus-specific probe for the identification of a broad spectrum of Nocardia spp. and to analyse the effects of using this developed primer and probe set on the ability to quantify Nocardia spp. in mixed DNA. The consequences of using a degenerative primer set and species-specific probe for the genus Nocardia on qPCR assays were examined using DNA extracts of pure cultures and activated sludge. The mixed DNA extracts where the target organism Nocardia flavorosea concentration ranged from 5 × 10 2 to 5 × 10 6 copies per reaction, while the background organism's DNA (Mycobacterium bovis) concentration was held at 5 × 10 6 copies per reaction, only produced comparable cycle threshold florescence levels when N. flavorosea concentration was greater than or equal to the background organism concentration. When concentrations of N. flavorosea were lowered in increments of 1 log, while holding M. bovis concentrations constant at 5 × 10 6 copies per reaction, all assays demonstrated delayed cycle threshold values with a maximum 34·6-fold decrease in cycle threshold at a ratio of 10 6 M. bovis: 10 2 N. flavorosea copies per reaction. The data presented in this study indicated that increasing the ability of a primer set to capture a broad group of organisms can affect the accuracy of quantification even when a highly specific probe is used. This study examined several applications of molecular tools in complex communities such as evaluating the effect of mispriming vs interference. It also elucidates the importance of understanding the community genetic make-up on primer design. Degenerative primers are very useful in amplifying bacterial DNA across genera, but reduce the efficiency of qPCR reactions. Therefore, standards that address closely related background species must be used to obtain accurate qPCR results. © 2016 The Society for Applied Microbiology.

Loop-mediated isothermal amplification for detection of the tomato and potato late blight pathogen, Phytophthora infestans

USDA-ARS?s Scientific Manuscript database

Aims: To design and validate a colorimetric loop-mediated isothermal amplification assay for rapid detection of P. infestans DNA. Methods and Results: Two sets of LAMP primers were designed and evaluated for their sensitivity and specificity for P. infestans. ITSII primers targeted a portion of the ...

Primer vector theory and applications

NASA Technical Reports Server (NTRS)

Jezewski, D. J.

1975-01-01

A method developed to compute two-body, optimal, N-impulse trajectories was presented. The necessary conditions established define the gradient structure of the primer vector and its derivative for any set of boundary conditions and any number of impulses. Inequality constraints, a conjugate gradient iterator technique, and the use of a penalty function were also discussed.

Detection and Identification of Psilocybe cubensis DNA Using a Real-Time Polymerase Chain Reaction High Resolution Melt Assay.

PubMed

Cowan, Ashley F; Elkins, Kelly M

2017-12-01

Psilocybe cubensis, or "magic mushroom," is the most common species of fungus with psychedelic characteristics. Two primer sets were designed to target Psilocybe DNA using web-based software and NBCI gene sequences. DNA was extracted from eighteen samples, including twelve mushroom species, using the Qiagen DNeasy ® Plant Mini Kit. The DNA was amplified by the polymerase chain reaction (PCR) using the primers and a master mix containing either a SYBR ® Green I, Radiant™ Green, or LCGreen Plus ® intercalating dye; amplicon size was determined using agarose gel electrophoresis. The PCR assays were tested for amplifiability, specificity, reproducibility, robustness, sensitivity, and multiplexing with primers that target marijuana. The observed high resolution melt (HRM) temperatures for primer sets 1 and 7 were 78.85 ± 0.31°C and 73.22 ± 0.61°C, respectively, using SYBR ® Green I dye and 81.67 ± 0.06°C and 76.04 ± 0.11°C, respectively, using Radiant™ Green dye. © 2017 American Academy of Forensic Sciences.

An innovative SNP genotyping method adapting to multiple platforms and throughputs.

PubMed

Long, Y M; Chao, W S; Ma, G J; Xu, S S; Qi, L L

2017-03-01

An innovative genotyping method designated as semi-thermal asymmetric reverse PCR (STARP) was developed for genotyping individual SNPs with improved accuracy, flexible throughputs, low operational costs, and high platform compatibility. Multiplex chip-based technology for genome-scale genotyping of single nucleotide polymorphisms (SNPs) has made great progress in the past two decades. However, PCR-based genotyping of individual SNPs still remains problematic in accuracy, throughput, simplicity, and/or operational costs as well as the compatibility with multiple platforms. Here, we report a novel SNP genotyping method designated semi-thermal asymmetric reverse PCR (STARP). In this method, genotyping assay was performed under unique PCR conditions using two universal priming element-adjustable primers (PEA-primers) and one group of three locus-specific primers: two asymmetrically modified allele-specific primers (AMAS-primers) and their common reverse primer. The two AMAS-primers each were substituted one base in different positions at their 3' regions to significantly increase the amplification specificity of the two alleles and tailed at 5' ends to provide priming sites for PEA-primers. The two PEA-primers were developed for common use in all genotyping assays to stringently target the PCR fragments generated by the two AMAS-primers with similar PCR efficiencies and for flexible detection using either gel-free fluorescence signals or gel-based size separation. The state-of-the-art primer design and unique PCR conditions endowed STARP with all the major advantages of high accuracy, flexible throughputs, simple assay design, low operational costs, and platform compatibility. In addition to SNPs, STARP can also be employed in genotyping of indels (insertion-deletion polymorphisms). As vast variations in DNA sequences are being unearthed by many genome sequencing projects and genotyping by sequencing, STARP will have wide applications across all biological organisms in agriculture, medicine, and forensics.

Rapid development of microsatellite markers with 454 pyrosequencing in a vulnerable fish, the mottled skate, Raja pulchra.

PubMed

Kang, Jung-Ha; Park, Jung-Youn; Jo, Hyun-Su

2012-01-01

The mottled skate, Raja pulchra, is an economically valuable fish. However, due to a severe population decline, it is listed as a vulnerable species by the International Union for Conservation of Nature. To analyze its genetic structure and diversity, microsatellite markers were developed using 454 pyrosequencing. A total of 17,033 reads containing dinucleotide microsatellite repeat units (mean, 487 base pairs) were identified from 453,549 reads. Among 32 loci containing more than nine repeat units, 20 primer sets (62%) produced strong PCR products, of which 14 were polymorphic. In an analysis of 60 individuals from two R. pulchra populations, the number of alleles per locus ranged from 1-10, and the mean allelic richness was 4.7. No linkage disequilibrium was found between any pair of loci, indicating that the markers were independent. The Hardy-Weinberg equilibrium test showed significant deviation in two of the 28 single-loci after sequential Bonferroni's correction. Using 11 primer sets, cross-species amplification was demonstrated in nine related species from four families within two classes. Among the 11 loci amplified from three other Rajidae family species; three loci were polymorphic. A monomorphic locus was amplified in all three Rajidae family species and the Dasyatidae family. Two Rajidae polymorphic loci amplified monomorphic target DNAs in four species belonging to the Carcharhiniformes class, and another was polymorphic in two Carcharhiniformes species.

Rapid Development of Microsatellite Markers with 454 Pyrosequencing in a Vulnerable Fish, the Mottled Skate, Raja pulchra

PubMed Central

Kang, Jung-Ha; Park, Jung-Youn; Jo, Hyun-Su

2012-01-01

The mottled skate, Raja pulchra, is an economically valuable fish. However, due to a severe population decline, it is listed as a vulnerable species by the International Union for Conservation of Nature. To analyze its genetic structure and diversity, microsatellite markers were developed using 454 pyrosequencing. A total of 17,033 reads containing dinucleotide microsatellite repeat units (mean, 487 base pairs) were identified from 453,549 reads. Among 32 loci containing more than nine repeat units, 20 primer sets (62%) produced strong PCR products, of which 14 were polymorphic. In an analysis of 60 individuals from two R. pulchra populations, the number of alleles per locus ranged from 1–10, and the mean allelic richness was 4.7. No linkage disequilibrium was found between any pair of loci, indicating that the markers were independent. The Hardy–Weinberg equilibrium test showed significant deviation in two of the 28 single-loci after sequential Bonferroni’s correction. Using 11 primer sets, cross-species amplification was demonstrated in nine related species from four families within two classes. Among the 11 loci amplified from three other Rajidae family species; three loci were polymorphic. A monomorphic locus was amplified in all three Rajidae family species and the Dasyatidae family. Two Rajidae polymorphic loci amplified monomorphic target DNAs in four species belonging to the Carcharhiniformes class, and another was polymorphic in two Carcharhiniformes species. PMID:22837688

Development of the polymerase chain reaction for diagnosis of chancroid.

PubMed Central

Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R

1993-01-01

The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959

FindGDPs: fast identification of primers for labeling microbial transcriptomes for DNA microarray analysis

PubMed Central

Blick, Robert J.; Revel, Andrew T.; Hansen, Eric J.

2008-01-01

Summary FindGDPs is a program that uses a greedy algorithm to quickly identify a set of genome-directed primers that specifically anneal to all of the open reading frames in a genome and that do not exhibit full-length complementarity to the members of another user-supplied set of nucleotide sequences. Availability The program code is distributed under the GNU General Public License at http://www8.utsouthwestern.edu/utsw/cda/dept131456/files/159331.html Contact eric.hansen@utsouthwestern.edu PMID:15593406

Introducing a primer for career development and promotion: succeeding as a psychologist in an academic health center.

PubMed

Christophersen, Edward; Butt, Zeeshan

2012-12-01

Noting a lack of such a resource, the authors developed a primer summarizing key concepts for career development and promotion for psychologists working in an academic health center. The present article presents a brief summary of the primer; however, the full version is available as an APAHC membership benefit (or for a small fee for non-members) by visiting http://www.div12.org/section8/index.html and is a supplement to the December issue of Volume 19 of the Journal of Clinical Psychology in Medical Settings (Supplementary material 1). The primer complements other APAHC membership benefits, which may be helpful for early career or more seasoned psychologists planning for career transitions.

RAPD-SCAR marker and genetic relationship analysis of three Demodex species (Acari: Demodicidae).

PubMed

Zhao, Ya-E; Wu, Li-Ping

2012-06-01

For a long time, classification of Demodex mites has been mainly based on their hosts and phenotype characteristics. The study was the first to conduct molecular identification and genetic relationship analysis for six isolates of three Demodex species by random amplified polymorphic DNA (RAPD) and sequence-characterized amplified region (SCAR) marker. Totally, 239 DNA fragments were amplified from six Demodex isolates with 10 random primers in RAPD, of which 165 were polymorphic. Using a single primer, at least five fragments and at most 40 in the six isolates were amplified, whereas within a single isolate, a range of 35-49 fragments were amplified. DNA fingerprints of primers CZ 1-9 revealed intra- and interspecies difference in six Demodex isolates, whereas primer CZ 10 only revealed interspecies difference. The genetic distance and dendrogram showed the intraspecific genetic distances were closer than the interspecific genetic distances. The interspecific genetic distances of Demodex folliculorum and Demodex canis (0.7931-0.8140) were shorter than that of Demodex brevis and D. canis (0.8182-0.8987). The RAPD-SCAR marker displayed primer CZ 10 could be applied to identify the three Demodex species. The 479-bp fragment was specific for D. brevis, and the 261-bp fragment was specific for D. canis. The conclusion was that the RAPD-SCAR multi-marker was effective in molecular identification of three Demodex species. The genetic relationship between D. folliculorum and D. canis was nearer than that between D. folliculorum and D. brevis.

Priming cases disturb visual search patterns in screening mammography

NASA Astrophysics Data System (ADS)

Lewis, Sarah J.; Reed, Warren M.; Tan, Alvin N. K.; Brennan, Patrick C.; Lee, Warwick; Mello-Thoms, Claudia

2015-03-01

Rationale and Objectives: To investigate the effect of inserting obvious cancers into a screening set of mammograms on the visual search of radiologists. Previous research presents conflicting evidence as to the impact of priming in scenarios where prevalence is naturally low, such as in screening mammography. Materials and Methods: An observer performance and eye position analysis study was performed. Four expert breast radiologists were asked to interpret two sets of 40 screening mammograms. The Control Set contained 36 normal and 4 malignant cases (located at case # 9, 14, 25 and 37). The Primed Set contained the same 34 normal and 4 malignant cases (in the same location) plus 2 "primer" malignant cases replacing 2 normal cases (located at positions #20 and 34). Primer cases were defined as lower difficulty cases containing salient malignant features inserted before cases of greater difficulty. Results: Wilcoxon Signed Rank Test indicated no significant differences in sensitivity or specificity between the two sets (P > 0.05). The fixation count in the malignant cases (#25, 37) in the Primed Set after viewing the primer cases (#20, 34) decreased significantly (Z = -2.330, P = 0.020). False-Negatives errors were mostly due to sampling in the Primed Set (75%) in contrast to in the Control Set (25%). Conclusion: The overall performance of radiologists is not affected by the inclusion of obvious cancer cases. However, changes in visual search behavior, as measured by eye-position recording, suggests visual disturbance by the inclusion of priming cases in screening mammography.

Primer design for a prokaryotic differential display RT-PCR.

PubMed Central

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-01-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR. PMID:9108168

Primer design for a prokaryotic differential display RT-PCR.

PubMed

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-05-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

Primer and platform effects on 16S rRNA tag sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tremblay, Julien; Singh, Kanwar; Fern, Alison

Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

Primer and platform effects on 16S rRNA tag sequencing

DOE PAGES

Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...

2015-08-04

Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

Single-primer fluorescent sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ruth, J.L.; Morgan, C.A.; Middendorf, L.R.

Modified linker arm oligonucleotides complementary to standard M13 priming sites were synthesized, labelled with either one, two, or three fluoresceins, and purified by reverse-phase HPLC. When used as primers in standard dideoxy M13 sequencing with /sup 32/P-dNTPs, normal autoradiographic patterns were obtained. To eliminate the radioactivity, direct on-line fluorescence detection was achieved by the use of a scanning 10 mW Argon laser emitting 488 nm light. Fluorescent bands were detected directly in standard 0.2 or 0.35 mm thick polyacrylamide gels at a distance of 24 cm from the loading wells by a photomultiplier tube filtered at 520 nm. Horizontal andmore » temporal location of each band was displayed by computer as a band in real time, providing visual appearance similar to normal 4-lane autoradiograms. Using a single primer labelled with two fluoresceins, sequences of between 500 and 600 bases have been read in a single loading with better than 98% accuracy; up to 400 bases can be read reproducibly with no errors. More than 50 sequences have been determined by this method. This approach requires only 1-2 ug of cloned template, and produces continuous sequence data at about one band per minute.« less

High-resolution physical and functional mapping of the template adjacent DNA binding site in catalytically active telomerase.

PubMed

Romi, Erez; Baran, Nava; Gantman, Marina; Shmoish, Michael; Min, Bosun; Collins, Kathleen; Manor, Haim

2007-05-22

Telomerase is a cellular reverse transcriptase, which utilizes an integral RNA template to extend single-stranded telomeric DNA. We used site-specific photocrosslinking to map interactions between DNA primers and the catalytic protein subunit (tTERT) of Tetrahymena thermophila telomerase in functional enzyme complexes. Our assays reveal contact of the single-stranded DNA adjacent to the primer-template hybrid and tTERT residue W187 at the periphery of the N-terminal domain. This contact was detected in complexes with three different registers of template in the active site, suggesting that it is maintained throughout synthesis of a complete telomeric repeat. Substitution of nearby residue Q168, but not W187, alters the K(m) for primer elongation, implying that it plays a role in the DNA recognition. These findings are the first to directly demonstrate the physical location of TERT-DNA contacts in catalytically active telomerase and to identify amino acid determinants of DNA binding affinity. Our data also suggest a movement of the TERT active site relative to the template-adjacent single-stranded DNA binding site within a cycle of repeat synthesis.

Development of PCR primers specific for the amplification and direct sequencing of gyrB genes from microbacteria, order Actinomycetales.

PubMed

Richert, Kathrin; Brambilla, Evelyne; Stackebrandt, Erko

2005-01-01

PCR primer sets were developed for the specific amplification and sequence analyses encoding the gyrase subunit B (gyrB) of members of the family Microbacteriaceae, class Actinobacteria. The family contains species highly related by 16S rRNA gene sequence analyses. In order to test if the gene sequence analysis of gyrB is appropriate to discriminate between closely related species, we evaluate the 16S rRNA gene phylogeny of its members. As the published universal primer set for gyrB failed to amplify the responding gene of the majority of the 80 type strains of the family, three new primer sets were identified that generated fragments with a composite sequence length of about 900 nt. However, the amplification of all three fragments was successful only in 25% of the 80 type strains. In this study, the substitution frequencies in genes encoding gyrase and 16S rDNA were compared for 10 strains of nine genera. The frequency of gyrB nucleotide substitution is significantly higher than that of the 16S rDNA, and no linear correlation exists between the similarities of both molecules among members of the Microbacteriaceae. The phylogenetic analyses using the gyrB sequences provide higher resolution than using 16S rDNA sequences and seem able to discriminate between closely related species.

Differentiation of Mycoplasma gallisepticum vaccine strains ts-11 and 6/85 from commonly used Mycoplasma gallisepticum challenge strains by PCR.

PubMed

Evans, J D; Leigh, S A

2008-09-01

Mycoplasma gallisepticum (MG) is an important avian pathogen causing significant economic losses within the poultry industry. In an effort to develop tools to aid in MG research and diagnostics, we have compared sequences of the attenuated MG vaccine strain ts-11 to those of commonly used pathogenic challenge strains in search of a simple means of differentiation. Via gapA sequence alignments and comparisons, we have identified and designed primers facilitating strain differentiation. When applied to conventional polymerase chain reaction (PCR) assay at low annealing temperature, the primer sets allow for the differentiation of MG attenuated vaccine strains ts-11 as well as the attenuated MG vaccine strain 6/85 from the commonly utilized MG challenge strains R(low), R, and S6. Conventional PCR differentiation is based on the visualization of sole products with the attenuated MG strains ts-11 and 6/85 and the lack of the corresponding products from MG strains R(low), R, and S6. When applied to MG strain F, product visualization varies with the applied primer set. The differentiation of MG strains ts-11 and 6/85 from the pathogenic challenge strains was also accomplished via real-time analyses, however, the primer sets were not able to differentiate MG strains ts-11 and 6/85 from selected MG field isolates.

Permanent Genetic Resources added to Molecular Ecology Resources Database 1 October 2011 – 30 November 2011

PubMed Central

ABREU, ALUANA G.; ALBAINA, A.; ALPERMANN, TILMAN J.; APKENAS, VANESSA E.; BANKHEAD-DRONNET, S.; BERGEK, SARA; BERUMEN, MICHAEL L.; CHO, CHANG-HUNG; CLOBERT, JEAN; COULON, AURÉLIE; DE FERAUDY, D.; ESTONBA, A.; HANKELN, THOMAS; HOCHKIRCH, AXEL; HSU, TSAI-WEN; HUANG, TSURNG-JUHN; IRIGOIEN, X.; IRIONDO, M.; KAY, KATHLEEN M.; KINITZ, TIM; KOTHERA, LINDA; LE HÉNANFF, MAXIME; LIEUTIER, F.; LOURDAIS, OLIVIER; MACRINI, CAMILA M. T.; MANZANO, C.; MARTIN, C.; MORRIS, VERONICA R. F.; NANNINGA, GERRIT; PARDO, M. A.; PLIESKE, JÖRG; POINTEAU, S.; PRESTEGAARD, TORE; QUACK, MARKUS; RICHARD, MURIELLE; SAVAGE, HARRY M.; SCHWARCZ, KAISER D.; SHADE, JESSICA; SIMMS, ELLEN L.; SOLFERINI, VERA N.; STEVENS, VIRGINIE M.; VEITH, MICHAEL; WEN, MEI-JUAN; WICKER, FLORIAN; YOST, JENNIFER M.; ZARRAONAINDIA, I.

2017-01-01

This article documents the addition of 139 microsatellite marker loci and 90 pairs of single-nucleotide polymorphism sequencing primers to the Molecular Ecology Resources Database. Loci were developed for the following species: Aglaoctenus lagotis, Costus pulverulentus, Costus scaber, Culex pipiens, Dascyllus marginatus, Lupinus nanus Benth, Phloeomyzus passerini, Podarcis muralis, Rhododendron rubropilosum Hayata var. taiwanalpinum and Zoarces viviparus. These loci were cross-tested on the following species: Culex quinquefasciatus, Rhododendron pseudochrysanthum Hay. ssp. morii (Hay.) Yamazaki and R. pseudochrysanthum Hayata. This article also documents the addition of 48 sequencing primer pairs and 90 allele-specific primers for Engraulis encrasicolus. PMID:22296658

Rolling Circle Amplification For Spatially Directed Synthesis Of A Solid Phase Anchored Single-Stranded DNA Molecule

NASA Astrophysics Data System (ADS)

Reiß, Edda; Hölzel, Ralph; von Nickisch-Rosenegk, Markus; Bier, Frank F.

2006-09-01

In this article the usefulness of the enzyme phi29 DNA polymerase and the principle of rolling circle amplification (RCA) for creating single-stranded DNA (ssDNA) nanostructures is described. Currently we are working on the spatial orientation of a growing ssDNA molecule during its RCA-based synthesis by the application of a hydrodynamic force. Starting at an immobilized primer at single molecule level, the aim is to construct a nanostructure of known location and orientation, providing multiple repeating binding sites that can be addressed via complementary base-pairing. Proof-of-principle experiments demonstrate the potential of the enzymatic reaction. ssDNA molecules of more than 20 μm length were created at an immobilized primer and detected by means of fluorescence microscopy.

Detection and quantitation of Kaposi's sarcoma-associated herpesvirus (KSHV) by a single competitive-quantitative polymerase chain reaction.

PubMed

Curreli, Francesca; Robles, Monica A; Friedman-Kien, Alvin E; Flore, Ornella

2003-02-01

Kaposi's sarcoma-associated herpesvirus is a novel herpesvirus linked to AIDS-related neoplasms. Currently it is difficult to evaluate the number of virions in viral preparation or in samples obtained from patients with Kaposi's sarcoma (KS), since no protocol for determining the plaque forming units of KSHV exists. We constructed a fragment of a different size than the target viral DNA to carry out a competitive-quantitative PCR. Both fragment and viral DNA were added to a single PCR reaction to compete for the same set of primers. By knowing the amount of the competitor added to the reaction, we could determine the number of viral DNA molecules. We used this assay successfully to detect and quantify KSHV genomes from KS skin biopsies and pleural effusion lymphoma, and from different viral preparations. To date, this is the most convenient and economic method that allows an accurate and fast viral detection/quantitation with a single PCR.

Identification of 29 Rat Genetic Markers by Arbitrarily Primed Polymerase Chain Reaction

PubMed Central

Canzian, Federico; Toyota, Minoru; Hosoya, Yoko; Sugimura, Takashi; Nagao, Minako

1996-01-01

The number of genetic markers for the rat is still limited, in spite of its wide use in cancer research. To facilitate accurate mapping of both established and novel rat genetic markers, we constructed a linkage map by genotyping 105 F2 rats from ACI/N (ACI) and BUF/Nac (BUF) crosses. This map consists of 120 genetic markers that had been previously reported, mainly by two research groups, but had not been integrated. To find new genetic markers, the arbitrarily primed polymerase chain reaction (AP‐PCR) was applied to detect polymorphic bands between ACI and BUF rats. After testing 56 single primers and 12 combinations of primers, we found 36 bands produced by 16 single primers and two combinations to be reliably polymorphic between ACI and BUF rats. The 36 bands were typed in the 105 F2 rats, and 29 of them could be linkage‐mapped. AP‐PCR is thus useful to detect new genetic markers in laboratory strains of rats. PMID:8698613

WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations

PubMed Central

Wangkumhang, Pongsakorn; Chaichoompu, Kridsadakorn; Ngamphiw, Chumpol; Ruangrit, Uttapong; Chanprasert, Juntima; Assawamakin, Anunchai; Tongsima, Sissades

2007-01-01

Background Allele-specific (AS) Polymerase Chain Reaction is a convenient and inexpensive method for genotyping Single Nucleotide Polymorphisms (SNPs) and mutations. It is applied in many recent studies including population genetics, molecular genetics and pharmacogenomics. Using known AS primer design tools to create primers leads to cumbersome process to inexperience users since information about SNP/mutation must be acquired from public databases prior to the design. Furthermore, most of these tools do not offer the mismatch enhancement to designed primers. The available web applications do not provide user-friendly graphical input interface and intuitive visualization of their primer results. Results This work presents a web-based AS primer design application called WASP. This tool can efficiently design AS primers for human SNPs as well as mutations. To assist scientists with collecting necessary information about target polymorphisms, this tool provides a local SNP database containing over 10 million SNPs of various populations from public domain databases, namely NCBI dbSNP, HapMap and JSNP respectively. This database is tightly integrated with the tool so that users can perform the design for existing SNPs without going off the site. To guarantee specificity of AS primers, the proposed system incorporates a primer specificity enhancement technique widely used in experiment protocol. In particular, WASP makes use of different destabilizing effects by introducing one deliberate 'mismatch' at the penultimate (second to last of the 3'-end) base of AS primers to improve the resulting AS primers. Furthermore, WASP offers graphical user interface through scalable vector graphic (SVG) draw that allow users to select SNPs and graphically visualize designed primers and their conditions. Conclusion WASP offers a tool for designing AS primers for both SNPs and mutations. By integrating the database for known SNPs (using gene ID or rs number), this tool facilitates the awkward process of getting flanking sequences and other related information from public SNP databases. It takes into account the underlying destabilizing effect to ensure the effectiveness of designed primers. With user-friendly SVG interface, WASP intuitively presents resulting designed primers, which assist users to export or to make further adjustment to the design. This software can be freely accessed at . PMID:17697334

Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

PubMed

Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

2016-01-01

Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

Single nucleotide primer extension to detect genetic diseases: Experimental application to hemophilia B (factor IX) and cystic fibrosis genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.

1991-02-15

In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5{prime} end of the mutation site, and either an {alpha}-{sup 32}P-labeled nucleotide corresponding tomore » the normal coding sequence at the mutation site or an {alpha}-{sup 32}P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3{prime} to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation.« less

Application of RAPD for molecular characterization of plant species of medicinal value from an arid environment.

PubMed

Arif, I A; Bakir, M A; Khan, H A; Al Farhan, A H; Al Homaidan, A A; Bahkali, A H; Al Sadoon, M; Shobrak, M

2010-11-09

The use of highly discriminatory methods for the identification and characterization of genotypes is essential for plant protection and appropriate use. We utilized the RAPD method for the genetic fingerprinting of 11 plant species of desert origin (seven with known medicinal value). Andrachne telephioides, Zilla spinosa, Caylusea hexagyna, Achillea fragrantissima, Lycium shawii, Moricandia sinaica, Rumex vesicarius, Bassia eriophora, Zygophyllum propinquum subsp migahidii, Withania somnifera, and Sonchus oleraceus were collected from various areas of Saudi Arabia. The five primers used were able to amplify the DNA from all the plant species. The amplified products of the RAPD profiles ranged from 307 to 1772 bp. A total of 164 bands were observed for 11 plant species, using five primers. The number of well-defined and major bands for a single plant species for a single primer ranged from 1 to 10. The highest pair-wise similarities (0.32) were observed between A. fragrantissima and L. shawii, when five primers were combined. The lowest similarities (0) were observed between A. telephioides and Z. spinosa; Z. spinosa and B. eriophora; B. eriophora and Z. propinquum. In conclusion, the RAPD method successfully discriminates among all the plant species, therefore providing an easy and rapid tool for identification, conservation and sustainable use of these plants.

Detection of N2O-producing fungi in environment using nitrite reductase gene (nirK)-targeting primers.

PubMed

Chen, Huaihai; Yu, Fangbo; Shi, Wei

2016-12-01

Fungal denitrification has been increasingly investigated, but its community ecology is poorly understood due to the lack of culture-independent tools. In this work, four pairs of nirK-targeting primers were designed and evaluated for primer specificity and efficiency using thirty N 2 O-producing fungal cultures and an agricultural soil. All primers amplified nirK from fungi and soil, but their efficiency and specificity were different. A primer set, FnirK_F3/R2 amplified ∼80 % of tested fungi, including Aspergillus, Fusarium, Penicillium, and Trichoderma, as compared to ∼40-70 % for other three primers. The nirK fragments of fungal and soil DNA amplified by FnirK_F3/R2 were phylogenetically related to denitrifying fungi in the orders Eurotiales, Hypocreales, and Sordariales; and clone sequences were also distributed in the clusters of Chaetomium, Metarhizium, and Myceliophthora that were uncultured from soil in our previous work. This proved the wide-range capability of primers for amplifying diverse denitrifying fungi from environment. However, our primers and recently-developed other primers amplified bacterial nirK from soil and this co-amplification of fungal and bacterial nirK was theoretically discussed. The FnirK_F3/R2 was further compared with published primers; results from clone libraries demonstrated that FnirK_F3/R2 was more specifically targeted on fungi and had broader taxonomical coverage than some others. Copyright © 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Development of new strains and related SCAR markers for an edible mushroom, Hypsizygus marmoreus.

PubMed

Lee, Chang Y; Park, Jeong-Eun; Lee, Jia; Kim, Jong-Kuk; Ro, Hyeon-Su

2012-02-01

New fast-growing and less bitter varieties of Hypsizygus marmoreus were developed by crossing monokaryotic mycelia from a commercial strain (Hm1-1) and a wild strain (Hm3-10). Six of the better tasting new strains with a shorter cultivation period were selected from 400 crosses in a large-scale cultivation experiment. We attempted to develop sequence characterized amplified region (SCAR) markers to identify the new strain from other commercial strains. For the SCAR markers, we conducted molecular genetic analysis on a wild strain and the eight most cultivated H. marmoreus strains collected from various areas in East Asia by randomly amplified polymorphic DNA. Ten unique DNA bands for a commercial Hm1-1 strain and the Hm3-10 strain were extracted and their sequences were determined. Primer sets were designed based on the determined sequences. PCR reactions with the primer sets revealed that four primer sets successfully discriminated the new strains from other commercial strains and are thus suitable for commercial purposes. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

A new set of primers for the detection of Toxoplasma gondii in amniotic fluid using polymerase chain reaction.

PubMed

Pelloux, H; Weiss, J; Simon, J; Muet, F; Fricker-Hidalgo, H; Goullier-Fleuret, A; Ambroise-Thomas, P

1996-04-15

A new PCR system including a pair of primers, a probe and an internal control were designed from the B1 gene of Toxoplasma gondii. The system described allowed the detection of less than 10 tachyzoites of the RH strain of T. gondii. Among 21 amniotic fluid samples, this system diagnosed the cases of congenital toxoplasmosis which were simultaneously diagnosed using mice inoculation, in vitro culture, and serology from both amniotic fluid and fetal blood. These results show that these new primers allow for a highly sensitive detection of T. gondii DNA.

Analysis of short tandem repeat polymorphisms using infrared fluorescence with M18 tailed primers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oetting, W.S.; Wiesner, G.; Laken, S.

The use of short tandem repeat polymorphisms (STRPs) are becoming increasingly important as markers for linkage analysis due to their large numbers of the human genome and their high degree of polymorphism. Fluorescence based detection of the STRP pattern using the LI-COR model 4000S automated DNA sequencer eliminates the need for radioactivity and produces a digitized image that can be used for the analysis of the polymorphisms. In an effort to reduce the cost of STRP analysis, we have synthesized primers with a 19 bp extension complementary to the sequence of the M13 primer on the 5{prime} end of onemore » of the two primers used in the amplification of the STRP instead of using primers with direct conjugation of the infrared fluorescent dye. Up to 5 primer pairs can be multiplexed together with the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye. Comparisons between primers that have been directly conjugated to the fluor with those having the M13 sequence extension show no difference in the ability to determine the STRP pattern. At present, the entire Weber 4A set of STRP markers is available with the M13 5{prime} extension. We are currently using this technique for linkage analysis of familial breast cancer and asthma. The combination of STRP analysis using fluorescence detection will allow this technique to be fully automated for allele scoring and linkage analysis.« less

Array of Synthetic Oligonucleotides to Generate Unique Multi-Target Artificial Positive Controls and Molecular Probe-Based Discrimination of Liposcelis Species

PubMed Central

Arif, Mohammad; Opit, George; Mendoza-Yerbafría, Abigail; Dobhal, Shefali; Li, Zhihong; Kučerová, Zuzana; Ochoa-Corona, Francisco M.

2015-01-01

Several species of the genus Liposcelis are common insect pests that cause serious qualitative and quantitative losses to various stored grains and processed grain products. They also can contaminate foods, transmit pathogenic microorganisms and cause allergies in humans. The common occurrence of multi-species infestations and the fact that it is difficult to identify and discriminate Liposcelis spp. make accurate, rapid detection and discriminatory tools absolutely necessary for confirmation of their identity. In this study, PCR primers and probes specific to different Liposcelis spp. were designed based on nucleotide sequences of the cytochrome oxidase 1 (CO1) gene. Primer sets ObsCo13F/13R, PeaCo15F/14R, BosCO7F/7R, BruCo5F/5R, and DecCo11F/11R were used to specifically detect Liposcelis obscura Broadhead, Liposcelis pearmani Lienhard, Liposcelis bostrychophila Badonnel, Liposcelis brunnea Motschulsky and Liposcelis decolor (Pearman) in multiplex endpoint PCRs, which amplified products of 438-, 351-, 191-, 140-, and 87-bp, respectively. In multiplex TaqMan qPCR assays, orange, yellow, red, crimson and green channels corresponding to reporter dyes 6-ROXN, HEX, Cy5, Quasar705 and 6-FAM specifically detected L. obscura, L. brunnea, L. bostrychophila, L. pearmani and L. decolor, respectively. All developed primer and probe sets allowed specific amplification of corresponding targeted Liposcelis species. The development of multiplex endpoint PCR and multiplex TaqMan qPCR will greatly facilitate psocid identification and their management. The use of APCs will streamline and standardize PCR assays. APC will also provide the opportunity to have all positive controls in a single tube, which reduces maintenance cost and labor, but increases the accuracy and reliability of the assays. These novel methods from our study will have applications in pest management, biosecurity, quarantine, food safety, and routine diagnostics. PMID:26086728

Different DNA methylation patterns detected by the Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) technique among various cell types of bulls.

PubMed

Phutikanit, Nawapen; Suwimonteerabutr, Junpen; Harrison, Dion; D'Occhio, Michael; Carroll, Bernie; Techakumphu, Mongkol

2010-03-05

The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR) assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII). The native genomic and enzyme treated DNA samples were used as templates in an arbitrarily primed-PCR assay with 30 sets of single short oligonucleotide primer. The PCR products were separated on silver stained denaturing polyacrylamide gels. Three types of PCR markers; digestion resistant-, digestion sensitive-, and digestion dependent markers, were analyzed based on the presence/absence polymorphism of the markers between the two templates. Approximately 1,000 PCR markers per sample were produced from 27 sets of primer and most of them (>90%) were digestion resistant markers. The highest percentage of digestion resistant markers was found in leukocytic DNA (94.8%) and the lowest in fibroblastic DNA (92.3%, P < or = 0.05). Spermatozoa contained a higher number of digestion sensitive markers when compared with the others (3.6% vs. 2.2% and 2.6% in leukocytes and fibroblasts respectively, P < or = 0.05). The powerfulness of the AMP PCR assay was the generation of methylation-associated markers without any prior knowledge of the genomic sequence. The data obtained from different primers provided an overview of genome wide DNA methylation content in different cell types. By using this technique, we found that DNA methylation profile is tissue-specific. Male germ cells were hypomethylated at the HpaII locations when compared with somatic cells, while the chromatin of the well-characterized somatic cells was heavily methylated when compared with that of the versatile somatic cells.

Multianalyte, dipstick-type, nanoparticle-based DNA biosensor for visual genotyping of single-nucleotide polymorphisms.

PubMed

Litos, Ioannis K; Ioannou, Penelope C; Christopoulos, Theodore K; Traeger-Synodinos, Jan; Kanavakis, Emmanuel

2009-06-15

DNA biosensors involve molecular recognition of the target sequence by hybridization with specific probes and detection by electrochemical, optical or gravimetric transduction. Disposable, dipstick-type biosensors have been developed recently, which enable visual detection of DNA without using instruments. In this context, we report a multianalyte DNA biosensor for visual genotyping of two single-nucleotide polymorphisms (SNPs). As a model, the biosensor was applied to the simultaneous genotyping of two SNPs, entailing the detection of four alleles. A PCR product that flanks both polymorphic sites is subjected to a single primer extension (PEXT) reaction employing four allele-specific primers, each containing a region complementary to an allele and a characteristic segment that enables subsequent capture on a test zone of the biosensor. The primers are extended with dNTPs and biotin-dUTP only if there is perfect complementarity with the interrogated sequence. The PEXT mixture is applied to the biosensor. As the developing buffer migrates along the strip, all the allele-specific primers are captured by immobilized oligonucleotides at the four test zones of the biosensor and detected by antibiotin-functionalized gold nanoparticles. As a result, the test zones are colored red if extension has occurred denoting the presence of the corresponding allele in the original sample. The excess nanoparticles are captured by immobilized biotinylated albumin at the control zone of the sensor forming another red zone that indicates the proper performance of the system. The assay was applied successfully to the genotyping of twenty clinical samples for two common SNPs of MBL2 gene.

Primer development to obtain complete coding sequence of HA and NA genes of influenza A/H3N2 virus.

PubMed

Agustiningsih, Agustiningsih; Trimarsanto, Hidayat; Setiawaty, Vivi; Artika, I Made; Muljono, David Handojo

2016-08-30

Influenza is an acute respiratory illness and has become a serious public health problem worldwide. The need to study the HA and NA genes in influenza A virus is essential since these genes frequently undergo mutations. This study describes the development of primer sets for RT-PCR to obtain complete coding sequence of Hemagglutinin (HA) and Neuraminidase (NA) genes of influenza A/H3N2 virus from Indonesia. The primers were developed based on influenza A/H3N2 sequence worldwide from Global Initiative on Sharing All Influenza Data (GISAID) and further tested using Indonesian influenza A/H3N2 archived samples of influenza-like illness (ILI) surveillance from 2008 to 2009. An optimum RT-PCR condition was acquired for all HA and NA fragments designed to cover complete coding sequence of HA and NA genes. A total of 71 samples were successfully sequenced for complete coding sequence both of HA and NA genes out of 145 samples of influenza A/H3N2 tested. The developed primer sets were suitable for obtaining complete coding sequences of HA and NA genes of Indonesian samples from 2008 to 2009.

Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples

PubMed Central

Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

2013-01-01

Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

Optimization of the Divergent method for genotyping single nucleotide variations using SYBR Green-based single-tube real-time PCR.

PubMed

Gentilini, Fabio; Turba, Maria E

2014-01-01

A novel technique, called Divergent, for single-tube real-time PCR genotyping of point mutations without the use of fluorescently labeled probes has recently been reported. This novel PCR technique utilizes a set of four primers and a particular denaturation temperature for simultaneously amplifying two different amplicons which extend in opposite directions from the point mutation. The two amplicons can readily be detected using the melt curve analysis downstream to a closed-tube real-time PCR. In the present study, some critical aspects of the original method were specifically addressed to further implement the technique for genotyping the DNM1 c.G767T mutation responsible for exercise-induced collapse in Labrador retriever dogs. The improved Divergent assay was easily set up using a standard two-step real-time PCR protocol. The melting temperature difference between the mutated and the wild-type amplicons was approximately 5°C which could be promptly detected by all the thermal cyclers. The upgraded assay yielded accurate results with 157pg of genomic DNA per reaction. This optimized technique represents a flexible and inexpensive alternative to the minor grove binder fluorescently labeled method and to high resolution melt analysis for high-throughput, robust and cheap genotyping of single nucleotide variations. Copyright © 2014 Elsevier B.V. All rights reserved.

Hindering the illegal trade in dog and cat furs through a DNA-based protocol for species identification.

PubMed

Garofalo, Luisa; Mariacher, Alessia; Fanelli, Rita; Fico, Rosario; Lorenzini, Rita

2018-01-01

In Western countries dogs and cats are the most popular pets, and people are increasingly opposed to their rearing for the fur industry. In 2007, a Regulation of the European Union (EU) banned the use and trade of dog and cat furs, but an official analytical protocol to identify them as source species was not provided, and violations of law are still frequent in all Member States. In this paper we report on the development and validation of a simple and affordable DNA method for species detection in furs to use as an effective tool to combat illegal trade in fur products. A set of mitochondrial primers was designed for amplification of partial cytochrome b, control region and ND1 gene in highly degraded samples, like furs and pelts. Our amplification workflow involved the use of a non-specific primer pair to perform a first test to identify the species through sequencing, then the application of species-specific primer pairs to use in singleplex end-point PCRs as confirmation tests. The advantage of this two-step procedure is twofold: on the one hand it minimises the possibility of negative test results from degraded samples, since failure of amplification with a first set of primers can be offset by successful amplification of the second, and on the other it adds confidence and reliability to final authentication of species. All designed primers were validated on a reference collection of tissue samples, obtaining solid results in terms of specificity, sensitivity, repeatability and reproducibility. Application of the protocol on real caseworks from seized furs yielded successful results also from old and dyed furs, suggesting that age and chemical staining do not necessarily affect positive amplifications. Major pros of this approach are: (1) sensitive and informative primer sets for detection of species; (2) short PCR amplicons for the analysis of poor quality DNA; (3) binding primers that avoid contamination from human DNA; (4) user-friendly protocol for any laboratory equipped for analysis of low-copy-number DNA. Our molecular procedure proved to be a good starting point for enforcing the EU Regulation against dog and cat fur trade in forensic contexts where source attribution is essential to the assignment of responsibilities.

Dual phase multiplex polymerase chain reaction

DOEpatents

Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL

2008-10-07

Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

An expanded nuclear phylogenomic PCR toolkit for Sapindales1

PubMed Central

Collins, Elizabeth S.; Gostel, Morgan R.; Weeks, Andrea

2016-01-01

Premise of the study: We tested PCR amplification of 91 low-copy nuclear gene loci in taxa from Sapindales using primers developed for Bursera simaruba (Burseraceae). Methods and Results: Cross-amplification of these markers among 10 taxa tested was related to their phylogenetic distance from B. simaruba. On average, each Sapindalean taxon yielded product for 53 gene regions (range: 16–90). Arabidopsis thaliana (Brassicales), by contrast, yielded product for two. Single representatives of Anacardiaceae and Rutacaeae yielded 34 and 26 products, respectively. Twenty-six primer pairs worked for all Burseraceae species tested if highly divergent Aucoumea klaineana is excluded, and eight of these amplified product in every Sapindalean taxon. Conclusions: Our study demonstrates that customized primers for Bursera can amplify product in a range of Sapindalean taxa. This collection of primer pairs, therefore, is a valuable addition to the toolkit for nuclear phylogenomic analyses of Sapindales and warrants further investigation. PMID:28101434

Robotic Enrichment Processing of Roche 454 Titanium Emlusion PCR at the DOE Joint Genome Institute

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hamilton, Matthew; Wilson, Steven; Bauer, Diane

2010-05-28

Enrichment of emulsion PCR product is the most laborious and pipette-intensive step in the 454 Titanium process, posing the biggest obstacle for production-oriented scale up. The Joint Genome Institute has developed a pair of custom-made robots based on the Microlab Star liquid handling deck manufactured by Hamilton to mediate the complexity and ergonomic demands of the 454 enrichment process. The robot includes a custom built centrifuge, magnetic deck positions, as well as heating and cooling elements. At present processing eight emulsion cup samples in a single 2.5 hour run, these robots are capable of processing up to 24 emulsion cupmore » samples. Sample emulsions are broken using the standard 454 breaking process and transferred from a pair of 50ml conical tubes to a single 2ml tube and loaded on the robot. The robot performs the enrichment protocol and produces beads in 2ml tubes ready for counting. The robot follows the Roche 454 enrichment protocol with slight exceptions to the manner in which it resuspends beads via pipette mixing rather than vortexing and a set number of null bead removal washes. The robotic process is broken down in similar discrete steps: First Melt and Neutralization, Enrichment Primer Annealing, Enrichment Bead Incubation, Null Bead Removal, Second Melt and Neutralization and Sequencing Primer Annealing. Data indicating our improvements in enrichment efficiency and total number of bases per run will also be shown.« less

Development of a simple and practical method of discrimination between Vibrio furnissii and V. fluvialis based on single-nucleotide polymorphisms of 16S rRNA genes observed in V. furnissii but not in V. fluvialis.

PubMed

Takajo, Ichiro; Yamada, Akiteru; Umeki, Kazumi; Saeki, Yuji; Hashikura, Yuuki; Yamamoto, Ikuo; Umekita, Kunihiko; Urayama-Kawano, Midori; Yamasaki, Shogo; Taniguchi, Takako; Misawa, Naoaki; Okayama, Akihiko

2018-01-01

Vibrio furnissii and V. fluvialis are closely related, the discrimination of which by conventional biochemical assay remains a challenge. Investigation of the sequence of the 16S rRNA genes in a clinical isolate of V. furnissii by visual inspection of a sequencing electropherogram revealed two sites of single-nucleotide polymorphisms (SNPs; positions 460 A/G and 1261 A/G) in these genes. A test of 12 strains each of V. fluvialis and V. furnissii revealed these SNPs to be common in V. furnissii but not in V. fluvialis. Divergence of SNP frequency was observed among the strains of V. furnissii tested. Because the SNPs described in V. furnissii produce a difference in the target sequence of restriction enzymes, a combination of polymerase chain reaction (PCR) of the 16S rRNA genes using conventional primers and restriction fragment length polymorphism analysis using Eco RV and Eae I was shown to discriminate between V. fluvialis and V. furnissii. This method is simple and alleviates the need for expensive equipment or primer sets specific to these bacteria. Therefore, we believe that this method can be useful, alongside specific PCR and mass spectrometry, when there is a need to discriminate between V. fluvialis and V. furnissii. Copyright © 2017 Elsevier B.V. All rights reserved.

Genic and Intergenic SSR Database Generation, SNPs Determination and Pathway Annotations, in Date Palm (Phoenix dactylifera L.).

PubMed

Mokhtar, Morad M; Adawy, Sami S; El-Assal, Salah El-Din S; Hussein, Ebtissam H A

2016-01-01

The present investigation was carried out aiming to use the bioinformatics tools in order to identify and characterize, simple sequence repeats within the third Version of the date palm genome and develop a new SSR primers database. In addition single nucleotide polymorphisms (SNPs) that are located within the SSR flanking regions were recognized. Moreover, the pathways for the sequences assigned by SSR primers, the biological functions and gene interaction were determined. A total of 172,075 SSR motifs was identified on date palm genome sequence with a frequency of 450.97 SSRs per Mb. Out of these, 130,014 SSRs (75.6%) were located within the intergenic regions with a frequency of 499 SSRs per Mb. While, only 42,061 SSRs (24.4%) were located within the genic regions with a frequency of 347.5 SSRs per Mb. A total of 111,403 of SSR primer pairs were designed, that represents 291.9 SSR primers per Mb. Out of the 111,403, only 31,380 SSR primers were in the genic regions, while 80,023 primers were in the intergenic regions. A number of 250,507 SNPs were recognized in 84,172 SSR flanking regions, which represents 75.55% of the total SSR flanking regions. Out of 12,274 genes only 463 genes comprising 896 SSR primers were mapped onto 111 pathways using KEGG data base. The most abundant enzymes were identified in the pathway related to the biosynthesis of antibiotics. We tested 1031 SSR primers using both publicly available date palm genome sequences as templates in the in silico PCR reactions. Concerning in vitro validation, 31 SSR primers among those used in the in silico PCR were synthesized and tested for their ability to detect polymorphism among six Egyptian date palm cultivars. All tested primers have successfully amplified products, but only 18 primers detected polymorphic amplicons among the studied date palm cultivars.

A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forwardmore » or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource-limited environments.« less

Primer Modification Improves Rapid and Sensitive In Vitro and Field-Deployable Assays for Detection of High Plains Virus Variants

PubMed Central

Arif, M.; Aguilar-Moreno, G. S.; Wayadande, A.; Fletcher, J.

2014-01-01

A high consequence pathogen, High plains virus (HPV) causes considerable damage to wheat if the crop is infected during early stages of development. Methods for the early, accurate, and sensitive detection of HPV in plant tissues are needed for the management of disease outbreaks and reservoir hosts. In this study, the effectiveness of five methods—real-time SYBR green and TaqMan reverse transcription-quantitative PCR (RT-qPCR), endpoint RT-PCR, RT-helicase dependent amplification (RT-HDA) and the Razor Ex BioDetection System (Razor Ex)—for the broad-range detection of HPV variants was evaluated. Specific PCR primer sets and probes were designed to target the HPV nucleoprotein gene. Primer set HPV6F and HPV4R, which amplifies a product of 96 bp, was validated in silico against published sequences and in vitro against an inclusivity panel of infected plant samples and an exclusivity panel of near-neighbor viruses. The primers were modified by adding a customized 22 nucleotide long tail at the 5′ terminus, raising the primers' melting temperature (Tm; ca. 10°C) to make them compatible with RT-HDA (required optimal Tm = 68°C), in which the use of primers lacking such tails gave no amplification. All of the methods allowed the detection of as little as 1 fg of either plasmid DNA carrying the target gene sequence or of infected plant samples. The described in vitro and in-field assays are accurate, rapid, sensitive, and useful for pathogen detection and disease diagnosis, microbial quantification, and certification and breeding programs, as well as for biosecurity and microbial forensics applications. PMID:24162574

A method for automatically extracting infectious disease-related primers and probes from the literature

PubMed Central

2010-01-01

Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1) convert each document into a tree of paper sections, (2) detect the candidate sequences using a set of finite state machine-based recognizers, (3) refine problem sequences using a rule-based expert system, and (4) annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch. PMID:20682041

Development and validation of broad-range qualitative and clade-specific quantitative molecular probes for assessing mercury methylation in the environment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Christensen, Geoff A.; Wymore, Ann M.; King, Andrew J.

Two genes, hgcA and hgcB, are essential for microbial mercury (Hg)-methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability and biogeochemistry is critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea. A distinct PCR product at the expected size was confirmed for all hgcAB+ strains tested via Sanger sequencing.more » Additionally, we developed clade-specific degenerate quantitative primers (qPCR) that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88% and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. Here, the resulting data will be essential in developing accurate and robust predictive models of Hg-methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB.« less

Development and validation of broad-range qualitative and clade-specific quantitative molecular probes for assessing mercury methylation in the environment

DOE PAGES

Christensen, Geoff A.; Wymore, Ann M.; King, Andrew J.; ...

2016-07-15

Two genes, hgcA and hgcB, are essential for microbial mercury (Hg)-methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability and biogeochemistry is critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea. A distinct PCR product at the expected size was confirmed for all hgcAB+ strains tested via Sanger sequencing.more » Additionally, we developed clade-specific degenerate quantitative primers (qPCR) that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88% and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. Here, the resulting data will be essential in developing accurate and robust predictive models of Hg-methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB.« less

Crystallographic observation of nonenzymatic RNA primer extension.

PubMed

Zhang, Wen; Walton, Travis; Li, Li; Szostak, Jack W

2018-05-31

The importance of genome replication has inspired detailed crystallographic studies of enzymatic DNA/RNA polymerization. In contrast, the mechanism of nonenzymatic polymerization is less well understood, despite its critical role in the origin of life. Here we report the direct observation of nonenzymatic RNA primer extension through time-resolved crystallography. We soaked crystals of an RNA primer-template-dGMP complex with guanosine-5'-phosphoro-2-aminoimidazolide for increasing times. At early times we see the activated ribonucleotides bound to the template, followed by formation of the imidazolium-bridged dinucleotide intermediate. At later times, we see a new phosphodiester bond forming between the primer and the incoming nucleotide. The intermediate is pre-organized because of the constraints of base-pairing with the template and hydrogen bonding between the imidazole amino group and both flanking phosphates. Our results provide atomic-resolution insight into the mechanism of nonenzymatic primer extension, and set the stage for further structural dissection and optimization of the RNA copying process. © 2018, Zhang et al.

Molecular diagnosis of group B coltiviruses infections.

PubMed

Billoir, F; Attoui, H; Simon, S; Gallian, P; de Micco, P; de Lamballerie, X

1999-08-01

The group-B of genus Coltivirus encompasses isolates from humans, ticks or mosquitoes collected in Indonesia and China. Subgroup-B1 includes the strain JKT/dsR-7075 and subgroup-B2 strains JKT/dsR-6423, JKT/dsR-6969, JKT/dsR-7043 and the Banna virus. Data are described for the PCR-based diagnosis of infection by group B coltiviruses. Sets of primers were designed from the sequences of the 7th, 9th and 12th viral segments and RT PCR assays were developed. Consensus primers permitted the detection of all known isolates of subgroup 1 or 2. Viral strains could be characterised further using primers specific for type B2a or B2b, or based on the length of the amplification products. All primers gave negative results when using RNAs from Orbiviruses or Group-A coltiviruses. These primers permitted the detection of Group-B coltiviruses-RNA in infected mouse blood at the acute stage of the disease. Accordingly, they could be used for the diagnosis of infection in humans.

Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using

DOEpatents

Weier, H.U.G.; Gray, J.W.

1995-06-27

A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers and probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity. 18 figs.

Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using

DOEpatents

Weier, Heinz-Ulrich G.; Gray, Joe W.

1995-01-01

A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers ard probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity.

Molecular Tools for the Detection of Nitrogen Cycling Archaea

PubMed Central

Rusch, Antje

2013-01-01

Archaea are widespread in extreme and temperate environments, and cultured representatives cover a broad spectrum of metabolic capacities, which sets them up for potentially major roles in the biogeochemistry of their ecosystems. The detection, characterization, and quantification of archaeal functions in mixed communities require Archaea-specific primers or probes for the corresponding metabolic genes. Five pairs of degenerate primers were designed to target archaeal genes encoding key enzymes of nitrogen cycling: nitrite reductases NirA and NirB, nitrous oxide reductase (NosZ), nitrogenase reductase (NifH), and nitrate reductases NapA/NarG. Sensitivity towards their archaeal target gene, phylogenetic specificity, and gene specificity were evaluated in silico and in vitro. Owing to their moderate sensitivity/coverage, the novel nirB-targeted primers are suitable for pure culture studies only. The nirA-targeted primers showed sufficient sensitivity and phylogenetic specificity, but poor gene specificity. The primers designed for amplification of archaeal nosZ performed well in all 3 criteria; their discrimination against bacterial homologs appears to be weakened when Archaea are strongly outnumbered by bacteria in a mixed community. The novel nifH-targeted primers showed high sensitivity and gene specificity, but failed to discriminate against bacterial homologs. Despite limitations, 4 of the new primer pairs are suitable tools in several molecular methods applied in archaeal ecology. PMID:23365509

A tailing genome walking method suitable for genomes with high local GC content.

PubMed

Liu, Taian; Fang, Yongxiang; Yao, Wenjuan; Guan, Qisai; Bai, Gang; Jing, Zhizhong

2013-10-15

The tailing genome walking strategies are simple and efficient. However, they sometimes can be restricted due to the low stringency of homo-oligomeric primers. Here we modified their conventional tailing step by adding polythymidine and polyguanine to the target single-stranded DNA (ssDNA). The tailed ssDNA was then amplified exponentially with a specific primer in the known region and a primer comprising 5' polycytosine and 3' polyadenosine. The successful application of this novel method for identifying integration sites mediated by φC31 integrase in goat genome indicates that the method is more suitable for genomes with high complexity and local GC content. Copyright © 2013 Elsevier Inc. All rights reserved.

Novel nuclear intron-spanning primers for Arecaceae evolutionary biology.

PubMed

Bacon, Christine D; Feltus, F Alex; Paterson, Andrew H; Bailey, C Donovan

2008-01-01

In this study, 96 nuclear 'conserved intron-scanning primers' were screened across subfamilies the Arecaceae (palms) for potential use in research focused on palm evolutionary biology. Primers were evaluated based on their ability to amplify single polymerase chain reaction products in Arecaceae, the clarity of sequencing reads, and the interspecific variability observed. Ultimately, the results suggest that: (i) seven of the loci are likely to be suitable when comparing non-Arecaceae outgroups and Arecaceae ingroups; (ii) seven loci may be of use when comparing subfamilies of Arecaceae; and (iii) four of the loci may be of use when comparing closely related genera. © 2007 Blackwell Publishing Ltd No claim to original US government works.

S-genotype identification based on allele-specific PCR in Japanese pear

PubMed Central

Nashima, Kenji; Terakami, Shingo; Nishio, Sogo; Kunihisa, Miyuki; Nishitani, Chikako; Saito, Toshihiro; Yamamoto, Toshiya

2015-01-01

Gametophytic self-incompatibility in Japanese pear (Pyrus pyrifolia Nakai) is controlled by the single, multi-allelic S-locus. Information about the S-genotypes is important for breeding and the selection of pollen donors for fruit production. Rapid and reliable S-genotype identification system is necessary for efficient breeding of new cultivars in Japanese pear. We designed S allele-specific PCR primer pairs for ten previously reported S-RNase alleles (S1–S9 and Sk) as simple and reliable method. Specific nucleotide sequences were chosen to design the primers to amplify fragments of only the corresponding S alleles. The developed primer pairs were evaluated by using homozygous S-genotypes (S1/S1–S9/S9 and S4sm/S4sm) and 14 major Japanese pear cultivars, and found that S allele-specific primer pairs can identify S-genotypes effectively. The S allele-specific primer pairs developed in this study will be useful for efficient S-genotyping and for marker-assisted selection in Japanese pear breeding programs. PMID:26175617

Metabolic primers for detection of (Per)chlorate-reducing bacteria in the environment and phylogenetic analysis of cld gene sequences.

PubMed

Bender, Kelly S; Rice, Melissa R; Fugate, William H; Coates, John D; Achenbach, Laurie A

2004-09-01

Natural attenuation of the environmental contaminant perchlorate is a cost-effective alternative to current removal methods. The success of natural perchlorate remediation is dependent on the presence and activity of dissimilatory (per)chlorate-reducing bacteria (DPRB) within a target site. To detect DPRB in the environment, two degenerate primer sets targeting the chlorite dismutase (cld) gene were developed and optimized. A nested PCR approach was used in conjunction with these primer sets to increase the sensitivity of the molecular detection method. Screening of environmental samples indicated that all products amplified by this method were cld gene sequences. These sequences were obtained from pristine sites as well as contaminated sites from which DPRB were isolated. More than one cld phylotype was also identified from some samples, indicating the presence of more than one DPRB strain at those sites. The use of these primer sets represents a direct and sensitive molecular method for the qualitative detection of (per)chlorate-reducing bacteria in the environment, thus offering another tool for monitoring natural attenuation. Sequences of cld genes isolated in the course of this project were also generated from various DPRB and provided the first opportunity for a phylogenetic treatment of this metabolic gene. Comparisons of the cld and 16S ribosomal DNA (rDNA) gene trees indicated that the cld gene does not track 16S rDNA phylogeny, further implicating the possible role of horizontal transfer in the evolution of (per)chlorate respiration.

Identification of duck plague virus by polymerase chain reaction.

PubMed

Hansen, W R; Brown, S E; Nashold, S W; Knudson, D L

1999-01-01

A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3' ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primers sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague.

Development of internal COI primers to improve and extend barcoding of fruit flies (Diptera: Tephritidae: Dacini).

PubMed

Krosch, Matt N; Strutt, Francesca; Blacket, Mark J; Batovska, Jana; Starkie, Melissa; Clarke, Anthony R; Cameron, Stephen L; Schutze, Mark K

2018-06-06

Accurate species-level identifications underpin many aspects of basic and applied biology; however, identifications can be hampered by a lack of discriminating morphological characters, taxonomic expertise or time. Molecular approaches, such as DNA 'barcoding' of the cytochrome c oxidase (COI) gene, are argued to overcome these issues. However, nuclear encoding of mitochondrial genes (numts) and poor amplification success of suboptimally preserved specimens can lead to erroneous identifications. One insect group for which these molecular and morphological problems are significant are the dacine fruit flies (Diptera: Tephritidae: Dacini). We addressed these issues associated with COI barcoding in the dacines by first assessing several 'universal' COI primers against public mitochondrial genome and numt sequences for dacine taxa. We then modified a set of four primers that more closely matched true dacine COI sequence and amplified two overlapping portions of the COI barcode region. Our new primers were tested alongside universal primers on a selection of dacine species, including both fresh preserved and decades-old dry specimens. Additionally, Bactrocera tryoni mitochondrial and nuclear genomes were compared to identify putative numts. Four numt clades were identified, three of which were amplified using existing universal primers. In contrast, our new primers preferentially amplified the 'true' mitochondrial COI barcode in all dacine species tested. The new primers also successfully amplified partial barcodes from dry specimens for which full length barcodes were unobtainable. Thus we recommend these new primers be incorporated into the suites of primers used by diagnosticians and quarantine labs for the accurate identification of dacine species. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Evaluation of different primers for PCR-DGGE analysis of cheese-associated enterococci.

PubMed

Lorbeg, Petra Mohar; Majhenic, Andreja Canzek; Rogelj, Irena

2009-08-01

Enterococci represent an important part of bacterial microbiota in different types of artisanal cheeses, made from either raw or pasteurized milk. Polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) of ribosomal DNA is currently one of the most frequently used fingerprinting method to study diversity and dynamics of microbial communities and also a tool for microbial identification. Among several primer pairs for DGGE analysis published so far, six primer pairs amplifying different variable regions of 16S rDNA were selected and applied in our DGGE analysis of 12 species belonging to genus Enterococcus and eight other bacterial species often found in cheeses (seven lactobacilli and one Lactoccocus lactis). When DGGE procedures were optimized, the same set of primers was used for DGGE analysis of five cheese samples. Our study demonstrates that the use of different primer pairs generate significant differences in DGGE analysis of enterococcal population, consequently, appropriate primers regarding the purpose of analysis can be selected. For differentiation and identification of pure enterococcal isolates, primer pair P1V1/P2V1 showed the most promising results since all 12 enterococcal isolates gave distinctive DGGE fingerprints, but with multiple bands patterns; therefore, these primers do not seem to be appropriate for identification of enterococcal species in mixed cultures. Use of primer pairs HDA1/HDA2 and V3f/V3r amplifying V3 region showed better potential for detection and identification of enterococci in mixed communities, but since some bacterial species showed the same fingerprint, for clear identification combination of DGGE and some other method (e.g. species specific PCR) or combined DGGE analysis using two primer pairs generating distinctive results should be used.

Development and Evaluation of Reverse Transcription-Loop-Mediated Isothermal Amplification (RT-LAMP) Assay Coupled with a Portable Device for Rapid Diagnosis of Ebola Virus Disease in Guinea

PubMed Central

Kurosaki, Yohei; Magassouba, N’Faly; Oloniniyi, Olamide K.; Cherif, Mahamoud S.; Sakabe, Saori; Takada, Ayato; Hirayama, Kenji; Yasuda, Jiro

2016-01-01

Given the current absence of specific drugs or vaccines for Ebola virus disease (EVD), rapid, sensitive, and reliable diagnostic methods are required to stem the transmission chain of the disease. We have developed a rapid detection assay for Zaire ebolavirus based on reverse transcription-loop-mediated isothermal amplification (RT-LAMP) and coupled with a novel portable isothermal amplification and detection platform. The RT-LAMP assay is based on primer sets that target the untranscribed trailer region or nucleoprotein coding region of the viral RNA. The test could specifically detect viral RNAs of Central and West African Ebola virus strains within 15 minutes with no cross-reactivity to other hemorrhagic fever viruses and arboviruses, which cause febrile disease. The assay was evaluated using a total of 100 clinical specimens (serum, n = 44; oral swab, n = 56) collected from suspected EVD cases in Guinea. The specificity of this diagnostic test was 100% for both primer sets, while the sensitivity was 100% and 97.9% for the trailer and nucleoprotein primer sets, respectively, compared with a reference standard RT-PCR test. These observations suggest that our diagnostic assay is useful for identifying EVD cases, especially in the field or in settings with insufficient infrastructure. PMID:26900929

Development and Evaluation of Reverse Transcription-Loop-Mediated Isothermal Amplification (RT-LAMP) Assay Coupled with a Portable Device for Rapid Diagnosis of Ebola Virus Disease in Guinea.

PubMed

Kurosaki, Yohei; Magassouba, N'Faly; Oloniniyi, Olamide K; Cherif, Mahamoud S; Sakabe, Saori; Takada, Ayato; Hirayama, Kenji; Yasuda, Jiro

2016-02-01

Given the current absence of specific drugs or vaccines for Ebola virus disease (EVD), rapid, sensitive, and reliable diagnostic methods are required to stem the transmission chain of the disease. We have developed a rapid detection assay for Zaire ebolavirus based on reverse transcription-loop-mediated isothermal amplification (RT-LAMP) and coupled with a novel portable isothermal amplification and detection platform. The RT-LAMP assay is based on primer sets that target the untranscribed trailer region or nucleoprotein coding region of the viral RNA. The test could specifically detect viral RNAs of Central and West African Ebola virus strains within 15 minutes with no cross-reactivity to other hemorrhagic fever viruses and arboviruses, which cause febrile disease. The assay was evaluated using a total of 100 clinical specimens (serum, n = 44; oral swab, n = 56) collected from suspected EVD cases in Guinea. The specificity of this diagnostic test was 100% for both primer sets, while the sensitivity was 100% and 97.9% for the trailer and nucleoprotein primer sets, respectively, compared with a reference standard RT-PCR test. These observations suggest that our diagnostic assay is useful for identifying EVD cases, especially in the field or in settings with insufficient infrastructure.

AMPLISAS: a web server for multilocus genotyping using next-generation amplicon sequencing data.

PubMed

Sebastian, Alvaro; Herdegen, Magdalena; Migalska, Magdalena; Radwan, Jacek

2016-03-01

Next-generation sequencing (NGS) technologies are revolutionizing the fields of biology and medicine as powerful tools for amplicon sequencing (AS). Using combinations of primers and barcodes, it is possible to sequence targeted genomic regions with deep coverage for hundreds, even thousands, of individuals in a single experiment. This is extremely valuable for the genotyping of gene families in which locus-specific primers are often difficult to design, such as the major histocompatibility complex (MHC). The utility of AS is, however, limited by the high intrinsic sequencing error rates of NGS technologies and other sources of error such as polymerase amplification or chimera formation. Correcting these errors requires extensive bioinformatic post-processing of NGS data. Amplicon Sequence Assignment (AMPLISAS) is a tool that performs analysis of AS results in a simple and efficient way, while offering customization options for advanced users. AMPLISAS is designed as a three-step pipeline consisting of (i) read demultiplexing, (ii) unique sequence clustering and (iii) erroneous sequence filtering. Allele sequences and frequencies are retrieved in excel spreadsheet format, making them easy to interpret. AMPLISAS performance has been successfully benchmarked against previously published genotyped MHC data sets obtained with various NGS technologies. © 2015 John Wiley & Sons Ltd.

Development of an assay for rapid identification of meat from yak and cattle using polymerase chain reaction technique.

PubMed

Yin, R H; Bai, W L; Wang, J M; Wu, C D; Dou, Q L; Yin, R L; He, J B; Luo, G B

2009-09-01

Yak meat is of good quality with fine texture, high protein and low fat content, and rich in amino acids compared with that of cattle, and it lacks anabolic steroids or other drugs. In general terms, however, the meat yield of yak is relatively low compared with that of the cattle. In order to prevent possible adulteration of yak meat with cattle meat, based on the sequence of mitochondrial 12S rRNA gene, a multiplex PCR-based approach was proposed for rapid identification of the meat from yak and cattle using three primers designed in this work. Through the combinatorial usage of three primers with a single reaction set, two fragments of 290 and 159bp were amplified from the cattle meat DNA, whereas only a fragment of 290bp was obtained from the yak meat DNA. Using the assay described, satisfactory amplification was accomplished in the analysis of raw and heat-treated binary meat mixtures of yak/cattle with a detection limit of 0.1% for cattle meat. The technique is fast and straightforward. It might be a useful tool in the quality control of yak meat and meat products.

Real-time multiplex PCR assay for detection of Yersinia pestis and Yersinia pseudotuberculosis.

PubMed

Matero, Pirjo; Pasanen, Tanja; Laukkanen, Riikka; Tissari, Päivi; Tarkka, Eveliina; Vaara, Martti; Skurnik, Mikael

2009-01-01

A multiplex real-time polymerase chain reaction (PCR) assay was developed for the detection of Yersinia pestis and Yersinia pseudotuberculosis. The assay includes four primer pairs, two of which are specific for Y. pestis, one for Y. pestis and Y. pseudotuberculosis and one for bacteriophage lambda; the latter was used as an internal amplification control. The Y. pestis-specific target genes in the assay were ypo2088, a gene coding for a putative methyltransferase, and the pla gene coding for the plasminogen activator. In addition, the wzz gene was used as a target to specifically identify both Y. pestis and the closely related Y. pseudotuberculosis group. The primer and probe sets described for the different genes can be used either in single or in multiplex PCR assays because the individual probes were designed with different fluorochromes. The assays were found to be both sensitive and specific; the lower limit of the detection was 10-100 fg of extracted Y. pestis or Y. pseudotuberculosis total DNA. The sensitivity of the tetraplex assay was determined to be 1 cfu for the ypo2088 and pla probe labelled with FAM and JOE fluorescent dyes, respectively.

The effect of zoledronate-containing primer on dentin bonding of a universal adhesive.

PubMed

Zenobi, Walter; Feitosa, Victor Pinheiro; Moura, Maria Elisa Martins; D'arcangelo, Camillo; Rodrigues, Lidiany Karla de Azevedo; Sauro, Salvatore

2018-01-01

To evaluate the bonding ability and nanoleakage of a universal adhesive applied to dentin pre-treated using a zoledronate-containing primer (zol-primer) before and after mechanical load cycling. Flat dentin surfaces obtained from human molars were assigned to one of the following adhesion procedures (n=6): 1-Single Bond Universal (SBU) applied in etch-and-rinse mode; 2- SBU applied as etch-and-rinse after the application of zol-primer; 3- SBU applied in self-etch strategy; 4- SBU applied as self-etch after the use of zol-primer. Half of the specimens were processed for microtensile bond strength test after 24h, while the other half part was submitted to 200,000 mechanical cycles. Further specimens were silver-impregnated and assessed for interface nanoleakage by SEM. Data were analyzed with two-way ANOVA and Tukey's test (p<0.05). At 24h evaluation, the four groups presented similar bond strengths, whilst both groups bonded with etch-and-rinse technique showed significant bond strength reduction after mechanical load (p<0.05), with the highest drop in bond strength for the specimens pre-treated with the zol-primer. No negative effects were found for self-etch strategy (p>0.05) in microtensile test. Lower nanoleakage expression was observed for etch-and-rinse specimens treated with zol-primer. However, noteworthy reduction of adhesive layer thickness was observed when combining the zol-primer with the self-etch bonding approach. It can be concluded that zol-primer should not be used along with a universal adhesive in etch-and-rinse mode, but its application before self-etch application may provide less degradation of the resin-dentin interface. Copyright © 2017 Elsevier Ltd. All rights reserved.

Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

PubMed

Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

2015-05-01

Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

Molecular diagnosis of symptomatic toxoplasmosis: a 9-year retrospective and prospective study in a referral laboratory in São Paulo, Brazil.

PubMed

Camilo, Lilian Muniz; Pereira-Chioccola, Vera Lucia; Gava, Ricardo; Meira-Strejevitch, Cristina da Silva; Vidal, Jose Ernesto; Brandão de Mattos, Cinara Cássia; Frederico, Fábio Batista; De Mattos, Luiz Carlos; Spegiorin, Lígia Cosentino Junqueira Franco

Symptomatic forms of toxoplasmosis are a serious public health problem and occur in around 10-20% of the infected people. Aiming to improve the molecular diagnosis of symptomatic toxoplasmosis in Brazilian patients, this study evaluated the performance of real time PCR testing two primer sets (B1 and REP-529) in detecting Toxoplasma gondii DNA. The methodology was assayed in 807 clinical samples with known clinical diagnosis, ELISA, and conventional PCR results in a 9-year period. All samples were from patients with clinical suspicion of several features of toxoplasmosis. According to the minimum detection limit curve (in C T ), REP-529 had greater sensitivity to detect T. gondii DNA than B1. Both primer sets were retrospectively evaluated using 515 DNA from different clinical samples. The 122 patients without toxoplasmosis provided high specificity (REP-529, 99.2% and B1, 100%). From the 393 samples with positive ELISA, 146 had clinical diagnosis of toxoplasmosis and positive conventional PCR. REP-529 and B1 sensitivities were 95.9% and 83.6%, respectively. Comparison of REP-529 and B1 performances was further analyzed prospectively in 292 samples. Thus, from a total of 807 DNA analyzed, 217 (26.89%) had positive PCR with, at least one primer set and symptomatic toxoplasmosis confirmed by clinical diagnosis. REP-529 was positive in 97.23%, whereas B1 amplified only 78.80%. After comparing several samples in a Brazilian referral laboratory, this study concluded that REP-529 primer set had better performance than B1 one. These observations were based after using cases with defined clinical diagnosis, ELISA, and conventional PCR. Copyright © 2017 Sociedade Brasileira de Infectologia. Published by Elsevier Editora Ltda. All rights reserved.

A novel HRM assay for differentiating classical strains and highly pathogenic strains of type 2 porcine reproductive and respiratory syndrome virus.

PubMed

Sun, Junying; Bingga, Gali; Liu, Zhicheng; Zhang, Chunhong; Shen, Haiyan; Guo, Pengju; Zhang, Jianfeng

2018-06-01

Differentiation of classical strains and highly pathogenic strains of porcine reproductive and respiratory syndrome virus is crucial for effective vaccination programs and epidemiological studies. We used nested PCR and high resolution melting curve analysis with unlabeled probe to distinguish between the classical and the highly pathogenic strains of this virus. Two sets of primers and a 20 bp unlabeled probe were designed from the NSP3 gene. The unlabeled probe included two mutations specific for the classical and highly pathogenic strains of the virus. An additional primer set from the NSP2 gene of the highly pathogenic vaccine strain JXA1-R was used to detect its exclusive single nucleotide polymorphism. We tested 107 clinical samples, 21 clinical samples were positive for PRRSV (consistent with conventional PCR assay), among them four were positive for the classical strain with the remainder 17 for the highly pathogenic strain. Around 10 °C difference between probe melting temperatures showed the high discriminatory power of this method. Among highly pathogenic positive samples, three samples were determined as positive for JXA1-R vaccine-related strain with a 95% genotype confidence percentage. All these genotyping results using the high resolution melting curve assay were confirmed with DNA sequencing. This unlabeled probe method provides an alternative means to differentiate the classical strains from the highly pathogenic porcine reproductive and respiratory syndrome virus strains rapidly and accurately. Copyright © 2018. Published by Elsevier Ltd.

Lack of correlation between reaction speed and analytical sensitivity in isothermal amplification reveals the value of digital methods for optimization: validation using digital real-time RT-LAMP

PubMed Central

Khorosheva, Eugenia M.; Karymov, Mikhail A.; Selck, David A.; Ismagilov, Rustem F.

2016-01-01

In this paper, we asked if it is possible to identify the best primers and reaction conditions based on improvements in reaction speed when optimizing isothermal reactions. We used digital single-molecule, real-time analyses of both speed and efficiency of isothermal amplification reactions, which revealed that improvements in the speed of isothermal amplification reactions did not always correlate with improvements in digital efficiency (the fraction of molecules that amplify) or with analytical sensitivity. However, we observed that the speeds of amplification for single-molecule (in a digital device) and multi-molecule (e.g. in a PCR well plate) formats always correlated for the same conditions. Also, digital efficiency correlated with the analytical sensitivity of the same reaction performed in a multi-molecule format. Our finding was supported experimentally with examples of primer design, the use or exclusion of loop primers in different combinations, and the use of different enzyme mixtures in one-step reverse-transcription loop-mediated amplification (RT-LAMP). Our results show that measuring the digital efficiency of amplification of single-template molecules allows quick, reliable comparisons of the analytical sensitivity of reactions under any two tested conditions, independent of the speeds of the isothermal amplification reactions. PMID:26358811

Technologies in the Whole-Genome Age: MALDI-TOF-Based Genotyping.

PubMed

Vogel, Nicolas; Schiebel, Katrin; Humeny, Andreas

2009-01-01

With the decipherment of the human genome, new questions have moved into the focus of today's research. One key aspect represents the discovery of DNA variations capable to influence gene transcription, RNA splicing, or regulating processes, and their link to pathology. Matrix-assisted laser desorption/ionization-time of flight mass spectrometry (MALDI-TOF-MS) is a powerful tool for the qualitative investigation and relative quantification of variations like single nucleotide polymorphisms, DNA methylation, microsatellite instability, or loss of heterozygosity. After its introduction into proteomics, efforts were made to adopt this technique to DNA analysis. Initially intended for peptide/protein analysis, it held several difficulties for application to nucleic acids. Today, MALDI-TOF-MS has reached worldwide acceptance and application in nucleic acid research, with a wide spectrum of methods being available. One of the most versatile approaches relies on primer extension to genotype single alleles, microsatellite repeat lengths or the methylation status of a given cytosine. Optimized methods comprising intelligent primer design and proper nucleotide selection for primer extension enabled multiplexing of reactions, rendering the analysis more economic due to parallel genotyping of several alleles in a single experiment. Laboratories equipped with MALDI-TOF-MS possess a universal technical platform for the analysis of a large variety of different molecules.

Phylogenetic utility of the nuclear genes AGAMOUS 1 and PHYTOCHROME B in palms (Arecaceae): an example within Bactridinae

PubMed Central

Ludeña, Bertha; Chabrillange, Nathalie; Aberlenc-Bertossi, Frédérique; Adam, Hélène; Tregear, James W.; Pintaud, Jean-Christophe

2011-01-01

Background and Aims Molecular phylogenetic studies of palms (Arecaceae) have not yet provided a fully resolved phylogeny of the family. There is a need to increase the current set of markers to resolve difficult groups such as the Neotropical subtribe Bactridinae (Arecoideae: Cocoseae). We propose the use of two single-copy nuclear genes as valuable tools for palm phylogenetics. Methods New primers were developed for the amplification of the AGAMOUS 1 (AG1) and PHYTOCHROME B (PHYB) genes. For the AGAMOUS gene, the paralogue 1 of Elaeis guineensis (EgAG1) was targeted. The region amplified contained coding sequences between the MIKC K and C MADS-box domains. For the PHYB gene, exon 1 (partial sequence) was first amplified in palm species using published degenerate primers for Poaceae, and then specific palm primers were designed. The two gene portions were sequenced in 22 species of palms representing all genera of Bactridinae, with emphasis on Astrocaryum and Hexopetion, the status of the latter genus still being debated. Key Results The new primers designed allow consistent amplification and high-quality sequencing within the palm family. The two loci studied produced more variability than chloroplast loci and equally or less variability than PRK, RPBII and ITS nuclear markers. The phylogenetic structure obtained with AG1 and PHYB genes provides new insights into intergeneric relationships within the Bactridinae and the intrageneric structure of Astrocaryum. The Hexopetion clade was recovered as monophyletic with both markers and was weakly supported as sister to Astrocaryum sensu stricto in the combined analysis. The rare Astrocaryum minus formed a species complex with Astrocaryum gynacanthum. Moreover, both AG1 and PHYB contain a microsatellite that could have further uses in species delimitation and population genetics. Conclusions AG1 and PHYB provide additional phylogenetic information within the palm family, and should prove useful in combination with other genes to improve the resolution of palm phylogenies. PMID:21828068

Influence of sequence mismatches on the specificity of recombinase polymerase amplification technology.

PubMed

Daher, Rana K; Stewart, Gale; Boissinot, Maurice; Boudreau, Dominique K; Bergeron, Michel G

2015-04-01

Recombinase polymerase amplification (RPA) technology relies on three major proteins, recombinase proteins, single-strand binding proteins, and polymerases, to specifically amplify nucleic acid sequences in an isothermal format. The performance of RPA with respect to sequence mismatches of closely-related non-target molecules is not well documented and the influence of the number and distribution of mismatches in DNA sequences on RPA amplification reaction is not well understood. We investigated the specificity of RPA by testing closely-related species bearing naturally occurring mismatches for the tuf gene sequence of Pseudomonas aeruginosa and/or Mycobacterium tuberculosis and for the cfb gene sequence of Streptococcus agalactiae. In addition, the impact of the number and distribution of mismatches on RPA efficiency was assessed by synthetically generating 14 types of mismatched forward primers for detecting five bacterial species of high diagnostic relevance such as Clostridium difficile, Staphylococcus aureus, S. agalactiae, P. aeruginosa, and M. tuberculosis as well as Bacillus atropheus subsp. globigii for which we use the spores as internal control in diagnostic assays. A total of 87 mismatched primers were tested in this study. We observed that target specific RPA primers with mismatches (n > 1) at their 3'extrimity hampered RPA reaction. In addition, 3 mismatches covering both extremities and the center of the primer sequence negatively affected RPA yield. We demonstrated that the specificity of RPA was multifactorial. Therefore its application in clinical settings must be selected and validated a priori. We recommend that the selection of a target gene must consider the presence of closely-related non-target genes. It is advisable to choose target regions with a high number of mismatches (≥36%, relative to the size of amplicon) with respect to closely-related species and the best case scenario would be by choosing a unique target gene. Copyright © 2014 Elsevier Ltd. All rights reserved.

A New Primer to Amplify pmoA Gene From NC10 Bacteria in the Sediments of Dongchang Lake and Dongping Lake.

PubMed

Wang, Shenghui; Liu, Yanjun; Liu, Guofu; Huang, Yaru; Zhou, Yu

2017-08-01

Nitrite-dependent anaerobic methane oxidation (n-damo) is catalyzed by the NC10 phylum bacterium "Candidatus Methylomirabilis oxyfera" (M. oxyfera). Generally, the pmoA gene is applied as a functional marker to test and identify NC10-like bacteria. However, it is difficult to detect the NC10 bacteria from sediments of freshwater lake (Dongchang Lake and Dongping Lake) with the previous pmoA gene primer sets. In this work, a new primer cmo208 was designed and used to amplify pmoA gene of NC10-like bacteria. A newly nested PCR approach was performed using the new primer cmo208 and the previous primers cmo182, cmo682, and cmo568 to detect the NC10 bacteria. The obtained pmoA gene sequences exhibited 85-92% nucleotide identity and 95-97% amino acid sequence identity to pmoA gene of M. oxyfera. The obtained diversity of pmoA gene sequences coincided well with the diversity of 16S rRNA sequences. These results indicated that the newly designed pmoA primer cmo208 could give one more option to detect NC10 bacteria from different environmental samples.

MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

PubMed

Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

2016-01-01

Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic strands to increase the success rate. It is a standalone web-based pipeline, which is fully configured within a virtual machine and thus can be readily used without any configuration. We have experimentally validated primer pairs designed by our pipeline and shown a very high success rate of primer pairs: out of 66 BSP primer pairs, 63 were successfully validated without any further optimization step and using the same qPCR conditions. The MSP-HTPrimer pipeline is freely available from http://sourceforge.net/p/msp-htprimer.

TipMT: Identification of PCR-based taxon-specific markers.

PubMed

Rodrigues-Luiz, Gabriela F; Cardoso, Mariana S; Valdivia, Hugo O; Ayala, Edward V; Gontijo, Célia M F; Rodrigues, Thiago de S; Fujiwara, Ricardo T; Lopes, Robson S; Bartholomeu, Daniella C

2017-02-11

Molecular genetic markers are one of the most informative and widely used genome features in clinical and environmental diagnostic studies. A polymerase chain reaction (PCR)-based molecular marker is very attractive because it is suitable to high throughput automation and confers high specificity. However, the design of taxon-specific primers may be difficult and time consuming due to the need to identify appropriate genomic regions for annealing primers and to evaluate primer specificity. Here, we report the development of a Tool for Identification of Primers for Multiple Taxa (TipMT), which is a web application to search and design primers for genotyping based on genomic data. The tool identifies and targets single sequence repeats (SSR) or orthologous/taxa-specific genes for genotyping using Multiplex PCR. This pipeline was applied to the genomes of four species of Leishmania (L. amazonensis, L. braziliensis, L. infantum and L. major) and validated by PCR using artificial genomic DNA mixtures of the Leishmania species as templates. This experimental validation demonstrates the reliability of TipMT because amplification profiles showed discrimination of genomic DNA samples from Leishmania species. The TipMT web tool allows for large-scale identification and design of taxon-specific primers and is freely available to the scientific community at http://200.131.37.155/tipMT/ .

Generation of Aptamers from A Primer-Free Randomized ssDNA Library Using Magnetic-Assisted Rapid Aptamer Selection

NASA Astrophysics Data System (ADS)

Tsao, Shih-Ming; Lai, Ji-Ching; Horng, Horng-Er; Liu, Tu-Chen; Hong, Chin-Yih

2017-04-01

Aptamers are oligonucleotides that can bind to specific target molecules. Most aptamers are generated using random libraries in the standard systematic evolution of ligands by exponential enrichment (SELEX). Each random library contains oligonucleotides with a randomized central region and two fixed primer regions at both ends. The fixed primer regions are necessary for amplifying target-bound sequences by PCR. However, these extra-sequences may cause non-specific bindings, which potentially interfere with good binding for random sequences. The Magnetic-Assisted Rapid Aptamer Selection (MARAS) is a newly developed protocol for generating single-strand DNA aptamers. No repeat selection cycle is required in the protocol. This study proposes and demonstrates a method to isolate aptamers for C-reactive proteins (CRP) from a randomized ssDNA library containing no fixed sequences at 5‧ and 3‧ termini using the MARAS platform. Furthermore, the isolated primer-free aptamer was sequenced and binding affinity for CRP was analyzed. The specificity of the obtained aptamer was validated using blind serum samples. The result was consistent with monoclonal antibody-based nephelometry analysis, which indicated that a primer-free aptamer has high specificity toward targets. MARAS is a feasible platform for efficiently generating primer-free aptamers for clinical diagnoses.

Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes

PubMed Central

Rebelo, Ana Rita; Bortolaia, Valeria; Kjeldgaard, Jette S; Pedersen, Susanne K; Leekitcharoenphon, Pimlapas; Hansen, Inge M; Guerra, Beatriz; Malorny, Burkhard; Borowiak, Maria; Hammerl, Jens Andre; Battisti, Antonio; Franco, Alessia; Alba, Patricia; Perrin-Guyomard, Agnes; Granier, Sophie A; De Frutos Escobar, Cristina; Malhotra-Kumar, Surbhi; Villa, Laura; Carattoli, Alessandra; Hendriksen, Rene S

2018-01-01

Background and aim Plasmid-mediated colistin resistance mechanisms have been identified worldwide in the past years. A multiplex polymerase chain reaction (PCR) protocol for detection of all currently known transferable colistin resistance genes (mcr-1 to mcr-5, and variants) in Enterobacteriaceae was developed for surveillance or research purposes. Methods: We designed four new primer pairs to amplify mcr-1, mcr-2, mcr-3 and mcr-4 gene products and used the originally described primers for mcr-5 to obtain a stepwise separation of ca 200 bp between amplicons. The primer pairs and amplification conditions allow for single or multiple detection of all currently described mcr genes and their variants present in Enterobacteriaceae. The protocol was validated testing 49 European Escherichia coli and Salmonella isolates of animal origin. Results: Multiplex PCR results in bovine and porcine isolates from Spain, Germany, France and Italy showed full concordance with whole genome sequence data. The method was able to detect mcr-1, mcr-3 and mcr-4 as singletons or in different combinations as they were present in the test isolates. One new mcr-4 variant, mcr-4.3, was also identified. Conclusions: This method allows rapid identification of mcr-positive bacteria and overcomes the challenges of phenotypic detection of colistin resistance. The multiplex PCR should be particularly interesting in settings or laboratories with limited resources for performing genetic analysis as it provides information on the mechanism of colistin resistance without requiring genome sequencing. PMID:29439754

Amplification of trace amounts of nucleic acids

DOEpatents

Church, George M [Brookline, MA; Zhang, Kun [Brighton, MA

2008-06-17

Methods of reducing background during amplification of small amounts of nucleic acids employ careful analysis of sources of low level contamination. Ultraviolet light can be used to reduce nucleic acid contaminants in reagents and equipment. "Primer-dimer" background can be reduced by judicious design of primers. We have shown clean signal-to-noise with as little as starting material as one single human cell (.about.6 picogram), E. coli cell (.about.5 femtogram) or Prochlorococcus cell (.about.3 femtogram).

Differentiation of Populus species using chloroplast single nucleotide polymorphism (SNP) markers--essential for comprehensible and reliable poplar breeding.

PubMed

Schroeder, H; Hoeltken, A M; Fladung, M

2012-03-01

Within the genus Populus several species belonging to different sections are cross-compatible. Hence, high numbers of interspecies hybrids occur naturally and, additionally, have been artificially produced in huge breeding programmes during the last 100 years. Therefore, determination of a single poplar species, used for the production of 'multi-species hybrids' is often difficult, and represents a great challenge for the use of molecular markers in species identification. Within this study, over 20 chloroplast regions, both intergenic spacers and coding regions, have been tested for their ability to differentiate different poplar species using 23 already published barcoding primer combinations and 17 newly designed primer combinations. About half of the published barcoding primers yielded amplification products, whereas the new primers designed on the basis of the total sequenced cpDNA genome of Populus trichocarpa Torr. & Gray yielded much higher amplification success. Intergenic spacers were found to be more variable than coding regions within the genus Populus. The highest discrimination power of Populus species was found in the combination of two intergenic spacers (trnG-psbK, psbK-psbl) and the coding region rpoC. In barcoding projects, the coding regions matK and rbcL are often recommended, but within the genus Populus they only show moderate variability and are not efficient in species discrimination. © 2011 German Botanical Society and The Royal Botanical Society of the Netherlands.

A rapid assay for detection of Rose rosette virus using reverse transcription-recombinase polymerase amplification using multiple gene targets.

PubMed

Babu, Binoy; Washburn, Brian K; Miller, Steven H; Poduch, Kristina; Sarigul, Tulin; Knox, Gary W; Ochoa-Corona, Francisco M; Paret, Mathews L

2017-02-01

Rose rosette disease caused by Rose rosette virus (RRV; genus Emaravirus) is the most economically relevant disease of Knock Out ® series roses in the U.S. As there are no effective chemical control options for the disease, the most critical disease management strategies include the use of virus free clean plants for propagation and early detection and destruction of infected plants. The current diagnostic techniques for RRV including end-point reverse transcription-polymerase chain reaction (RT-PCR) and real-time PCR (RT-qPCR) are highly sensitive, but limited to diagnostic labs with the equipment and expertise; and is time consuming. To address this limitation, an isothermal reverse transcription-recombinase polymerase amplification (RT-RPA) assay based on multiple gene targets for specific detection of RRV was developed. The assay is highly specific and did not cross react with other viruses belonging to the inclusive and exclusive genus. Dilution assays using the in vitro transcripts showed that the primer sets designed (RPA-267, RPA-131, and RPA-321) are highly sensitive, consistently detecting RRV with a detection limit of 1fg/μL. Testing of the infected plants using the primer sets indicated that the virus could be detected from leaves, stems and petals of roses. The primer pair RPA-267 produced 100% positive detection of the virus from infected leaf tissues, while primer set RPA-131 produced 100% detection from stems and petals. The primer set RPA-321 produced 83%, 87.5% and 75% positive detection from leaves, petals and stem tissues, respectively. In addition, the assay has been efficiently used in the detection of RRV infecting Knock Out ® roses, collected from different states in the U.S. The assay can be completed in 20min as compared to the end-point RT-PCR assay (3-4h) and RT-qPCR (1.5h). The RT-RPA assay is reliable, rapid, highly sensitive, and can be easily used in diagnostic laboratories for detection of RRV with no need for any special equipment. Copyright © 2016 Elsevier B.V. All rights reserved.

Strand Invasion Based Amplification (SIBA®): a novel isothermal DNA amplification technology demonstrating high specificity and sensitivity for a single molecule of target analyte.

PubMed

Hoser, Mark J; Mansukoski, Hannu K; Morrical, Scott W; Eboigbodin, Kevin E

2014-01-01

Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR) in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA). SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO) into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.

Partial sequencing of sodA gene and its application to identification of Streptococcus dysgalactiae subsp. dysgalactiae isolated from farmed fish.

PubMed

Nomoto, R; Kagawa, H; Yoshida, T

2008-01-01

To investigate the difference between Lancefield group C Streptococcus dysgalactiae (GCSD) strains isolated from diseased fish and animals by sequencing and phylogenetic analysis of the sodA gene. The sodA gene of Strep. dysgalactiae strains isolated from fish and animals were amplified and its nucleotide sequences were determined. Although 100% sequence identity was observed among fish GCSD strains, the determined sequences from animal isolates showed variations against fish isolate sequences. Thus, all fish GCSD strains were clearly separated from the GCSD strains of other origin by using phylogenetic tree analysis. In addition, the original primer set was designed based on the determined sequences for specifically amplify the sodA gene of fish GCSD strains. The primer set yield amplification products from only fish GCSD strains. By sequencing analysis of the sodA gene, the genetic divergence between Strep. dysgalactiae strains isolated from fish and mammals was demonstrated. Moreover, an original oligonucletide primer set, which could simply detect the genotype of fish GCSD strains was designed. This study shows that Strep. dysgalactiae isolated from diseased fish could be distinguished from conventional GCSD strains by the difference in the sequence of the sodA gene.

Molecular analysis of single oocyst of Eimeria by whole genome amplification (WGA) based nested PCR.

PubMed

Wang, Yunzhou; Tao, Geru; Cui, Yujuan; Lv, Qiyao; Xie, Li; Li, Yuan; Suo, Xun; Qin, Yinghe; Xiao, Lihua; Liu, Xianyong

2014-09-01

PCR-based molecular tools are widely used for the identification and characterization of protozoa. Here we report the molecular analysis of Eimeria species using combined methods of whole genome amplification (WGA) and nested PCR. Single oocyst of Eimeria stiedai or Eimeriamedia was directly used for random amplification of the genomic DNA with either primer extension preamplification (PEP) or multiple displacement amplification (MDA), and then the WGA product was used as template in nested PCR with species-specific primers for ITS-1, 18S rDNA and 23S rDNA of E. stiedai and E. media. WGA-based PCR was successful for the amplification of these genes from single oocyst. For the species identification of single oocyst isolated from mixed E. stiedai or E. media, the results from WGA-based PCR were exactly in accordance with those from morphological identification, suggesting the availability of this method in molecular analysis of eimerian parasites at the single oocyst level. WGA-based PCR method can also be applied for the identification and genetic characterization of other protists. Copyright © 2014 Elsevier Inc. All rights reserved.

Extension of base mispairs by Taq DNA polymerase: implications for single nucleotide discrimination in PCR.

PubMed Central

Huang, M M; Arnheim, N; Goodman, M F

1992-01-01

Thermus aquaticus (Taq) DNA polymerase was used to measure the extension efficiency for all configurations of matched and mismatched base pairs at template-primer 3'-termini. The transition mispairs, A(primer).C, C.A, G.T, and T.G were extended 10(-3) to 10(-4)-fold less efficiently than their correctly paired counterparts. Relative efficiencies for extending transversion mispairs were 10(-4) to 10(-5) for T.C and T.T, about 10(-6) for A.A, and less than 10(-6) for G.A, A.G, G.G and C.C. The transversion mispair C(primer).T was extended with high efficiency, about 10(-2) compared to a correct A.T basepair. The unexpected ease of extending the C.T mismatch was not likely to have been caused by primer-template misalignment. Taq polymerase was observed to bind with similar affinities to each of the correctly paired and mispaired primer-template 3'-ends. Thus, the failure of Taq polymerase to extend mismatches efficiently appears to be an intrinsic property of the enzyme and not due to an inability to bind to 3'-terminal mispairs. For almost all of the mispairs, C.T being the exception, Taq polymerase exhibits about 100 to 1000-fold greater discrimination against mismatch extension compared to avian myeloblastosis reverse transcriptase and HIV-1 reverse transcriptase which extend most mismatched basepairs permissively. Relative mismatch extension efficiencies for Taq polymerase were measured at 45 degrees C, 55 degrees C and 70 degrees C and found to be independent of temperature. The mispair extension data should be important in designing experiments using PCR to distinguish between sequences that vary by a single nucleotide. Images PMID:1408758

A novel Tetra-primer ARMS-PCR based assay for genotyping SNP rs12303764(G/T) of human Unc-51 like kinase 1 gene.

PubMed

Randhawa, Rohit; Duseja, Ajay; Changotra, Harish

2017-02-01

Various case-control studies have shown association of single nucleotide polymorphism rs12303764(G/T) in ULK1 with crohn's disease. The techniques used in these studies were time consuming, complicated and require sophisticated/expensive instruments. Therefore, in order to overcome these problems, we have developed a new, rapid and cost effective Tetra-primer ARMS-PCR assay to genotype single nucleotide polymorphism rs12303764(G/T) of ULK1 gene. We manually designed allele specific primers. DNA fragment amplified using outer primers was sequenced to obtain samples with known genotypes (GG, GT and TT) for further use in the development of T-ARMS-PCR assay. Amplification conditions were optimized for parameters; annealing temperature, Taq DNA polymerase and primers. The developed T-ARMS-PCR assay was applied to genotype one hundred samples from healthy individuals. Genotyping results of 10 DNA samples from healthy individuals for rs12303764(G/T) by T-ARMS-PCR assay and sequencing were concordant. The newly developed assay was further applied to genotype samples from 100 healthy individuals of North Indian origin. Genotype frequencies were 9, 34 and 57 % for GG, GT and TT, respectively. Allele frequencies were 0.26 and 0.74 for G and T, respectively. The allele frequencies were in Hardy-Weinberg's equilibrium (p = 0.2443). T-ARMS-PCR assay developed in our laboratory for genotyping rs12303764 (G/T) of ULK1 gene is time saving and cost-effective as compared to the available methods. Furthermore, this is the first study reporting allelic and genotype frequencies of ULK1 rs12303764 (G/T) variants in North Indian population.

Development of loop-mediated isothermal amplification (LAMP) assays for the rapid detection of allergic peanut in processed food.

PubMed

Sheu, Shyang-Chwen; Tsou, Po-Chuan; Lien, Yi-Yang; Lee, Meng-Shiou

2018-08-15

Peanut is a widely and common used in many cuisines around the world. However, peanut is also one of the most important food allergen for causing anaphylactic reaction. To prevent allergic reaction, the best way is to avoid the food allergen or food containing allergic ingredient such as peanut before food consuming. Thus, to efficient and precisely detect the allergic ingredient, peanut or related product, is essential and required for maintain consumer's health or their interest. In this study, a loop-mediated isothermal amplification (LAMP) assay was developed for the detection of allergic peanut using specifically designed primer sets. Two sets of the specific LAMP primers respectively targeted the internal transcribed sequence 1 (ITS1) of nuclear ribosomal DNA sequence regions and the ara h1 gene sequence of Arachia hypogeae (peanut) were used to address the application of LAMP for detecting peanut in processed food or diet. The results demonstrated that the identification of peanut using the newly designed primers for ITS 1 sequence is more sensitive rather than primers for sequence of Ara h1 gene when performing LAMP assay. Besides, the sensitivity of LAMP for detecting peanut is also higher than the traditional PCR method. These LAMP primers sets showed high specificity for the identification of the peanut and had no cross-reaction to other species of nut including walnut, hazelnut, almonds, cashew and macadamia nut. Moreover, when minimal 0.1% peanuts were mixed with other nuts ingredients at different ratios, no any cross-reactivity was evident during performing LAMP. Finally, genomic DNAs extracted from boiled and steamed peanut were used as templates; the detection of peanut by LAMP was not affected and reproducible. As to this established LAMP herein, not only can peanut ingredients be detected but commercial foods containing peanut can also be identified. This assay will be useful and potential for the rapid detection of peanut in practical food markets. Copyright © 2018 Elsevier Ltd. All rights reserved.

Loop-mediated isothermal amplification (LAMP) method for detection of genetically modified maize T25.

PubMed

Xu, Junyi; Zheng, Qiuyue; Yu, Ling; Liu, Ran; Zhao, Xin; Wang, Gang; Wang, Qinghua; Cao, Jijuan

2013-11-01

The loop-mediated isothermal amplification (LAMP) assay indicates a potential and valuable means for genetically modified organism (GMO) detection especially for its rapidity, simplicity, and low cost. We developed and evaluated the specificity and sensitivity of the LAMP method for rapid detection of the genetically modified (GM) maize T25. A set of six specific primers was successfully designed to recognize six distinct sequences on the target gene, including a pair of inner primers, a pair of outer primers, and a pair of loop primers. The optimum reaction temperature and time were verified to be 65°C and 45 min, respectively. The detection limit of this LAMP assay was 5 g kg(-1) GMO component. Comparative experiments showed that the LAMP assay was a simple, rapid, accurate, and specific method for detecting the GM maize T25.

Development of microsatellite markers in Lupinus luteus (Fabaceae) and cross-species amplification in other lupine species.

PubMed

Gonzalez, Lorena B Parra; Straub, Shannon C K; Doyle, Jeff J; Ortega, Paula E Mora; Garrido, Haroldo E Salvo; Butler, Iván J Maureira

2010-08-01

Microsatellite primers were developed in Lupinus luteus L., an emerging temperate protein crop, to investigate genetic diversity, population structure, and to facilitate the generation of better yellow lupine varieties. • Thirteen polymorphic primer sets were evaluated in a European and Eastern European accession collection of L. luteus. The primers amplified di-, tri-, and tetranucleotide repeats with 2-4 alleles per locus. These revealed a moderate to low level of genetic variation, as indicated by an average observed heterozygosity of 0.0126. Select loci also amplified successfully in the closely related species L. hispanicus Boiss. & Reut. and in the New World species L. mutabilis Sweet. • These results indicate the utility of primers for the study of genetic diversity across L. luteus populations and related lupine species. The use of these microsatellite markers will facilitate the implementation of several molecular breeding strategies in yellow lupine.

Loop-mediated isothermal amplification (LAMP) method for detection of genetically modified maize T25

PubMed Central

Xu, Junyi; Zheng, Qiuyue; Yu, Ling; Liu, Ran; Zhao, Xin; Wang, Gang; Wang, Qinghua; Cao, Jijuan

2013-01-01

The loop-mediated isothermal amplification (LAMP) assay indicates a potential and valuable means for genetically modified organism (GMO) detection especially for its rapidity, simplicity, and low cost. We developed and evaluated the specificity and sensitivity of the LAMP method for rapid detection of the genetically modified (GM) maize T25. A set of six specific primers was successfully designed to recognize six distinct sequences on the target gene, including a pair of inner primers, a pair of outer primers, and a pair of loop primers. The optimum reaction temperature and time were verified to be 65°C and 45 min, respectively. The detection limit of this LAMP assay was 5 g kg−1 GMO component. Comparative experiments showed that the LAMP assay was a simple, rapid, accurate, and specific method for detecting the GM maize T25. PMID:24804053

Method for high-volume sequencing of nucleic acids: random and directed priming with libraries of oligonucleotides

DOEpatents

Studier, F. William

1995-04-18

Random and directed priming methods for determining nucleotide sequences by enzymatic sequencing techniques, using libraries of primers of lengths 8, 9 or 10 bases, are disclosed. These methods permit direct sequencing of nucleic acids as large as 45,000 base pairs or larger without the necessity for subcloning. Individual primers are used repeatedly to prime sequence reactions in many different nucleic acid molecules. Libraries containing as few as 10,000 octamers, 14,200 nonamers, or 44,000 decamers would have the capacity to determine the sequence of almost any cosmid DNA. Random priming with a fixed set of primers from a smaller library can also be used to initiate the sequencing of individual nucleic acid molecules, with the sequence being completed by directed priming with primers from the library. In contrast to random cloning techniques, a combined random and directed priming strategy is far more efficient.

Method for high-volume sequencing of nucleic acids: random and directed priming with libraries of oligonucleotides

DOEpatents

Studier, F.W.

1995-04-18

Random and directed priming methods for determining nucleotide sequences by enzymatic sequencing techniques, using libraries of primers of lengths 8, 9 or 10 bases, are disclosed. These methods permit direct sequencing of nucleic acids as large as 45,000 base pairs or larger without the necessity for subcloning. Individual primers are used repeatedly to prime sequence reactions in many different nucleic acid molecules. Libraries containing as few as 10,000 octamers, 14,200 nonamers, or 44,000 decamers would have the capacity to determine the sequence of almost any cosmid DNA. Random priming with a fixed set of primers from a smaller library can also be used to initiate the sequencing of individual nucleic acid molecules, with the sequence being completed by directed priming with primers from the library. In contrast to random cloning techniques, a combined random and directed priming strategy is far more efficient. 2 figs.

Aptamer Selection Express: A Novel Method for Rapid Single-Step Selection and Sensing of Aptamers

DTIC Science & Technology

2008-12-01

sample) was as follows: 5 µL buffer, 2 µL MgCl2, 2.5 µL DMSO, 1 µL betaine , 1 µL each dNTP, 2.5 µL F primer, 2.5 µL R primer, 0.54 µL taq polymerase...and 25.1 µL H2O. Betaine and increased DMSO were added to the master mix to eliminate polymerase jumping during PCR ampli- fication.10 Using the

Terrorism Information Sharing and the Nationwide Suspicious Activity Report Initiative: Background and Issues for Congress

DTIC Science & Technology

2009-11-05

December_23_2008_Final.pdf. 46 Ibid. 47 Federated search is the process of performing a simultaneous real-time search of multiple diverse and distributed...sources from a single search page, with the federated search engine acting as intermediary. See Sol Lederman, “A Federated Search Primer, Part II...at http://www.altsearchengines.com/2009/01/12/a- federated - search -primer-part-ii-of- iii/ 48 Examples of this controversy can be found at Alice

Developing a Prototype Handbook for Monitoring and Evaluating Department of Defense Humanitarian Assistance Projects

DTIC Science & Technology

2011-01-01

caloric intake could stand alone as a single specific indicator for com- munity nutritional status if necessary. The caloric intake indicator is also...principle, the user’s guide and the primer can each stand alone. Those already experienced with M&E or assessment can go directly to the user’s...planning and data collection were very valuable, as was the ability for each section of the handbook (i.e., the primer and user’s guide) to stand

A Multiplex Snapback Primer System for the Enrichment and Detection of JAK2 V617F and MPL W515L/K Mutations in Philadelphia-Negative Myeloproliferative Neoplasms

PubMed Central

Zhang, Yunqing; Zhang, Xinju; Xu, Xiao; Kang, Zhihua; Li, Shibao; Zhang, Chen; Su, Bing

2014-01-01

A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph-) negative myeloproliferative neoplasms (MPNs). The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE) PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS), quantitative PCR (qPCR) and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process. PMID:24729973

Characterization of (CA)n microsatellite repeats from large-insert clones.

PubMed

Litt, M; Browne, D

2001-05-01

The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit determination of sequences flanking the microsatellites. When cosmids or large-insert phage clones are used as primary sources of (CA)n repeat markers, they have traditionally been subcloned into plasmid vectors such as pUC18 or M13 mp 18/19 cloning vectors to obtain fragments of suitable size for DNA sequencing. This unit presents an alternative approach whereby a set of degenerate sequencing primers that anneal directly to (CA)n microsatellites can be used to determine sequences that are inaccessible with vector-derived primers. Because the primers anneal to the repeat and not to the vector, they can be used with subclones containing inserts of several kilobases and should, in theory, always give sequence in the regions directly flanking the repeat. Degeneracy at the 3 end of each of these primers prevents elongation of primers that have annealed out-of-register. The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit.

Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

PubMed

Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

2011-03-01

The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

Development of Fluorescent Reverse Transcription Loop-mediated Isothermal Amplification (RT-LAMP) using Quenching Probes for the Detection of the Middle East Respiratory Syndrome Coronavirus.

PubMed

Shirato, Kazuya; Semba, Shohei; El-Kafrawy, Sherif A; Hassan, Ahmed M; Tolah, Ahmed M; Takayama, Ikuyo; Kageyama, Tsutomu; Notomi, Tsugunori; Kamitani, Wataru; Matsuyama, Shutoku; Azhar, Esam Ibraheem

2018-05-12

Clinical detection of Middle East respiratory syndrome (MERS) coronavirus (MERS-CoV) in patients is achieved using genetic diagnostic methods, such as real-time RT-PCR assay. Previously, we developed a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assay for the detection of MERS-CoV [Virol J. 2014. 11:139]. Generally, amplification of RT-LAMP is monitored by the turbidity induced by precipitation of magnesium pyrophosphate with newly synthesized DNA. However, this mechanism cannot completely exclude the possibility of unexpected reactions. Therefore, in this study, fluorescent RT-LAMP assays using quenching probes (QProbes) were developed specifically to monitor only primer-derived signals. Two primer sets (targeting nucleocapsid and ORF1a sequences) were constructed to confirm MERS cases by RT-LAMP assay only. Our data indicate that both primer sets were capable of detecting MERS-CoV RNA to the same level as existing genetic diagnostic methods, and that both were highly specific with no cross-reactivity observed with other respiratory viruses. These primer sets were highly efficient in amplifying target sequences derived from different MERS-CoV strains, including camel MERS-CoV. In addition, the detection efficacy of QProbe RT-LAMP was comparable to that of real-time RT-PCR assay using clinical specimens from patients in Saudi Arabia. Altogether, these results indicate that QProbe RT-LAMP assays described here can be used as powerful diagnostic tools for rapid detection and surveillance of MERS-CoV infections. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

A PCR technique based on the Hip1 interspersed repetitive sequence distinguishes cyanobacterial species and strains.

PubMed

Smith, J K; Parry, J D; Day, J G; Smith, R J

1998-10-01

The use of primers based on the Hip1 sequence as a typing technique for cyanobacteria has been investigated. The discovery of short repetitive sequence structures in bacterial DNA during the last decade has led to the development of PCR-based methods for typing, i.e., distinguishing and identifying, bacterial species and strains. An octameric palindromic sequence known as Hip1 has been shown to be present in the chromosomal DNA of many species of cyanobacteria as a highly repetitious interspersed sequence. PCR primers were constructed that extended the Hip1 sequence at the 3' end by two bases. Five of the 16 possible extended primers were tested. Each of the five primers produced a different set of products when used to prime PCR from cyanobacterial genomic DNA. Each primer produced a distinct set of products for each of the 15 cyanobacterial species tested. The ability of Hip1-based PCR to resolve taxonomic differences was assessed by analysis of independent isolates of Anabaena flos-aquae and Nostoc ellipsosporum obtained from the CCAP (Culture Collection of Algae and Protozoa, IFE, Cumbria, UK). A PCR-based RFLP analysis of products amplified from the 23S-16S rDNA intergenic region was used to characterize the isolates and to compare with the Hip1 typing data. The RFLP and Hip1 typing yielded similar results and both techniques were able to distinguish different strains. On the basis of these results it is suggested that the Hip1 PCR technique may assist in distinguishing cyanobacterial species and strains.

Poliovirus serotype-specific VP1 sequencing primers.

PubMed

Kilpatrick, David R; Iber, Jane C; Chen, Qi; Ching, Karen; Yang, Su-Ju; De, Lina; Mandelbaum, Mark D; Emery, Brian; Campagnoli, Ray; Burns, Cara C; Kew, Olen

2011-06-01

The Global Polio Laboratory Network routinely uses poliovirus-specific PCR primers and probes to determine the serotype and genotype of poliovirus isolates obtained as part of global poliovirus surveillance. To provide detailed molecular epidemiologic information, poliovirus isolates are further characterized by sequencing the ~900-nucleotide region encoding the major capsid protein, VP1. It is difficult to obtain quality sequence information when clinical or environmental samples contain poliovirus mixtures. As an alternative to conventional methods for resolving poliovirus mixtures, sets of serotype-specific primers were developed for amplifying and sequencing the VP1 regions of individual components of mixed populations of vaccine-vaccine, vaccine-wild, and wild-wild polioviruses. Published by Elsevier B.V.

The novel primers for mammal species identification-based mitochondrial cytochrome b sequence: implication for reserved wild animals in Thailand and endangered mammal species in Southeast Asia.

PubMed

Muangkram, Yuttamol; Wajjwalku, Worawidh; Amano, Akira; Sukmak, Manakorn

2018-01-01

We presented the powerful techniques for species identification using the short amplicon of mitochondrial cytochrome b gene sequence. Two faecal samples and one single hair sample of the Asian tapir were tested using the new cytochrome b primers. The results showed a high sequence similarity with the mainland Asian tapir group. The comparative sequence analysis of the reserved wild mammals in Thailand and the other endangered mammal species from Southeast Asia comprehensibly verified the potential of our novel primers. The forward and reverse primers were 94.2 and 93.2%, respectively, by the average value of the sequence identity among 77 species sequences, and the overall mean distance was 35.9%. This development technique could provide rapid, simple, and reliable tools for species confirmation. Especially, it could recognize the problematic biological specimens contained less DNA material from illegal products and assist with wildlife crime investigation of threatened species and related forensic casework.

Massively Parallel Sequencing Detected a Mutation in the MFN2 Gene Missed by Sanger Sequencing Due to a Primer Mismatch on an SNP Site.

PubMed

Neupauerová, Jana; Grečmalová, Dagmar; Seeman, Pavel; Laššuthová, Petra

2016-05-01

We describe a patient with early onset severe axonal Charcot-Marie-Tooth disease (CMT2) with dominant inheritance, in whom Sanger sequencing failed to detect a mutation in the mitofusin 2 (MFN2) gene because of a single nucleotide polymorphism (rs2236057) under the PCR primer sequence. The severe early onset phenotype and the family history with severely affected mother (died after delivery) was very suggestive of CMT2A and this suspicion was finally confirmed by a MFN2 mutation. The mutation p.His361Tyr was later detected in the patient by massively parallel sequencing with a gene panel for hereditary neuropathies. According to this information, new primers for amplification and sequencing were designed which bind away from the polymorphic sites of the patient's DNA. Sanger sequencing with these new primers then confirmed the heterozygous mutation in the MFN2 gene in this patient. This case report shows that massively parallel sequencing may in some rare cases be more sensitive than Sanger sequencing and highlights the importance of accurate primer design which requires special attention. © 2016 John Wiley & Sons Ltd/University College London.

Beam shaping for laser initiated optical primers

NASA Astrophysics Data System (ADS)

Lizotte, Todd E.

2008-08-01

Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.

The bias associated with amplicon sequencing does not affect the quantitative assessment of bacterial community dynamics.

PubMed

Ibarbalz, Federico M; Pérez, María Victoria; Figuerola, Eva L M; Erijman, Leonardo

2014-01-01

The performance of two sets of primers targeting variable regions of the 16S rRNA gene V1-V3 and V4 was compared in their ability to describe changes of bacterial diversity and temporal turnover in full-scale activated sludge. Duplicate sets of high-throughput amplicon sequencing data of the two 16S rRNA regions shared a collection of core taxa that were observed across a series of twelve monthly samples, although the relative abundance of each taxon was substantially different between regions. A case in point was the changes in the relative abundance of filamentous bacteria Thiothrix, which caused a large effect on diversity indices, but only in the V1-V3 data set. Yet the relative abundance of Thiothrix in the amplicon sequencing data from both regions correlated with the estimation of its abundance determined using fluorescence in situ hybridization. In nonmetric multidimensional analysis samples were distributed along the first ordination axis according to the sequenced region rather than according to sample identities. The dynamics of microbial communities indicated that V1-V3 and the V4 regions of the 16S rRNA gene yielded comparable patterns of: 1) the changes occurring within the communities along fixed time intervals, 2) the slow turnover of activated sludge communities and 3) the rate of species replacement calculated from the taxa-time relationships. The temperature was the only operational variable that showed significant correlation with the composition of bacterial communities over time for the sets of data obtained with both pairs of primers. In conclusion, we show that despite the bias introduced by amplicon sequencing, the variable regions V1-V3 and V4 can be confidently used for the quantitative assessment of bacterial community dynamics, and provide a proper qualitative account of general taxa in the community, especially when the data are obtained over a convenient time window rather than at a single time point.

Comparison of specificity and sensitivity of immunochemical and molecular techniques for determination of Clavibacter michiganensis subsp. michiganensis.

PubMed

Kokosková, B; Mráz, I; Fousek, J

2010-05-01

Detection of Clavibacter michiganensis subsp. michiganensis (Cmm), causing bacterial canker of tomato, was verified using PTA-ELISA and IFAS with PAbs of Neogen Europe Ltd. (UK), and with published and also laboratory-generated PCR primers from the Cmm tomatinase gene. The specificity of this technique was determined with 15 plant-pathogenic and 4 common, saprophytic bacteria. With IFAS, crossreactions were found for Pantoea dispersa, P. agglomerans and Rahnella aquatilis, and with PTA-ELISA for Curtobacterium flaccumfaciens, Pectobacterium atrosepticum and Dickeya sp. Cross-reactions with subspecies other than michiganensis were also found using both methods. Molecular methods were optimized by verification of annealing temperatures and times for both primers. Conditions were finally adjusted to 30 s at 65 degrees C for Dreier's and 10 s at 69 degrees C for our primer set. After this optimization, both primer pairs produced positive reaction only with Cmm. By means of PTA-ELISA and IFAS, Cmm strains were detected at a concentration up to 10(5) CFU/mL and 10(3) CFU/mL, respectively. The PCR test with bacterial cell suspensions reached a sensitivity of 10(3) CFU/mL with our designed primers and 104 CFU/mL with Dreier's primer pair.

Using long ssDNA polynucleotides to amplify STRs loci in degraded DNA samples

PubMed Central

Pérez Santángelo, Agustín; Corti Bielsa, Rodrigo M.; Sala, Andrea; Ginart, Santiago; Corach, Daniel

2017-01-01

Obtaining informative short tandem repeat (STR) profiles from degraded DNA samples is a challenging task usually undermined by locus or allele dropouts and peak-high imbalances observed in capillary electrophoresis (CE) electropherograms, especially for those markers with large amplicon sizes. We hereby show that the current STR assays may be greatly improved for the detection of genetic markers in degraded DNA samples by using long single stranded DNA polynucleotides (ssDNA polynucleotides) as surrogates for PCR primers. These long primers allow a closer annealing to the repeat sequences, thereby reducing the length of the template required for the amplification in fragmented DNA samples, while at the same time rendering amplicons of larger sizes suitable for multiplex assays. We also demonstrate that the annealing of long ssDNA polynucleotides does not need to be fully complementary in the 5’ region of the primers, thus allowing for the design of practically any long primer sequence for developing new multiplex assays. Furthermore, genotyping of intact DNA samples could also benefit from utilizing long primers since their close annealing to the target STR sequences may overcome wrong profiling generated by insertions/deletions present between the STR region and the annealing site of the primers. Additionally, long ssDNA polynucleotides might be utilized in multiplex PCR assays for other types of degraded or fragmented DNA, e.g. circulating, cell-free DNA (ccfDNA). PMID:29099837

Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

PubMed

Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

2016-02-01

The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

Designing, optimization and validation of tetra-primer ARMS PCR protocol for genotyping mutations in caprine Fec genes

PubMed Central

Ahlawat, Sonika; Sharma, Rekha; Maitra, A.; Roy, Manoranjan; Tantia, M.S.

2014-01-01

New, quick, and inexpensive methods for genotyping novel caprine Fec gene polymorphisms through tetra-primer ARMS PCR were developed in the present investigation. Single nucleotide polymorphism (SNP) genotyping needs to be attempted to establish association between the identified mutations and traits of economic importance. In the current study, we have successfully genotyped three new SNPs identified in caprine fecundity genes viz. T(-242)C (BMPR1B), G1189A (GDF9) and G735A (BMP15). Tetra-primer ARMS PCR protocol was optimized and validated for these SNPs with short turn-around time and costs. The optimized techniques were tested on 158 random samples of Black Bengal goat breed. Samples with known genotypes for the described genes, previously tested in duplicate using the sequencing methods, were employed for validation of the assay. Upon validation, complete concordance was observed between the tetra-primer ARMS PCR assays and the sequencing results. These results highlight the ability of tetra-primer ARMS PCR in genotyping of mutations in Fec genes. Any associated SNP could be used to accelerate the improvement of goat reproductive traits by identifying high prolific animals at an early stage of life. Our results provide direct evidence that tetra-primer ARMS-PCR is a rapid, reliable, and cost-effective method for SNP genotyping of mutations in caprine Fec genes. PMID:25606428

Genus-Specific Primers for Study of Fusarium Communities in Field Samples

PubMed Central

Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

2015-01-01

Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

Massively parallel single-molecule and single-cell emulsion reverse transcription polymerase chain reaction using agarose droplet microfluidics.

PubMed

Zhang, Huifa; Jenkins, Gareth; Zou, Yuan; Zhu, Zhi; Yang, Chaoyong James

2012-04-17

A microfluidic device for performing single copy, emulsion Reverse Transcription Polymerase Chain Reaction (RT-PCR) within agarose droplets is presented. A two-aqueous-inlet emulsion droplet generator was designed and fabricated to produce highly uniform monodisperse picoliter agarose emulsion droplets with RT-PCR reagents in carrier oil. Template RNA or cells were delivered from one inlet with RT-PCR reagents/cell lysis buffer delivered separately from the other. Efficient RNA/cell encapsulation and RT-PCR at the single copy level was achieved in agarose-in-oil droplets, which, after amplification, can be solidified into agarose beads for further analysis. A simple and efficient method to graft primer to the polymer matrix using 5'-acrydite primer was developed to ensure highly efficient trapping of RT-PCR products in agarose. High-throughput single RNA molecule/cell RT-PCR was demonstrated in stochastically diluted solutions. Our results indicate that single-molecule RT-PCR can be efficiently carried out in agarose matrix. Single-cell RT-PCR was successfully performed which showed a clear difference in gene expression level of EpCAM, a cancer biomarker gene, at the single-cell level between different types of cancer cells. This work clearly demonstrates for the first time, single-copy RT-PCR in agarose droplets. We believe this will open up new possibilities for viral RNA detection and single-cell transcription analysis.

Lack of correlation between reaction speed and analytical sensitivity in isothermal amplification reveals the value of digital methods for optimization: validation using digital real-time RT-LAMP.

PubMed

Khorosheva, Eugenia M; Karymov, Mikhail A; Selck, David A; Ismagilov, Rustem F

2016-01-29

In this paper, we asked if it is possible to identify the best primers and reaction conditions based on improvements in reaction speed when optimizing isothermal reactions. We used digital single-molecule, real-time analyses of both speed and efficiency of isothermal amplification reactions, which revealed that improvements in the speed of isothermal amplification reactions did not always correlate with improvements in digital efficiency (the fraction of molecules that amplify) or with analytical sensitivity. However, we observed that the speeds of amplification for single-molecule (in a digital device) and multi-molecule (e.g. in a PCR well plate) formats always correlated for the same conditions. Also, digital efficiency correlated with the analytical sensitivity of the same reaction performed in a multi-molecule format. Our finding was supported experimentally with examples of primer design, the use or exclusion of loop primers in different combinations, and the use of different enzyme mixtures in one-step reverse-transcription loop-mediated amplification (RT-LAMP). Our results show that measuring the digital efficiency of amplification of single-template molecules allows quick, reliable comparisons of the analytical sensitivity of reactions under any two tested conditions, independent of the speeds of the isothermal amplification reactions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

DNA polymerase preference determines PCR priming efficiency.

PubMed

Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

2014-01-30

Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially available DNA polymerases. The results suggest that the interaction of the DNA polymerase with the primer:template junction during the initiation of DNA polymerization is very important in terms of overall amplification bias and has broader implications for both the primer design process and multiplex PCR.

One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

PubMed

Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

2015-12-01

The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

Ligase Detection Reaction Generation of Reverse Molecular Beacons for Near Real-Time Analysis of Bacterial Pathogens Using Single-Pair Fluorescence Resonance Energy Transfer and a Cyclic Olefin Copolymer Microfluidic Chip

PubMed Central

Peng, Zhiyong; Soper, Steven A.; Pingle, Maneesh R.; Barany, Francis; Davis, Lloyd M.

2015-01-01

Detection of pathogenic bacteria and viruses require strategies that can signal the presence of these targets in near real-time due to the potential threats created by rapid dissemination into water and/or food supplies. In this paper, we report an innovative strategy that can rapidly detect bacterial pathogens using reporter sequences found in their genome without requiring polymerase chain reaction (PCR). A pair of strain-specific primers was designed based on the 16S rRNA gene and were end-labeled with a donor (Cy5) or acceptor (Cy5.5) dye. In the presence of the target bacterium, the primers were joined using a ligase detection reaction (LDR) only when the primers were completely complementary to the target sequence to form a reverse molecular beacon (rMB), thus bringing Cy5 (donor) and Cy5.5 (acceptor) into close proximity to allow fluorescence resonance energy transfer (FRET) to occur. These rMBs were subsequently analyzed using single-molecule detection of the FRET pairs (single-pair FRET; spFRET). The LDR was performed using a continuous flow thermal cycling process configured in a cyclic olefin copolymer (COC) microfluidic device using either 2 or 20 thermal cycles. Single-molecule photon bursts from the resulting rMBs were detected on-chip and registered using a simple laser-induced fluorescence (LIF) instrument. The spFRET signatures from the target pathogens were reported in as little as 2.6 min using spFRET. PMID:21047095

Detection of norovirus (GI, GII), Sapovirus and astrovirus in fecal samples using reverse transcription single-round multiplex PCR.

PubMed

Yan, Hainian; Yagyu, Fumihiro; Okitsu, Shoko; Nishio, Osamu; Ushijima, Hiroshi

2003-12-01

A reverse transcription (RT) single-round multiplex polymerase chain reaction (smPCR) assay was developed to detect simultaneously Norovirus genogroup I and II, Sapovirus and astrovirus. A total of 377 diarrhea stool samples (screened for rotavirus- and adenorivus-negative) from four regions in Japan during July 2000 to June 2001 were examined by RT-smPCR. The positive rate was 16.4% (62 out of 377 stool samples). Norovirus, Sapovirus and astrovirus were detected in 42, 16, 4 of 60 positive samples, respectively. Coinfection was not found in these samples. Infections occurred mainly in November, December and January. The key elements of the RT-smPCR are (i) the cDNA synthesis with the Superscript RTII and random primer at 42 degrees C for 1 h, at 99 degrees C for 5 min, and (ii) single-round multiplex PCR by using Taq polymerase mixed together with a mixture of four different primer pairs (G1-SKF/G1-SKR for Norovirus genogroup I, COG2F/G2-SKR for Norovirus genogroup II, SLV5317/SLV5749 for Sapovirus, PreCAP1/82b for astrovirus). All of the four primer pairs amplify the capsid region of target viral genome, produce four size-specific amplicons of 330, 387, 434, 719 bp for Norovirus genogroup I and II, Sapovirus and astrovirus, respectively. This assay provides a more rapid and efficient way to detect these viruses from fecal samples in a single test, and also offers the potential for their molecular detection in food and environmental samples.

Methods, compounds and systems for detecting a microorganism in a sample

DOEpatents

Colston, Jr, Bill W.; Fitch, J. Patrick; Gardner, Shea N.; Williams, Peter L.; Wagner, Mark C.

2016-09-06

Methods to identify a set of probe polynucleotides suitable for detecting a set of targets and in particular methods for identification of primers suitable for detection of target microorganisms related polynucleotides, set of polynucleotides and compositions, and related methods and systems for detection and/or identification of microorganisms in a sample.

Validation and Application of a Real-time PCR Protocol for the Specific Detection and Quantification of Clavibacter michiganensis subsp. sepedonicus in Potato.

PubMed

Cho, Min Seok; Park, Duck Hwan; Namgung, Min; Ahn, Tae-Young; Park, Dong Suk

2015-06-01

Clavibacter michiganensis subsp. sepedonicus (Cms) multiplies very rapidly, passing through the vascular strands and into the stems and petioles of a diseased potato. Therefore, the rapid and specific detection of this pathogen is highly important for the effective control of the pathogen. Although several PCR assays have been developed for detection, they cannot afford specific detection of Cms. Therefore, in this study, a computational genome analysis was performed to compare the sequenced genomes of the C. michiganensis subspecies and to identify an appropriate gene for the development of a subspecies-specific PCR primer set (Cms89F/R). The specificity of the primer set based on the putative phage-related protein was evaluated using genomic DNA from seven isolates of Cms and 27 other reference strains. The Cms89F/R primer set was more specific and sensitive than the existing assays in detecting Cms in in vitro using Cms cells and its genomic DNA. This assay was also able to detect at least 1.47×10(2) copies/μl of cloned-amplified target DNA, 5 fg of DNA using genomic DNA or 10(-6) dilution point of 0.12 at OD600 units of cells per reaction using a calibrated cell suspension.

Evaluation of a duplex reverse-transcription real-time PCR assay for the detection of encephalomyocarditis virus.

PubMed

Qin, Shaomin; Underwood, Darren; Driver, Luke; Kistler, Carol; Diallo, Ibrahim; Kirkland, Peter D

2018-06-01

We evaluated a fluorogenic probe-based assay for the detection of encephalomyocarditis virus (EMCV) by comparing a set of published primers and probe to a new set of primers and probe. The published reagents failed to amplify a range of Australian isolates and an Italian reference strain of EMCV. In contrast, an assay based on 2 new sets of primers and probes that were run in a duplex reverse-transcription real-time PCR (RT-rtPCR) worked well, with high amplification efficiency. The analytical sensitivity was ~100-fold higher than virus isolation in cell culture. The intra-assay variation was 0.21-4.90%. No cross-reactivity was observed with a range of other porcine viruses. One hundred and twenty-two clinical specimens were tested simultaneously by RT-rtPCR and virus isolation in cell culture; 72 specimens gave positive results by RT-rtPCR, and 63 of these were also positive by virus isolation. Of 245 archived cell culture isolates of EMCV that were tested in the RT-rtPCR, 242 samples were positive. The new duplex RT-rtPCR assay is a reliable tool for the detection of EMCV in clinical specimens and for use in epidemiologic investigations.

Validation and Application of a Real-time PCR Protocol for the Specific Detection and Quantification of Clavibacter michiganensis subsp. sepedonicus in Potato

PubMed Central

Cho, Min Seok; Park, Duck Hwan; Namgung, Min; Ahn, Tae-Young; Park, Dong Suk

2015-01-01

Clavibacter michiganensis subsp. sepedonicus (Cms) multiplies very rapidly, passing through the vascular strands and into the stems and petioles of a diseased potato. Therefore, the rapid and specific detection of this pathogen is highly important for the effective control of the pathogen. Although several PCR assays have been developed for detection, they cannot afford specific detection of Cms. Therefore, in this study, a computational genome analysis was performed to compare the sequenced genomes of the C. michiganensis subspecies and to identify an appropriate gene for the development of a subspecies-specific PCR primer set (Cms89F/R). The specificity of the primer set based on the putative phage-related protein was evaluated using genomic DNA from seven isolates of Cms and 27 other reference strains. The Cms89F/R primer set was more specific and sensitive than the existing assays in detecting Cms in in vitro using Cms cells and its genomic DNA. This assay was also able to detect at least 1.47×102 copies/μl of cloned-amplified target DNA, 5 fg of DNA using genomic DNA or 10−6 dilution point of 0.12 at OD600 units of cells per reaction using a calibrated cell suspension. PMID:26060431

Quantitative Real-Time PCR using the Thermo Scientific Solaris qPCR Assay

PubMed Central

Ogrean, Christy; Jackson, Ben; Covino, James

2010-01-01

The Solaris qPCR Gene Expression Assay is a novel type of primer/probe set, designed to simplify the qPCR process while maintaining the sensitivity and accuracy of the assay. These primer/probe sets are pre-designed to >98% of the human and mouse genomes and feature significant improvements from previously available technologies. These improvements were made possible by virtue of a novel design algorithm, developed by Thermo Scientific bioinformatics experts. Several convenient features have been incorporated into the Solaris qPCR Assay to streamline the process of performing quantitative real-time PCR. First, the protocol is similar to commonly employed alternatives, so the methods used during qPCR are likely to be familiar. Second, the master mix is blue, which makes setting the qPCR reactions easier to track. Third, the thermal cycling conditions are the same for all assays (genes), making it possible to run many samples at a time and reducing the potential for error. Finally, the probe and primer sequence information are provided, simplifying the publication process. Here, we demonstrate how to obtain the appropriate Solaris reagents using the GENEius product search feature found on the ordering web site (www.thermo.com/solaris) and how to use the Solaris reagents for performing qPCR using the standard curve method. PMID:20567213

Sebacinales are associates of the leafy liverwort Lophozia excisa in the southern maritime Antarctic.

PubMed

Newsham, Kevin K; Bridge, Paul D

2010-06-01

The leafy liverwort Lophozia excisa, which is colonised by basidiomycete fungi in other biomes and which evidence suggests may be colonised by mycorrhizal fungi in Antarctica, was sampled from Léonie Island in the southern maritime Antarctic (67 degrees 36' S, 68 degrees 21' W). Microscopic examination of plants indicated that fungal hyphae colonised 78% of the rhizoids of the liverwort, apparently by entering the tips of rhizoids prior to growing into their bases, where they formed hyphal coils. Extensive colonisation of stem medullary cells by hyphae was also observed. DNA was extracted from surface-sterilised liverwort tissues and sequenced following nested PCR, using the primer set ITS1F/TW14, followed by a second round of amplification using the ITSSeb3/TW13 primer set. Neighbour-joining analyses showed that the sequences obtained nested in Sebacinales clade B as a 100% supported sister group to Sebacinales sequences from the leafy liverworts Lophozia sudetica, L. incisa and Calypogeia muelleriana sampled from Europe. Direct PCR using the fungal specific primer set ITS1F/ITS4 similarly identified fungi belonging to Sebacinales clade B as the principal colonists of L. excisa tissues. These observations indicate the presence of a second mycothallus in Antarctica and support the previous suggestion that the Sebacinales has a wide geographical distribution.

Nuclear Matrix Proteins in Disparity of Prostate Cancer

DTIC Science & Technology

2011-07-01

using G3PDH 3’ primer and PCR primer 1 followed by two rounds of hybridization. In the first hybridization, the RsaI-digested driver cDNA was mixed...determined using β-actin to confirm the reduced relative abundance of the housekeeping gene after SSH. The SSH nested PCR products were cloned using pCR®2.1...variability of DNA concentration. Additionally, negative and positive controls ( housekeeping genes) from the Ambion™ ArrayControls™ Set were included

Use of the Genomic Subtractive Hybridization Technique To Develop a Real-Time PCR Assay for Quantitative Detection of Prevotella spp. in Oral Biofilm Samples

PubMed Central

Nagashima, Shiori; Yoshida, Akihiro; Suzuki, Nao; Ansai, Toshihiro; Takehara, Tadamichi

2005-01-01

Genomic subtractive hybridization was used to design Prevotella nigrescens-specific primers and TaqMan probes. Based on this technique, a TaqMan real-time PCR assay was developed for quantifying four oral black-pigmented Prevotella species. The combination of real-time PCR and genomic subtractive hybridization is useful for preparing species-specific primer-probe sets for closely related species. PMID:15956428

Regulation of Mammary Stem Cell Quiescence via Post-Translational Modification of DeltaNp63alpha

DTIC Science & Technology

2014-02-01

mRNA expression in atopic dermatitis following narrow- band ultraviolet B phototherapy: results of a pilot study. J Dermatol Sci 44: 56– 58. 39. Lee...Change II site-directed mutagenesis kit ( Cat # 200523-5) with the following set of primers; sense primer 59-CGATGCTCTCGCTCCAGCACCCGC- CATCCCCTCC-39, and...Invitrogen, Cat #11668) according to manufacturers protocol. Kinome Screen The Silencer Select Human Kinase siRNA Library ( Cat - alog#4397918) from Ambion

3'-terminal sequence of a small round structured virus (SRSV) in Japan.

PubMed

Utagawa, E T; Takeda, N; Inouye, S; Kasuga, K; Yamazaki, S

1994-01-01

We determined the nucleotide sequence of about 1,000 bases from the 3'-terminus of a small round structured virus (SRSV), which caused a gastroenteritis outbreak in Chiba Prefecture, Japan, in 1987. The sequence was compared with the corresponding sequence region of Norwalk virus; it consisted of a part of the open reading frame 2 (ORF2), whole ORF3, and 3'-noncoding region (NCR). The 624-base-long ORF3 had sequence homology of 68% with the corresponding region of Norwalk virus. (The amino acid sequence homology was 74%.) The 94-base-long NCR had 65% homology with Norwalk virus. We then selected two consensus-sequence portions in the above sequence between Chiba and Norwalk viruses for primers in the reverse transcriptase-polymerase chain reaction (RT-PCR). Using this primer set, we detected 669-bp bands in agarose gel electrophoresis of RT-PCR products from feces containing Chiba or Norwalk viruses. Furthermore, in Southern hybridization with Chiba probes which were labeled with digoxigenin-dUTP in PCR, the bands of the two viruses were clearly stained under a low stringency condition. Since both Chiba and Norwalk viruses were detected by the above primer set although they are geographically and chronologically different viruses, our primer-pair may be useful for detection of a broad range of SRSVs which cause gastroenteritis in different areas.

Molecular tools for the identification of Tuber melanosporum in agroindustry.

PubMed

Séjalon-Delmas, N; Roux, C; Martins, M; Kulifaj, M; Bécard, G; Dargent, R

2000-06-01

Tuber melanosporum Vitt., Tuber magnatum Pico, and Tuber uncinatum Chat. can be differentiated by their morphological characters. Fraud problems have arisen recently with the importation to Europe of truffles from China. T. melanosporum is morphologically very close, but distinct from the Chinese species [Tuber indicum (Cooke and Massee) and T. himalayense BC (Zhang and Winter)]. We have optimized molecular tools to unequivocally identify T. melanosporum. DNA extraction from ascocarps of black truffles is not straightforward. Problems to obtain pure DNA are due to high contents of phenolic compounds, melanine, and various polymers (proteins, polysaccharides, etc). These compounds coprecipitate with the DNA during extraction and strongly inhibit the PCR reaction. We have developed an efficient and reliable protocol for DNA extraction from truffle ascocarps. It was used successfully for DNA extraction from mycorrhizal root tips as well as from canned preparations of T. melanosporum. Several approaches to identify T. melanosporum by PCR were developed. Two specific primers for T. melanosporum were designed after comparison of the ITS region of this species with those of three Chinese fungi. They proved to be efficient to specifically detect the presence of T. melanosporum by PCR. The mycorrhizal status of trees inoculated with T. melanosporum but unable to produce truffles was confirmed in a single-step PCR reaction. A multiplex PCR approach was also developed with three sets of primers (including a specific one for Chinese truffles) to detect, in one PCR reaction, the presence of any other Tuber species mixed with T. melanosporum ascocarps. This optimized protocol, in association with the specific primers we designed, is applicable to quality control in the truffle industry from the production stages to final commercial products.

Isolation, characterization, and development of WRKY genes as useful genetic markers in Theobroma cacao.

PubMed

Borrone, James W; Kuhn, David N; Schnell, Raymond J

2004-08-01

There is currently an international effort in improving disease resistance and crop yield in Theobroma cacao L., an economically important crop of the tropics, using marker-assisted selection for breeding. We are developing molecular genetic markers focusing upon gene families involved with disease resistance. One such family is the WRKY proteins, which are plant-specific transcriptional factors associated with regulating defense responses to both abiotic and biotic stresses. Degenerate PCR primers were designed to the highly conserved DNA-binding domain and other conserved motifs of group I and group II, subgroups a-c, WRKY genes. Sixteen individual WRKY fragments were isolated from a mixture of T. cacao DNA using one pair of primers. Of the 16 WRKY loci investigated, seven contained single nucleotide polymorphisms within the intron as detected by sequence comparison of the PCR products. Four of these were successfully converted into molecular markers and mapped in an F2 population by capillary electrophoresis-single strand conformation polymorphism analysis. This is the first report of a pair of degenerate primers amplifying WRKY loci directly from genomic DNA and demonstrates a simple method for developing useful genetic markers from members of a large gene family. Copyright 2004 Springer-Verlag

Application of SCAR (sequence characterized amplified region) analysis to authenticate Lycium barbarum (wolfberry) and its adulterants.

PubMed

Sze, Stephen Cho-Wing; Song, Ju-Xian; Wong, Ricky Ngok-Shun; Feng, Yi-Bin; Ng, Tzi-Bun; Tong, Yao; Zhang, Kalin Yan-Bo

2008-09-01

Fructus Lycii (Gouqizi) is well known in Chinese herbal medicine for its restorative function of benefiting the liver and kidney, replenishing vital essence and improving eyesight. However, ten species and varieties of Lycium have benn found to be substitutes or adulterants of Lycium barbarum (wolfberry) in commercial markets in the Hong Kong Special Administrative Region and in China generally. L. barbarum cv. 'Tianjinense' and Lycium chinense var. potaninii are the most common examples. It is difficult to differentiate among the Lycium species by traditional morphological and histological analyses. An easy and reliable approach based on SCAR (sequence characterized amplified region) analysis was developed in the present study to differentiate L. barbarum from other Lycium species. Two characteristic bands of approx. 700 and 650 bp were detected on the RAPD (random amplification of polymorphic DNA) profiles generated from samples of L. barbarum and L. chinense var. potaninii using the primer OPC-7. They were isolated and sequenced. Two primer sets, based on the sequences, could amplify a single specific band in samples of L. barbarum respectively, whereas no bands were detected in samples of L. chinense var. potaninii. The results confirmed that the SCAR technique can be employed for authenticating L. barbarum and its adulterants.

Sensitive Detection of Xanthomonas oryzae Pathovars oryzae and oryzicola by Loop-Mediated Isothermal Amplification

PubMed Central

Lang, Jillian M.; Langlois, Paul; Nguyen, Marian Hanna R.; Triplett, Lindsay R.; Purdie, Laura; Holton, Timothy A.; Djikeng, Appolinaire; Vera Cruz, Casiana M.; Verdier, Valérie

2014-01-01

Molecular diagnostics for crop diseases can enhance food security by enabling the rapid identification of threatening pathogens and providing critical information for the deployment of disease management strategies. Loop-mediated isothermal amplification (LAMP) is a PCR-based tool that allows the rapid, highly specific amplification of target DNA sequences at a single temperature and is thus ideal for field-level diagnosis of plant diseases. We developed primers highly specific for two globally important rice pathogens, Xanthomonas oryzae pv. oryzae, the causal agent of bacterial blight (BB) disease, and X. oryzae pv. oryzicola, the causal agent of bacterial leaf streak disease (BLS), for use in reliable, sensitive LAMP assays. In addition to pathovar distinction, two assays that differentiate X. oryzae pv. oryzae by African or Asian lineage were developed. Using these LAMP primer sets, the presence of each pathogen was detected from DNA and bacterial cells, as well as leaf and seed samples. Thresholds of detection for all assays were consistently 104 to 105 CFU ml−1, while genomic DNA thresholds were between 1 pg and 10 fg. Use of the unique sequences combined with the LAMP assay provides a sensitive, accurate, rapid, simple, and inexpensive protocol to detect both BB and BLS pathogens. PMID:24837384

A Novel High-Resolving Method for Genomic PCR-Fingerprinting of Enterobacteria

PubMed Central

Isaeva, A.S.; Kulikov, E.E.; Tarasyan, K.K.

2010-01-01

We developed a novel PCR–fingerprinting system for differentiation of enterobacterial strains using a single oligonucleotide primer IS1tr that matches the inverted terminal repeats of the IS1 insertion element. Compared to widely used BOX–PCR and ribotyping methods, our system features higher resolution allowing differentiation of closely related isolates that appear identical in BOX–PCR and ribotyping but differ in their phage sensitivity. The IS1–profiling system is less sensitive to the quality of the material and equipment used. At the same time, BOX–PCR is more universal and suitable for bacterial strain grouping and reconstruction of the low–distance phylogeny. Thus, our system represents an important supplement to the existing set of tools for bacterial strain differentiation; it is particularly valuable for a detailed investigation of highly divergent and rapidly evolving natural bacterial populations and for studies on coliphage ecology. However, some isolates could not be reliably differentiated by IS1–PCR, because of the low number of bands in their patterns. For improvement of IS1–fingerprinting characteristics, we offer to modify the system by introducing the second primer TR8834 hybridizing to the sequence of a transposase gene that is widely spread in enterobacterial genomes. PMID:22649631

A comparison of restriction fragment length polymorphism, tetra primer amplification refractory mutation system PCR and unlabeled probe melting analysis for LTA+252 C>T SNP genotyping.

PubMed

Soler, Stephan; Rittore, Cécile; Touitou, Isabelle; Philibert, Laurent

2011-02-20

From the wide range of methods currently available for genotyping, we wished to identify a quick, reliable and affordable approach for routine use in our laboratory for LTA+252 C>T SNP screening. We set up and compared three genotyping methods for SNP detection: restriction fragment length polymorphism (RFLP), tetra primer amplification refractory mutation system PCR (TPAP) and unlabeled probe melting analysis (UPMA). The SNP model used was LTA+252 C>T, a cytokine gene polymorphism that has been associated with response to treatment in rheumatoid arthritis. The study was performed using 46 samples from healthy Caucasian volunteers. Allele and genotype distribution was similar to that previously described in the same population. All three genotyping methods showed good reproducibility and are suitable for a medium scale throughput molecular platform. UPMA was the most cost effective, reliable and safe method since it required the shortest technician time, could be performed in a single closed tube and involved automatic data analysis. This work is the first to compare these three genotyping techniques and provides evidence for UPMA being the method of choice for LTA+252 C>T SNP genotyping. Copyright © 2010 Elsevier B.V. All rights reserved.

Detection of early and single infections of Schistosoma japonicum in the intermediate host snail, Oncomelania hupensis, by PCR and loop-mediated isothermal amplification (LAMP) assay.

PubMed

Kumagai, Takashi; Furushima-Shimogawara, Rieko; Ohmae, Hiroshi; Wang, Tian-Ping; Lu, Shaohong; Chen, Rui; Wen, Liyong; Ohta, Nobuo

2010-09-01

Polymerase chain reaction (PCR) with the specific primer set amplifying 28S ribosomal DNA (rDNA) of Schistosoma japonicum was able to detect genomic DNA of S. japonicum, but not S. mansoni, at 100 fg. This procedure enabled us to detect the DNA from a single miracidium and a snail infected with one miracidium at just 1 day after infection. We compared these results with those from loop-mediated isothermal amplification (LAMP) targeting 28S rDNA and found similar results. The LAMP could amplify the specific DNA from a group of 100 normal snails mixed with one infected snail A PCR screening of infected snails from endemic regions in Anhui Province revealed schistosomal DNA even in snails found negative by microscopy. PCR and LAMP show promise for monitoring the early infection rate in snails, and they may be useful for predicting the risk of infection in the endemic places.

AFLP fragment isolation technique as a method to produce random sequences for single nucleotide polymorphism discovery in the green turtle, Chelonia mydas.

PubMed

Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A

2009-01-01

The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.

A Phylogenomic Approach Based on PCR Target Enrichment and High Throughput Sequencing: Resolving the Diversity within the South American Species of Bartsia L. (Orobanchaceae)

PubMed Central

Tank, David C.

2016-01-01

Advances in high-throughput sequencing (HTS) have allowed researchers to obtain large amounts of biological sequence information at speeds and costs unimaginable only a decade ago. Phylogenetics, and the study of evolution in general, is quickly migrating towards using HTS to generate larger and more complex molecular datasets. In this paper, we present a method that utilizes microfluidic PCR and HTS to generate large amounts of sequence data suitable for phylogenetic analyses. The approach uses the Fluidigm Access Array System (Fluidigm, San Francisco, CA, USA) and two sets of PCR primers to simultaneously amplify 48 target regions across 48 samples, incorporating sample-specific barcodes and HTS adapters (2,304 unique amplicons per Access Array). The final product is a pooled set of amplicons ready to be sequenced, and thus, there is no need to construct separate, costly genomic libraries for each sample. Further, we present a bioinformatics pipeline to process the raw HTS reads to either generate consensus sequences (with or without ambiguities) for every locus in every sample or—more importantly—recover the separate alleles from heterozygous target regions in each sample. This is important because it adds allelic information that is well suited for coalescent-based phylogenetic analyses that are becoming very common in conservation and evolutionary biology. To test our approach and bioinformatics pipeline, we sequenced 576 samples across 96 target regions belonging to the South American clade of the genus Bartsia L. in the plant family Orobanchaceae. After sequencing cleanup and alignment, the experiment resulted in ~25,300bp across 486 samples for a set of 48 primer pairs targeting the plastome, and ~13,500bp for 363 samples for a set of primers targeting regions in the nuclear genome. Finally, we constructed a combined concatenated matrix from all 96 primer combinations, resulting in a combined aligned length of ~40,500bp for 349 samples. PMID:26828929

Collecting in collections: a PCR strategy and primer set for DNA barcoding of decades-old dried museum specimens.

PubMed

Mitchell, Andrew

2015-09-01

Natural history museums are vastly underutilized as a source of material for DNA analysis because of perceptions about the limitations of DNA degradation in older specimens. Despite very few exceptions, most DNA barcoding projects, which aim to obtain sequence data from all species, generally use specimens collected specifically for that purpose, instead of the wealth of identified material in museums, constrained by the lack of suitable PCR methods. Any techniques that extend the utility of museum specimens for DNA analysis therefore are highly valuable. This study first tested the effects of specimen age and PCR amplicon size on PCR success rates in pinned insect specimens, then developed a PCR primer set and amplification strategy allowing greatly increased utilization of older museum specimens for DNA barcoding. PCR success rates compare favourably with the few published studies utilizing similar aged specimens, and this new strategy has the advantage of being easily automated for high-throughput laboratory workflows. The strategy uses hemi-nested, degenerate, M13-tailed PCR primers to amplify two overlapping amplicons, using two PCRs per amplicon (i.e. four PCRs per DNA sample). Initial PCR products are reamplified using an internal primer and a M13 primer. Together the two PCR amplicons yield 559 bp of the COI gene from Coleoptera, Lepidoptera, Diptera, Hemiptera, Odonata and presumably also other insects. BARCODE standard-compliant data were recovered from 67% (56 of 84) of specimens up to 25 years old, and 51% (102 of 197) of specimens up to 55 years old. Given the time, cost and specialist expertise required for fieldwork and identification, 'collecting in collections' is a viable alternative allowing researchers to capitalize on the knowledge captured by curation work in decades past. © 2015 John Wiley & Sons Ltd.

Enhanced Reliability and Accuracy for Field Deployable Bioforensic Detection and Discrimination of Xylella fastidiosa subsp. pauca, Causal Agent of Citrus Variegated Chlorosis Using Razor Ex Technology and TaqMan Quantitative PCR

PubMed Central

Fletcher, Jacqueline; Melcher, Ulrich; Ochoa Corona, Francisco Manuel

2013-01-01

A reliable, accurate and rapid multigene-based assay combining real time quantitative PCR (qPCR) and a Razor Ex BioDetection System (Razor Ex) was validated for detection of Xylella fastidiosa subsp. pauca (Xfp, a xylem-limited bacterium that causes citrus variegated chlorosis [CVC]). CVC, which is exotic to the United States, has spread through South and Central America and could significantly impact U.S. citrus if it arrives. A method for early, accurate and sensitive detection of Xfp in plant tissues is needed by plant health officials for inspection of products from quarantined locations, and by extension specialists for detection, identification and management of disease outbreaks and reservoir hosts. Two sets of specific PCR primers and probes, targeting Xfp genes for fimbrillin and the periplasmic iron-binding protein were designed. A third pair of primers targeting the conserved cobalamin synthesis protein gene was designed to detect all possible X. fastidiosa (Xf) strains. All three primer sets detected as little as 1 fg of plasmid DNA carrying X. fastidiosa target sequences and genomic DNA of Xfp at as little as 1 - 10 fg. The use of Razor Ex facilitates a rapid (about 30 min) in-field assay capability for detection of all Xf strains, and for specific detection of Xfp. Combined use of three primer sets targeting different genes increased the assay accuracy and broadened the range of detection. To our knowledge, this is the first report of a field-deployable rapid and reliable bioforensic detection and discrimination method for a bacterial phytopathogen based on multigene targets. PMID:24312333

Enhanced reliability and accuracy for field deployable bioforensic detection and discrimination of Xylella fastidiosa subsp. pauca, causal agent of citrus variegated chlorosis using razor ex technology and TaqMan quantitative PCR.

PubMed

Ouyang, Ping; Arif, Mohammad; Fletcher, Jacqueline; Melcher, Ulrich; Ochoa Corona, Francisco Manuel

2013-01-01

A reliable, accurate and rapid multigene-based assay combining real time quantitative PCR (qPCR) and a Razor Ex BioDetection System (Razor Ex) was validated for detection of Xylella fastidiosa subsp. pauca (Xfp, a xylem-limited bacterium that causes citrus variegated chlorosis [CVC]). CVC, which is exotic to the United States, has spread through South and Central America and could significantly impact U.S. citrus if it arrives. A method for early, accurate and sensitive detection of Xfp in plant tissues is needed by plant health officials for inspection of products from quarantined locations, and by extension specialists for detection, identification and management of disease outbreaks and reservoir hosts. Two sets of specific PCR primers and probes, targeting Xfp genes for fimbrillin and the periplasmic iron-binding protein were designed. A third pair of primers targeting the conserved cobalamin synthesis protein gene was designed to detect all possible X. fastidiosa (Xf) strains. All three primer sets detected as little as 1 fg of plasmid DNA carrying X. fastidiosa target sequences and genomic DNA of Xfp at as little as 1 - 10 fg. The use of Razor Ex facilitates a rapid (about 30 min) in-field assay capability for detection of all Xf strains, and for specific detection of Xfp. Combined use of three primer sets targeting different genes increased the assay accuracy and broadened the range of detection. To our knowledge, this is the first report of a field-deployable rapid and reliable bioforensic detection and discrimination method for a bacterial phytopathogen based on multigene targets.

New universal ITS2 primers for high-resolution herbivory analyses using DNA metabarcoding in both tropical and temperate zones.

PubMed

Moorhouse-Gann, Rosemary J; Dunn, Jenny C; de Vere, Natasha; Goder, Martine; Cole, Nik; Hipperson, Helen; Symondson, William O C

2018-06-04

DNA metabarcoding is a rapidly growing technique for obtaining detailed dietary information. Current metabarcoding methods for herbivory, using a single locus, can lack taxonomic resolution for some applications. We present novel primers for the second internal transcribed spacer of nuclear ribosomal DNA (ITS2) designed for dietary studies in Mauritius and the UK, which have the potential to give unrivalled taxonomic coverage and resolution from a short-amplicon barcode. In silico testing used three databases of plant ITS2 sequences from UK and Mauritian floras (native and introduced) totalling 6561 sequences from 1790 species across 174 families. Our primers were well-matched in silico to 88% of species, providing taxonomic resolution of 86.1%, 99.4% and 99.9% at the species, genus and family levels, respectively. In vitro, the primers amplified 99% of Mauritian (n = 169) and 100% of UK (n = 33) species, and co-amplified multiple plant species from degraded faecal DNA from reptiles and birds in two case studies. For the ITS2 region, we advocate taxonomic assignment based on best sequence match instead of a clustering approach. With short amplicons of 187-387 bp, these primers are suitable for metabarcoding plant DNA from faecal samples, across a broad geographic range, whilst delivering unparalleled taxonomic resolution.

Nodavirus infections in Israeli mariculture.

PubMed

Ucko, M; Colorni, A; Diamant, A

2004-08-01

Viral encephalopathy and retinopathy (VER) infections were diagnosed in five fish species: Epinephelus aeneus, Dicentrarchus labrax, Sciaenops ocellatus, Lates calcarifer and Mugil cephalus cultured on both the Red Sea and Mediterranean coasts of Israel during 1998-2002. Spongiform vacuolation of nervous tissue was observed in histological sections of all examined species. With transmission electron microscopy, paracrystalline arrays and pieces of membrane-associated non-enveloped virions measuring approximately 30 nm in diameter were observed in the brain and retina of all species. At the molecular level, the nodavirus was detected by using a primer set that amplified the T4 region of the coat protein gene. When the same set of primers was used to search for VER in an additional fish species, Sparus aurata, it was found to produce non-specific amplicons, giving rise to false-positive results. This problem was overcome by using a different primer set (F1/VR3), designed on a highly conserved region of the virus gene, which amplified a fragment of 254 bp, and confirmed that S. aurata was nodavirus-free. This set was validated on all five species of infected fish, as well as clinically healthy fish. Comparison of the coat protein genes from the Israeli isolated sequences indicated that more than one viral strain was involved. No strict host-specificity was evident. Red Sea and Mediterranean isolated sequences grouped in distinct clusters, together with several foreign isolates from the Mediterranean area and the Far East, as phylogenetically close to the Epinephelus akaara RGNNV type.

Design and validation of a real-time RT-PCR for the simultaneous detection of enteroviruses and parechoviruses in clinical samples.

PubMed

Cabrerizo, María; Calvo, Cristina; Rabella, Nuria; Muñoz-Almagro, Carmen; del Amo, Eva; Pérez-Ruiz, Mercedes; Sanbonmatsu-Gámez, Sara; Moreno-Docón, Antonio; Otero, Almudena; Trallero, Gloria

2014-11-01

Human enteroviruses (EVs) and parechoviruses (HPeVs) are important etiological agents causing infections such as meningitis, encephalitis and sepsis-like disease in neonates and young children. We have developed a real-time RT-PCR for simultaneous detection of EV and HPeV in clinical samples. Primers and probe sets were designed from the conserved 5'-noncoding region of the genomes. The sensitivity, specificity and reproducibility of the technique were measured using a set of 25 EV and 6 HPeV types. All EVs but no HPeVs were detected with the EV primers-probe set. The HPeV primers-probe set detected only the 6 HPeV types. The lower detection limit was found to be 4 and 40CCID50/ml for HPeV and EV respectively, demonstrating high sensitivity of the technique for both viruses. The threshold cycle values were highly reproducible on repeat testing of positive controls among assay runs. The assay was evaluated in 53 clinical samples of suspected meningitis, sepsis or febrile syndromes from children under 3 years. In 11 of these (21%) EVs were detected, while 4, i.e. 7.5%, were HPeV positive. Molecular typing was carried out for 73% of the viruses. In summary, the RT-PCR method developed demonstrated effectively both EV and HPeV detection, which can cause similar clinical symptoms in infants. Copyright © 2014 Elsevier B.V. All rights reserved.

Dynamic variable selection in SNP genotype autocalling from APEX microarray data.

PubMed

Podder, Mohua; Welch, William J; Zamar, Ruben H; Tebbutt, Scott J

2006-11-30

Single nucleotide polymorphisms (SNPs) are DNA sequence variations, occurring when a single nucleotide--adenine (A), thymine (T), cytosine (C) or guanine (G)--is altered. Arguably, SNPs account for more than 90% of human genetic variation. Our laboratory has developed a highly redundant SNP genotyping assay consisting of multiple probes with signals from multiple channels for a single SNP, based on arrayed primer extension (APEX). This mini-sequencing method is a powerful combination of a highly parallel microarray with distinctive Sanger-based dideoxy terminator sequencing chemistry. Using this microarray platform, our current genotype calling system (known as SNP Chart) is capable of calling single SNP genotypes by manual inspection of the APEX data, which is time-consuming and exposed to user subjectivity bias. Using a set of 32 Coriell DNA samples plus three negative PCR controls as a training data set, we have developed a fully-automated genotyping algorithm based on simple linear discriminant analysis (LDA) using dynamic variable selection. The algorithm combines separate analyses based on the multiple probe sets to give a final posterior probability for each candidate genotype. We have tested our algorithm on a completely independent data set of 270 DNA samples, with validated genotypes, from patients admitted to the intensive care unit (ICU) of St. Paul's Hospital (plus one negative PCR control sample). Our method achieves a concordance rate of 98.9% with a 99.6% call rate for a set of 96 SNPs. By adjusting the threshold value for the final posterior probability of the called genotype, the call rate reduces to 94.9% with a higher concordance rate of 99.6%. We also reversed the two independent data sets in their training and testing roles, achieving a concordance rate up to 99.8%. The strength of this APEX chemistry-based platform is its unique redundancy having multiple probes for a single SNP. Our model-based genotype calling algorithm captures the redundancy in the system considering all the underlying probe features of a particular SNP, automatically down-weighting any 'bad data' corresponding to image artifacts on the microarray slide or failure of a specific chemistry. In this regard, our method is able to automatically select the probes which work well and reduce the effect of other so-called bad performing probes in a sample-specific manner, for any number of SNPs.

Estimates of abundance and diversity of Shewanella genus in natural and engineered aqueous environments with newly designed primers.

PubMed

Li, Bing-Bing; Cheng, Yuan-Yuan; Fan, Yang-Yang; Liu, Dong-Feng; Fang, Cai-Yun; Wu, Chao; Li, Wen-Wei; Yang, Zong-Chuang; Yu, Han-Qing

2018-05-12

Shewanella species have a diverse respiratory ability and wide distribution in environments and play an important role in bioremediation and the biogeochemical cycles of elements. Primers with more accuracy and broader coverage are required with consideration of the increasing number of Shewanella species and evaluation of their roles in various environments. In this work, a new primer set of 640F/815R was developed to quantify the abundance of Shewanella species in natural and engineered environments. In silico tools for primer evaluation, quantitative polymerase chain reaction (qPCR) and clone library results showed that 640F/815R had a higher specificity and coverage than the previous primers in quantitative analysis of Shewanella. Another newly developed primer pair of 211F/815cR was also adopted to analyze the Shewanella diversity and demonstrated to be the best candidate in terms of specificity and coverage. We detected more Shewanella-related species in freshwater environments and found them to be substantially different from those in marine environments. Abundance and diversity of Shewanella species in wastewater treatment plants were largely affected by the process and operating conditions. Overall, this study suggests that investigations of abundance and diversity of Shewanella in various environments are of great importance to evaluate their ecophysiology and potential ecological roles. Copyright © 2018 Elsevier B.V. All rights reserved.

Evaluation of LSSP-PCR for identification of Leptospira spp. in urine samples of cattle with clinical suspicion of leptospirosis.

PubMed

Bomfim, Maria Rosa Quaresma; Koury, Matilde Cota

2006-12-20

We evaluated the use of low-stringency single specific primer PCR (LSSP-PCR) for genetically typing Leptospira directly from urine samples of cattle with clinical suspicion of leptospirosis. Urine samples obtained from 40 cattle with clinical suspicion of leptospirosis were amplified by specific PCR using the following primers: Internal 1/Internal 2 and G1/G2. The internal primers were designed from the gene sequence of the outer membrane lipoprotein Lip32 from Leptospira kirschneri, strain RM52. The PCR products were amplified with these two pairs of primers, which had approximately 497 and 285bp, respectively, and were subsequently used as a template for LSSP-PCR analysis. The genetic signatures from the leptospires which were present in the urine samples allowed us to make a preliminary identification of the leptospires by comparing the LSSP-PCR profiles obtained directly from urine samples with those from reference leptospires. The LSSP-PCR profiles obtained with the Internal 1 primer or with the G1 primer allowed the grouping of the leptospires into serogroups. LSSP-PCR was found to be a useful and sensitive approach capable of identifying leptospires directly from biological samples without the need for prior bacterial isolation. In conclusion, the LSSP-PCR technique may still be helpful in discriminating serogroups of Leptospira from different animal reservoirs, since the early identification of carrier animals and information on the shedding state are crucial to prevent the spread of leptospiral infection to other animals and humans.

Rapid amplification of 5' complementary DNA ends (5' RACE).

PubMed

2005-08-01

This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

A simple approach to the generation of heterologous competitive internal controls for real-time PCR assays on the LightCycler.

PubMed

Stöcher, Markus; Leb, Victoria; Hölzl, Gabriele; Berg, Jörg

2002-12-01

The real-time PCR technology allows convenient detection and quantification of virus derived DNA. This approach is used in many PCR based assays in clinical laboratories. Detection and quantification of virus derived DNA is usually performed against external controls or external standards. Thus, adequacy within a clinical sample is not monitored for. This can be achieved using internal controls that are co-amplified with the specific target within the same reaction vessel. We describe a convenient way to prepare heterologous internal controls as competitors for real-time PCR based assays. The internal controls were devised as competitors in real-time PCR, e.g. LightCycler-PCR. The bacterial neomycin phosphotransferase gene (neo) was used as source for heterologous DNA. Within the neo gene a box was chosen containing sequences for four differently spaced forward primers, one reverse primer, and a pair of neo specific hybridization probes. Pairs of primers were constructed to compose of virus-specific primer sequences and neo box specific primer sequences. Using those composite primers in conventional preparative PCR four types of internal controls were amplified from the neo box and subsequently cloned. A panel of the four differently sized internal controls was generated and tested by LightCycler PCR using their virus-specific primers. All four different PCR products were detected with the single pair of neo specific FRET-hybridization probes. The presented approach to generate competitive internal controls for use in LightCycler PCR assays proved convenient und rapid. The obtained internal controls match most PCR product sizes used in clinical routine molecular assays and will assist to discriminate true from false negative results.

Nucleocapsid Protein Annealing of a Primer-Template Enhances (+)-Strand DNA Synthesis and Fidelity by HIV-1 Reverse Transcriptase†

PubMed Central

Kim, Jiae; Roberts, Anne; Yuan, Hua; Xiong, Yong; Anderson, Karen S.

2012-01-01

Human immunodeficiency virus type-1 (HIV-1) requires reverse transcriptase (RT) and HIV-1 nucleocapsid protein (NCp7) for proper viral replication. HIV-1 NCp7 has been shown to enhance various steps in reverse transcription including tRNA initiation and strand transfer which may be mediated through interactions with RT as well as RNA and DNA oligonucleotides. With the use of DNA oligonucleotides, we have examined the interaction of NCp7 with RT and the kinetics of reverse transcription during (+)-strand synthesis with an NCp7-facilitated annealed primer-template. Using a pre-steady state kinetics approach, the NCp7-annealed primer-template has a substantial increase (3-7 fold) in the rate of incorporation (kpol) by RT as compared to heat annealed primer-template with single nucleotide incorporation. There was also a 2-fold increase in the binding affinity constant (Kd) of the nucleotide. These differences in kpol and Kd were not through direct interactions between HIV-1 RT and NCp7. When examining extension by RT, the data suggests that the NCp7-annealed primer-template facilitates the formation of a longer product more quickly compared to the heat annealed primer-template. This enhancement in rate is mediated through interactions with NCp7’s zinc fingers and N-terminal domain and nucleic acids. The NCp7-annealed primer-template also enhances the fidelity of RT (3-fold) by slowing the rate of incorporation of an incorrect nucleotide. Taken together, this study elucidates a new role of NCp7 by facilitating DNA-directed DNA synthesis during reverse transcription by HIV-1 RT that may translate into enhanced viral fitness and offers an avenue to exploit for targeted therapeutic intervention against HIV. PMID:22210155

Effects of silane- and MDP-based primers application orders on zirconia-resin adhesion-A ToF-SIMS study.

PubMed

Chuang, Shu-Fen; Kang, Li-Li; Liu, Yi-Chuan; Lin, Jui-Che; Wang, Ching-Cheng; Chen, Hui-Min; Tai, Cheng-Kun

2017-08-01

To evaluate the 3-methacryloyloxypropyltrimethoxysilane (MPS)- and 10-methacryloyloxydecyl-dihydrogen-phosphate (MDP)-base primers, in their single or sequential applications, with regard to modifying zirconia surfaces and improving resin-zirconia adhesion. Zirconia disks received different treatments: without primer (Zr), MPS-base primer (S), MDP-base primer (M), MPS/MDP mixture (SMmix), MPS followed by MDP (SM), and MDP followed by MPS (MS). The compositions and chemical interactions of the coatings to zirconia were analyzed using time-of-flight secondary ion mass spectrometry (ToF-SIMS) and reconstructed 3D ion images. Surface wettability of these coatings to water and resin adhesive was assessed. The shear bond strength (SBS) between resin and the treated zirconia was also examined before and after thermocycling. Groups S and MS presented substantial OH - ions in the coatings and zirconia substrate. PO 2 - and PO 3 - fragments existed in all MDP-treatment groups with various proportions and distributions, while groups M and SM showed higher proportions of PO 3 - and the zirconium phosphate related ions. In 3D ion images, PO 3 - in groups M and SM was denser and segregated to the interface, but was dispersed or overlaid above PO 2 - in SMmix and MS. All the primers increased the surface wettability to water and resin, with M and SM presenting superhydrophilic surfaces. All MDP-treatment groups showed improved SBS before thermocycling, while M and SM retained higher SBS after this. The MDP-base primer shows a relevant function in facilitating POZr bonding and enhancing resin-zirconia bonding. The co-treated MPS impairs the chemical activity of MDP, especially if it is the final coat. Copyright © 2017 The Academy of Dental Materials. Published by Elsevier Ltd. All rights reserved.

Highly effective sequencing whole chloroplast genomes of angiosperms by nine novel universal primer pairs.

PubMed

Yang, Jun-Bo; Li, De-Zhu; Li, Hong-Tao

2014-09-01

Chloroplast genomes supply indispensable information that helps improve the phylogenetic resolution and even as organelle-scale barcodes. Next-generation sequencing technologies have helped promote sequencing of complete chloroplast genomes, but compared with the number of angiosperms, relatively few chloroplast genomes have been sequenced. There are two major reasons for the paucity of completely sequenced chloroplast genomes: (i) massive amounts of fresh leaves are needed for chloroplast sequencing and (ii) there are considerable gaps in the sequenced chloroplast genomes of many plants because of the difficulty of isolating high-quality chloroplast DNA, preventing complete chloroplast genomes from being assembled. To overcome these obstacles, all known angiosperm chloroplast genomes available to date were analysed, and then we designed nine universal primer pairs corresponding to the highly conserved regions. Using these primers, angiosperm whole chloroplast genomes can be amplified using long-range PCR and sequenced using next-generation sequencing methods. The primers showed high universality, which was tested using 24 species representing major clades of angiosperms. To validate the functionality of the primers, eight species representing major groups of angiosperms, that is, early-diverging angiosperms, magnoliids, monocots, Saxifragales, fabids, malvids and asterids, were sequenced and assembled their complete chloroplast genomes. In our trials, only 100 mg of fresh leaves was used. The results show that the universal primer set provided an easy, effective and feasible approach for sequencing whole chloroplast genomes in angiosperms. The designed universal primer pairs provide a possibility to accelerate genome-scale data acquisition and will therefore magnify the phylogenetic resolution and species identification in angiosperms. © 2014 John Wiley & Sons Ltd.

Single-Case Experimental Designs for the Evaluation of Treatments for Self-Injurious and Suicidal Behaviors

ERIC Educational Resources Information Center

Rizvi, Shireen L.; Nock, Matthew K.

2008-01-01

Single-case experimental designs (SCEDs) provide a time- and cost-effective alternative to randomized clinical trials and offer significant advantages in terms of internal and external validity. A brief history and primer on SCEDs is provided, specifically for use in suicide intervention research. Various SCED methodologies, such as AB, ABAB,…

The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing.

PubMed

Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P; Panitz, Frank; Bendixen, Christian; Nielsen, Rasmus; Willerslev, Eske

2007-02-14

The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources. We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences). Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis. We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%). Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial analyses, population genetics, and phylogenetics.

Setting up Targeted Research Interviews: A Primer for Students and New Interviewers

ERIC Educational Resources Information Center

Noy, Darren

2009-01-01

This article analyzes key strategic considerations for setting up targeted research interviews, including human subjects and Institutional Review Board requirements, approaching respondents, the medium of contact, using technology, cultural conceptions of time and commitment, using networks, wading through bureaucracies, and watching for warning…

Herpes Simplex Virus Processivity Factor UL42 Imparts Increased DNA-Binding Specificity to the Viral DNA Polymerase and Decreased Dissociation from Primer-Template without Reducing the Elongation Rate

PubMed Central

Weisshart, Klaus; Chow, Connie S.; Coen, Donald M.

1999-01-01

Herpes simplex virus DNA polymerase consists of a catalytic subunit, Pol, and a processivity subunit, UL42, that, unlike other established processivity factors, binds DNA directly. We used gel retardation and filter-binding assays to investigate how UL42 affects the polymerase-DNA interaction. The Pol/UL42 heterodimer bound more tightly to DNA in a primer-template configuration than to single-stranded DNA (ssDNA), while Pol alone bound more tightly to ssDNA than to DNA in a primer-template configuration. The affinity of Pol/UL42 for ssDNA was reduced severalfold relative to that of Pol, while the affinity of Pol/UL42 for primer-template DNA was increased ∼15-fold relative to that of Pol. The affinity of Pol/UL42 for circular double-stranded DNA (dsDNA) was reduced drastically relative to that of UL42, but the affinity of Pol/UL42 for short primer-templates was increased modestly relative to that of UL42. Pol/UL42 associated with primer-template DNA ∼2-fold faster than did Pol and dissociated ∼10-fold more slowly, resulting in a half-life of 2 h and a subnanomolar Kd. Despite such stable binding, rapid-quench analysis revealed that the rates of elongation of Pol/UL42 and Pol were essentially the same, ∼30 nucleotides/s. Taken together, these studies indicate that (i) Pol/UL42 is more likely than its subunits to associate with DNA in a primer-template configuration rather than nonspecifically to either ssDNA or dsDNA, and (ii) UL42 reduces the rate of dissociation from primer-template DNA but not the rate of elongation. Two models of polymerase-DNA interactions during replication that may explain these findings are presented. PMID:9847307

RPA physically interacts with the human DNA glycosylase NEIL1 to regulate excision of oxidative DNA base damage in primer-template structures.

PubMed

Theriot, Corey A; Hegde, Muralidhar L; Hazra, Tapas K; Mitra, Sankar

2010-06-04

The human DNA glycosylase NEIL1, activated during the S-phase, has been shown to excise oxidized base lesions in single-strand DNA substrates. Furthermore, our previous work demonstrating functional interaction of NEIL1 with PCNA and flap endonuclease 1 (FEN1) suggested its involvement in replication-associated repair. Here we show interaction of NEIL1 with replication protein A (RPA), the heterotrimeric single-strand DNA binding protein that is essential for replication and other DNA transactions. The NEIL1 immunocomplex isolated from human cells contains RPA, and its abundance in the complex increases after exposure to oxidative stress. NEIL1 directly interacts with the large subunit of RPA (K(d) approximately 20 nM) via the common interacting interface (residues 312-349) in NEIL1's disordered C-terminal region. RPA inhibits the base excision activity of both wild-type NEIL1 (389 residues) and its C-terminal deletion CDelta78 mutant (lacking the interaction domain) for repairing 5-hydroxyuracil (5-OHU) in a primer-template structure mimicking the DNA replication fork. This inhibition is reduced when the damage is located near the primer-template junction. Contrarily, RPA moderately stimulates wild-type NEIL1 but not the CDelta78 mutant when 5-OHU is located within the duplex region. While NEIL1 is inhibited by both RPA and Escherichia coli single-strand DNA binding protein, only inhibition by RPA is relieved by PCNA. These results showing modulation of NEIL1's activity on single-stranded DNA substrate by RPA and PCNA support NEIL1's involvement in repairing the replicating genome. Copyright 2010 Elsevier B.V. All rights reserved.

Development of a Highly Sensitive Nested-PCR Procedure Using a Single Closed Tube for Detection of Erwinia amylovora in Asymptomatic Plant Material

PubMed Central

Llop, Pablo; Bonaterra, Anna; Peñalver, Javier; López, María M.

2000-01-01

A novel method, which involves a nested PCR in a single closed tube, was developed for the sensitive detection of Erwinia amylovora in plant material. The external and internal primer pairs used had different annealing temperatures and directed the amplification of a specific DNA fragment from plasmid pEA29. The procedure involved two consecutive PCRs, the first of which was performed at a higher annealing temperature that allowed amplification only by the external primer pair. Using pure cultures of E. amylovora, the sensitivity of the nested PCR in one tube was similar to that of a standard nested PCR in two tubes. The specificity and sensitivity were greater than those of standard PCR procedures that used a single primer pair. The presence of inhibitors in plant material, very common in E. amylovora hosts, is overcome with this system in combination with a simple DNA extraction protocol because it eliminates many of the inhibitory compounds. In addition, it needs a very small sample volume (1 μl of DNA extracted). With 83 samples of naturally infected material, this method achieved better results than any other PCR technique: standard PCR detected 55% of positive samples, two-tube nested PCR detected 71% of positive samples, and nested PCR in a single closed tube detected 78% of positive samples. When analyzing asymptomatic plant material, the number of positive samples detected by the developed nested PCR was also the highest, compared with the PCR protocols indicated previously (17, 20, and 25% of 251 samples analyzed, respectively). This method is proposed for the detection of endophytic and epiphytic populations of E. amylovora in epidemiological studies and for routine use in quarantine surveys, due to its high sensitivity, specificity, speed, and simplicity. PMID:10788384

Non-lethal sampling for the detection of Myxobolus cerebralis in asymptomatic rainbow trout

USGS Publications Warehouse

Schill, Bane; Waldrop, Thomas; Densmore, Christine; Blazer, Vicki

1999-01-01

We have described in previous reports (Schill et al., 1998) the development of a polymerase chain reaction (PCR) amplification of 18S ribosomal RNA for the detection of Myxozoan parasites. Oligonucleotide primers were developed by multiple alignment of Myxozoan sequence information and analysis by a custom-written computer program (PRIM). Candidate pairs of primer sequences were then analyzed for specificity by BLAST (Basic Local Alignment Search Tool). From these, a set of promising primers (MYXFWD and MYXREV) was chosen for further testing. These were chosen because they should direct detection of a number of Myxozoan species (Table 1). PCR using MXYFWD and MYXREV proved to be robust and relatively free of artifact products. Further, we were able to routinely detect Myxobolus cerebralis in fish tissues (Figure 1).

Evolutionary dynamics of an expressed MHC class IIβ locus in the Ranidae (Anura) uncovered by genome walking and high-throughput amplicon sequencing

USGS Publications Warehouse

Mulder, Kevin P.; Cortazar-Chinarro, Maria; Harris, D. James; Crottini, Angelica; Grant, Evan H. Campbell; Fleischer, Robert C.; Savage, Anna E.

2017-01-01

The Major Histocompatibility Complex (MHC) is a genomic region encoding immune loci that are important and frequently used markers in studies of adaptive genetic variation and disease resistance. Given the primary role of infectious diseases in contributing to global amphibian declines, we characterized the hypervariable exon 2 and flanking introns of the MHC Class IIβ chain for 17 species of frogs in the Ranidae, a speciose and cosmopolitan family facing widespread pathogen infections and declines. We find high levels of genetic variation concentrated in the Peptide Binding Region (PBR) of the exon. Ten codons are under positive selection, nine of which are located in the mammal-defined PBR. We hypothesize that the tenth codon (residue 21) is an amphibian-specific PBR site that may be important in disease resistance. Trans-species and trans-generic polymorphisms are evident from exon-based genealogies, and co-phylogenetic analyses between intron, exon and mitochondrial based reconstructions reveal incongruent topologies, likely due to different locus histories. We developed two sets of barcoded adapters that reliably amplify a single and likely functional locus in all screened species using both 454 and Illumina based sequencing methods. These primers provide a resource for multiplexing and directly sequencing hundreds of samples in a single sequencing run, avoiding the labour and chimeric sequences associated with cloning, and enabling MHC population genetic analyses. Although the primers are currently limited to the 17 species we tested, these sequences and protocols provide a useful genetic resource and can serve as a starting point for future disease, adaptation and conservation studies across a range of anuran taxa.

A single tube PCR assay for simultaneous amplification of HSV-1/-2, VZV, CMV, HHV-6A/-6B, and EBV DNAs in cerebrospinal fluid from patients with virus-related neurological diseases.

PubMed

Yamamoto, T; Nakamura, Y

2000-10-01

Cerebrospinal fluid (CSF) specimens from 27 patients with encephalitis, meningitis, and other neurological diseases were studied for the presence of herpes simplex virus types 1 and 2 (HSV-1/-2), varicella-zoster virus (VZV), cytomegalovirus (CMV), human herpesviruses 6A and 6B (HHV-6A/-6B) and Epstein-Barr virus (EBV) DNA using the polymerase chain reaction (PCR) method. The DNAs were amplified using two sets of consensus primer pairs in a single tube, bringing simultaneous amplification of the herpesviruses. The PCR products were analyzed by agarose gel electrophoresis, and Southern blot hybridization with virus-type specific probes, thus allowing discrimination between the different types of herpesviruses to be made. Each virus-specific probe was highly specific for identifying the PCR product. Thirty CSF specimens from 13 patients with encephalitis and 10 specimens from 10 patients with meningitis, respectively, were examined using this method. Eight patients with encephalitis and six with meningitis were positive for different herpesviruses, including patients with coinfections (HSV-1/-2 and VZV, VZV and CMV). Among four CSF specimens from four patients with other neurological disorders, dual amplification of CMV and EBV was present. Since identification of the types of herpesviruses in this system requires a very small amount of CSF, and is completed with one PCR, it is useful for routine diagnosis of herpesvirus infections in diagnostic laboratories. The viruses responsible for central nervous system infection are easily detected with various coinfection and serial patterns of herpesviruses, by this consensus primer-based PCR method. This may give an insight into the relationship between virus-related neurological diseases (VRNDS) and herpesvirus infections.

Comparison between single PCR and nested PCR in detection of human papilloma viruses in paraffin-embedded OSCC and fresh oral mucosa.

PubMed

Jalouli, Miranda; Jalouli, Jamshid; Ibrahim, Salah O; Hirsch, Jan-Michaél; Sand, Lars

2015-01-01

Infection with human papilloma virus (HPV) has been implicated as one of the risk factors for the development of oropharyngeal cancer. Many different HPV tests exist, and information regarding their specific technical, analytical, and clinical properties is increasing. This study aimed to compare the level of detection of HPV using two reliable polymerase chain reaction (PCR) methods, nested PCR (NPCR) and single PCR (SPCR), in archival paraffin-embedded oral squamous cell carcinoma (OSCC) samples and fresh oral mucosa specimens. The presence of HPV genome in two groups of tissue samples was analyzed: (i) 57 paraffin-embedded OSCC samples from Sudan and (ii) eight healthy fresh oral mucosal samples from Swedish volunteers. The specimens were tested by SPCR with primer pair MY9/MY11 and NPCR using GP5+/GP6+ primer sets. Eighteen (32%) out of the 57 paraffin-embedded OSCC samples, and five (62%) out of the eight fresh clinically healthy samples were found to be HPV-positive with NPCR. With SPCR, four (7%) out of the paraffin-embedded OSCC samples were HPV-positive. A statistically significant difference between HPV-positive and -negative samples was found when comparing NPCR and SPCR in OSCC and fresh oral mucosa (p<0.0001). The comparative test between SPCR and NPCR showed 100% sensitivity and 69% specificity for OSCC. The use of the GP5+/GP6+ nested PCR increased the positivity rate, efficiency rate and sensitivity of HPV detection in oral samples significantly and should be considered as the method of choice. Copyright © 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Ligase Detection Reaction for the Analysis of Point Mutations using Free Solution Conjugate Electrophoresis in a Polymer Microfluidic Device

PubMed Central

Sinville, Rondedrick; Coyne, Jennifer; Meagher, Robert J.; Cheng, Yu-Wei; Barany, Francis; Barron, Annelise; Soper, Steven A.

2010-01-01

We have developed a new method for the analysis of low abundant point mutations in genomic DNA using a combination of an allele-specific ligase detection reaction (LDR) with free-solution conjugate electrophoresis (FSCE) to generate and analyze the genetic products. FSCE eliminates the need for a polymer sieving matrix by conjugating chemically synthesized polyamide “drag-tags” onto the LDR primers. The additional drag of the charge-neutral drag-tag breaks the linear scaling of the charge-to-friction ratio of DNA and enables size-based separations of DNA in free solution using electrophoresis with no sieving matrix. We successfully demonstrate the conjugation of polyamide drag-tags onto a set of four LDR primers designed to probe the K-ras oncogene for mutations highly associated with colorectal cancer, the simultaneous generation of fluorescently-labeled LDR/drag-tagged (LDR-dt) products in a multiplexed, single-tube format with mutant:wild-type ratios as low as 1:100, respectively, and the single-base, high-resolution separation of all four LDR-dt products. Separations were conducted in free solution with no polymer network using both a commercial capillary array electrophoresis (CAE) system and a poly(methylmethacrylate), PMMA, microchip replicated via hot-embossing with only a Tris-based running buffer containing additives to suppress the electroosmotic flow (EOF). Typical analysis times for LDR-dt conjugates were 11 min using the CAE system and as low as 85 s for the PMMA microchips. With resolution comparable to traditional gel-based CAE, FSCE along with microchip electrophoresis decreased the separation time by more than a factor of 40. PMID:19053073

Evolutionary dynamics of an expressed MHC class IIβ locus in the Ranidae (Anura) uncovered by genome walking and high-throughput amplicon sequencing.

PubMed

Mulder, Kevin P; Cortazar-Chinarro, Maria; Harris, D James; Crottini, Angelica; Campbell Grant, Evan H; Fleischer, Robert C; Savage, Anna E

2017-11-01

The Major Histocompatibility Complex (MHC) is a genomic region encoding immune loci that are important and frequently used markers in studies of adaptive genetic variation and disease resistance. Given the primary role of infectious diseases in contributing to global amphibian declines, we characterized the hypervariable exon 2 and flanking introns of the MHC Class IIβ chain for 17 species of frogs in the Ranidae, a speciose and cosmopolitan family facing widespread pathogen infections and declines. We find high levels of genetic variation concentrated in the Peptide Binding Region (PBR) of the exon. Ten codons are under positive selection, nine of which are located in the mammal-defined PBR. We hypothesize that the tenth codon (residue 21) is an amphibian-specific PBR site that may be important in disease resistance. Trans-species and trans-generic polymorphisms are evident from exon-based genealogies, and co-phylogenetic analyses between intron, exon and mitochondrial based reconstructions reveal incongruent topologies, likely due to different locus histories. We developed two sets of barcoded adapters that reliably amplify a single and likely functional locus in all screened species using both 454 and Illumina based sequencing methods. These primers provide a resource for multiplexing and directly sequencing hundreds of samples in a single sequencing run, avoiding the labour and chimeric sequences associated with cloning, and enabling MHC population genetic analyses. Although the primers are currently limited to the 17 species we tested, these sequences and protocols provide a useful genetic resource and can serve as a starting point for future disease, adaptation and conservation studies across a range of anuran taxa. Copyright © 2017 Elsevier Ltd. All rights reserved.

The development of loop-mediated isothermal amplification (LAMP) assays for the rapid authentication of five forbidden vegetables in strict vegetarian diets

PubMed Central

Lee, Meng-Shiou; Su, Ting-Ying; Lien, Yi-Yang; Sheu, Shyang-Chwen

2017-01-01

Plant-based food ingredients such as garlic, Chinese leek, Chinese onion, green onion and onion are widely used in many cuisines around the world. However, these ingredients known as the “five forbidden vegetables” (FFVs) are not allowed in some vegetarian diets. In this study, a loop-mediated isothermal amplification (LAMP) assay was developed for the detection of FFVs using five respective LAMP primer sets. The specific primers targeted the ITS1-5.8S-ITS2 nuclear ribosomal DNA sequence regions among the five vegetables. The results demonstrated that the identification of FFVs using the newly developed LAMP assay is more sensitive than the traditional PCR method. Using pepper, basil, parsley, chili and ginger as references, established LAMP primer sets showed high specificity for the identification of the FFV species. Moreover, when FFVs were mixed with other plant ingredients at different ratios (100:0, 50:50, 20:80, 10:90, 5:95, 2:98, and 1:99), no cross-reactivity was evident using LAMP. Finally, genomic DNAs extracted from boiled and steamed FFVs in processed foods were used as templates; the performance of the LAMP reaction was not influenced using validated LAMP primers. Not only can FFV ingredients be identified but commercial foods containing FFVs can also be authenticated. This LAMP method will be useful for the authentication of FFVs in practical food markets in the future. PMID:28290475

The development of loop-mediated isothermal amplification (LAMP) assays for the rapid authentication of five forbidden vegetables in strict vegetarian diets.

PubMed

Lee, Meng-Shiou; Su, Ting-Ying; Lien, Yi-Yang; Sheu, Shyang-Chwen

2017-03-14

Plant-based food ingredients such as garlic, Chinese leek, Chinese onion, green onion and onion are widely used in many cuisines around the world. However, these ingredients known as the "five forbidden vegetables" (FFVs) are not allowed in some vegetarian diets. In this study, a loop-mediated isothermal amplification (LAMP) assay was developed for the detection of FFVs using five respective LAMP primer sets. The specific primers targeted the ITS1-5.8S-ITS2 nuclear ribosomal DNA sequence regions among the five vegetables. The results demonstrated that the identification of FFVs using the newly developed LAMP assay is more sensitive than the traditional PCR method. Using pepper, basil, parsley, chili and ginger as references, established LAMP primer sets showed high specificity for the identification of the FFV species. Moreover, when FFVs were mixed with other plant ingredients at different ratios (100:0, 50:50, 20:80, 10:90, 5:95, 2:98, and 1:99), no cross-reactivity was evident using LAMP. Finally, genomic DNAs extracted from boiled and steamed FFVs in processed foods were used as templates; the performance of the LAMP reaction was not influenced using validated LAMP primers. Not only can FFV ingredients be identified but commercial foods containing FFVs can also be authenticated. This LAMP method will be useful for the authentication of FFVs in practical food markets in the future.

Detection of different South American hantaviruses.

PubMed

Guterres, Alexandro; de Oliveira, Renata Carvalho; Fernandes, Jorlan; Schrago, Carlos Guerra; de Lemos, Elba Regina Sampaio

2015-12-02

Hantaviruses are the etiologic agents of Hemorrhagic Fever with Renal Syndrome (HFRS) in Old World, and Hantavirus Pulmonary Syndrome (HPS)/Hantavirus Cardiopulmonary Syndrome (HCPS), in the New World. Serological methods are the most common approach used for laboratory diagnosis of HCPS, however theses methods do not allow the characterization of viral genotypes. The polymerase chain reaction (PCR) has been extensively used for diagnosis of viral infections, including those caused by hantaviruses, enabling detection of few target sequence copies in the sample. However, most studies proposed methods of PCR with species-specific primers. This study developed a simple and reliable diagnostic system by RT-PCR for different hantavirus detection. Using new primers set, we evaluated human and rodent hantavirus positive samples of various regions from Brazil. Besides, we performed computational analyzes to evaluate the detection of other South American hantaviruses. The diagnostic system by PCR proved to be a sensible and simple assay, allowing amplification of Juquitiba virus, Araraquara virus, Laguna Negra virus, Rio Mamore virus and Jabora virus, beyond of the possibility of the detecting Andes, Anajatuba, Bermejo, Choclo, Cano Delgadito, Lechiguanas, Maciel, Oran, Pergamino and Rio Mearim viruses. The primers sets designed in this study can detect hantaviruses from almost all known genetics lineages in Brazil and from others South America countries and also increases the possibility to detect new hantaviruses. These primers could easily be used both in diagnosis of suspected hantavirus infections in humans and also in studies with animals reservoirs. Copyright © 2015 Elsevier B.V. All rights reserved.

Establishment of a sensitive system for analysis of human vaginal microbiota on the basis of rRNA-targeted reverse transcription-quantitative PCR.

PubMed

Kurakawa, Takashi; Ogata, Kiyohito; Tsuji, Hirokazu; Kado, Yukiko; Takahashi, Takuya; Kida, Yumi; Ito, Masahiro; Okada, Nobuhiko; Nomoto, Koji

2015-04-01

Ten specific primer sets, for Lactobacillus gasseri, Lactobacillus crispatus, Atopobium vaginae, Gardnerella vaginalis, Mobiluncus curtisii, Chlamydia trachomatis/muridarum, Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, Bifidobacterium adolescentis, and Bifidobacterium angulatum, were developed for quantitative analysis of vaginal microbiota. rRNA-targeted reverse transcription-quantitative PCR (RT-qPCR) analysis of the vaginal samples from 12 healthy Japanese volunteers using the new primer sets together with 25 existing primer sets revealed the diversity of their vaginal microbiota: Lactobacilli such as L. crispatus, L. gasseri, Lactobacillus jensenii, Lactobacillus iners, and Lactobacillus vaginalis, as the major populations at 10(7) cells/ml vaginal fluid, were followed by facultative anaerobes such as Streptococcus and strict anaerobes at lower population levels of 10(4) cells/ml or less. Certain bacterial vaginosis (BV)-related bacteria, such as G. vaginalis, A. vaginae, M. curtisii, and Prevotella, were also detected in some subjects. Especially in one subject, both G. vaginalis and A. vaginae were detected at high population levels of 10(8.8) and 10(8.9) cells/ml vaginal fluid, suggesting that she is an asymptomatic BV patient. These results suggest that the RT-qPCR system is effective for accurate analysis of major vaginal commensals and diagnosis of several vaginal infections. Copyright © 2015 Elsevier B.V. All rights reserved.

Use of molecular techniques to evaluate the survival of a microorganism injected into an aquifer

USGS Publications Warehouse

Thiem, S.M.; Krumme, M.L.; Smith, R.L.; Tiedje, J.M.

1994-01-01

A PCR primer set and an internal probe that are specific for Pseudomonas sp. strain B13, a 3-chlorobenzoate-metabolizing strain, were developed. Using this primer set and probe, we were able to detect Pseudomonas sp. strain B13 DNA sequences in DNA extracted from aquifer samples 14.5 months after Pseudomonas sp. strain B13 had been injected into a sand and gravel aquifer. This primer set and probe were also used to analyze isolates from 3-chlorobenzoate enrichments of the aquifer samples by Southern blot analysis. Hybridization of Southern blots with the Pseudomonas sp. strain B13-specific probe and a catabolic probe in conjunction with restriction fragment length polymorphism (RFLP) analysis of ribosome genes was used to determine that viable Pseudomonas sp. strain B13 persisted in this environment. We isolated a new 3-chlorobenzoate-degrading strain from one of these enrichment cultures. The B13-specific probe does not hybridize to DNA from this isolate. The new strain could be the result of gene exchange between Pseudomonas sp. strain B13 and an indigenous bacterium. This speculation is based on an RFLP pattern of ribosome genes that differs from that of Pseudomonas sp. strain B13, the fact that identically sized restriction fragments hybridized to the catabolic gene probe, and the absence of any enrichable 3-chlorobenzoate-degrading strains in the aquifer prior to inoculation.

Improved PCR assay for the species-specific identification and quantitation of Legionella pneumophila in water.

PubMed

Cho, Min Seok; Ahn, Tae-Young; Joh, Kiseong; Lee, Eui Seok; Park, Dong Suk

2015-11-01

Legionellosis outbreak is a major global health care problem. However, current Legionella risk assessments may be compromised by uncertainties in Legionella detection methods, infectious dose, and strain infectivity. These limitations may place public health at significant risk, leading to significant monetary losses in health care. However, there are still unmet needs for its rapid identification and monitoring of legionellae in water systems. Therefore, in the present study, a primer set was designed based on a LysR-type transcriptional regulator (LTTR) family protein gene of Legionella pneumophila subsp. pneumophila str. Philadelphia 1 because it was found that this gene is structurally diverse among species through BLAST searches. The specificity of the primer set was evaluated using genomic DNA from 6 strains of L. pneumophila, 5 type strains of other related Legionella species, and other 29 reference pathogenic bacteria. The primer set used in the PCR assay amplified a 264-bp product for only targeted six strains of L. pneumophila. The assay was also able to detect at least 1.39 × 10(3) copies/μl of cloned amplified target DNA using purified DNA or 7.4 × 10(0) colony-forming unit per reaction when using calibrated cell suspension. In addition, the sensitivity and specificity of this assay were confirmed by successful detection of Legionella pneumophila in environmental water samples.

Do we need primer for orthodontic bonding? A randomized controlled trial.

PubMed

Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

2015-04-01

To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P < 0.0001). As the study was only performed by one operator, the results can therefore only be truly be applied to their practice. Also this study was powered to ascertain if there was no difference between the 2 groups up to 5%, however orthodontists may consider a change in the bracket failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown statistically to be non-inferior to bonding with primer (P =0.08). There was no significant difference in bond-up times. Bond failure was more likely to happen at the composite-enamel interface when bonded without a primer. No conflict of interest for all authors. No funding sources were used. Study was not registered on external databases. © The Author 2014. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Collecting Behavioral Data in General Education Settings: A Primer for Behavioral Data Collection

ERIC Educational Resources Information Center

Lee, David L.; Vostal, Brooks; Lylo, Brooke; Hua, Youjia

2011-01-01

Recent trends toward the inclusion of students with disabilities mean that a majority of students with emotional and behavioral disorders (EBD) now spend at least 40% of their day in general education settings. With this change in location, teachers in general education settings are now asked to perform tasks that were not given much emphasis…

KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bowman, Stephen M

2008-09-01

The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VImore » in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of using SCALE/KENO-VI for criticality analyses; the SCALE/KENO-VI manual provides information on the use of SCALE/KENO-VI and all its modules. The primer also contains an appendix with sample input files.« less

Rapid and inexpensive analysis of genetic variability in Arapaima gigas by PCR multiplex panel of eight microsatellites.

PubMed

Hamoy, I G; Santos, E J M; Santos, S E B

2008-01-22

The aim of the present study was the development of a multiplex genotyping panel of eight microsatellite markers of Arapaima gigas, previously described. Specific primer pairs were developed, each one of them marked with either FAM-6, HEX or NED. The amplification conditions using the new primers were standardized for a single reaction. The results obtained demonstrate high heterozygosity (average of 0.69) in a Lower Amazon population. The multiplex system described can thus be considered a fast, efficient and inexpensive method for the investigation of genetic variability in Arapaima populations.

Identification of Erwinia species isolated from apples and pears by differential PCR.

PubMed

Gehring, I; Geider, K

2012-04-01

Many pathogenic and epiphytic bacteria isolated from apples and pears belong to the genus Erwinia; these include the species E. amylovora, E. pyrifoliae, E. billingiae, E. persicina, E. rhapontici and E. tasmaniensis. Identification and classification of freshly isolated bacterial species often requires tedious taxonomic procedures. To facilitate routine identification of Erwinia species, we have developed a PCR method based on species-specific oligonucleotides (SSOs) from the sequences of the housekeeping genes recA and gpd. Using species-specific primers that we report here, differentiation was done with conventional PCR (cPCR) and quantitative PCR (qPCR) applying two consecutive primer annealing temperatures. The specificity of the primers depends on terminal Single Nucleotide Polymorphisms (SNPs) that are characteristic for the target species. These PCR assays enabled us to distinguish eight Erwinia species, as well as to identify new Erwinia isolates from plant surfaces. When performed with mixed bacterial cultures, they only detected a single target species. This method is a novel approach to classify strains within the genus Erwinia by PCR and it can be used to confirm other diagnostic data, especially when specific PCR detection methods are not already available. The method may be applied to classify species within other bacterial genera. Copyright © 2012 Elsevier B.V. All rights reserved.

Direct sequencing of hepatitis A virus and norovirus RT-PCR products from environmentally contaminated oyster using M13-tailed primers.

PubMed

Williams-Woods, Jacquelina; González-Escalona, Narjol; Burkhardt, William

2011-12-01

Human norovirus (HuNoV) and hepatitis A (HAV) are recognized as leading causes of non-bacterial foodborne associated illnesses in the United States. DNA sequencing is generally considered the standard for accurate viral genotyping in support of epidemiological investigations. Due to the genetic diversity of noroviruses (NoV), degenerate primer sets are often used in conventional reverse transcription (RT) PCR and real-time RT-quantitative PCR (RT-qPCR) for the detection of these viruses and cDNA fragments are generally cloned prior to sequencing. HAV detection methods that are sensitive and specific for real-time RT-qPCR yields small fragments sizes of 89-150bp, which can be difficult to sequence. In order to overcome these obstacles, norovirus and HAV primers were tailed with M13 forward and reverse primers. This modification increases the sequenced product size and allows for direct sequencing of the amplicons utilizing complementary M13 primers. HuNoV and HAV cDNA products from environmentally contaminated oysters were analyzed using this method. Alignments of the sequenced samples revealed ≥95% nucleotide identities. Tailing NoV and HAV primers with M13 sequence increases the cDNA product size, offers an alternative to cloning, and allows for rapid, accurate and direct sequencing of cDNA products produced by conventional or real time RT-qPCR assays. Published by Elsevier B.V.

PRIMED: PRIMEr Database for Deleting and Tagging All Fission and Budding Yeast Genes Developed Using the Open-Source Genome Retrieval Script (GRS)

PubMed Central

Cummings, Michael T.; Joh, Richard I.; Motamedi, Mo

2015-01-01

The fission (Schizosaccharomyces pombe) and budding (Saccharomyces cerevisiae) yeasts have served as excellent models for many seminal discoveries in eukaryotic biology. In these organisms, genes are deleted or tagged easily by transforming cells with PCR-generated DNA inserts, flanked by short (50-100bp) regions of gene homology. These PCR reactions use especially designed long primers, which, in addition to the priming sites, carry homology for gene targeting. Primer design follows a fixed method but is tedious and time-consuming especially when done for a large number of genes. To automate this process, we developed the Python-based Genome Retrieval Script (GRS), an easily customizable open-source script for genome analysis. Using GRS, we created PRIMED, the complete PRIMEr D atabase for deleting and C-terminal tagging genes in the main S. pombe and five of the most commonly used S. cerevisiae strains. Because of the importance of noncoding RNAs (ncRNAs) in many biological processes, we also included the deletion primer set for these features in each genome. PRIMED are accurate and comprehensive and are provided as downloadable Excel files, removing the need for future primer design, especially for large-scale functional analyses. Furthermore, the open-source GRS can be used broadly to retrieve genome information from custom or other annotated genomes, thus providing a suitable platform for building other genomic tools by the yeast or other research communities. PMID:25643023

A complex structure in the mRNA of Tf1 is recognized and cleaved to generate the primer of reverse transcription.

PubMed

Lin, J H; Levin, H L

1997-01-15

All retroviruses and LTR-containing retrotransposons are thought to require specific tRNA molecules to serve as primers of reverse transcription. An exception is the LTR-containing retrotransposon Tf1, isolated from Schizosaccharomyces pombe. Instead of requiring a tRNA, the reverse transcriptase of Tf1 uses the first 11 bases of the Tf1 transcript as the primer for reverse transcription. The primer is generated by a cleavage that occurs between bases 11 and 12 of the Tf1 mRNA. Sequence analysis of the 5' untranslated region of the Tf1 mRNA resulted in the identification of a region with the potential to form an RNA structure of 89 bases that included the primer binding site and the first 11 bases of the Tf1 mRNA. Systematic mutagenesis of this region revealed 34 single-point mutants in the structure that resulted in reduced transposition activity. The defects in transposition correlated with reduced level of Tf1 reverse transcripts as determined by DNA blot analysis. Evidence that the RNA structure did form in vivo included the result that strains with second site mutations that restored complementarity resulted in increased levels of reverse transcripts and Tf1 transposition. The majority of the mutants defective for reverse transcription were unable to cleave the Tf1 mRNA between bases 11 and 12. These data indicate that formation of an extensive RNA structure was required for the cleavage reaction that generated the primer for Tf1 reverse transcription.

A multiplex primer design algorithm for target amplification of continuous genomic regions.

PubMed

Ozturk, Ahmet Rasit; Can, Tolga

2017-06-19

Targeted Next Generation Sequencing (NGS) assays are cost-efficient and reliable alternatives to Sanger sequencing. For sequencing of very large set of genes, the target enrichment approach is suitable. However, for smaller genomic regions, the target amplification method is more efficient than both the target enrichment method and Sanger sequencing. The major difficulty of the target amplification method is the preparation of amplicons, regarding required time, equipment, and labor. Multiplex PCR (MPCR) is a good solution for the mentioned problems. We propose a novel method to design MPCR primers for a continuous genomic region, following the best practices of clinically reliable PCR design processes. On an experimental setup with 48 different combinations of factors, we have shown that multiple parameters might effect finding the first feasible solution. Increasing the length of the initial primer candidate selection sequence gives better results whereas waiting for a longer time to find the first feasible solution does not have a significant impact. We generated MPCR primer designs for the HBB whole gene, MEFV coding regions, and human exons between 2000 bp to 2100 bp-long. Our benchmarking experiments show that the proposed MPCR approach is able produce reliable NGS assay primers for a given sequence in a reasonable amount of time.

Molecular diagnosis of Plasmodium ovale by photo-induced electron transfer fluorogenic primers: PET-PCR

PubMed Central

Akerele, David; Ljolje, Dragan; Talundzic, Eldin; Udhayakumar, Venkatachalam

2017-01-01

Accurate diagnosis of malaria infections continues to be challenging and elusive, especially in the detection of submicroscopic infections. Developing new malaria diagnostic tools that are sensitive enough to detect low-level infections, user friendly, cost effective and capable of performing large scale diagnosis, remains critical. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. ovale by real-time PCR. In our study, a total of 173 clinical samples, consisting of different malaria species, were utilized to test this novel PET-PCR primer. The sensitivity and specificity were calculated using nested-PCR as the reference test. The novel primer set demonstrated a sensitivity of 97.5% and a specificity of 99.2% (95% CI 85.2–99.8% and 95.2–99.9% respectively). Furthermore, the limit of detection for P. ovale was found to be 1 parasite/μl. The PET-PCR assay is a new molecular diagnostic tool with comparable performance to other commonly used PCR methods. It is relatively easy to perform, and amiable to large scale malaria surveillance studies and malaria control and elimination programs. Further field validation of this novel primer will be helpful to ascertain the utility for large scale malaria screening programs. PMID:28640824

Molecular diagnosis of Plasmodium ovale by photo-induced electron transfer fluorogenic primers: PET-PCR.

PubMed

Akerele, David; Ljolje, Dragan; Talundzic, Eldin; Udhayakumar, Venkatachalam; Lucchi, Naomi W

2017-01-01

Accurate diagnosis of malaria infections continues to be challenging and elusive, especially in the detection of submicroscopic infections. Developing new malaria diagnostic tools that are sensitive enough to detect low-level infections, user friendly, cost effective and capable of performing large scale diagnosis, remains critical. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. ovale by real-time PCR. In our study, a total of 173 clinical samples, consisting of different malaria species, were utilized to test this novel PET-PCR primer. The sensitivity and specificity were calculated using nested-PCR as the reference test. The novel primer set demonstrated a sensitivity of 97.5% and a specificity of 99.2% (95% CI 85.2-99.8% and 95.2-99.9% respectively). Furthermore, the limit of detection for P. ovale was found to be 1 parasite/μl. The PET-PCR assay is a new molecular diagnostic tool with comparable performance to other commonly used PCR methods. It is relatively easy to perform, and amiable to large scale malaria surveillance studies and malaria control and elimination programs. Further field validation of this novel primer will be helpful to ascertain the utility for large scale malaria screening programs.

Detection and quantification of root-knot nematode (Meloidogyne javanica), lesion nematode (Pratylenchus zeae) and dagger nematode (Xiphinema elongatum) parasites of sugarcane using real-time PCR.

PubMed

Berry, Shaun D; Fargette, Mireille; Spaull, Vaughan W; Morand, Serge; Cadet, Patrice

2008-06-01

A number of different plant parasitic nematode species are found associated with sugarcane in South Africa. Of these, the root-knot nematode (Meloidogyne javanica), the lesion nematode (Pratylenchus zeae) and the dagger nematode (Xiphinema elongatum) are potentially the most damaging pests. Identification and enumeration of the number of these nematodes are necessary for providing advice to farmers as well as studying the effects of various treatments in field and glasshouse trials. We report on the development, use, and extent of specificity of three sets of primers, for M. javanica, P. zeae and X. elongatum, and on tests to detect and quantify the number of these nematodes in soil samples using SYBR Green I dye and real-time PCR technology. Amplicons from the three target species (obtained with their respective primer sets) are discernible in size by gel electrophoresis (380bp for M. javanica, 250bp for P. zeae and 500bp for X. elongatum). Also, these amplicons have characteristic melting temperatures of 83.8 degrees C (M. javanica), 86.6 degrees C (P. zeae) and 86.1 degrees C (X. elongatum). Investigations into multiplex reactions found competition between species with M. javanica competing with P. zeae and X. elongatum. Subsequent single tube (simplex) assays, enabled the construction of calibration curves for each of the three species. These were then used for quantification of the numbers of each of these species in nematode samples extracted from the field, with a high (R2=0.83) and significant positive correlation between real-time PCR and counts performed with microscopy.

High resolution melting curve analysis as a new tool for rapid identification of canine parvovirus type 2 strains.

PubMed

Bingga, Gali; Liu, Zhicheng; Zhang, Jianfeng; Zhu, Yujun; Lin, Lifeng; Ding, Shuangyang; Guo, Pengju

2014-01-01

A high resolution melting (HRM) curve method was developed to identify canine parvovirus type 2 (CPV-2) strains by nested PCR. Two sets of primers, CPV-426F/426R and CPV-87R/87F, were designed that amplified a 52 bp and 53 bp product from the viral VP2 capsid gene. The region amplified by CPV-426F/426R included the A4062G and T4064A mutations in CPV-2a, CPV-2b and CPV-2c. The region amplified by CPV-87F/87R included the A3045T mutation in the vaccine strains of CPV-2 and CPV-2a, CPV-2b and CPV-2c. Faecal samples were obtained from 30 dogs that were CPV antigen-positive. The DNA was isolated from the faecal samples and PCR-amplified using the two sets of primers, and genotyped by HRM curve analysis. The PCR-HRM assay was able to distinguish single nucleotide polymorphisms between CPV-2a, CPV-2b and CPV-2c using CPV-426F/426R. CPV-2a was distinguished from CPV-2b and CPV-2c by differences in the melting temperature. CPV-2b and CPV-2c could be distinguished based on the shape of the melting curve after generating heteroduplexes using a CPV-2b reference sample. The vaccine strains of CPV-2 were identified using CPV-87F/87R. Conventional methods for genotyping CPV strains are labor intensive, expensive or time consuming; the present PCR-based HRM assay might be an attractive alternative. Copyright © 2014 Elsevier Ltd. All rights reserved.

Real-Time PCR Method for Detection of Salmonella spp. in Environmental Samples.

PubMed

Kasturi, Kuppuswamy N; Drgon, Tomas

2017-07-15

The methods currently used for detecting Salmonella in environmental samples require 2 days to produce results and have limited sensitivity. Here, we describe the development and validation of a real-time PCR Salmonella screening method that produces results in 18 to 24 h. Primers and probes specific to the gene invA , group D, and Salmonella enterica serovar Enteritidis organisms were designed and evaluated for inclusivity and exclusivity using a panel of 329 Salmonella isolates representing 126 serovars and 22 non- Salmonella organisms. The invA - and group D-specific sets identified all the isolates accurately. The PCR method had 100% inclusivity and detected 1 to 2 copies of Salmonella DNA per reaction. Primers specific for Salmonella -differentiating fragment 1 (Sdf-1) in conjunction with the group D set had 100% inclusivity for 32 S Enteritidis isolates and 100% exclusivity for the 297 non-Enteritidis Salmonella isolates. Single-laboratory validation performed on 1,741 environmental samples demonstrated that the PCR method detected 55% more positives than the V itek i mmuno d iagnostic a ssay s ystem (VIDAS) method. The PCR results correlated well with the culture results, and the method did not report any false-negative results. The receiver operating characteristic (ROC) analysis documented excellent agreement between the results from the culture and PCR methods (area under the curve, 0.90; 95% confidence interval of 0.76 to 1.0) confirming the validity of the PCR method. IMPORTANCE This validated PCR method detects 55% more positives for Salmonella in half the time required for the reference method, VIDAS. The validated PCR method will help to strengthen public health efforts through rapid screening of Salmonella spp. in environmental samples.

Real-Time PCR Method for Detection of Salmonella spp. in Environmental Samples

PubMed Central

Drgon, Tomas

2017-01-01

ABSTRACT The methods currently used for detecting Salmonella in environmental samples require 2 days to produce results and have limited sensitivity. Here, we describe the development and validation of a real-time PCR Salmonella screening method that produces results in 18 to 24 h. Primers and probes specific to the gene invA, group D, and Salmonella enterica serovar Enteritidis organisms were designed and evaluated for inclusivity and exclusivity using a panel of 329 Salmonella isolates representing 126 serovars and 22 non-Salmonella organisms. The invA- and group D-specific sets identified all the isolates accurately. The PCR method had 100% inclusivity and detected 1 to 2 copies of Salmonella DNA per reaction. Primers specific for Salmonella-differentiating fragment 1 (Sdf-1) in conjunction with the group D set had 100% inclusivity for 32 S. Enteritidis isolates and 100% exclusivity for the 297 non-Enteritidis Salmonella isolates. Single-laboratory validation performed on 1,741 environmental samples demonstrated that the PCR method detected 55% more positives than the Vitek immunodiagnostic assay system (VIDAS) method. The PCR results correlated well with the culture results, and the method did not report any false-negative results. The receiver operating characteristic (ROC) analysis documented excellent agreement between the results from the culture and PCR methods (area under the curve, 0.90; 95% confidence interval of 0.76 to 1.0) confirming the validity of the PCR method. IMPORTANCE This validated PCR method detects 55% more positives for Salmonella in half the time required for the reference method, VIDAS. The validated PCR method will help to strengthen public health efforts through rapid screening of Salmonella spp. in environmental samples. PMID:28500041

Amplification of the Gp41 gene for detection of mutations conferring resistance to HIV-1 fusion inhibitors on genotypic assay

NASA Astrophysics Data System (ADS)

Tanumihardja, J.; Bela, B.

2017-08-01

Fusion inhibitors have potential for future use in HIV control programs in Indonesia, so the capacity to test resistance to such drugs needs to be developed. Resistance-detection with a genotypic assay began with amplification of the target gene, gp41. Based on the sequence of the two most common HIV subtypes in Indonesia, AE and B, a primer pair was designed. Plasma samples containing both subtypes were extracted to obtain HIV RNA. Using PCR, the primer pair was used to produce the amplification product, the identity of which was checked based on length under electrophoresis. Eleven plasma samples were included in this study. One-step PCR using the primer pair was able to amplify gp41 from 54.5% of the samples, and an unspecific amplification product was seen in 1.1% of the samples. Amplification failed in 36.4% of the samples, which may be due to an inappropriate primer sequence. It was also found that the optimal annealing temperature for producing the single expected band was 57.2 °C. With one-step PCR, the designed primer pair amplified the HIV-1 gp41 gene from subtypes AE and B. However, further research should be done to determine the conditions that will increase the sensitivity and specificity of the amplification process.

RUCS: rapid identification of PCR primers for unique core sequences.

PubMed

Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik; Kaya, Hülya; Lund, Ole

2017-12-15

Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs for the targets in silico. Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin resistance gene. Three of the predicted pairs were chosen for experimental validation using PCR and gel electrophoresis. All three pairs successfully produced an amplicon with the target length for the samples containing mcr-1 and no amplification products were produced for the negative samples. The novel methods presented in this manuscript can reduce the time needed to identify target sequences, and provide a quick virtual PCR validation to eliminate time wasted on ambiguously binding primers. Source code is freely available on https://bitbucket.org/genomicepidemiology/rucs. Web service is freely available on https://cge.cbs.dtu.dk/services/RUCS. mcft@cbs.dtu.dk. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

Development of strain-specific PCR primers for quantitative detection of Bacillus mesentericus strain TO-A in human feces.

PubMed

Sato, Naoki; Seo, Genichiro; Benno, Yoshimi

2014-01-01

Strain-specific polymerase chain reaction (PCR) primers for detection of Bacillus mesentericus strain TO-A (BM TO-A) were developed. The randomly amplified polymorphic DNA (RAPD) technique was used to produce potential strain-specific markers. A 991-bp RAPD marker found to be strain-specific was sequenced, and two primer pairs specific to BM TO-A were constructed based on this sequence. In addition, we explored a more specific DNA region using inverse PCR, and designed a strain-specific primer set for use in real-time quantitative PCR (qPCR). These primer pairs were tested against 25 Bacillus subtilis strains and were found to be strain-specific. After examination of the detection limit and linearity of detection of BM TO-A in feces, the qPCR method and strain-specific primers were used to quantify BM TO-A in the feces of healthy volunteers who had ingested 3×10(8) colony forming unit (CFU) of BM TO-A per day in tablets. During the administration period, BM TO-A was detected in the feces of all 24 subjects, and the average number of BM TO-A detected using the culture method and qPCR was about 10(4.8) and 10(5.8) cells per gram of feces, respectively. Using the qPCR method, BM TO-A was detected in the feces of half of the subjects 3 d after withdrawal, and was detected in the feces of only one subject 1 week after withdrawal. These results suggest that the qPCR method using BM TO-A strain-specific primers is useful for the quantitative detection of this strain in feces.

Establishing a novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure for the direct detection of gene doping.

PubMed

Beiter, Thomas; Zimmermann, Martina; Fragasso, Annunziata; Armeanu, Sorin; Lauer, Ulrich M; Bitzer, Michael; Su, Hua; Young, William L; Niess, Andreas M; Simon, Perikles

2008-01-01

So far, the abuse of gene transfer technology in sport, so-called gene doping, is undetectable. However, recent studies in somatic gene therapy indicate that long-term presence of transgenic DNA (tDNA) following various gene transfer protocols can be found in DNA isolated from whole blood using conventional PCR protocols. Application of these protocols for the direct detection of gene doping would require almost complete knowledge about the sequence of the genetic information that has been transferred. Here, we develop and describe the novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure that overcomes this difficulty. Apart from the interesting perspectives that this spiPCR procedure offers in the fight against gene doping, this technology could also be of interest in biodistribution and biosafety studies for gene therapeutic applications.

A NASTRAN primer for the analysis of rotating flexible blades

NASA Technical Reports Server (NTRS)

Lawrence, Charles; Aiello, Robert A.; Ernst, Michael A.; Mcgee, Oliver G.

1987-01-01

This primer provides documentation for using MSC NASTRAN in analyzing rotating flexible blades. The analysis of these blades includes geometrically nonlinear (large displacement) analysis under centrifugal loading, and frequency and mode shape (normal modes) determination. The geometrically nonlinear analysis using NASTRAN Solution sequence 64 is discussed along with the determination of frequencies and mode shapes using Solution Sequence 63. A sample problem with the complete NASTRAN input data is included. Items unique to rotating blade analyses, such as setting angle and centrifugal softening effects are emphasized.

Computer-Mediated Materials for Chinese Character Learning.

ERIC Educational Resources Information Center

Hsu, Hui-Mei; Gao, Liwei

2002-01-01

Reviews four sets of computer-mediated materials for Chinese character learning. These include the following: Write Chinese, Chinese Characters Primer, Animated Chinese Characters, and USC Chinese Character Page. (Author/VWL)

Grapevine fleck virus-like viruses in Vitis.

PubMed

Sabanadzovic, S; Abou-Ghanem, N; Castellano, M A; Digiaro, M; Martelli, G P

2000-01-01

Two sets of degenerate primers for the specific amplification of 572-575 nt and 386 nt segments of the methyltransferase and RNA- dependent RNA polymerase cistrons of members of the genera Tymovirus and Marafivirus and of the unassigned virus Grapevine fleck virus (GFkV) were designed on the basis of available sequences. These primers were used for amplifying and subsequent cloning and sequencing part of the open reading frame 1 of the genome of GFkV, Grapevine asteroid mosaic-associated virus (GAMaV) and of another previously unreported virus, for which the name Grapevine red globe virus (GRGV) is proposed. Computer-assisted analysis of the amplified genome portions showed that the three grapevine viruses are phylogenetically related with one another and with sequenced tymoviruses and marafiviruses. The relationships with tymoviruses was confirmed by the type of ultrastructural modifications induced in the host cells. RdRp-specific degenerate primers were successfully used for the aspecific detection of the three viruses in crude grapevine sap extracts. Specific virus identification was obtained with RT-PCR using antisense virus-specific primers.

Polymerase chain reaction-based identification of clinically relevant Pasteurellaceae isolated from cats and dogs in Poland.

PubMed

Król, Jaroslaw; Bania, Jacek; Florek, Magdalena; Pliszczak-Król, Aleksandra; Staroniewicz, Zdzislaw

2011-05-01

A set of polymerase chain reaction (PCR) assays for identification of the most important Pasteurellaceae species encountered in cats and dogs were developed. Primers for Pasteurella multocida were designed to detect a fragment of the kmt, a gene encoding the outer-membrane protein. Primers specific to Pasteurella canis, Pasteurella dagmatis, and Pasteurella stomatis were based on the manganese-dependent superoxide dismutase gene (sodA) and those specific to [Haemophilus] haemoglobinophilus on species-specific sequences of the 16S ribosomal RNA gene. All the primers were tested on respective reference and control strains and applied to the identification of 47 canine and feline field isolates of Pasteurellaceae. The PCR assays were shown to be species specific, providing a valuable supplement to phenotypic identification of species within this group of bacteria. © 2011 The Author(s)

Diagnosis and molecular characterization of Trichomonas vaginalis in sex workers in the Philippines

PubMed Central

Queza, Macario Ireneo P; Rivera, Windell L

2013-01-01

Trichomonas vaginalis is a pathogenic protozoon which causes the sexually transmitted infection, trichomoniasis. The absence or non-specificity of symptoms often leads to misdiagnosis of the infection. In this study, 969 samples consisting of vaginal swabs and urine were collected and screened from social hygiene clinics across the Philippines. Of the 969 samples, 216 were used for the comparative analysis of diagnostic tools such as wet mount microscopy, culture, and PCR utilizing universal trichomonad primers, TFR1/2 and species-specific primers, TVK3/7 and TV1/2. PCR demonstrated higher sensitivity of 100% compared to 77% of the wet mount. PCR primer set TVK3/7 and culture had the same and the best expected average performance [receiver-operating characteristic (ROC): 0.98]. Prevalence of infection in the sample population was 6.8%. PMID:23683368

Detection of infectious bronchitis virus with the use of real-time quantitative reverse transcriptase-PCR and correlation with virus detection in embryonated eggs.

PubMed

Roh, Ha-Jung; Hilt, Deborah A; Jackwood, Mark W

2014-09-01

Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assays have been used to detect the presence of challenge virus when the efficacy of infectious bronchitis virus (IBV) vaccine against field viruses is being experimentally evaluated. However, federal guidelines for licensing IBV vaccines indicate that challenge-virus detection following vaccination is to be conducted in embryonated eggs. In this study, we examined qRT-PCR data with the use of universal and type-specific primers and probe sets for IBV detection and compared those data with challenge-virus detection in embryonated eggs to determine if the two methods of evaluating vaccine efficacy are comparable. In addition, we tested the qRT-PCR assays on thermocyclers from two different manufacturers. We found the universal IBV primers and probe set to be comparable to challenge-virus detection in embryonated eggs. However, for some IBV types (Mass41 and Conn on the SmartCycler II and Ark, Mass41, Conn, and GA98 on the ABI 7500) the qRT-PCR assay was more sensitive than virus detection in embryonated eggs. This may simply be due to the universal IBV qRT-PCR assay being more sensitive than virus detection in eggs or to the assay detecting nucleic acid from nonviable virus. This finding is important and needs to be considered when evaluating challenge-virus detection for vaccination and challenge studies, because qRT-PCR could potentially identify positive birds that would otherwise be negative by virus detection in embryonated eggs; thus it could lead to a more stringent measure of vaccine efficacy. We also found that the IBV type-specific primers and probe sets designed in this study were in general less sensitive than the universal IBV primers and probe set. Only the Ark-DPI-spedcific assay on the SmartCycler II and the Ark-DPI-, Mass41-, and DE072/GA98- (for detection of GA98 virus only) specific assays on the ABI 7500 were comparable in sensitivity to virus detection in eggs. We found that a number of variables, including the virus type examined, primers and probe efficiency and stability, and assay conditions, including thermocycler platform, can affect the data obtained from qRT-PCR assays. These results indicate that qRT-PCR assays can be used to detect IBV challenge virus, but each assay, including the assay conditions and thermocycler, should be individually evaluated if those data are expected to be comparable to virus detection in embryonated eggs.

Validation of a PCR-based method for the detection of various rendered materials in feedstuffs using a forensic DNA extraction kit.

PubMed

Myers, Michael J; Yancy, Haile F; Araneta, Michael; Armour, Jennifer; Derr, Janice; Hoostelaere, Lawrence A D; Farmer, Doris; Jackson, Falana; Kiessling, William M; Koch, Henry; Lin, Huahua; Liu, Yan; Mowlds, Gabrielle; Pinero, David; Riter, Ken L; Sedwick, John; Shen, Yuelian; Wetherington, June; Younkins, Ronsha

2006-01-01

A method trial was initiated to validate the use of a commercial DNA forensic kit to extract DNA from animal feed as part of a PCR-based method. Four different PCR primer pairs (one bovine pair, one porcine pair, one ovine primer pair, and one multispecies pair) were also evaluated. Each laboratory was required to analyze a total of 120 dairy feed samples either not fortified (control, true negative) or fortified with bovine meat and bone meal, porcine meat and bone meal (PMBM), or lamb meal. Feeds were fortified with the animal meals at a concentration of 0.1% (wt/wt). Ten laboratories participated in this trial, and each laboratory was required to evaluate two different primer pairs, i.e., each PCR primer pair was evaluated by five different laboratories. The method was considered to be validated for a given animal source when three or more laboratories achieved at least 97% accuracy (29 correct of 30 samples for 96.7% accuracy, rounded up to 97%) in detecting the fortified samples for that source. Using this criterion, the method was validated for the bovine primer because three laboratories met the criterion, with an average accuracy of 98.9%. The average false-positive rate was 3.0% in these laboratories. A fourth laboratory was 80% accurate in identifying the samples fortified with bovine meat and bone meal. A fifth laboratory was not able to consistently extract the DNA from the feed samples and did not achieve the criterion for accuracy for either the bovine or multispecies PCR primers. For the porcine primers, the method was validated, with four laboratories meeting the criterion for accuracy with an average accuracy of 99.2%. The fifth laboratory had a 93.3% accuracy outcome for the porcine primer. Collectively, these five laboratories had a 1.3% false-positive rate for the porcine primer. No laboratory was able to meet the criterion for accuracy with the ovine primers, most likely because of problems with the synthesis of the primer pair; none of the positive control DNA samples could be detected with the ovine primers. The multispecies primer pair was validated in three laboratories for use with bovine meat and bone meal and lamb meal but not with PMBM. The three laboratories had an average accuracy of 98.9% for bovine meat and bone meal, 97.8% for lamb meal, and 63.3% for PMBM. When examined on an individual laboratory basis, one of these four laboratories could not identify a single feed sample containing PMBM by using the multispecies primer, whereas the other laboratory identified only one PMBM-fortified sample, suggesting that the limit of detection for PMBM with this primer pair is around 0.1% (wt/wt). The results of this study demonstrated that the DNA forensic kit can be used to extract DNA from animal feed, which can then be used for PCR analysis to detect animal-derived protein present in the feed sample.

Internal coating of zirconia restoration with silica-based ceramic improves bonding of resin cement to dental zirconia ceramic.

PubMed

Kitayama, Shuzo; Nikaido, Toru; Ikeda, Masaomi; Alireza, Sadr; Miura, Hiroyuki; Tagami, Junji

2010-01-01

Resin bonding to zirconia ceramic cannot be established by standard methods that are utilized for conventional silica-based dental ceramics. This study was aimed to examine the tensile bond strength of resin cement to zirconia ceramic using a new laboratory technique. Sixty-four zirconia ceramic specimens were air-abraded using Al2O3 particles and divided into two groups; the control group with no pretreatment (Control), and the group pretreated using the internal coating technique (INT), in which the surface of the zirconia specimens were thinly coated by fusing silica-based ceramic and air-abraded in the same manner. The specimens in each group were further divided into two subgroups according to the silane coupling agents applied; a mixture of dentin primer/silane coupling agent (Clearfil SE Bond Primer/Porcelain Bond Activator) or a newly developed single-component silane coupling agent (Clearfil Ceramic Primer). After bonding with dual-cured resin cement (Panavia F 2.0), they were stored in water for 24 h and half of them were additionally subjected to thermal cycling. The tensile bond strengths were tested using a universal testing machine. ANOVAs revealed significant influence of ceramic surface pretreatment (p<0.001), silane coupling agent (p<0.001) and thermal cycling (p<0.001); the INT coating technique significantly increased the bond strengths of resin cement to zirconia ceramic, whereas thermal cycling significantly decreased the bond strengths. The use of a single-component silane coupling agent demonstrated significantly higher bond strengths than that of a mixture of dentin primer/silane coupling agent. The internal coating of zirconia dental restorations with silica-based ceramic followed by silanization may be indicated in order to achieve better bonding for the clinical success.

Fluorescence studies with DNA probes: dynamic aspects of DNA structure and DNA-protein interactions

NASA Astrophysics Data System (ADS)

Millar, David P.; Carver, Theodore E.

1994-08-01

Time-resolved fluorescence measurements of optical probes incorporated at specific sites in DNA provides a new approach to studies of DNA structure and DNA:protein interactions. This approach can be used to study complex multi-state behavior, such as the folding of DNA into alternative higher order structures or the transfer of DNA between multiple binding sites on a protein. In this study, fluorescence anisotropy decay of an internal dansyl probe attached to 17/27-mer oligonucleotides was used to monitor the distribution of DNA 3' termini bound at either the polymerase of 3' to 5' exonuclease sites of the Klenow fragment of DNA polymerase I. Partitioning of the primer terminus between the two active sites of the enzyme resulted in a heterogeneous probe environment, reflected in the associative behavior of the fluorescence anisotropy decay. Analysis of the anisotropy decay with a two state model of solvent-exposed and protein-associated dansyl probes was used to determine the fraction of DNA bound at each site. We examined complexes of Klenow fragment with DNAs containing various base mismatches. Single mismatches at the primer terminus caused a 3-fold increase in the equilibrium partitioning of DNA into the exonuclease site, while two or more consecutive G:G mismatches caused the DNA to bind exclusively at the exonuclease site, with a partitioning constant at least 250- fold greater than that of the corresponding matched DNA sequence. Internal single mismatches located up to four bases from the primer terminus produced larger effects than the same mismatch at the primer terminus. These results provide insight into the recognition mechanisms that enable DNA polymerases to proofread misincorporated bases during DNA replication.

Improved Safety for Molecular Diagnosis of Classical Rabies Viruses by Use of a TaqMan Real-Time Reverse Transcription-PCR “Double Check” Strategy▿ †

PubMed Central

Hoffmann, B.; Freuling, C. M.; Wakeley, P. R.; Rasmussen, T. B.; Leech, S.; Fooks, A. R.; Beer, M.; Müller, T.

2010-01-01

To improve the diagnosis of classical rabies virus with molecular methods, a validated, ready-to-use, real-time reverse transcription-PCR (RT-PCR) assay was developed. In a first step, primers and 6-carboxyfluorescien-labeled TaqMan probes specific for rabies virus were selected from the consensus sequence of the nucleoprotein gene of 203 different rabies virus sequences derived from GenBank. The selected primer-probe combination was highly specific and sensitive. During validation using a sample set of rabies virus strains from the virus archives of the Friedrich-Loeffler-Institut (FLI; Germany), the Veterinary Laboratories Agency (VLA; United Kingdom), and the DTU National Veterinary Institute (Lindholm, Denmark), covering the global diversity of rabies virus lineages, it was shown that both the newly developed assay and a previously described one had some detection failures. This was overcome by a combined assay that detected all samples as positive. In addition, the introduction of labeled positive controls (LPC) increased the diagnostic safety of the single as well as the combined assay. Based on the newly developed, alternative assay for the detection of rabies virus and the application of LPCs, an improved diagnostic sensitivity and reliability can be ascertained for postmortem and intra vitam real-time RT-PCR analyses in rabies reference laboratories. PMID:20739489

Quantitative PCR: an appropriate tool to detect viable but not culturable Brettanomyces bruxellensis in wine.

PubMed

Willenburg, Elize; Divol, Benoit

2012-11-15

Quantitative PCR as a tool has been used to detect Brettanomyces bruxellensis directly from wine samples. Accurate and timely detection of this yeast is important to prevent unwanted spoilage of wines and beverages. The aim of this study was to distinguish differences between DNA and mRNA as template for the detection of this yeast. The study was also used to determine if it is possible to accurately detect cells in the viable but not culturable (VBNC) state of B. bruxellensis by qPCR. Several methods including traditional plating, epifluorescence counts and qPCR were used to amplify DNA and mRNA. It was observed that mRNA was a better template for the detection in terms of standard curve analysis and qPCR efficiencies. Various primers previously published were tested for their specificity, qPCR efficiency and accuracy of enumeration. A single primer set was selected which amplified a region of the actin-encoding gene. The detection limit for this assay was 10cellsmL(-1). B. bruxellensis could also be quantified in naturally contaminated wines with this assay. The mRNA gave a better indication of the viability of the cells which compared favourably to fluorescent microscopy and traditional cell counts. The ability of the assay to accurately estimate the number of cells in the VBNC state was also demonstrated. Copyright © 2012 Elsevier B.V. All rights reserved.

Simplified Pan-species Real-time PCR-based Detection of Plasmodium Spp. in Blood Smear.

PubMed

Hassanpour, Gholamreza; Mirhendi, Hossein; Mohebali, Mehdi; Raeisi, Ahmad; Zeraati, Hojjat; Keshavarz, Hossein

2016-01-01

We aimed to quicken and simplify the detection of Plasmodium in blood samples by developing and testing a pan- Plasmodium real-time PCR for accurate screening of individuals suspected of malaria. A single primer/probe set for pan-species Plasmodium -specific real time PCR targeting a conserved region of the small subunit 18S ribosomal DNA was designed and evaluated for rapid diagnosis and screening of malaria infections using dried blood smears. FTA cards were used for rapid and simple DNA extraction. The primers and probes showed a positive response with the DNA extracted from bloods infected with P. falciparum and P. vivax but not with DNA extracted from various smears from uninfected blood samples. Seven positive cases positive by both microscopy and nested PCR were found among 280 blood samples taken from in South and Southeast Iran. Five samples were identified as positive for P. vivax and two as positive for P. falciparum . All positive samples were positive by real-time PCR. Furthermore, all 38-blood samples positive by microscopy were positive by real-time PCR. No microscopy-negative samples were positive by real-time PCR. By using a simple FTA card for DNA extraction and by application of the real-time PCR developed in this study, sensitivity similar to nested-PCR and microscopy was achieved. This format simplifies the detection of Plasmodium in large numbers of samples.

Improved safety for molecular diagnosis of classical rabies viruses by use of a TaqMan real-time reverse transcription-PCR "double check" strategy.

PubMed

Hoffmann, B; Freuling, C M; Wakeley, P R; Rasmussen, T B; Leech, S; Fooks, A R; Beer, M; Müller, T

2010-11-01

To improve the diagnosis of classical rabies virus with molecular methods, a validated, ready-to-use, real-time reverse transcription-PCR (RT-PCR) assay was developed. In a first step, primers and 6-carboxyfluorescien-labeled TaqMan probes specific for rabies virus were selected from the consensus sequence of the nucleoprotein gene of 203 different rabies virus sequences derived from GenBank. The selected primer-probe combination was highly specific and sensitive. During validation using a sample set of rabies virus strains from the virus archives of the Friedrich-Loeffler-Institut (FLI; Germany), the Veterinary Laboratories Agency (VLA; United Kingdom), and the DTU National Veterinary Institute (Lindholm, Denmark), covering the global diversity of rabies virus lineages, it was shown that both the newly developed assay and a previously described one had some detection failures. This was overcome by a combined assay that detected all samples as positive. In addition, the introduction of labeled positive controls (LPC) increased the diagnostic safety of the single as well as the combined assay. Based on the newly developed, alternative assay for the detection of rabies virus and the application of LPCs, an improved diagnostic sensitivity and reliability can be ascertained for postmortem and intra vitam real-time RT-PCR analyses in rabies reference laboratories.

Recognition of the pro-mutagenic base uracil by family B DNA polymerases from archaea.

PubMed

Shuttleworth, Gillian; Fogg, Mark J; Kurpiewski, Michael R; Jen-Jacobson, Linda; Connolly, Bernard A

2004-03-26

Archaeal family B DNA polymerases contain a specialised pocket that binds tightly to template-strand uracil, causing the stalling of DNA replication. The mechanism of this unique "template-strand proof-reading" has been studied using equilibrium binding measurements, DNA footprinting, van't Hoff analysis and calorimetry. Binding assays have shown that the polymerase preferentially binds to uracil in single as opposed to double-stranded DNA. Tightest binding is observed using primer-templates that contain uracil four bases in front of the primer-template junction, corresponding to the observed stalling position. Ethylation interference analysis of primer-templates shows that the two phosphates, immediately flanking the uracil (NpUpN), are important for binding; contacts are also made to phosphates in the primer-strand. Microcalorimetry and van't Hoff analysis have given a fuller understanding of the thermodynamic parameters involved in uracil recognition. All the results are consistent with a "read-ahead" mechanism, in which the replicating polymerase scans the template, ahead of the replication fork, for the presence of uracil and halts polymerisation on detecting this base. Post-stalling events, serving to eliminate uracil, await full elucidation.

Identifying krill eggs in the central California current using novel multiplex PCR primers: Applications and limitations

NASA Astrophysics Data System (ADS)

Carrion, C. N.; Slesinger, E.; Marinovic, B.

2016-02-01

Euphausiids, otherwise known as krill, are an important link between primary producers and higher trophic levels within the central California current upwelling system. Euphausia pacifica and Thysanoessa spinifera, two of the most common euphausiid species along the central California coast, are both broadcast spawners and have some overlap in habitat, e.g. near marine life hotspots like the Monterey Bay and Gulf of Farallones. Species composition of euphausiid egg population within these regions is currently unknown. Distinct morphological differences between their eggs are lost once the egg dies or is preserved via formalin, alcohol, or freezing. In this project we designed genus specific DNA primers (mtCOI) for use in a multiplex PCR to distinguish among spawned euphausiid eggs of Euphausia spp. and Thysanoessa spp. in central California current surface waters. Effective and ineffective application of primers in a multiplex versus single-plex PCR is discussed, with an emphasis on primer design limitations in reference to the available barcoded regions of mitochondrial cytochrome oxidase subunit I (mtCOI) for each species in GenBank. This new protocol expands current monitoring efforts into sampling a non-swimming portion of the population which has the potential to improve euphausiid biomass estimates.

The Bias Associated with Amplicon Sequencing Does Not Affect the Quantitative Assessment of Bacterial Community Dynamics

PubMed Central

Figuerola, Eva L. M.; Erijman, Leonardo

2014-01-01

The performance of two sets of primers targeting variable regions of the 16S rRNA gene V1–V3 and V4 was compared in their ability to describe changes of bacterial diversity and temporal turnover in full-scale activated sludge. Duplicate sets of high-throughput amplicon sequencing data of the two 16S rRNA regions shared a collection of core taxa that were observed across a series of twelve monthly samples, although the relative abundance of each taxon was substantially different between regions. A case in point was the changes in the relative abundance of filamentous bacteria Thiothrix, which caused a large effect on diversity indices, but only in the V1–V3 data set. Yet the relative abundance of Thiothrix in the amplicon sequencing data from both regions correlated with the estimation of its abundance determined using fluorescence in situ hybridization. In nonmetric multidimensional analysis samples were distributed along the first ordination axis according to the sequenced region rather than according to sample identities. The dynamics of microbial communities indicated that V1–V3 and the V4 regions of the 16S rRNA gene yielded comparable patterns of: 1) the changes occurring within the communities along fixed time intervals, 2) the slow turnover of activated sludge communities and 3) the rate of species replacement calculated from the taxa–time relationships. The temperature was the only operational variable that showed significant correlation with the composition of bacterial communities over time for the sets of data obtained with both pairs of primers. In conclusion, we show that despite the bias introduced by amplicon sequencing, the variable regions V1–V3 and V4 can be confidently used for the quantitative assessment of bacterial community dynamics, and provide a proper qualitative account of general taxa in the community, especially when the data are obtained over a convenient time window rather than at a single time point. PMID:24923665

MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species

PubMed Central

Miya, M.; Sato, Y.; Fukunaga, T.; Sado, T.; Poulsen, J. Y.; Sato, K.; Minamoto, T.; Yamamoto, S.; Yamanaka, H.; Araki, H.; Kondoh, M.; Iwasaki, W.

2015-01-01

We developed a set of universal PCR primers (MiFish-U/E) for metabarcoding environmental DNA (eDNA) from fishes. Primers were designed using aligned whole mitochondrial genome (mitogenome) sequences from 880 species, supplemented by partial mitogenome sequences from 160 elasmobranchs (sharks and rays). The primers target a hypervariable region of the 12S rRNA gene (163–185 bp), which contains sufficient information to identify fishes to taxonomic family, genus and species except for some closely related congeners. To test versatility of the primers across a diverse range of fishes, we sampled eDNA from four tanks in the Okinawa Churaumi Aquarium with known species compositions, prepared dual-indexed libraries and performed paired-end sequencing of the region using high-throughput next-generation sequencing technologies. Out of the 180 marine fish species contained in the four tanks with reference sequences in a custom database, we detected 168 species (93.3%) distributed across 59 families and 123 genera. These fishes are not only taxonomically diverse, ranging from sharks and rays to higher teleosts, but are also greatly varied in their ecology, including both pelagic and benthic species living in shallow coastal to deep waters. We also sampled natural seawaters around coral reefs near the aquarium and detected 93 fish species using this approach. Of the 93 species, 64 were not detected in the four aquarium tanks, rendering the total number of species detected to 232 (from 70 families and 152 genera). The metabarcoding approach presented here is non-invasive, more efficient, more cost-effective and more sensitive than the traditional survey methods. It has the potential to serve as an alternative (or complementary) tool for biodiversity monitoring that revolutionizes natural resource management and ecological studies of fish communities on larger spatial and temporal scales. PMID:26587265

MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species.

PubMed

Miya, M; Sato, Y; Fukunaga, T; Sado, T; Poulsen, J Y; Sato, K; Minamoto, T; Yamamoto, S; Yamanaka, H; Araki, H; Kondoh, M; Iwasaki, W

2015-07-01

We developed a set of universal PCR primers (MiFish-U/E) for metabarcoding environmental DNA (eDNA) from fishes. Primers were designed using aligned whole mitochondrial genome (mitogenome) sequences from 880 species, supplemented by partial mitogenome sequences from 160 elasmobranchs (sharks and rays). The primers target a hypervariable region of the 12S rRNA gene (163-185 bp), which contains sufficient information to identify fishes to taxonomic family, genus and species except for some closely related congeners. To test versatility of the primers across a diverse range of fishes, we sampled eDNA from four tanks in the Okinawa Churaumi Aquarium with known species compositions, prepared dual-indexed libraries and performed paired-end sequencing of the region using high-throughput next-generation sequencing technologies. Out of the 180 marine fish species contained in the four tanks with reference sequences in a custom database, we detected 168 species (93.3%) distributed across 59 families and 123 genera. These fishes are not only taxonomically diverse, ranging from sharks and rays to higher teleosts, but are also greatly varied in their ecology, including both pelagic and benthic species living in shallow coastal to deep waters. We also sampled natural seawaters around coral reefs near the aquarium and detected 93 fish species using this approach. Of the 93 species, 64 were not detected in the four aquarium tanks, rendering the total number of species detected to 232 (from 70 families and 152 genera). The metabarcoding approach presented here is non-invasive, more efficient, more cost-effective and more sensitive than the traditional survey methods. It has the potential to serve as an alternative (or complementary) tool for biodiversity monitoring that revolutionizes natural resource management and ecological studies of fish communities on larger spatial and temporal scales.

Application of the multiplex PCR method for discrimination of Artemisia iwayomogi from other Artemisia herbs.

PubMed

Lee, Mi Young; Doh, Eui Jeong; Kim, Eung Soo; Kim, Young Wha; Ko, Byong Seob; Oh, Seung-Eun

2008-04-01

Some plants classified in the genus Artemisia are used for medicinal purposes. In particular, A. iwayomogi, which is referred to as 'Haninjin,' is used as an important medicinal material in traditional Korean medicine. However, A. capillaris, and both A. argyi and A. princeps, referred to as 'Injinho' and 'Aeyup,' respectively, are used for purposes other than those for which 'Haninjin' is utilized. However, it is occasionally difficult to differentiate 'Haninjin' from 'Injinho' and/or 'Aeyup' on the basis of their morphological features, particularly when in the dried and/or sliced form. Therefore, the development of a reliable method by which to discriminate 'Haninjin' from other Artemisia herbs, especially 'Injinho' and 'Aeyup,' is clearly necessary. We recently determined that the RAPD (random amplified polymorphic DNA) technique can be used to discriminate efficiently between some Artemisia herbs. In particular, when applied to RAPD, the non-specific UBC primer 391 (5'-GCG AAC CTC G-3') was demonstrated to amplify PCR products specific to A. iwayomogi. Based on the nucleotide sequences of the PCR product, we designed a 2F1 (5'-ACC TCG GAC CTA AAT ACA-3')/ 2F3 (5'-TTA TGA TTC ATG TTC AAT TC-3') primer set to amplify a SCAR (sequence-characterized amplified region) marker of A. iwayomogi. Employing this primer set, along with two other primer sets amplifying SCAR markers of 'Aeyup' (A. argyi and A. princeps) and both 'Injinho' (A. capillaris) and A. japonica, which are classified into the same subgroup in a phenogram constructed from RAPD analysis, we developed a multiplex PCR method by which A. iwayomogi could be discriminated with certainty from other Artemisia herbs. Via this method, we determined not only whether the tested Artemisia herb was A. iwayomogi, but also which Artemisia herbs were tested concurrently with A. iwayomogi.

Improved Method for Direct Detection of Environmental Microorganisms Using an Amplification of 16S rDNA Region

NASA Astrophysics Data System (ADS)

Tsujimura, M.; Akutsu, J.; Zhang, Z.; Sasaki, M.; Tajima, H.; Kawarabayasi, Y.

2004-12-01

The thermostable proteins or enzymes were expected to be capable to be utilized in many areas of industries. Many thermophilic microorganisms, which possess the thermostable proteins or enzymes, were identified from the extreme environment. However, many unidentified and uncultivable microorganisms are still remaining in the environment on the earth. It is generally said that the cultivable microorganisms are less than 1% of entire microorganisms living in the earth, remaining over 99% are still uncultivable. As an approach to the uncultivable microorganisms, the PCR amplification of 16S rDNA region using primer sets designed from the conserved region has been generally utilized for detection and community analysis of microorganism in the environment. However, the facts, that PCR amplification introduces the mutation in the amplified DNA fragment and efficiency of PCR amplification is depend on the sequences of primer sets, indicated that the improving of PCR analysis was necessary for more correct detection of microorganisms. As the result of evaluation for the quality of DNA polymerases, sequences of primers used for amplification and conditions of PCR amplification, the DNA polymerase, the primer set and the conditions for amplification, which did not amplify the DNA fragment from the DNA contaminated within the DNA polymerase itself, were successfully selected. Also the rate of mutation in the DNA fragment amplified was evaluated using this conditions and the genomic DNA from cultivable microbes as a template. The result indicated the rate of mutation introduced by PCR was approximately 0.1% to 0.125%. The improved method using these conditions and error rate calculated was applied for the analysis of microorganisms in the geothermal environment. The result indicated that four kinds of dominant microorganisms, including both of bacteria and archaea, were alive within soil in the hot spring in Tohoku Area. We would like to apply this improved method to detection of microorganisms with important genes from more other environments.

Development and Evaluation of a Multiplex Real-Time Polymerase Chain Reaction Procedure to Clinically Type Prevalent Salmonella enterica Serovars

PubMed Central

Muñoz, Nélida; Diaz-Osorio, Miguel; Moreno, Jaime; Sánchez-Jiménez, Miryan; Cardona-Castro, Nora

2010-01-01

A multiplex real-time polymerase chain reaction procedure was developed to identify the most prevalent clinical isolates of Salmonella enterica subsp. enterica. Genes from the rfb, fliC, fljB, and viaB groups that encode the O, H, and Vi antigens were used to design 15 primer pairs and TaqMan probes specific for the genes rfbJ, wzx, fliC, fljB, wcdB, the sdf-l sequence, and invA, which was used as an internal amplification control. The primers and probes were variously combined into six sets. The first round of reactions used two of these sets to detect Salmonella O:4, O:9, O:7, O:8, and O:3,10 serogroups. Once the serogroups were identified, the results of a second round of reactions that used primers and probes for the flagellar antigen l genes, 1,2; e,h; g,m; d; e,n,x; and z10, and the Vi gene were used to identify individual serovars. The procedure was standardized using 18 Salmonella reference strains and other enterobacteria. The procedure's reliability and sensitivity was evaluated using 267 randomly chosen serotyped Salmonella clinical isolates. The procedure had a sensitivity of 95.5% and was 100% specific. Thus, our technique is a quick, sensitive, reliable, and specific means of identifying S. enterica serovars and can be used in conjunction with traditional serotyping. Other primer and probe combinations could be used to increase the number of identifiable serovars. PMID:20110454

Quantification of Endospore-Forming Firmicutes by Quantitative PCR with the Functional Gene spo0A

PubMed Central

Bueche, Matthieu; Wunderlin, Tina; Roussel-Delif, Ludovic; Junier, Thomas; Sauvain, Loic; Jeanneret, Nicole

2013-01-01

Bacterial endospores are highly specialized cellular forms that allow endospore-forming Firmicutes (EFF) to tolerate harsh environmental conditions. EFF are considered ubiquitous in natural environments, in particular, those subjected to stress conditions. In addition to natural habitats, EFF are often the cause of contamination problems in anthropogenic environments, such as industrial production plants or hospitals. It is therefore desirable to assess their prevalence in environmental and industrial fields. To this end, a high-sensitivity detection method is still needed. The aim of this study was to develop and evaluate an approach based on quantitative PCR (qPCR). For this, the suitability of functional genes specific for and common to all EFF were evaluated. Seven genes were considered, but only spo0A was retained to identify conserved regions for qPCR primer design. An approach based on multivariate analysis was developed for primer design. Two primer sets were obtained and evaluated with 16 pure cultures, including representatives of the genera Bacillus, Paenibacillus, Brevibacillus, Geobacillus, Alicyclobacillus, Sulfobacillus, Clostridium, and Desulfotomaculum, as well as with environmental samples. The primer sets developed gave a reliable quantification when tested on laboratory strains, with the exception of Sulfobacillus and Desulfotomaculum. A test using sediment samples with a diverse EFF community also gave a reliable quantification compared to 16S rRNA gene pyrosequencing. A detection limit of about 104 cells (or spores) per gram of initial material was calculated, indicating this method has a promising potential for the detection of EFF over a wide range of applications. PMID:23811505

Invasion of European pine stands by a North American forest pathogen and its hybridization with a native interfertile taxon.

PubMed

Gonthier, P; Nicolotti, G; Linzer, R; Guglielmo, F; Garbelotto, M

2007-04-01

It was recently reported that North American (NA) individuals of the forest pathogen Heterobasidion annosum were found in a single pine stand near Rome, in association with the movement of US troops during World War II. Here, we report on some aspects of the invasion biology of this pathogen in Italian coastal pinewoods, and on its interaction with native (EU) Heterobasidion populations. Spores of Heterobasidion were sampled using woody traps in pine stands along 280 km of coast around Rome. DNA of single-spore colonies was characterized by two sets of nuclear and one set of mitochondrial taxon-specific polymerase chain reaction primers. NA spores were found not only in a single site, but in many locations over a wide geographic area. Invasion occurred at an estimated rate of 1.3 km/year through invasion corridors provided by single trees, and not necessarily by sizable patches of forests. Within the 100-km long range of expansion, the NA taxon was dominant in all pure pine stands. Because abundance of the EU taxon is low and identical among stands within and outside the area invaded by NA individuals, we infer that the exotic population has invaded habitats mostly unoccupied by the native species. Discrepancy between a mitochondrial and a nuclear marker occurred in 3.8% of spores from one site, a mixed oak-pine forest where both taxa were equally represented. Combined phylogenetic analyses on nuclear and mitochondrial loci confirmed these isolates were recombinant. The finding of hybrids indicates that genetic interaction between NA and EU Heterobasidion taxa is occurring as a result of their current sympatry.

Molecular characterization of Hepatozoon sp. from Brazilian dogs and its phylogenetic relationship with other Hepatozoon spp.

PubMed

Forlano, M D; Teixeira, K R S; Scofield, A; Elisei, C; Yotoko, K S C; Fernandes, K R; Linhares, G F C; Ewing, S A; Massard, C L

2007-04-10

To characterize phylogenetically the species which causes canine hepatozoonosis at two rural areas of Rio de Janeiro State, Brazil, we used universal or Hepatozoon spp. primer sets for the 18S SSU rRNA coding region. DNA extracts were obtained from blood samples of thirteen dogs naturally infected, from four experimentally infected, and from five puppies infected by vertical transmission from a dam, that was experimentally infected. DNA of sporozoites of Hepatozoon americanum was used as positive control. The amplification of DNA extracts from blood of dogs infected with sporozoites of Hepatozoon spp. was observed in the presence of primers to 18S SSU rRNA gene of Hepatozoon spp., whereas DNA of H. americanum sporozoites was amplified in the presence of either universal or Hepatozoon spp.-specific primer sets; the amplified products were approximately 600bp in size. Cloned PCR products obtained from DNA extracts of blood from two dogs experimentally infected with Hepatozoon sp. were sequenced. The consensus sequence, derived from six sequence data sets, were blasted against sequences of 18S SSU rRNA of Hepatozoon spp. available at GenBank and aligned to homologous sequences to perform the phylogenetic analysis. This analysis clearly showed that our sequence clustered, independently of H. americanum sequences, within a group comprising other Hepatozoon canis sequences. Our results confirmed the hypothesis that the agent causing hepatozoonosis in the areas studied in Brazil is H. canis, supporting previous reports that were based on morphological and morphometric analyses.

Identification and Differentiation of Monilinia Species Causing Brown Rot of Pome and Stone Fruit using High-Resolution Melting (HRM) Analysis.

PubMed

Papavasileiou, Antonios; Madesis, Panagiotis B; Karaoglanidis, George S

2016-09-01

Brown rot is a devastating disease of stone fruit caused by Monilinia spp. Among these species, Monilinia fructicola is a quarantine pathogen in Europe but has recently been detected in several European countries. Identification of brown rot agents relies on morphological differences or use of molecular methods requiring fungal isolation. The current study was initiated to develop and validate a high-resolution melting (HRM) method for the identification of the Monilinia spp. and for the detection of M. fructicola among other brown rot pathogens. Based on the sequence of the cytb intron from M. laxa, M. fructicola, M. fructigena, M. mumecola, M. linhartiana, and M. yunnanensis isolates originating from several countries, a pair of universal primers for species identification and a pair of primers specific to M. fructicola were designed. The specificity of the primers was verified to ensure against cross-reaction with other fungal species. The melting curve analysis using the universal primers generated six different HRM curve profiles, each one specific for each species. Τhe HRM analysis primers specific to M. fructicola amplified a 120-bp region with a distinct melt profile corresponding to the presence of M. fructicola, regardless of the presence of other species. HRM analysis can be a useful tool for rapid identification and differentiation of the six Monilinia spp. using a single primer pair. This novel assay has the potential for simultaneous identification and differentiation of the closely related Monilinia spp. as well as for the differentiation of M. fructicola from other common pathogens or saprophytes that may occur on the diseased fruit.

Primer ID Validates Template Sampling Depth and Greatly Reduces the Error Rate of Next-Generation Sequencing of HIV-1 Genomic RNA Populations

PubMed Central

Zhou, Shuntai; Jones, Corbin; Mieczkowski, Piotr

2015-01-01

ABSTRACT Validating the sampling depth and reducing sequencing errors are critical for studies of viral populations using next-generation sequencing (NGS). We previously described the use of Primer ID to tag each viral RNA template with a block of degenerate nucleotides in the cDNA primer. We now show that low-abundance Primer IDs (offspring Primer IDs) are generated due to PCR/sequencing errors. These artifactual Primer IDs can be removed using a cutoff model for the number of reads required to make a template consensus sequence. We have modeled the fraction of sequences lost due to Primer ID resampling. For a typical sequencing run, less than 10% of the raw reads are lost to offspring Primer ID filtering and resampling. The remaining raw reads are used to correct for PCR resampling and sequencing errors. We also demonstrate that Primer ID reveals bias intrinsic to PCR, especially at low template input or utilization. cDNA synthesis and PCR convert ca. 20% of RNA templates into recoverable sequences, and 30-fold sequence coverage recovers most of these template sequences. We have directly measured the residual error rate to be around 1 in 10,000 nucleotides. We use this error rate and the Poisson distribution to define the cutoff to identify preexisting drug resistance mutations at low abundance in an HIV-infected subject. Collectively, these studies show that >90% of the raw sequence reads can be used to validate template sampling depth and to dramatically reduce the error rate in assessing a genetically diverse viral population using NGS. IMPORTANCE Although next-generation sequencing (NGS) has revolutionized sequencing strategies, it suffers from serious limitations in defining sequence heterogeneity in a genetically diverse population, such as HIV-1 due to PCR resampling and PCR/sequencing errors. The Primer ID approach reveals the true sampling depth and greatly reduces errors. Knowing the sampling depth allows the construction of a model of how to maximize the recovery of sequences from input templates and to reduce resampling of the Primer ID so that appropriate multiplexing can be included in the experimental design. With the defined sampling depth and measured error rate, we are able to assign cutoffs for the accurate detection of minority variants in viral populations. This approach allows the power of NGS to be realized without having to guess about sampling depth or to ignore the problem of PCR resampling, while also being able to correct most of the errors in the data set. PMID:26041299

Long-range barcode labeling-sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Feng; Zhang, Tao; Singh, Kanwar K.

Methods for sequencing single large DNA molecules by clonal multiple displacement amplification using barcoded primers. Sequences are binned based on barcode sequences and sequenced using a microdroplet-based method for sequencing large polynucleotide templates to enable assembly of haplotype-resolved complex genomes and metagenomes.

Design and Analysis of Single-Cell Sequencing Experiments.

PubMed

Grün, Dominic; van Oudenaarden, Alexander

2015-11-05

Recent advances in single-cell sequencing hold great potential for exploring biological systems with unprecedented resolution. Sequencing the genome of individual cells can reveal somatic mutations and allows the investigation of clonal dynamics. Single-cell transcriptome sequencing can elucidate the cell type composition of a sample. However, single-cell sequencing comes with major technical challenges and yields complex data output. In this Primer, we provide an overview of available methods and discuss experimental design and single-cell data analysis. We hope that these guidelines will enable a growing number of researchers to leverage the power of single-cell sequencing. Copyright © 2015 Elsevier Inc. All rights reserved.

A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less

A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

DOE PAGES

Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.

2015-12-09

The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less

Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys

PubMed Central

Berry, David; Gutierrez, Tony

2017-01-01

Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira, and Thalassolituus, as well as the Alphaproteobacterial genus Thalassospira. Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys. PMID:28567035

Evaluating the Detection of Hydrocarbon-Degrading Bacteria in 16S rRNA Gene Sequencing Surveys.

PubMed

Berry, David; Gutierrez, Tony

2017-01-01

Hydrocarbonoclastic bacteria (HCB) play a key role in the biodegradation of oil hydrocarbons in marine and other environments. A small number of taxa have been identified as obligate HCB, notably the Gammaproteobacterial genera Alcanivorax, Cycloclasticus, Marinobacter, Neptumonas, Oleiphilus, Oleispira , and Thalassolituus , as well as the Alphaproteobacterial genus Thalassospira . Detection of HCB in amplicon-based sequencing surveys relies on high coverage by PCR primers and accurate taxonomic classification. In this study, we performed a phylogenetic analysis to identify 16S rRNA gene sequence regions that represent the breadth of sequence diversity within these taxa. Using validated sequences, we evaluated 449 universal 16S rRNA gene-targeted bacterial PCR primer pairs for their coverage of these taxa. The results of this analysis provide a practical framework for selection of suitable primer sets for optimal detection of HCB in sequencing surveys.

Predictive Modeling of K-12 Academic Outcomes: A Primer for Researchers Working with Education Data

ERIC Educational Resources Information Center

Porter, Kristin E.; Balu, Rekha

2016-01-01

Education systems are increasingly creating rich, longitudinal data sets with frequent, and even real-time, data updates of many student measures, including daily attendance, homework submissions, and exam scores. These data sets provide an opportunity for district and school staff members to move beyond an indicators-based approach and instead…

Microsatellite markers for northern red oak (Fagaceae: Quercus rubra)

Treesearch

Preston R. Aldrich; Charles H. Michler; Weilin Sun; Jeanne Romero-Severson

2002-01-01

We provide primer sequences for 14 (GA)n microsatellite loci developed from northern red oak, an important timber species. We screened loci using two sets of samples. A parent-offspring set included DNA from seven acorns collected from one mother tree along with maternal DNA, to determine that all progeny carried a maternal allele at each locus....

A Primer-Test Centered Equating Method for Setting Cut-Off Scores

ERIC Educational Resources Information Center

Zhu, Weimo; Plowman, Sharon Ann; Park, Youngsik

2010-01-01

This study evaluated the use of a new primary field test method based on test equating to address inconsistent classification among field tests. We analyzed students' information on the Progressive Aerobic Cardiovascular Endurance Run (PACER), mile run (MR), and VO[subscript 2]max from three data sets (college: n = 94; middle school: n = 39;…

Identification of a common single nucleotide polymorphism at the primer binding site of D2S1360 that causes heterozygote peak imbalance when using the Investigator HDplex Kit.

PubMed

Inokuchi, Shota; Yamashita, Yasuhiro; Nishimura, Kazuma; Nakanishi, Hiroaki; Saito, Kazuyuki

2017-11-01

Phenomena known as null alleles and peak imbalance can occur because of mutations in the primer binding sites used for DNA typing. In these cases, an accurate statistical evaluation of DNA typing is difficult. The estimated likelihood ratio is incorrectly calculated because of the null allele and allele dropout caused by mutation-induced peak imbalance. Although a number of studies have attempted to uncover examples of these phenomena, few reports are available on the human identification kit manufactured by Qiagen. In this study, 196 Japanese individuals who were heterozygous at D2S1360 were genotyped using an Investigator HDplex Kit with optimal amounts of DNA. A peak imbalance was frequently observed at the D2S1360 locus. We performed a sequencing analysis of the area surrounding the D2S1360 repeat motif to identify the cause for peak imbalance. A point mutation (G>A transition) 136 nucleotides upstream from the D2S1360 repeat motif was discovered in a number of samples. The allele frequency of the mutation was 0.0566 in the Japanese population. Therefore, human identification or kinship testing using the Investigator HDplex Kit requires caution because of the higher frequency of single nucleotide polymorphisms at the primer binding site of D2S1360 locus in the Japanese population.

Characterization of vaginal Lactobacillus species by rplK -based multiplex qPCR in Russian women.

PubMed

Demkin, Vladimir V; Koshechkin, Stanislav I

2017-10-01

We describe a multiplex qPCR assay for identification and quantitative assessment of a set of vaginal Lactobacillus species, including L. acidophilus, L. crispatus, L. gasseri, L. helveticus, L. iners, and L. jensenii. The assay extends the previously developed qPCR method for Lactobacillus detection and total quantification based on targeting the rplK gene. Both assays use only single pair of primers and a set of probes combined in three reactions, comprising a vaginal Lactobacillus diagnostic assay panel. The utility of the diagnostic panel was evaluated by analyzing of vaginal swab specimens from 145 patients with different status of vaginal health. Most frequently, only one Lactobacillus species was dominant (68,9%), mostly L. crispatus (18,6%) or L. iners (33,1%), but two or three Lactobacillus species were also being simultaneously detected (24,9%). The diagnostic panel will facilitate investigations of the role of Lactobacillus species in the health of the female reproductive system and promote studies of variability of the vaginal microbiota. Copyright © 2017 Elsevier Ltd. All rights reserved.

A CRISPR Cas9 high-throughput genome editing toolkit for kinetoplastids

PubMed Central

Beneke, Tom; Makin, Laura; Valli, Jessica; Sunter, Jack

2017-01-01

Clustered regularly interspaced short palindromic repeats (CRISPR), CRISPR-associated gene 9 (Cas9) genome editing is set to revolutionize genetic manipulation of pathogens, including kinetoplastids. CRISPR technology provides the opportunity to develop scalable methods for high-throughput production of mutant phenotypes. Here, we report development of a CRISPR-Cas9 toolkit that allows rapid tagging and gene knockout in diverse kinetoplastid species without requiring the user to perform any DNA cloning. We developed a new protocol for single-guide RNA (sgRNA) delivery using PCR-generated DNA templates which are transcribed in vivo by T7 RNA polymerase and an online resource (LeishGEdit.net) for automated primer design. We produced a set of plasmids that allows easy and scalable generation of DNA constructs for transfections in just a few hours. We show how these tools allow knock-in of fluorescent protein tags, modified biotin ligase BirA*, luciferase, HaloTag and small epitope tags, which can be fused to proteins at the N- or C-terminus, for functional studies of proteins and localization screening. These tools enabled generation of null mutants in a single round of transfection in promastigote form Leishmania major, Leishmania mexicana and bloodstream form Trypanosoma brucei; deleted genes were undetectable in non-clonal populations, enabling for the first time rapid and large-scale knockout screens. PMID:28573017

Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food.

PubMed

Kim, Kwang-Pyo; Singh, Atul K; Bai, Xingjian; Leprun, Lena; Bhunia, Arun K

2015-09-08

The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634) encoding alcohol acetaldehyde dehydrogenase (Aad), previously designated as Listeria adhesion protein (LAP), and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology). PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap) can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 10⁴ CFU/mL.

Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food

PubMed Central

Kim, Kwang-Pyo; Singh, Atul K.; Bai, Xingjian; Leprun, Lena; Bhunia, Arun K.

2015-01-01

The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634) encoding alcohol acetaldehyde dehydrogenase (Aad), previously designated as Listeria adhesion protein (LAP), and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology). PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap) can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 104 CFU/mL. PMID:26371000

Development of a multiplex PCR assay for detection and discrimination of Theileria annulata and Theileria sergenti in cattle.

PubMed

Junlong, Liu; Li, Youquan; Liu, Aihong; Guan, Guiquan; Xie, Junren; Yin, Hong; Luo, Jianxun

2015-07-01

Aim to construct a simple and efficient diagnostic assay for Theileria annulata and Theileria sergenti, a multiplex polymerase chain reaction (PCR) method was developed in this study. Following the alignment of the related sequences, two primer sets were designed specific targeting on T. annulata cytochrome b (COB) gene and T. sergenti internal transcribed spacer (ITS) sequences. It was found that the designed primers could react in one PCR system and generating amplifications of 818 and 393 base pair for T. sergenti and T. annulata, respectively. The standard genomic DNA of both species Theileria was serial tenfold diluted for testing the sensitivity, while specificity test confirmed both primer sets have no cross-reaction with other Theileria and Babesia species. In addition, 378 field samples were used for evaluation of the utility of the multiplex PCR assay for detection of the pathogens infection. The detection results were compared with the other two published PCR methods which targeting on T. annulata COB gene and T. sergenti major piroplasm surface protein (MPSP) gene, respectively. The developed multiplex PCR assay has similar efficient detection with COB and MPSP PCR, which indicates this multiplex PCR may be a valuable assay for the epidemiological studies for T. annulata and T. sergenti.

Optimization of a magnetic capture RT-LAMP assay for fast and real-time detection of potato virus Y and differentiation of N and O serotypes.

PubMed

Treder, Krzysztof; Chołuj, Joanna; Zacharzewska, Bogumiła; Babujee, Lavanya; Mielczarek, Mateusz; Burzyński, Adam; Rakotondrafara, Aurélie M

2018-02-01

Potato virus Y (PVY) infection has been a global challenge for potato production and the leading cause of downgrading and rejection of seed crops for certification. Accurate and timely diagnosis is a key for effective disease control. Here, we have optimized a reverse transcription loop-mediated amplification (RT-LAMP) assay to differentiate the PVY O and N serotypes. The RT-LAMP assay is based on isothermal autocyclic strand displacement during DNA synthesis. The high specificity of this method relies heavily on the primer sets designed for the amplification of the targeted regions. We designed specific primer sets targeting a region within the coat protein gene that contains nucleotide signatures typical for O and N coat protein types, and these primers differ in their annealing temperature. Combining this assay with total RNA extraction by magnetic capture, we have established a highly sensitive, simplified and shortened RT-LAMP procedure as an alternative to conventional nucleic acid assays for diagnosis. This optimized procedure for virus detection may be used as a preliminary test for identifying the viral serotype prior to investing time and effort in multiplex RT-PCR tests when a specific strain is needed.

STITCHER: A web resource for high-throughput design of primers for overlapping PCR applications.

PubMed

O'Halloran, Damien M

2015-06-01

Overlapping PCR is routinely used in a wide number of molecular applications. These include stitching PCR fragments together, generating fluorescent transcriptional and translational fusions, inserting mutations, making deletions, and PCR cloning. Overlapping PCR is also used for genotyping by traditional PCR techniques and in detection experiments using techniques such as loop-mediated isothermal amplification (LAMP). STITCHER is a web tool providing a central resource for researchers conducting all types of overlapping PCR experiments with an intuitive interface for automated primer design that's fast, easy to use, and freely available online (http://ohalloranlab.net/STITCHER.html). STITCHER can handle both single sequence and multi-sequence input, and specific features facilitate numerous other PCR applications, including assembly PCR, adapter PCR, and primer walking. Field PCR, and in particular, LAMP, offers promise as an on site tool for pathogen detection in underdeveloped areas, and STITCHER includes off-target detection features for pathogens commonly targeted using LAMP technology.

Permanent Genetic Resources added to Molecular Ecology Resources Database 1 October 2009-30 November 2009.

PubMed

An, Junghwa; Bechet, Arnaud; Berggren, Asa; Brown, Sarah K; Bruford, Michael W; Cai, Qingui; Cassel-Lundhagen, Anna; Cezilly, Frank; Chen, Song-Lin; Cheng, Wei; Choi, Sung-Kyoung; Ding, X Y; Fan, Yong; Feldheim, Kevin A; Feng, Z Y; Friesen, Vicki L; Gaillard, Maria; Galaraza, Juan A; Gallo, Leonardo; Ganeshaiah, K N; Geraci, Julia; Gibbons, John G; Grant, William S; Grauvogel, Zac; Gustafsson, S; Guyon, Jeffrey R; Han, L; Heath, Daniel D; Hemmilä, S; Hogan, J Derek; Hou, B W; Jakse, Jernej; Javornik, Branka; Kaňuch, Peter; Kim, Kyung-Kil; Kim, Kyung-Seok; Kim, Sang-Gyu; Kim, Sang-In; Kim, Woo-Jin; Kim, Yi-Kyung; Klich, Maren A; Kreiser, Brian R; Kwan, Ye-Seul; Lam, Athena W; Lasater, Kelly; Lascoux, M; Lee, Hang; Lee, Yun-Sun; Li, D L; Li, Shao-Jing; Li, W Y; Liao, Xiaolin; Liber, Zlatko; Lin, Lin; Liu, Shaoying; Luo, Xin-Hui; Ma, Y H; Ma, Yajun; Marchelli, Paula; Min, Mi-Sook; Moccia, Maria Domenica; Mohana, Kumara P; Moore, Marcelle; Morris-Pocock, James A; Park, Han-Chan; Pfunder, Monika; Ivan, Radosavljević; Ravikanth, G; Roderick, George K; Rokas, Antonis; Sacks, Benjamin N; Saski, Christopher A; Satovic, Zlatko; Schoville, Sean D; Sebastiani, Federico; Sha, Zhen-Xia; Shin, Eun-Ha; Soliani, Carolina; Sreejayan, N; Sun, Zhengxin; Tao, Yong; Taylor, Scott A; Templin, William D; Shaanker, R Uma; Vasudeva, R; Vendramin, Giovanni G; Walter, Ryan P; Wang, Gui-Zhong; Wang, Ke-Jian; Wang, Y Q; Wattier, Rémi A; Wei, Fuwen; Widmer, Alex; Woltmann, Stefan; Won, Yong-Jin; Wu, Jing; Xie, M L; Xu, Genbo; Xu, Xiao-Jun; Ye, Hai-Hui; Zhan, Xiangjiang; Zhang, F; Zhong, J

2010-03-01

This article documents the addition of 411 microsatellite marker loci and 15 pairs of Single Nucleotide Polymorphism (SNP) sequencing primers to the Molecular Ecology Resources Database. Loci were developed for the following species: Acanthopagrus schlegeli, Anopheles lesteri, Aspergillus clavatus, Aspergillus flavus, Aspergillus fumigatus, Aspergillus oryzae, Aspergillus terreus, Branchiostoma japonicum, Branchiostoma belcheri, Colias behrii, Coryphopterus personatus, Cynogolssus semilaevis, Cynoglossus semilaevis, Dendrobium officinale, Dendrobium officinale, Dysoxylum malabaricum, Metrioptera roeselii, Myrmeciza exsul, Ochotona thibetana, Neosartorya fischeri, Nothofagus pumilio, Onychodactylus fischeri, Phoenicopterus roseus, Salvia officinalis L., Scylla paramamosain, Silene latifo, Sula sula, and Vulpes vulpes. These loci were cross-tested on the following species: Aspergillus giganteus, Colias pelidne, Colias interior, Colias meadii, Colias eurytheme, Coryphopterus lipernes, Coryphopterus glaucofrenum, Coryphopterus eidolon, Gnatholepis thompsoni, Elacatinus evelynae, Dendrobium loddigesii Dendrobium devonianum, Dysoxylum binectariferum, Nothofagus antarctica, Nothofagus dombeyii, Nothofagus nervosa, Nothofagus obliqua, Sula nebouxii, and Sula variegata. This article also documents the addition of 39 sequencing primer pairs and 15 allele specific primers or probes for Paralithodes camtschaticus. © 2010 Blackwell Publishing Ltd.

Development of Genomic Microsatellite Markers in Carthamus tinctorius L. (Safflower) Using Next Generation Sequencing and Assessment of Their Cross-Species Transferability and Utility for Diversity Analysis

PubMed Central

Variath, Murali Tottekkad; Joshi, Gopal; Bali, Sapinder; Agarwal, Manu; Kumar, Amar; Jagannath, Arun; Goel, Shailendra

2015-01-01

Background Safflower (Carthamus tinctorius L.), an Asteraceae member, yields high quality edible oil rich in unsaturated fatty acids and is resilient to dry conditions. The crop holds tremendous potential for improvement through concerted molecular breeding programs due to the availability of significant genetic and phenotypic diversity. Genomic resources that could facilitate such breeding programs remain largely underdeveloped in the crop. The present study was initiated to develop a large set of novel microsatellite markers for safflower using next generation sequencing. Principal Findings Low throughput genome sequencing of safflower was performed using Illumina paired end technology providing ~3.5X coverage of the genome. Analysis of sequencing data allowed identification of 23,067 regions harboring perfect microsatellite loci. The safflower genome was found to be rich in dinucleotide repeats followed by tri-, tetra-, penta- and hexa-nucleotides. Primer pairs were designed for 5,716 novel microsatellite sequences with repeat length ≥ 20 bases and optimal flanking regions. A subset of 325 microsatellite loci was tested for amplification, of which 294 loci produced robust amplification. The validated primers were used for assessment of 23 safflower accessions belonging to diverse agro-climatic zones of the world leading to identification of 93 polymorphic primers (31.6%). The numbers of observed alleles at each locus ranged from two to four and mean polymorphism information content was found to be 0.3075. The polymorphic primers were tested for cross-species transferability on nine wild relatives of cultivated safflower. All primers except one showed amplification in at least two wild species while 25 primers amplified across all the nine species. The UPGMA dendrogram clustered C. tinctorius accessions and wild species separately into two major groups. The proposed progenitor species of safflower, C. oxyacantha and C. palaestinus were genetically closer to cultivated safflower and formed a distinct cluster. The cluster analysis also distinguished diploid and tetraploid wild species of safflower. Conclusion Next generation sequencing of safflower genome generated a large set of microsatellite markers. The novel markers developed in this study will add to the existing repertoire of markers and can be used for diversity analysis, synteny studies, construction of linkage maps and marker-assisted selection. PMID:26287743

Development of loop-mediated isothermal amplification with Plasmodium falciparum unique genes for molecular diagnosis of human malaria.

PubMed

Zhang, Yijing; Yao, Yi; Du, Weixing; Wu, Kai; Xu, Wenyue; Lin, Min; Tan, Huabing; Li, Jian

2017-07-01

In order to achieve better outcomes for treatment and in the prophylaxis of malaria, it is imperative to develop a sensitive, specific, and accurate assay for early diagnosis of Plasmodium falciparum infection, which is the major cause of malaria. In this study, we aimed to develop a loop-mediated isothermal amplification (LAMP) assay with P. falciparum unique genes for sensitive, specific, and accurate detection of P. falciparum infection. The unique genes of P. falciparum were randomly selected from PlasmoDB. The LAMP primers of the unique genes were designed using PrimerExplorer V4. LAMP assays with primers from unique genes of P. falciparum and conserved 18S rRNA gene were developed and their sensitivity was assessed. The specificity of the most sensitive LAMP assay was further examined using genomic DNA from Plasmodium vivax, Plasmodium yoelii and Toxoplasma gondii. Finally, the unique gene-based LAMP assay was validated using clinical samples of P. falciparum infection cases. A total of 31 sets of top-scored LAMP primers from nine unique genes were selected from the pools of designed primers. The LAMP assay with PF3D7_1253300-5 was the most sensitive with the detection limit 5 parasites/μl, and it displayed negative LAMP assay with the genomic DNA samples of P. vivax, P. yoelii, and T. gondii. The LAMP assay with PF3D7_0112300 (18S rRNA) was less sensitive with the detection limit 50 parasites/μl, and it displayed negative LAMP assay with the genomic DNA samples of P. yoelii and T. gondii, but displayed positive LAMP detection with P. vivax. The positive detection rate of the LAMP assay with PF3D7_1253300-5 was 90% (27/30), higher than that (80%, 24/30) of the positive rate of PF3D7_0112300 (18S rRNA) in examining clinical samples of P. falciparum infection cases. The LAMP assay with the primer set PF3D7_1253300-5 was more sensitive, specific, and accurate than those with PF3D7_0112300 (18S rRNA) in examining P. falciparum infection, and therefore it is a promising tool for diagnosis of P. falciparum infection.

Development and Validation of Broad-Range Qualitative and Clade-Specific Quantitative Molecular Probes for Assessing Mercury Methylation in the Environment.

PubMed

Christensen, Geoff A; Wymore, Ann M; King, Andrew J; Podar, Mircea; Hurt, Richard A; Santillan, Eugenio U; Soren, Ally; Brandt, Craig C; Brown, Steven D; Palumbo, Anthony V; Wall, Judy D; Gilmour, Cynthia C; Elias, Dwayne A

2016-10-01

Two genes, hgcA and hgcB, are essential for microbial mercury (Hg) methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability, and biogeochemistry, are critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea genomes. A distinct PCR product at the expected size was confirmed for all hgcAB(+) strains tested via Sanger sequencing. Additionally, we developed clade-specific degenerate quantitative PCR (qPCR) primers that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88%, and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes, and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. The resulting data will be essential in developing accurate and robust predictive models of Hg methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB IMPORTANCE: The neurotoxin methylmercury (MeHg) poses a serious risk to human health. MeHg production in nature is associated with anaerobic microorganisms. The recent discovery of the Hg-methylating gene pair, hgcA and hgcB, has allowed us to design and optimize molecular probes against these genes within the genomic DNA for microorganisms known to methylate Hg. The protocols designed in this study allow for both qualitative and quantitative assessments of pure-culture or environmental samples. With these protocols in hand, we can begin to study the distribution of Hg-methylating organisms in nature via a cultivation-independent strategy. Copyright © 2016 Christensen et al.

Species identification and sex determination of the genus Nepenthes (Nepenthaceae).

PubMed

Mokkamul, Piya; Chaveerach, Arunrat; Sudmoon, Runglawan; Tanee, Tawatchai

2007-02-15

Nepenthes species are well known for their ornamentally attractive pitchers. The species diversity was randomly surveyed in some conservation areas of Thailand and three species were found, namely N. gracilis Korth., N. mirabilis Druce. and N. smilesii Hemsl. Young plants as unknown species from Chatuchak market were added in plant sampled set. Thirty two Inter Simple Sequence Repeat (ISSR) primers were screened and 13 successful primers were used to produce DNA banding patterns for constructing a dendrogram. The dendrogram is potentially power tool to identify unknown species from Chatuchak market, differentiate species population, population by geographical areas and sex determination. The geographical area of N. mirabilis was specified to Southern and Northeastern regions and finally, subdivided into exact areas according to province. Male and female plants of N. gracilis at Phu Wua Wildlife Sanctuary and N. mirabilis at Bung Khonglong non-hunting area were determined. Two unknown species from Chatuchak market were analyzed to be N. mirabilis with the genetic similarities (S) 77.2 to 84.7. Be more sex specific in all sample studied, 37 Random Amplified Polymorphic DNA (RAPD) primers were investigated. The result shows that only one RAPD primer show high resolution results at about 750 bp specific male-related marker.

A new rapid methodological strategy to assess BRCA mutational status.

PubMed

Vuttariello, Emilia; Borra, Marco; Calise, Celeste; Mauriello, Elvira; Greggi, Stefano; Vecchione, Aldo; Biffali, Elio; Chiappetta, Gennaro

2013-07-01

Hereditary cancers account for approximately 10 % of breast and ovarian cancers. Mutations of the BRCA1 and BRCA2 genes, encoding two proteins involved in DNA repair, underlie most cases of such hereditary cancers. Women with BRCA mutations develop breast cancer in 50-80 % of cases and ovarian cancer in 10-40 % of cases. Assessing BRCA mutational status is needed to direct the clinical management of women with predisposition to these hereditary cancers. However, BRCA screening constitutes a bottleneck in terms of costs and time to deliver results. We developed a PCR-based assay using 73 primer pairs covering the entire coding regions of BRCA1 and BRCA2. PCR primers, containing at the 5' end the universal M13 primer sequences, were pre-spotted in 96-well plates. Following PCR, direct sequencing was performed using M13 primers, allowing to standardize the conditions. PCR amplification and sequencing were successful for each amplicon. We tested and validated the assay on 10 known gDNAs from patients with Hereditary breast and ovarian cancer (HBOC). Our strategy is a promising time and cost-effective method to detect BRCA mutations in the clinical setting, which is essential to formulate a personalized therapy for patients with HBOC.

The development and mapping of functional markers in Fragaria and their transferability and potential for mapping in other genera.

PubMed

Sargent, D J; Rys, A; Nier, S; Simpson, D W; Tobutt, K R

2007-01-01

We have developed 46 primer pairs from exon sequences flanking polymorphic introns of 23 Fragaria gene sequences and one Malus sequence deposited in the EMBL database. Sequencing of a set of the PCR products amplified with the novel primer pairs in diploid Fragaria showed the products to be homologous to the sequences from which the primers were originally designed. By scoring the segregation of the 24 genes in two diploid Fragaria progenies FV x FN (F. vesca x F. nubicola F(2)) and 815 x 903BC (F. vesca x F. viridis BC(1)) 29 genetic loci at discrete positions on the seven linkage groups previously characterised could be mapped, bringing to 35 the total number of known function genes mapped in Fragaria. Twenty primer pairs, representing 14 genes, amplified a product of the expected size in both Malus and Prunus. To demonstrate the applicability of these gene-specific loci to comparative mapping in Rosaceae, five markers that displayed clear polymorphism between the parents of a Malus and a Prunus mapping population were selected. The markers were then scored and mapped in at least one of the two additional progenies.

Ultrasensitive Single Fluorescence-Labeled Probe-Mediated Single Universal Primer-Multiplex-Droplet Digital Polymerase Chain Reaction for High-Throughput Genetically Modified Organism Screening.

PubMed

Niu, Chenqi; Xu, Yuancong; Zhang, Chao; Zhu, Pengyu; Huang, Kunlun; Luo, Yunbo; Xu, Wentao

2018-05-01

As genetically modified (GM) technology develops and genetically modified organisms (GMOs) become more available, GMOs face increasing regulations and pressure to adhere to strict labeling guidelines. A singleplex detection method cannot perform the high-throughput analysis necessary for optimal GMO detection. Combining the advantages of multiplex detection and droplet digital polymerase chain reaction (ddPCR), a single universal primer-multiplex-ddPCR (SUP-M-ddPCR) strategy was proposed for accurate broad-spectrum screening and quantification. The SUP increases efficiency of the primers in PCR and plays an important role in establishing a high-throughput, multiplex detection method. Emerging ddPCR technology has been used for accurate quantification of nucleic acid molecules without a standard curve. Using maize as a reference point, four heterologous sequences ( 35S, NOS, NPTII, and PAT) were selected to evaluate the feasibility and applicability of this strategy. Surprisingly, these four genes cover more than 93% of the transgenic maize lines and serve as preliminary screening sequences. All screening probes were labeled with FAM fluorescence, which allows the signals from the samples with GMO content and those without to be easily differentiated. This fiveplex screening method is a new development in GMO screening. Utilizing an optimal amplification assay, the specificity, limit of detection (LOD), and limit of quantitation (LOQ) were validated. The LOD and LOQ of this GMO screening method were 0.1% and 0.01%, respectively, with a relative standard deviation (RSD) < 25%. This method could serve as an important tool for the detection of GM maize from different processed, commercially available products. Further, this screening method could be applied to other fields that require reliable and sensitive detection of DNA targets.

Permanent Genetic Resources added to Molecular Ecology Resources Database 1 May 2009-31 July 2009.

PubMed

Almany, Glenn R; DE Arruda, Maurício P; Arthofer, Wolfgang; Atallah, Z K; Beissinger, Steven R; Berumen, Michael L; Bogdanowicz, S M; Brown, S D; Bruford, Michael W; Burdine, C; Busch, Jeremiah W; Campbell, Nathan R; Carey, D; Carstens, Bryan C; Chu, K H; Cubeta, Marc A; Cuda, J P; Cui, Zhaoxia; Datnoff, L E; Dávila, J A; Davis, Emily S; Davis, R M; Diekmann, Onno E; Eizirik, Eduardo; Fargallo, J A; Fernandes, Fabiano; Fukuda, Hideo; Gale, L R; Gallagher, Elizabeth; Gao, Yongqiang; Girard, Philippe; Godhe, Anna; Gonçalves, Evonnildo C; Gouveia, Licinia; Grajczyk, Amber M; Grose, M J; Gu, Zhifeng; Halldén, Christer; Härnström, Karolina; Hemmingsen, Amanda H; Holmes, Gerald; Huang, C H; Huang, Chuan-Chin; Hudman, S P; Jones, Geoffrey P; Kanetis, Loukas; Karunasagar, Iddya; Karunasagar, Indrani; Keyghobadi, Nusha; Klosterman, S J; Klug, Page E; Koch, J; Koopman, Margaret M; Köppler, Kirsten; Koshimizu, Eriko; Krumböck, Susanne; Kubisiak, T; Landis, J B; Lasta, Mario L; Lee, Chow-Yang; Li, Qianqian; Li, Shou-Hsien; Lin, Rong-Chien; Liu, M; Liu, Na; Liu, W C; Liu, Yuan; Loiseau, A; Luan, Weisha; Maruthachalam, K K; McCormick, Helen M; Mellick, Rohan; Monnahan, P J; Morielle-Versute, Eliana; Murray, Tomás E; Narum, Shawn R; Neufeld, Katie; De Nova, P J G; Ojiambo, Peter S; Okamoto, Nobuaki; Othman, Ahmad Sofiman; Overholt, W A; Pardini, Renata; Paterson, Ian G; Patty, Olivia A; Paxton, Robert J; Planes, Serge; Porter, Carolyn; Pratchett, Morgan S; Püttker, Thomas; Rasic, Gordana; Rasool, Bilal; Rey, O; Riegler, Markus; Riehl, C; Roberts, John M K; Roberts, P D; Rochel, Elisabeth; Roe, Kevin J; Rossetto, Maurizio; Ruzzante, Daniel E; Sakamoto, Takashi; Saravanan, V; Sarturi, Cladinara Roberts; Schmidt, Anke; Schneider, Maria Paula Cruz; Schuler, Hannes; Serb, Jeanne M; Serrão, Ester T A; Shi, Yaohua; Silva, Artur; Sin, Y W; Sommer, Simone; Stauffer, Christian; Strüssmann, Carlos Augusto; Subbarao, K V; Syms, Craig; Tan, Feng; Tejedor, Eugenio Daniel; Thorrold, Simon R; Trigiano, Robert N; Trucco, María I; Tsuchiya-Jerep, Mirian Tieko Nunes; Vergara, P; Van De Vliet, Mirjam S; Wadl, Phillip A; Wang, Aimin; Wang, Hongxia; Wang, R X; Wang, Xinwang; Wang, Yan; Weeks, Andrew R; Wei, Fuwen; Werner, William J; Wiley, E O; Williams, D A; Wilkins, Richard J; Wisely, Samantha M; With, Kimberly A; Wu, Danhua; Yao, Cheng-Te; Yau, Cynthia; Yeap, Beng-Keok; Zhai, Bao-Ping; Zhan, Xiangjiang; Zhang, Guo-Yan; Zhang, S Y; Zhao, Ru; Zhu, Lifeng

2009-11-01

This article documents the addition of 512 microsatellite marker loci and nine pairs of Single Nucleotide Polymorphism (SNP) sequencing primers to the Molecular Ecology Resources Database. Loci were developed for the following species: Alcippe morrisonia morrisonia, Bashania fangiana, Bashania fargesii, Chaetodon vagabundus, Colletes floralis, Coluber constrictor flaviventris, Coptotermes gestroi, Crotophaga major, Cyprinella lutrensis, Danaus plexippus, Fagus grandifolia, Falco tinnunculus, Fletcherimyia fletcheri, Hydrilla verticillata, Laterallus jamaicensis coturniculus, Leavenworthia alabamica, Marmosops incanus, Miichthys miiuy, Nasua nasua, Noturus exilis, Odontesthes bonariensis, Quadrula fragosa, Pinctada maxima, Pseudaletia separata, Pseudoperonospora cubensis, Podocarpus elatus, Portunus trituberculatus, Rhagoletis cerasi, Rhinella schneideri, Sarracenia alata, Skeletonema marinoi, Sminthurus viridis, Syngnathus abaster, Uroteuthis (Photololigo) chinensis, Verticillium dahliae, Wasmannia auropunctata, and Zygochlamys patagonica. These loci were cross-tested on the following species: Chaetodon baronessa, Falco columbarius, Falco eleonorae, Falco naumanni, Falco peregrinus, Falco subbuteo, Didelphis aurita, Gracilinanus microtarsus, Marmosops paulensis, Monodelphis Americana, Odontesthes hatcheri, Podocarpus grayi, Podocarpus lawrencei, Podocarpus smithii, Portunus pelagicus, Syngnathus acus, Syngnathus typhle,Uroteuthis (Photololigo) edulis, Uroteuthis (Photololigo) duvauceli and Verticillium albo-atrum. This article also documents the addition of nine sequencing primer pairs and sixteen allele specific primers or probes for Oncorhynchus mykiss and Oncorhynchus tshawytscha; these primers and assays were cross-tested in both species. © 2009 Blackwell Publishing Ltd.

Isolation of a species-specific mitochondrial DNA sequence for identification of Tilletia indica, the Karnal bunt of wheat fungus.

PubMed Central

Ferreira, M A; Tooley, P W; Hatziloukas, E; Castro, C; Schaad, N W

1996-01-01

Mitochondrial DNA (mtDNA) from five isolates of Tilletia indica was isolated and digested with several restriction enzymes. A 2.3-kb EcoRI fragment was chosen, cloned, and shown to hybridize with total DNA restricted with EcoRI from T. indica and not from a morphologically similar smut fungus, Tilletia barclayana. The clone was partially sequenced, and primers were designed and tested under high-stringency conditions in PCR assays. The primer pair Ti1/Ti4 amplified a 2.3-kb fragment from total DNA of 17 T. indica isolates from India, Pakistan, and Mexico. DNA from 25 isolates of other smut fungi (T. barclayana, Tilletia foetida, Tilletia caries, Tilletia fusca, and Tilletia controversa) did not produce any bands, as detected by ethidium bromide-stained agarose gels and Southern hybridizations. The sensitivity of the assay was determined and increased by using a single nested primer in a second round of amplification, so that 1 pg of total mycelial DNA could be detected. The results indicated that the primers which originated from a cloned mtDNA sequence can be used to differentiate T. indica from other Tilletia species and have the potential to identify teliospores contaminating wheat seeds. PMID:8572716

Characterization and application of a quantitative DNA marker that discriminates sex in Chinook salmon (Oncorhynchus tshawytscha)

USGS Publications Warehouse

Clifton, D.R.; Rodriguez, R.J.

1997-01-01

A qualitative male-specific DNA marker (OT-24) was amplified by spPCR (single-primer polymerase chain reaction) from chinook salmon (Oncorhynchus tshawytscha) DNA along with several non-sex-linked products. The termini of the male-specific product were sequenced, and a pair of PeR primers were constructed for marker-specific PCR amplification. Dual primer PCR (dpPCR), with the marker-specific primers, amplified a product from both nudes and females. The amount of dpPCR product amplified from males was at least 100-fold greater than that from females. The quantitative difference between males and females was consistent among geographically distinct populations from western U.S. rivers. In addition, DNA sequence analysis indicated that OT-24 was highly conserved among geographically distinct salmon populations. The qualitative spPCR product segregated through several genetic crosses indicating equal sex ratios among progeny. Identification of the male and female juveniles by dpPCR was consistent with the spPCR analysis. There was no tissue specificity observed by spPCR or dpPCR analysis of this marker. A rapid DNA extraction method and dpPCR analysis were used to nonlethally determine sex ratios in wild spring chinook salmon adults, withheld for genetic and behavioral studies, prior to their development of gross sexual differences in their external morphology.

Application of Partial Internal Transcribed Spacer Sequences for the Discrimination of Artemisia capillaris from Other Artemisia Species

PubMed Central

Doh, Eui Jeong; Paek, Seung-Ho; Lee, Guemsan; Lee, Mi-Young; Oh, Seung-Eun

2016-01-01

Several Artemisia species are used as herbal medicines including the dried aerial parts of Artemisia capillaris, which are used as Artemisiae Capillaris Herba (known as “Injinho” in Korean medicinal terminology and “Yin Chen Hao” in Chinese). In this study, we developed tools for distinguishing between A. capillaris and 11 other Artemisia species that grow and/or are cultured in China, Japan, and Korea. Based on partial nucleotide sequences in the internal transcribed spacer (ITS) that differ between the species, we designed primers to amplify a DNA marker for A. capillaris. In addition, to detect other Artemisia species that are contaminants of A. capillaris, we designed primers to amplify DNA markers of A. japonica, A. annua, A. apiacea, and A. anomala. Moreover, based on random amplified polymorphic DNA analysis, we confirmed that primers developed in a previous study could be used to identify Artemisia species that are sources of Artemisiae Argyi Folium and Artemisiae Iwayomogii Herba. By using these primers, we found that multiplex polymerase chain reaction (PCR) was a reliable tool to distinguish between A. capillaris and other Artemisia species and to identify other Artemisia species as contaminants of A. capillaris in a single PCR. PMID:27313651

Characterization and application of a quantitative DNA marker that discriminates sex in chinook salmon (Oncorhynchus tshawytscha)

USGS Publications Warehouse

Clifton, D.R.; Rodriguez, R.J.

1997-01-01

A qualitative male-specific DNA marker (OT-24) was amplified by spPCR (single-primer polymerase chain reaction) from chinook salmon (Oncorhynchus tshawytscha) DNA along with several non-sex-linked products. The termini of the male-specific product were sequenced, and a pair of PeR primers were constructed for marker-specific PCR amplification. Dual primer PCR (dpPCR), with the marker-specific primers, amplified a product from both nudes and females. The amount of dpPCR product amplified from males was at least 100-fold greater than that from females. The quantitative difference between males and females was consistent among geographically distinct populations from western U.S. rivers. In addition, DNA sequence analysis indicated that OT-24 was highly conserved among geographically distinct salmon populations. The qualitative spPCR product segregated through several genetic crosses indicating equal sex ratios among progeny. Identification of the male and female juveniles by dpPCR was consistent with the spPCR analysis. There was no tissue specificity observed by spPCR or dpPCR analysis of this marker. A rapid DNA extraction method and dpPCR analysis were used to nonlethally determine sex ratios in wild spring chinook salmon adults, withheld for genetic and behavioral studies, prior to their development of gross sexual differences in their external morphology.

Detection of Fungi from an Indoor Environment using Loop-mediated Isothermal Amplification (LAMP) Method.

PubMed

Nakayama, Takako; Yamazaki, Takashi; Yo, Ayaka; Tone, Kazuya; Mahdi Alshahni, Mohamed; Fujisaki, Ryuichi; Makimura, Koichi

2017-01-01

　Loop-mediated isothermal amplification (LAMP) is a useful DNA detection method with high specificity and sensitivity. The LAMP reaction is carried out within a short time at a constant temperature without the need for thermal cycling. We developed a LAMP primer set for detecting a wide range of fungi by aligning the sequences of the large subunit ribosomal RNA gene of Candida albicans (Ascomycota), Cryptococcus neoformans (Basidiomycota), and Mucor racemosus (Mucorales). The threshold of C. albicans rDNA as template with our LAMP primer set was in the range of 10-100 copies per a reaction. In this study, we evaluated the correlation between colony forming units (CFU) and LAMP detection rate using the LAMP method for environmental fungi. The LAMP method should be a useful means of detecting fungi in indoor environments, disaster areas, or even in confined manned spacecraft to prevent allergies or infections caused by fungi.

A rapid screening with direct sequencing from blood samples for the diagnosis of Leigh syndrome.

PubMed

Shimbo, Hiroko; Takagi, Mariko; Okuda, Mitsuko; Tsuyusaki, Yu; Takano, Kyoko; Iai, Mizue; Yamashita, Sumimasa; Murayama, Kei; Ohtake, Akira; Goto, Yu-Ichi; Aida, Noriko; Osaka, Hitoshi

2014-01-01

Large numbers of genes are responsible for Leigh syndrome (LS), making genetic confirmation of LS difficult. We screened our patients with LS using a limited set of 21 primers encompassing the frequently reported gene for the respiratory chain complexes I (ND1-ND6, and ND4L), IV(SURF1), and V(ATP6) and the pyruvate dehydrogenase E1α-subunit. Of 18 LS patients, we identified mutations in 11 patients, including 7 in mDNA (two with ATP6), 4 in nuclear (three with SURF1). Overall, we identified mutations in 61% of LS patients (11/18 individuals) in this cohort. Sanger sequencing with our limited set of primers allowed us a rapid genetic confirmation of more than half of the LS patients and it appears to be efficient as a primary genetic screening in this cohort.

Repertoire of novel sequence signatures for the detection of Candidatus Liberibacter asiaticus by quantitative real-time PCR

PubMed Central

2014-01-01

Background Huanglongbing (HLB) or citrus greening is a devastating disease of citrus. The gram-negative bacterium Candidatus Liberibacter asiaticus (Las) belonging to the α-proteobacteria is responsible for HLB in North America as well as in Asia. Currently, there is no cure for this disease. Early detection and quarantine of Las-infected trees are important management strategies used to prevent HLB from invading HLB-free citrus producing regions. Quantitative real-time PCR (qRT-PCR) based molecular diagnostic assays have been routinely used in the detection and diagnosis of Las. The oligonucleotide primer pairs based on conserved genes or regions, which include 16S rDNA and the β-operon, have been widely employed in the detection of Las by qRT-PCR. The availability of whole genome sequence of Las now allows the design of primers beyond the conserved regions for the detection of Las explicitly. Results We took a complimentary approach by systematically screening the genes in a genome-wide fashion, to identify the unique signatures that are only present in Las by an exhaustive sequence based similarity search against the nucleotide sequence database. Our search resulted in 34 probable unique signatures. Furthermore, by designing the primer pair specific to the identified signatures, we showed that most of our primer sets are able to detect Las from the infected plant and psyllid materials collected from the USA and China by qRT-PCR. Overall, 18 primer pairs of the 34 are found to be highly specific to Las with no cross reactivity to the closely related species Ca. L. americanus (Lam) and Ca. L. africanus (Laf). Conclusions We have designed qRT-PCR primers based on Las specific genes. Among them, 18 are suitable for the detection of Las from Las-infected plant and psyllid samples. The repertoire of primers that we have developed and characterized in this study enhanced the qRT-PCR based molecular diagnosis of HLB. PMID:24533511

Transferability of microsatellite markers of Capsicum annuum L. to C. frutescens L. and C. chinense Jacq.

PubMed

Carvalho, S I C; Ragassi, C F; Oliveira, I B; Amaral, Z P S; Reifschneider, F J B; Faleiro, F G; Buso, G S C

2015-07-17

In order to support further genetic, diversity, and phylogeny studies of Capsicum species, the transferability of a Capsicum annuum L. simple sequence repeat (SSR) microsatellite set was analyzed for C. frutescens L. ("malagueta" and "tabasco" peppers) and C. chinense Jacq. (smell peppers, among other types). A total of 185 SSR primers were evaluated in 12 accessions from 115 C. frutescens L. and 480 C. chinense Jacq, representing different types within each species. Transferability to C. frutescens L. and C. chinense Jacq. occurred for 116 primers (62.7%). Nineteen (16.37%) were polymorphic in C. frutescens L. and 36 (31.03%) in C. chinense Jacq., 17 of which were coincident and could be used to analyze samples obtained for the 2 species. Among these primers, CA49 showed a different amplitude range of alleles between the 2 species (130-132 base pairs for C. frutescens L. and 120-128 base pairs for C. chinense Jacq.), and could differentiate the species. A total of 55 alleles were identified among the 19 polymorphic SSR loci among accessions of C. frutescens L., with the number of alleles per locus ranging from 2 to 5, a mean of 2.89, and the polymorphic information content ranging from 0.30 to 0.65. The number of alleles identified in C. chinense Jacq. was 119, ranging from 2 to 5 alleles per locus, an average of 3.30, and polymorphic information content from 0.19 to 0.68. The C. annuum L. SSR primers were most often transfer-able and polymorphic for C. frutescens L. and C. chinense Jacq., and we present a set of SSR for each species.

Introduction on Using the FastPCR Software and the Related Java Web Tools for PCR and Oligonucleotide Assembly and Analysis.

PubMed

Kalendar, Ruslan; Tselykh, Timofey V; Khassenov, Bekbolat; Ramanculov, Erlan M

2017-01-01

This chapter introduces the FastPCR software as an integrated tool environment for PCR primer and probe design, which predicts properties of oligonucleotides based on experimental studies of the PCR efficiency. The software provides comprehensive facilities for designing primers for most PCR applications and their combinations. These include the standard PCR as well as the multiplex, long-distance, inverse, real-time, group-specific, unique, overlap extension PCR for multi-fragments assembling cloning and loop-mediated isothermal amplification (LAMP). It also contains a built-in program to design oligonucleotide sets both for long sequence assembly by ligase chain reaction and for design of amplicons that tile across a region(s) of interest. The software calculates the melting temperature for the standard and degenerate oligonucleotides including locked nucleic acid (LNA) and other modifications. It also provides analyses for a set of primers with the prediction of oligonucleotide properties, dimer and G/C-quadruplex detection, linguistic complexity as well as a primer dilution and resuspension calculator. The program consists of various bioinformatical tools for analysis of sequences with the GC or AT skew, CG% and GA% content, and the purine-pyrimidine skew. It also analyzes the linguistic sequence complexity and performs generation of random DNA sequence as well as restriction endonucleases analysis. The program allows to find or create restriction enzyme recognition sites for coding sequences and supports the clustering of sequences. It performs efficient and complete detection of various repeat types with visual display. The FastPCR software allows the sequence file batch processing that is essential for automation. The program is available for download at http://primerdigital.com/fastpcr.html , and its online version is located at http://primerdigital.com/tools/pcr.html .

SYBR green-based real-time reverse transcription-PCR for typing and subtyping of all hemagglutinin and neuraminidase genes of avian influenza viruses and comparison to standard serological subtyping tests.

PubMed

Tsukamoto, Kenji; Panei, Carlos Javier; Javier, Panei Carlos; Shishido, Makiko; Noguchi, Daigo; Pearce, John; Kang, Hyun-Mi; Jeong, Ok Mi; Lee, Youn-Jeong; Nakanishi, Koji; Ashizawa, Takayoshi

2012-01-01

Continuing outbreaks of H5N1 highly pathogenic (HP) avian influenza virus (AIV) infections of wild birds and poultry worldwide emphasize the need for global surveillance of wild birds. To support the future surveillance activities, we developed a SYBR green-based, real-time reverse transcriptase PCR (rRT-PCR) for detecting nucleoprotein (NP) genes and subtyping 16 hemagglutinin (HA) and 9 neuraminidase (NA) genes simultaneously. Primers were improved by focusing on Eurasian or North American lineage genes; the number of mixed-base positions per primer was set to five or fewer, and the concentration of each primer set was optimized empirically. Also, 30 cycles of amplification of 1:10 dilutions of cDNAs from cultured viruses effectively reduced minor cross- or nonspecific reactions. Under these conditions, 346 HA and 345 NA genes of 349 AIVs were detected, with average sensitivities of NP, HA, and NA genes of 10(1.5), 10(2.3), and 10(3.1) 50% egg infective doses, respectively. Utility of rRT-PCR for subtyping AIVs was compared with that of current standard serological tests by using 104 recent migratory duck virus isolates. As a result, all HA genes and 99% of the NA genes were genetically subtyped, while only 45% of HA genes and 74% of NA genes were serologically subtyped. Additionally, direct subtyping of AIVs in fecal samples was possible by 40 cycles of amplification: approximately 70% of HA and NA genes of NP gene-positive samples were successfully subtyped. This validation study indicates that rRT-PCR with optimized primers and reaction conditions is a powerful tool for subtyping varied AIVs in clinical and cultured samples.

Characterization of Biofilm Community Structure by Ribosomal RNA sequences

DTIC Science & Technology

1989-12-01

for strains of Fibrobacter, 2) Desulfobacter genus-specific probe, 3) Desulfosarcina genus-specific probe, 4) archaebacterial kingdom -specific probes...and 5) eubacterial kingdom -specific probes 5) eukaryote kingdom -specific probe and 6) a general probe encompassing all characterized sulfate-reducing...sets have been fabricated. The group-specific primer sets selectively amplify either sulfate-reducing bacteria or archaebacteria . The SRB-specific

Is the simian virus SV40 associated with idiopathic focal segmental glomerulosclerosis in humans?

PubMed

Galdenzi, Gabriella; Lupo, Antonio; Anglani, Franca; Perini, Marino; Galeazzi, Luciano; Giunta, Sergio; Marcantoni, Carmelita; Del Prete, Dorella; Graziotto, Romina; D'angelo, Angela; Maschio, Giuseppe; Gambaro, Giovanni

2003-01-01

Glomerulosclerosis was reported in mice transgenic for the simian polyomavirus SV40 early region that contains the transforming sequences encoding the SV40 large T-antigen (TAG). This was discovered when an SV40 epidemic occurred following the use of contaminated polio vaccines during 1955-1963, and led to investigations that showed an association between SV40 infection and tumors in humans. We investigated the possible association of SV40 infection and idiopathic focal segmental glomerulosclerosis (FSGS). The study was performed in 17 Bouin-fixed, paraffin-embedded renal biopsies from FSGS patients and 10 matched biopsies from patients with IgA glomerulonephritis; all patients had undergone polio vaccination in the early 1960s. Extracted DNA was polymerase chain reaction (PCR) amplified using SV.for3/SV.rev primers and GabE1/GabE2 primers; both sets of primers map in the region of SV40 TAG sequences, and amplify a fragment of respectively 105-bp and 135-bp. The biopsies considered were those in which the DNA was sufficiently intact to allow amplification of a fragment of 102-bp of the ApoE gene. Three FSGS and none of the IgA biopsies were positive for the SV.for3/SV.rev fragment. Conversely, amplification with GabE1/GabE2 primers did not lead to any specific product in either the IgA or FSGS biopsies. Restriction fragment length polymorphism and sequencing analyses revealed that the positive results obtained with the SV.for3/SV.rev primers were due to amplicons generated by multiple dimerization of forward and reverse primers. With the limited number of patients investigated, this study excludes the hypothesis that SV40 is associated with idiopathic FSGS.

Direct detection of RNA in vitro and in situ by target-primed RCA: The impact of E. coli RNase III on the detection efficiency of RNA sequences distanced far from the 3'-end.

PubMed

Merkiene, Egle; Gaidamaviciute, Edita; Riauba, Laurynas; Janulaitis, Arvydas; Lagunavicius, Arunas

2010-08-01

We improved the target RNA-primed RCA technique for direct detection and analysis of RNA in vitro and in situ. Previously we showed that the 3' --> 5' single-stranded RNA exonucleolytic activity of Phi29 DNA polymerase converts the target RNA into a primer and uses it for RCA initiation. However, in some cases, the single-stranded RNA exoribonucleolytic activity of the polymerase is hindered by strong double-stranded structures at the 3'-end of target RNAs. We demonstrate that in such hampered cases, the double-stranded RNA-specific Escherichia coli RNase III efficiently assists Phi29 DNA polymerase in converting the target RNA into a primer. These observations extend the target RNA-primed RCA possibilities to test RNA sequences distanced far from the 3'-end and customize this technique for the inner RNA sequence analysis.

Purification and properties of poliovirus RNA polymerase expressed in Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Plotch, S.J.; Palant, O.; Gluzman, Y.

1989-01-01

A cDNA clone encoding the RNA polymerase of poliovirus has been expressed in Escherichia coli under the transcriptional control of a T7 bacteriophage promoter. This poliovirus enzyme was designed to contain only a single additional amino acid, the N-terminal methionine. The recombinant enzyme has been purified to near homogeneity, and polyclonal antibodies have been prepared against it. The enzyme exhibits poly(A)-dependent oligo(U)-primed ply(U) polymerase activity as well as RNA polymerase activity. In the presence of an oligo(U) primer, the enzyme catalyzes the synthesis of a full-length copy of either poliovirus or globin RNA templates. In the absence of added primer,more » RNA products up to twice the length of the template are synthesized. When incubated in the presence of a single nucleoside triphosphate, (..cap alpha..-/sup 32/P)UTP, the enzyme catalyzes the incorporation of radioactive label into template RNA. These results are discussed in light of previously proposed models of poliovirus RNA synthesis in vitro.« less

Resistance gene homologues in Theobroma cacao as useful genetic markers.

PubMed

Kuhn, D N; Heath, M; Wisser, R J; Meerow, A; Brown, J S; Lopes, U; Schnell, R J

2003-07-01

Resistance gene homologue (RGH) sequences have been developed into useful genetic markers for marker-assisted selection (MAS) of disease resistant Theobroma cacao. A plasmid library of amplified fragments was created from seven different cultivars of cacao. Over 600 cloned recombinant amplicons were evaluated. From these, 74 unique RGHs were identified that could be placed into 11 categories based on sequence analysis. Primers specific to each category were designed. The primers specific for a single RGH category amplified fragments of equal length from the seven different cultivars used to create the library. However, these fragments exhibited single-strand conformational polymorphism (SSCP), which allowed us to map six of the RGH categories in an F(2) population of T. cacao. RGHs 1, 4 and 5 were in the same linkage group, with RGH 4 and 5 separated by less than 4 cM. As SSCP can be efficiently performed on our automated sequencer, we have developed a convenient and rapid high throughput assay for RGH alleles.

Comparison of Self-Etch Primers with Conventional Acid Etching System on Orthodontic Brackets

PubMed Central

Zope, Amit; Zope-Khalekar, Yogita; Chitko, Shrikant S.; Kerudi, Veerendra V.; Patil, Harshal Ashok; Jaltare, Pratik; Dolas, Siddhesh G

2016-01-01

Introduction The self-etching primer system consists of etchant and primer dispersed in a single unit. The etching and priming are merged as a single step leading to fewer stages in bonding procedure and reduction in the number of steps that also reduces the chance of introduction of error, resulting in saving time for the clinician. It also results in smaller extent of enamel decalcification. Aim To compare the Shear Bond Strength (SBS) of orthodontic bracket bonded with Self-Etch Primers (SEP) and conventional acid etching system and to study the surface appearance of teeth after debonding; etching with conventional acid etch and self-etch priming, using stereomicroscope. Materials and Methods Five Groups (n=20) were created randomly from a total of 100 extracted premolars. In a control Group A, etching of enamel was done with 37% phosphoric acid and bonding of stainless steel brackets with Transbond XT (3M Unitek, Monrovia, California). Enamel conditioning in left over four Groups was done with self-etching primers and adhesives as follows: Group B-Transbond Plus (3M Unitek), Group C Xeno V+ (Dentsply), Group D-G-Bond (GC), Group E-One-Coat (Coltene). The Adhesive Remnant Index (ARI) score was also evaluated. Additionally, the surface roughness using profilometer were observed. Results Mean SBS of Group A was 18.26±7.5MPa, Group B was 10.93±4.02MPa, Group C was 6.88±2.91MPa while of Group D was 7.78±4.13MPa and Group E was 10.39±5.22MPa respectively. In conventional group ARI scores shows that over half of the adhesive was remaining on the surface of tooth (score 1 to 3). In self-etching primer groups ARI scores show that there was no or minor amount of adhesive remaining on the surface of tooth (score 4 and 5). SEP produces a lesser surface roughness on the enamel than conventional etching. However, statistical analysis shows significant correlation (p<0.001) of bond strength with surface roughness of enamel. Conclusion All groups might show clinically useful SBS values and Transbond XT can be successfully used for bracket bonding after enamel conditioning with any of the SEPs tested. The SEPs used in Groups C (Xeno V+) and D (G-Bond) have significantly lowered SBS. Although, the values might still be clinically acceptable. PMID:28208997

BiQ Analyzer HT: locus-specific analysis of DNA methylation by high-throughput bisulfite sequencing

PubMed Central

Lutsik, Pavlo; Feuerbach, Lars; Arand, Julia; Lengauer, Thomas; Walter, Jörn; Bock, Christoph

2011-01-01

Bisulfite sequencing is a widely used method for measuring DNA methylation in eukaryotic genomes. The assay provides single-base pair resolution and, given sufficient sequencing depth, its quantitative accuracy is excellent. High-throughput sequencing of bisulfite-converted DNA can be applied either genome wide or targeted to a defined set of genomic loci (e.g. using locus-specific PCR primers or DNA capture probes). Here, we describe BiQ Analyzer HT (http://biq-analyzer-ht.bioinf.mpi-inf.mpg.de/), a user-friendly software tool that supports locus-specific analysis and visualization of high-throughput bisulfite sequencing data. The software facilitates the shift from time-consuming clonal bisulfite sequencing to the more quantitative and cost-efficient use of high-throughput sequencing for studying locus-specific DNA methylation patterns. In addition, it is useful for locus-specific visualization of genome-wide bisulfite sequencing data. PMID:21565797

Enhancer scanning to locate regulatory regions in genomic loci

PubMed Central

Buckley, Melissa; Gjyshi, Anxhela; Mendoza-Fandiño, Gustavo; Baskin, Rebekah; Carvalho, Renato S.; Carvalho, Marcelo A.; Woods, Nicholas T.; Monteiro, Alvaro N.A.

2016-01-01

The present protocol provides a rapid, streamlined and scalable strategy to systematically scan genomic regions for the presence of transcriptional regulatory regions active in a specific cell type. It creates genomic tiles spanning a region of interest that are subsequently cloned by recombination into a luciferase reporter vector containing the Simian Virus 40 promoter. Tiling clones are transfected into specific cell types to test for the presence of transcriptional regulatory regions. The protocol includes testing of different SNP (single nucleotide polymorphism) alleles to determine their effect on regulatory activity. This procedure provides a systematic framework to identify candidate functional SNPs within a locus during functional analysis of genome-wide association studies. This protocol adapts and combines previous well-established molecular biology methods to provide a streamlined strategy, based on automated primer design and recombinational cloning to rapidly go from a genomic locus to a set of candidate functional SNPs in eight weeks. PMID:26658467

Labeled Nucleoside Triphosphates with Reversibly Terminating Aminoalkoxyl Groups

PubMed Central

Hutter, Daniel; Kim, Myong-Jung; Karalkar, Nilesh; Leal, Nicole A.; Chen, Fei; Guggenheim, Evan; Visalakshi, Visa; Olejnik, Jerzy; Gordon, Steven; Benner, Steven A.

2013-01-01

Nucleoside triphosphates having a 3′-ONH2 blocking group have been prepared with and without fluorescent tags on their nucleobases. DNA polymerases were identified that accepted these, adding a single nucleotide to the 3′-end of a primer in a template-directed extension reaction that then stops. Nitrite chemistry was developed to cleave the 3′-ONH2 group under mild conditions to allow continued primer extension. Extension-cleavage-extension cycles in solution were demonstrated with untagged nucleotides and mixtures of tagged and untagged nucleotides. Multiple extension-cleavage-extension cycles were demonstrated on an Intelligent Bio-Systems Sequencer, showing the potential of the 3′-ONH2 blocking group in “next generation sequencing”. PMID:21128174

Comparison of endogenous feline leukemia virus RNA content in feline vaccine and nonvaccine site-associated sarcomas.

PubMed

Kidney, B A; Ellis, J A; Haines, D M; Jackson, M L

2001-12-01

To determine whether feline vaccine site-associated sarcomas (VSS) contain a higher amount of endogenous FeLV (enFeLV) RNA, compared with feline nonvaccine site-associated sarcomas (non-VSS). Formalin-fixed paraffin-embedded (FFPE) tissues from 50 VSS and 50 cutaneous non-VSS. RNA was extracted from FFPE sections of each tumor, and regions of the long terminal repeat (LTR) and envelope (env) gene of enFeLV were amplified by use of reverse transcriptase-polymerase chain reaction (RT-PCR). The density of each RT-PCR product band for enFeLV was compared with that of a constitutively expressed gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH). An integrated density value (IDV) was determined by use of densitometry, and the IDV ratio for enFeLV to GAPDH was calculated for each enFeLV primer set. The median (interquartile range) of the IDV ratio for the enFeLV LTR primer set was 0.52 (0.26 to 1.17) for the VSS group and 0.84 (0.21 to 1.53) for the non-VSS group. The median (interquartile range) of the IDV ratio for the enFeLV env primer set was 0.60 (0.37 to 0.91) for the VSS group and 0.59 (0.36 to 1.09) for the non-VSS group. Because the amount of enFeLV RNA within the LTR and env gene was not significantly different between the VSS and non-VSS groups, enFeLV replication or expression is unlikely to be involved in VSS development.

Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA

PubMed Central

Hashemipetroudi, Seyyed Hamidreza; Nematzadeh, Ghorbanali; Ahmadian, Gholamreza; Yamchi, Ahad; Kuhlmann, Markus

2018-01-01

One method extensively used for the quantification of gene expression changes and transcript abundances is reverse-transcription quantitative real-time PCR (RT-qPCR). It provides accurate, sensitive, reliable, and reproducible results. Several factors can affect the sensitivity and specificity of RT-qPCR. Residual genomic DNA (gDNA) contaminating RNA samples is one of them. In gene expression analysis, non-specific amplification due to gDNA contamination will overestimate the abundance of transcript levels and can affect the RT-qPCR results. Generally, gDNA is detected by qRT-PCR using primer pairs annealing to intergenic regions or an intron of the gene of interest. Unfortunately, intron/exon annotations are not yet known for all genes from vertebrate, bacteria, protist, fungi, plant, and invertebrate metazoan species. Here we present a protocol for detection of gDNA contamination in RNA samples by using ribosomal DNA (rDNA)-based primers. The method is based on the unique features of rDNA: their multigene nature, highly conserved sequences, and high frequency in the genome. Also as a case study, a unique set of primers were designed based on the conserved region of ribosomal DNA (rDNA) in the Poaceae family. The universality of these primer pairs was tested by melt curve analysis and agarose gel electrophoresis. Although our method explains how rDNA-based primers can be applied for the gDNA contamination assay in the Poaceae family, it could be easily used to other prokaryote and eukaryote species PMID:29443017