Sample records for sirna transcripts produced
-
Targeting siRNA Missiles to Her2+ Breast Cancer
2009-06-01
that HerPBK10 protects siRNA from serum nuclease-mediated degradation, T7 transcribed siRNA is more cytotoxic than synthetic siRNA when delivered to...nuclease-mediated degradation, T7 transcribed siRNA is more cytotoxic than synthetic siRNA when delivered to HER2+ breast cancer cells by HerPBK10...produced either synthetically by a commercial vendor (Dharmacon), or from a T7 transcription kit (Ambion), and shRNA, which is reportedly a more effective
-
Bioinformatics Analysis of Small RNAs in Pima (Gossypium barbadense L.)
Hu, Hongtao; Yu, Dazhao; Liu, Hong
2015-01-01
Small RNAs (sRNAs) are ~20 to 24 nucleotide single-stranded RNAs that play crucial roles in regulation of gene expression. In plants, sRNAs are classified into microRNAs (miRNAs), repeat-associated siRNAs (ra-siRNAs), phased siRNAs (pha-siRNAs), cis and trans natural antisense transcript siRNAs (cis- and trans-nat siRNAs). Pima (Gossypium barbadense L.) is one of the most economically important fiber crops, producing the best and longest spinnable fiber. Although some miRNAs are profiled in Pima, little is known about siRNAs, the largest subclass of plant sRNAs. In order to profile these gene regulators in Pima, a comprehensive analysis of sRNAs was conducted by mining publicly available sRNA data, leading to identification of 678 miRNAs, 3,559,126 ra-siRNAs, 627 pha-siRNAs, 136,600 cis-nat siRNAs and 79,994 trans-nat siRNAs. The 678 miRNAs, belonging to 98 conserved and 402 lineage-specific families, were produced from 2,138 precursors, of which 297 arose from introns, exons, or intron/UTR-exon junctions of protein-coding genes. Ra-siRNAs were produced from various repeat loci, while most (97%) were yielded from retrotransposons, especially LTRs (long terminal repeats). The genes encoding auxin-signaling-related proteins, NBS-LRRs and transcription factors were major sources of pha-siRNAs, while two conserved TAS3 homologs were found as well. Most cis-NATs in Pima overlapped in enclosed and convergent orientations, while a few hybridized in divergent and coincided orientations. Most cis- and trans-nat siRNAs were produced from overlapping regions. Additionally, characteristics of length and the 5’-first nucleotide of each sRNA class were analyzed as well. Results in this study created a valuable molecular resource that would facilitate studies on mechanism of controlling gene expression. PMID:25679373
-
Small interfering RNA-producing loci in the ancient parasitic eukaryote Trypanosoma brucei
2012-01-01
Background At the core of the RNA interference (RNAi) pathway in Trypanosoma brucei is a single Argonaute protein, TbAGO1, with an established role in controlling retroposon and repeat transcripts. Recent evidence from higher eukaryotes suggests that a variety of genomic sequences with the potential to produce double-stranded RNA are sources for small interfering RNAs (siRNAs). Results To test whether such endogenous siRNAs are present in T. brucei and to probe the individual role of the two Dicer-like enzymes, we affinity purified TbAGO1 from wild-type procyclic trypanosomes, as well as from cells deficient in the cytoplasmic (TbDCL1) or nuclear (TbDCL2) Dicer, and subjected the bound RNAs to Illumina high-throughput sequencing. In wild-type cells the majority of reads originated from two classes of retroposons. We also considerably expanded the repertoire of trypanosome siRNAs to encompass a family of 147-bp satellite-like repeats, many of the regions where RNA polymerase II transcription converges, large inverted repeats and two pseudogenes. Production of these newly described siRNAs is strictly dependent on the nuclear DCL2. Notably, our data indicate that putative centromeric regions, excluding the CIR147 repeats, are not a significant source for endogenous siRNAs. Conclusions Our data suggest that endogenous RNAi targets may be as evolutionarily old as the mechanism itself. PMID:22925482
-
Hanning, Jennifer E; Groves, Ian J; Pett, Mark R; Coleman, Nicholas
2013-05-21
Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects.
-
2013-01-01
Background Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. Findings We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. Conclusions These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects. PMID:23693071
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ness, Gene C., E-mail: gness@hsc.usf.edu; Edelman, Jeffrey L.; Brooks, Patricia A.
2012-03-30
Highlights: Black-Right-Pointing-Pointer siRNAs to tristetraprolin blocks transcription of HMGR in vivo in rat liver. Black-Right-Pointing-Pointer siRNAs to tristetraprolin inhibits insulin activation of HMGR transcription. Black-Right-Pointing-Pointer Insulin acts to rapidly increase tristetraprolin in liver nuclear extracts. -- Abstract: Several AU-rich RNA binding element (ARE) proteins were investigated for their possible effects on transcription of hepatic 3-hydroxy-3-methyglutaryl coenzyme A reductase (HMGR) in normal rats. Using in vivo electroporation, four different siRNAs to each ARE protein were introduced together with HMGR promoter (-325 to +20) luciferase construct and compared to saline controls. All four siRNAs to tristetraprolin (TTP) completely eliminated transcription from themore » HMGR promoter construct. Since insulin acts to rapidly increase hepatic HMGR transcription, the effect of TTP siRNA on induction by insulin was tested. The 3-fold stimulation by insulin was eliminated by this treatment. In comparison, siRNA to AU RNA binding protein/enoyl coenzyme A hydratase (AUH) had no effect. These findings indicate a role for TTP in the insulin-mediated activation of hepatic HMGR transcription.« less
-
Branscheid, Anja; Marchais, Antonin; Schott, Gregory; Lange, Heike; Gagliardi, Dominique; Andersen, Stig Uggerhøj; Voinnet, Olivier; Brodersen, Peter
2015-01-01
Small regulatory RNAs are fundamental in eukaryotic and prokaryotic gene regulation. In plants, an important element of post-transcriptional control is effected by 20–24 nt microRNAs (miRNAs) and short interfering RNAs (siRNAs) bound to the ARGONAUTE1 (AGO1) protein in an RNA induced silencing complex (RISC). AGO1 may cleave target mRNAs with small RNA complementarity, but the fate of the resulting cleavage fragments remains incompletely understood. Here, we show that SKI2, SKI3 and SKI8, subunits of a cytoplasmic cofactor of the RNA exosome, are required for degradation of RISC 5′, but not 3′-cleavage fragments in Arabidopsis. In the absence of SKI2 activity, many miRNA targets produce siRNAs via the RNA-dependent RNA polymerase 6 (RDR6) pathway. These siRNAs are low-abundant, and map close to the cleavage site. In most cases, siRNAs were produced 5′ to the cleavage site, but several examples of 3′-spreading were also identified. These observations suggest that siRNAs do not simply derive from RDR6 action on stable 5′-cleavage fragments and hence that SKI2 has a direct role in limiting secondary siRNA production in addition to its function in mediating degradation of 5′-cleavage fragments. PMID:26464441
-
Splicing stimulates siRNA formation at Drosophila DNA double-strand breaks
Merk, Karin; Breinig, Marco; Böttcher, Romy; Krebs, Stefan; Blum, Helmut; Boutros, Michael
2017-01-01
DNA double-strand breaks trigger the production of locus-derived siRNAs in fruit flies, human cells and plants. At least in flies, their biogenesis depends on active transcription running towards the break. Since siRNAs derive from a double-stranded RNA precursor, a major question is how broken DNA ends can generate matching sense and antisense transcripts. We performed a genome-wide RNAi-screen in cultured Drosophila cells, which revealed that in addition to DNA repair factors, many spliceosome components are required for efficient siRNA generation. We validated this observation through site-specific DNA cleavage with CRISPR-cas9 followed by deep sequencing of small RNAs. DNA breaks in intron-less genes or upstream of a gene’s first intron did not efficiently trigger siRNA production. When DNA double-strand breaks were induced downstream of an intron, however, this led to robust siRNA generation. Furthermore, a downstream break slowed down splicing of the upstream intron and a detailed analysis of siRNA coverage at the targeted locus revealed that unspliced pre-mRNA contributes the sense strand to the siRNA precursor. Since splicing factors are stimulating the response but unspliced transcripts are entering the siRNA biogenesis, the spliceosome is apparently stalled in a pre-catalytic state and serves as a signaling hub. We conclude that convergent transcription at DNA breaks is stimulated by a splicing dependent control process. The resulting double-stranded RNA is converted into siRNAs that instruct the degradation of cognate mRNAs. In addition to a potential role in DNA repair, the break-induced transcription may thus be a means to cull improper RNAs from the transcriptome of Drosophila melanogaster. Since the splicing factors identified in our screen also stimulated siRNA production from high copy transgenes, it is possible that this surveillance mechanism serves in genome defense beyond DNA double-strand breaks. PMID:28628606
-
Heterochromatic siRNAs and DDM1 Independently Silence Aberrant 5S rDNA Transcripts in Arabidopsis
Blevins, Todd; Pontes, Olga; Pikaard, Craig S.; Meins, Frederick
2009-01-01
5S ribosomal RNA gene repeats are arranged in heterochromatic arrays (5S rDNA) situated near the centromeres of Arabidopsis chromosomes. The chromatin remodeling factor DDM1 is known to maintain 5S rDNA methylation patterns while silencing transcription through 5S rDNA intergenic spacers (IGS). We mapped small-interfering RNAs (siRNA) to a composite 5S rDNA repeat, revealing a high density of siRNAs matching silenced IGS transcripts. IGS transcript repression requires proteins of the heterochromatic siRNA pathway, including RNA polymerase IV (Pol IV), RNA-DEPENDENT RNA POLYMERASE 2 (RDR2) and DICER-LIKE 3 (DCL3). Using molecular and cytogenetic approaches, we show that the DDM1 and siRNA-dependent silencing effects are genetically independent. DDM1 suppresses production of the siRNAs, however, thereby limiting RNA-directed DNA methylation at 5S rDNA repeats. We conclude that DDM1 and siRNA-dependent silencing are overlapping processes that both repress aberrant 5S rDNA transcription and contribute to the heterochromatic state of 5S rDNA arrays. PMID:19529764
-
Branscheid, Anja; Marchais, Antonin; Schott, Gregory; Lange, Heike; Gagliardi, Dominique; Andersen, Stig Uggerhøj; Voinnet, Olivier; Brodersen, Peter
2015-12-15
Small regulatory RNAs are fundamental in eukaryotic and prokaryotic gene regulation. In plants, an important element of post-transcriptional control is effected by 20-24 nt microRNAs (miRNAs) and short interfering RNAs (siRNAs) bound to the ARGONAUTE1 (AGO1) protein in an RNA induced silencing complex (RISC). AGO1 may cleave target mRNAs with small RNA complementarity, but the fate of the resulting cleavage fragments remains incompletely understood. Here, we show that SKI2, SKI3 and SKI8, subunits of a cytoplasmic cofactor of the RNA exosome, are required for degradation of RISC 5', but not 3'-cleavage fragments in Arabidopsis. In the absence of SKI2 activity, many miRNA targets produce siRNAs via the RNA-dependent RNA polymerase 6 (RDR6) pathway. These siRNAs are low-abundant, and map close to the cleavage site. In most cases, siRNAs were produced 5' to the cleavage site, but several examples of 3'-spreading were also identified. These observations suggest that siRNAs do not simply derive from RDR6 action on stable 5'-cleavage fragments and hence that SKI2 has a direct role in limiting secondary siRNA production in addition to its function in mediating degradation of 5'-cleavage fragments. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
-
NASA Astrophysics Data System (ADS)
Jang, Mihue; Kim, Jong Hwan; Nam, Hae Yun; Kwon, Ick Chan; Ahn, Hyung Jun
2015-08-01
For therapeutic applications of siRNA, there are technical challenges with respect to targeted and systemic delivery. We here report a new siRNA carrier, RNAtr NPs, in a way that multiple tandem copies of RNA hairpins as a result of rolling circle transcription (RCT) can be readily adapted in tumour-targeted and systemic siRNA delivery. RNAtr NPs provide a means of condensing large amounts of multimeric RNA transcripts into the compact nanoparticles, especially without the aid of polycationic agents, and thus reduce the risk of immunogenicity and cytotoxicity by avoiding the use of synthetic polycationic reagents. This strategy allows the design of a platform technology for systemic delivery of siRNA to tumour sites, because RCT reaction, which enzymatically generates RNA polymers in multiple copy numbers at low cost, can lead to directly accessible routes to targeted and systemic delivery. Therefore, RNAtr NPs suggest great potentials as the siRNA therapeutics for cancer treatment.
-
Kasai, Megumi; Matsumura, Hideo; Yoshida, Kentaro; Terauchi, Ryohei; Taneda, Akito; Kanazawa, Akira
2013-01-30
Introduction of a transgene that transcribes RNA homologous to an endogenous gene in the plant genome can induce silencing of both genes, a phenomenon termed cosuppression. Cosuppression was first discovered in transgenic petunia plants transformed with the CHS-A gene encoding chalcone synthase, in which nonpigmented sectors in flowers or completely white flowers are produced. Some of the flower-color patterns observed in transgenic petunias having CHS-A cosuppression resemble those in existing nontransgenic varieties. Although the mechanism by which white sectors are generated in nontransgenic petunia is known to be due to RNA silencing of the CHS-A gene as in cosuppression, whether the same trigger(s) and/or pattern of RNA degradation are involved in these phenomena has not been known. Here, we addressed this question using deep-sequencing and bioinformatic analyses of small RNAs. We analyzed short interfering RNAs (siRNAs) produced in nonpigmented sectors of petal tissues in transgenic petunia plants that have CHS-A cosuppression and a nontransgenic petunia variety Red Star, that has naturally occurring CHS-A RNA silencing. In both silencing systems, 21-nt and 22-nt siRNAs were the most and the second-most abundant size classes, respectively. CHS-A siRNA production was confined to exon 2, indicating that RNA degradation through the RNA silencing pathway occurred in this exon. Common siRNAs were detected in cosuppression and naturally occurring RNA silencing, and their ranks based on the number of siRNAs in these plants were correlated with each other. Noticeably, highly abundant siRNAs were common in these systems. Phased siRNAs were detected in multiple phases at multiple sites, and some of the ends of the regions that produced phased siRNAs were conserved. The features of siRNA production found to be common to cosuppression and naturally occurring silencing of the CHS-A gene indicate mechanistic similarities between these silencing systems especially in the biosynthetic processes of siRNAs including cleavage of CHS-A transcripts and subsequent production of secondary siRNAs in exon 2. The data also suggest that these events occurred at multiple sites, which can be a feature of these silencing phenomena.
-
Rational design of micro-RNA-like bifunctional siRNAs targeting HIV and the HIV coreceptor CCR5.
Ehsani, Ali; Saetrom, Pål; Zhang, Jane; Alluin, Jessica; Li, Haitang; Snøve, Ola; Aagaard, Lars; Rossi, John J
2010-04-01
Small-interfering RNAs (siRNAs) and micro-RNAs (miRNAs) are distinguished by their modes of action. SiRNAs serve as guides for sequence-specific cleavage of complementary mRNAs and the targets can be in coding or noncoding regions of the target transcripts. MiRNAs inhibit translation via partially complementary base-pairing to 3' untranslated regions (UTRs) and are generally ineffective when targeting coding regions of a transcript. In this study, we deliberately designed siRNAs that simultaneously direct cleavage and translational suppression of HIV RNAs, or cleavage of the mRNA encoding the HIV coreceptor CCR5 and suppression of translation of HIV. These bifunctional siRNAs trigger inhibition of HIV infection and replication in cell culture. The design principles have wide applications throughout the genome, as about 90% of genes harbor sites that make the design of bifunctional siRNAs possible.
-
Genetic and Functional Diversification of Small RNA Pathways in Plants
Gustafson, Adam M; Kasschau, Kristin D; Lellis, Andrew D; Zilberman, Daniel; Jacobsen, Steven E
2004-01-01
Multicellular eukaryotes produce small RNA molecules (approximately 21–24 nucleotides) of two general types, microRNA (miRNA) and short interfering RNA (siRNA). They collectively function as sequence-specific guides to silence or regulate genes, transposons, and viruses and to modify chromatin and genome structure. Formation or activity of small RNAs requires factors belonging to gene families that encode DICER (or DICER-LIKE [DCL]) and ARGONAUTE proteins and, in the case of some siRNAs, RNA-dependent RNA polymerase (RDR) proteins. Unlike many animals, plants encode multiple DCL and RDR proteins. Using a series of insertion mutants of Arabidopsis thaliana, unique functions for three DCL proteins in miRNA (DCL1), endogenous siRNA (DCL3), and viral siRNA (DCL2) biogenesis were identified. One RDR protein (RDR2) was required for all endogenous siRNAs analyzed. The loss of endogenous siRNA in dcl3 and rdr2 mutants was associated with loss of heterochromatic marks and increased transcript accumulation at some loci. Defects in siRNA-generation activity in response to turnip crinkle virus in dcl2 mutant plants correlated with increased virus susceptibility. We conclude that proliferation and diversification of DCL and RDR genes during evolution of plants contributed to specialization of small RNA-directed pathways for development, chromatin structure, and defense. PMID:15024409
-
Bustos-Sanmamed, Pilar; Hudik, Elodie; Laffont, Carole; Reynes, Christelle; Sallet, Erika; Wen, Jiangqi; Mysore, Kirankumar S; Camproux, Anne-Claude; Hartmann, Caroline; Gouzy, Jérome; Frugier, Florian; Crespi, Martin; Lelandais-Brière, Christine
2014-12-01
RNA-dependent RNA polymerase 6 (RDR6) and suppressor of gene silencing 3 (SGS3) act together in post-transcriptional transgene silencing mediated by small interfering RNAs (siRNAs) and in biogenesis of various endogenous siRNAs including the tasiARFs, known regulators of auxin responses and plant development. Legumes, the third major crop family worldwide, has been widely improved through transgenic approaches. Here, we isolated rdr6 and sgs3 mutants in the model legume Medicago truncatula. Two sgs3 and one rdr6 alleles led to strong developmental defects and impaired biogenesis of tasiARFs. In contrast, the rdr6.1 homozygous plants produced sufficient amounts of tasiARFs to ensure proper development. High throughput sequencing of small RNAs from this specific mutant identified 354 potential MtRDR6 substrates, for which siRNA production was significantly reduced in the mutant. Among them, we found a large variety of novel phased loci corresponding to protein-encoding genes or transposable elements. Interestingly, measurement of GFP expression revealed that post-transcriptional transgene silencing was reduced in rdr6.1 roots. Hence, this novel mis-sense mutation, affecting a highly conserved amino acid residue in plant RDR6s, may be an interesting tool both to analyse endogenous pha-siRNA functions and to improve transgene expression, at least in legume species. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
-
Impact of target mRNA structure on siRNA silencing efficiency: A large-scale study.
Gredell, Joseph A; Berger, Angela K; Walton, S Patrick
2008-07-01
The selection of active siRNAs is generally based on identifying siRNAs with certain sequence and structural properties. However, the efficiency of RNA interference has also been shown to depend on the structure of the target mRNA, primarily through studies using exogenous transcripts with well-defined secondary structures in the vicinity of the target sequence. While these studies provide a means for examining the impact of target sequence and structure independently, the predicted secondary structures for these transcripts are often not reflective of structures that form in full-length, native mRNAs where interactions can occur between relatively remote segments of the mRNAs. Here, using a combination of experimental results and analysis of a large dataset, we demonstrate that the accessibility of certain local target structures on the mRNA is an important determinant in the gene silencing ability of siRNAs. siRNAs targeting the enhanced green fluorescent protein were chosen using a minimal siRNA selection algorithm followed by classification based on the predicted minimum free energy structures of the target transcripts. Transfection into HeLa and HepG2 cells revealed that siRNAs targeting regions of the mRNA predicted to have unpaired 5'- and 3'-ends resulted in greater gene silencing than regions predicted to have other types of secondary structure. These results were confirmed by analysis of gene silencing data from previously published siRNAs, which showed that mRNA target regions unpaired at either the 5'-end or 3'-end were silenced, on average, approximately 10% more strongly than target regions unpaired in the center or primarily paired throughout. We found this effect to be independent of the structure of the siRNA guide strand. Taken together, these results suggest minimal requirements for nucleation of hybridization between the siRNA guide strand and mRNA and that both mRNA and guide strand structure should be considered when choosing candidate siRNAs. (c) 2008 Wiley Periodicals, Inc.
-
Impact of target mRNA structure on siRNA silencing efficiency: a large-scale study
Gredell, Joseph A.; Berger, Angela K.; Walton, S. Patrick
2009-01-01
The selection of active siRNAs is generally based on identifying siRNAs with certain sequence and structural properties. However, the efficiency of RNA interference has also been shown to depend on the structure of the target mRNA, primarily through studies using exogenous transcripts with well-defined secondary structures in the vicinity of the target sequence. While these studies provide a means for examining the impact of target sequence and structure independently, the predicted secondary structures for these transcripts are often not reflective of structures that form in full-length, native mRNAs where interactions can occur between relatively remote segments of the mRNAs. Here, using a combination of experimental results and analysis of a large dataset, we demonstrate that the accessibility of certain local target structures on the mRNA is an important determinant in the gene silencing ability of siRNAs. siRNAs targeting the enhanced green fluorescent protein were chosen using a minimal siRNA selection algorithm followed by classification based on the predicted minimum free energy structures of the target transcripts. Transfection into HeLa and HepG2 cells revealed that siRNAs targeting regions of the mRNA predicted to have unpaired 5’- and 3’-ends resulted in greater gene silencing than regions predicted to have other types of secondary structure. These results were confirmed by analysis of gene silencing data from previously published siRNAs, which showed that mRNA target regions unpaired at either the 5’-end or 3’-end were silenced, on average, ~10% more strongly than target regions unpaired in the center or primarily paired throughout. We found this effect to be independent of the structure of the siRNA guide strand. Taken together, these results suggest minimal requirements for nucleation of hybridization between the siRNA guide strand and mRNA and that both mRNA and guide strand structure should be considered when choosing candidate siRNAs. PMID:18306428
-
The siRNA Non-seed Region and Its Target Sequences Are Auxiliary Determinants of Off-Target Effects.
Kamola, Piotr J; Nakano, Yuko; Takahashi, Tomoko; Wilson, Paul A; Ui-Tei, Kumiko
2015-12-01
RNA interference (RNAi) is a powerful tool for post-transcriptional gene silencing. However, the siRNA guide strand may bind unintended off-target transcripts via partial sequence complementarity by a mechanism closely mirroring micro RNA (miRNA) silencing. To better understand these off-target effects, we investigated the correlation between sequence features within various subsections of siRNA guide strands, and its corresponding target sequences, with off-target activities. Our results confirm previous reports that strength of base-pairing in the siRNA seed region is the primary factor determining the efficiency of off-target silencing. However, the degree of downregulation of off-target transcripts with shared seed sequence is not necessarily similar, suggesting that there are additional auxiliary factors that influence the silencing potential. Here, we demonstrate that both the melting temperature (Tm) in a subsection of siRNA non-seed region, and the GC contents of its corresponding target sequences, are negatively correlated with the efficiency of off-target effect. Analysis of experimentally validated miRNA targets demonstrated a similar trend, indicating a putative conserved mechanistic feature of seed region-dependent targeting mechanism. These observations may prove useful as parameters for off-target prediction algorithms and improve siRNA 'specificity' design rules.
-
Vickers, Timothy A; Crooke, Stanley T
2012-07-01
While most siRNAs induce sequence-specific target mRNA cleavage and degradation in a process mediated by Ago2/RNA-induced silencing complex (RISC), certain siRNAs have also been demonstrated to direct target RNA reduction through deadenylation and subsequent degradation of target transcripts in a process which involves Ago1/RISC and P-bodies. In the current study, we present data suggesting that a third class of siRNA exist, which are capable of promoting target RNA reduction that is independent of both Ago and RISC. These siRNAs bind the target messenger RNA at the polyA signal and are capable of redirecting a small amount of polyadenylation to downstream polyA sites when present, however, the majority of the activity appears to be due to inhibition of polyadenylation or deadenylation of the transcript, followed by exosomal degradation of the immature mRNA.
-
Poirier, Enzo Z; Goic, Bertsy; Tomé-Poderti, Lorena; Frangeul, Lionel; Boussier, Jérémy; Gausson, Valérie; Blanc, Hervé; Vallet, Thomas; Loyd, Hyelee; Levi, Laura I; Lanciano, Sophie; Baron, Chloé; Merkling, Sarah H; Lambrechts, Louis; Mirouze, Marie; Carpenter, Susan; Vignuzzi, Marco; Saleh, Maria-Carla
2018-03-14
The RNAi pathway confers antiviral immunity in insects. Virus-specific siRNA responses are amplified via the reverse transcription of viral RNA to viral DNA (vDNA). The nature, biogenesis, and regulation of vDNA are unclear. We find that vDNA produced during RNA virus infection of Drosophila and mosquitoes is present in both linear and circular forms. Circular vDNA (cvDNA) is sufficient to produce siRNAs that confer partially protective immunity when challenged with a cognate virus. cvDNAs bear homology to defective viral genomes (DVGs), and DVGs serve as templates for vDNA and cvDNA synthesis. Accordingly, DVGs promote the amplification of vDNA-mediated antiviral RNAi responses in infected Drosophila. Furthermore, vDNA synthesis is regulated by the DExD/H helicase domain of Dicer-2 in a mechanism distinct from its role in siRNA generation. We suggest that, analogous to mammalian RIG-I-like receptors, Dicer-2 functions like a pattern recognition receptor for DVGs to modulate antiviral immunity in insects. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
-
Vig, Komal; Lewis, Nuruddeen; Moore, Eddie G; Pillai, Shreekumar; Dennis, Vida A; Singh, Shree R
2009-11-01
RNA interference (RNAi) is a post-transcriptional, gene silencing mechanism which uses small interfering RNA molecules (siRNA) for gene silencing. Respiratory Syncytial Virus (RSV) is an important respiratory pathogen of medical significance that causes high mortality in infants. The fusion (F) protein of RSV is a good target for therapeutic purposes as it is primarily responsible for penetration of the virus into host cells and subsequent syncytium formation during infection. In the present study, four siRNAs were designed and used individually as well as a mixture, to silence the RSV F gene. The relationship between siRNA design, target RNA structure, and their thermodynamics was also investigated. Silencing of F gene was observed using indirect immunofluorescence, western blot, reverse transcription PCR, and progeny viral titers. Our results show F gene silencing by all the four siRNAs individually and collectively. RT-PCR analysis revealed a decrease in mRNA level which corresponded to decreased F protein expression. siRNAs also inhibited RSV progeny as shown by viral titer estimation on infected HEp-2 cells. The present study demonstrates the silencing of the F gene using siRNA. Thermodynamic characteristics of the target RSV mRNA and siRNA seem to play an important role in siRNA gene silencing efficiency.
-
[siRNAs with high specificity to the target: a systematic design by CRM algorithm].
Alsheddi, T; Vasin, L; Meduri, R; Randhawa, M; Glazko, G; Baranova, A
2008-01-01
'Off-target' silencing effect hinders the development of siRNA-based therapeutic and research applications. Common solution to this problem is an employment of the BLAST that may miss significant alignments or an exhaustive Smith-Waterman algorithm that is very time-consuming. We have developed a Comprehensive Redundancy Minimizer (CRM) approach for mapping all unique sequences ("targets") 9-to-15 nt in size within large sets of sequences (e.g. transcriptomes). CRM outputs a list of potential siRNA candidates for every transcript of the particular species. These candidates could be further analyzed by traditional "set-of-rules" types of siRNA designing tools. For human, 91% of transcripts are covered by candidate siRNAs with kernel targets of N = 15. We tested our approach on the collection of previously described experimentally assessed siRNAs and found that the correlation between efficacy and presence in CRM-approved set is significant (r = 0.215, p-value = 0.0001). An interactive database that contains a precompiled set of all human siRNA candidates with minimized redundancy is available at http://129.174.194.243. Application of the CRM-based filtering minimizes potential "off-target" silencing effects and could improve routine siRNA applications.
-
Analysis of hairpin RNA transgene-induced gene silencing in Fusarium oxysporum
2013-01-01
Background Hairpin RNA (hpRNA) transgenes can be effective at inducing RNA silencing and have been exploited as a powerful tool for gene function analysis in many organisms. However, in fungi, expression of hairpin RNA transcripts can induce post-transcriptional gene silencing, but in some species can also lead to transcriptional gene silencing, suggesting a more complex interplay of the two pathways at least in some fungi. Because many fungal species are important pathogens, RNA silencing is a powerful technique to understand gene function, particularly when gene knockouts are difficult to obtain. We investigated whether the plant pathogenic fungus Fusarium oxysporum possesses a functional gene silencing machinery and whether hairpin RNA transcripts can be employed to effectively induce gene silencing. Results Here we show that, in the phytopathogenic fungus F. oxysporum, hpRNA transgenes targeting either a β-glucuronidase (Gus) reporter transgene (hpGus) or the endogenous gene Frp1 (hpFrp) did not induce significant silencing of the target genes. Expression analysis suggested that the hpRNA transgenes are prone to transcriptional inactivation, resulting in low levels of hpRNA and siRNA production. However, the hpGus RNA can be efficiently transcribed by promoters acquired either by recombination with a pre-existing, actively transcribed Gus transgene or by fortuitous integration near an endogenous gene promoter allowing siRNA production. These siRNAs effectively induced silencing of a target Gus transgene, which in turn appeared to also induce secondary siRNA production. Furthermore, our results suggested that hpRNA transcripts without poly(A) tails are efficiently processed into siRNAs to induce gene silencing. A convergent promoter transgene, designed to express poly(A)-minus sense and antisense Gus RNAs, without an inverted-repeat DNA structure, induced consistent Gus silencing in F. oxysporum. Conclusions These results indicate that F. oxysporum possesses functional RNA silencing machineries for siRNA production and target mRNA cleavage, but hpRNA transgenes may induce transcriptional self-silencing due to its inverted-repeat structure. Our results suggest that F. oxysporum possesses a similar gene silencing pathway to other fungi like fission yeast, and indicate a need for developing more effective RNA silencing technology for gene function studies in this fungal pathogen. PMID:23819794
-
Identification of Potential Therapeutic Mechanisms for HIP1 Inhibition in Breast Cancer
2006-05-01
repressing transcription when knocked down using a silencing RNA approach and activating tran- scription when overexpressed. We have also identified a...HIP1, huntingtin interacting protein 1; PSA, prostate-specific antigen; siRNA, silencing RNA . The online version of this article includes supplemental...We examined whether endogenous HIP1 was also required to sustain AR transcriptional activity by taking a silencing RNA (siRNA) approach to knockdown
-
Revisiting Criteria for Plant MicroRNA Annotation in the Era of Big Data[OPEN
2018-01-01
MicroRNAs (miRNAs) are ∼21-nucleotide-long regulatory RNAs that arise from endonucleolytic processing of hairpin precursors. Many function as essential posttranscriptional regulators of target mRNAs and long noncoding RNAs. Alongside miRNAs, plants also produce large numbers of short interfering RNAs (siRNAs), which are distinguished from miRNAs primarily by their biogenesis (typically processed from long double-stranded RNA instead of single-stranded hairpins) and functions (typically via roles in transcriptional regulation instead of posttranscriptional regulation). Next-generation DNA sequencing methods have yielded extensive data sets of plant small RNAs, resulting in many miRNA annotations. However, it has become clear that many miRNA annotations are questionable. The sheer number of endogenous siRNAs compared with miRNAs has been a major factor in the erroneous annotation of siRNAs as miRNAs. Here, we provide updated criteria for the confident annotation of plant miRNAs, suitable for the era of “big data” from DNA sequencing. The updated criteria emphasize replication and the minimization of false positives, and they require next-generation sequencing of small RNAs. We argue that improved annotation systems are needed for miRNAs and all other classes of plant small RNAs. Finally, to illustrate the complexities of miRNA and siRNA annotation, we review the evolution and functions of miRNAs and siRNAs in plants. PMID:29343505
-
Global effects of the CSR-1 RNA interference pathway on transcriptional landscape
Cecere, Germano; Hoersch, Sebastian; O’Keeffe, Sean; Sachidanandam, Ravi; Grishok, Alla
2014-01-01
Argonaute proteins and their small RNA co-factors short interfering RNAs (siRNAs) are known to inhibit gene expression at the transcriptional and post-transcriptional levels. In Caenorhabditis elegans, the Argonaute CSR-1 binds thousands of endogenous siRNAs (endo-siRNAs) antisense to germline transcripts and associates with chromatin in a siRNA-dependent manner. However, its role in gene expression regulation remains controversial. Here, we used a genome-wide profiling of nascent RNA transcripts to demonstrate that the CSR-1 RNAi pathway promotes sense-oriented Pol II transcription. Moreover, a loss of CSR-1 function resulted in global increase in antisense transcription and ectopic transcription of silent chromatin domains, which led to reduced chromatin incorporation of centromere-specific histone H3. Based on these findings, we propose that the CSR-1 pathway has a role in maintaining the directionality of active transcription thereby propagating the distinction between transcriptionally active and silent genomic regions. PMID:24681887
-
Yamaguchi, Rui; Sakamoto, Arisa; Yamaguchi, Reona; Haraguchi, Misa; Narahara, Shinji; Sugiuchi, Hiroyuki; Yamaguchi, Yasuo
2018-08-01
The stimuli inducing expression of single immunoglobulin IL-1-related receptor (SIGIRR) and the relevant regulatory mechanisms are not well defined. Transforming growth factor β1 (TGFβ1) delays internalization of neurokinin-1 receptor (NK1R) and subsequently enhances cellular signaling. This study investigated the effect of TGFβ1 on SIGIRR protein production by human M1 macrophages in response to stimulation with substance P (SP). SP caused upregulation of SIGIRR expression in a concentration-dependent manner, whereas aprepitant (an NK1R inhibitor) blunted this response. Silencing p38γMAPK or TAK-1 partially attenuated the response to SP stimulation, while TGFβ1/2/3 siRNA dramatically diminished it. SP induced much greater SIGIRR protein production than either lipopolysaccharide (a TLR4 agonist) or resiquimod (a TLR7/8 agonist). Unexpectedly, silencing of transcription factor specificity protein 1 (Sp1) led to significant upregulation of SIGIRR expression after SP stimulation, while KLF2 siRNA only partially enhanced it and Fli-1 siRNA reduced it. SP also upregulated TGFβ1 expression, along with a corresponding increase of SIGIRR protein, whereas silencing TGFβ1/2/3 blunted these responses. Sp1 siRNA or mithramycin (a gene-selective Sp1 inhibitor) significantly enhanced the expression of TGFβ1 and SIGIRR by macrophages after SP stimulation. Importantly, this effect of Sp1 siRNA on TGFβ1 and SIGIRR was blunted by siRNA for Smad2, Smad3, or Smad4, but not by TAK-1 siRNA. Next, we investigated the influence of transcription factor cross-talk on SIGIRR expression in response to SP. Co-transfection of macrophages with Sp1 siRNA and C/EBPβ or TIF1β siRNA attenuated the upregulation of SIGIRR by SP, while a combination of Sp1 siRNA and Fli-1 siRNA dramatically diminished it. In conclusion, TGFβ1 may be an intermediary between SP/NK1R activation and SIGIRR expression in Sp1 siRNA-transfected macrophages. In addition, Sp1 modulates TGFβ1/Smad signaling and negatively regulates SIGIRR protein production by macrophages after SP stimulation. Copyright © 2018 Elsevier Ltd. All rights reserved.
-
Chimeric peptide-mediated siRNA transduction to inhibit HIV-1 infection.
Bivalkar-Mehla, Shalmali; Mehla, Rajeev; Chauhan, Ashok
2017-04-01
Persistent human immunodeficiency virus 1 (HIV-1) infection provokes immune activation and depletes CD4 + lymphocytes, leading to acquired immunodeficiency syndrome. Uninterrupted administration of combination antiretroviral therapy (cART) in HIV-infected patients suppresses viral replication to below the detectable level and partially restores the immune system. However, cART-unresponsive residual HIV-1 infection and elusive transcriptionally silent but reactivatable viral reservoirs maintain a permanent viral DNA blue print. The virus rebounds within a few weeks after interruption of suppressive therapy. Adjunct gene therapy to control viral replication by ribonucleic acid interference (RNAi) is a post-transcriptional gene silencing strategy that could suppress residual HIV-1 burden and overcome viral resistance. Small interfering ribonucleic acids (siRNAs) are efficient transcriptional inhibitors, but need delivery systems to reach inside target cells. We investigated the potential of chimeric peptide (FP-PTD) to deliver specific siRNAs to HIV-1-susceptible and permissive cells. Chimeric FP-PTD peptide was designed with an RNA binding domain (PTD) to bind siRNA and a cell fusion peptide domain (FP) to enter cells. FP-PTD-siRNA complex entered and inhibited HIV-1 replication in susceptible cells, and could be a candidate for in vivo testing.
-
Lu, Sha; Yin, Xiaoyan; Spollen, William; Zhang, Ning; Xu, Dong; Schoelz, James; Bilyeu, Kristin; Zhang, Zhanyuan J
2015-01-01
In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.
-
Analysis of energetically biased transcripts of viruses and transposable elements
Secolin, Rodrigo; Pascoal, Vinícius D’Ávila Bitencourt; Lopes-Cendes, Iscia; Pereira, Tiago Campos
2012-01-01
RNA interference (RNAi) is a natural endogenous process by which double-stranded RNA molecules trigger potent and specific gene silencing in eukaryotic cells and is characterized by target RNA cleavage. In mammals, small interfering RNAs (siRNAs) are the trigger molecules of choice and constitute a new class of RNA-based antiviral agents. In an efficient RNAi response, the antisense strand of siRNAs must enter the RNA-induced silencing complex (RISC) in a process mediated by thermodynamic features. In this report, we hypothesize that silent mutations capable of inverting thermodynamic properties can promote resistance to siRNAs. Extensive computational analyses were used to assess whether continuous selective pressure that promotes such mutations could lead to the emergence of viral strains completely resistant to RNAi (i.e., prone to transfer only the sense strands to RISC). Based on our findings, we propose that, although synonymous mutations may produce functional resistance, this strategy cannot be systematically adopted by viruses since the longest RNAi-refractory sequence is only 10 nt long. This finding also suggests that all mRNAs display fluctuating thermodynamic landscapes and that, in terms of thermodynamic features, RNAi is a very efficient antiviral system since there will always be sites susceptible to siRNAs. PMID:23271949
-
Liu, Wanlu; Duttke, Sascha H; Hetzel, Jonathan; Groth, Martin; Feng, Suhua; Gallego-Bartolome, Javier; Zhong, Zhenhui; Kuo, Hsuan Yu; Wang, Zonghua; Zhai, Jixian; Chory, Joanne; Jacobsen, Steven E
2018-03-01
Small RNAs regulate chromatin modifications such as DNA methylation and gene silencing across eukaryotic genomes. In plants, RNA-directed DNA methylation (RdDM) requires 24-nucleotide small interfering RNAs (siRNAs) that bind to ARGONAUTE 4 (AGO4) and target genomic regions for silencing. RdDM also requires non-coding RNAs transcribed by RNA polymerase V (Pol V) that probably serve as scaffolds for binding of AGO4-siRNA complexes. Here, we used a modified global nuclear run-on protocol followed by deep sequencing to capture Pol V nascent transcripts genome-wide. We uncovered unique characteristics of Pol V RNAs, including a uracil (U) common at position 10. This uracil was complementary to the 5' adenine found in many AGO4-bound 24-nucleotide siRNAs and was eliminated in a siRNA-deficient mutant as well as in the ago4/6/9 triple mutant, suggesting that the +10 U signature is due to siRNA-mediated co-transcriptional slicing of Pol V transcripts. Expression of wild-type AGO4 in ago4/6/9 mutants was able to restore slicing of Pol V transcripts, but a catalytically inactive AGO4 mutant did not correct the slicing defect. We also found that Pol V transcript slicing required SUPPRESSOR OF TY INSERTION 5-LIKE (SPT5L), an elongation factor whose function is not well understood. These results highlight the importance of Pol V transcript slicing in RNA-mediated transcriptional gene silencing, which is a conserved process in many eukaryotes.
-
Hu, Hongtao; Rashotte, Aaron M; Singh, Narendra K; Weaver, David B; Goertzen, Leslie R; Singh, Shree R; Locy, Robert D
2015-01-01
MicroRNAs (miRNAs) and secondary small interfering RNAs (principally phased siRNAs or trans-acting siRNAs) are two distinct subfamilies of small RNAs (sRNAs) that are emerging as key regulators of posttranscriptional gene expression in plants. Both miRNAs and secondary-siRNAs (sec-siRNAs) are processed from longer RNA precursors by DICER-LIKE proteins (DCLs). Gossypium arboreum L., also known as tree cotton or Asian cotton, is a diploid, possibly ancestral relative of tetraploid Gossypium hirsutum L., the predominant type of commercially grown cotton worldwide known as upland cotton. To understand the biological significance of these gene regulators in G. arboreum, a bioinformatics analysis was performed on G. arboreum small RNAs produced from G. arboreum leaf, flower, and boll tissues. Consequently, 263 miRNAs derived from 353 precursors, including 155 conserved miRNAs (cs-miRNAs) and 108 novel lineage-specific miRNAs (ls-miRNAs). Along with miRNAs, 2,033 miRNA variants (isomiRNAs) were identified as well. Those isomiRNAs with variation at the 3'-miRNA end were expressed at the highest levels, compared to other types of variants. In addition, 755 pha-siRNAs derived 319 pha-siRNA gene transcripts (PGTs) were identified, and the potential pha-siRNA initiators were predicted. Also, 2,251 non-phased siRNAs were found as well, of which 1,088 appeared to be produced by so-called cis- or trans-cleavage of the PGTs observed at positions differing from pha-siRNAs. Of those sRNAs, 148 miRNAs/isomiRNAs and 274 phased/non-phased siRNAs were differentially expressed in one or more pairs of tissues examined. Target analysis revealed that target genes for both miRNAs and pha-siRNAs are involved a broad range of metabolic and enzymatic activities. We demonstrate that secondary siRNA production could result from initial cleavage of precursors by both miRNAs or isomiRNAs, and that subsequently produced phased and unphased siRNAs could result that also serve as triggers of a second round of both cis- and trans-cleavage of additional siRNAs, leading to the formation of complex sRNA regulatory networks mediating posttranscriptional gene silencing. Results from this study extended our knowledge on G. arboreum sRNAs and their biological importance, which would facilitate future studies on regulatory mechanism of tissue development in cotton and other plant species.
-
RNA interference technology to control pest sea lampreys--a proof-of-concept.
Heath, George; Childs, Darcy; Docker, Margaret F; McCauley, David W; Whyard, Steven
2014-01-01
The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0-fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species.
-
RNA Interference Technology to Control Pest Sea Lampreys - A Proof-of-Concept
Heath, George; Childs, Darcy; Docker, Margaret F.; McCauley, David W.; Whyard, Steven
2014-01-01
The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0–fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species. PMID:24505485
-
Ni, Julie Zhouli; Kalinava, Natallia; Chen, Esteban; Huang, Alex; Trinh, Thi; Gu, Sam Guoping
2016-01-01
Environmental stress-induced transgenerational epigenetic effects have been observed in various model organisms and human. The capacity and mechanism of such phenomena are poorly understood. In C. elegans, siRNA mediates transgenerational gene silencing through the germline nuclear RNAi pathway. This pathway is also required to maintain the germline immortality when C. elegans is under heat stress. However, the underlying molecular mechanism is unknown. In this study, we investigated the impact of heat stress on chromatin, transcription, and siRNAs at the whole-genome level, and whether any of the heat-induced effects is transgenerationally heritable in either the wild-type or the germline nuclear RNAi mutant animals. We performed 12-generation temperature-shift experiments using the wild-type C. elegans and a mutant strain that lacks the germline-specific nuclear Argonaute protein HRDE-1/WAGO-9. By examining the mRNA, small RNA, RNA polymerase II, and H3K9 trimethylation profiles at the whole-genome level, we revealed an epigenetic role of HRDE-1 in repressing heat stress-induced transcriptional activation of over 280 genes. Many of these genes are in or near LTR (long-terminal repeat) retrotransposons. Strikingly, for some of these genes, the heat stress-induced transcriptional activation in the hrde-1 mutant intensifies in the late generations under the heat stress and is heritable for at least two generations after the mutant animals are shifted back to lower temperature. hrde-1 mutation also leads to siRNA expression changes of many genes. This effect on siRNA is dependent on both the temperature and generation. Our study demonstrated that a large number of the endogenous targets of the germline nuclear RNAi pathway in C. elegans are sensitive to heat-induced transcriptional activation. This effect at certain genomic loci including LTR retrotransposons is transgenerational. Germline nuclear RNAi antagonizes this temperature effect at the transcriptional level and therefore may play a key role in heat stress response in C. elegans.
-
Prediction of siRNA potency using sparse logistic regression.
Hu, Wei; Hu, John
2014-06-01
RNA interference (RNAi) can modulate gene expression at post-transcriptional as well as transcriptional levels. Short interfering RNA (siRNA) serves as a trigger for the RNAi gene inhibition mechanism, and therefore is a crucial intermediate step in RNAi. There have been extensive studies to identify the sequence characteristics of potent siRNAs. One such study built a linear model using LASSO (Least Absolute Shrinkage and Selection Operator) to measure the contribution of each siRNA sequence feature. This model is simple and interpretable, but it requires a large number of nonzero weights. We have introduced a novel technique, sparse logistic regression, to build a linear model using single-position specific nucleotide compositions which has the same prediction accuracy of the linear model based on LASSO. The weights in our new model share the same general trend as those in the previous model, but have only 25 nonzero weights out of a total 84 weights, a 54% reduction compared to the previous model. Contrary to the linear model based on LASSO, our model suggests that only a few positions are influential on the efficacy of the siRNA, which are the 5' and 3' ends and the seed region of siRNA sequences. We also employed sparse logistic regression to build a linear model using dual-position specific nucleotide compositions, a task LASSO is not able to accomplish well due to its high dimensional nature. Our results demonstrate the superiority of sparse logistic regression as a technique for both feature selection and regression over LASSO in the context of siRNA design.
-
Mishra, Swati; Vaughn, Asa D.; Devore, David I.
2015-01-01
Heterotopic ossification (HO) associated with traumatic neurological or musculoskeletal injuries remains a major clinical challenge. One approach to understanding better and potentially treating this condition is to silence one or more genes believed to be responsible for osteogenesis by small interfering RNA (siRNA) post-injury. Improved methods of delivering siRNA to myoprogenitor cells as well as relevant cell culture models of HO are needed to advance this approach. We utilize a model of HO featuring C2C12 myoprogenitor cells stimulated to the osteogenic phenotype by addition of BMP-2. For siRNA delivery, we utilize a nanocomposite consisting of DOTAP- based cationic liposomes coated with a graft copolymer of poly(propylacrylic acid) grafted with polyetheramine (Jeffamine), as this system has been shown previously to deliver antisense oligonucleotides safely into cells and out of endosomes for gene silencing in vitro and in vivo. Delivery of siRNA targeting Runx2, a transcription factor downstream of BMP-2, to stimulated C2C12 cells produced greater than 60% down-regulation of the Runx2 gene. This level of gene silencing was sufficient to inhibit alkaline phosphatase activity over the course of several days and calcium phosphate deposition over the course of 2 weeks. These results show the utility of the BMP-2/C2C12 model for capturing the cellular cell-fate decision in HO. Further, they suggest DOTAP/PPAA-g-Jeffamine as a promising delivery system for siRNA– based therapy for HO. PMID:23146945
-
Environmental RNAi in herbivorous insects.
Ivashuta, Sergey; Zhang, Yuanji; Wiggins, B Elizabeth; Ramaseshadri, Partha; Segers, Gerrit C; Johnson, Steven; Meyer, Steve E; Kerstetter, Randy A; McNulty, Brian C; Bolognesi, Renata; Heck, Gregory R
2015-05-01
Environmental RNAi (eRNAi) is a sequence-specific regulation of endogenous gene expression in a receptive organism by exogenous double-stranded RNA (dsRNA). Although demonstrated under artificial dietary conditions and via transgenic plant presentations in several herbivorous insects, the magnitude and consequence of exogenous dsRNA uptake and the role of eRNAi remains unknown under natural insect living conditions. Our analysis of coleopteran insects sensitive to eRNAi fed on wild-type plants revealed uptake of plant endogenous long dsRNAs, but not small RNAs. Subsequently, the dsRNAs were processed into 21 nt siRNAs by insects and accumulated in high quantities in insect cells. No accumulation of host plant-derived siRNAs was observed in lepidopteran larvae that are recalcitrant to eRNAi. Stability of ingested dsRNA in coleopteran larval gut followed by uptake and transport from the gut to distal tissues appeared to be enabling factors for eRNAi. Although a relatively large number of distinct coleopteran insect-processed plant-derived siRNAs had sequence complementarity to insect transcripts, the vast majority of the siRNAs were present in relatively low abundance, and RNA-seq analysis did not detect a significant effect of plant-derived siRNAs on insect transcriptome. In summary, we observed a broad genome-wide uptake of plant endogenous dsRNA and subsequent processing of ingested dsRNA into 21 nt siRNAs in eRNAi-sensitive insects under natural feeding conditions. In addition to dsRNA stability in gut lumen and uptake, dosage of siRNAs targeting a given insect transcript is likely an important factor in order to achieve measurable eRNAi-based regulation in eRNAi-competent insects that lack an apparent silencing amplification mechanism. © 2015 Ivashuta et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
-
Hydrophobization and bioconjugation for enhanced siRNA delivery and targeting
De Paula, Daniel; Bentley, M. Vitória L.B.; Mahato, Ram I.
2007-01-01
RNA interference (RNAi) is an evolutionarily conserved process by which double-stranded small interfering RNA (siRNA) induces sequence-specific, post-transcriptional gene silencing. Unlike other mRNA targeting strategies, RNAi takes advantage of the physiological gene silencing machinery. The potential use of siRNA as therapeutic agents has attracted great attention as a novel approach for treating severe and chronic diseases. RNAi can be achieved by either delivery of chemically synthesized siRNAs or endogenous expression of small hairpin RNA, siRNA, and microRNA (miRNA). However, the relatively high dose of siRNA required for gene silencing limits its therapeutic applications. This review discusses several strategies to improve therapeutic efficacy as well as to abrogate off-target effects and immunostimulation caused by siRNAs. There is an in-depth discussion on various issues related to the (1) mechanisms of RNAi, (2) methods of siRNA production, (3) barriers to RNAi-based therapies, (4) biodistribution, (5) design of siRNA molecules, (6) chemical modification and bioconjugation, (7) complex formation with lipids and polymers, (8) encapsulation into lipid particles, and (9) target specificity for enhanced therapeutic effectiveness. PMID:17329355
-
Hypoxia preconditioning protection of corneal stromal cells requires HIF1alpha but not VEGF.
Xing, Dongmei; Bonanno, Joseph A
2009-05-18
Hypoxia preconditioning protects corneal stromal cells from stress-induced death. This study determined whether the transcription factor HIF-1alpha (Hypoxia Inducible Factor) is responsible and whether this is promulgated by VEGF (Vascular Endothelial Growth Factor). Cultured bovine stromal cells were preconditioned with hypoxia in the presence of cadmium chloride, a chemical inhibitor of HIF-1alpha, and HIF-1alpha siRNA to test if HIF-1alpha activity is needed for hypoxia preconditioning protection from UV-irradiation induced cell death. TUNEL assay was used to detect cell apoptosis after UV-irradiation. RT-PCR and western blot were used to detect the presence of HIF-1alpha and VEGF in transcriptional and translational levels. During hypoxia (0.5% O2), 5 muM cadmium chloride completely inhibited HIF-1alpha expression and reversed the protection by hypoxia preconditioning. HIF-1alpha siRNA (15 nM) reduced HIF-1alpha expression by 90% and produced a complete loss of protection provided by hypoxia preconditioning. Since VEGF is induced by hypoxia, can be HIF-1alpha dependent, and is often protective, we examined the changes in transcription of VEGF and its receptors after 4 h of hypoxia preconditioning. VEGF and its receptors Flt-1 and Flk-1 are up-regulated after hypoxia preconditioning. However, the transcription and translation of VEGF were paradoxically increased by siHIF-1alpha, suggesting that VEGF expression in stromal cells is not down-stream of HIF-1alpha. These findings demonstrate that hypoxia preconditioning protection in corneal stromal cells requires HIF-1alpha, but that VEGF is not a component of the protection.
-
Novel targeted therapy for neuroblastoma: silencing the MXD3 gene using siRNA.
Duong, Connie; Yoshida, Sakiko; Chen, Cathy; Barisone, Gustavo; Diaz, Elva; Li, Yueju; Beckett, Laurel; Chung, Jong; Antony, Reuben; Nolta, Jan; Nitin, Nitin; Satake, Noriko
2017-09-01
BackgroundNeuroblastoma is the second most common extracranial cancer in children. Current therapies for neuroblastoma, which use a combination of chemotherapy drugs, have limitations for high-risk subtypes and can cause significant long-term adverse effects in young patients. Therefore, a new therapy is needed. In this study, we investigated the transcription factor MXD3 as a potential therapeutic target in neuroblastoma.MethodsMXD3 expression was analyzed in five neuroblastoma cell lines by immunocytochemistry and quantitative real-time reverse transcription PCR, and in 18 primary patient tumor samples by immunohistochemistry. We developed nanocomplexes using siRNA and superparamagnetic iron oxide nanoparticles to target MXD3 in neuroblastoma cell lines in vitro as a single-agent therapeutic and in combination with doxorubicin, vincristine, cisplatin, or maphosphamide-common drugs used in current neuroblastoma treatment.ResultsMXD3 was highly expressed in neuroblastoma cell lines and in patient tumors that had high-risk features. Neuroblastoma cells treated in vitro with the MXD3 siRNA nanocomplexes showed MXD3 protein knockdown and resulted in cell apoptosis. Furthermore, on combining MXD3 siRNA nanocomplexes with each of the four drugs, all showed additive efficacy.ConclusionThese results indicate that MXD3 is a potential new target and that the use of MXD3 siRNA nanocomplexes is a novel therapeutic approach for neuroblastoma.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wierzbicki, A. T.; Cocklin, Ross; Mayampurath, Anoop
2012-08-15
Multisubunit RNA polymerases IV and V (Pols IV and V) mediate RNA-directed DNA methylation and transcriptional silencing of retrotransposons and heterochromatic repeats in plants. We identified genomic sites of Pol V occupancy in parallel with siRNA deep sequencing and methylcytosine mapping, comparing wild-type plants with mutants defective for Pol IV, Pol V, or both Pols IV and V. Approximately 60% of Pol V-associated regions encompass regions of 24-nucleotide (nt) siRNA complementarity and cytosine methylation, consistent with cytosine methylation being guided by base-pairing of Pol IV-dependent siRNAs with Pol V transcripts. However, 27% of Pol V peaks do not overlap sitesmore » of 24-nt siRNA biogenesis or cytosine methylation, indicating that Pol V alone does not specify sites of cytosine methylation. Surprisingly, the number of methylated CHH motifs, a hallmark of RNA-directed de novo methylation, is similar in wild-type plants and Pol IV or Pol V mutants. In the mutants, methylation is lost at 50%-60% of the CHH sites that are methylated in the wild type but is gained at new CHH positions, primarily in pericentromeric regions. These results indicate that Pol IV and Pol V are not required for cytosine methyltransferase activity but shape the epigenome by guiding CHH methylation to specific genomic sites.« less
-
Celton, Jean-Marc; Gaillard, Sylvain; Bruneau, Maryline; Pelletier, Sandra; Aubourg, Sébastien; Martin-Magniette, Marie-Laure; Navarro, Lionel; Laurens, François; Renou, Jean-Pierre
2014-07-01
Characterizing the transcriptome of eukaryotic organisms is essential for studying gene regulation and its impact on phenotype. The realization that anti-sense (AS) and noncoding RNA transcription is pervasive in many genomes has emphasized our limited understanding of gene transcription and post-transcriptional regulation. Numerous mechanisms including convergent transcription, anti-correlated expression of sense and AS transcripts, and RNAi remain ill-defined. Here, we have combined microarray analysis and high-throughput sequencing of small RNAs (sRNAs) to unravel the complexity of transcriptional and potential post-transcriptional regulation in eight organs of apple (Malus × domestica). The percentage of AS transcript expression is higher than that identified in annual plants such as rice and Arabidopsis thaliana. Furthermore, we show that a majority of AS transcripts are transcribed beyond 3'UTR regions, and may cover a significant portion of the predicted sense transcripts. Finally we demonstrate at a genome-wide scale that anti-sense transcript expression is correlated with the presence of both short (21-23 nt) and long (> 30 nt) siRNAs, and that the sRNA coverage depth varies with the level of AS transcript expression. Our study provides a new insight on the functional role of anti-sense transcripts at the genome-wide level, and a new basis for the understanding of sRNA biogenesis in plants. © 2014 INRA. New Phytologist © 2014 New Phytologist Trust.
-
Hegde, Vikas; Hickerson, Robyn P; Nainamalai, Sitheswaran; Campbell, Paul A; Smith, Frances J D; McLean, W H Irwin; Pedrioli, Deena M Leslie
2014-12-28
Therapeutics based on short interfering RNAs (siRNAs), which act by inhibiting the expression of target transcripts, represent a novel class of potent and highly specific next-generation treatments for human skin diseases. Unfortunately, the intrinsic barrier properties of the skin combined with the large size and negative charge of siRNAs make epidermal delivery of these macromolecules quite challenging. To help evaluate the in vivo activity of these therapeutics and refine delivery strategies we generated an innovative reporter mouse model that predominantly expresses firefly luciferase (luc2p) in the paw epidermis--the region of murine epidermis that most closely models the tissue architecture of human skin. Combining this animal model with state-of-the-art live animal imaging techniques, we have developed a real-time in vivo analysis work-flow that has allowed us to compare and contrast the efficacies of a wide range nucleic acid-based gene silencing reagents in the skin of live animals. While inhibition was achieved with all of the reagents tested, only the commercially available "self-delivery" modified Accell-siRNAs (Dharmacon) produced potent and sustained in vivo gene silencing. Together, these findings highlight just how informative reliable reporter mouse models can be when assessing novel therapeutics in vivo. Using this work-flow, we developed a novel clinically-relevant topical formulation that facilitates non-invasive epidermal delivery of unmodified and "self-delivery" siRNAs. Remarkably, a sustained >40% luc2p inhibition was observed after two 1-hour treatments with Accell-siRNAs in our topical formulation. Importantly, our ability to successfully deliver siRNA molecules topically brings these novel RNAi-based therapeutics one-step closer to clinical use. Crown Copyright © 2014. Published by Elsevier B.V. All rights reserved.
-
Flusin, Olivier; Vigne, Solenne; Peyrefitte, Christophe N; Bouloy, Michèle; Crance, Jean-Marc; Iseni, Frédéric
2011-05-21
The genus Nairovirus in the family Bunyaviridae contains 34 tick-borne viruses classified into seven serogroups. Hazara virus (HAZV) belongs to the Crimean-Congo hemorrhagic fever (CCHF) serogroup that also includes CCHF virus (CCHFV) a major pathogen for humans. HAZV is an interesting model to study CCHFV due to a close serological and phylogenetical relationship and a classification which allows handling in a BSL2 laboratory. Nairoviruses are characterized by a tripartite negative-sense single stranded RNA genome (named L, M and S segments) that encode the RNA polymerase, the Gn-Gc glycoproteins and the nucleoprotein (NP), respectively. Currently, there are neither vaccines nor effective therapies for the treatment of any bunyavirus infection in humans. In this study we report, for the first time, the use of RNA interference (RNAi) as an approach to inhibit nairovirus replication. Chemically synthesized siRNAs were designed to target the mRNA produced by the three genomic segments. We first demonstrated that the siRNAs targeting the NP mRNA displayed a stronger antiviral effect than those complementary to the L and M transcripts in A549 cells. We further characterized the two most efficient siRNAs showing, that the induced inhibition is specific and associated with a decrease in NP synthesis during HAZV infection. Furthermore, both siRNAs depicted an antiviral activity when used before and after HAZV infection. We next showed that HAZV was sensitive to ribavirin which is also known to inhibit CCHFV. Finally, we demonstrated the additive or synergistic antiviral effect of siRNAs used in combination with ribavirin. Our study highlights the interest of using RNAi (alone or in combination with ribavirin) to treat nairovirus infection. This approach has to be considered for the development of future antiviral compounds targeting CCHFV, the most pathogenic nairovirus.
-
Tan, Martha; Vernes, Jean-Michel; Chan, Joyce; Cuellar, Trinna L; Asundi, Aarati; Nelson, Christopher; Yip, Victor; Shen, Ben; Vandlen, Richard; Siebel, Christian; Meng, Y Gloria
2012-11-15
Short interfering RNA (siRNA) has therapeutic potential. However, efficient delivery is a formidable task. To facilitate delivery of siRNA into cells, we covalently conjugated siRNA to antibodies that bind to cell surface proteins and internalize. Understanding how these antibody-siRNA conjugates function in vivo requires pharmacokinetic analysis. Thus, we developed a simple real-time antigen capture reverse transcription-polymerase chain reaction (RT-PCR) assay to detect intact antibody-siRNA conjugates. Biotinylated antigen bound to streptavidin-coated PCR tubes was used to capture antibody-siRNA conjugate. The captured antibody-siRNA conjugate was then reverse-transcribed in the same tube, avoiding a sample transfer step. This reproducible assay had a wide standard curve range of 0.029 to 480ng/ml and could detect as low as 0.58ng/ml antibody-siRNA conjugates in mouse serum. The presence of unconjugated antibody that could be generated from siRNA degradation in vivo did not affect the assay as long as the total antibody concentration in the antigen capture step did not exceed 480ng/ml. Using this assay, we observed a more rapid decrease in serum antibody-siRNA conjugate concentrations than the total antibody concentrations in mice dosed with antibody-siRNA conjugates, suggesting loss of siRNA from the antibody. This assay is useful for optimizing antibody-siRNA and likely aptamer-siRNA conjugates to improve pharmacokinetics and aid siRNA delivery. Copyright © 2012 Elsevier Inc. All rights reserved.
-
siRNA Versus miRNA as Therapeutics for Gene Silencing
Lam, Jenny K W; Chow, Michael Y T; Zhang, Yu; Leung, Susan W S
2015-01-01
Discovered a little over two decades ago, small interfering RNAs (siRNAs) and microRNAs (miRNAs) are noncoding RNAs with important roles in gene regulation. They have recently been investigated as novel classes of therapeutic agents for the treatment of a wide range of disorders including cancers and infections. Clinical trials of siRNA- and miRNA-based drugs have already been initiated. siRNAs and miRNAs share many similarities, both are short duplex RNA molecules that exert gene silencing effects at the post-transcriptional level by targeting messenger RNA (mRNA), yet their mechanisms of action and clinical applications are distinct. The major difference between siRNAs and miRNAs is that the former are highly specific with only one mRNA target, whereas the latter have multiple targets. The therapeutic approaches of siRNAs and miRNAs are therefore very different. Hence, this review provides a comparison between therapeutic siRNAs and miRNAs in terms of their mechanisms of action, physicochemical properties, delivery, and clinical applications. Moreover, the challenges in developing both classes of RNA as therapeutics are also discussed. PMID:26372022
-
Tiemann, Katrin; Höhn, Britta; Ehsani, Ali; Forman, Stephen J.; Rossi, John J.; Sætrom, Pål
2010-01-01
We have developed an algorithm for the prediction of dual-targeting short interfering RNAs (siRNAs) in which both strands are deliberately designed to separately target different mRNA transcripts with complete complementarity. An advantage of this approach versus the use of two separate duplexes is that only two strands, as opposed to four, are competing for entry into the RNA-induced silencing complex. We chose to design our dual-targeting siRNAs as Dicer substrate 25/27mer siRNAs, since design features resembling pre-microRNAs (miRNAs) can be introduced for Dicer processing. Seven different dual-targeting siRNAs targeting genes that are potential targets in cancer therapy have been developed including Bcl2, Stat3, CCND1, BIRC5, and MYC. The dual-targeting siRNAs have been characterized for dual target knockdown in three different cell lines (HEK293, HCT116, and PC3), where they were as effective as their corresponding single-targeting siRNAs in target knockdown. The algorithm developed in this study should prove to be useful for predicting dual-targeting siRNAs in a variety of different targets and is available from http://demo1.interagon.com/DualTargeting/. PMID:20410240
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shimizu, Takashi, E-mail: shimizut@obihiro.ac.jp; Hirai, Yuko; Murayama, Chiaki
2011-08-19
Highlights: {yields} Treatment with Per2 and Clock siRNAs decreased the number of granulosa cells and LHr expression. {yields}Per2 siRNA treatment did not stimulate the production of estradiol and expression of P450arom. {yields} Clock siRNA treatment inhibited the production of estradiol and expression of P450arom mRNA. {yields}Per2 and Clock siRNA treatment increased and unchanged, respectively, progesterone production in FSH-treated granulosa cells. {yields} The expression of StAR mRNA was increased by Per2 siRNA and unchanged by Clock siRNA. -- Abstract: Circadian Clock genes are associated with the estrous cycle in female animals. Treatment with Per2 and Clock siRNAs decreased the number ofmore » granulosa cells and LHr expression in follicle-stimulating hormone FSH-treated granulosa cells. Per2 siRNA treatment did not stimulate the production of estradiol and expression of P450arom, whereas Clock siRNA treatment inhibited the production of estradiol and expression of P450arom mRNA. Per2 and Clock siRNA treatment increased and unchanged, respectively, progesterone production in FSH-treated granulosa cells. Similarly, expression of StAR mRNA was increased by Per2 siRNA and unchanged by Clock siRNA. Our data provide a new insight that Per2 and Clock have different action on ovarian granulosa cell functions.« less
-
[Study on the inhibition effect of siRNA on herpes simplex virus type 2 ICP4 gene].
Liu, Ji-feng; Guan, Cui-ping; Tang, Xu; Xu, Ai-e
2010-06-01
To explore the inhibition effect of RNA interference on the ICP4 expression and DNA replication of herpes simplex virus type 2 (HSV2). Four pairs of siRNA targeted to HSV2 ICP4 gene and negative control siRNA were synthetized by chemical method, named as siRNA-1, siRNA-2, siRNA-3, siRNA-4 and siRNA-N respecticely. HSV2 HG52 was used to attack Vero cell after transfection overnight. Vero cell and supernatant were collected at 1d, 2d, 3d, 4d and 5d after virus attacking. Flurogenic quantitative reverse transcription polymerase chain reaction (FQ-RT-PCR)was used to detect the expression of HSV2 ICP4 mRNA, flurogenic quantitative polymerase chain reaction(FG-PCR) was used to detect the expression of HSV2 DNA and Western-Blot was used to detect the expression of HSV2 ICP4 protein. All the four pairs of siRNA could significantly inhibit the expression of HSV2 ICP4 mRNA and protein, especially siRNA-2. The above siRNAs could significantly decrease HSV2 DNA copy number,too. siRNAs targeted to HSV2 ICP4 gene could significantly inhibit expression of HSV2 ICP4 mRNA and protein, and decrease HSV2 DNA copy number, suggesting that siRNA can inhibit HSV2 DNA replication through silencing ICP4 gene.
-
Generation of genetic constructs that simultaneously express several shRNAs.
Kretova, Olga V; Alembekov, Ildar R; Tchurikov, Nickolai A
2012-05-01
RNAi has potential as an antiviral gene therapy strategy. Cassette constructs simultaneously expressing several siRNAs could prove to be the most efficient technique in developing gene therapy approaches for highly mutable viruses such as HIV-1. Here we describe a rapid and cost-saving protocol to generate cassettes that simultaneously express three siRNAs for repression of HIV-1 and CCR5 transcripts. siRNA biological activity was tested in a non-viral system, and exhibited both efficiency and specificity. Our results suggest this protocol can be used to rapidly generate cassette constructs for antiviral gene therapy applications.
-
Hes6 is required for actin cytoskeletal organization in differentiating C2C12 myoblasts
DOE Office of Scientific and Technical Information (OSTI.GOV)
Malone, Caroline M.P.; Domaschenz, Renae; Amagase, Yoko
Hes6 is a member of the hairy-enhancer-of-split family of transcription factors that regulate proliferating cell fate in development and is known to be expressed in developing muscle. Here we investigate its function in myogenesis in vitro. We show that Hes6 is a direct transcriptional target of the myogenic transcription factors MyoD and Myf5, indicating that it is integral to the myogenic transcriptional program. The localization of Hes6 protein changes during differentiation, becoming predominantly nuclear. Knockdown of Hes6 mRNA levels by siRNA has no effect on cell cycle exit or induction of myosin heavy chain expression in differentiating C2C12 myoblasts, butmore » F-actin filament formation is disrupted and both cell motility and myoblast fusion are reduced. The knockdown phenotype is rescued by expression of Hes6 cDNA resistant to siRNA. These results define a novel role for Hes6 in actin cytoskeletal dynamics in post mitotic myoblasts.« less
-
Plant-specific multisubunit RNA polymerase in gene silencing.
Lahmy, Sylvie; Bies-Etheve, Natacha; Lagrange, Thierry
2010-01-01
In recent years, a major breakthrough in the study of epigenetic silencing in eukaryotes came with the discovery that the RNA-interference pathway (RNAi) is generally implicated in heterochromatin assembly and gene silencing. An important and paradoxical feature of the RNAi-mediated heterochromatin pathways is their requirement for some form of transcription. In fission yeast, Schizosaccharomyces pombe, centromeric siRNAs have been shown to derive from chromatin-bound nascent transcripts produced by RNA polymerase II (PolII) at the site of heterochromatin formation. Likewise, chromatin-bound nascent transcripts generated by a PolII-related DNA-dependent RNA polymerase, known as PolIVb/PolV, have recently been implicated in RNA-directed DNA methylation (RdDM), the prominent RNAi-mediated chromatin pathway in plants. In this review we discuss recent work on the plant-specific PolII variant enzymes and discuss the mechanistic convergences that have been observed in the role of these enzymes in their respective siRNA-mediated heterochromatin formation pathways.
-
miRNAs trigger widespread epigenetically activated siRNAs from transposons in Arabidopsis.
Creasey, Kate M; Zhai, Jixian; Borges, Filipe; Van Ex, Frederic; Regulski, Michael; Meyers, Blake C; Martienssen, Robert A
2014-04-17
In plants, post-transcriptional gene silencing (PTGS) is mediated by DICER-LIKE 1 (DCL1)-dependent microRNAs (miRNAs), which also trigger 21-nucleotide secondary short interfering RNAs (siRNAs) via RNA-DEPENDENT RNA POLYMERASE 6 (RDR6), DCL4 and ARGONAUTE 1 (AGO1), whereas transcriptional gene silencing (TGS) of transposons is mediated by 24-nucleotide heterochromatic (het)siRNAs, RDR2, DCL3 and AGO4 (ref. 4). Transposons can also give rise to abundant 21-nucleotide 'epigenetically activated' small interfering RNAs (easiRNAs) in DECREASED DNA METHYLATION 1 (ddm1) and DNA METHYLTRANSFERASE 1 (met1) mutants, as well as in the vegetative nucleus of pollen grains and in dedifferentiated plant cell cultures. Here we show that easiRNAs in Arabidopsis thaliana resemble secondary siRNAs, in that thousands of transposon transcripts are specifically targeted by more than 50 miRNAs for cleavage and processing by RDR6. Loss of RDR6, DCL4 or DCL1 in a ddm1 background results in loss of 21-nucleotide easiRNAs and severe infertility, but 24-nucleotide hetsiRNAs are partially restored, supporting an antagonistic relationship between PTGS and TGS. Thus miRNA-directed easiRNA biogenesis is a latent mechanism that specifically targets transposon transcripts, but only when they are epigenetically reactivated during reprogramming of the germ line. This ancient recognition mechanism may have been retained both by transposons to evade long-term heterochromatic silencing and by their hosts for genome defence.
-
NASA Astrophysics Data System (ADS)
Tian, Caiping; Ma, Yi; Li, Siwen; Gu, Yueqing
2014-09-01
Mammalian target of rapamycin (mTOR) as a key protein in PI3K-AKT-mTOR signaling pathway ,plays an important role in the tumor growth. The small interfering RNA (siRNA) of mTOR would decrease the expression of mTOR protein. In this study, we screened the mTOR siRNA sequence using MATLAB software and ascertained it based on BLAST. Then we imported it with the aid of Lipofectamine2000 into MCF-7 cancer cells where mTOR is over expression .And then we used a special hairpin deoxyribonucleic acid (DNA) for combining with the human mTOR mRNA to functionalize gold nanoparticles, which served as a molecule beacon for detecting human mTOR mRNA transcription. Laser scanning confocal microscope and Flow Cytometry data showed that the quenching efficiency was up to 90%,which are consistent with the RT-PCR measurement and Western. Compared to the previous approaches, this beacon has advantages of higher target to background ratio of detection. The strategy reported in this study is a promising approach for the intracellular measurement of the result of siRNA or protein expression in living cells, and has great potential in the study of drug screening and discovery.
-
New Type of BACE1 siRNA Delivery to Cells
Jabłkowski, Maciej; Szemraj, Maciej; Oszajca, Katarzyna; Janiszewska, Grażyna; Bartkowiak, Jacek; Szemraj, Janusz
2014-01-01
Background Small interfering RNA (siRNA) gene therapy is a new molecular approach in the search for an efficient therapy for Alzheimer disease (AD), based on the principle of RNA interference. Reducing BACE activity can have great therapeutic potential for the treatment of AD. In this study, receptor-mediated delivery was used to deliver opioid peptide-conjugated BACE 1 to INR-32 human neuroblastoma cells. Material/Methods An INR-32 human neuroblastoma cell line was stably transfected to express the APP cDNA coding fragment containing the predicted sites for cleavage by α, β, or γ-secretase. This was then treated with BACE 1 siRNA to silence BACE gene expression. BACE gene transcription and translation was determined using BACE-1 siRNA cross-linked with opioid peptide, together with RT-PCR, Western blot analysis, and ELISA. Results Receptor-mediated delivery was used to introduce BACE1 siRNA to the APP – INR 32 human neuroblastoma cells. Decreased BACE mRNA and protein expression were observed after the cells were transfected with BACE1 siRNA. Conclusions Delivery of BACE1 siRNA appears to specifically reduce the cleavage of APP by inhibiting BACE1 activity. PMID:25491230
-
No significant impact of Foxf1 siRNA treatment in acute and chronic CCl4 liver injury.
Abshagen, Kerstin; Rotberg, Tobias; Genz, Berit; Vollmar, Brigitte
2017-08-01
Chronic liver injury of any etiology is the main trigger of fibrogenic responses and thought to be mediated by hepatic stellate cells. Herein, activating transcription factors like forkhead box f1 are described to stimulate pro-fibrogenic genes in hepatic stellate cells. By using a liver-specific siRNA delivery system (DBTC), we evaluated whether forkhead box f1 siRNA treatment exhibit beneficial effects in murine models of acute and chronic CCl 4 -induced liver injury. Systemic administration of DBTC-forkhead box f1 siRNA in mice was only sufficient to silence forkhead box f1 in acute CCl 4 model, but was not able to attenuate liver injury as measured by liver enzymes and necrotic liver cell area. Therapeutic treatment of mice with DBTC-forkhead box f1 siRNA upon chronic CCl 4 exposition failed to inhibit forkhead box f1 expression and hence lacked to diminish hepatic stellate cells activation or fibrosis development. As a conclusion, DBTC-forkhead box f1 siRNA reduced forkhead box f1 expression in a model of acute but not chronic toxic liver injury and showed no positive effects in either of these mice models. Impact statement As liver fibrosis is a worldwide health problem, antifibrotic therapeutic strategies are urgently needed. Therefore, further developments of new technologies including validation in different experimental models of liver disease are essential. Since activation of hepatic stellate cells is a key event upon liver injury, the activating transcription factor forkhead box f1 (Foxf1) represents a potential target gene. Previously, we evaluated Foxf1 silencing by a liver-specific siRNA delivery system (DBTC), exerting beneficial effects in cholestasis. The present study was designed to confirm the therapeutic potential of Foxf1 siRNA in models of acute and chronic CCl 4 -induced liver injury. DBTC-Foxf1 siRNA was only sufficient to silence Foxf1 in acute CCl 4 model and did not ameliorate liver injury or fibrogenesis. This underlines the significance of the experimental model used. Each model displays specific characteristics in the pathogenic nature, time course and severity of fibrosis and the optimal time point for starting a therapy.
-
Wada, K; Wada, Y; Iwasaki, Y; Ikemura, T
2017-10-01
Oligonucleotides are key elements of nucleic acid therapeutics such as small interfering RNAs (siRNAs). Influenza and Ebolaviruses are zoonotic RNA viruses mutating very rapidly, and their sequence changes must be characterized intensively to design therapeutic oligonucleotides with long utility. Focusing on a total of 182 experimentally validated siRNAs for influenza A, B and Ebolaviruses compiled by the siRNA database, we conducted time-series analyses of occurrences of siRNA targets in these viral genomes. Reflecting their high mutation rates, occurrences of target oligonucleotides evidently fluctuate in viral populations and often disappear. Time-series analysis of the one-base changed sequences derived from each original target identified the oligonucleotide that shows a compensatory increase and will potentially become the 'awaiting-type oligonucleotide'; the combined use of this oligonucleotide with the original can provide therapeutics with long utility. This strategy is also useful for assigning diagnostic reverse transcription-PCR primers with long utility.
-
Wada, K; Wada, Y; Iwasaki, Y; Ikemura, T
2017-01-01
Oligonucleotides are key elements of nucleic acid therapeutics such as small interfering RNAs (siRNAs). Influenza and Ebolaviruses are zoonotic RNA viruses mutating very rapidly, and their sequence changes must be characterized intensively to design therapeutic oligonucleotides with long utility. Focusing on a total of 182 experimentally validated siRNAs for influenza A, B and Ebolaviruses compiled by the siRNA database, we conducted time-series analyses of occurrences of siRNA targets in these viral genomes. Reflecting their high mutation rates, occurrences of target oligonucleotides evidently fluctuate in viral populations and often disappear. Time-series analysis of the one-base changed sequences derived from each original target identified the oligonucleotide that shows a compensatory increase and will potentially become the ‘awaiting-type oligonucleotide’ the combined use of this oligonucleotide with the original can provide therapeutics with long utility. This strategy is also useful for assigning diagnostic reverse transcription-PCR primers with long utility. PMID:28905886
-
Possible linkage of SP6 transcriptional activity with amelogenesis by protein stabilization.
Utami, Trianna W; Miyoshi, Keiko; Hagita, Hiroko; Yanuaryska, Ryna Dwi; Horiguchi, Taigo; Noma, Takafumi
2011-01-01
Ameloblasts produce enamel matrix proteins such as amelogenin, ameloblastin, and amelotin during tooth development. The molecular mechanisms of ameloblast differentiation (amelogenesis) are currently not well understood. SP6 is a transcription factor of the Sp/KLF family that was recently found to regulate cell proliferation in a cell-type-specific manner. Sp6-deficient mice demonstrate characteristic tooth anomalies such as delayed eruption of the incisors and supernumerary teeth with disorganized amelogenesis. However, it remains unclear how Sp6 controls amelogenesis. In this study, we used SP6 high producer cells to identify SP6 target genes. Based on the observations that long-term culture of SP6 high producer cells reduced SP6 protein expression but not Sp6 mRNA expression, we found that SP6 is short lived and specifically degraded through a proteasome pathway. We established an in vitro inducible SP6 expression system coupled with siRNA knockdown and found a possible linkage between SP6 and amelogenesis through the regulation of amelotin and Rock1 gene expression by microarray analysis. Our findings suggest that the regulation of SP6 protein stability is one of the crucial steps in amelogenesis.
-
Possible Linkage of SP6 Transcriptional Activity with Amelogenesis by Protein Stabilization
Utami, Trianna W.; Miyoshi, Keiko; Hagita, Hiroko; Yanuaryska, Ryna Dwi; Horiguchi, Taigo; Noma, Takafumi
2011-01-01
Ameloblasts produce enamel matrix proteins such as amelogenin, ameloblastin, and amelotin during tooth development. The molecular mechanisms of ameloblast differentiation (amelogenesis) are currently not well understood. SP6 is a transcription factor of the Sp/KLF family that was recently found to regulate cell proliferation in a cell-type-specific manner. Sp6-deficient mice demonstrate characteristic tooth anomalies such as delayed eruption of the incisors and supernumerary teeth with disorganized amelogenesis. However, it remains unclear how Sp6 controls amelogenesis. In this study, we used SP6 high producer cells to identify SP6 target genes. Based on the observations that long-term culture of SP6 high producer cells reduced SP6 protein expression but not Sp6 mRNA expression, we found that SP6 is short lived and specifically degraded through a proteasome pathway. We established an in vitro inducible SP6 expression system coupled with siRNA knockdown and found a possible linkage between SP6 and amelogenesis through the regulation of amelotin and Rock1 gene expression by microarray analysis. Our findings suggest that the regulation of SP6 protein stability is one of the crucial steps in amelogenesis. PMID:22046099
-
Phosphate-binding pocket in Dicer-2 PAZ domain for high-fidelity siRNA production
Kandasamy, Suresh K.
2016-01-01
The enzyme Dicer produces small silencing RNAs such as micro-RNAs (miRNAs) and small interfering RNAs (siRNAs). In Drosophila, Dicer-1 produces ∼22–24-nt miRNAs from pre-miRNAs, whereas Dicer-2 makes 21-nt siRNAs from long double-stranded RNAs (dsRNAs). How Dicer-2 precisely makes 21-nt siRNAs with a remarkably high fidelity is unknown. Here we report that recognition of the 5′-monophosphate of a long dsRNA substrate by a phosphate-binding pocket in the Dicer-2 PAZ (Piwi, Argonaute, and Zwille/Pinhead) domain is crucial for the length fidelity, but not the efficiency, in 21-nt siRNA production. Loss of the length fidelity, meaning increased length heterogeneity of siRNAs, caused by point mutations in the phosphate-binding pocket of the Dicer-2 PAZ domain decreased RNA silencing activity in vivo, showing the importance of the high fidelity to make 21-nt siRNAs. We propose that the 5′-monophosphate of a long dsRNA substrate is anchored by the phosphate-binding pocket in the Dicer-2 PAZ domain and the distance between the pocket and the RNA cleavage active site in the RNaseIII domain corresponds to the 21-nt pitch in the A-form duplex of a long dsRNA substrate, resulting in high-fidelity 21-nt siRNA production. This study sheds light on the molecular mechanism by which Dicer-2 produces 21-nt siRNAs with a remarkably high fidelity for efficient RNA silencing. PMID:27872309
-
Zheng, Lianxing; Ding, Sheng
2004-04-01
Extract: RNA interference (RNAi), first discovered in Caenorhabdtitis elegans and now widely found and applied in a variety of organisms such as Drosophila, zebrafish and mammalian systems, has emerged to revolutionize the field of functional genomics by inducing specific and effective post-transcriptional gene silencing for loss-of-function studies. Mechanistic investigations of RNAi suggest that long double-stranded RNAs (dsRNAs) are first cleaved by the RNase III-like enzyme, Dicer, to 21-23 base pair (bp) small interfering RNAs (siRNAs). These siRNAs are resolved by ATP-dependent RNA helicase, and the resulting single-stranded RNAs are then incorporated into the RNA-induced silencing complex (RISC). The antisense strand of the siRNA duplex guides the RISC to the homologous mRNA, where the RISC-associated endoribonuclease cleaves the target mRNA, resulting in silencing of the target gene. The approach of using long dsRNA (up to 1-2 kb) in C. elegans and Drosophila to induce gene silencing cannot be similarly used in mammalian cells, where introduction of long dsRNA activates the dsRNA-dependent protein kinase PKR. PKR phosphorylates and inactivates the translation initiation factor eIF2, resulting in a non-specific gene-silencing effect. Development and implementation of the use of 21 to 23bp siRNAs, which can be prepared by chemical synthesis, in vitro transcription, or expressed in cells using siRNA expression systems, allows specific and effective gene silencing in mammalian cells to occur without activation of PKR.
-
USDA-ARS?s Scientific Manuscript database
Small RNAs regulate the genome by guiding transcriptional and post-transcriptional silencing machinery to specific target sequences, including genes and transposable elements (TEs). Although miniature inverted-repeat transposable elements (MITEs) are closely associated with euchromatic genes, the br...
-
Rajeswaran, Rajendran; Seguin, Jonathan; Chabannes, Matthieu; Duroy, Pierre-Olivier; Laboureau, Nathalie; Farinelli, Laurent; Iskra-Caruana, Marie-Line
2014-01-01
ABSTRACT Vegetatively propagated crop plants often suffer from infections with persistent RNA and DNA viruses. Such viruses appear to evade the plant defenses that normally restrict viral replication and spread. The major antiviral defense mechanism is based on RNA silencing generating viral short interfering RNAs (siRNAs) that can potentially repress viral genes posttranscriptionally through RNA cleavage and transcriptionally through DNA cytosine methylation. Here we examined the RNA silencing machinery of banana plants persistently infected with six pararetroviruses after many years of vegetative propagation. Using deep sequencing, we reconstructed consensus master genomes of the viruses and characterized virus-derived and endogenous small RNAs. Consistent with the presence of endogenous siRNAs that can potentially establish and maintain DNA methylation, the banana genomic DNA was extensively methylated in both healthy and virus-infected plants. A novel class of abundant 20-nucleotide (nt) endogenous small RNAs with 5′-terminal guanosine was identified. In all virus-infected plants, 21- to 24-nt viral siRNAs accumulated at relatively high levels (up to 22% of the total small RNA population) and covered the entire circular viral DNA genomes in both orientations. The hotspots of 21-nt and 22-nt siRNAs occurred within open reading frame (ORF) I and II and the 5′ portion of ORF III, while 24-nt siRNAs were more evenly distributed along the viral genome. Despite the presence of abundant viral siRNAs of different size classes, the viral DNA was largely free of cytosine methylation. Thus, the virus is able to evade siRNA-directed DNA methylation and thereby avoid transcriptional silencing. This evasion of silencing likely contributes to the persistence of pararetroviruses in banana plants. IMPORTANCE We report that DNA pararetroviruses in Musa acuminata banana plants are able to evade DNA cytosine methylation and transcriptional gene silencing, despite being targeted by the host silencing machinery generating abundant 21- to 24-nucleotide short interfering RNAs. At the same time, the banana genomic DNA is extensively methylated in both healthy and virus-infected plants. Our findings shed light on the siRNA-generating gene silencing machinery of banana and provide a possible explanation why episomal pararetroviruses can persist in plants whereas true retroviruses with an obligatory genome-integration step in their replication cycle do not exist in plants. PMID:25056897
-
Rajeswaran, Rajendran; Seguin, Jonathan; Chabannes, Matthieu; Duroy, Pierre-Olivier; Laboureau, Nathalie; Farinelli, Laurent; Iskra-Caruana, Marie-Line; Pooggin, Mikhail M
2014-10-01
Vegetatively propagated crop plants often suffer from infections with persistent RNA and DNA viruses. Such viruses appear to evade the plant defenses that normally restrict viral replication and spread. The major antiviral defense mechanism is based on RNA silencing generating viral short interfering RNAs (siRNAs) that can potentially repress viral genes posttranscriptionally through RNA cleavage and transcriptionally through DNA cytosine methylation. Here we examined the RNA silencing machinery of banana plants persistently infected with six pararetroviruses after many years of vegetative propagation. Using deep sequencing, we reconstructed consensus master genomes of the viruses and characterized virus-derived and endogenous small RNAs. Consistent with the presence of endogenous siRNAs that can potentially establish and maintain DNA methylation, the banana genomic DNA was extensively methylated in both healthy and virus-infected plants. A novel class of abundant 20-nucleotide (nt) endogenous small RNAs with 5'-terminal guanosine was identified. In all virus-infected plants, 21- to 24-nt viral siRNAs accumulated at relatively high levels (up to 22% of the total small RNA population) and covered the entire circular viral DNA genomes in both orientations. The hotspots of 21-nt and 22-nt siRNAs occurred within open reading frame (ORF) I and II and the 5' portion of ORF III, while 24-nt siRNAs were more evenly distributed along the viral genome. Despite the presence of abundant viral siRNAs of different size classes, the viral DNA was largely free of cytosine methylation. Thus, the virus is able to evade siRNA-directed DNA methylation and thereby avoid transcriptional silencing. This evasion of silencing likely contributes to the persistence of pararetroviruses in banana plants. We report that DNA pararetroviruses in Musa acuminata banana plants are able to evade DNA cytosine methylation and transcriptional gene silencing, despite being targeted by the host silencing machinery generating abundant 21- to 24-nucleotide short interfering RNAs. At the same time, the banana genomic DNA is extensively methylated in both healthy and virus-infected plants. Our findings shed light on the siRNA-generating gene silencing machinery of banana and provide a possible explanation why episomal pararetroviruses can persist in plants whereas true retroviruses with an obligatory genome-integration step in their replication cycle do not exist in plants. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
-
YB-1, the E2F Pathway, and Regulation of Tumor Cell Growth
Samuel, Weini; Cao, Helen; Patel, Rachna; Mehta, Reena; Stern, J. Lewis; Reid, Glen; Woolley, Adele G.; Miller, Lance D.; Black, Michael A; Shelling, Andrew N.; Print, Cristin G.; Braithwaite, Antony W.
2012-01-01
Background Y-box binding factor 1 (YB-1) has been associated with prognosis in many tumor types. Reduced YB-1 expression inhibits tumor cell growth, but the mechanism is unclear. Methods YB-1 mRNA levels were compared with tumor grade and histology using microarray data from 771 breast cancer patients and with disease-free survival and distant metastasis–free survival using data from 375 of those patients who did not receive adjuvant therapy. Microarrays were further searched for genes that had correlated expression with YB-1 mRNA. Small interfering RNA (siRNA) was used to study the effects of reduced YB-1 expression on growth of three tumor cell lines (MCF-7 breast, HCT116 colon, and A549 lung cancer cells), on tumorigenesis by A549 cells in nude mice, and on global transcription in the three cancer cell lines. Reporter gene assays were used to determine whether YB-1 siRNAs affected the expression of E2F1, and chromatin immunoprecipitation was used to determine whether YB-1 bound to various E2F promoters as well as E2F1-regulated promoters. All P values were from two-sided tests. Results YB-1 levels were elevated in more aggressive tumors and were strongly associated with poor disease-free survival and distant metastasis–free survival. YB-1 expression was often associated with the expression of genes with E2F sites in their promoters. Cells expressing YB-1 siRNA grew substantially more slowly than control cells and formed tumors less readily in nude mice. Transcripts that were altered in cancer cell lines with YB-1 siRNA included 32 genes that are components of prognostic gene expression signatures. YB-1 regulated expression of an E2F1 promoter–reporter construct in A549 cells (eg, relative E2F1 promoter activity with control siRNA = 4.04; with YB-1 siRNA = 1.40, difference= −2.64, 95% confidence interval = −3.57 to −1.71, P < .001) and bound to the promoters of several well-defined E2F1 target genes. Conclusion YB-1 expression is associated with the activity of E2F transcription factors and may control tumor cell growth by this mechanism. PMID:22205655
-
Chan, Wen-Ling; Yang, Wen-Kuang; Huang, Hsien-Da; Chang, Jan-Gowth
2013-01-01
RNA interference (RNAi) is a gene silencing process within living cells, which is controlled by the RNA-induced silencing complex with a sequence-specific manner. In flies and mice, the pseudogene transcripts can be processed into short interfering RNAs (siRNAs) that regulate protein-coding genes through the RNAi pathway. Following these findings, we construct an innovative and comprehensive database to elucidate siRNA-mediated mechanism in human transcribed pseudogenes (TPGs). To investigate TPG producing siRNAs that regulate protein-coding genes, we mapped the TPGs to small RNAs (sRNAs) that were supported by publicly deep sequencing data from various sRNA libraries and constructed the TPG-derived siRNA-target interactions. In addition, we also presented that TPGs can act as a target for miRNAs that actually regulate the parental gene. To enable the systematic compilation and updating of these results and additional information, we have developed a database, pseudoMap, capturing various types of information, including sequence data, TPG and cognate annotation, deep sequencing data, RNA-folding structure, gene expression profiles, miRNA annotation and target prediction. As our knowledge, pseudoMap is the first database to demonstrate two mechanisms of human TPGs: encoding siRNAs and decoying miRNAs that target the parental gene. pseudoMap is freely accessible at http://pseudomap.mbc.nctu.edu.tw/. Database URL: http://pseudomap.mbc.nctu.edu.tw/
-
Lepère, Gersende; Bétermier, Mireille; Meyer, Eric; Duharcourt, Sandra
2008-01-01
The germline genome of ciliates is extensively rearranged during the development of a new somatic macronucleus from the germline micronucleus, after sexual events. In Paramecium tetraurelia, single-copy internal eliminated sequences (IESs) are precisely excised from coding sequences and intergenic regions. For a subset of IESs, introduction of the IES sequence into the maternal macronucleus specifically inhibits excision of the homologous IES in the developing zygotic macronucleus, suggesting that epigenetic regulation of excision involves a global comparison of germline and somatic genomes. ScanRNAs (scnRNAs) produced during micronuclear meiosis by a developmentally regulated RNAi pathway have been proposed to mediate this transnuclear cross-talk. In this study, microinjection experiments provide direct evidence that 25-nucleotide (nt) scnRNAs promote IES excision. We further show that noncoding RNAs are produced from the somatic maternal genome, both during vegetative growth and during sexual events. Maternal inhibition of IES excision is abolished when maternal somatic transcripts containing an IES are targeted for degradation by a distinct RNAi pathway involving 23-nt siRNAs. The results strongly support a scnRNA/macronuclear RNA scanning model in which a natural genomic subtraction, occurring during meiosis between deletion-inducing scnRNAs and antagonistic transcripts from the maternal macronucleus, regulates rearrangements of the zygotic genome. PMID:18519642
-
Transposon Variants and Their Effects on Gene Expression in Arabidopsis
Wang, Xi; Weigel, Detlef; Smith, Lisa M.
2013-01-01
Transposable elements (TEs) make up the majority of many plant genomes. Their transcription and transposition is controlled through siRNAs and epigenetic marks including DNA methylation. To dissect the interplay of siRNA–mediated regulation and TE evolution, and to examine how TE differences affect nearby gene expression, we investigated genome-wide differences in TEs, siRNAs, and gene expression among three Arabidopsis thaliana accessions. Both TE sequence polymorphisms and presence of linked TEs are positively correlated with intraspecific variation in gene expression. The expression of genes within 2 kb of conserved TEs is more stable than that of genes next to variant TEs harboring sequence polymorphisms. Polymorphism levels of TEs and closely linked adjacent genes are positively correlated as well. We also investigated the distribution of 24-nt-long siRNAs, which mediate TE repression. TEs targeted by uniquely mapping siRNAs are on average farther from coding genes, apparently because they more strongly suppress expression of adjacent genes. Furthermore, siRNAs, and especially uniquely mapping siRNAs, are enriched in TE regions missing in other accessions. Thus, targeting by uniquely mapping siRNAs appears to promote sequence deletions in TEs. Overall, our work indicates that siRNA–targeting of TEs may influence removal of sequences from the genome and hence evolution of gene expression in plants. PMID:23408902
-
Targets of small interfering RNA restriction during human immunodeficiency virus type 1 replication.
Gao, Yong; Lobritz, Michael A; Roth, Justin; Abreha, Measho; Nelson, Kenneth N; Nankya, Immaculate; Moore-Dudley, Dawn M; Abraha, Awet; Gerson, Stanton L; Arts, Eric J
2008-03-01
Small interfering RNAs (siRNAs) have been shown to effectively inhibit human immunodeficiency virus type 1 (HIV-1) replication in vitro. The mechanism(s) for this inhibition is poorly understood, as siRNAs may interact with multiple HIV-1 RNA species during different steps of the retroviral life cycle. To define susceptible HIV-1 RNA species, siRNAs were first designed to specifically inhibit two divergent primary HIV-1 isolates via env and gag gene targets. A self-inactivating lentiviral vector harboring these target sequences confirmed that siRNA cannot degrade incoming genomic RNA. Disruption of the incoming core structure by rhesus macaque TRIM5alpha did, however, provide siRNA-RNA-induced silencing complex access to HIV-1 genomic RNA and promoted degradation. In the absence of accelerated core disruption, only newly transcribed HIV-1 mRNA in the cytoplasm is sensitive to siRNA degradation. Inhibitors of HIV-1 mRNA nuclear export, such as leptomycin B and camptothecin, blocked siRNA restriction. All HIV-1 RNA regions and transcripts found 5' of the target sequence, including multiply spliced HIV-1 RNA, were degraded by unidirectional 3'-to-5' siRNA amplification and spreading. In contrast, HIV-1 RNA 3' of the target sequence was not susceptible to siRNA. Even in the presence of siRNA, full-length HIV-1 RNA is still encapsidated into newly assembled viruses. These findings suggest that siRNA can target only a relatively "naked" cytoplasmic HIV-1 RNA despite the involvement of viral RNA at nearly every step in the retroviral life cycle. Protection of HIV-1 RNA within the core following virus entry, during encapsidation/virus assembly, or within the nucleus may reflect virus evolution in response to siRNA, TRIM5alpha, or other host restriction factors.
-
Silencing and innate immunity in plant defense against viral and non-viral pathogens.
Zvereva, Anna S; Pooggin, Mikhail M
2012-10-29
The frontline of plant defense against non-viral pathogens such as bacteria, fungi and oomycetes is provided by transmembrane pattern recognition receptors that detect conserved pathogen-associated molecular patterns (PAMPs), leading to pattern-triggered immunity (PTI). To counteract this innate defense, pathogens deploy effector proteins with a primary function to suppress PTI. In specific cases, plants have evolved intracellular resistance (R) proteins detecting isolate-specific pathogen effectors, leading to effector-triggered immunity (ETI), an amplified version of PTI, often associated with hypersensitive response (HR) and programmed cell death (PCD). In the case of plant viruses, no conserved PAMP was identified so far and the primary plant defense is thought to be based mainly on RNA silencing, an evolutionary conserved, sequence-specific mechanism that regulates gene expression and chromatin states and represses invasive nucleic acids such as transposons. Endogenous silencing pathways generate 21-24 nt small (s)RNAs, miRNAs and short interfering (si)RNAs, that repress genes post-transcriptionally and/or transcriptionally. Four distinct Dicer-like (DCL) proteins, which normally produce endogenous miRNAs and siRNAs, all contribute to the biogenesis of viral siRNAs in infected plants. Growing evidence indicates that RNA silencing also contributes to plant defense against non-viral pathogens. Conversely, PTI-based innate responses may contribute to antiviral defense. Intracellular R proteins of the same NB-LRR family are able to recognize both non-viral effectors and avirulence (Avr) proteins of RNA viruses, and, as a result, trigger HR and PCD in virus-resistant hosts. In some cases, viral Avr proteins also function as silencing suppressors. We hypothesize that RNA silencing and innate immunity (PTI and ETI) function in concert to fight plant viruses. Viruses counteract this dual defense by effectors that suppress both PTI-/ETI-based innate responses and RNA silencing to establish successful infection.
-
Morita, Yasumasa; Saito, Ryoko; Ban, Yusuke; Tanikawa, Natsu; Kuchitsu, Kazuyuki; Ando, Toshio; Yoshikawa, Manabu; Habu, Yoshiki; Ozeki, Yoshihiro; Nakayama, Masayoshi
2012-06-01
The natural bicolor floral traits of the horticultural petunia (Petunia hybrida) cultivars Picotee and Star are caused by the spatial repression of the chalcone synthase A (CHS-A) gene, which encodes an anthocyanin biosynthetic enzyme. Here we show that Picotee and Star petunias carry the same short interfering RNA (siRNA)-producing locus, consisting of two intact CHS-A copies, PhCHS-A1 and PhCHS-A2, in a tandem head-to-tail orientation. The precursor CHS mRNAs are transcribed from the two CHS-A copies throughout the bicolored petals, but the mature CHS mRNAs are not found in the white tissues. An analysis of small RNAs revealed the accumulation of siRNAs of 21 nucleotides that originated from the exon 2 region of both CHS-A copies. This accumulation is closely correlated with the disappearance of the CHS mRNAs, indicating that the bicolor floral phenotype is caused by the spatially regulated post-transcriptional silencing of both CHS-A genes. Linkage between the tandemly arranged CHS-A allele and the bicolor floral trait indicates that the CHS-A allele is a necessary factor to confer the trait. We suppose that the spatially regulated production of siRNAs in Picotee and Star flowers is triggered by another putative regulatory locus, and that the silencing mechanism in this case may be different from other known mechanisms of post-transcriptional gene silencing in plants. A sequence analysis of wild Petunia species indicated that these tandem CHS-A genes originated from Petunia integrifolia and/or Petunia inflata, the parental species of P. hybrida, as a result of a chromosomal rearrangement rather than a gene duplication event. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.
-
Patil, Basavaprabhu L; Fauquet, Claude M
2015-06-01
RNA silencing is a sequence-specific post-transcriptional gene inactivation mechanism that operates in diverse organisms and that can extend beyond its site of initiation, owing to the movement of the silencing signal, called non-autonomous gene silencing. Previous studies have shown that several factors manifest the movement of the silencing signal, such as the size (21 or 24 nucleotides) of the secondary small interfering RNA (siRNA) produced, the steady-state concentration of siRNAs and their cognate messenger RNA (mRNA) or a change in the sink-source status of plant parts affecting phloem translocation. Our study shows that both light intensity and temperature have a significant impact on the systemic movement of the silencing signal in transient agroinfiltration studies in Nicotiana benthamiana. At higher light intensities (≥ 450 μE/m(2)/s) and higher temperatures (≥ 30 °C), gene silencing was localized to leaf tissue that was infiltrated, without any systemic spread. Interestingly, in these light and temperature conditions (≥ 450 μE/m(2) /s and ≥ 30 °C), the N. benthamiana plants showed recovery from the viral symptoms. However, the reduced systemic silencing and reduced viral symptom severity at higher light intensities were caused by a change in the sink-source status of the plant, ultimately affecting the phloem translocation of small RNAs or the viral genome. In contrast, at lower light intensities (<300 μE/m(2)/s) with a constant temperature of 25 °C, there was strong systemic movement of the silencing signal in the N. benthamiana plants and reduced recovery from virus infections. The accumulation of gene-specific siRNAs was reduced at higher temperature as a result of a reduction in the accumulation of transcript on transient agroinfiltration of RNA interference (RNAi) constructs, mostly because of poor T-DNA transfer activity of Agrobacterium, possibly also accompanied by reduced phloem translocation. © 2014 BSPP AND JOHN WILEY & SONS LTD.
-
Yang, Ching-Fu; Chen, Kuan-Chun; Cheng, Ying-Hui; Raja, Joseph A. J.; Huang, Ya-Ling; Chien, Wan-Chu; Yeh, Shyi-Dong
2014-01-01
Global threats of ssDNA geminivirus and ss(-)RNA tospovirus on crops necessitate the development of transgenic resistance. Here, we constructed a two-T DNA vector carrying a hairpin of the intergenic region (IGR) of Ageratum yellow vein virus (AYVV), residing in an intron inserted in an untranslatable nucleocapsid protein (NP) fragment of Melon yellow spot virus (MYSV). Transgenic tobacco lines highly resistant to AYVV and MYSV were generated. Accumulation of 24-nt siRNA, higher methylation levels on the IGR promoters of the transgene, and suppression of IGR promoter activity of invading AYVV indicate that AYVV resistance is mediated by transcriptional gene silencing. Lack of NP transcript and accumulation of corresponding siRNAs indicate that MYSV resistance is mediated through post-transcriptional gene silencing. Marker-free progenies with concurrent resistance to both AYVV and MYSV, stably inherited as dominant nuclear traits, were obtained. Hence, we provide a novel way for concurrent control of noxious DNA and RNA viruses with less biosafety concerns. PMID:25030413
-
Mercier, Frédéric; Paris, Jérôme; Kaisin, Geoffroy; Thonon, David; Flagothier, Jessica; Teller, Nathalie; Lemaire, Christian; Luxen, André
2011-01-19
The alkyne-azide Cu(I)-catalyzed Huisgen cycloaddition, a click-type reaction, was used to label a double-stranded oligonucleotide (siRNA) with fluorine-18. An alkyne solid support CPG for the preparation of monostranded oligonucleotides functionalized with alkyne has been developed. Two complementary azide labeling agents (1-(azidomethyl)-4-[(18)F]fluorobenzene) and 1-azido-4-(3-[(18)F]fluoropropoxy)benzene have been produced with 41% and 35% radiochemical yields (decay-corrected), respectively. After annealing with the complementary strand, the siRNA was directly labeled by click chemistry with [(18)F]fluoroazide to produce the [(18)F]-radiolabeled siRNA with excellent radiochemical yield and purity.
-
Graft-transmissible movement of inverted-repeat-induced siRNA signals into flowers.
Zhang, Wenna; Kollwig, Gregor; Stecyk, Ewelina; Apelt, Federico; Dirks, Rob; Kragler, Friedrich
2014-10-01
In plants, small interfering RNAs (siRNA) and microRNAs move to distant tissues where they control numerous developmental and physiological processes such as morphogenesis and stress responses. Grafting techniques and transient expression systems have been employed to show that sequence-specific siRNAs with a size of 21-24 nucleotides traffic to distant organs. We used inverted-repeat constructs producing siRNA targeting the meiosis factor DISRUPTED MEIOTIC cDNA 1 (DMC1) and GFP to test whether silencing signals move into meiotically active tissues. In grafted Nicotiana tabacum, a transgenic DMC1 siRNA signal made in source tissues preferably entered the anthers formed in the first flowers. Here, the DMC1 siRNA interfered with meiotic progression and, consequently, the flowers were at least partially sterile. In agro-infiltrated N. benthamiana plants, a GFP siRNA signal produced in leaves was allocated and active in most flower tissues including anthers. In hypocotyl-grafted Arabidopsis thaliana plants, the DMC1 silencing signal consistently appeared in leaves, petioles, and stem, and only a small number of plants displayed DMC1 siRNA signals in flowers. In all three tested plant species the systemic silencing signal penetrated male sporogenic tissues suggesting that plants harbour an endogenous long-distance small RNA transport pathway facilitating siRNA signalling into meiotically active cells. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.
-
MicroRNA-directed siRNA biogenesis in Caenorhabditis elegans.
Corrêa, Régis L; Steiner, Florian A; Berezikov, Eugene; Ketting, René F
2010-04-08
RNA interference (RNAi) is a post-transcriptional silencing process, triggered by double-stranded RNA (dsRNA), leading to the destabilization of homologous mRNAs. A distinction has been made between endogenous RNAi-related pathways and the exogenous RNAi pathway, the latter being essential for the experimental use of RNAi. Previous studies have shown that, in Caenorhabditis elegans, a complex containing the enzymes Dicer and the Argonaute RDE-1 process dsRNA. Dicer is responsible for cleaving dsRNA into short interfering RNAs (siRNAs) while RDE-1 acts as the siRNA acceptor. RDE-1 then guides a multi-protein complex to homologous targets to trigger mRNA destabilization. However, endogenous role(s) for RDE-1, if any, have remained unexplored. We here show that RDE-1 functions as a scavenger protein, taking up small RNA molecules from many different sources, including the microRNA (miRNA) pathway. This is in striking contrast to Argonaute proteins functioning directly in the miRNA pathway, ALG-1 and ALG-2: these proteins exclusively bind miRNAs. While playing no significant role in the biogenesis of the main pool of miRNAs, RDE-1 binds endogenous miRNAs and triggers RdRP activity on at least one perfectly matching, endogenous miRNA target. The resulting secondary siRNAs are taken up by a set of Argonaute proteins known to act as siRNA acceptors in exogenous RNAi, resulting in strong mRNA destabilization. Our results show that RDE-1 in an endogenous setting is actively screening the transcriptome using many different small RNAs, including miRNAs, as a guide, with implications for the evolution of transcripts with a potential to be recognized by Dicer.
-
MicroRNA–Directed siRNA Biogenesis in Caenorhabditis elegans
Corrêa, Régis L.; Steiner, Florian A.; Berezikov, Eugene; Ketting, René F.
2010-01-01
RNA interference (RNAi) is a post-transcriptional silencing process, triggered by double-stranded RNA (dsRNA), leading to the destabilization of homologous mRNAs. A distinction has been made between endogenous RNAi–related pathways and the exogenous RNAi pathway, the latter being essential for the experimental use of RNAi. Previous studies have shown that, in Caenorhabditis elegans, a complex containing the enzymes Dicer and the Argonaute RDE-1 process dsRNA. Dicer is responsible for cleaving dsRNA into short interfering RNAs (siRNAs) while RDE-1 acts as the siRNA acceptor. RDE-1 then guides a multi-protein complex to homologous targets to trigger mRNA destabilization. However, endogenous role(s) for RDE-1, if any, have remained unexplored. We here show that RDE-1 functions as a scavenger protein, taking up small RNA molecules from many different sources, including the microRNA (miRNA) pathway. This is in striking contrast to Argonaute proteins functioning directly in the miRNA pathway, ALG-1 and ALG-2: these proteins exclusively bind miRNAs. While playing no significant role in the biogenesis of the main pool of miRNAs, RDE-1 binds endogenous miRNAs and triggers RdRP activity on at least one perfectly matching, endogenous miRNA target. The resulting secondary siRNAs are taken up by a set of Argonaute proteins known to act as siRNA acceptors in exogenous RNAi, resulting in strong mRNA destabilization. Our results show that RDE-1 in an endogenous setting is actively screening the transcriptome using many different small RNAs, including miRNAs, as a guide, with implications for the evolution of transcripts with a potential to be recognized by Dicer. PMID:20386745
-
Ravaee, Roya; Ebadi, Parimah; Hatam, Gholamreza; Vafafar, Arghavan; Ghahramani Seno, Mohammad Mahdi
2015-10-01
The flagellated protozoan Trichomonas vaginalis (T. vaginalis) causes trichomoniasis, a reproductive tract infection, in humans. Trichomoniasis is the most common non-viral sexually transmitted disease worldwide. In addition to direct consequences such as infertility and abortion, there are indications that trichomoniasis favours development of prostate cancer and it has also been associated with increased risk of spreading human immunodeficiency virus and papillomavirus infections. Reports from around the world show that the rate of drug resistance in T. vaginalis is increasing, and therefore new therapeutic approaches have to be developed. Studying molecular biology of T. vaginalis will be quite helpful in identifying new drugable targets. RNAi is a powerful technique which allows biologist to specifically target gene products (i.e. mRNA) helping them in unravelling gene functions and biology of systems. However, due to lack of some parts of the required intrinsic RNAi machinery, the RNAi system is not functional in all orders of life. Here, by using synthetic siRNAs targeting two genes, i.e. α-actinin and cystein protease 12 (cp12), we demonstrate T. vaginalis cells are amenable to RNAi experiments conducted by extrinsic siRNAs. Electroporation of siRNAs targeting α-actinin or cp12 into T. vaginalis cells resulted in, respectively, 48-67% and 33-72% downregulation of the cognate transcripts compared to the T. vaginalis cells received siRNAs targeting GL2 luciferase as a control. This finding is helpful in that it demonstrates the potential of using extrinsically induced RNAi in studies on molecular biology of T. vaginalis such as those aiming at identifying new drug targets. Copyright © 2015 Elsevier Inc. All rights reserved.
-
Promoter Targeting RNAs: Unexpected Contributors to the Control of HIV-1 Transcription.
Suzuki, Kazuo; Ahlenstiel, Chantelle; Marks, Katherine; Kelleher, Anthony D
2015-01-27
In spite of prolonged and intensive treatment with combined antiretroviral therapy (cART), which efficiently suppresses plasma viremia, the integrated provirus of HIV-1 persists in resting memory CD4(+) T cells as latent infection. Treatment with cART does not substantially reduce the burden of latent infection. Once cART is ceased, HIV-1 replication recrudesces from these reservoirs in the overwhelming majority of patients. There is increasing evidence supporting a role for noncoding RNAs (ncRNA), including microRNAs (miRNAs), antisense (as)RNAs, and short interfering (si)RNA in the regulation of HIV-1 transcription. This appears to be mediated by interaction with the HIV-1 promoter region. Viral miRNAs have the potential to act as positive or negative regulators of HIV transcription. Moreover, inhibition of virally encoded long-asRNA can induce positive transcriptional regulation, while antisense strands of siRNA targeting the NF-κB region suppress viral transcription. An in-depth understanding of the interaction between ncRNAs and the HIV-1 U3 promoter region may lead to new approaches for the control of HIV reservoirs. This review focuses on promoter associated ncRNAs, with particular emphasis on their role in determining whether HIV-1 establishes active or latent infection.
-
Promoter Targeting RNAs: Unexpected Contributors to the Control of HIV-1 Transcription
Suzuki, Kazuo; Ahlenstiel, Chantelle; Marks, Katherine; Kelleher, Anthony D
2015-01-01
In spite of prolonged and intensive treatment with combined antiretroviral therapy (cART), which efficiently suppresses plasma viremia, the integrated provirus of HIV-1 persists in resting memory CD4+ T cells as latent infection. Treatment with cART does not substantially reduce the burden of latent infection. Once cART is ceased, HIV-1 replication recrudesces from these reservoirs in the overwhelming majority of patients. There is increasing evidence supporting a role for noncoding RNAs (ncRNA), including microRNAs (miRNAs), antisense (as)RNAs, and short interfering (si)RNA in the regulation of HIV-1 transcription. This appears to be mediated by interaction with the HIV-1 promoter region. Viral miRNAs have the potential to act as positive or negative regulators of HIV transcription. Moreover, inhibition of virally encoded long-asRNA can induce positive transcriptional regulation, while antisense strands of siRNA targeting the NF-κB region suppress viral transcription. An in-depth understanding of the interaction between ncRNAs and the HIV-1 U3 promoter region may lead to new approaches for the control of HIV reservoirs. This review focuses on promoter associated ncRNAs, with particular emphasis on their role in determining whether HIV-1 establishes active or latent infection. PMID:25625613
-
Targeting Sirna Missiles to Her2+ Breast Cancer
2008-06-01
intact and appears to be protected from serum nucleases (Fig. 1) . T7 -transcribed siRNA induces higher breast cancer cell cytotoxicity than synthetic...cytotoxicity of T7 transcribed vs s y n t h e t i c anti-HER2 siRNA on HER2+ cells. We acquired a 21 nucleotide (nt) s y n t h e t i c anti-HER2...ErbB2) siRNA and also produced a T7 -transcribed molecule (Silencer Principal Investigator: Medina-Kauwe, Lali K. 2 siRNA construction kit; Ambion) using
-
Held, Michael A.; Penning, Bryan; Brandt, Amanda S.; Kessans, Sarah A.; Yong, Weidong; Scofield, Steven R.; Carpita, Nicholas C.
2008-01-01
Small-interfering RNAs (siRNAs) from natural cis-antisense pairs derived from the 3′-coding region of the barley (Hordeum vulgare) CesA6 cellulose synthase gene substantially increase in abundance during leaf elongation. Strand-specific RT-PCR confirmed the presence of an antisense transcript of HvCesA6 that extends ≥1230 bp from the 3′ end of the CesA-coding sequence. The increases in abundance of the CesA6 antisense transcript and the 21-nt and 24-nt siRNAs derived from the transcript are coincident with the down-regulation of primary wall CesAs, several Csl genes, and GT8 glycosyl transferase genes, and are correlated with the reduction in rates of cellulose and (1 → 3),(1 → 4)-β-D-glucan synthesis. Virus induced gene silencing using unique target sequences derived from HvCesA genes attenuated expression not only of the HvCesA6 gene, but also of numerous nontarget Csls and the distantly related GT8 genes and reduced the incorporation of D-14C-Glc into cellulose and into mixed-linkage (1 → 3),(1 → 4)-β-D-glucans of the developing leaves. Unique target sequences for CslF and CslH conversely silenced the same genes and lowered rates of cellulose and (1 → 3),(1 → 4)-β-D-glucan synthesis. Our results indicate that the expression of individual members of the CesA/Csl superfamily and glycosyl transferases share common regulatory control points, and siRNAs from natural cis-antisense pairs derived from the CesA/Csl superfamily could function in this global regulation of cell-wall synthesis. PMID:19075248
-
McKinlay, Anastasia; Podicheti, Ram; Wendte, Jered M; Cocklin, Ross; Rusch, Douglas B
2018-02-01
Nuclear multisubunit RNA polymerases IV and V (Pol IV and Pol V) evolved in plants as specialized forms of Pol II. Their functions are best understood in the context of RNA-directed DNA methylation (RdDM), a process in which Pol IV-dependent 24 nt siRNAs direct the de novo cytosine methylation of regions transcribed by Pol V. Pol V has additional functions, independent of Pol IV and 24 nt siRNA biogenesis, in maintaining the repression of transposons and genomic repeats whose silencing depends on maintenance cytosine methylation. Here we report that Pol IV and Pol V play unexpected roles in defining the 3' boundaries of Pol II transcription units. Nuclear run-on assays reveal that in the absence of Pol IV or Pol V, Pol II occupancy downstream of poly A sites increases for approximately 12% of protein-coding genes. This effect is most pronounced for convergently transcribed gene pairs. Although Pols IV and V are detected near transcript ends of the affected Pol II - transcribed genes, their role in limiting Pol II read-through is independent of siRNA biogenesis or cytosine methylation for the majority of these genes. Interestingly, we observed that splicing was less efficient in pol IV or pol V mutant plants, compared to wild-type plants, suggesting that Pol IV or Pol V might affect pre-mRNA processing. We speculate that Pols IV and V (and/or their associated factors) play roles in Pol II transcription termination and pre-mRNA splicing by influencing polymerase elongation rates and/or release at collision sites for convergent genes.
-
Transcriptional and phenotypic comparisons of Ppara knockout and siRNA knockdown mice
De Souza, Angus T.; Dai, Xudong; Spencer, Andrew G.; Reppen, Tom; Menzie, Ann; Roesch, Paula L.; He, Yudong; Caguyong, Michelle J.; Bloomer, Sherri; Herweijer, Hans; Wolff, Jon A.; Hagstrom, James E.; Lewis, David L.; Linsley, Peter S.; Ulrich, Roger G.
2006-01-01
RNA interference (RNAi) has great potential as a tool for studying gene function in mammals. However, the specificity and magnitude of the in vivo response to RNAi remains to be fully characterized. A molecular and phenotypic comparison of a genetic knockout mouse and the corresponding knockdown version would help clarify the utility of the RNAi approach. Here, we used hydrodynamic delivery of small interfering RNA (siRNA) to knockdown peroxisome proliferator activated receptor alpha (Ppara), a gene that is central to the regulation of fatty acid metabolism. We found that Ppara knockdown in the liver results in a transcript profile and metabolic phenotype that is comparable to those of Ppara−/− mice. Combining the profiles from mice treated with the PPARα agonist fenofibrate, we confirmed the specificity of the RNAi response and identified candidate genes proximal to PPARα regulation. Ppara knockdown animals developed hypoglycemia and hypertriglyceridemia, phenotypes observed in Ppara−/− mice. In contrast to Ppara−/− mice, fasting was not required to uncover these phenotypes. Together, these data validate the utility of the RNAi approach and suggest that siRNA can be used as a complement to classical knockout technology in gene function studies. PMID:16945951
-
Reduction of bilirubin by targeting human heme oxygenase-1 through siRNA.
Xia, Zhen-Wei; Li, Chun-E; Jin, You-Xin; Shi, Yi; Xu, Li-Qing; Zhong, Wen-Wei; Li, Yun-Zhu; Yu, Shan-Chang; Zhang, Zi-Li
2007-04-01
Neonatal hyperbilirubinemia is a common clinical condition caused mainly by the increased production and decreased excretion of bilirubin. Current treatment is aimed at reducing the serum levels of bilirubin. Heme oxygenase-1 (HO-1) is a rate-limiting enzyme that generates bilirubin. In this study we intended to suppress HO-1 using the RNA interference technique. Small interfering RNA (siRNA)-A, -B, and -C were designed based on human HO-1 (hHO-1) mRNA sequences. siRNA was transfected into a human hepatic cell line (HL-7702). hHO-1 transcription and protein levels were then determined. In addition, the inhibitory effect of siRNA on hHO-1 was assessed in cells treated with hemin or transfected with an hHO-1 plasmid. siRNA-C showed the most potent suppressive effect on hHO-1. This inhibition is dose and time dependent. Compared with control, both hemin and hHO-1 plasmids up-regulated hHO-1 expression in HL-7702 cells. However, the up-regulation was significantly attenuated by siRNA-C. Furthermore, the decrease in hHO-1 activity was coincident with the suppression of its transcription. Finally, siRNA-C was shown to reduce hHO-1 enzymatic activity and bilirubin levels. Thus, this study provides a novel therapeutic rationale by blocking bilirubin formation via siRNA for preventing and treating neonatal hyperbilirubinemia and bilirubin encephalopathy at an early clinical stage.
-
Comes, Nuria; Borrás, Teresa
2007-08-01
To investigate whether naked short-interfering RNA (siRNA) molecules could be directly delivered to perfused intact human trabecular meshwork (TM) tissue, whether this siRNA could silence a trabecular meshwork preferred gene, and whether it could counteract the downstream effect of a deleterious agent (dexamethasone, DEX) by silencing its receptor. Anterior segments from post-mortem normal human donors were perfused at 3.4+/-0.3 microl/min-constant flow or 15 mmHg-constant pressure to stable baseline (outflow facility, C=0.22+/-0.19 microl/min/mmHg; n=14). Commercial siRNAs were diluted in DMEM (Dulbecco's Modified Eagle's Medium) perfusion medium and used without coupling to transfection reagents ("naked"). Perfusion of Cy3-labeled siRNA was performed at 100 nM for 48 h followed by 24 h with DMEM medium (two pairs). Perfusions of Matrix GLA protein (MGP) siRNA (100 nM; right eye [Oculus Dexter]; OD) and scramble-siRNA (control; left eye [Oculus Sinster]; OS) were performed for 48 h (two pairs). Perfusions of glucocorticoid receptor (GR)-siRNA (OD) and scramble-control (OS) were performed for 48 h and continued by adding 100 nM DEX to the perfusion media for an additional 24 h (two pairs). Frozen sections of labeled anterior segments were analyzed by confocal fluorescence microscopy. Differential expression of GR, MGP, myocilin (MYOC), cornea-derived transcript 6 (CDT6), and 18S genes was determined by reverse-transcriptase TaqMan polymerase chain reacion (RT-TaqMan PCR) on RNA extracted from dissected trabecular meshwork. Primary human trabecular meshwork cells were generated from single individuals and transfected using the nucleofector electroporator with program T-23. Levels of secreted MYOC in the effluents were analyzed by western blot. Histological evaluation of anterior segments perfused with Cy3 labeled siRNA followed by unlabeled medium showed intense fluorescence in the trabecular meshwork region. MGP gene expression was silenced in the trabecular meshwork perfused with naked MGP siRNA. MGP transcripts were reduced 94.7% +/- 0.62 (individual 3) and 93.6% +/- 0.13 (individual 4) from those present in the contralateral eye perfused with the scramble control. Pretreatment of GR siRNA followed by DEX treatment caused a reduction of the MYOC and CDT6 gene expressions when compared with eyes pretreated with scramble-control (percent silencing: 99.3% +/- 0.005 and 97.3% +/- 0.25, respectively, for individual 5 and 98.2% +/- 0.06 and 85.6% +/- 0.88, respectively, for individual 6). Western blots revealed the decrease of MYOC secreted by GR siRNA-treated cell and organ cultures. Readily available siRNA can be delivered to the intact human trabecular meshwork by intracameral perfusion. The delivered naked siRNA is functional, inhibiting not only the targeted gene but also their downstream effectors. This functional intracameral delivery might be of use to protect the trabecular meshwork from unwanted insults and could have important therapeutic applications.
-
KDM1A triggers androgen-induced miRNA transcription via H3K4me2 demethylation and DNA oxidation.
Yang, Shu; Zhang, Jiyuan; Zhang, Yalong; Wan, Xuechao; Zhang, Congzhe; Huang, Xiaohui; Huang, Wenhua; Pu, Honglei; Pei, Chaohan; Wu, Hai; Huang, Yan; Huang, Shengdong; Li, Yao
2015-06-15
Androgen receptor (AR) is a ligand dependent transcription factor that regulates the transcription of target genes. AR activity is closely involved in the maintenance and progression of prostate cancer. After the binding with androgen, AR moves into nucleus and binds to DNA sequence containing androgen response elements (ARE). Flavin-dependent monoamine oxidase KDM1A is necessary for AR driven transcription while the mechanism remains unclear. The association between androgen-dependent transcription and oxidation was tested through pharmaceutical inhibitions and siRNA knockdown of DNA oxidation repair components in prostate cancer cells. The recruitment of involved proteins and the histone methylation dynamics on ARE region was explored by chromatin immunoprecipitation (ChIP). Oxidation inhibition reduced AR dependent expression of KLK3, TMPRSS2, hsa-miR-125b2, and hsa-miR-133b. And such reduction could be restored by H2 O2 treatment. KDM1A recruitment and H3K4me2 demethylation on ARE regions, which produce H2 O2 , are associated with AR targets transcription. AR targets transcription and coupled oxidation recruit 8-oxoguanine-DNA glycosylase (OGG1) and the nuclease APEX1 to ARE regions. Such recruitment depends on KDM1A, and is necessary for AR targets transcription. Our work underlined the importance of histone demethylation and DNA oxidation/repairing machinery in androgen-dependent transcription. The present finds have implications for research into new druggable targets for prostate cancer relying on the cascade of AR activity regulation. © 2015 Wiley Periodicals, Inc.
-
Kostopoulou, Ourania N.; Wilhelmi, Vanessa; Raiss, Sina; Ananthaseshan, Sharan; Lindström, Mikael S.; Bartek, Jiri; Söderberg-Naucler, Cecilia
2017-01-01
Human cytomegalovirus (HCMV) utilizes RNA polymerase II to transcribe viral genes and produce viral mRNAs. It can specifically target the nucleolus to facilitate viral transcription and translation. As RNA polymerase I (Pol I)-mediated transcription is active in the nucleolus, we investigated the role of Pol I, along with relative contributions of the human Pol II and Pol III, to early phases of viral transcription in HCMV infected cells, compared with Herpes Simplex Virus-1 (HSV-1) and Murine cytomegalovirus (MCMV). Inhibition of Pol I with siRNA or the Pol I inhibitors CX-5461 or Actinomycin D (5nM) resulted in significantly decreased IE and pp65 mRNA and protein levels in human fibroblasts at early times post infection. This initially delayed replication was compensated for later during the replication process, at which stage it didn’t significantly affect virus production. Pol I inhibition also reduced HSV-1 ICP0 and gB transcripts, suggesting that some herpesviruses engage Pol I for their early transcription. In contrast, inhibition of Pol I failed to affect MCMV transcription. Collectively, our results contribute to better understanding of the functional interplay between RNA Pol I-mediated nucleolar events and the Herpes viruses, particularly HCMV whose pathogenic impact ranges from congenital malformations and potentially deadly infections among immunosuppressed patients, up to HCMV’s emerging oncomodulatory role in human tumors. PMID:29228551
-
Park, Jong-Beom; Park, Chanjoo
2017-10-01
In vitro cell culture model. To investigate the effect of small interfering RNA (siRNA) on Fas expression, apoptosis, and proliferation in serum-deprived rat disc cells. Synthetic siRNA can trigger an RNA interference (RNAi) response in mammalian cells and precipitate the inhibition of specific gene expression. However, the potential utility of siRNA technology in downregulation of specific genes associated with disc cell apoptosis remains unclear. Rat disc cells were isolated and cultured in the presence of either 10% fetal bovine serum (FBS) (normal control) or 0% FBS (serum deprivation to induce apoptosis) for 48 hours. Fas expression, apoptosis, and proliferation were determined. Additionally, siRNA oligonucleotides against Fas (Fas siRNA) were transfected into rat disc cells to suppress Fas expression. Changes in Fas expression were assessed by reverse transcription-polymerase chain reaction and semiquantitatively analyzed using densitometry. The effect of Fas siRNA on apoptosis and proliferation of rat disc cells were also determined. Negative siRNA and transfection agent alone (Mock) were used as controls. Serum deprivation increased apoptosis by 40.3% ( p <0.001), decreased proliferation by 45.3% ( p <0.001), and upregulated Fas expression. Additionally, Fas siRNA suppressed Fas expression in serum-deprived cultures, with 68.5% reduction at the mRNA level compared to the control cultures ( p <0.001). Finally, Fas siRNA-mediated suppression of Fas expression significantly inhibited apoptosis by 9.3% and increased proliferation by 21% in serum-deprived cultures ( p <0.05 for both). The observed dual positive effect of Fas siRNA might be a powerful therapeutic approach for disc degeneration by suppression of harmful gene expression.
-
Gao, Xiao-Ling; Yang, Jiao-Jiao; Wang, Shu-Juan; Chen, Yan; Wang, Bei; Cheng, Er-Jing; Gong, Jian-Nan; Dong, Yan-Ting; Liu, Dai; Wang, Xiang-Li; Huang, Ya-Qiong; An, Dong-Dong
2018-06-22
Breast cancer is known as the most prevalent cancer in women worldwide, and has an undeniable negative impact on public health, both physically, and mentally. This study aims to investigate the effects of toll-like receptor 4 (TLR4) gene silencing on proliferation and apoptosis of human breast cancer cells to explore for a new theoretical basis for its treatment. TLR4 small interference RNA (siRNA) fragment recombinant plasmids were constructed, including TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3. Human breast cancer MCF-7 and MDA-MB-231 cells were assigned into blank, negative control (NC), TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3 groups. MCF-7 and MDA-MB-231 cell growth was detected by MTT assay. Apoptosis and cell cycle were determined by flow cytometry. Reverse transcription quantitative polymerase chain reaction (RT-qPCR) and Western blot analysis were conducted to determine the expression of TLR4, CDK4, cyclin D1, Livin, Bcl-2, p53, c-FLIP, and caspase-3. In comparison with the NC and blank groups, the TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3 groups showed decreased the expression of TLR4, inhibited proliferation of MCF-7 and MDA-MB-231 cells and promoted MCF-7 and MDA-MB-231 cell apoptosis, and the cells were blocked in G1 phase. In comparison with the NC and blank groups, in the TLR4 siRNA-1, TLR4 siRNA-2, and TLR4 siRNA-3 groups, siRNA-TLR4 significantly increased expression of p53 and caspase-3 in MCF-7 and MDA-MB-231 cells, while it decreased the expressions of CDK4, cyclinD1, Livin, Bal-2, and c-FLIP. The study demonstrates that TLR4 gene silencing inhibits proliferation and induces apoptosis of MCF-7 and MDA-MB-231 cells. © 2018 Wiley Periodicals, Inc.
-
Using small RNA deep sequencing data to detect siRNA duplexes induced by plant viruses
USDA-ARS?s Scientific Manuscript database
Small interfering RNA (siRNA) duplexes are produced in plants during virus infection, which are short (usually 21 to 24-base pair) double-stranded RNAs (dsRNAs) with several overhanging nucleotides on the 5' end and 3' end. The investigation of the siRNA duplexes is useful to better understand the R...
-
Establishment of conditional vectors for hairpin siRNA knockdowns
Matsukura, Shiro; Jones, Peter A.; Takai, Daiya
2003-01-01
Small interference RNA (siRNA) is an emerging methodology in reverse genetics. Here we report the development of a new tetracycline-inducible vector-based siRNA system, which uses a tetracycline-responsive derivative of the U6 promoter and the tetracycline repressor for conditional in vivo transcription of short hairpin RNA. This method prevents potential lethality immediately after transfection of a vector when the targeted gene is indispensable, or the phenotype of the knockdown is lethal or results in a growth abnormality. We show that the controlled knockdown of DNA methyltransferase 1 (DNMT1) in human cancer resulted in growth arrest. Removal of the inducer, doxycycline, from treated cells led to re-expression of the targeted gene. Thus the method allows for a highly controlled approach to gene knockdown. PMID:12888529
-
Design of siRNA Therapeutics from the Molecular Scale
Angart, Phillip; Vocelle, Daniel; Chan, Christina; Walton, S. Patrick
2013-01-01
While protein-based therapeutics is well-established in the market, development of nucleic acid therapeutics has lagged. Short interfering RNAs (siRNAs) represent an exciting new direction for the pharmaceutical industry. These small, chemically synthesized RNAs can knock down the expression of target genes through the use of a native eukaryotic pathway called RNA interference (RNAi). Though siRNAs are routinely used in research studies of eukaryotic biological processes, transitioning the technology to the clinic has proven challenging. Early efforts to design an siRNA therapeutic have demonstrated the difficulties in generating a highly-active siRNA with good specificity and a delivery vehicle that can protect the siRNA as it is transported to a specific tissue. In this review article, we discuss design considerations for siRNA therapeutics, identifying criteria for choosing therapeutic targets, producing highly-active siRNA sequences, and designing an optimized delivery vehicle. Taken together, these design considerations provide logical guidelines for generating novel siRNA therapeutics. PMID:23976875
-
Zhao, Yan; Shi, Xue; Ding, Chunchun; Feng, Dongcheng; Li, Yang; Hu, Yan; Wang, Li; Gao, Dongyan; Tian, Xiaofeng; Yao, Jihong
2018-01-15
Carnosic acid (CA), a major bioactive component in rosemary extract, has many biological and pharmaceutical activities. Smad3 acetylation can regulate the transcription of type I α2 collagen (COL1A2), which is the major component of the extracellular matrix (ECM). The aim of the current study was to evaluate whether CA inhibits COL1A2 transcription via the reduction of Smad3 acetylation against liver fibrosis. The results showed that CA treatment significantly suppressed COL1A2 transcription and markedly decreased the deposition of ECM induced by dimethylamine (DMN) in rats. Importantly, the suppression of COL1A2 transcription following CA treatment depended on the reduction of Smad3 acetylation via the activation of Sirtuin 1 (SIRT1), a nicotinamide adenine dinucleotide + (NAD + )-dependent deacetylase. SIRT1 siRNA increased the acetylation of Smad3 and blocked CA-down-regulated Smad3 deacetylation. Notably, CA-mediated AMP-activated protein kinase-α1 (AMPKα1) activation not only increased AMPKα1 phosphorylation but also increased SIRT1 expression, thus leading to a significant reduction in Smad3 acetylation. Furthermore, CA-mediated SIRT1 activation was inhibited by AMPKα1 siRNA. Collectively, CA can inhibit the transcription of COL1A2 through SIRT1-mediated Smad3 deacetylation, and the activation of SIRT1 by CA involves the AMPKα1/SIRT1 pathway in liver fibrosis. Copyright © 2017 Elsevier Inc. All rights reserved.
-
Li, L; Yang, L; Scudiero, D A; Miller, S A; Yu, Z-X; Stukenberg, P T; Shoemaker, R H; Kotin, R M
2007-05-01
Transcript depletion using small interfering RNA (siRNA) technology represents a potentially valuable technique for the treatment of cancer. However, delivering therapeutic quantities of siRNA into solid tumors by chemical transfection is not feasible, whereas viral vectors efficiently transduce many human tumor cell lines. Yet producing sufficient quantities of viral vectors that elicit acute and selective cytotoxicity remains a major obstacle for preclinical and clinical trials. Using the invertebrate Spodoptera frugiperda (Sf9) cell line, we were able to produce high titer stocks of cytotoxic recombinant adeno-associated virus (rAAV) that express short hairpin RNA (shRNA) and that efficiently deplete Hec1 (highly expressed in cancer 1), or Kntc2 (kinetochore-associated protein 2), a kinetochore protein directly involved in kinetochore microtubule interactions, chromosome congression and spindle checkpoint signaling. Depletion of Hec1 protein results in persistent spindle checkpoint activation followed by cell death. Because Hec1 expression and activity are only present in mitotic cells, non-dividing cells were not affected by rAAV treatment. On the basis of the results of screening 56 human tumor cell lines with three different serotype vectors, we used a tumor xenograft model to test the effects in vivo. The effects of the shHec1 vector were evident in sectioned and stained tumors. The experiments with rAAV-shRNA vectors demonstrate the utility of producing vectors in invertebrate cells to obtain sufficient concentrations and quantities for solid tumor therapy. This addresses an important requirement for cancer gene therapy, to produce cytotoxic vectors in sufficient quantities and concentrations to enable quantitative transduction and selective killing of solid tumor cells.
-
Shahzad, Mian MK; Mangala, Lingegowda S; Han, Hee Dong; Lu, Chunhua; Bottsford-Miller, Justin; Nishimura, Masato; Mora, Edna M; Lee, Jeong-Won; Stone, Rebecca L; Pecot, Chad V; Thanapprapasr, Duangmani; Roh, Ju-Won; Gaur, Puja; Nair, Maya P; Park, Yun-Yong; Sabnis, Nirupama; Deavers, Michael T; Lee, Ju-Seog; Ellis, Lee M; Lopez-Berestein, Gabriel; McConathy, Walter J; Prokai, Laszlo; Lacko, Andras G; Sood, Anil K
2011-01-01
RNA interference holds tremendous potential as a therapeutic approach, especially in the treatment of malignant tumors. However, efficient and biocompatible delivery methods are needed for systemic delivery of small interfering RNA (siRNA). To maintain a high level of growth, tumor cells scavenge high-density lipoprotein (HDL) particles by overexpressing its receptor: scavenger receptor type B1 (SR-B1). In this study, we exploited this cellular characteristic to achieve efficient siRNA delivery and established a novel formulation of siRNA by incorporating it into reconstituted HDL (rHDL) nanoparticles. Here, we demonstrate that rHDL nanoparticles facilitate highly efficient systemic delivery of siRNA in vivo, mediated by the SR-B1. Moreover, in therapeutic proof-of-concept studies, these nanoparticles were effective in silencing the expression of two proteins that are key to cancer growth and metastasis (signal transducer and activator of transcription 3 and focal adhesion kinase) in orthotopic mouse models of ovarian and colorectal cancer. These data indicate that an rHDL nanoparticle is a novel and highly efficient siRNA carrier, and therefore, this novel technology could serve as the foundation for new cancer therapeutic approaches. PMID:21472135
-
Williamson, Tracy P; Johnson, Delinda A; Johnson, Jeffrey A
2012-06-01
Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that binds to the antioxidant response element, a cis-acting regulatory element that increases expression of detoxifying enzymes and antioxidant proteins. Kelch-like ECH associating protein 1 (Keap1) protein is a negative regulator of Nrf2. Previous work has shown that genetic overexpression of Nrf2 is protective in vitro and in vivo. To modulate the Nrf2-ARE system without overexpressing Nrf2, we used short interfering RNA (siRNA) directed against Keap1. Keap1 siRNA administration in primary astrocytes increased the levels of Nrf2-ARE driven genes and protected against oxidative stress. Moreover, Keap1 siRNA resulted in a persistent upregulation of the Nrf2-ARE pathway and protection against oxidative stress in primary astrocytes. Keap1 siRNA injected into the striatum was also modestly protective against MPTP-induced dopaminergic terminal damage. These data indicate that activation of endogenous intracellular levels of Nrf2 is sufficient to protect in models of oxidative stress and Parkinson's disease. Copyright © 2012 Elsevier Inc. All rights reserved.
-
De Backer, Lynn; Cerrada, Alejandro; Pérez-Gil, Jesús; De Smedt, Stefaan C; Raemdonck, Koen
2015-12-28
Many pathologies of the respiratory tract are inadequately treated with existing small molecule-based therapies. The emergence of RNA interference (RNAi) enables the post-transcriptional silencing of key molecular disease factors that cannot readily be targeted with conventional small molecule drugs. Pulmonary administration of RNAi effectors, such as small interfering RNA (siRNA), allows direct delivery into the lung tissue, hence reducing systemic exposure. Unfortunately, the clinical translation of RNAi is severely hampered by inefficient delivery of siRNA therapeutics towards the cytoplasm of the target cells. In order to have a better control of the siRNA delivery process, both extra- and intracellular, siRNAs are typically formulated in nanosized delivery vehicles (nanoparticles, NPs). In the lower airways, which are the targeted sites of action for multiple pulmonary disorders, these siRNA-loaded NPs will encounter the pulmonary surfactant (PS) layer, covering the entire alveolar surface. The interaction between the instilled siRNA-loaded NPs and the PS at this nano-bio interface results in the adsorption of PS components onto the surface of the NPs. The formation of this so-called biomolecular corona conceals the original NP surface and will therefore profoundly determine the biological efficacy of the NP. Though this interplay has initially been regarded as a barrier towards efficient siRNA delivery to the respiratory target cell, recent reports have illustrated that the interaction with PS might also be beneficial for local pulmonary siRNA delivery.
-
siRNA as a tool to improve the treatment of brain diseases: Mechanism, targets and delivery.
Gomes, Maria João; Martins, Susana; Sarmento, Bruno
2015-05-01
As the population ages, brain pathologies such as neurodegenerative diseases and brain cancer increase their incidence, being the need to find successful treatments of upmost importance. Drug delivery to the central nervous system (CNS) is required in order to reach diseases causes and treat them. However, biological barriers, mainly blood-brain barrier (BBB), are the key obstacles that prevent the effectiveness of possible treatments due to their ability to strongly limit the perfusion of compounds into the brain. Over the past decades, new approaches towards overcoming BBB and its efflux transporters had been proposed. One of these approaches here reviewed is through small interfering RNA (siRNA), which is capable to specifically target one gene and silence it in a post-transcriptional way. There are different possible functional proteins at the BBB, as the ones responsible for transport or just for its tightness, which could be a siRNA target. As important as the effective silence is the way to delivery siRNA to its anatomical site of action. This is where nanotechnology-based systems may help, by protecting siRNA circulation and providing cell/tissue-targeting and intracellular siRNA delivery. After an initial overview on incidence of brain diseases and basic features of the CNS, BBB and its efflux pumps, this review focuses on recent strategies to reach brain based on siRNA, and how to specifically target these approaches in order to treat brain diseases. Copyright © 2015 Elsevier B.V. All rights reserved.
-
Novel liposomal combination treatments using dual genes knockdown in oral cancer treatment
NASA Astrophysics Data System (ADS)
Wu, Jyun-Sian; Yeh, Chia-Hsien; Huang, Leaf; Hsu, Yih-Chih
2018-02-01
Small interfering RNA (siRNA) can be used to treat tumor because it can effectively knockdown target oncoprotein expression and it leads to cancer cell death and apoptosis. Hypoxia-inducible factors-1 (HIF-1) is a transcription factor gene. Its high expression of tumor hypoxia cells, activation of transcription factor HIF-1α and angiogenesis found in most cancerous tissues. HIF-1α protein in cancer cells are critical to cell survival, tumor growth and proliferation. Epidermal growth factor receptor (EGFR) gene is another common head and neck oncogene. The dual self-designed siRNA sequences were encapsulated in the lipid-calcium-phosphate (LCP) and targeted to sigma receptors on the surface of cancer cells via binding to amino ethyl anisamide (AEAA). We used human oral cancer cells to establish the xenograft animal model to study the combination therapy for therapeutic results.
-
Mobile Transcripts and Intercellular Communication in Plants.
Saplaoura, E; Kragler, F
2016-01-01
Phloem serves as a highway for mobile signals in plants. Apart from sugars and hormones, proteins and RNAs are transported via the phloem and contribute to the intercellular communication coordinating growth and development. Different classes of RNAs have been found mobile and in the phloem exudate such as viral RNAs, small interfering RNAs (siRNAs), microRNAs, transfer RNAs, and messenger RNAs (mRNAs). Their transport is considered to be mediated via ribonucleoprotein complexes formed between phloem RNA-binding proteins and mobile RNA molecules. Recent advances in the analysis of the mobile transcriptome indicate that thousands of transcripts move along the plant axis. Although potential RNA mobility motifs were identified, research is still in progress on the factors triggering siRNA and mRNA mobility. In this review, we discuss the approaches used to identify putative mobile mRNAs, the transport mechanism, and the significance of mRNA trafficking. © 2016 Elsevier Inc. All rights reserved.
-
A single miR390 targeting event is sufficient for triggering TAS3-tasiRNA biogenesis in Arabidopsis
Marchais, Antonin; Sarazin, Alexis; Oberlin, Stefan; Voinnet, Olivier
2017-01-01
Abstract In plants, tasiRNAs form a class of endogenous secondary siRNAs produced through the action of RNA-DEPENDENT-RNA-POLYMERASE-6 (RDR6) upon microRNA-mediated cleavage of non-coding TAS RNAs. In Arabidopsis thaliana, TAS1, TAS2 and TAS4 tasiRNA production proceeds via a single cleavage event mediated by 22nt-long or/and asymmetric miRNAs in an ARGONAUTE-1 (AGO1)-dependent manner. By contrast, tasiRNA production from TAS3 seems to follow the so-called ‘two-hit’ process, where dual targeting of TAS3, specifically mediated by the 21nt-long, symmetric miR390, initiates AGO7-dependent tasiRNA production. Interestingly, features for TAS3 tasiRNA production differ in other plant species and we show here that such features also enable TAS3 tasiRNA biogenesis in Arabidopsis, and that a single miR390 targeting event is, in fact, sufficient for this process, suggesting that the ‘one-hit’ model underpins all the necessary rudiments of secondary siRNA biogenesis from plant TAS transcripts. Further results suggest that the two-hit configuration likely enhances the fidelity of tasiRNA production and, hence, the accuracy of downstream gene regulation. Finally, we show that a ‘non-cleavable one-hit’ process allows tasiRNA production from both TAS1 and TAS3 transcripts, indicating that RDR6 recruitment does not require miRNA cleavage, nor does the recruitment, as we further show, of SUPRRESSOR-OF-GENE-SILENCING-3, indispensable for tasiRNA generation. PMID:28334969
-
Han, Yao; Zhang, Bin; Qin, Xiaoting; Li, Mingyang; Guo, Yulong
2015-01-01
MIGS (miRNA-induced gene silencing) is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs). MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase) and PDS (phytoene desaturase) gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant functions.
-
Han, Yao; Zhang, Bin; Qin, Xiaoting; Li, Mingyang; Guo, Yulong
2015-01-01
MIGS (miRNA-induced gene silencing) is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs). MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase) and PDS (phytoene desaturase) gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5′- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant functions. PMID:26658695
-
Relationship between serum response factor and androgen receptor in prostate cancer.
Prencipe, Maria; O'Neill, Amanda; O'Hurley, Gillian; Nguyen, Lan K; Fabre, Aurelie; Bjartell, Anders; Gallagher, William M; Morrissey, Colm; Kay, Elaine W; Watson, R William
2015-11-01
Serum response factor (SRF) is an important transcription factor in castrate-resistant prostate cancer (CRPC). Since CRPC is associated with androgen receptor (AR) hypersensitivity, we investigated the relationship between SRF and AR. Transcriptional activity was assessed by luciferase assay. Cell proliferation was measured by MTT and flow cytometry. Protein expression in patients was assessed by immunohistochemistry. To investigate AR involvement in SRF response to androgen, AR expression was down-regulated using siRNA. This resulted in the abrogation of SRF induction post-DHT. Moreover, DHT stimulation failed to induce SRF transcriptional activity in AR-negative PC346 DCC cells, which was only restored following AR over-expression. Next, SRF expression was down-regulated by siRNA, resulting in AR increased transcriptional activity in castrate-resistant LNCaP Abl cells but not in the parental LNCaP. This negative feedback loop in the resistant cells was confirmed by immunohistochemistry which showed a negative correlation between AR and SRF expression in CRPC bone metastases and a positive correlation in androgen-naïve prostatectomies. Cell proliferation was next assessed following SRF inhibition, demonstrating that SRF inhibition is more effective than AR inhibition in castrate-resistant cells. Our data support SRF as a promising therapeutic target in combination with current treatments. © 2015 Wiley Periodicals, Inc.
-
Murali, Reena; John, Philips George; Peter S, David
2015-05-15
The ability of small interfering RNA (siRNA) to do posttranscriptional gene regulation by knocking down targeted genes is an important research topic in functional genomics, biomedical research and in cancer therapeutics. Many tools had been developed to design exogenous siRNA with high experimental inhibition. Even though considerable amount of work has been done in designing exogenous siRNA, design of effective siRNA sequences is still a challenging work because the target mRNAs must be selected such that their corresponding siRNAs are likely to be efficient against that target and unlikely to accidentally silence other transcripts due to sequence similarity. In some cases, siRNAs may tolerate mismatches with the target mRNA, but knockdown of genes other than the intended target could make serious consequences. Hence to design siRNAs, two important concepts must be considered: the ability in knocking down target genes and the off target possibility on any nontarget genes. So before doing gene silencing by siRNAs, it is essential to analyze their off target effects in addition to their inhibition efficacy against a particular target. Only a few methods have been developed by considering both efficacy and off target possibility of siRNA against a gene. In this paper we present a new design of neural network model with whole stacking energy (ΔG) that enables to identify the efficacy and off target effect of siRNAs against target genes. The tool lists all siRNAs against a particular target with their inhibition efficacy and number of matches or sequence similarity with other genes in the database. We could achieve an excellent performance of Pearson Correlation Coefficient (R=0. 74) and Area Under Curve (AUC=0.906) when the threshold of whole stacking energy is ≥-34.6 kcal/mol. To the best of the author's knowledge, this is one of the best score while considering the "combined efficacy and off target possibility" of siRNA for silencing a gene. The proposed model shall be useful for designing exogenous siRNA for therapeutic applications and gene silencing techniques in the area of bioinformatics. The software is developed as a desktop application and available at http://opsid.in/opsid/. Copyright © 2015 Elsevier B.V. All rights reserved.
-
Yagi, Nobuhiro; Manabe, Ichiro; Tottori, Tsuneaki; Ishihara, Atsushi; Ogata, Fusa; Kim, Jong Heon; Nishimura, Satoshi; Fujiu, Katsuhito; Oishi, Yumiko; Itaka, Keiji; Kato, Yasuki; Yamauchi, Masahiro; Nagai, Ryozo
2009-08-15
Use of short interfering RNA (siRNA) is a promising new approach thought to have a strong potential to lead to rapid development of gene-oriented therapies. Here, we describe a newly developed, systemically injectable siRNA vehicle, the "wrapsome" (WS), which contains siRNA and a cationic lipofection complex in a core that is fully enveloped by a neutral lipid bilayer and hydrophilic polymers. WS protected siRNA from enzymatic digestion, providing a long half-life in the systemic circulation. Moreover, siRNA/WS leaked from blood vessels within tumors into the tumor tissue, where it accumulated and was subsequently transfected into the tumor cells. Because the transcription factor KLF5 is known to play a role in tumor angiogenesis, we designed KLF5-siRNA to test the antitumor activity of siRNA/WS. KLF5-siRNA/WS exhibited significant antitumor activity, although neither WS containing control scrambled-siRNA nor saline containing KLF5-siRNA affected tumor growth. KLF5-siRNA/WS inhibited Klf5 expression within tumors at both mRNA and protein levels, significantly reducing angiogenesis, and we detected no significant acute or long-term toxicity. Our findings support the idea that siRNA/WS can be used to knock down specific genes within tumors and thereby exert therapeutic effects against cancers.
-
RNA interference: new mechanistic and biochemical insights with application in oral cancer therapy.
Buduru, Smaranda; Zimta, Alina-Andreea; Ciocan, Cristina; Braicu, Cornelia; Dudea, Diana; Irimie, Alexandra Iulia; Berindan-Neagoe, Ioana
2018-01-01
Over the last few decades, the incidence of oral cancer has gradually increased, due to the negative influence of environmental factors and also abnormalities within the genome. The main issues in oral cancer treatment consist in surpassing resistance and recurrence. However, continuous discovery of altered signaling pathways in these tumors provides valuable information for the identification of novel gene candidates targeted in personalized therapy. RNA interference (RNAi) is a natural mechanism that involves small interfering RNA (siRNA); this can be exploited in biomedical research by using natural or synthetic constructs for activation of the mechanism. Synthetic siRNA transcripts were developed as a versatile class of molecular tools that have a diverse range of programmable roles, being involved in the regulation of several biological processes, thereby providing the perspective of an alternative option to classical treatment. In this review, we summarize the latest information related to the application of siRNA in oral malignancy together with molecular aspects of the technology and also the perspective upon the delivery system. Also, the emergence of newer technologies such as clustered regularly interspaced short palindromic repeats/Cas9 or transcription activator-like effector nucleases in comparison with the RNAi approach is discussed in this paper.
-
Liu, Na; Wang, Yafang; Zhou, Yongan; Pang, Hailin; Zhou, Jing; Qian, Pei; Liu, Lili; Zhang, Helong
2014-12-01
Previously, we reported that hypoxia was able to induce invasion and metastasis in gastric cancer and that hypoxia-inducible factor-1 (HIF-1) is a key factor involved in this tumor type. Krüppel-like factor 8 (KLF8) as a transcriptional repressor has been suggested as a promoter of tumor metastasis in breast cancer and an inducer of the epithelial‑mesenchymal transition (EMT). KLF8 is also highly expressed in gastric cancer tissues, contributing to poor prognosis. However, the association between KLF8 and HIF-1 in regulating the progression of human gastric cancer in hypoxia is unclear. In the present study, we found that KLF8 was overexpressed in gastric cancer metastatic tissues and cells. Additionally, KLF8 siRNA significantly inhibited SGC7901 cell invasion and migration compared with SGC7901, SGC7901/Scr-si cells. Hypoxia is thus able to induce KLF8 expression and EMT in SGC7901 cells. However, following the examination of changes in cell morphology and epithelial and mesenchymal markers, it was found that KLF8 siRNA and HIF-1 siRNA strongly reversed EMT in cells undergoing hypoxia. Furthermore, hypoxia-induced KLF8 overexpression was attenuated by HIF-1 siRNA. Experiments using luciferase promoter constructs resulted in a marked increase in the activity of cells exposed to hypoxia and decreased activity in cells co-transfected with HIF-1 siRNA. The chromatin immunoprecipitation assay revealed proximal HRE at -133 is the main HIF-1 binding site in the KLF8 promoter. In conclusion, the results demonstrated that KLF8 is actively enhanced by hypoxia and is a novel HIF-1 target. KLF8 is a novel EMT regulating transcription factor that involved in the progression of gastric cancer. The specific anti-EMT drugs in combination with anti-hypoxia are new promising cancer therapies.
-
Thakur, Nidhi; Upadhyay, Santosh Kumar; Verma, Praveen C.; Chandrashekar, Krishnappa; Tuli, Rakesh; Singh, Pradhyumna K.
2014-01-01
Background Expression of double strand RNA (dsRNA) designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi), thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci) upon oral feeding. The v-ATPase subunit A (v-ATPaseA) coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. Methodology/Principal Findings Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. Conclusions/Significance Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops. PMID:24595215
-
Doucette, Lance P; Footz, Tim; Walter, Michael A
2018-05-01
This study examines the effect of FOXC1 on the prostaglandin pathway in order to explore FOXC1's role in the prostaglandin-resistant glaucoma phenotype commonly seen in Axenfeld-Rieger syndrome. Binding and transcriptional activity of FOXC1 to the gene coding for the EP3 prostaglandin receptor (PTGER3) were evaluated through ChIP-qPCR and luciferase-based assays. Immortalized trabecular meshwork cells (TM1) and HeLa cells had FOXC1 mRNA reduced via siRNA interference. qPCR and Western blot experiments were conducted to examine the changes in prostaglandin receptor expression brought about by lowered FOXC1. TM1 cells were then treated with 10 μM latanoprost acid and/or an siRNA for FOXC1. The expression of fibronectin and matrix metalloproteinase 9 were evaluated via qPCR in each treatment condition. ChIP-qPCR and luciferase experiments confirmed that FOXC1 binds to and activates transcription of the EP3 gene prostaglandin receptor. qPCR and Western experiments in HeLa and TM1 cells showed that FOXC1 siRNA knockdown results in significantly lowered EP3 levels (protein and RNA). In addition, RNA levels of the other prostaglandin receptor genes EP1 (PTGER1), EP2 (PTGER2), EP4 (PTGER4), and FP (PTGFR) were altered when FOXC1 was knocked down in TM1 and HeLa cells. Analysis of fibronectin expression in TM1 cells after treatment with 10 μM latanoprost acid showed a statistically significant increase in expression; this increase was abrogated by cotreatment with a siRNA for FOXC1. We show the abrogation of latanoprost signalling when FOXC1 is knocked down via siRNA in a trabecular meshwork cell line. We propose that the lower levels of active FOXC1 in Axenfeld-Rieger syndrome patients with glaucoma account for the lack of response to prostaglandin-based medications.
-
Suzuki, Harukazu; Forrest, Alistair R R; van Nimwegen, Erik; Daub, Carsten O; Balwierz, Piotr J; Irvine, Katharine M; Lassmann, Timo; Ravasi, Timothy; Hasegawa, Yuki; de Hoon, Michiel J L; Katayama, Shintaro; Schroder, Kate; Carninci, Piero; Tomaru, Yasuhiro; Kanamori-Katayama, Mutsumi; Kubosaki, Atsutaka; Akalin, Altuna; Ando, Yoshinari; Arner, Erik; Asada, Maki; Asahara, Hiroshi; Bailey, Timothy; Bajic, Vladimir B; Bauer, Denis; Beckhouse, Anthony G; Bertin, Nicolas; Björkegren, Johan; Brombacher, Frank; Bulger, Erika; Chalk, Alistair M; Chiba, Joe; Cloonan, Nicole; Dawe, Adam; Dostie, Josee; Engström, Pär G; Essack, Magbubah; Faulkner, Geoffrey J; Fink, J Lynn; Fredman, David; Fujimori, Ko; Furuno, Masaaki; Gojobori, Takashi; Gough, Julian; Grimmond, Sean M; Gustafsson, Mika; Hashimoto, Megumi; Hashimoto, Takehiro; Hatakeyama, Mariko; Heinzel, Susanne; Hide, Winston; Hofmann, Oliver; Hörnquist, Michael; Huminiecki, Lukasz; Ikeo, Kazuho; Imamoto, Naoko; Inoue, Satoshi; Inoue, Yusuke; Ishihara, Ryoko; Iwayanagi, Takao; Jacobsen, Anders; Kaur, Mandeep; Kawaji, Hideya; Kerr, Markus C; Kimura, Ryuichiro; Kimura, Syuhei; Kimura, Yasumasa; Kitano, Hiroaki; Koga, Hisashi; Kojima, Toshio; Kondo, Shinji; Konno, Takeshi; Krogh, Anders; Kruger, Adele; Kumar, Ajit; Lenhard, Boris; Lennartsson, Andreas; Lindow, Morten; Lizio, Marina; Macpherson, Cameron; Maeda, Norihiro; Maher, Christopher A; Maqungo, Monique; Mar, Jessica; Matigian, Nicholas A; Matsuda, Hideo; Mattick, John S; Meier, Stuart; Miyamoto, Sei; Miyamoto-Sato, Etsuko; Nakabayashi, Kazuhiko; Nakachi, Yutaka; Nakano, Mika; Nygaard, Sanne; Okayama, Toshitsugu; Okazaki, Yasushi; Okuda-Yabukami, Haruka; Orlando, Valerio; Otomo, Jun; Pachkov, Mikhail; Petrovsky, Nikolai; Plessy, Charles; Quackenbush, John; Radovanovic, Aleksandar; Rehli, Michael; Saito, Rintaro; Sandelin, Albin; Schmeier, Sebastian; Schönbach, Christian; Schwartz, Ariel S; Semple, Colin A; Sera, Miho; Severin, Jessica; Shirahige, Katsuhiko; Simons, Cas; St Laurent, George; Suzuki, Masanori; Suzuki, Takahiro; Sweet, Matthew J; Taft, Ryan J; Takeda, Shizu; Takenaka, Yoichi; Tan, Kai; Taylor, Martin S; Teasdale, Rohan D; Tegnér, Jesper; Teichmann, Sarah; Valen, Eivind; Wahlestedt, Claes; Waki, Kazunori; Waterhouse, Andrew; Wells, Christine A; Winther, Ole; Wu, Linda; Yamaguchi, Kazumi; Yanagawa, Hiroshi; Yasuda, Jun; Zavolan, Mihaela; Hume, David A; Arakawa, Takahiro; Fukuda, Shiro; Imamura, Kengo; Kai, Chikatoshi; Kaiho, Ai; Kawashima, Tsugumi; Kawazu, Chika; Kitazume, Yayoi; Kojima, Miki; Miura, Hisashi; Murakami, Kayoko; Murata, Mitsuyoshi; Ninomiya, Noriko; Nishiyori, Hiromi; Noma, Shohei; Ogawa, Chihiro; Sano, Takuma; Simon, Christophe; Tagami, Michihira; Takahashi, Yukari; Kawai, Jun; Hayashizaki, Yoshihide
2009-05-01
Using deep sequencing (deepCAGE), the FANTOM4 study measured the genome-wide dynamics of transcription-start-site usage in the human monocytic cell line THP-1 throughout a time course of growth arrest and differentiation. Modeling the expression dynamics in terms of predicted cis-regulatory sites, we identified the key transcription regulators, their time-dependent activities and target genes. Systematic siRNA knockdown of 52 transcription factors confirmed the roles of individual factors in the regulatory network. Our results indicate that cellular states are constrained by complex networks involving both positive and negative regulatory interactions among substantial numbers of transcription factors and that no single transcription factor is both necessary and sufficient to drive the differentiation process.
-
RNA therapeutics targeting osteoclast-mediated excessive bone resorption
Wang, Yuwei; Grainger, David W
2011-01-01
RNA interference (RNAi) is a sequence-specific post-transcriptional gene silencing technique developed with dramatically increasing utility for both scientific and therapeutic purposes. Short interfering RNA (siRNA) is currently exploited to regulate protein expression relevant to many therapeutic applications, and commonly used as a tool for elucidating disease-associated genes. Osteoporosis and their associated osteoporotic fragility fractures in both men and women are rapidly becoming a global healthcare crisis as average life expectancy increases worldwide. New therapeutics are needed for this increasing patient population. This review describes the diversity of molecular targets suitable for RNAi-based gene knock-down in osteoclasts to control osteoclast-mediated excessive bone resorption. We identify strategies for developing targeted siRNA delivery and efficient gene silencing, and describe opportunities and challenges of introducing siRNA as a therapeutic approach to hard and connective tissue disorders. PMID:21945356
-
Fujino, Takayuki; Muhib, Sharifi; Sato, Nobuyuki; Hasebe, Naoyuki
2013-12-01
p53, a pivotal protein in the apoptotic pathway, has been identified as a mediator of transcriptional responses to ischemia-reperfusion (IR) injury. The characteristics and functional significance of the p53 response in vivo are largely unknown in IR-induced kidney injury. Therapeutic opportunities of delivering small interfering RNA (siRNA) via venous injection have gained recognition; however, systemic adverse effects of siRNA therapy should be considered. To prevent IR-induced kidney injury, we tested the efficacy of transarterial administration of siRNA targeting p53 (p53 siRNA). Female C57BL/6 mice underwent unilateral renal artery ischemia for 30 min, followed by reperfusion. siRNA experiments utilized short hairpin (sh) RNA plasmid-based approaches. Transfection of shRNA was performed using cationic polymer transfection reagent. Injection of synthetic p53 shRNA into the left renal artery just after ischemia improved tubular injury, apoptosis, and the swelling of mitochondria in cells of the thick ascending limb of Henle (mTALH) at the outer medullary regions. Staining of upregulated p53 was colocalized with the inducible expression of glycogen synthase kinase-3β (GSK-3β) at mTALH after IR injury. p53 shRNA inhibited GSK-3β expression and restored β-catenin expression at mTALH. For IR-induced kidney injury, transarterial delivery of p53 siRNA is an effective pharmacological intervention. Targeting siRNA to p53 leads to an attenuation of apoptosis and mitochondrial damage through the downregulation of GSK-3β expression and upregulation of β-catenin. Local delivery of vectors such as p53 siRNA through a transaortic catheter is clinically useful in reducing the adverse effect of siRNA-related therapy.
-
Recognizing the enemy within: licensing RNA-guided genome defense
Dumesic, Phillip A.; Madhani, Hiten D.
2014-01-01
How do cells distinguish normal genes from transposons? Although much has been learned about RNAi-related RNA silencing pathways responsible for genome defense, this fundamental question remains. The literature points to several classes of mechanisms. In some cases, double-stranded RNA structures produced by transposon inverted repeats or antisense integration trigger endo-siRNA biogenesis. In other instances, DNA features associated with transposons—such as their unusual copy number, chromosomal arrangement, and/or chromatin environment—license RNA silencing. Finally, recent studies have identified improper transcript processing events, such as stalled pre-mRNA splicing, as signals for siRNA production. Thus, the suboptimal gene expression properties of selfish elements can enable their identification by RNA silencing pathways. PMID:24280023
-
Kwon, Ok-Seon; Kwon, Soo-Jung; Kim, Jin Sang; Lee, Gunbong; Maeng, Han-Joo; Lee, Jeongmi; Hwang, Gwi Seo; Cha, Hyuk-Jin; Chun, Kwang-Hoon
2018-05-01
Melanin is a pigment produced from tyrosine in melanocytes. Although melanin has a protective role against UVB radiation-induced damage, it is also associated with the development of melanoma and darker skin tone. Tyrosinase is a key enzyme in melanin synthesis, which regulates the rate-limiting step during conversion of tyrosine into DOPA and dopaquinone. To develop effective RNA interference therapeutics, we designed a melanin siRNA pool by applying multiple prediction programs to reduce human tyrosinase levels. First, 272 siRNAs passed the target accessibility evaluation using the RNAxs program. Then we selected 34 siRNA sequences with ΔG ≥-34.6 kcal/mol, i-Score value ≥65, and siRNA scales score ≤30. siRNAs were designed as 19-bp RNA duplexes with an asymmetric 3' overhang at the 3' end of the antisense strand. We tested if these siRNAs effectively reduced tyrosinase gene expression using qRT-PCR and found that 17 siRNA sequences were more effective than commercially available siRNA. Three siRNAs further tested showed an effective visual color change in MNT-1 human cells without cytotoxic effects, indicating these sequences are anti-melanogenic. Our study revealed that human tyrosinase siRNAs could be efficiently designed using multiple prediction algorithms.
-
Kwon, Ok-Seon; Kwon, Soo-Jung; Kim, Jin Sang; Lee, Gunbong; Maeng, Han-Joo; Lee, Jeongmi; Hwang, Gwi Seo; Cha, Hyuk-Jin; Chun, Kwang-Hoon
2018-01-01
Melanin is a pigment produced from tyrosine in melanocytes. Although melanin has a protective role against UVB radiation-induced damage, it is also associated with the development of melanoma and darker skin tone. Tyrosinase is a key enzyme in melanin synthesis, which regulates the rate-limiting step during conversion of tyrosine into DOPA and dopaquinone. To develop effective RNA interference therapeutics, we designed a melanin siRNA pool by applying multiple prediction programs to reduce human tyrosinase levels. First, 272 siRNAs passed the target accessibility evaluation using the RNAxs program. Then we selected 34 siRNA sequences with ΔG ≥−34.6 kcal/mol, i-Score value ≥65, and siRNA scales score ≤30. siRNAs were designed as 19-bp RNA duplexes with an asymmetric 3′ overhang at the 3′ end of the antisense strand. We tested if these siRNAs effectively reduced tyrosinase gene expression using qRT-PCR and found that 17 siRNA sequences were more effective than commercially available siRNA. Three siRNAs further tested showed an effective visual color change in MNT-1 human cells without cytotoxic effects, indicating these sequences are anti-melanogenic. Our study revealed that human tyrosinase siRNAs could be efficiently designed using multiple prediction algorithms. PMID:29223142
-
Okabe, Akishi; Urano, Yasuomi; Itoh, Sayoko; Suda, Naoto; Kotani, Rina; Nishimura, Yuki; Saito, Yoshiro; Noguchi, Noriko
2013-01-01
Lipid peroxidation products have been known to induce cellular adaptive responses and enhance tolerance against subsequent oxidative stress through up-regulation of antioxidant compounds and enzymes. 24S-hydroxycholesterol (24SOHC) which is endogenously produced oxysterol in the brain plays an important role in maintaining brain cholesterol homeostasis. In this study, we evaluated adaptive responses induced by brain-specific oxysterol 24SOHC in human neuroblastoma SH-SY5Y cells. Cells treated with 24SOHC at sub-lethal concentrations showed significant reduction in cell death induced by subsequent treatment with 7-ketocholesterol (7KC) in both undifferentiated and retinoic acid-differentiated SH-SY5Y cells. These adaptive responses were also induced by other oxysterols such as 25-hydroxycholesterol and 27-hydroxycholesterol which are known to be ligands of liver X receptor (LXR). Co-treatment of 24SOHC with 9-cis retinoic acid, a retinoid X receptor ligand, enhanced the adaptive responses. Knockdown of LXRβ by siRNA diminished the adaptive responses induced by 24SOHC almost completely. The treatment with 24SOHC induced the expression of LXR target genes, such as ATP-binding cassette transporter A1 (ABCA1) and G1 (ABCG1). The 24SOHC-induced adaptive responses were significantly attenuated by siRNA for ABCG1 but not by siRNA for ABCA1. Taken together, these results strongly suggest that 24SOHC at sub-lethal concentrations induces adaptive responses via transcriptional activation of LXR signaling pathway, thereby protecting neuronal cells from subsequent 7KC-induced cytotoxicity. PMID:24371802
-
Global effects of the CSR-1 RNA interference pathway on the transcriptional landscape.
Cecere, Germano; Hoersch, Sebastian; O'Keeffe, Sean; Sachidanandam, Ravi; Grishok, Alla
2014-04-01
Argonaute proteins and their small RNA cofactors short interfering RNAs are known to inhibit gene expression at the transcriptional and post-transcriptional levels. In Caenorhabditis elegans, the Argonaute CSR-1 binds thousands of endogenous siRNAs (endo-siRNAs) that are antisense to germline transcripts. However, its role in gene expression regulation remains controversial. Here we used genome-wide profiling of nascent RNA transcripts and found that the CSR-1 RNA interference pathway promoted sense-oriented RNA polymerase II transcription. Moreover, a loss of CSR-1 function resulted in global increase in antisense transcription and ectopic transcription of silent chromatin domains, which led to reduced chromatin incorporation of centromere-specific histone H3. On the basis of these findings, we propose that the CSR-1 pathway helps maintain the directionality of active transcription, thereby propagating the distinction between transcriptionally active and silent genomic regions.
-
Zhao, Dongyan; Song, Guo-qing
2014-12-01
Small interfering RNAs (siRNAs) are silencing signals in plants. Virus-resistant transgenic rootstocks developed through siRNA-mediated gene silencing may enhance virus resistance of nontransgenic scions via siRNAs transported from the transgenic rootstocks. However, convincing evidence of rootstock-to-scion movement of siRNAs of exogenous genes in woody plants is still lacking. To determine whether exogenous siRNAs can be transferred, nontransgenic sweet cherry (scions) was grafted on transgenic cherry rootstocks (TRs), which was transformed with an RNA interference (RNAi) vector expressing short hairpin RNAs of the genomic RNA3 of Prunus necrotic ringspot virus (PNRSV-hpRNA). Small RNA sequencing was conducted using bud tissues of TRs and those of grafted (rootstock/scion) trees, locating at about 1.2 m above the graft unions. Comparison of the siRNA profiles revealed that the PNRSV-hpRNA was efficient in producing siRNAs and eliminating PNRSV in the TRs. Furthermore, our study confirmed, for the first time, the long-distance (1.2 m) transfer of PNRSV-hpRNA-derived siRNAs from the transgenic rootstock to the nontransgenic scion in woody plants. Inoculation of nontransgenic scions with PNRSV revealed that the transferred siRNAs enhanced PNRSV resistance of the scions grafted on the TRs. Collectively, these findings provide the foundation for 'using transgenic rootstocks to produce products of nontransgenic scions in fruit trees'. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
-
Chen, X G; Liu, Y M; Lv, Q X; Ma, J
2017-01-01
We investigated the effects of recombinant adenovirus vectors that overexpress or silence PLCγ2 on the expression of this gene during hepatocyte proliferation. Hepatocytes were isolated, identified by immunofluorescent cytochemical staining and infected by previously constructed Ad-PLCγ2 and Ad-PLCγ2 siRNA1, siRNA2 and siRNA3. Green fluorescent protein (GFP) expression was observed by fluorescence microscopy. Infection percentage was calculated by flow cytometry. mRNA and protein levels of PLCγ2 were detected by quantitative reverse transcription-PCR (qRT-PCR) and western blotting, respectively. The viability of the infected hepatocytes was measured by 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. We found that nearly 97% of cells were positive for the hepatocyte marker, CK18. After infection of Ad-PLCγ2 and Ad-PLCγ2 siRNA, more than 99% of hepatocytes expressed GFP significantly, and mRNA and protein expression of PLCγ2 was up-regulated significantly in Ad-PLCγ2 infected hepatocytes, but down-regulated in Ad-PLCγ2 siRNA2 infected cells. The cell proliferation rate decreased in PLCγ2-overexpressing cells, while the rate increased in PLCγ2-silencing cells. We verified that recombinant Ad-PLCγ2 and Ad-PLCγ2 siRNA2 were constructed successfully. These two recombinant vectors promoted or decreased the expression of PLCγ2 in rat hepatocytes and affected the cell proliferation rate, which provides a useful tool for further investigation of the role of PLCγ2 in hepatocyte apoptosis.
-
Kasai, Atsushi; Sano, Teruo; Harada, Takeo
2013-01-01
Plants can attenuate the replication of plant viruses and viroids by RNA silencing induced by virus and viroid infection. In higher plants, silencing signals such as small interfering RNAs (siRNAs) produced by RNA silencing can be transported systemically through phloem, so it is anticipated that antiviral siRNA signals produced in a stock would have the potential to attenuate propagation of viruses or viroids in the scion. To test whether this is indeed the case, we prepared transgenic tobacco (Nicotiana benthamiana) expressing a hairpin RNA (hpRNA) of Potato spindle tuber viroid (PSTVd) in companion cells by using a strong companion cell-specific promoter. A grafting experiment of the wild type tobacco scion on the top of the transgenic tobacco stock revealed that accumulation of PSTVd challenge-inoculated into the scion was apparently attenuated compared to the control grafted plants. These results indicate that genetically modified rootstock expressing viroid-specific siRNAs can attenuate viroid accumulation in a non-genetically modified scion grafted on the stock. PMID:23469061
-
Wang, Qin; Jiang, Hao; Li, Yan; Chen, Wenfei; Li, Hanmei; Peng, Ke; Zhang, Zhirong; Sun, Xun
2017-04-01
The transcription factor NF-kB plays a pivotal role in the pathogenesis of rheumatoid arthritis. Here we attempt to slow arthritis progression by co-delivering the glucocorticoid dexamethasone (Dex) and small-interfering RNA targeting NF-kB p65 using our previously developed polymeric hybrid micelle system. These micelles contain two similar amphiphilic copolymers: polycaprolactone-polyethylenimine (PCL-PEI) and polycaprolactone-polyethyleneglycol (PCL-PEG). The hybrid micelles loaded with Dex and siRNA effectively inhibited NF-kB signaling in murine macrophages more efficiently than micelles containing either Dex or siRNA on their own. In addition, the co-delivery system was able to switch macrophages from the M1 to M2 state. Injecting hybrid micelles containing Dex and siRNA into mice with collagen-induced arthritis led the therapeutic agents to accumulate in inflamed joints and reduce inflammation, without damaging renal or liver function. Thus, blocking NF-kB activation in inflammatory tissue using micelle-based co-delivery may provide a new approach for treating inflammatory disease. Copyright © 2017 Elsevier Ltd. All rights reserved.
-
Soifer, Harris S; Zaragoza, Adriana; Peyvan, Maany; Behlke, Mark A; Rossi, John J
2005-01-01
Long interspersed nuclear elements (LINE-1 or L1) comprise 17% of the human genome, although only 80-100 L1s are considered retrotransposition-competent (RC-L1). Despite their small number, RC-L1s are still potential hazards to genome integrity through insertional mutagenesis, unequal recombination and chromosome rearrangements. In this study, we provide several lines of evidence that the LINE-1 retrotransposon is susceptible to RNA interference (RNAi). First, double-stranded RNA (dsRNA) generated in vitro from an L1 template is converted into functional short interfering RNA (siRNA) by DICER, the RNase III enzyme that initiates RNAi in human cells. Second, pooled siRNA from in vitro cleavage of L1 dsRNA, as well as synthetic L1 siRNA, targeting the 5'-UTR leads to sequence-specific mRNA degradation of an L1 fusion transcript. Finally, both synthetic and pooled siRNA suppressed retrotransposition from a highly active RC-L1 clone in cell culture assay. Our report is the first to demonstrate that a human transposable element is subjected to RNAi.
-
Pulmonary Delivery of siRNA via Polymeric Vectors as Therapies of Asthma
Xie, Yuran; Merkel, Olivia M
2015-01-01
Asthma is a chronic inflammatory disease. Despite the fact that current therapies, such as the combination of inhaled corticosteroids and β2-agonists, can control the symptoms of asthma in most patients, there is still an urgent need for an alternative anti-inflammatory therapy for patients who suffer from severe asthma but lack acceptable response to conventional therapies. Many molecular factors are involved in the inflammatory process in asthma, and thus blocking the function of these factors could efficiently alleviate airway inflammation. RNA interference (RNAi) is often thought to be the answer in the search for more efficient and biocompatible treatments. However, difficulties of efficient delivery of small interference RNA (siRNA), the key factor in RNAi, to target cells and tissues has limited its clinical application. In this review, we summarize cytokines and chemokines, transcription factors, tyrosine kinases and costimulatory factors that have been reported as targets of siRNA mediated treatment in experimental asthma. Additionally, we conclude several targeted delivery systems of siRNA to specific cells such as T cells, macrophages and dendritic cells, which could potentially be applied in asthma therapy. PMID:26148454
-
Hand, Jacqelyn M; Zhang, Kun; Wang, Lei; Koganti, Prasanthi P; Mastrantoni, Kristen; Rajput, Sandeep K; Ashry, Mohamed; Smith, George W; Yao, Jianbo
2017-04-01
Zinc finger (ZNF) transcription factors interact with DNA through zinc finger motifs and play important roles in a variety of cellular functions including cell growth, proliferation, development, apoptosis, and intracellular signal transduction. One-third of ZNF proteins in metazoans contain a highly conserved N-terminal motif known as the Krüppel-associated box (KRAB) domain, which acts as a potent, DNA-binding dependent transcriptional repression module. Analysis of RNA-Seq data generated from a bovine oocyte cDNA library identified a novel transcript, which encodes a KRAB-containing ZNF transcription factor (named ZNFO). Characterization of ZNFO mRNA expression revealed that it is exclusively expressed in bovine oocytes and early embryos. A GFP reporter assay demonstrated that ZNFO protein localizes specifically to the nucleus, supporting its role in transcriptional regulation. To test the role of ZNFO in early embryonic development, zygotes were generated by in vitro maturation and fertilization of oocytes, and injected with small interfering RNA (siRNA) designed to knockdown ZNFO. Cleavage rates were not affected by ZNFO siRNA injection. However, embryonic development to 8- to 16-cell stage and blastocyst stage was significantly reduced relative to the uninjected and negative control siRNA-injected embryos. Further, interaction of ZNFO with the highly conserved co-factor, KRAB-associated protein-1 (KAP1), was demonstrated, and evidence supporting transcriptional repression by ZNFO was demonstrated using a GAL4-luciferase reporter system. Results of described studies demonstrate that ZNFO is a maternally-derived oocyte-specific nuclear factor required for early embryonic development in cattle, presumably functioning by repressing transcription. Copyright © 2017 Elsevier B.V. All rights reserved.
-
Moyo, Lindani; Ramesh, Shunmugiah V; Kappagantu, Madhu; Mitter, Neena; Sathuvalli, Vidyasagar; Pappu, Hanu R
2017-07-17
Potato virus Y (PVY) is one of the most economically important pathogen of potato that is present as biologically distinct strains. The virus-derived small interfering RNAs (vsiRNAs) from potato cv. Russet Burbank individually infected with PVY-N, PVY-NTN and PVY-O strains were recently characterized. Plant defense RNA-silencing mechanisms deployed against viruses produce vsiRNAs to degrade homologous viral transcripts. Based on sequence complementarity, the vsiRNAs can potentially degrade host RNA transcripts raising the prospect of vsiRNAs as pathogenicity determinants in virus-host interactions. This study investigated the global effects of PVY vsiRNAs on the host potato transcriptome. The strain-specific vsiRNAs of PVY, expressed in high copy number, were analyzed in silico for their proclivity to target potato coding and non-coding RNAs using psRobot and psRNATarget algorithms. Functional annotation of target coding transcripts was carried out to predict physiological effects of the vsiRNAs on the potato cv. Russet Burbank. The downregulation of selected target coding transcripts was further validated using qRT-PCR. The vsiRNAs derived from biologically distinct strains of PVY displayed diversity in terms of absolute number, copy number and hotspots for siRNAs on their respective genomes. The vsiRNAs populations were derived with a high frequency from 6 K1, P1 and Hc-Pro for PVY-N, P1, Hc-Pro and P3 for PVY-NTN, and P1, 3' UTR and NIa for PVY-O genomic regions. The number of vsiRNAs that displayed interaction with potato coding transcripts and number of putative coding target transcripts were comparable between PVY-N and PVY-O, and were relatively higher for PVY-NTN. The most abundant target non-coding RNA transcripts for the strain specific PVY-derived vsiRNAs were found to be MIR821, 28S rRNA,18S rRNA, snoR71, tRNA-Met and U5. Functional annotation and qRT-PCR validation suggested that the vsiRNAs target genes involved in plant hormone signaling, genetic information processing, plant-pathogen interactions, plant defense and stress response processes in potato. The findings suggested that the PVY-derived vsiRNAs could act as a pathogenicity determinant and as a counter-defense strategy to host RNA silencing in PVY-potato interactions. The broad range of host genes targeted by PVY vsiRNAs in infected potato suggests a diverse role for vsiRNAs that includes suppression of host stress responses and developmental processes. The interactome scenario is the first report on the interaction between one of the most important Potyvirus genome-derived siRNAs and the potato transcripts.
-
Wu, Na; Zhang, Xinxin; Li, Feifei; Zhang, Tao; Gan, Yong; Li, Juan
2015-01-01
Vaginal small interfering RNA (siRNA) delivery provides a promising strategy for the prevention and treatment of vaginal diseases. However, the densely cross-linked mucus layer on the vaginal wall severely restricts nanoparticle-mediated siRNA delivery to the vaginal epithelium. In order to overcome this barrier and enhance vaginal mucus penetration, we prepared spray-dried powders containing siRNA-loaded nanoparticles. Powders with Pluronic F127 (F127), hydroxypropyl methyl cellulose (HPMC), and mannitol as carriers were obtained using an ultrasound-assisted spray-drying technique. Highly dispersed dry powders with diameters of 5-15 μm were produced. These powders showed effective siRNA protection and sustained release. The mucus-penetrating properties of the powders differed depending on their compositions. They exhibited different potential of opening mesh size of molecular sieve in simulated vaginal mucus system. A powder formulation with 0.6% F127 and 0.1% HPMC produced the maximum increase in the pore size of the model gel used to simulate vaginal mucus by rapidly extracting water from the gel and interacting with the gel; the resulting modulation of the molecular sieve effect achieved a 17.8-fold improvement of siRNA delivery in vaginal tract and effective siRNA delivery to the epithelium. This study suggests that powder formulations with optimized compositions have the potential to alter the steric barrier posed by mucus and hold promise for effective vaginal siRNA delivery.
-
PlGF gene knockdown in human retinal pigment epithelial cells.
Akrami, Hassan; Soheili, Zahra-Soheila; Sadeghizadeh, Majid; Ahmadieh, Hamid; Rezaeikanavi, Mozhgan; Samiei, Shahram; Khalooghi, Keynoush
2011-04-01
To evaluate the knockdown of placental growth factor (PlGF) gene expression in human retinal pigment epithelium (RPE) cells and its effect on cell proliferation, apoptosis and angiogenic potential of RPE cells. Human RPE cells were isolated by dispase I solution and cultured in DMEM/F12 supplemented with 10% fetal calf serum (FCS). A small interfering RNA (siRNA) corresponding to PlGF mRNA and a scrambled siRNA (scRNA) were introduced into the cells. Cell proliferation and cell death were examined by ELISA. PlGF mRNA and protein were quantified by real-time polymerase chain reaction (PCR) and western blot. The levels of gene expression for human retinal pigment epithelium-specific protein 65 kDa (RPE65), cellular retinaldehyde-binding protein (CRALBP) and tyrosinase were examined by real-time PCR. The angiogenic activity of RPE cell-derived conditioned media was assayed by a tube formation assay using human umbilical vein endothelial cells (HUVECs). At a final siRNA concentration of 20 pmol/ml, the transfection efficiency was about 80%. The amount of PlGF transcripts was reduced to 10% after 36 h of incubation, and the amount of PlGF protein in culture supernatant was significantly decreased. Suppression of PlGF gene had no effect on RPE cell proliferation and survival, and there were no notable changes in the transcript levels of RPE65, CRALBP or tyrosinase for the cultures treated by siRNA cognate to PlGF. Vascular tube formation was efficiently reduced in HUVECs. Our findings present PlGF as a key modulator of angiogenic potential in RPE cells of the human retina.
-
Finlay, James; Roberts, Cai M.; Dong, Juyao; Zink, Jeffrey I.; Tamanoi, Fuyuhiko; Glackin, Carlotta A.
2015-01-01
Growth and progression of solid tumors depends on the integration of multiple pro-growth and survival signals, including the induction of angiogenesis. TWIST1 is a transcription factor whose reactivation in tumors leads to epithelial to mesenchymal transition (EMT), including increased cancer cell stemness, survival, and invasiveness. Additionally, TWIST1 drives angiogenesis via activation of IL-8 and CCL2, independent of VEGF signaling. In this work, results suggest that chemically modified siRNA against TWIST1 reverses EMT both in vitro and in vivo. siRNA delivery with a polyethyleneimine-coated mesoporous silica nanoparticle (MSN) led to reduction of TWIST1 target genes and migratory potential in vitro. In mice bearing xenograft tumors, weekly intravenous injections of the siRNA-nanoparticle complexes resulted in decreased tumor burden together with a loss of CCL2 suggesting a possible anti-angiogenic response. Therapeutic use of TWIST1 siRNA delivered via MSNs has the potential to inhibit tumor growth and progression in many solid tumor types. Chemically modified siRNA against TWIST1 was complexed to cation-coated mesoporous silica nanoparticles and tested in vitro and in vivo. In cell culture experiments, siRNA reduced expression of TWIST1 and its target genes, and reduced cell migration. In mice, injections of the siRNA-nanoparticle complex led to reduced tumor weight. Data suggest that diminished tumor burden was the result of reduced CCL2 expression and angiogenesis following TWIST1 knockdown. PMID:26115637
-
Hattori, Yoshiyuki; Arai, Shohei; Okamoto, Ryou; Hamada, Megumi; Kawano, Kumi; Yonemochi, Etsuo
2014-12-10
In this study, we developed novel siRNA transfer method to the liver by sequential intravenous injection of anionic polymer and cationic liposome/cholesterol-modified siRNA complex (cationic lipoplex). When cationic lipoplex was intravenously injected into mice, the accumulation of siRNA was mainly observed in the lungs. In contrast, when cationic lipoplex was intravenously injected at 1 min after intravenous injection of poly-L-glutamic acid (PGA) or chondroitin sulfate C (CS), siRNA was accumulated in the liver. In terms of suppression of gene expression in vivo, apolipoprotein B (ApoB) mRNA in the liver and low-density-lipoprotein (LDL) and very low-density-lipoprotein (VLDL) cholesterol level in serum were reduced at 48 h after single sequential injection of PGA or CS plus cationic lipoplex of cholesterol-modified ApoB siRNA. Furthermore, sequential injections of PGA plus cationic lipoplex of cholesterol-modified luciferase siRNA could reduce luciferase activity in tumor xenografts bearing liver metastasis of human breast tumor MCF-7-Luc. From these findings, sequential injection of anionic polymer and cationic lipoplex of siRNA might produce a systemic vector of siRNA to the liver. Copyright © 2014 Elsevier B.V. All rights reserved.
-
NASA Astrophysics Data System (ADS)
Huang, Jia-Lin; Jiang, Gan; Song, Qing-Xiang; Gu, Xiao; Hu, Meng; Wang, Xiao-Lin; Song, Hua-Hua; Chen, Le-Pei; Lin, Ying-Ying; Jiang, Di; Chen, Jun; Feng, Jun-Feng; Qiu, Yong-Ming; Jiang, Ji-Yao; Jiang, Xin-Guo; Chen, Hong-Zhuan; Gao, Xiao-Ling
2017-05-01
Hyperactivated Ras regulates many oncogenic pathways in several malignant human cancers including glioblastoma and it is an attractive target for cancer therapies. Ras activation in cancer cells drives protein internalization via macropinocytosis as a key nutrient-gaining process. By utilizing this unique endocytosis pathway, here we create a biologically inspired nanostructure that can induce cancer cells to `drink drugs' for targeting activating transcription factor-5 (ATF5), an overexpressed anti-apoptotic transcription factor in glioblastoma. Apolipoprotein E3-reconstituted high-density lipoprotein is used to encapsulate the siRNA-loaded calcium phosphate core and facilitate it to penetrate the blood-brain barrier, thus targeting the glioblastoma cells in a macropinocytosis-dependent manner. The nanostructure carrying ATF5 siRNA exerts remarkable RNA-interfering efficiency, increases glioblastoma cell apoptosis and inhibits tumour cell growth both in vitro and in xenograft tumour models. This strategy of targeting the macropinocytosis caused by Ras activation provides a nanoparticle-based approach for precision therapy in glioblastoma and other Ras-activated cancers.
-
Identifying MicroRNAs and Transcript Targets in Jatropha Seeds
Galli, Vanessa; Guzman, Frank; de Oliveira, Luiz F. V.; Loss-Morais, Guilherme; Körbes, Ana P.; Silva, Sérgio D. A.; Margis-Pinheiro, Márcia M. A. N.; Margis, Rogério
2014-01-01
MicroRNAs, or miRNAs, are endogenously encoded small RNAs that play a key role in diverse plant biological processes. Jatropha curcas L. has received significant attention as a potential oilseed crop for the production of renewable oil. Here, a sRNA library of mature seeds and three mRNA libraries from three different seed development stages were generated by deep sequencing to identify and characterize the miRNAs and pre-miRNAs of J. curcas. Computational analysis was used for the identification of 180 conserved miRNAs and 41 precursors (pre-miRNAs) as well as 16 novel pre-miRNAs. The predicted miRNA target genes are involved in a broad range of physiological functions, including cellular structure, nuclear function, translation, transport, hormone synthesis, defense, and lipid metabolism. Some pre-miRNA and miRNA targets vary in abundance between the three stages of seed development. A search for sequences that produce siRNA was performed, and the results indicated that J. curcas siRNAs play a role in nuclear functions, transport, catalytic processes and disease resistance. This study presents the first large scale identification of J. curcas miRNAs and their targets in mature seeds based on deep sequencing, and it contributes to a functional understanding of these miRNAs. PMID:24551031
-
Two classes of silencing RNAs move between C. elegans tissues
Jose, Antony M; Garcia, Giancarlo A; Hunter, Craig P
2011-01-01
Summary Organism-wide RNA interference (RNAi) is due to the transport of mobile silencing RNA throughout the organism but the identities of these mobile RNA species in animals are unknown. Here we present genetic evidence that both the initial double-stranded RNA (dsRNA), which triggers RNAi, and at least one dsRNA intermediate produced during RNAi can act as or generate mobile silencing RNA in Caenorhabditis elegans. This dsRNA intermediate requires the long dsRNA-binding protein RDE-4, the endonuclease DCR-1, which cleaves long dsRNA into double-stranded short-interfering RNA (ds-siRNA), and the putative nucleotidyltransferase MUT-2 (RDE-3). However, single-stranded siRNA and downstream secondary siRNA produced upon amplification by the RNA-dependent RNA Polymerase RRF-1 do not generate mobile silencing RNA. Restricting inter-tissue transport to long dsRNA and directly processed siRNA intermediates rather than amplified siRNA may serve to modulate the extent of systemic silencing in proportion to available dsRNA. PMID:21984186
-
Protection from feed-forward amplification in an amplified RNAi mechanism
Pak, Julia; Maniar, Jay Mahesh; Mello, Cecilia Cabral; Fire, Andrew
2012-01-01
SUMMARY The effectiveness of RNA interference (RNAi) in many organisms is potentiated through the signal-amplifying activity of a targeted RNA directed RNA polymerase (RdRP) system that can convert a small population of exogenously-encountered dsRNA fragments into an abundant internal pool of small interfering RNA (siRNA). As for any biological amplification system, we expect an underlying architecture that will limit the ability of a randomly encountered trigger to produce an uncontrolled and self-escalating response. Investigating such limits in C. elegans, we find that feed-forward amplification is limited by a critical biosynthetic and structural distinction at the RNA level between (i) triggers that can produce amplification and (ii) siRNA products of the amplification reaction. By assuring that initial (primary) siRNAs can act as triggers but not templates for activation, and that the resulting (secondary) siRNAs can enforce gene silencing on additional targets without unbridled trigger amplification, the system achieves substantial but fundamentally limited signal amplification. PMID:23141544
-
Ribosome profiling-guided depletion of an mRNA increases cell growth rate and protein secretion
NASA Astrophysics Data System (ADS)
Kallehauge, Thomas Beuchert; Li, Shangzhong; Pedersen, Lasse Ebdrup; Ha, Tae Kwang; Ley, Daniel; Andersen, Mikael Rørdam; Kildegaard, Helene Faustrup; Lee, Gyun Min; Lewis, Nathan E.
2017-01-01
Recombinant protein production coopts the host cell machinery to provide high protein yields of industrial enzymes or biotherapeutics. However, since protein translation is energetically expensive and tightly controlled, it is unclear if highly expressed recombinant genes are translated as efficiently as host genes. Furthermore, it is unclear how the high expression impacts global translation. Here, we present the first genome-wide view of protein translation in an IgG-producing CHO cell line, measured with ribosome profiling. Through this we found that our recombinant mRNAs were translated as efficiently as the host cell transcriptome, and sequestered up to 15% of the total ribosome occupancy. During cell culture, changes in recombinant mRNA translation were consistent with changes in transcription, demonstrating that transcript levels influence specific productivity. Using this information, we identified the unnecessary resistance marker NeoR to be a highly transcribed and translated gene. Through siRNA knock-down of NeoR, we improved the production- and growth capacity of the host cell. Thus, ribosomal profiling provides valuable insights into translation in CHO cells and can guide efforts to enhance protein production.
-
Yang, Yingzhen; Jittayasothorn, Yingyos; Chronis, Demosthenis; Wang, Xiaohong; Cousins, Peter; Zhong, Gan-Yuan
2013-01-01
Root-knot nematodes (RKNs) infect many annual and perennial crops and are the most devastating soil-born pests in vineyards. To develop a biotech-based solution for controlling RKNs in grapes, we evaluated the efficacy of plant-derived RNA interference (RNAi) silencing of a conserved RKN effector gene, 16D10, for nematode resistance in transgenic grape hairy roots. Two hairpin-based silencing constructs, containing a stem sequence of 42 bp (pART27-42) or 271 bp (pART27-271) of the 16D10 gene, were transformed into grape hairy roots and compared for their small interfering RNA (siRNA) production and efficacy on suppression of nematode infection. Transgenic hairy root lines carrying either of the two RNAi constructs showed less susceptibility to nematode infection compared with control. Small RNA libraries from four pART27-42 and two pART27-271 hairy root lines were sequenced using an Illumina sequencing technology. The pART27-42 lines produced hundred times more 16D10-specific siRNAs than the pART27-271 lines. On average the 16D10 siRNA population had higher GC content than the 16D10 stem sequences in the RNAi constructs, supporting previous observation that plant dicer-like enzymes prefer GC-rich sequences as substrates for siRNA production. The stems of the 16D10 RNAi constructs were not equally processed into siRNAs. Several hot spots for siRNA production were found in similar positions of the hairpin stems in pART27-42 and pART27-271. Interestingly, stem sequences at the loop terminus produced more siRNAs than those at the stem base. Furthermore, the relative abundance of guide and passenger single-stranded RNAs from putative siRNA duplexes was largely correlated with their 5' end thermodynamic strength. This study demonstrated the feasibility of using a plant-derived RNAi approach for generation of novel nematode resistance in grapes and revealed several interesting molecular characteristics of transgene siRNAs important for optimizing plant RNAi constructs.
-
Chronis, Demosthenis; Wang, Xiaohong; Cousins, Peter; Zhong, Gan-Yuan
2013-01-01
Root-knot nematodes (RKNs) infect many annual and perennial crops and are the most devastating soil-born pests in vineyards. To develop a biotech-based solution for controlling RKNs in grapes, we evaluated the efficacy of plant-derived RNA interference (RNAi) silencing of a conserved RKN effector gene, 16D10, for nematode resistance in transgenic grape hairy roots. Two hairpin-based silencing constructs, containing a stem sequence of 42 bp (pART27-42) or 271 bp (pART27-271) of the 16D10 gene, were transformed into grape hairy roots and compared for their small interfering RNA (siRNA) production and efficacy on suppression of nematode infection. Transgenic hairy root lines carrying either of the two RNAi constructs showed less susceptibility to nematode infection compared with control. Small RNA libraries from four pART27-42 and two pART27-271 hairy root lines were sequenced using an Illumina sequencing technology. The pART27-42 lines produced hundred times more 16D10-specific siRNAs than the pART27-271 lines. On average the 16D10 siRNA population had higher GC content than the 16D10 stem sequences in the RNAi constructs, supporting previous observation that plant dicer-like enzymes prefer GC-rich sequences as substrates for siRNA production. The stems of the 16D10 RNAi constructs were not equally processed into siRNAs. Several hot spots for siRNA production were found in similar positions of the hairpin stems in pART27-42 and pART27-271. Interestingly, stem sequences at the loop terminus produced more siRNAs than those at the stem base. Furthermore, the relative abundance of guide and passenger single-stranded RNAs from putative siRNA duplexes was largely correlated with their 5′ end thermodynamic strength. This study demonstrated the feasibility of using a plant-derived RNAi approach for generation of novel nematode resistance in grapes and revealed several interesting molecular characteristics of transgene siRNAs important for optimizing plant RNAi constructs. PMID:23874962
-
NASA Astrophysics Data System (ADS)
Yu-Wai-Man, Cynthia; Tagalakis, Aristides D.; Manunta, Maria D.; Hart, Stephen L.; Khaw, Peng T.
2016-02-01
There is increasing evidence that the Myocardin-related transcription factor/Serum response factor (MRTF/SRF) pathway plays a key role in fibroblast activation and that knocking down MRTF can lead to reduced scarring and fibrosis. Here, we have developed a receptor-targeted liposome-peptide-siRNA nanoparticle as a non-viral delivery system for MRTF-B siRNA in conjunctival fibrosis. Using 50 nM siRNA, the MRTF-B gene was efficiently silenced by 76% and 72% with LYR and LER nanoparticles, respectively. The silencing efficiency was low when non-targeting peptides or siRNA alone or liposome-siRNA alone were used. LYR and LER nanoparticles also showed higher silencing efficiency than PEGylated LYR-P and LER-P nanoparticles. The nanoparticles were not cytotoxic using different liposomes, targeting peptides, and 50 nM siRNA. Three-dimensional fibroblast-populated collagen matrices were also used as a functional assay to measure contraction in vitro, and showed that MRTF-B LYR nanoparticles completely blocked matrix contraction after a single transfection treatment. In conclusion, this is the first study to develop and show that receptor-targeted liposome-peptide-siRNA nanoparticles represent an efficient and safe non-viral siRNA delivery system that could be used to prevent fibrosis after glaucoma filtration surgery and other contractile scarring conditions in the eye.
-
Comparing 2-nt 3' overhangs against blunt-ended siRNAs: a systems biology based study.
Ghosh, Preetam; Dullea, Robert; Fischer, James E; Turi, Tom G; Sarver, Ronald W; Zhang, Chaoyang; Basu, Kalyan; Das, Sajal K; Poland, Bradley W
2009-07-07
In this study, we formulate a computational reaction model following a chemical kinetic theory approach to predict the binding rate constant for the siRNA-RISC complex formation reaction. The model allowed us to study the potency difference between 2-nt 3' overhangs against blunt-ended siRNA molecules in an RNA interference (RNAi) system. The rate constant predicted by this model was fed into a stochastic simulation of the RNAi system (using the Gillespie stochastic simulator) to study the overall potency effect. We observed that the stochasticity in the transcription/translation machinery has no observable effects in the RNAi pathway. Sustained gene silencing using siRNAs can be achieved only if there is a way to replenish the dsRNA molecules in the cell. Initial findings show about 1.5 times more blunt-ended molecules will be required to keep the mRNA at the same reduced level compared to the 2-nt overhang siRNAs. However, the mRNA levels jump back to saturation after a longer time when blunt-ended siRNAs are used. We found that the siRNA-RISC complex formation reaction rate was 2 times slower when blunt-ended molecules were used pointing to the fact that the presence of the 2-nt overhangs has a greater effect on the reaction in which the bound RISC complex cleaves the mRNA.
-
Comparing 2-nt 3' overhangs against blunt-ended siRNAs: a systems biology based study
Ghosh, Preetam; Dullea, Robert; Fischer, James E; Turi, Tom G; Sarver, Ronald W; Zhang, Chaoyang; Basu, Kalyan; Das, Sajal K; Poland, Bradley W
2009-01-01
In this study, we formulate a computational reaction model following a chemical kinetic theory approach to predict the binding rate constant for the siRNA-RISC complex formation reaction. The model allowed us to study the potency difference between 2-nt 3' overhangs against blunt-ended siRNA molecules in an RNA interference (RNAi) system. The rate constant predicted by this model was fed into a stochastic simulation of the RNAi system (using the Gillespie stochastic simulator) to study the overall potency effect. We observed that the stochasticity in the transcription/translation machinery has no observable effects in the RNAi pathway. Sustained gene silencing using siRNAs can be achieved only if there is a way to replenish the dsRNA molecules in the cell. Initial findings show about 1.5 times more blunt-ended molecules will be required to keep the mRNA at the same reduced level compared to the 2-nt overhang siRNAs. However, the mRNA levels jump back to saturation after a longer time when blunt-ended siRNAs are used. We found that the siRNA-RISC complex formation reaction rate was 2 times slower when blunt-ended molecules were used pointing to the fact that the presence of the 2-nt overhangs has a greater effect on the reaction in which the bound RISC complex cleaves the mRNA. PMID:19594876
-
Manunta, Maria D I; Tagalakis, Aristides D; Attwood, Martin; Aldossary, Ahmad M; Barnes, Josephine L; Munye, Mustafa M; Weng, Alexander; McAnulty, Robin J; Hart, Stephen L
2017-04-06
The inhibition of ENaC may have therapeutic potential in CF airways by reducing sodium hyperabsorption, restoring lung epithelial surface fluid levels, airway hydration and mucociliary function. The challenge has been to deliver siRNA to the lung with sufficient efficacy for a sustained therapeutic effect. We have developed a self-assembling nanocomplex formulation for siRNA delivery to the airways that consists of a liposome (DOTMA/DOPE; L), an epithelial targeting peptide (P) and siRNA (R). LPR formulations were assessed for their ability to silence expression of the transcript of the gene encoding the α-subunit of the sodium channel ENaC in cell lines and primary epithelial cells, in submerged cultures or grown in air-liquid interface conditions. LPRs, containing 50 nM or 100 nM siRNA, showed high levels of silencing, particularly in primary airway epithelial cells. When nebulised these nanocomplexes still retained their biophysical properties and transfection efficiencies. The silencing ability was determined at protein level by confocal microscopy and western blotting. In vivo data demonstrated that these nanoparticles had the ability to silence expression of the α-ENaC subunit gene. In conclusion, these findings show that LPRs can modulate the activity of ENaC and this approach might be promising as co-adjuvant therapy for cystic fibrosis.
-
FOXO1 is a direct target of EWS-Fli1 oncogenic fusion protein in Ewing's sarcoma cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Liu, E-mail: lyang@u.washington.edu; Medical Research Service, VA Puget Sound Health Care System, Seattle, WA 98108; Hu, Hsien-Ming
2010-11-05
Research highlights: {yields} Inducible and reversible siRNA knockdown of an oncogenic fusion protein such as EWS-Fli1 is feasible and more advantageous than other siRNA methods. {yields} The tumor suppressor gene FOXO1 is a new EWS-Fli1 target. {yields} While trans-activators are known for the FOXO1 gene, there has been no report on negative regulators of FOXO1 transcription. {yields} This study provides first evidence that the EWS-Fli1 oncogenic fusion protein can function as a transcriptional repressor of the FOXO1 gene. -- Abstract: Ewing's family tumors are characterized by a specific t(11;22) chromosomal translocation that results in the formation of EWS-Fli1 oncogenic fusionmore » protein. To investigate the effects of EWS-Fli1 on gene expression, we carried out DNA microarray analysis after specific knockdown of EWS-Fli1 through transfection of synthetic siRNAs. EWS-Fli1 knockdown increased expression of genes such as DKK1 and p57 that are known to be repressed by EWS-Fli1 fusion protein. Among other potential EWS-Fli1 targets identified by our microarray analysis, we have focused on the FOXO1 gene since it encodes a potential tumor suppressor and has not been previously reported in Ewing's cells. To better understand how EWS-Fli1 affects FOXO1 expression, we have established a doxycycline-inducible siRNA system to achieve stable and reversible knockdown of EWS-Fli1 in Ewing's sarcoma cells. Here we show that FOXO1 expression in Ewing's cells has an inverse relationship with EWS-Fli1 protein level, and FOXO1 promoter activity is increased after doxycycline-induced EWS-Fli1 knockdown. In addition, we have found that direct binding of EWS-Fli1 to FOXO1 promoter is attenuated after doxycycline-induced siRNA knockdown of the fusion protein. Together, these results suggest that suppression of FOXO1 function by EWS-Fli1 fusion protein may contribute to cellular transformation in Ewing's family tumors.« less
-
Sidorenko, Lyudmila; Dorweiler, Jane E; Cigan, A Mark; Arteaga-Vazquez, Mario; Vyas, Meenal; Kermicle, Jerry; Jurcin, Diane; Brzeski, Jan; Cai, Yu; Chandler, Vicki L
2009-11-01
Paramutation involves homologous sequence communication that leads to meiotically heritable transcriptional silencing. We demonstrate that mop2 (mediator of paramutation2), which alters paramutation at multiple loci, encodes a gene similar to Arabidopsis NRPD2/E2, the second-largest subunit of plant-specific RNA polymerases IV and V. In Arabidopsis, Pol-IV and Pol-V play major roles in RNA-mediated silencing and a single second-largest subunit is shared between Pol-IV and Pol-V. Maize encodes three second-largest subunit genes: all three genes potentially encode full length proteins with highly conserved polymerase domains, and each are expressed in multiple overlapping tissues. The isolation of a recessive paramutation mutation in mop2 from a forward genetic screen suggests limited or no functional redundancy of these three genes. Potential alternative Pol-IV/Pol-V-like complexes could provide maize with a greater diversification of RNA-mediated transcriptional silencing machinery relative to Arabidopsis. Mop2-1 disrupts paramutation at multiple loci when heterozygous, whereas previously silenced alleles are only up-regulated when Mop2-1 is homozygous. The dramatic reduction in b1 tandem repeat siRNAs, but no disruption of silencing in Mop2-1 heterozygotes, suggests the major role for tandem repeat siRNAs is not to maintain silencing. Instead, we hypothesize the tandem repeat siRNAs mediate the establishment of the heritable silent state-a process fully disrupted in Mop2-1 heterozygotes. The dominant Mop2-1 mutation, which has a single nucleotide change in a domain highly conserved among all polymerases (E. coli to eukaryotes), disrupts both siRNA biogenesis (Pol-IV-like) and potentially processes downstream (Pol-V-like). These results suggest either the wild-type protein is a subunit in both complexes or the dominant mutant protein disrupts both complexes. Dominant mutations in the same domain in E. coli RNA polymerase suggest a model for Mop2-1 dominance: complexes containing Mop2-1 subunits are non-functional and compete with wild-type complexes.
-
Das, Jayeeta; Das, Sreemanti; Paul, Avijit; Samadder, Asmita; Bhattacharyya, Soumya Sundar; Khuda-Bukhsh, Anisur Rahman
2014-03-21
Activation of signal transducer and activator of transcription3 (STAT3) is a hallmark of several types of cancer. Failure to inhibit STAT3 expression by injection of siRNA for STAT3 directly to Balb/c mice led us to adopt alternative means. We formulated nanoparticle-based encapsulation of siRNA (NsiRNA) with polyethylenimine (PEI) and poly(lactide-co-glycolide) (PLGA) and characterized them. The siRNA treated and NsiRNA-treated cells were subjected separately to different assay systems. We also checked if NsiRNA could cross the blood brain barrier (BBB). Cell viability reduced dramatically in A549 cells after NsiRNA administration (23.89% at 24 h), thereby implicating considerable silencing of STAT3 by NsiRNA, but not after siRNA administration. Compared to controls, a significant decrease in expression of IL-6 and the angiogenic factor (VEGF) and increase in Caspase 3 activity was observed with corresponding regression in tumor growth in mice treated with NsiRNA. NsiRNA induced apoptosis of cells and arrested cells at G1/G0 stage, both in vitro and in vivo. Apoptosis was also verified by Annexin-V-FITC/Propidium-iodide staining. NsiRNA could cross blood brain barrier. Overall results revealed PEI-PLGA to be a promising carrier for delivery of siRNA targeting STAT3 expression, which can be utilized as an effective strategy for cancer therapy. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
-
Zhang, Ning; Chan, Cecilia W S; Sanchez-Guerrero, Estella; Khachigian, Levon M
2012-06-01
Wound healing is a complex dynamic process involving a variety of cell types, including fibroblasts that express and respond to cytokines and growth factors in the local microenvironment. The mechanisms controlling gene expression after injury at a transcriptional level are poorly understood. Here we show that decreased expression of a key receptor, PDGF-receptor (R)-α, after fibroblast injury is due to the release and paracrine activity of TNF-α. TNF-α inhibits PDGF-R-α expression and this involves formation of a c-Fos-Yin Yang 1 (YY1) complex and histone deacetylase (HDAC) activity. c-Fos, induced by TNF-α, negatively regulates PDGF-R-α transcription. Small interfering RNA (siRNA) targeting c-Fos or the zinc finger transcription factor YY1 inhibits TNF-α suppression of PDGF-R-α expression. Coimmunoprecipitation studies show that TNF-α stimulates the formation of a complex between c-Fos with YY1. Furthermore, chromatin immunoprecipitation (ChIP) analysis reveals the enrichment of c-Fos, YY1, and HDAC-1 at the PDGF-R-α promoter in cells exposed to TNF-α. With suberoylanilide hydroxamic acid (SAHA) and HDAC-1 siRNA, we demonstrate that HDAC mediates TNF-α repression of PDGF-R-α. These findings demonstrate that transcriptional repression of PDGF-R-α after fibroblast injury involves paracrine activity of endogenous TNF-α, the formation of a c-Fos-YY1 complex, and negative regulatory activity by HDAC.
-
Roles of Non-Coding RNA in Sugarcane-Microbe Interaction.
Thiebaut, Flávia; Rojas, Cristian A; Grativol, Clícia; Calixto, Edmundo P da R; Motta, Mariana R; Ballesteros, Helkin G F; Peixoto, Barbara; de Lima, Berenice N S; Vieira, Lucas M; Walter, Maria Emilia; de Armas, Elvismary M; Entenza, Júlio O P; Lifschitz, Sergio; Farinelli, Laurent; Hemerly, Adriana S; Ferreira, Paulo C G
2017-12-20
Studies have highlighted the importance of non-coding RNA regulation in plant-microbe interaction. However, the roles of sugarcane microRNAs (miRNAs) in the regulation of disease responses have not been investigated. Firstly, we screened the sRNA transcriptome of sugarcane infected with Acidovorax avenae . Conserved and novel miRNAs were identified. Additionally, small interfering RNAs (siRNAs) were aligned to differentially expressed sequences from the sugarcane transcriptome. Interestingly, many siRNAs aligned to a transcript encoding a copper-transporter gene whose expression was induced in the presence of A. avenae , while the siRNAs were repressed in the presence of A. avenae . Moreover, a long intergenic non-coding RNA was identified as a potential target or decoy of miR408. To extend the bioinformatics analysis, we carried out independent inoculations and the expression patterns of six miRNAs were validated by quantitative reverse transcription-PCR (qRT-PCR). Among these miRNAs, miR408-a copper-microRNA-was downregulated. The cleavage of a putative miR408 target, a laccase, was confirmed by a modified 5'RACE (rapid amplification of cDNA ends) assay. MiR408 was also downregulated in samples infected with other pathogens, but it was upregulated in the presence of a beneficial diazotrophic bacteria. Our results suggest that regulation by miR408 is important in sugarcane sensing whether microorganisms are either pathogenic or beneficial, triggering specific miRNA-mediated regulatory mechanisms accordingly.
-
Roles of Non-Coding RNA in Sugarcane-Microbe Interaction
Grativol, Clícia; Motta, Mariana R.; Ballesteros, Helkin G. F.; Peixoto, Barbara; Vieira, Lucas M.; Walter, Maria Emilia; de Armas, Elvismary M.; Entenza, Júlio O. P.; Lifschitz, Sergio; Farinelli, Laurent; Hemerly, Adriana S.
2017-01-01
Studies have highlighted the importance of non-coding RNA regulation in plant-microbe interaction. However, the roles of sugarcane microRNAs (miRNAs) in the regulation of disease responses have not been investigated. Firstly, we screened the sRNA transcriptome of sugarcane infected with Acidovorax avenae. Conserved and novel miRNAs were identified. Additionally, small interfering RNAs (siRNAs) were aligned to differentially expressed sequences from the sugarcane transcriptome. Interestingly, many siRNAs aligned to a transcript encoding a copper-transporter gene whose expression was induced in the presence of A. avenae, while the siRNAs were repressed in the presence of A. avenae. Moreover, a long intergenic non-coding RNA was identified as a potential target or decoy of miR408. To extend the bioinformatics analysis, we carried out independent inoculations and the expression patterns of six miRNAs were validated by quantitative reverse transcription-PCR (qRT-PCR). Among these miRNAs, miR408—a copper-microRNA—was downregulated. The cleavage of a putative miR408 target, a laccase, was confirmed by a modified 5′RACE (rapid amplification of cDNA ends) assay. MiR408 was also downregulated in samples infected with other pathogens, but it was upregulated in the presence of a beneficial diazotrophic bacteria. Our results suggest that regulation by miR408 is important in sugarcane sensing whether microorganisms are either pathogenic or beneficial, triggering specific miRNA-mediated regulatory mechanisms accordingly. PMID:29657296
-
Transfection of small RNAs globally perturbs gene regulation by endogenous microRNAs.
Khan, Aly A; Betel, Doron; Miller, Martin L; Sander, Chris; Leslie, Christina S; Marks, Debora S
2009-06-01
Transfection of small RNAs (such as small interfering RNAs (siRNAs) and microRNAs (miRNAs)) into cells typically lowers expression of many genes. Unexpectedly, increased expression of genes also occurs. We investigated whether this upregulation results from a saturation effect--that is, competition among the transfected small RNAs and the endogenous pool of miRNAs for the intracellular machinery that processes small RNAs. To test this hypothesis, we analyzed genome-wide transcript responses from 151 published transfection experiments in seven different human cell types. We show that targets of endogenous miRNAs are expressed at significantly higher levels after transfection, consistent with impaired effectiveness of endogenous miRNA repression. This effect exhibited concentration and temporal dependence. Notably, the profile of endogenous miRNAs can be largely inferred by correlating miRNA sites with gene expression changes after transfections. The competition and saturation effects have practical implications for miRNA target prediction, the design of siRNA and short hairpin RNA (shRNA) genomic screens and siRNA therapeutics.
-
Rajan, Devi; Chinnadurai, Raghavan; Keefe, Evan O; Boyoglu-Barnum, Seyhan; Todd, Sean O; Hartert, Tina V; Galipeau, Jacques; Anderson, Larry J
2017-12-01
RSV is a major cause of severe lower respiratory infection in infants and young children. With no vaccine yet available, it is important to clarify mechanisms of disease pathogenesis. Since indoleamine-2,3-dioxygenase (IDO) is an immunomodulatory enzyme and is upregulated with RSV infection, we studied it in vivo during infection of BALB/c mice and in vitro in A549 cells. RSV infection upregulated IDO transcripts in vivo and in vitro. IDO siRNA decreased IDO transcripts ~2 fold compared to control siRNA after RSV infection but this decrease did not affect RSV replication. In the presence of IFN-γ, siRNA-induced a decrease in IDO expression that was associated with an increase in virus replication and increased levels of IL-6, IL-8, CXCL10 and CCL4. Thus, our results show IDO is upregulated with RSV infection and this upregulation likely participates with IFN-γ in inhibition of virus replication and suppression of some host cell responses to infection. Copyright © 2017 Elsevier Inc. All rights reserved.
-
Effects of hypoxia-inducible factor-1α silencing on the proliferation of CBRH-7919 hepatoma cells
Xu, Lin-Feng; Ni, Jia-Yan; Sun, Hong-Liang; Chen, Yao-Ting; Wu, Yu-Dan
2013-01-01
AIM: To study the effects of hypoxia-inducible factor-1α (HIF-1α) silencing on the proliferation of hypoxic CBRH-7919 rat hepatoma cells. METHODS: The CBRH-7919 rat hepatoma cell line was used in this study and the hypoxic model was constructed using CoCl2. The HIF-1α-specific RNAi sequences were designed according to the gene coding sequence of rat HIF-1α obtained from GeneBank. The secondary structure of the HIF-1α gene sequence was analyzed using RNA draw software. The small interfering RNA (siRNA) transfection mixture was produced by mixing the siRNA and Lipofectamine2000TM, and transfected into the hypoxic hepatoma cells. Real time reverse transcription-polymerase chain reaction (RT-PCR) and Western blotting assay were used to detect the expression levels of mRNA and protein. HIF-1α and vascular endothelial growth factor (VEGF) mRNA was determined using real time RT-PCR; the protein expression levels of AKT, p-AKT, p21 and cyclinD1 were determined using Western blotting. The proliferation of hepatoma cells was observed using the methyl thiazolyl tetrazolium (MTT) assay and the bromodeoxyuridine (BrdU) incorporation cell proliferation assay. RESULTS: Under induced hypoxia, the viability of the hepatoma cells reached a minimum at 800 μmol/L CoCl2; the viability of the cells was relatively high at CoCl2 concentrations between 100 μmol/L and 200 μmol/L. Under hypoxia, the mRNA and protein expression levels of HIF-1α and VEGF were significantly higher than that of hepatoma cells that were cultured in normaxia. HIF-1α-specific RNAi sequences were successfully transfected into hepatoma cells. The transfection of specific siRNAs significantly inhibited the mRNA and protein expression levels of HIF-1α and VEGF, along with the protein expression levels of p-AKT and cyclinD1; the protein expression of p21 was significantly increased, and there was no significant difference in the expression of AKT. The MTT assay showed that the amount of hepatoma cells in S phase in the siRNA transfection group was obviously smaller than that in the control group; in the siRNA transfection group, the amount of hepatoma cells in G1 phase was more than that in the control group. The BrdU incorporation assay showed that the number of BrdU positive hepatoma cells in the siRNA transfection group was less than that in the control group. The data of the MTT assay and BrdU incorporation assay suggested that HIF-1α silencing using siRNAs significantly inhibited the proliferation of hepatoma cells. CONCLUSION: Hypoxia increases the expression of HIF-1α, and HIF-1α silencing significantly inhibits the proliferation of hypoxic CBRH-7919 rat hepatoma cells. PMID:23555163
-
Huzil, John Torin; Saliaj, Evi; Ivanova, Marina V; Gharagozloo, Marjan; Loureiro, Maria Jimena; Lamprecht, Constanze; Korinek, Andreas; Chen, Ding Wen; Foldvari, Marianna
2015-01-01
Background: The potential use of carbon nanotubes (CNTs) in gene therapy as delivery systems for nucleic acids has been recently recognized. Here, we describe that metallic versus semiconducting single-wall CNTs can produce significant differences in transfection rate and cellular distribution of siRNA in murine PAM212 keratinocytes. Results/Methodology: The results of cell interaction studies, coupled with supportive computational simulations and ultrastructural studies revealed that the use of metallic single wall CNTs resulted in siRNA delivery into both the cytoplasm and nucleus of keratinocytes, whereas semiconducting CNTs resulted in delivery only to the cytoplasm. Conclusion: Using enriched fractions of metallic or semiconducting CNTs for siRNA complex preparation may provide specific subcellular targeting advantages. PMID:28031892
-
Tang, Wanjin; Li, Yang; Osimiri, Lindsey; Zhang, Chi
2011-09-23
Osterix (Osx) is an osteoblast-specific transcription factor essential for osteoblast differentiation and bone formation. Osx knock-out mice lack bone completely. Satb2 is critical for osteoblast differentiation as a special AT-rich binding transcription factor. It is not known how Satb2 is transcriptionally regulated during bone formation. In this study, quantitative real-time RT-PCR results demonstrated that Satb2 was down-regulated in Osx-null calvaria. In stable C2C12 mesenchymal cells using the tetracycline (Tet)-Off system, overexpression of Osx stimulated Satb2 expression. Moreover, inhibition of Osx by siRNA led to repression of Satb2 expression in osteoblasts. These results suggest that Osx controls Satb2 expression. Transient transfection assay showed that Osx activated 1kb Satb2 promoter reporter activity in a dose-dependent manner. To define the region of Satb2 promoter responsive to Osx activation, a series of deletion mutants of Satb2 constructs were made, and the minimal region was narrowed down to the proximal 130 bp of the Satb2 promoter. Further point mutation studies found that two GC-rich region mutations disrupted the Satb2 130bp promoter activation by Osx, suggesting that these GC-rich binding sites were responsible for Satb2 activation by Osx. Gel shift assay showed that Osx bound to the Satb2 promoter sequence directly. ChIP assays indicated that endogenous Osx associated with the native Satb2 promoter in osteoblasts. Importantly, Satb2 siRNA significantly inhibited Osx-induced osteoblast marker gene expressions. Taken together, our findings indicate that Osx is an upstream regulator of Satb2 during bone formation. This reveals a new additional link of the transcriptional regulation mechanism that Osx controls bone formation.
-
New basic approach to treat non-small cell lung cancer based on RNA-interference.
Makowiecki, Christina; Nolte, Andrea; Sutaj, Besmire; Keller, Timea; Avci-Adali, Meltem; Stoll, Heidi; Schlensak, Christian; Wendel, Hans Peter; Walker, Tobias
2014-03-01
To date the therapy for non-small cell lung cancer (NSCLC) is associated with severe side effects, frustrating outcomes, and does not consider different tumor characteristics. The RNA-interference (RNAi) pathway represents a potential new approach to treat NSCLC. With small interfering ribonucleic acids (siRNAs), it is possible to reduce the expression of proliferation-dependent proteins in tumor cells, leading to their apoptosis. We propose that siRNAs could be adapted to the tumor type and may cause fewer side effects than current therapy. Four NSCLC cell lines were cultured under standard conditions and transfected with three different concentrations of siRNAs targeted against the hypoxia-inducible factors 1α and 2α (HIF1α and HIF2α) and signal transducer and activator of transcription 3 (STAT3). The expression was observed by quantitative real-time polymerase chain reaction and western blots. For the analysis of cell growth three days after transfection, the cell number was detected using a CASY cell counter system. The results of the silencing of the analyzed factors differ in each cell line. Cell growth was significantly reduced in all cell lines after transfection with HIF1α- and STAT3-siRNA. The silencing of HIF2α resulted in a significant effect on cell growth in squamous, and large-cell lung cancer. This study shows that the knockdown and viability to siRNA transfection differ in each tumor type according to the used siRNA. This implies that the tumor types differ among themselves and should be treated differently. Therefore, the authors suggest a possible approach to a more personalized treatment of NSCLC.
-
Lu, Wei; Zhang, Guodong; Zhang, Rui; Flores, Leo G; Huang, Qian; Gelovani, Juri G; Li, Chun
2010-01-01
Nuclear factor-κB (NF-κB) transcription factor is a critical regulator of the expression of genes involved in tumor formation and progression. Successful RNA interference (RNAi) therapeutics targeting NF-κB is challenged by siRNA delivery systems, which can render targeted in vivo delivery, efficient endo-lysosomal escape and dynamic control over activation of RNAi. Here, we report near-infrared light-inducible NF-κB down-regulation through folate receptor-targeted hollow gold nanospheres carrying siRNA recognizing NF-κB p65 subunit. Using micro-positron emission tomography/computed tomography imaging, the targeted nanoconstructs exhibited significantly higher tumor uptake in nude mice-bearing HeLa cervical cancer xenografts than non-targeted nanoparticles following intravenous administration. Mediated by hollow gold nanospheres, controllable cytoplasmic delivery of siRNA was obtained upon near-infrared light irradiation through photothermal effect. Efficient down-regulation of NF-κB p65 was achieved only in tumors irradiated with near-infrared light, but not in non-irradiated tumors grown in the same mice. Liver, spleen, kidney, and lung were not affected by the treatments, in spite of significant uptake of the siRNA nanoparticles in these organs. We term this mode of action “photothermal transfection”. Combined treatments with p65 siRNA photothermal transfection and irinotecan caused substantially enhanced tumor apoptosis and significant tumor growth delay compared with other treatment regimens. Therefore, photothermal transfection of NF-κB p65 siRNA could effectively sensitize the tumor to chemotherapeutic agents. Because NIR light can penetrate skin and be delivered with high spatiotemporal control, therapeutic RNAi may benefit from this novel transfection strategy while avoiding unwanted side effect. PMID:20388791
-
Pinel, Sophie; Aman, Emmanuel; Erblang, Felix; Dietrich, Jonathan; Frisch, Benoit; Sirman, Julien; Kichler, Antoine; Sibler, Annie-Paule; Dontenwill, Monique; Schaffner, Florence; Zuber, Guy
2014-05-28
The activity of synthetic interfering nucleic acids (siRNAs) relies on the capacity of delivery systems to efficiently transport nucleic acids into the cytosol of target cells. The pyridylthiourea-grafted 25KDa polyethylenimine (πPEI) is an excellent carrier for siRNA delivery into cells and it was extensively investigated in this report. Quantification of the siRNA-mediated gene silencing efficiency indicated that the πPEI specific delivery activity at the cell level may be measured and appears relatively constant in various cell lines. Delivery experiments assaying inhibitors of various entry pathways or concanamycin A, an inhibitor of the H(+)/ATPase vacuolar pump showed that the πPEI/siRNA polyplexes did not require any specific entry mode but strongly relied on vacuolar acidification for functional siRNA delivery. Next, πPEI polyplexes containing a siRNA targeting the transcription factor HIF-1α, known to be involved in tumor progression, were locally injected into mice xenografted with a human glioblastoma. A 55% reduction of the level of the target mRNA was observed at doses comparable to those used in vitro when the πPEI delivery activity was calculated per cell. Altogether, our study underscores the usefulness of "simple"/rough cationic polymers for siRNA delivery despite their intrinsic limitations. The study underscores as well as that bottom-up strategies make sense. The in vitro experiments can precede in vivo administration and be of high value for selection of the carrier with enhanced specific delivery activity and parallel other research aiming at improving synthetic delivery systems for resilience in the blood and for enhanced tissue-targeting capacity. Copyright © 2014 Elsevier B.V. All rights reserved.
-
Whole-Genome Thermodynamic Analysis Reduces siRNA Off-Target Effects
Chen, Xi; Liu, Peng; Chou, Hui-Hsien
2013-01-01
Small interfering RNAs (siRNAs) are important tools for knocking down targeted genes, and have been widely applied to biological and biomedical research. To design siRNAs, two important aspects must be considered: the potency in knocking down target genes and the off-target effect on any nontarget genes. Although many studies have produced useful tools to design potent siRNAs, off-target prevention has mostly been delegated to sequence-level alignment tools such as BLAST. We hypothesize that whole-genome thermodynamic analysis can identify potential off-targets with higher precision and help us avoid siRNAs that may have strong off-target effects. To validate this hypothesis, two siRNA sets were designed to target three human genes IDH1, ITPR2 and TRIM28. They were selected from the output of two popular siRNA design tools, siDirect and siDesign. Both siRNA design tools have incorporated sequence-level screening to avoid off-targets, thus their output is believed to be optimal. However, one of the sets we tested has off-target genes predicted by Picky, a whole-genome thermodynamic analysis tool. Picky can identify off-target genes that may hybridize to a siRNA within a user-specified melting temperature range. Our experiments validated that some off-target genes predicted by Picky can indeed be inhibited by siRNAs. Similar experiments were performed using commercially available siRNAs and a few off-target genes were also found to be inhibited as predicted by Picky. In summary, we demonstrate that whole-genome thermodynamic analysis can identify off-target genes that are missed in sequence-level screening. Because Picky prediction is deterministic according to thermodynamics, if a siRNA candidate has no Picky predicted off-targets, it is unlikely to cause off-target effects. Therefore, we recommend including Picky as an additional screening step in siRNA design. PMID:23484018
-
Lau, Shannen; Graham, Bim; Cao, Nga; Boyd, Ben J; Pouton, Colin W; White, Paul J
2012-01-01
A potential barrier to progression of siRNA therapeutics to the clinic is the ability of these agents to cross the vascular endothelium to reach target cells. This study aimed to bypass the endothelial barrier by harnessing the extravasation capability of the serum protein albumin to allow siRNA to reach cardiomyocytes. A strategy for conjugating siRNA to albumin in vivo was developed that involved activating 3'-amine, 2'-O-methyl, phosphorothioate modified siRNA with succinimidyl 4-[N-maleimidomethyl]cyclohexane-1-carboxylate (SMCC) to yield maleimide-functionalized siRNA ("activated siRNA"); this thiol-reactive species can then irreversibly link to the single surface-exposed cysteine residue of endogenous albumin following intravenous administration. An IGF-I-receptor (IGF-IR) siRNA sequence which was effective in vitro was used to test the ability of the siRNA-albumin conjugate to bypass the endothelial barrier in Balb/C mice and produce silencing. In situ conjugation of maleimide-functionalized siRNA to albumin in mouse serum occurred within minutes of addition, and the resulting conjugate was found to be nuclease stable by SDS-PAGE analysis. In Sprague-Dawley rats, activated siRNA showed a significantly enhanced elimination half-life (75.9 ± 18.2 min) compared to unactivated siRNA (5.1 ± 0.2 min). Intravenous injection of this activated siRNA (1 mg/kg daily for four days) significantly reduced left ventricle IGF-IR mRNA to 64.1 ± 4.1% of that in vehicle-treated animals (mean ± SEM), while the control siRNA (unconjugated) had no effect (n = 4, P > 0.05). Imaging of microvessels from mice treated with fluorescein-labeled activated siRNA showed clear evidence of extravasation and cellular uptake in capillary endothelial cells, cardiomyocytes and vascular smooth muscle cells for mice treated with the activated siRNA but not mice treated with the unactivated siRNA. siRNA-albumin constructs are therefore capable of extravasation to the myocardium resulting in silencing in this otherwise silencing-resistant organ.
-
NASA Astrophysics Data System (ADS)
Yin, Di; Li, Yang; Lin, Hang; Guo, Baofeng; Du, Yanwei; Li, Xin; Jia, Huijie; Zhao, Xuejian; Tang, Jun; Zhang, Ling
2013-03-01
Graphene oxide (GO) has attracted intensive interest in the biomedical field in recent years. We investigate whether the use of functional graphene oxide as an efficient delivery system for delivering specific molecular antitumor therapeutics in vivo could achieve a more excellent antitumor effect. Constitutive activation of signal transducer and activator of transcription 3 (Stat3) promotes survival in a wide spectrum of human cancers. In this paper, we study the in vivo behavior of graphene oxide chemically functionalized with polyethylenimine and polyethylene glycol (GO-PEI-PEG) as a plasmid-based Stat3-specific small interfering RNA (siRNA) carrier in mouse malignant melanoma. The in vivo results indicate significant regression in tumor growth and tumor weight after plasmid-based Stat3 siRNA delivered by GO-PEI-PEG treatment. Moreover, there was no significant side effect from GO-PEI-PEG treatment according to histological examination and blood chemistry analysis in mice. Thus, our work is the first success of using GO-PEI-PEG as a promising carrier for plasmid Stat3 siRNA delivery and down-regulation of Stat3 by a polymer-mediated vehicle and suggests the great promise of graphene in biomedical applications such as cancer treatment.
-
Systematic Evaluation of Promising Clinical Trials-Gene Silencing for the Treatment of Glioblastoma.
Karaarslan, Numan; Yilmaz, Ibrahim; Ozbek, Hanefi; Caliskan, Tezcan; Topuk, Savas; Sirin, Duygu Yasar; Ates, Ozkan
2018-04-06
The aim of this study was to systematically investigate the role of artificial small interfering RNA (siRNA) molecules in glioblastoma treatment and to give a detailed overview of the literature concerning studies performed in this field worldwide in the last 31 years. Articles about clinical trials conducted between December 1, 1949 and November 8, 2017, were identified from the Cochrane Collaboration, the Cochrane Library, Ovid MEDLINE, ProQuest, the National Library of Medicine, and PubMed electronic databases, using the terms "post transcriptional gene silencing," "small interfering RNA," "siRNA," and "glioblastoma," either individually or combined (\\"OR\\" and \\"AND"), without language and country restrictions. Articles that met the examination criteria were included in the study. After descriptive statistical evaluation, the results were reported in frequency (%). After scanning 2.752 articles, five articles were found that met the research criteria. Examination of full texts of the five identified articles provided no sufficient evidence for research conducted with regard to the use of gene silencing via siRNAs in glioblastoma treatment. To be able to evaluate the clinical use of siRNAs, there is an urgent need for in-vivo studies and for trials with randomized, controlled, and clinical designs that provide long-term functional outcomes.
-
Modeling RNA interference in mammalian cells
2011-01-01
Background RNA interference (RNAi) is a regulatory cellular process that controls post-transcriptional gene silencing. During RNAi double-stranded RNA (dsRNA) induces sequence-specific degradation of homologous mRNA via the generation of smaller dsRNA oligomers of length between 21-23nt (siRNAs). siRNAs are then loaded onto the RNA-Induced Silencing multiprotein Complex (RISC), which uses the siRNA antisense strand to specifically recognize mRNA species which exhibit a complementary sequence. Once the siRNA loaded-RISC binds the target mRNA, the mRNA is cleaved and degraded, and the siRNA loaded-RISC can degrade additional mRNA molecules. Despite the widespread use of siRNAs for gene silencing, and the importance of dosage for its efficiency and to avoid off target effects, none of the numerous mathematical models proposed in literature was validated to quantitatively capture the effects of RNAi on the target mRNA degradation for different concentrations of siRNAs. Here, we address this pressing open problem performing in vitro experiments of RNAi in mammalian cells and testing and comparing different mathematical models fitting experimental data to in-silico generated data. We performed in vitro experiments in human and hamster cell lines constitutively expressing respectively EGFP protein or tTA protein, measuring both mRNA levels, by quantitative Real-Time PCR, and protein levels, by FACS analysis, for a large range of concentrations of siRNA oligomers. Results We tested and validated four different mathematical models of RNA interference by quantitatively fitting models' parameters to best capture the in vitro experimental data. We show that a simple Hill kinetic model is the most efficient way to model RNA interference. Our experimental and modeling findings clearly show that the RNAi-mediated degradation of mRNA is subject to saturation effects. Conclusions Our model has a simple mathematical form, amenable to analytical investigations and a small set of parameters with an intuitive physical meaning, that makes it a unique and reliable mathematical tool. The findings here presented will be a useful instrument for better understanding RNAi biology and as modelling tool in Systems and Synthetic Biology. PMID:21272352
-
Švančarová, P; Svetlíková, D; Betáková, T
2015-06-01
RNA interference (RNAi) represents a form of post-transcriptional gene silencing mediated by small interfering RNAs (siRNA) and provides a powerful tool to specifically inhibit viral infection. To investigate therapeutic capacity of siRNAs targeting M gene, six vectors with U1-short hairpin RNA (shRNA) expression system were prepared and tested in infected cells and animals. In infected cells, three of six shRNAs targeting M1 gene significantly (P <0,01) reduced the virus titer to 66%, 45% or 21%, respectively. Replication of IAV and levels of M1 RNAs were significantly reduced in the cells transfected with shRNAs, which decreased the virus titer. IFN-α/β altered in shRNAs-treated cells. The level of IFN-λ (type III interferon) mRNA was significantly increased in the infected cells treated with shM22, shM349, shM522, and (type I interferon) as well as IP-10 (type II interferon) mRNAs were not significantly their mixtures. The increased level of IFN-λ mRNA corresponded to significantly increased level of RIG-1 mRNA. shRNAs inhibited influenza virus infection in a gene-specific manner in co-operation with IFN-λ. Some constructs targeting the M1 transcript prolonged the survival of infected mice.
-
Tricker, Penny J.; Gibbings, J. George; Rodríguez López, Carlos M.; Hadley, Paul; Wilkinson, Mike J.
2012-01-01
Environmental cues influence the development of stomata on the leaf epidermis, and allow plants to exert plasticity in leaf stomatal abundance in response to the prevailing growing conditions. It is reported that Arabidopsis thaliana ‘Landsberg erecta’ plants grown under low relative humidity have a reduced stomatal index and that two genes in the stomatal development pathway, SPEECHLESS and FAMA, become de novo cytosine methylated and transcriptionally repressed. These environmentally-induced epigenetic responses were abolished in mutants lacking the capacity for de novo DNA methylation, for the maintenance of CG methylation, and in mutants for the production of short-interfering non-coding RNAs (siRNAs) in the RNA-directed DNA methylation pathway. Induction of methylation was quantitatively related to the induction of local siRNAs under low relative humidity. Our results indicate the involvement of both transcriptional and post-transcriptional gene suppression at these loci in response to environmental stress. Thus, in a physiologically important pathway, a targeted epigenetic response to a specific environmental stress is reported and several of its molecular, mechanistic components are described, providing a tractable platform for future epigenetics experiments. Our findings suggest epigenetic regulation of stomatal development that allows for anatomical and phenotypic plasticity, and may help to explain at least some of the plant’s resilience to fluctuating relative humidity. PMID:22442411
-
PU.1 is a major transcriptional activator of the tumour suppressor gene LIMD1
Foxler, Daniel E.; James, Victoria; Shelton, Samuel J.; Vallim, Thomas Q. de A.; Shaw, Peter E.; Sharp, Tyson V.
2011-01-01
LIMD1 is a tumour suppressor gene (TSG) down regulated in ∼80% of lung cancers with loss also demonstrated in breast and head and neck squamous cell carcinomas. LIMD1 is also a candidate TSG in childhood acute lymphoblastic leukaemia. Mechanistically, LIMD1 interacts with pRB, repressing E2F-driven transcription as well as being a critical component of microRNA-mediated gene silencing. In this study we show a CpG island within the LIMD1 promoter contains a conserved binding motif for the transcription factor PU.1. Mutation of the PU.1 consensus reduced promoter driven transcription by 90%. ChIP and EMSA analysis demonstrated that PU.1 specifically binds to the LIMD1 promoter. siRNA depletion of PU.1 significantly reduced endogenous LIMD1 expression, demonstrating that PU.1 is a major transcriptional activator of LIMD1. PMID:21402070
-
An, Jing; Xu, Qin-Zhi; Sui, Jian-Li; Bai, Bei; Zhou, Ping-Kun
2005-09-01
DNA-dependent protein kinase catalytic subunit (DNA-PKcs), a member of a sub-family of phosphoinositol 3-kinases, has been reported overexpressed in various human cancers, but its significance is unclear. In the present study, we generated the stable cell line HeLa(siRNAH1) of silenced DNA-PKcs by transfecting HeLa cells with the siRNA construct targeting the catalytic motif of DNA-PKcs. The expression of DNA-PKcs was markedly suppressed in HeLa(siRNAH1) cells, and eventuating in increased cellular sensitivity to ionizing radiation as well as cisplatin. Microarray assay was used to explore the transcriptional profiling of signal transduction-associated genes. The results demonstrated that 15 genes were up-regulated and eight were down-regulated in HeLa(siRNAH1) as compared with the HeLa(control) cells that transfected with non-specific siRNA construct. Seven of the up-regulated genes are associated with the interferon-signaling events, the others function in the BMP signal pathway, or as regulators of cell cycle and differentiation. The down-regulated genes include IL8, IL10RA, DAPK3, and those involved in nuclear factor of activated T cells (NFAT) signal pathway and endocrine responsiveness. Using the NFAT-driving secreted alkaline phosphatase reporter expression system, we further confirmed that NFAT transcriptional activity was markedly minimized after silencing DNA-PKcs. These results demonstrated that inactivation of DNA-PKcs altered the transcriptional level of certain signal transduction-associated genes related to proliferation and differentiation.
-
Jia, Di; Huang, Lan; Bischoff, Joyce; Moses, Marsha A.
2015-01-01
We have previously identified a zinc finger transcription factor, ZNF24 (zinc finger protein 24), as a novel inhibitor of tumor angiogenesis and have demonstrated that ZNF24 exerts this effect by repressing the transcription of VEGF in breast cancer cells. Here we focused on the role of ZNF24 in modulating the angiogenic potential of the endothelial compartment. Knockdown of ZNF24 by siRNA in human primary microvascular endothelial cells (ECs) led to significantly decreased cell migration and invasion compared with control siRNA. ZNF24 knockdown consistently led to significantly impaired VEGF receptor 2 (VEGFR2) signaling and decreased levels of matrix metalloproteinase-2 (MMP-2), with no effect on levels of major regulators of MMP-2 activity such as the tissue inhibitors of metalloproteinases and MMP-14. Moreover, silencing ZNF24 in these cells led to significantly decreased EC proliferation. Quantitative PCR array analyses identified multiple cell cycle regulators as potential ZNF24 downstream targets which may be responsible for the decreased proliferation in ECs. In vivo, knockdown of ZNF24 specifically in microvascular ECs led to significantly decreased formation of functional vascular networks. Taken together, these results demonstrate that ZNF24 plays an essential role in modulating the angiogenic potential of microvascular ECs by regulating the proliferation, migration, and invasion of these cells.— Jia, D., Huang, L., Bischoff, J., Moses, M. A. The endogenous zinc finger transcription factor, ZNF24, modulates the angiogenic potential of human microvascular endothelial cells. PMID:25550468
-
Silencing of P2Y2 receptor delays Ap4A-corneal re-epithelialization process
Crooke, Almudena; Mediero, Aránzazu; Guzmán-Aránguez, Ana
2009-01-01
Purpose There are no selective antagonists for the metabotropic nucleotide P2Y2 receptor subtype. This implies that it is not possible to demonstrate the importance of such a receptor in the relevant process of corneal wound healing. Therefore, we have cloned and designed a small interference RNA (siRNA) against the rabbit P2Y2 receptor (P2Y2-R) mRNA, which clearly demonstrates the importance of this receptor in the process of wound healing triggered by nucleotides and dinucleotides both in vitro and in vivo. Methods Rabbit P2Y2-R cDNA was cloned using a combination of degenerate reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). To test the efficacy of synthesized siRNAs targeting P2Y2-R, immunocytochemistry, immunohistochemistry, and quantitative RT-PCR (qRT–PCR) assays were performed. Migration assays were performed both in vitro and in vivo by wounding the epithelium with a pipette tip and n-heptanol, respectively. These wounds were performed 72 h after siRNA transfection either in the presence or the absence of the P2Y2 agonist, 100 μM Ap4A (diadenosine tetraphosphate). Results The cloned receptor presents 93% homology compared to the human gene. Two siRNAs were designed and synthesized against a rabbit P2Y2-R sequence. After transfection (in vitro assays) or topical instillation (in vivo assays), we demonstrated P2Y2-R siRNA efficient transfection/delivery and its efficient gene silencing. Clear reduction of P2Y2-R expression was observed at both the mRNA and protein levels in corneas treated with siRNA. In vitro and in vivo migration analysis showed that the silencing process has concomitantly reduced the ability of corneal cells to close the wounds in the presence of the Ap4A. In addition, both synthesized siRNAs exert a delay effect on the Ap4A-induced migration rate in vitro. These results suggest the absence of non-specific (off-target) effects by our siRNA. Conclusions The application of P2Y2-R siRNA has demonstrated the role of this receptor in the accelerating effect of diadenosine tetraphosphate (Ap4A) on the corneal wound healing process. PMID:19521552
-
Silencing of P2Y2 receptor delays Ap4A-corneal re-epithelialization process.
Crooke, Almudena; Mediero, Aránzazu; Guzmán-Aránguez, Ana; Pintor, Jesús
2009-06-11
There are no selective antagonists for the metabotropic nucleotide P2Y(2) receptor subtype. This implies that it is not possible to demonstrate the importance of such a receptor in the relevant process of corneal wound healing. Therefore, we have cloned and designed a small interference RNA (siRNA) against the rabbit P2Y(2) receptor (P2Y(2)-R) mRNA, which clearly demonstrates the importance of this receptor in the process of wound healing triggered by nucleotides and dinucleotides both in vitro and in vivo. Rabbit P2Y(2)-R cDNA was cloned using a combination of degenerate reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). To test the efficacy of synthesized siRNAs targeting P2Y(2)-R, immunocytochemistry, immunohistochemistry, and quantitative RT-PCR (qRT-PCR) assays were performed. Migration assays were performed both in vitro and in vivo by wounding the epithelium with a pipette tip and n-heptanol, respectively. These wounds were performed 72 h after siRNA transfection either in the presence or the absence of the P2Y(2) agonist, 100 muM Ap(4)A (diadenosine tetraphosphate). The cloned receptor presents 93% homology compared to the human gene. Two siRNAs were designed and synthesized against a rabbit P2Y(2)-R sequence. After transfection (in vitro assays) or topical instillation (in vivo assays), we demonstrated P2Y(2)-R siRNA efficient transfection/delivery and its efficient gene silencing. Clear reduction of P2Y(2)-R expression was observed at both the mRNA and protein levels in corneas treated with siRNA. In vitro and in vivo migration analysis showed that the silencing process has concomitantly reduced the ability of corneal cells to close the wounds in the presence of the Ap(4)A. In addition, both synthesized siRNAs exert a delay effect on the Ap(4)A-induced migration rate in vitro. These results suggest the absence of non-specific (off-target) effects by our siRNA. The application of P2Y(2)-R siRNA has demonstrated the role of this receptor in the accelerating effect of diadenosine tetraphosphate (Ap(4)A) on the corneal wound healing process.
-
Pu, Jiarui; Mei, Hong; Zhao, Jun; Huang, Kai; Zeng, Fuqing; Tong, Qiangsong
2012-01-01
Heparanase (HPA), an endo-h-D-glucuronidase that cleaves the heparan sulfate chain of heparan sulfate proteoglycans, is overexpressed in majority of human cancers. Recent evidence suggests that small interfering RNA (siRNA) induces transcriptional gene silencing (TGS) in human cells. In this study, transfection of siRNA against −9/+10 bp (siH3), but not −174/−155 bp (siH1) or −134/−115 bp (siH2) region relative to transcription start site (TSS) locating at 101 bp upstream of the translation start site, resulted in TGS of heparanase in human prostate cancer, bladder cancer, and gastric cancer cells in a sequence-specific manner. Methylation-specific PCR and bisulfite sequencing revealed no DNA methylation of CpG islands within heparanase promoter in siH3-transfected cells. The TGS of heparanase did not involve changes of epigenetic markers histone H3 lysine 9 dimethylation (H3K9me2), histone H3 lysine 27 trimethylation (H3K27me3) or active chromatin marker acetylated histone H3 (AcH3). The regulation of alternative splicing was not involved in siH3-mediated TGS. Instead, siH3 interfered with transcription initiation via decreasing the binding of both RNA polymerase II and transcription factor II B (TFIIB), but not the binding of transcription factors Sp1 or early growth response 1, on the heparanase promoter. Moreover, Argonaute 1 and Argonaute 2 facilitated the decreased binding of RNA polymerase II and TFIIB on heparanase promoter, and were necessary in siH3-induced TGS of heparanase. Stable transfection of the short hairpin RNA construct targeting heparanase TSS (−9/+10 bp) into cancer cells, resulted in decreased proliferation, invasion, metastasis and angiogenesis of cancer cells in vitro and in athymic mice models. These results suggest that small RNAs targeting TSS can induce TGS of heparanase via interference with transcription initiation, and significantly suppress the tumor growth, invasion, metastasis and angiogenesis of cancer cells. PMID:22363633
-
Beauchef, Gallic; Bigot, Nicolas; Kypriotou, Magdalini; Renard, Emmanuelle; Porée, Benoît; Widom, Russell; Dompmartin-Blanchere, Anne; Oddos, Thierry; Maquart, François-Xavier; Demoor, Magali; Boumediene, Karim; Galera, Philippe
2012-01-01
Transcriptional mechanisms regulating type I collagen genes expression in physiopathological situations are not completely known. In this study, we have investigated the role of nuclear factor-κB (NF-κB) transcription factor on type I collagen expression in adult normal human (ANF) and scleroderma (SF) fibroblasts. We demonstrated that NF-κB, a master transcription factor playing a major role in immune response/apoptosis, down-regulates COL1A1 expression by a transcriptional control involving the −112/−61 bp sequence. This 51-bp region mediates the action of two zinc fingers, Sp1 (specific protein-1) and Sp3, acting as trans-activators of type I collagen expression in ANF and SF. Knockdown of each one of these trans factors by siRNA confirmed the trans-activating effect of Sp1/Sp3 and the p65 subunit of NF-κB trans-inhibiting effect on COL1A1 expression. Despite no existing κB consensus sequence in the COL1A1 promoter, we found that Sp1/Sp3/c-Krox and NF-κB bind and/or are recruited on the proximal promoter in chromatin immunoprecipitation (ChIP) assays. Attempts to elucidate whether interactions between Sp1/Sp3/c-Krox and p65 are necessary to mediate the NF-κB inhibitory effect on COL1A1 in ANF and SF were carried out; in this regard, immunoprecipitation assays revealed that they interact, and this was validated by re-ChIP. Finally, the knockdown of Sp1/Sp3/c-Krox prevents the p65 inhibitory effect on COL1A1 transcription in ANF, whereas only the siRNAs targeting Sp3 and c-Krox provoked the same effect in SF, suggesting that particular interactions are characteristic of the scleroderma phenotype. In conclusion, our findings highlight a new mechanism for COL1A1 transcriptional regulation by NF-κB, and these data could allow the development of new antifibrotic strategies. PMID:22139845
-
Ying, Shibo; Dünnebier, Thomas; Si, Jing; Hamann, Ute
2013-01-01
UBC9 encodes a protein that conjugates small ubiquitin-related modifier (SUMO) to target proteins thereby changing their functions. Recently, it was noted that UBC9 expression and activity play a role in breast tumorigenesis and response to anticancer drugs. However, the underlying mechanism is poorly understood. To investigate the transcriptional regulation of the UBC9 gene, we identified and characterized its promoter and cis-elements. Promoter activity was tested using luciferase reporter assays. The binding of transcription factors to the promoter was detected by chromatin immunoprecipitation (ChIP), and their functional role was confirmed by siRNA knockdown. UBC9 mRNA and protein levels were measured by quantitative reverse transcription PCR and Western blot analysis, respectively. An increased expression of UBC9 mRNA and protein was found in MCF-7 breast cancer cells treated with 17β-estradiol (E2). Analysis of various deletion mutants revealed a 137 bp fragment upstream of the transcription initiation site to be sufficient for reporter gene transcription. Mutations of putative estrogen receptor α (ER-α) (one imperfect estrogen response element, ERE) and/or nuclear factor Y (NF-Y) binding sites (two CCAAT boxes) markedly reduced promoter activity. Similar results were obtained in ER-negative MDA-MB-231 cells except that the ERE mutation did not affect promoter activity. Additionally, promoter activity was stimulated upon E2 treatment and overexpression of ER-α or NF-YA in MCF-7 cells. ChIP confirmed direct binding of both transcription factors to the UBC9 promoter in vivo. Furthermore, UBC9 expression was diminished by ER-α and NF-Y siRNAs on the mRNA and protein levels. In conclusion, we identified the proximal UBC9 promoter and provided evidence that ER-α and NF-Y regulate UBC9 expression on the transcriptional level in response to E2 in MCF-7 cells. These findings may contribute to a better understanding of the regulation of UBC9 in ER-positive breast cancer and be useful for the development of cancer therapies targeting UBC9.
-
Xu, Chaoqian; Hu, Yingying; Hou, Liangyu; Ju, Jin; Li, Xiaoguang; Du, Ning; Guan, Xiaoxiang; Liu, Zhenhong; Zhang, Tianze; Qin, Wei; Shen, Nannan; Bilal, Muhammad U; Lu, Yanjie; Zhang, Yong; Shan, Hongli
2014-10-01
Oxidative stress is a causal factor and key promoter of a variety of cardiovascular diseases associated with apoptotic cell death by causing deregulation of related genes. Though carvedilol, a β-adrenergic blocker, has been shown to produce cytoprotective effects against cardiomyocyte apoptosis, the mechanisms are not fully understood. The present study was designed to investigate whether the beneficial effects of carvedilol are related to microRNAs which have emerged as critical players in cardiovascular pathophysiology via post-transcriptional regulation of protein-coding genes. In vivo, we demonstrated that carvedilol ameliorated impaired cardiac function of infarct rats and restored miR-133 expression. In vitro, carvedilol protected cardiomyocytes from H2O2 induced apoptosis detected by TUNEL staining and MTT assays, and increased miR-133 expression in cardiomyocytes. Overexpression of miR-133, a recognized anti-apoptotic miRNA, produced similar effects to carvedilol: reduction of reactive oxygen species (ROS) and malondialdehyde (MDA) content and increment of superoxide dismutase (SOD) activity and glutathione peroxidase (GPx) level, so as to protect cardiomyocytes from apoptosis by downregulating caspase-9 and caspase-3 expression in the presence of H2O2. Transfection with AMO-133 (antisense inhibitor oligodeoxyribonucleotides) alone abolished the beneficial effects of carvedilol. Caspase-9-specific inhibitor z-LEHD-fmk, caspase-3-specific inhibitor z-DEVD-fmk, caspase-9 siRNA and caspase-3 siRNA were used to establish caspase-3 as a downstream target of miR-133. In conclusion, our data indicated that carvedilol protected cardiomyocytes by increasing miR-133 expression and suppressing caspase-9 and subsequent apoptotic pathways. Copyright © 2014 Elsevier Ltd. All rights reserved.
-
USDA-ARS?s Scientific Manuscript database
Soybean plants infected with Bean pod mottle virus (BPMV) develop acute symptoms that usually decrease in severity over time. In other plant-virus interactions, this type of symptom recovery has been associated with degradation of viral RNAs by post-transcriptional gene silencing (PTGS), which is ac...
-
Novel meiotic miRNAs and indications for a role of phasiRNAs in meiosis
USDA-ARS?s Scientific Manuscript database
Small RNAs (sRNA) add additional layers to the regulation of gene expression, with siRNAs directing gene silencing at the DNA level by RdDM (RNA-directed DNA methylation), and miRNAs directing post-transcriptional regulation of specific target genes, mostly by mRNA cleavage. We used manually isolate...
-
Voronov, Dmitry; Gromova, Anastasia; Liu, Daren; Zoukhri, Driss; Medvinsky, Alexander; Meech, Robyn; Makarenkova, Helen P.
2013-01-01
Purpose. Lacrimal gland (LG) morphogenesis and repair are regulated by a complex interplay of intrinsic factors (e.g., transcription factors) and extrinsic signals (e.g., soluble growth/signaling factors). Many of these interconnections remain poorly characterized. Runt-related (Runx) factors belong to a small family of heterodimeric transcription factors known to regulate lineage-specific proliferation and differentiation of stem cells. The purpose of this study was to define the expression pattern and the role of Runx proteins in LG development and regeneration. Methods. Expression of epithelial-restricted transcription factors in murine LG was examined using immunostaining, qRT-PCR, and RT2Profiler PCR microarrays. The role of Runx transcription factors in LG morphogenesis was studied using siRNA and ex vivo LG cultures. Expression of Runx transcription factors during LG regeneration was assessed using in vivo model of LG regeneration. Results. We found that Runx factors are expressed in the epithelial compartment of the LG; in particular, Runx1 was restricted to the epithelium with highest level of expression in ductal and centroacinar cells. Downregulation of Runx1 to 3 expression using Runx-specific siRNAs abolished LG growth and branching and our data suggest that Runx1, 2, and 3 are partially redundant in LG development. In siRNA-treated LG, reduction of branching correlated with reduction of epithelial proliferation, as well as expression of cyclin D1 and the putative epithelial progenitor cell marker cytokeratin-5. Runx1, Runx3, and cytokeratin-5 expression increased significantly in regenerating LG and there was modest increase in Runx2 expression during LG differentiation. Conclusions. Runx1 and 2 are new markers of the LG epithelial lineage and Runx factors are important for normal LG morphogenesis and regeneration. PMID:23532528
-
Efficient Intracellular siRNA Delivery by Ethyleneimine-Modified Amphiphilic Macromolecules
Sparks, Sarah M.; Waite, Carolyn L.; Harmon, Alexander M.; Nusblat, Leora M.; Roth, Charles M.; Uhrich, Kathryn E.
2013-01-01
Summary New materials that can bind and deliver oligonucleotides such as short interfering RNA (siRNA) without toxicity are greatly needed to fulfill the promise of therapeutic gene silencing. Amphiphilic macromolecules (AMs) were functionalized with linear ethyleneimines to create cationic AMs capable of complexing with siRNA. Structurally, the parent AM is formed from a mucic acid backbone whose tetra-hydroxy groups are alkylated with 12-carbon aliphatic chains to form the hydrophobic component of the macromolecule. This alkylated mucic acid is then mono-functionalized with poly(ethylene glycol) (PEG) as a hydrophilic component. The resulting AM contains a free carboxylic acid within the hydrophobic domain. In this work, linear ethyleneimines were conjugated to the free carboxylic acid to produce an AM with one primary amine (1N) or one primary amine and four secondary amines (5N). Further, an AM with amine substitution both to the free carboxylic acid in the hydrophobic domain and also to the adjacent PEG was synthesized to produce a polymer with one primary amine and eight secondary amines (9N), four located on each side of the AM hydrophobic domain. All amine-functionalized AMs formed nanoscale micelles but only the 5N and 9N AMs had cationic zeta potentials, which increased with increasing number of amines. All AMs exhibited less inherent cytotoxicity than linear polyethyleneimine (L-PEI) at concentrations of 10 µM and above. By increasing the length of the cationic ethyleneimine chain and the total number of amines, successful siRNA complexation and cellular siRNA delivery was achieved in a malignant glioma cell line. In addition, siRNA-induced silencing of firefly luciferase was observed using complexes of siRNA with the 9N AM and comparable to L-PEI, yet showed better cell viability at higher concentrations (above 10 µM). This work highlights the promise of cationic AMs as safe and efficient synthetic vectors for siRNA delivery. Specifically, a novel polymer (9N) was identified for efficient siRNA delivery to cancer cells and will be further evaluated. PMID:21793212
-
Abasic pivot substitution harnesses target specificity of RNA interference
Lee, Hye-Sook; Seok, Heeyoung; Lee, Dong Ha; Ham, Juyoung; Lee, Wooje; Youm, Emilia Moonkyung; Yoo, Jin Seon; Lee, Yong-Seung; Jang, Eun-Sook; Chi, Sung Wook
2015-01-01
Gene silencing via RNA interference inadvertently represses hundreds of off-target transcripts. Because small interfering RNAs (siRNAs) can function as microRNAs, avoiding miRNA-like off-target repression is a major challenge. Functional miRNA–target interactions are known to pre-require transitional nucleation, base pairs from position 2 to the pivot (position 6). Here, by substituting nucleotide in pivot with abasic spacers, which prevent base pairing and alleviate steric hindrance, we eliminate miRNA-like off-target repression while preserving on-target activity at ∼80–100%. Specifically, miR-124 containing dSpacer pivot substitution (6pi) loses seed-mediated transcriptome-wide target interactions, repression activity and biological function, whereas other conventional modifications are ineffective. Application of 6pi allows PCSK9 siRNA to efficiently lower plasma cholesterol concentration in vivo, and abolish potentially deleterious off-target phenotypes. The smallest spacer, C3, also shows the same improvement in target specificity. Abasic pivot substitution serves as a general means to harness the specificity of siRNA experiments and therapeutic applications. PMID:26679372
-
TAF11 assembles RISC loading complex to enhance RNAi efficiency
Liang, Chunyang; Wang, Yibing; Murota, Yukiko; Liu, Xiang; Smith, Dean; Siomi, Mikiko C.; Liu, Qinghua
2015-01-01
SUMMARY Assembly of the RNA-induced silencing complex (RISC) requires formation of the RISC loading complex (RLC), which contains Dicer-2(Dcr-2)-R2D2 complex and recruits duplex siRNA to Ago2 in Drosophila melanogaster. However, the precise composition and action mechanism of Drosophila RLC remain unclear. Here, we identified the missing factor of RLC as TATA-binding protein associated factor 11 (TAF11) by genetic screen. Although an annotated nuclear transcription factor, we found that TAF11 also associated with Dcr-2/R2D2 and localized to cytoplasmic D2 bodies. Consistent with defective RLC assembly in taf11−/− ovary extract, we reconstituted the RLC in vitro using recombinant Dcr-2-R2D2 complex, TAF11, and duplex siRNA. Furthermore, we showed that TAF11 tetramer facilitates Dcr-2-R2D2 tetramerization to enhance siRNA binding and RISC loading activities. Together, our genetic and biochemical studies define the molecular nature of Drosophila RLC and elucidate a novel cytoplasmic function of TAF11 in organizing RLC assembly to enhance RNAi efficiency. PMID:26257286
-
He, Xin-Jian; Hsu, Yi-Feng; Pontes, Olga; Zhu, Jianhua; Lu, Jian; Bressan, Ray A.; Pikaard, Craig; Wang, Co-Shine; Zhu, Jian-Kang
2009-01-01
RNA-directed DNA methylation (RdDM) is an RNAi-based mechanism for establishing transcriptional gene silencing in plants. The plant-specific RNA polymerases IV and V are required for the generation of 24-nucleotide (nt) siRNAs and for guiding sequence-specific DNA methylation by the siRNAs, respectively. However, unlike the extensively studied multisubunit Pol II, our current knowledge about Pol IV and Pol V is restricted to only the two largest subunits NRPD1a/NRPD1 and NRPD1b/NRPE1 and the one second-largest subunit NRPD2a. It is unclear whether other subunits may be required for the functioning of Pol IV and Pol V in RdDM. From a genetic screen for second-site suppressors of the DNA demethylase mutant ros1, we identified a new component (referred to as RDM2) as well as seven known components (NRPD1, NRPE1, NRPD2a, AGO4, HEN1, DRD1, and HDA6) of the RdDM pathway. The differential effects of the mutations on two mechanistically distinct transcriptional silencing reporters suggest that RDM2, NRPD1, NRPE1, NRPD2a, HEN1, and DRD1 function only in the siRNA-dependent pathway of transcriptional silencing, whereas HDA6 and AGO4 have roles in both siRNA-dependent and -independent pathways of transcriptional silencing. In the rdm2 mutants, DNA methylation and siRNA accumulation were reduced substantially at loci previously identified as endogenous targets of Pol IV and Pol V, including 5S rDNA, MEA-ISR, AtSN1, AtGP1, and AtMU1. The amino acid sequence of RDM2 is similar to that of RPB4 subunit of Pol II, but we show evidence that RDM2 has diverged significantly from RPB4 and cannot function in Pol II. An association of RDM2 with both NRPD1 and NRPE1 was observed by coimmunoprecipitation and coimmunolocalization assays. Our results show that RDM2/NRPD4/NRPE4 is a new component of the RdDM pathway in Arabidopsis and that it functions as part of Pol IV and Pol V. PMID:19204117
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
He, Xin-Jian; Hsu, Yi-Feng; Pontes, Olga
2009-01-01
RNA-directed DNA methylation (RdDM) is an RNAi-based mechanism for establishing transcriptional gene silencing in plants. The plant-specific RNA polymerases IV and V are required for the generation of 24-nucleotide (nt) siRNAs and for guiding sequence-specific DNA methylation by the siRNAs, respectively. However, unlike the extensively studied multisubunit Pol II, our current knowledge about Pol IV and Pol V is restricted to only the two largest subunits NRPD1a/NRPD1 and NRPD1b/NRPE1 and the one second-largest subunit NRPD2a. It is unclear whether other subunits may be required for the functioning of Pol IV and Pol V in RdDM. From a genetic screen formore » second-site suppressors of the DNA demethylase mutant ros1, we identified a new component (referred to as RDM2) as well as seven known components (NRPD1, NRPE1, NRPD2a, AGO4, HEN1, DRD1, and HDA6) of the RdDM pathway. The differential effects of the mutations on two mechanistically distinct transcriptional silencing reporters suggest that RDM2, NRPD1, NRPE1, NRPD2a, HEN1, and DRD1 function only in the siRNA-dependent pathway of transcriptional silencing, whereas HDA6 and AGO4 have roles in both siRNA-dependent and -independent pathways of transcriptional silencing. In the rdm2 mutants, DNA methylation and siRNA accumulation were reduced substantially at loci previously identified as endogenous targets of Pol IV and Pol V, including 5S rDNA, MEA-ISR, AtSN1, AtGP1, and AtMU1. The amino acid sequence of RDM2 is similar to that of RPB4 subunit of Pol II, but we show evidence that RDM2 has diverged significantly from RPB4 and cannot function in Pol II. An association of RDM2 with both NRPD1 and NRPE1 was observed by coimmunoprecipitation and coimmunolocalization assays. Our results show that RDM2/NRPD4/NRPE4 is a new component of the RdDM pathway in Arabidopsis and that it functions as part of Pol IV and Pol V.« less
-
Min, Kyoung-Jin; Nam, Ju-Ock; Kwon, Taeg Kyu
2017-08-02
Fisetin is a natural compound found in fruits and vegetables such as strawberries, apples, cucumbers, and onions. Since fisetin can elicit anti-cancer effects, including anti-proliferation and anti-migration, we investigated whether fisetin induced apoptosis in human renal carcinoma (Caki) cells. Fisetin markedly induced sub-G1 population and cleavage of poly (ADP-ribose) polymerase (PARP), which is a marker of apoptosis, and increased caspase activation. We found that pan-caspase inhibitor (z-VAD-fmk) inhibited fisetin-induced apoptosis. In addition, fisetin induced death receptor 5 (DR5) expression at the transcriptional level, and down-regulation of DR5 by siRNA blocked fisetin-induced apoptosis. Furthermore, fisetin induced p53 protein expression through up-regulation of protein stability, whereas down-regulation of p53 by siRNA markedly inhibited fisetin-induced DR5 expression. In contrast, fisetin induced up-regulation of CHOP expression and reactive oxygen species production, which had no effect on fisetin-induced apoptosis. Taken together, our study demonstrates that fisetin induced apoptosis through p53 mediated up-regulation of DR5 expression at the transcriptional level.
-
NASA Astrophysics Data System (ADS)
Liu, Xun; Shah, Ankit; Gangwani, Mohitkumar R.; Silverstein, Peter S.; Fu, Mingui; Kumar, Anil
2014-03-01
The prevalence of HIV-associated neurocognitive disorders (HAND) remains high in patients infected with HIV-1. The production of pro-inflammatory cytokines by astrocytes/microglia exposed to viral proteins is thought to be one of the mechanisms leading to HIV-1- mediated neurotoxicity. In the present study we examined the effects of Nef on CCL5 induction in astrocytes. The results demonstrate that CCL5 is significantly induced in Nef-transfected SVGA astrocytes. To determine the mechanisms responsible for the increased CCL5 caused by Nef, we employed siRNA and chemical antagonists. Antagonists of NF-κB, PI3K, and p38 significantly reduced the expression levels of CCL5 induced by Nef transfection. Furthermore, specific siRNAs demonstrated that the Akt, p38MAPK, NF-κB, CEBP, and AP-1 pathways play a role in Nef-mediated CCL5 expression. The results demonstrated that the PI3K/Akt and p38 MAPK pathways, along with the transcription factors NF-κB, CEBP, and AP-1, are involved in Nef-induced CCL5 production in astrocytes.
-
Immune modulation through RNA interference-mediated silencing of CD40 in dendritic cells.
Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Samiee, Shahram; Ataee, Zahra; Tabei, Seyyed Ziyaoddin; Moazzeni, Seyed Mohammad
2009-01-01
RNA interference (RNAi) is an exciting mechanism for knocking down any target gene in transcriptional level. It is now clear that small interfering RNA (siRNA), a 19-21nt long dsRNA, can trigger a degradation process (RNAi) that specifically silences the expression of a cognate mRNA. Our findings in this study showed that down regulation of CD40 gene expression in dendritic cells (DCs) by RNAi culminated to immune modulation. Effective delivery of siRNA into DCs would be a reasonable method for the blocking of CD40 gene expression at the cell surface without any effect on other genes and cell cytotoxicity. The effects of siRNA against CD40 mRNA on the function and phenotype of DCs were investigated. The DCs were separated from the mice spleen and then cultured in vitro. By the means of Lipofectamine2000, siRNA was delivered to the cells and the efficacy of transfection was estimated by flow cytometry. By Annexine V and Propidium Iodide staining, we could evaluate the transfected cells viability. Also, the mRNA expression and protein synthesis were assessed by real-time PCR and flow cytometry, respectively. Knocking down the CD40 gene in the DCs caused an increase in IL-4 production, decrease in IL-12 production and allostimulation activity. All together, these effects would stimulate Th2 cytokines production from allogenic T-cells in vitro.
-
An siRNA-based method for efficient silencing of gene expression in mature brown adipocytes.
Isidor, Marie S; Winther, Sally; Basse, Astrid L; Petersen, M Christine H; Cannon, Barbara; Nedergaard, Jan; Hansen, Jacob B
2016-01-01
Brown adipose tissue is a promising therapeutic target for opposing obesity, glucose intolerance and insulin resistance. The ability to modulate gene expression in mature brown adipocytes is important to understand brown adipocyte function and delineate novel regulatory mechanisms of non-shivering thermogenesis. The aim of this study was to optimize a lipofection-based small interfering RNA (siRNA) transfection protocol for efficient silencing of gene expression in mature brown adipocytes. We determined that a critical parameter was to deliver the siRNA to mature adipocytes by reverse transfection, i.e. transfection of non-adherent cells. Using this protocol, we effectively knocked down both high- and low-abundance transcripts in a model of mature brown adipocytes (WT-1) as well as in primary mature mouse brown adipocytes. A functional consequence of the knockdown was confirmed by an attenuated increase in uncoupled respiration (thermogenesis) in response to β-adrenergic stimulation of mature WT-1 brown adipocytes transfected with uncoupling protein 1 siRNA. Efficient gene silencing was also obtained in various mouse and human white adipocyte models (3T3-L1, primary mouse white adipocytes, hMADS) with the ability to undergo "browning." In summary, we report an easy and versatile reverse siRNA transfection protocol to achieve specific silencing of gene expression in various models of mature brown and browning-competent white adipocytes, including primary cells.
-
Singh, Ankita; Singh, Vishal; Tiwari, Rajiv L.; Chandra, Tulika; Kumar, Ashutosh; Dikshit, Madhu; Barthwal, Manoj K.
2016-01-01
In monocytic cells, Toll-like receptor 4 (TLR4)- and TLR2-induced reactive oxygen species (ROS) cause oxidative stress and inflammatory response; however, the mechanism is not well understood. The present study investigated the role of interleukin-1 receptor-associated kinase (IRAK), extracellular signal-regulated kinase (ERK), p67phox and Nox-2 in TLR4- and TLR2-induced ROS generation during interleukin-1 beta (IL-1β) transcription, processing, and secretion. An IRAK1/4 inhibitor, U0126, PD98059, an NADPH oxidase inhibitor (diphenyleneiodonium (DPI)), and a free radical scavenger (N-acetyl cysteine (NAC))-attenuated TLR4 (lipopolysaccharide (LPS))- and TLR2 (Pam3csk4)-induced ROS generation and IL-1β production in THP-1 and primary human monocytes. An IRAK1/4 inhibitor and siRNA-attenuated LPS- and Pam3csk4-induced ERK-IRAK1 association and ERK phosphorylation and activity. LPS and Pam3csk4 also induced IRAK1/4-, ERK- and ROS-dependent activation of activator protein-1 (AP-1), IL-1β transcription, and IL-1β processing because significant inhibition in AP-1 activity, IL-1β transcription, Pro- and mature IL-β expression, and caspase-1 activity was observed with PD98059, U0126, DPI, NAC, an IRAK1/4 inhibitor, tanshinone IIa, and IRAK1 siRNA treatment. IRAK-dependent ERK-p67phox interaction, p67phox translocation, and p67phox–Nox-2 interaction were observed. Nox-2 siRNA significantly reduced secreted IL-1β, IL-1β transcript, pro- and mature IL-1β expression, and caspase-1 activity indicating a role for Nox-2 in LPS- and Pam3csk4-induced IL-1β production, transcription, and processing. In the present study, we demonstrate that the TLR4- and TLR2-induced IRAK-ERK pathway cross-talks with p67phox-Nox-2 for ROS generation, thus regulating IL-1β transcription and processing in monocytic cells. PMID:26320741
-
Lee, Soo Hyeon; Chung, Bong Hyun; Park, Tae Gwan; Nam, Yoon Sung; Mok, Hyejung
2012-07-17
Because of RNA's ability to encode structure and functional information, researchers have fabricated diverse geometric structures from this polymer at the micro- and nanoscale. With their tunable structures, rigidity, and biocompatibility, novel two-dimensional and three-dimensional RNA structures can serve as a fundamental platform for biomedical applications, including engineered tissues, biosensors, and drug delivery vehicles. The discovery of the potential of small-interfering RNA (siRNA) has underscored the applications of RNA-based micro- and nanostructures in medicine. Small-interfering RNA (siRNA), synthetic double-stranded RNA consisting of approximately 21 base pairs, suppresses problematic target genes in a sequence-specific manner via inherent RNA interference (RNAi) processing. As a result, siRNA offers a potential strategy for treatment of many human diseases. However, due to inefficient delivery to cells and off-target effects, the clinical application of therapeutic siRNA has been very challenging. To address these issues, researchers have studied a variety of nanocarrier systems for siRNA delivery. In this Account, we describe several strategies for efficient siRNA delivery and selective gene silencing. We took advantage of facile chemical conjugation and complementary hybridization to design novel siRNA-based micro- and nanostructures. Using chemical crosslinkers and hydrophobic/hydrophilic polymers at the end of siRNA, we produced various RNA-based structures, including siRNA block copolymers, micelles, linear siRNA homopolymers, and microhydrogels. Because of their increased charge density and flexibility compared with conventional siRNA, these micro- and nanostructures can form polyelectrolyte complexes with poorly charged and biocompatible cationic carriers that are both more condensed and more homogenous than the complexes formed in other carrier systems. In addition, the fabricated siRNA-based structures are linked by cleavable disulfide bonds for facile generation of original siRNA in the cytosol and for target-specific gene silencing. These newly developed siRNA-based structures greatly enhance intracellular uptake and gene silencing both in vitro and in vivo, making them promising biomaterials for siRNA therapeutics.
-
A Genetic Network for Systemic RNA Silencing in Plants1[OPEN
Chen, Weiwei; Zhang, Xian; Fan, Yaya; Li, Bin; Shi, Nongnong; Zhao, Mei; Qin, Cheng; Zheng, Qianqian; Zhang, Pengcheng; Wang, Huizhong; Jackson, Stephen; Cheng, Qi
2018-01-01
Non-cell autonomous RNA silencing can spread from cell to cell and over long distances in animals and plants. However, the genetic requirements and signals involved in plant mobile gene silencing are poorly understood. Here, we identified a DICER-LIKE2 (DCL2)-dependent mechanism for systemic spread of posttranscriptional RNA silencing, also known as posttranscriptional gene silencing (PTGS), in Nicotiana benthamiana. Using a suite of transgenic DCL RNAi lines coupled with a GFP reporter, we demonstrated that N. benthamiana DCL1, DCL2, DCL3, and DCL4 are required to produce microRNAs and 22, 24, and 21nt small interfering RNAs (siRNAs), respectively. All investigated siRNAs produced in local incipient cells were present at low levels in distal tissues. Inhibition of DCL2 expression reduced the spread of gene silencing, while suppression of DCL3 or DCL4 expression enhanced systemic PTGS. In contrast to DCL4 RNAi lines, DCL2-DCL4 double-RNAi lines developed systemic PTGS similar to that observed in DCL2 RNAi. We further showed that the 21 or 24 nt local siRNAs produced by DCL4 or DCL3 were not involved in long-distance gene silencing. Grafting experiments demonstrated that DCL2 was required in the scion to respond to the signal, but not in the rootstock to produce/send the signal. These results suggest a coordinated DCL genetic pathway in which DCL2 plays an essential role in systemic PTGS in N. benthamiana, while both DCL4 and DCL3 attenuate systemic PTGS. We discuss the potential role of 21, 22, and 24 nt siRNAs in systemic PTGS. PMID:29439213
-
Stoleriu, Mircea Gabriel; Steger, Volker; Mustafi, Migdat; Michaelis, Martin; Cinatl, Jindrich; Schneider, Wilke; Nolte, Andrea; Kurz, Julia; Wendel, Hans Peter; Schlensak, Christian; Walker, Tobias
2014-11-01
According to the actual treatment strategies of lung cancer, the current therapeutic regimen is an individualized, multidisciplinary concept. The development of chemoresistance in the last decade represents the most important obstacle to an effective treatment. In our study, we examined a new therapeutic alternative in the treatment of multiresistant lung adenocarcinoma via siRNA-specific transfection of six crucial molecules involved in lung carcinogenesis [serum response factor(SFR), E2F1, Survivin, hypoxia inducible factor1 (HIF1), HIF2 and signal transducer and activator of transcription (STAT3)]. Three chemoresistant A549 adenocarcinoma cells were cultured under standard conditions at 37°C and 5% CO2. The chemoresistance against Vinflunine, Vinorelbine and Methotrexate was induced artificially. The A549 cells were transfected for 2 h at 37°C with specific siRNA targeting SRF, E2F1, Survivin, HIF1, HIF2 and STAT3 in a non-viral manner. The efficiency of siRNA silencing was evaluated via quantitative real-time polymerase chain reaction, whereas the surviving cells after siRNA transfection as predictor factor for tumoural growth were analysed with a CASY cell counter 3 days after transfection. The response of the chemotherapeutic resistant adenocarcinoma cells after siRNA transfection was concentration-dependent at both 25 and 100 nM. The CASY analysis showed a very effective suppression of adenocarcinoma cells in Vinorelbine, Vinflunine and Methotrexate groups, with significantly better results in comparison with the control group. In our study, we emphasized that siRNA interference might represent a productive platform for further research in order to investigate whether a new regimen in the treatment of multiresistant non-small-cell lung cancer could be established in vivo in the context of a multimodal cancer therapy. © The Author 2014. Published by Oxford University Press on behalf of the European Association for Cardio-Thoracic Surgery. All rights reserved.
-
A Magnetic Bead-Integrated Chip for the Large Scale Manufacture of Normalized esiRNAs
Wang, Zhao; Huang, Huang; Zhang, Hanshuo; Sun, Changhong; Hao, Yang; Yang, Junyu; Fan, Yu; Xi, Jianzhong Jeff
2012-01-01
The chemically-synthesized siRNA duplex has become a powerful and widely used tool for RNAi loss-of-function studies, but suffers from a high off-target effect problem. Recently, endoribonulease-prepared siRNA (esiRNA) has been shown to be an attractive alternative due to its lower off-target effect and cost effectiveness. However, the current manufacturing method for esiRNA is complicated, mainly in regards to purification and normalization on a large-scale level. In this study, we present a magnetic bead-integrated chip that can immobilize amplification or transcription products on beads and accomplish transcription, digestion, normalization and purification in a robust and convenient manner. This chip is equipped to manufacture ready-to-use esiRNAs on a large-scale level. Silencing specificity and efficiency of these esiRNAs were validated at the transcriptional, translational and functional levels. Manufacture of several normalized esiRNAs in a single well, including those silencing PARP1 and BRCA1, was successfully achieved, and the esiRNAs were subsequently utilized to effectively investigate their synergistic effect on cell viability. A small esiRNA library targeting 68 tyrosine kinase genes was constructed for a loss-of-function study, and four genes were identified in regulating the migration capability of Hela cells. We believe that this approach provides a more robust and cost-effective choice for manufacturing esiRNAs than current approaches, and therefore these heterogeneous RNA strands may have utility in most intensive and extensive applications. PMID:22761791
-
Tsang, Wing Pui; Zhang, Fengjie; He, Qiling; Cai, Waijiao; Huang, Jianhua; Chan, Wai Yee; Shen, Ziyin; Wan, Chao
2017-01-01
Utilization of small molecules in modulation of stem cell self-renewal is a promising approach to expand stem cells for regenerative therapy. Here, we identify Icaritin, a phytoestrogen molecule enhances self-renewal of mouse embryonic stem cells (mESCs). Icaritin increases mESCs proliferation while maintains their self-renewal capacity in vitro and pluripotency in vivo. This coincides with upregulation of key pluripotency transcription factors OCT4, NANOG, KLF4 and SOX2. The enhancement of mESCs self-renewal is characterized by increased population in S-phase of cell cycle, elevation of Cylin E and Cyclin-dependent kinase 2 (CDK2) and downregulation of p21, p27 and p57. PCR array screening reveals that caudal-related homeobox 2 (Cdx2) and Rbl2/p130 are remarkably suppressed in mESCs treated with Icaritin. siRNA knockdown of Cdx2 or Rbl2/p130 upregulates the expression of Cyclin E, OCT4 and SOX2, and subsequently increases cell proliferation and colony forming efficiency of mESCs. We then demonstrate that Icaritin co-localizes with estrogen receptor alpha (ERα) and activates its nuclear translocation in mESCs. The promotive effect of Icaritin on cell cycle and pluripotency regulators are eliminated by siRNA knockdown of ERα in mESCs. The results suggest that Icaritin enhances mESCs self-renewal by regulating cell cycle machinery and core pluripotency transcription factors mediated by ERα. PMID:28091581
-
Tsang, Wing Pui; Zhang, Fengjie; He, Qiling; Cai, Waijiao; Huang, Jianhua; Chan, Wai Yee; Shen, Ziyin; Wan, Chao
2017-01-16
Utilization of small molecules in modulation of stem cell self-renewal is a promising approach to expand stem cells for regenerative therapy. Here, we identify Icaritin, a phytoestrogen molecule enhances self-renewal of mouse embryonic stem cells (mESCs). Icaritin increases mESCs proliferation while maintains their self-renewal capacity in vitro and pluripotency in vivo. This coincides with upregulation of key pluripotency transcription factors OCT4, NANOG, KLF4 and SOX2. The enhancement of mESCs self-renewal is characterized by increased population in S-phase of cell cycle, elevation of Cylin E and Cyclin-dependent kinase 2 (CDK2) and downregulation of p21, p27 and p57. PCR array screening reveals that caudal-related homeobox 2 (Cdx2) and Rbl2/p130 are remarkably suppressed in mESCs treated with Icaritin. siRNA knockdown of Cdx2 or Rbl2/p130 upregulates the expression of Cyclin E, OCT4 and SOX2, and subsequently increases cell proliferation and colony forming efficiency of mESCs. We then demonstrate that Icaritin co-localizes with estrogen receptor alpha (ERα) and activates its nuclear translocation in mESCs. The promotive effect of Icaritin on cell cycle and pluripotency regulators are eliminated by siRNA knockdown of ERα in mESCs. The results suggest that Icaritin enhances mESCs self-renewal by regulating cell cycle machinery and core pluripotency transcription factors mediated by ERα.
-
Shi, Fuxin; Cheng, Yen-fu; Wang, Xiaohui L.; Edge, Albert S. B.
2010-01-01
Atoh1, a basic helix-loop-helix transcription factor, plays a critical role in the differentiation of several epithelial and neural cell types. We found that β-catenin, the key mediator of the canonical Wnt pathway, increased expression of Atoh1 in mouse neuroblastoma cells and neural progenitor cells, and baseline Atoh1 expression was decreased by siRNA directed at β-catenin. The up-regulation of Atoh1 was caused by an interaction of β-catenin with the Atoh1 enhancer that could be demonstrated by chromatin immunoprecipitation. We found that two putative Tcf-Lef sites in the 3′ enhancer of the Atoh1 gene displayed an affinity for β-catenin and were critical for the activation of Atoh1 transcription because mutation of either site decreased expression of a reporter gene downstream of the enhancer. Tcf-Lef co-activators were found in the complex that bound to these sites in the DNA together with β-catenin. Inhibition of Notch signaling, which has previously been shown to induce bHLH transcription factor expression, increased β-catenin expression in progenitor cells of the nervous system. Because this could be a mechanism for up-regulation of Atoh1 after inhibition of Notch, we tested whether siRNA to β-catenin prevented the increase in Atoh1 and found that β-catenin expression was required for increased expression of Atoh1 after Notch inhibition. PMID:19864427
-
Emerling, Brooke M.; Weinberg, Frank; Liu, Juinn-Lin; Mak, Tak W.; Chandel, Navdeep S.
2008-01-01
The tumor suppressor PTEN is mutated or deleted in many tumors, causing the activation of the PI3K pathway. Here, we show that the loss of PTEN increases the transcriptional activity of hypoxia-inducible factor 1 (HIF-1) through the inactivation of Forkhead transcription factors (FOXO) in PTEN-null cells. Reintroduction of PTEN into the nucleus, overexpression of a nonphosphorylatable FOXO3a, which accumulates in the nucleus, or inhibition of nuclear export of FOXO3a by leptomycin B represses HIF-1 transcriptional activity in PTEN-null cells. HIF-1 transcriptional activity increases in PTEN-positive cells depleted of FOXO3a with siRNA. PTEN and FOXO3a regulate the transactivation domain of HIF-1α. Chromatin immunoprecipitation indicates that FOXO3a complexes with HIF-1α and p300 on the Glut-1 promoter, a HIF-1 target gene. Overexpression of p300 reverses FOXO3a-mediated repression of HIF-1 transcriptional activity. Coimmunoprecipitation and GAL4-HIF-1α transactivation assays reveal that FOXO3a interferes with p300-dependent HIF-1 transcriptional activity. Thus, FOXO3a negatively regulates HIF-1 transcriptional activity. PMID:18268343
-
Radiosensitization by inhibiting STAT1 in renal cell carcinoma.
Hui, Zhouguang; Tretiakova, Maria; Zhang, Zhongfa; Li, Yan; Wang, Xiaozhen; Zhu, Julie Xiaohong; Gao, Yuanhong; Mai, Weiyuan; Furge, Kyle; Qian, Chao-Nan; Amato, Robert; Butler, E Brian; Teh, Bin Tean; Teh, Bin S
2009-01-01
Renal cell carcinoma (RCC) has been historically regarded as a radioresistant malignancy, but the molecular mechanism underlying its radioresistance is not understood. This study investigated the role of signal transducer and activator of transcription 1 (STAT1), a transcription factor downstream of the interferon-signaling pathway, in radioresistant RCC. The expressions of STAT1 and STAT3 in 164 human clear cell RCC samples, 47 papillary RCC samples, and 15 normal kidney tissue samples were examined by microarray expression profiling and immunohistochemistry. Western blotting was performed to evaluate the total and phosphorylated STAT1 expression in CRL-1932 (786-O) (human clear cell RCC), SKRC-39 (human papillary RCC), CCL-116 (human fibroblast), and CRL-1441 (G-401) (human Wilms tumor). STAT1 was reduced or inhibited by fludarabine and siRNA, respectively, and the effects on radiation-induced cell death were investigated using clonogenic assays. STAT1 expression, but not STAT3 expression, was significantly greater in human RCC samples (p = 1.5 x 10(-8) for clear cell; and p = 3.6 x 10(-4) for papillary). Similarly, the expression of STAT1 was relatively greater in the two RCC cell lines. STAT1 expression was reduced by both fludarabine and siRNA, significantly increasing the radiosensitivity in both RCC cell lines. This is the first study reporting the overexpression of STAT1 in human clear cell and papillary RCC tissues. Radiosensitization in RCC cell lines was observed by a reduction or inhibition of STAT1 signaling, using fludarabine or siRNA. Our data suggest that STAT1 may play a key role in RCC radioresistance and manipulation of this pathway may enhance the efficacy of radiotherapy.
-
Parra, Eduardo; Gutierréz, Luís; Ferreira, Jorge
2016-02-01
The Tax protein of human T cell leukemia virus type 1 plays a major role in the pathogenesis of adult T cell leukemia (ATL), an aggressive neoplasia of CD4+ T cells. In the present study, we investigated whether the EGR-1 pathway is involved in the regulation of Tax-induced JNK expression in human Jurkat T cells transfected to express the Tax protein in the presence or absence of PMA or ionomycin. Overexpression of EGR-1 in Jurkat cells transfected to express Tax, promoted the activation of several genes, with the most potent being those that contained AP-1 (Jun/c-Fos), whereas knockdown of endogenous EGR-1 by small interfering RNA (siRNA) somewhat reduced Tax-mediated JNK-1 transcription. Additionally, luciferase-based AP-1 and NF-κB reporter gene assays demonstrated that inhibition of EGR-1 expression by an siRNA did not affect the transcriptional activity of a consensus sequence of either AP-1 or NF-κB. On the other hand, the apoptosis assay, using all-trans retinoic acid (ATRA) as an inducer of apoptosis, confirmed that siRNA against EGR-1 failed to suppress ATRA-induced apoptosis in Jurkat and Jurkat-Tax cells, as noted by the low levels of both DEVDase activity and DNA fragmentation, indicating that the induction of apoptosis by ATRA was Egr-1-independent. Finally, our data showed that activation of Tax by JNK-1 was not dependent on the EGR-1 cascade of events, suggesting that EGR-1 is important but not a determinant for the activity for Tax-induced proliferation of Jurkat cells.
-
Liu, Zun-Jing; Liu, Hong-Qiang; Xiao, Cheng; Fan, Hui-Zhen; Huang, Qing; Liu, Yun-Hai; Wang, Yu
2014-11-01
The turmeric derivative curcumin protects against cerebral ischemic injury. We previously demonstrated that curcumin activates peroxisome proliferator-activated receptor-γ (PPARγ), a ligand-activated transcription factor involved in both neuroprotective and anti-inflammatory signaling pathways. This study tested whether the neuroprotective effects of curcumin against oxygen-glucose deprivation/reoxygenation (OGD/R)-induced injury of rat cortical neurons are mediated (at least in part) by PPARγ. Curcumin (10 μM) potently enhanced PPARγ expression and transcriptional activity following OGD/R. In addition, curcumin markedly increased neuronal viability, as evidenced by decreased lactate dehydrogenase release and reduced nitric oxide production, caspase-3 activity, and apoptosis. These protective effects were suppressed by coadministration of the PPARγ antagonist 2-chloro-5-nitrobenzanilide (GW9662) and by prior transfection of a small-interfering RNA (siRNA) targeting PPARγ, treatments that had no toxic effects on healthy neurons. Curcumin reduced OGD/R-induced accumulation of reactive oxygen species and inhibited the mitochondrial apoptosis pathway, as indicated by reduced release of cytochrome c and apoptosis-inducing factor and maintenance of both the mitochondrial membrane potential and the Bax/Bcl-2 ratio. Again, GW9662 or PPARγ siRNA transfection mitigated the protective effects of curcumin on mitochondrial function. Curcumin suppressed IκB kinase phosphorylation and IκB degradation, thereby inhibiting nuclear factor-κ B (NF-κB) nuclear translocation, effects also blocked by GW9662 or PPARγ siRNA. Immunoprecipitation experiments revealed that PPARγ interacted with NF-κB p65 and inhibited NF-κB activation. The present study provides strong evidence that at least some of the neuroprotective effects of curcumin against OGD/R are mediated by PPARγ activation. Copyright © 2014 Wiley Periodicals, Inc.
-
Preventing intimal thickening of vein grafts in vein artery bypass using STAT-3 siRNA
2012-01-01
Background Proliferation and migration of vascular smooth muscle cells (VSMCs) play a key role in neointimal formation which leads to restenosis of vein graft in venous bypass. STAT-3 is a transcription factor associated with cell proliferation. We hypothesized that silencing of STAT-3 by siRNA will inhibit proliferation of VSMCs and attenuate intimal thickening. Methods Rat VSMCs were isolated and cultured in vitro by applying tissue piece inoculation methods. VSMCs were transfected with STAT 3 siRNA using lipofectamine 2000. In vitro proliferation of VSMC was quantified by the MTT assay, while in vivo assessment was performed in a venous transplantation model. In vivo delivery of STAT-3 siRNA plasmid or scramble plasmid was performed by admixing with liposomes 2000 and transfected into the vein graft by bioprotein gel applied onto the adventitia. Rat jugular vein-carotid artery bypass was performed. On day 3 and7 after grafting, the vein grafts were extracted, and analyzed morphologically by haematoxylin eosin (H&E), and assessed by immunohistochemistry for expression of Ki-67 and proliferating cell nuclear antigen (PCNA). Western-blot and reverse transcriptase polymerase chain reaction (RT-PCR) were used to detect the protein and mRNA expression in vivo and in vitro. Cell apoptosis in vein grafts was detected by TUNEL assay. Results MTT assay shows that the proliferation of VSMCs in the STAT-3 siRNA treated group was inhibited. On day 7 after operation, a reduced number of Ki-67 and PCNA positive cells were observed in the neointima of the vein graft in the STAT-3 siRNA treated group as compared to the scramble control. The PCNA index in the control group (31.3 ± 4.7) was higher than that in the STAT-3 siRNA treated group (23.3 ± 2.8) (P < 0.05) on 7d. The neointima in the experimental group(0.45 ± 0.04 μm) was thinner than that in the control group(0.86 ± 0.05 μm) (P < 0.05).Compared with the control group, the protein and mRNA levels in the experimental group in vivo and in vitro decreased significantly. Down regulation of STAT-3 with siRNA resulted in a reduced expression of Bcl-2 and cyclin D1. However, apoptotic cells were not obviously found in all grafts on day 3 and 7 post surgery. Conclusions The STAT-3 siRNA can inhibit the proliferation of VSMCs in vivo and in vitro and attenuate neointimal formation. PMID:22216901
-
Kawakami, Emi; Kawai, Nobuhiko; Kinouchi, Nao; Mori, Hiroyo; Ohsawa, Yutaka; Ishimaru, Naozumi; Sunada, Yoshihide; Noji, Sumihare; Tanaka, Eiji
2013-01-01
Growing evidence suggests that small-interfering RNA (siRNA) can promote gene silencing in mammalian cells without induction of interferon synthesis or nonspecific gene suppression. Recently, a number of highly specific siRNAs targeted against disease-causing or disease-promoting genes have been developed. In this study, we evaluate the effectiveness of atelocollagen (ATCOL)-mediated application of siRNA targeting myostatin (Mst), a negative regulator of skeletal muscle growth, into skeletal muscles of muscular dystrophy model mice. We injected a nanoparticle complex containing myostatin-siRNA and ATCOL (Mst-siRNA/ATCOL) into the masseter muscles of mutant caveolin-3 transgenic (mCAV-3Tg) mice, an animal model for muscular dystrophy. Scrambled (scr) -siRNA/ATCOL complex was injected into the contralateral muscles as a control. Two weeks after injection, the masseter muscles were dissected for histometric analyses. To investigate changes in masseter muscle activity by local administration of Mst-siRNA/ATCOL complex, mouse masseter electromyography (EMG) was measured throughout the experimental period via telemetry. After local application of the Mst-siRNA/ATCOL complex, masseter muscles were enlarged, while no significant change was observed on the contralateral side. Histological analysis showed that myofibrils of masseter muscles treated with the Mst-siRNA/ATCOL complex were significantly larger than those of the control side. Real-time PCR analysis revealed a significant downregulation of Mst expression in the treated masseters of mCAV-3Tg mice. In addition, expression of myogenic transcription factors was upregulated in the Mst-siRNA-treated masseter muscle, while expression of adipogenic transcription factors was significantly downregulated. EMG results indicate that masseter muscle activity in mCAV-3Tg mice was increased by local administration of the Mst-siRNA/ATCOL complex. These data suggest local administration of Mst-siRNA/ATCOL complex could lead to skeletal muscle hypertrophy and recovery of motor disability in mCAV-3Tg mice. Therefore, ATCOL-mediated application of siRNA is a potential tool for therapeutic use in muscular atrophy diseases.
-
Thiebaut, Flávia; Rojas, Cristian A; Grativol, Clícia; Motta, Mariana Romeiro; Vieira, Tauan; Regulski, Michael; Martienssen, Robert A; Farinelli, Laurent; Hemerly, Adriana S; Ferreira, Paulo C G
2014-09-06
Small RNA (sRNA) has been described as a regulator of gene expression. In order to understand the role of maize sRNA (Zea mays-hybrid UENF 506-8) during association with endophytic nitrogen-fixing bacteria, we analyzed the sRNA regulated by its association with two diazotrophic bacteria, Herbaspirillum seropedicae and Azospirillum brasilense. Deep sequencing analysis was done with RNA extracted from plants inoculated with H. seropedicae, allowing the identification of miRNA and siRNA. A total of 25 conserved miRNA families and 15 novel miRNAs were identified. A dynamic regulation in response to inoculation was also observed. A hypothetical model involving copper-miRNA is proposed, emphasizing the fact that the up-regulation of miR397, miR398, miR408 and miR528, which is followed by inhibition of their targets, can facilitate association with diazotrophic bacteria. Similar expression patterns were observed in samples inoculated with A. brasilense. Moreover, novel miRNA and siRNA were classified in the Transposable Elements (TE) database, and an enrichment of siRNA aligned with TE was observed in the inoculated samples. In addition, an increase in 24-nt siRNA mapping to genes was observed, which was correlated with an increase in methylation of the coding regions and a subsequent reduction in transcription. Our results show that maize has RNA-based silencing mechanisms that can trigger specific responses when plants interact with beneficial endophytic diazotrophic bacteria. Our findings suggest important roles for sRNA regulation in maize, and probably in other plants, during association with diazotrophic bacteria, emphasizing the up-regulation of Cu-miRNA.
-
Li, Guanhua; Hu, Zuojun; Yin, Henghui; Zhang, Yunjian; Huang, Xueling; Wang, Shenming; Li, Wen
2013-01-01
The application of RNA interference techniques is promising in gene therapeutic approaches, especially for cancers. To improve safety and efficiency of small interfering RNA (siRNA) delivery, a triblock dendritic nanocarrier, polyamidoamine-polyethylene glycol-cyclic RGD (PAMAM-PEG-cRGD), was developed and studied as an siRNA vector targeting the human ether-à-go-go-related gene (hERG) in human anaplastic thyroid carcinoma cells. Structure characterization, particle size, zeta potential, and gel retardation assay confirmed that complete triblock components were successfully synthesized with effective binding capacity of siRNA in this triblock nanocarrier. Cytotoxicity data indicated that conjugation of PEG significantly alleviated cytotoxicity when compared with unmodified PAMAM. PAMAM-PEG-cRGD exerted potent siRNA cellular internalization in which transfection efficiency measured by flow cytometry was up to 68% when the charge ratio (N/P ratio) was 3.5. Ligand-receptor affinity together with electrostatic interaction should be involved in the nano-siRNA endocytosis mechanism and we then proved that attachment of cRGD enhanced cellular uptake via RGD-integrin recognition. Gene silencing was evaluated by reverse transcription polymerase chain reaction and PAMAM-PEG-cRGD-siRNA complex downregulated the expression of hERG to 26.3% of the control value. Furthermore, gene knockdown of hERG elicited growth suppression as well as activated apoptosis by means of abolishing vascular endothelial growth factor secretion and triggering caspase-3 cascade in anaplastic thyroid carcinoma cells. Our study demonstrates that this novel triblock polymer, PAMAM-PEG-cRGD, exhibits negligible cytotoxicity, effective transfection, “smart” cancer targeting, and therefore is a promising siRNA nanocarrier. PMID:23569377
-
In vitro inhibition of African swine fever virus-topoisomerase II disrupts viral replication.
Freitas, Ferdinando B; Frouco, Gonçalo; Martins, Carlos; Leitão, Alexandre; Ferreira, Fernando
2016-10-01
African swine fever virus (ASFV) is the etiological agent of a highly-contagious and fatal disease of domestic pigs, leading to serious socio-economic impact in affected countries. To date, neither a vaccine nor a selective anti-viral drug are available for prevention or treatment of African swine fever (ASF), emphasizing the need for more detailed studies at the role of ASFV proteins involved in viral DNA replication and transcription. Notably, ASFV encodes for a functional type II topoisomerase (ASFV-Topo II) and we recently showed that several fluoroquinolones (bacterial DNA topoisomerase inhibitors) fully abrogate ASFV replication in vitro. Here, we report that ASFV-Topo II gene is actively transcribed throughout infection, with transcripts being detected as early as 2 hpi and reaching a maximum peak concentration around 16 hpi, when viral DNA synthesis, transcription and translation are more active. siRNA knockdown experiments showed that ASFV-Topo II plays a critical role in viral DNA replication and gene expression, with transfected cells presenting lower viral transcripts (up to 89% decrease) and reduced cytopathic effect (-66%) when compared to the control group. Further, a significant decrease in the number of both infected cells (75.5%) and viral factories per cell and in virus yields (up to 99.7%, 2.5 log) was found only in cells transfected with siRNA targeting ASFV-Topo II. We also demonstrate that a short exposure to enrofloxacin during the late phase of infection (from 15 to 1 hpi) induces fragmentation of viral genomes, whereas no viral genomes were detected when enrofloxacin was added from the early phase of infection (from 2 to 16 hpi), suggesting that fluoroquinolones are ASFV-Topo II poisons. Altogether, our results demonstrate that ASFV-Topo II enzyme has an essential role during viral genome replication and transcription, emphasizing the idea that this enzyme can be a potential target for drug and vaccine development against ASF. Copyright © 2016 Elsevier B.V. All rights reserved.
-
Yamamura, Nobuhisa; Fugo, Kazunori; Kishimoto, Takashi
2017-09-01
Alpha-fetoprotein (AFP)-producing adenocarcinoma is a high-malignant variant of adenocarcinoma with a hepatic or fetal-intestinal phenotype. The number of cases of AFP-producing adenocarcinomas is increasing, but the molecular mechanism underlying the aberrant production of AFP is unclear. Here we sought to assess the role of Forkhead box A (FoxA)2, which is a pioneer transcription factor in the differentiation of hepatoblasts. FoxA2 expression was investigated in five cases of AFP-producing gastric adenocarcinomas by immunohistochemistry, and all cases showed FoxA2 expression. Chromatin immunoprecipitation revealed the DNA binding of FoxA2 on the regulatory element of AFP gene in AFP-producing adenocarcinoma cells. The inhibition of FoxA2 expression with siRNA reduced the mRNA expression of liver-specific proteins, including AFP, albumin, and transferrin. The inhibition of FoxA2 also reduced the expressions of liver-enriched nuclear factors, i.e., hepatocyte nuclear factor (HNF) 4α and HNF6, although the expressions of HNF1α and HNF1β were not affected. The same effect as FoxA2 knockdown in AFP producing adenocarcinoma cells was also observed in hepatocellular carcinoma cells. Our results suggest that FoxA2 plays a key role in the expression of hepatic phenotype of AFP-producing adenocarcinomas. Copyright © 2017 Elsevier GmbH. All rights reserved.
-
Structural Basis of Transcriptional Gene Silencing Mediated by Arabidopsis MOM1
Nishimura, Taisuke; Molinard, Guillaume; Petty, Tom J.; Broger, Larissa; Gabus, Caroline; Halazonetis, Thanos D.; Thore, Stéphane; Paszkowski, Jerzy
2012-01-01
Shifts between epigenetic states of transcriptional activity are typically correlated with changes in epigenetic marks. However, exceptions to this rule suggest the existence of additional, as yet uncharacterized, layers of epigenetic regulation. MOM1, a protein of 2,001 amino acids that acts as a transcriptional silencer, represents such an exception. Here we define the 82 amino acid domain called CMM2 (Conserved MOM1 Motif 2) as a minimal MOM1 fragment capable of transcriptional regulation. As determined by X-ray crystallography, this motif folds into an unusual hendecad-based coiled-coil. Structure-based mutagenesis followed by transgenic complementation tests in plants demonstrate that CMM2 and its dimerization are effective for transcriptional suppression at chromosomal loci co-regulated by MOM1 and the siRNA pathway but not at loci controlled by MOM1 in an siRNA–independent fashion. These results reveal a surprising separation of epigenetic activities that enable the single, large MOM1 protein to coordinate cooperating mechanisms of epigenetic regulation. PMID:22346760
-
Structural basis of transcriptional gene silencing mediated by Arabidopsis MOM1.
Nishimura, Taisuke; Molinard, Guillaume; Petty, Tom J; Broger, Larissa; Gabus, Caroline; Halazonetis, Thanos D; Thore, Stéphane; Paszkowski, Jerzy
2012-02-01
Shifts between epigenetic states of transcriptional activity are typically correlated with changes in epigenetic marks. However, exceptions to this rule suggest the existence of additional, as yet uncharacterized, layers of epigenetic regulation. MOM1, a protein of 2,001 amino acids that acts as a transcriptional silencer, represents such an exception. Here we define the 82 amino acid domain called CMM2 (Conserved MOM1 Motif 2) as a minimal MOM1 fragment capable of transcriptional regulation. As determined by X-ray crystallography, this motif folds into an unusual hendecad-based coiled-coil. Structure-based mutagenesis followed by transgenic complementation tests in plants demonstrate that CMM2 and its dimerization are effective for transcriptional suppression at chromosomal loci co-regulated by MOM1 and the siRNA pathway but not at loci controlled by MOM1 in an siRNA-independent fashion. These results reveal a surprising separation of epigenetic activities that enable the single, large MOM1 protein to coordinate cooperating mechanisms of epigenetic regulation.
-
Negative regulation of neuronal cell differentiation by INHAT subunit SET/TAF-Iβ.
Kim, Dong-Wook; Kim, Kee-Beom; Kim, Ji-Young; Lee, Kyu-Sun; Seo, Sang-Beom
2010-09-24
Epigenetic modification plays an important role in transcriptional regulation. As a subunit of the INHAT (inhibitor of histone acetyltransferases) complex, SET/TAF-Iβ evidences transcriptional repression activity. In this study, we demonstrate that SET/TAF-Iβ is abundantly expressed in neuronal tissues of Drosophila embryos. It is expressed at high levels prior to and in early stages of neuronal development, and gradually reduced as differentiation proceeds. SET/TAF-Iβ binds to the promoters of a subset of neuronal development markers and negatively regulates the transcription of these genes. The results of this study show that the knockdown of SET/TAF-Iβ by si-RNA induces neuronal cell differentiation, thus implicating SET/TAF-Iβ as a negative regulator of neuronal development. Copyright © 2010 Elsevier Inc. All rights reserved.
-
Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.
Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige
2007-07-26
Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.
-
BMP15 regulates AMH expression via the p38 MAPK pathway in granulosa cells from goat.
Zhao, Zhongquan; Guo, Fangyue; Sun, Xiaowei; He, Qijie; Dai, Zinuo; Chen, Xiaochuan; Zhao, Yongju; Wang, Jian
2018-05-31
Anti-Mullerian hormone (AMH), a member of the TGF-β superfamily, is produced by granulosa cells (GCs) of preantral and small antral follicles and plays a role in regulating the recruitment of primordial follicles and the FSH-dependent development of follicles. However, the regulation of AMH expression in follicles remains poorly understood. The objectives of this study were to determine the following: 1. the association between bone morphogenetic protein 15 (BMP15) and AMH; 2. whether BMP15 can regulate the expression of AMH by inhibiting the p38 MAPK pathway; and 3. whether SRY-related HMG box 9 (SOX9), a transcription factor for AMH, is involved in the regulation of AMH expression by BMP15. In this study, an inhibitor of p38 MAPK and an siRNA specific for p38 MAPK were used to prevent the function of the p38 MAPK signaling pathway. Then, AMH mRNA expression and AMH secretion were detected in goat GCs using an RT-PCR assay and ELISA, respectively, after treatment with BMP15. The results indicated that BMP15 up-regulates the transcription of AMH and that the inhibition of p38 MAPK decreases the BMP15-induced expression of AMH and SOX9, suggesting that BMP15 up-regulates the expression of AMH via the p38 MAPK signaling pathway, and this process involves the SOX9 transcription factor. Copyright © 2018 Elsevier Inc. All rights reserved.
-
Palanca-Wessels, Maria C; Convertine, Anthony J; Cutler-Strom, Richelle; Booth, Garrett C; Lee, Fan; Berguig, Geoffrey Y; Stayton, Patrick S; Press, Oliver W
2011-01-01
The application of small interfering RNA (siRNA) for cancer treatment is a promising strategy currently being explored in early phase clinical trials. However, efficient systemic delivery limits clinical implementation. We developed and tested a novel delivery system comprised of (i) an internalizing streptavidin-conjugated monoclonal antibody (mAb-SA) directed against CD22 and (ii) a biotinylated diblock copolymer containing both a positively charged siRNA condensing block and a pH-responsive block to facilitate endosome release. The modular design of the carrier facilitates the exchange of different targeting moieties and siRNAs to permit its usage in a variety of tumor types. The polymer was synthesized using the reversible addition fragmentation chain transfer (RAFT) technique and formed micelles capable of binding siRNA and mAb-SA. A hemolysis assay confirmed the predicted membrane destabilizing activity of the polymer under acidic conditions typical of the endosomal compartment. Enhanced siRNA uptake was demonstrated in DoHH2 lymphoma and transduced HeLa-R cells expressing CD22 but not in CD22 negative HeLa-R cells. Gene knockdown was significantly improved with CD22-targeted vs. nontargeted polymeric micelles. Treatment of DoHH2 cells with CD22-targeted polymeric micelles containing 15 nmol/l siRNA produced 70% reduction of gene expression. This CD22-targeted polymer carrier may be useful for siRNA delivery to lymphoma cells. PMID:21629223
-
Palanca-Wessels, Maria C; Convertine, Anthony J; Cutler-Strom, Richelle; Booth, Garrett C; Lee, Fan; Berguig, Geoffrey Y; Stayton, Patrick S; Press, Oliver W
2011-08-01
The application of small interfering RNA (siRNA) for cancer treatment is a promising strategy currently being explored in early phase clinical trials. However, efficient systemic delivery limits clinical implementation. We developed and tested a novel delivery system comprised of (i) an internalizing streptavidin-conjugated monoclonal antibody (mAb-SA) directed against CD22 and (ii) a biotinylated diblock copolymer containing both a positively charged siRNA condensing block and a pH-responsive block to facilitate endosome release. The modular design of the carrier facilitates the exchange of different targeting moieties and siRNAs to permit its usage in a variety of tumor types. The polymer was synthesized using the reversible addition fragmentation chain transfer (RAFT) technique and formed micelles capable of binding siRNA and mAb-SA. A hemolysis assay confirmed the predicted membrane destabilizing activity of the polymer under acidic conditions typical of the endosomal compartment. Enhanced siRNA uptake was demonstrated in DoHH2 lymphoma and transduced HeLa-R cells expressing CD22 but not in CD22 negative HeLa-R cells. Gene knockdown was significantly improved with CD22-targeted vs. nontargeted polymeric micelles. Treatment of DoHH2 cells with CD22-targeted polymeric micelles containing 15 nmol/l siRNA produced 70% reduction of gene expression. This CD22-targeted polymer carrier may be useful for siRNA delivery to lymphoma cells.
-
RISC-Target Interaction: Cleavage and Translational Suppression
van den Berg, Arjen; Mols, Johann; Han, Jiahuai
2008-01-01
Summary Small RNA molecules have been known and utilized to suppress gene expression for more than a decade. The discovery that these small RNA molecules are endogenously expressed in many organisms and have a critical role in controlling gene expression have led to the arising of a whole new field of research. Termed small interfering RNA (siRNA) or microRNA (miRNA) these ~22 nt RNA molecules have the capability to suppress gene expression through various mechanisms once they are incorporated in the multi-protein RNA-Induced Silencing Complex (RISC) and interact with their target mRNA. This review introduces siRNAs and microRNAs in a historical perspective and focuses on the key molecules in RISC, structural properties and mechanisms underlying the process of small RNA regulated post-transcriptional suppression of gene expression. PMID:18692607
-
Phloem-mobile signals affecting flowers: applications for crop breeding.
McGarry, Roisin C; Kragler, Friedrich
2013-04-01
Transport of endogenous macromolecules within and between tissues serves as a signaling pathway to regulate numerous aspects of plant growth. The florigenic FT gene product moves via the phloem from leaves to apical tissues and induces the flowering program in meristems. Similarly, short interfering RNA (siRNA) signals produced in source or sink tissues move cell-to-cell and long distance via the phloem to apical tissues. Recent advances in identifying these mobile signals regulating flowering or the epigenetic status of targeted tissues can be applicable to crop-breeding programs. In this review, we address the identity of florigen, the mechanism of allocation, and how virus-induced flowering and grafting of transgenes producing siRNA signals affecting meiosis can produce transgene-free progenies useful for agriculture. Copyright © 2013 Elsevier Ltd. All rights reserved.
-
TAF11 Assembles the RISC Loading Complex to Enhance RNAi Efficiency.
Liang, Chunyang; Wang, Yibing; Murota, Yukiko; Liu, Xiang; Smith, Dean; Siomi, Mikiko C; Liu, Qinghua
2015-09-03
Assembly of the RNA-induced silencing complex (RISC) requires formation of the RISC loading complex (RLC), which contains the Dicer-2 (Dcr-2)-R2D2 complex and recruits duplex siRNA to Ago2 in Drosophila melanogaster. However, the precise composition and action mechanism of Drosophila RLC remain unclear. Here we identified the missing factor of RLC as TATA-binding protein-associated factor 11 (TAF11) by genetic screen. Although it is an annotated nuclear transcription factor, we found that TAF11 also associated with Dcr-2/R2D2 and localized to cytoplasmic D2 bodies. Consistent with defective RLC assembly in taf11(-/-) ovary extract, we reconstituted the RLC in vitro using the recombinant Dcr-2-R2D2 complex, TAF11, and duplex siRNA. Furthermore, we showed that TAF11 tetramer facilitates Dcr-2-R2D2 tetramerization to enhance siRNA binding and RISC loading activities. Together, our genetic and biochemical studies define the molecular nature of the Drosophila RLC and elucidate a cytoplasmic function of TAF11 in organizing RLC assembly to enhance RNAi efficiency. Copyright © 2015 Elsevier Inc. All rights reserved.
-
Pulmonary Delivery of siRNA via Polymeric Vectors as Therapies of Asthma.
Xie, Yuran; Merkel, Olivia M
2015-10-01
Asthma is a chronic inflammatory disease. Despite the fact that current therapies, such as the combination of inhaled corticosteroids and β2-agonists, can control the symptoms of asthma in most patients, there is still an urgent need for an alternative anti-inflammatory therapy for patients who suffer from severe asthma but lack acceptable response to conventional therapies. Many molecular factors are involved in the inflammatory process in asthma, and thus blocking the function of these factors could efficiently alleviate airway inflammation. RNA interference (RNAi) is often thought to be the answer in the search for more efficient and biocompatible treatments. However, difficulties of efficient delivery of small interference RNA (siRNA), the key factor in RNAi, to target cells and tissues have limited its clinical application. In this review, we summarize cytokines and chemokines, transcription factors, tyrosine kinases, and costimulatory factors that have been reported as targets of siRNA-mediated treatment in experimental asthma. Additionally, we conclude several targeted delivery systems of siRNA to specific cells such as T cells, macrophages, and dendritic cells, which could potentially be applied in asthma therapy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
-
Liu, Zhi-Li; Li, Hong; Liu, Jia; Wu, Mo-Li; Chen, Xiao-Yan; Liu, Li-Hong; Wang, Qian
2017-01-01
Squamous cell carcinoma (SCC) is the most common epidermal malignancy, and Wnt/β-catenin signaling is frequently activated in SCC. Resveratrol prevents rodent epidermal carcinogenesis, while its effect on human epidermal cancer remains unknown. To address this issue, the impact of resveratrol on the growth and Wnt signaling of skin SCC Colo16 cells were investigated at the cellular and molecular biology levels by flow cytometry, immunocytochemistry, reverse transcription-polymerase chain reaction, western blotting and β-catenin-specific small interfering RNA (siRNA) transfection. Resveratrol (100 µM) suppressed cell growth and induced apoptosis in Colo16 cells. Wnt2 and its downstream genes were downregulated, which was accompanied by increased expression of the Wnt signaling inhibitor Axin2. Transfection with a β-catenin-specific siRNA did not affect cell growth but enhanced the resveratrol susceptibility of Colo16 transfectants. The present results suggest the inhibitory effects of resveratrol on epidermal SCCs and inactivation of Wnt signaling as one of the resveratrol-caused molecular events in Colo16 cells. β-catenin oriented siRNA is insufficient to induce cell crisis, implicating the presence of more critical cancer-associated element(s) as the target in Colo16 cells. PMID:28781663
-
Richardson, Casey R.; Luo, Qing-Jun; Gontcharova, Viktoria; Jiang, Ying-Wen; Samanta, Manoj; Youn, Eunseog; Rock, Christopher D.
2010-01-01
Background MicroRNAs (miRNAs) and trans-acting small-interfering RNAs (tasi-RNAs) are small (20–22 nt long) RNAs (smRNAs) generated from hairpin secondary structures or antisense transcripts, respectively, that regulate gene expression by Watson-Crick pairing to a target mRNA and altering expression by mechanisms related to RNA interference. The high sequence homology of plant miRNAs to their targets has been the mainstay of miRNA prediction algorithms, which are limited in their predictive power for other kingdoms because miRNA complementarity is less conserved yet transitive processes (production of antisense smRNAs) are active in eukaryotes. We hypothesize that antisense transcription and associated smRNAs are biomarkers which can be computationally modeled for gene discovery. Principal Findings We explored rice (Oryza sativa) sense and antisense gene expression in publicly available whole genome tiling array transcriptome data and sequenced smRNA libraries (as well as C. elegans) and found evidence of transitivity of MIRNA genes similar to that found in Arabidopsis. Statistical analysis of antisense transcript abundances, presence of antisense ESTs, and association with smRNAs suggests several hundred Arabidopsis ‘orphan’ hypothetical genes are non-coding RNAs. Consistent with this hypothesis, we found novel Arabidopsis homologues of some MIRNA genes on the antisense strand of previously annotated protein-coding genes. A Support Vector Machine (SVM) was applied using thermodynamic energy of binding plus novel expression features of sense/antisense transcription topology and siRNA abundances to build a prediction model of miRNA targets. The SVM when trained on targets could predict the “ancient” (deeply conserved) class of validated Arabidopsis MIRNA genes with an accuracy of 84%, and 76% for “new” rapidly-evolving MIRNA genes. Conclusions Antisense and smRNA expression features and computational methods may identify novel MIRNA genes and other non-coding RNAs in plants and potentially other kingdoms, which can provide insight into antisense transcription, miRNA evolution, and post-transcriptional gene regulation. PMID:20520764
-
[Proteomics and personalized medicine].
Rocchiccioli, Silvia; Tedeschi, Lorena; Citti, Lorenzo; Cecchettini, Antonella
2013-05-01
With the disclosure of the human genome a new era for bio-medicine has arisen, characterized by the challenge to investigate pathogenic mechanisms, studying simultaneously metabolites, DNA, RNA, and proteins. As a result, the "omics" revolution boomed, giving birth to a new medicine named "omics-based medicine". Among the other "omics", proteomics has been widely used in medicine, since it can produce a more "holistic" overview of a disease and provide a "constellation" of possible specific markers, a molecular fingerprinting that defines the clinical condition of an individual. Endpoint of this comprehensive and detailed analysis is the "diagnostic-omics", i.e. the achievement of personalized diagnoses with obvious benefits for prevention and therapy and this goal can be reached only with a perfect integration between clinicians and proteomists. To impact on the possible key factors involved in the pathological processes, oligonucleotide-based knock-down strategies can be helpful. They exploit omics-derived molecular tools (antisense, siRNA, ribozymes, decoys, and aptamers) that can be used to inhibit, at transcriptional or post-transcriptional levels, the events leading to protein synthesis, thus decreasing its expression. The identification of the pivotal mechanisms involved in diseases using global, "scenic" approaches such as the "omics" ones, and the subsequent validation and detailed description of the processes by specific molecular tools, can result in a more preventive, predictive and personalized medicine.
-
Marshall, Brendan; Mo, Juan; Covar, Jason; Atherton, Sally S; Zhang, Ming
2014-06-06
Retinitis induced by both human and murine cytomegaloviruses following immunosuppression is characterized by progressive loss of retinal architecture, due to necrosis of virus-infected cells as well as widespread apoptosis of uninfected bystander cells. Because small inhibitory RNA molecules (siRNA) can reduce murine cytomegalovirus (MCMV) gene expression and thereby inhibit virus replication in vitro, we tested siRNAs directed against MCMV immediate early protein-3 (IE-3) to determine if MCMV-induced retinitis could be alleviated in vivo. Immunosuppressed Balb/c mice (2.0 mg methylprednisolone acetate every 3 days beginning on day -2) were infected with 5 × 10(3) pfu of the K181 strain of MCMV via the supraciliary route. At day 2 post infection, mice were treated with various doses of IE-3-specific siRNA ranging from 0.1 nmol to 10 nmol, in a volume of 20 μL PBS via tail vein injection. Injected eyes were collected at various times post inoculation and subjected to plaque assay for virus titer, MCMV antigen staining, H&E staining, TUNEL assay, and Western blot for MCMV IE-3 protein. Small but significant amounts of fluorescently labeled IE-3-specific siRNA localized to the RPE layer 48 hours after intravenous injection. IE-3-specific siRNA significantly reduced virus titers at all concentrations tested (ranging from 0.1 nmol to 10 nmol), but the most potent effect of siRNA was observed at a dose of 1 nmol. We also observed that IE-3-specific siRNA produced a substantial decrease in MCMV titers and a substantial reduction in bystander cell apoptosis over the time course of virus infection. Systemic administration of IE-3-specific siRNA could alleviate MCMV retinitis by inhibiting virus replication and subsequent death of uninfected retinal cells. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.
-
Marshall, Brendan; Mo, Juan; Covar, Jason; Atherton, Sally S.; Zhang, Ming
2014-01-01
Purpose. Retinitis induced by both human and murine cytomegaloviruses following immunosuppression is characterized by progressive loss of retinal architecture, due to necrosis of virus-infected cells as well as widespread apoptosis of uninfected bystander cells. Because small inhibitory RNA molecules (siRNA) can reduce murine cytomegalovirus (MCMV) gene expression and thereby inhibit virus replication in vitro, we tested siRNAs directed against MCMV immediate early protein-3 (IE-3) to determine if MCMV-induced retinitis could be alleviated in vivo. Methods. Immunosuppressed Balb/c mice (2.0 mg methylprednisolone acetate every 3 days beginning on day −2) were infected with 5 × 103 pfu of the K181 strain of MCMV via the supraciliary route. At day 2 post infection, mice were treated with various doses of IE-3–specific siRNA ranging from 0.1 nmol to 10 nmol, in a volume of 20 μL PBS via tail vein injection. Injected eyes were collected at various times post inoculation and subjected to plaque assay for virus titer, MCMV antigen staining, H&E staining, TUNEL assay, and Western blot for MCMV IE-3 protein. Results. Small but significant amounts of fluorescently labeled IE-3–specific siRNA localized to the RPE layer 48 hours after intravenous injection. IE-3–specific siRNA significantly reduced virus titers at all concentrations tested (ranging from 0.1 nmol to 10 nmol), but the most potent effect of siRNA was observed at a dose of 1 nmol. We also observed that IE-3–specific siRNA produced a substantial decrease in MCMV titers and a substantial reduction in bystander cell apoptosis over the time course of virus infection. Conclusions. Systemic administration of IE-3–specific siRNA could alleviate MCMV retinitis by inhibiting virus replication and subsequent death of uninfected retinal cells. PMID:24906861
-
Solid nano-in-nanoparticles for potential delivery of siRNA.
Amsalem, Orit; Nassar, Taher; Benhamron, Sandrine; Lazarovici, Philip; Benita, Simon; Yavin, Eylon
2017-07-10
siRNA-based therapeutics possess great potential to treat a wide variety of genetic disorders. However, they suffer from low cellular uptake and short half-lives in blood circulation; issues that remain to be addressed. This work is, to the best of our knowledge, the first to report the production of solid nano-in-nanoparticles, termed double nano carriers (DNCs) by means of the innovative technology of nano spray drying. DNCs (with a median size of 580-770nm) were produced by spraying at low temperatures (50°C) to prevent damage to heat-sensitive biomacromolecules like siRNA. DNCs consisting of Poly (d,l-lactide-co-glycolide) used as a wall material, encapsulating 20% human serum albumin primary nanoparticles (PNPs) loaded with siRNA, were obtained as a dry nanoparticulate powder with smooth spherical surfaces and a unique inner morphology. Incubation of pegylated or non-pegylated DNCs under sink conditions at 37°C, elicited a controlled release profile of the siRNA for up to 12 or 24h, respectively, with a minimal burst effect. Prolonged incubation of pegylated DNCs loaded with active siRNA (anti EGFR) in an A549 epithelial cell culture monolayer did not induce any apparent cytotoxicity. A slow degradation of the internalized DNCs by the cells was also observed resulting in the progressive release of the siRNA for up to 6days, as corroborated by laser confocal microscopy. The structural integrity and silencing activity of the double encapsulated siRNA were fully preserved, as demonstrated by HPLC, gel electrophoresis, and potent RNAi activity of siRNA extracted from DNCs. These results demonstrate the potential use of DNCs as a nano drug delivery system for systemic administration and controlled release of siRNA and potentially other sensitive bioactive macromolecules. Copyright © 2016 Elsevier B.V. All rights reserved.
-
In C. elegans, high levels of dsRNA allow RNAi in the absence of RDE-4.
Habig, Jeffrey W; Aruscavage, P Joseph; Bass, Brenda L
2008-01-01
C. elegans Dicer requires an accessory double-stranded RNA binding protein, RDE-4, to enact the first step of RNA interference, the cleavage of dsRNA to produce siRNA. While RDE-4 is typically essential for RNAi, we report that in the presence of high concentrations of trigger dsRNA, rde-4 deficient animals are capable of silencing a transgene. By multiple criteria the silencing occurs by the canonical RNAi pathway. For example, silencing is RDE-1 dependent and exhibits a decrease in the targeted mRNA in response to an increase in siRNA. We also find that high concentrations of dsRNA trigger lead to increased accumulation of primary siRNAs, consistent with the existence of a rate-limiting step during the conversion of primary to secondary siRNAs. Our studies also revealed that transgene silencing occurs at low levels in the soma, even in the presence of ADARs, and that at least some siRNAs accumulate in a temperature-dependent manner. We conclude that an RNAi response varies with different conditions, and this may allow an organism to tailor a response to specific environmental signals.
-
In C. elegans, High Levels of dsRNA Allow RNAi in the Absence of RDE-4
Habig, Jeffrey W.; Aruscavage, P. Joseph; Bass, Brenda L.
2008-01-01
C. elegans Dicer requires an accessory double-stranded RNA binding protein, RDE-4, to enact the first step of RNA interference, the cleavage of dsRNA to produce siRNA. While RDE-4 is typically essential for RNAi, we report that in the presence of high concentrations of trigger dsRNA, rde-4 deficient animals are capable of silencing a transgene. By multiple criteria the silencing occurs by the canonical RNAi pathway. For example, silencing is RDE-1 dependent and exhibits a decrease in the targeted mRNA in response to an increase in siRNA. We also find that high concentrations of dsRNA trigger lead to increased accumulation of primary siRNAs, consistent with the existence of a rate-limiting step during the conversion of primary to secondary siRNAs. Our studies also revealed that transgene silencing occurs at low levels in the soma, even in the presence of ADARs, and that at least some siRNAs accumulate in a temperature-dependent manner. We conclude that an RNAi response varies with different conditions, and this may allow an organism to tailor a response to specific environmental signals. PMID:19112503
-
Durdevic, Zeljko; Mobin, Mehrpouya Balaghy; Hanna, Katharina; Lyko, Frank; Schaefer, Matthias
2013-09-12
Transfer RNA (tRNA) fragmentation in response to stress conditions has been described in many organisms. tRNA fragments have been found in association with small interfering RNA (siRNA) components, but the biological role of these interactions remains unclear. We report here that the tRNA methyltransferase Dnmt2 is essential for efficient Dicer-2 (Dcr-2) function in Drosophila. Using small RNA (sRNA) sequencing, we confirmed that Dnmt2 limits the extent of tRNA fragmentation during the heat-shock response. tRNAs as well as tRNA fragments serve as Dcr-2 substrates, and Dcr-2 degrades tRNA-derived sequences, especially under heat-shock conditions. tRNA-derived RNAs are able to inhibit Dcr-2 activity on long double-stranded RNAs (dsRNAs). Consequently, heat-shocked Dnmt2 mutant animals accumulate dsRNAs, produce fewer siRNAs, and show misregulation of siRNA pathway-dependent genes. These results reveal the impact of tRNA fragmentation on siRNA pathways and implicate tRNA modifications in the regulation of sRNA homeostasis during the heat-shock response. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
-
Novel strategies to enforce an epithelial phenotype in mesenchymal cells
Dragoi, Ana-Maria; Swiss, Rachel; Gao, Beile; Agaisse, Hervé
2014-01-01
E-cadherin downregulation in cancer cells is associated with epithelial-to-mesenchymal transition (EMT) and metastatic prowess, but the underlying mechanisms are incompletely characterized. In this study, we probed E-cadherin expression at the plasma membrane as a functional assay to identify genes involved in E-cadherin downregulation. The assay was based on the E-cadherin-dependent invasion properties of the intracellular pathogen Listeria monocytogenes. On the basis of a functional readout, automated microscopy and computer-assisted image analysis were used to screen siRNAs targeting 7,000 human genes. The validity of the screen was supported by its definion of several known regulators of E-cadherin expression, including ZEB1, HDAC1 and MMP14. We identified three new regulators (FLASH, CASP7 and PCGF1), the silencing of which was sufficient to restore high levels of E-cadherin transcription. Additionally, we identified two new regulators (FBXL5 and CAV2), the silencing of which was sufficient to increase E-cadherin expression at a post-transcriptional level. FLASH silencing regulated the expression of E-cadherin and other ZEB1-dependent genes, through post-transcriptional regulation of ZEB1, but it also regulated the expression of numerous ZEB1-independent genes with functions predicted to contribute to a restoration of the epithelial phenotype. Finally, we also report the identification of siRNA duplexes that potently restored the epithelial phenotype by mimicking the activity of known and putative microRNAs. Our findings suggest new ways to enforce epithelial phenotypes as a general strategy to treat cancer by blocking invasive and metastatic phenotypes associated with EMT. PMID:24845104
-
Wu, Jui-Sheng; Tsai, Hsin-Da; Cheung, Wai-Mui; Hsu, Chung Y; Lin, Teng-Nan
2016-08-01
Peroxisome proliferator-activated receptor-gamma (PPAR-γ), a stress-induced transcription factor, protects neurons against ischemic stroke insult by reducing oxidative stress. NADPH oxidase (NOX) activation, a major driving force in ROS generation in the setting of reoxygenation/reperfusion, constitutes an important pathogenetic mechanism of ischemic brain damage. In the present study, both transient in vitro oxygen-glucose deprivation and in vivo middle cerebral artery (MCA) occlusion-reperfusion experimental paradigms of ischemic neuronal death were used to investigate the interaction between PPAR-γ and NOX. With pharmacological (PPAR-γ antagonist GW9662), loss-of-function (PPAR-γ siRNA), and gain-of-function (Ad-PPAR-γ) approaches, we first demonstrated that 15-deoxy-∆(12,14)-PGJ2 (15d-PGJ2), via selectively attenuating p22phox expression, inhibited NOX activation and the subsequent ROS generation and neuronal death in a PPAR-γ-dependent manner. Secondly, results of promoter analyses and subcellular localization studies further revealed that PPAR-γ, via inhibiting hypoxia-induced NF-κB nuclear translocation, indirectly suppressed NF-κB-driven p22phox transcription. Noteworthily, postischemic p22phox siRNA treatment not only reduced infarct volumes but also improved functional outcome. In summary, we report a novel transrepression mechanism involving PPAR-γ downregulation of p22phox expression to suppress the subsequent NOX activation, ischemic neuronal death, and brain infarct. Identification of a PPAR-γ → NF-κB → p22phox neuroprotective signaling cascade opens a new avenue for protecting the brain against ischemic insult.
-
Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.
Parrish, S; Fire, A
2001-10-01
RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed.
-
Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.
Parrish, S; Fire, A
2001-01-01
RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed. PMID:11680844
-
A two-step process for epigenetic inheritance in Arabidopsis
Blevins, Todd; Pontvianne, Frédéric; Cocklin, Ross; Podicheti, Ram; Chandrasekhara, Chinmayi; Yerneni, Satwica; Braun, Chris; Lee, Brandon; Rusch, Doug; Mockaitis, Keithanne; Tang, Haixu; Pikaard, Craig S.
2014-01-01
Summary In Arabidopsis, multisubunit RNA polymerases IV and V orchestrate RNA-directed DNA methylation (RdDM) and transcriptional silencing, but what identifies the loci to be silenced is unclear. We show that heritable silent locus identity at a specific subset of RdDM targets requires HISTONE DEACETYLASE 6 (HDA6) acting upstream of Pol IV recruitment and siRNA biogenesis. At these loci, epigenetic memory conferring silent locus identity is erased in hda6 mutants such that restoration of HDA6 activity cannot restore siRNA biogenesis or silencing. Silent locus identity is similarly lost in mutants for the cytosine maintenance methyltransferase, MET1. By contrast, pol IV or pol V mutants disrupt silencing without erasing silent locus identity, allowing restoration of Pol IV or Pol V function to restore silencing. Collectively, these observations indicate that silent locus specification and silencing are separable steps that together account for epigenetic inheritance of the silenced state. PMID:24657166
-
2013-03-01
oligonucleotide-based drug approaches (better than ribozymes, antisense oligonucleotides ( ASO ), or microRNAs). (4) To accomplish these objectives, we...negative control scrambled ASO (designated NC). The combination of siRNAs T1 and R1 produced a knockdown of ~80% of TGFb1 protein in the conditioned...sequences (antisense oligonucleotides, ASOs ) into rabbit corneal cells and found that technique was very effective in delivering ASOs into the stroma and
-
2014-12-24
toxlet.2011.04.007 Rogers JV, Choi YW, Kiser RC et al (2004) Microarray analysis of gene expression in murine skin exposed to sulfur mustard. J Bio...Chemotactic factors released in culture by intact developing and healing skin lesions produced in rabbits by the irritant sulfur mustard. Inflam- mation 21(2...Project ID Number CBM.CUTOC.04.10. RC 00114. ABSTRACT See reprint. 15. SUBJECT TERMS sulfur mustard, cutaneous injury, siRNA, high-throughput screening
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Haag, Jeremy R.; Ream, Thomas S.; Marasco, Michelle
2012-12-14
In Arabidopsis, RNA-dependent DNA methylation and transcriptional silencing involves three nuclear RNA polymerases that are biochemically undefined: the presumptive DNA-dependent RNA polymerases, Pol IV and Pol V and the putative RNA-dependent RNA polymerase, RDR2. Here, we demonstrate their RNA polymerase activities in vitro. Unlike Pol II, Pols IV and V require an RNA primer, are insensitive to alpha-amanitin and differ in their ability to displace non-template DNA during transcription. Biogenesis of 24 nt small interfering RNAs (siRNAs) requires both Pol IV and RDR2, which physically associate in vivo. Pol IV does not require RDR2 for activity, but RDR2 is nonfunctionalmore » in the absence of associated Pol IV, suggesting that their coupling explains the channeling of Pol IV transcripts into double-stranded RNAs that are then diced into 24 nt siRNAs.« less
-
Eun, Changho; Lorkovic, Zdravko J; Naumann, Ulf; Long, Quan; Havecker, Ericka R; Simon, Stacey A; Meyers, Blake C; Matzke, Antonius J M; Matzke, Marjori
2011-01-01
RNA-directed DNA methylation (RdDM) is a small interfering RNA (siRNA)-mediated epigenetic modification that contributes to transposon silencing in plants. RdDM requires a complex transcriptional machinery that includes specialized RNA polymerases, named Pol IV and Pol V, as well as chromatin remodelling proteins, transcription factors, RNA binding proteins, and other plant-specific proteins whose functions are not yet clarified. In Arabidopsis thaliana, DICER-LIKE3 and members of the ARGONAUTE4 group of ARGONAUTE (AGO) proteins are involved, respectively, in generating and using 24-nt siRNAs that trigger methylation and transcriptional gene silencing of homologous promoter sequences. AGO4 is the main AGO protein implicated in the RdDM pathway. Here we report the identification of the related AGO6 in a forward genetic screen for mutants defective in RdDM and transcriptional gene silencing in shoot and root apical meristems in Arabidopsis thaliana. The identification of AGO6, and not AGO4, in our screen is consistent with the primary expression of AGO6 in shoot and root growing points.
-
Targeting Promoter-Associated Noncoding RNA In Vivo.
Civenni, Gianluca
2017-01-01
There are many classes of noncoding RNAs (ncRNAs), with wide-ranging functionalities (e.g., RNA editing, mediation of mRNA splicing, ribosomal function). MicroRNAs (miRNAs) and long ncRNAs (lncRNAs) are implicated in a wide variety of cellular processes, including the regulation of gene expression. Incorrect expression or mutation of lncRNAs has been reported to be associated with several disease conditions, such a malignant transformation in humans. Importantly, pivotal players in tumorigenesis and cancer progression, such as c-Myc, may be regulated by lncRNA at promoter level. The function of lncRNA can be reduced with antisense oligonucleotides that sequester or degrade mature lncRNAs. In alternative, lncRNA transcription can be blocked by small interference RNA (RNAi), which had acquired, recently, broad interested in clinical applications. In vivo-jetPEI™ is a linear polyethylenimine mediating nucleic acid (DNA, shRNA, siRNA, oligonucelotides) delivery with high efficiency. Different in vivo delivery routes have been validated: intravenous (IV), intraperitoneal (IP), intratumoral, subcutaneous, topical, and intrathecal. High levels of nucleic acid delivery are achieved into a broad range of tissues, such as lung, salivary glands, heart, spleen, liver, and prostate upon systemic administration. In addition, in vivo-jetPEI™ is also an efficient carrier for local gene and siRNA delivery such as intratumoral or topical application on the skin. After systemic injection, siRNA can be detected and the levels can be validated in target tissues by qRT-PCR. Targeting promoter-associated lncRNAs with siRNAs (small interfering RNAs) in vivo is becoming an exciting breakthrough for the treatment of human disease.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Koike, Taro, E-mail: koiket@hirakata.kmu.ac.jp; Wakabayashi, Taketoshi; Mori, Tetsuji
Sox2 is a transcriptional factor expressed in neural stem cells. It is known that Sox2 regulates cell differentiation, proliferation and survival of the neural stem cells. Our previous study showed that Sox2 is expressed in all satellite glial cells of the adult rat dorsal root ganglion. In this study, to examine the role of Sox2 in satellite glial cells, we establish a satellite glial cell-enriched culture system. Our culture method succeeded in harvesting satellite glial cells with the somata of neurons in the dorsal root ganglion. Using this culture system, Sox2 was downregulated by siRNA against Sox2. The knockdown ofmore » Sox2 downregulated ErbB2 and ErbB3 mRNA at 2 and 4 days after siRNA treatment. MAPK phosphorylation, downstream of ErbB, was also inhibited by Sox2 knockdown. Because ErbB2 and ErbB3 are receptors that support the survival of glial cells in the peripheral nervous system, apoptotic cells were also counted. TUNEL-positive cells increased at 5 days after siRNA treatment. These results suggest that Sox2 promotes satellite glial cell survival through the MAPK pathway via ErbB receptors. - Highlights: • We established satellite glial cell culture system. • Function of Sox2 in satellite glial cell was examined using siRNA. • Sox2 knockdown downregulated expression level of ErbB2 and ErbB3 mRNA. • Sox2 knockdown increased apoptotic satellite glial cell. • Sox2 promotes satellite glial cell survival through ErbB signaling.« less
-
Pavelin, Jon; Reynolds, Natalie; Chiweshe, Stephen; Wu, Guanming; Tiribassi, Rebecca; Grey, Finn
2013-01-01
Recent advances in microRNA target identification have greatly increased the number of putative targets of viral microRNAs. However, it is still unclear whether all targets identified are biologically relevant. Here, we use a combined approach of RISC immunoprecipitation and focused siRNA screening to identify targets of HCMV encoded human cytomegalovirus that play an important role in the biology of the virus. Using both a laboratory and clinical strain of human cytomegalovirus, we identify over 200 putative targets of human cytomegalovirus microRNAs following infection of fibroblast cells. By comparing RISC-IP profiles of miRNA knockout viruses, we have resolved specific interactions between human cytomegalovirus miRNAs and the top candidate target transcripts and validated regulation by western blot analysis and luciferase assay. Crucially we demonstrate that miRNA target genes play important roles in the biology of human cytomegalovirus as siRNA knockdown results in marked effects on virus replication. The most striking phenotype followed knockdown of the top target ATP6V0C, which is required for endosomal acidification. siRNA knockdown of ATP6V0C resulted in almost complete loss of infectious virus production, suggesting that an HCMV microRNA targets a crucial cellular factor required for virus replication. This study greatly increases the number of identified targets of human cytomegalovirus microRNAs and demonstrates the effective use of combined miRNA target identification and focused siRNA screening for identifying novel host virus interactions. PMID:24385903
-
Masanga, Joel Okoyo; Matheka, Jonathan Mutie; Omer, Rasha Adam; Ommeh, Sheila Cecily; Monda, Ethel Oranga; Alakonya, Amos Emitati
2015-08-01
We report success of host-induced gene silencing in downregulation of aflatoxin biosynthesis in Aspergillus flavus infecting maize transformed with a hairpin construct targeting transcription factor aflR. Infestation of crops by aflatoxin-producing fungi results in economic losses as well as negative human and animal health effects. Currently, the control strategies against aflatoxin accumulation are not effective to the small holder farming systems in Africa and this has led to widespread aflatoxin exposure especially in rural populations of sub-Saharan Africa that rely on maize as a staple food crop. A recent strategy called host-induced gene silencing holds great potential for developing aflatoxin-resistant plant germplasm for the African context where farmers are unable to make further investments other than access to the germplasm. We transformed maize with a hairpin construct targeting the aflatoxin biosynthesis transcription factor aflR. The developed transgenic maize were challenged with an aflatoxigenic Aspergillus flavus strain from Eastern Kenya, a region endemic to aflatoxin outbreaks. Our results indicated that aflR was downregulated in A. flavus colonizing transgenic maize. Further, maize kernels from transgenic plants accumulated significantly lower levels of aflatoxins (14-fold) than those from wild type plants. Interestingly, we observed that our silencing cassette caused stunting and reduced kernel placement in the transgenic maize. This could have been due to "off-target" silencing of unintended genes in transformed plants by aflR siRNAs. Overall, this work indicates that host-induced gene silencing has potential in developing aflatoxin-resistant germplasm.
-
Choudhury, Mahua; Pandey, Ravi S; Clemens, Dahn L; Davis, Justin Wade; Lim, Robert W; Shukla, Shivendra D
2011-06-01
We have investigated whether Gcn5, a histone acetyltransferase (HAT), is involved in ethanol-induced acetylation of histone H3 at lysine 9 (H3AcK9) and has any effect on the gene expression. Human hepatoma HepG2 cells transfected with ethanol-metabolizing enzyme alcohol dehydrogenase 1 (VA 13 cells) were used. Knock down of Gcn5 by siRNA silencing decreased mRNA and protein levels of general control nondepressible 5 (GCN5), HAT activity, and also attenuated ethanol-induced H3AcK9 in VA13 cells. Illumina gene microarray analysis using total RNA showed 940 transcripts affected by GCN5 silencing or ethanol. Silencing caused differential expression of 891 transcripts (≥1.5-fold upregulated or downregulated). Among these, 492 transcripts were upregulated and 399 were downregulated compared with their respective controls. Using a more stringent threshold (≥2.5-fold), the array data from GCN5-silenced samples showed 57 genes differentially expressed (39 upregulated and 18 downregulated). Likewise, ethanol caused differential regulation of 57 transcripts with ≥1.5-fold change (35 gene upregulated and 22 downregulated). Further analysis showed that eight genes were differentially regulated that were common for both ethanol treatment and GCN5 silencing. Among these, SLC44A2 (a putative choline transporter) was strikingly upregulated by ethanol (three fold), and GCN5 silencing downregulated it (1.5-fold). The quantitative real-time polymerase chain reaction profile corroborated the array findings. This report demonstrates for the first time that (1) GCN5 differentially affects expression of multiple genes, (2) ethanol-induced histone H3-lysine 9 acetylation is mediated via GCN5, and (3) GCN5 is involved in ethanol-induced expression of the putative choline transporter SLC44A2. Copyright © 2011 Elsevier Inc. All rights reserved.
-
FOXD3 inhibits SCN2A gene transcription in intractable epilepsy cell models.
Xiang, Jun; Wen, Fang; Zhang, Lingyun; Zhou, Yu
2018-04-01
The expression of sodium voltage-gated channel alpha subunit 2 (SCN2A) is closely related to the development of epilepsy. This study investigated regulatory element of the SCN2A gene involved in epilepsy. An intractable epilepsy cell model was constructed using hippocampal primary neurons and the SH-SY5Y cell line. SCN2A protein and gene expression in cells as well as the level of lactic acid dehydrogenase (LDH) in the cell culture supernatants was detected. Potential regulatory factors of SCN2A and its upstream regulatory elements were identified using the dual-luciferase reporter assay. Finally, the role of the hypothetical transcription factor in epilepsy was examined by using its small interfering RNA (siRNA). Results found that levels of LDH and expression of the hypothetical transcription factor, Forkhead box D3 (FOXD3), was both increased in the model cells, whereas that of SCN2A was decreased. The results of dual-luciferase reporter assays revealed that an upstream region of SCN2A gene spanning from nucleotides -1617 to -1470 was a transcription factor binding region and a trans-acting factor role of FOXD3 was identified in the core region (GGCAAAATTAT). Then the FOXD3 binding site was further verified by the chromatin immunoprecipitation (ChIP) assay and electrophoretic mobility shift assay (EMSA). After SH-SY5Y cells were transfected with FOXD3 siRNA, the release of LDH into culture supernatants and the LDH expression levels in cells were significantly decreased. SCN2A expression in model cells was increased by knockdown of FOXD3. Therefore, this study demonstrated that FOXD3 is a trans-acting factor of SCN2A, and this mechanism may play a role in cell injury after epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.
-
Wei, Liya; Gu, Lianfeng; Song, Xianwei; Cui, Xiekui; Lu, Zhike; Zhou, Ming; Wang, Lulu; Hu, Fengyi; Zhai, Jixian; Meyers, Blake C.; Cao, Xiaofeng
2014-01-01
Transposable elements (TEs) and repetitive sequences make up over 35% of the rice (Oryza sativa) genome. The host regulates the activity of different TEs by different epigenetic mechanisms, including DNA methylation, histone H3K9 methylation, and histone H3K4 demethylation. TEs can also affect the expression of host genes. For example, miniature inverted repeat TEs (MITEs), dispersed high copy-number DNA TEs, can influence the expression of nearby genes. In plants, 24-nt small interfering RNAs (siRNAs) are mainly derived from repeats and TEs. However, the extent to which TEs, particularly MITEs associated with 24-nt siRNAs, affect gene expression remains elusive. Here, we show that the rice Dicer-like 3 homolog OsDCL3a is primarily responsible for 24-nt siRNA processing. Impairing OsDCL3a expression by RNA interference caused phenotypes affecting important agricultural traits; these phenotypes include dwarfism, larger flag leaf angle, and fewer secondary branches. We used small RNA deep sequencing to identify 535,054 24-nt siRNA clusters. Of these clusters, ∼82% were OsDCL3a-dependent and showed significant enrichment of MITEs. Reduction of OsDCL3a function reduced the 24-nt siRNAs predominantly from MITEs and elevated expression of nearby genes. OsDCL3a directly targets genes involved in gibberellin and brassinosteroid homeostasis; OsDCL3a deficiency may affect these genes, thus causing the phenotypes of dwarfism and enlarged flag leaf angle. Our work identifies OsDCL3a-dependent 24-nt siRNAs derived from MITEs as broadly functioning regulators for fine-tuning gene expression, which may reflect a conserved epigenetic mechanism in higher plants with genomes rich in dispersed repeats or TEs. PMID:24554078
-
Peptides Used in the Delivery of Small Noncoding RNA
2015-01-01
RNA interference (RNAi) is an endogenous process in which small noncoding RNAs, including small interfering RNAs (siRNAs) and microRNAs (miRNAs), post-transcriptionally regulate gene expressions. In general, siRNA and miRNA/miRNA mimics are similar in nature and activity except their origin and specificity. Although both siRNAs and miRNAs have been extensively studied as novel therapeutics for a wide range of diseases, the large molecular weight, anionic surface charges, instability in blood circulation, and intracellular trafficking to the RISC after cellular uptake have hindered the translation of these RNAs from bench to clinic. As a result, a great variety of delivery systems have been investigated for safe and effective delivery of small noncoding RNAs. Among these systems, peptides, especially cationic peptides, have emerged as a promising type of carrier due to their inherent ability to condense negatively charged RNAs, ease of synthesis, controllable size, and tunable structure. In this review, we will focus on three major types of cationic peptides, including poly(l-lysine) (PLL), protamine, and cell penetrating peptides (CPP), as well as peptide targeting ligands that have been extensively used in RNA delivery. The delivery strategies, applications, and limitations of these cationic peptides in siRNA/miRNA delivery will be discussed. PMID:25157701
-
Li, Dengzhe; Gale, Robert Peter; Liu, Yanfeng; Lei, Baoxia; Wang, Yuan; Diao, Dongmei; Zhang, Mei
2017-07-01
Multi-drug resistance (MDR), immune suppression and decreased apoptosis are important causes of therapy-failure in leukaemia. Short interfering RNAs (siRNAs) down-regulate gene transcription, have sequence-independent immune-stimulatory effects and synergize with other anti-cancer therapies in some experimental models. We designed a siRNA targeting MDR1 with 5'-triphosphate ends (3p-siRNA-MDR1). Treatment of leukaemia cells with 3p-siRNA-MDR1 down-regulated MDR1 expression, reduced-drug resistance and induced immune and pro-apoptotic effects in drug-resistant HL-60/Adr and K562/Adr human leukaemia cell lines. We show mechanisms-of-action of these effects involve alterations in the anti-viral cytosolic retinoic acid-inducible protein-I (RIG-I; encoded by RIG-I or DDX58) mediated type-I interferon signal induction, interferon-gamma-inducible protein 10 (IP-10; encoded by IP10 or CXCL10) secretion, major histocompatibility complex-I expression (MHC-I) and caspase-mediated cell apoptosis. 3p-siRNA-MDR1 transfection also enhanced the anti-leukaemia efficacy of doxorubicin. These data suggest a possible synergistic role for 3p-siRNA-MDR1 in anti-leukaemia therapy. Copyright © 2017 Elsevier Ltd. All rights reserved.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kitagawa, Yukiko; Department of Oral and Maxillofacial Surgery II, Osaka University, Osaka 565-0871; Kameoka, Masanori
2008-03-30
The transfection of human cells with siRNA against adapter-related protein complex 2 alpha 1 subunit (AP2{alpha}) was revealed to significantly up-regulate the replication of human immunodeficiency virus type 1 (HIV-1). This effect was confirmed by cell infection with vesicular stomatitis virus G protein-pseudotyped HIV-1 as well as CXCR4-tropic and CCR5-tropic HIV-1. Viral adsorption, viral entry and reverse transcription processes were not affected by cell transfection with siRNA against AP2{alpha}. In contrast, viral nuclear translocation as well as the integration process was significantly up-regulated in cells transfected with siRNA against AP2{alpha}. Confocal fluorescence microscopy revealed that a subpopulation of AP2{alpha} wasmore » not only localized in the cytoplasm but was also partly co-localized with lamin B, importin {beta} and Nup153, implying that AP2{alpha} negatively regulates HIV-1 replication in the process of nuclear translocation of viral DNA in the cytoplasm or the perinuclear region. We propose that AP2{alpha} may be a novel target for disrupting HIV-1 replication in the early stage of the viral life cycle.« less
-
He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang
2010-08-27
P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.
-
He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang
2010-01-01
P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy. PMID:20957096
-
Synthetic RNAs for Gene Regulation: Design Principles and Computational Tools
Laganà, Alessandro; Shasha, Dennis; Croce, Carlo Maria
2014-01-01
The use of synthetic non-coding RNAs for post-transcriptional regulation of gene expression has not only become a standard laboratory tool for gene functional studies but it has also opened up new perspectives in the design of new and potentially promising therapeutic strategies. Bioinformatics has provided researchers with a variety of tools for the design, the analysis, and the evaluation of RNAi agents such as small-interfering RNA (siRNA), short-hairpin RNA (shRNA), artificial microRNA (a-miR), and microRNA sponges. More recently, a new system for genome engineering based on the bacterial CRISPR-Cas9 system (Clustered Regularly Interspaced Short Palindromic Repeats), was shown to have the potential to also regulate gene expression at both transcriptional and post-transcriptional level in a more specific way. In this mini review, we present RNAi and CRISPRi design principles and discuss the advantages and limitations of the current design approaches. PMID:25566532
-
Pietschke, Katharina; Walker, Tobias; Krajewski, Stefanie; Kurz, Julia; Aufderklamm, Stefan; Schwentner, Christian; Schlensak, Christian; Stenzl, Arnulf; Wendel, Hans P; Nolte, Andrea
2014-01-01
Prostate cancer is one of the leading malignant tumors in men. Current therapies are associated with severe side effects making it problematic for many multi-morbid patients to receive treatment. Prostate specific antigen, serum response factor (SRF), signal transducer and activator of transcription-3 (STAT3), hypoxia-inducible factor-1α (HIF-1α), HIF-2α, E2F1 and Survivin are well known proteins being overexpressed in cancer cells, expediting cell growth and also demonstrated in prostate cancer cells. Targeting these genes using the RNA-Interference pathway could be a new approach for prostate cancer therapy with fewer side effects. Three prostate cancer cell lines were cultured under standard conditions and transfected with three different concentrations (25 nM, 50 nM, 100 nM) of specific small interfering RNAs (siRNAs) targeting SRF, STAT3, HIF1α, HIF2α, E2F1 and Survivin in a non-viral manner. Cells treated with non-specific siRNA (SCR-siRNA) served as control. Changes of messenger RNA (mRNA) levels were determined using quantitative real-time polymerase chain reaction (qRT-PCR). The analysis of the effect of siRNA on the number of cells was detected using CASY cell counter system. Transfections of the PC-3 cell line with specific siRNA especially against Survivin, E2F1, HIF1α- and HIF2α-siRNA resulted in a significant reduction of intracellular mRNA concentration together with a significant decreased number of cells. In the LnCAP and DU-145 cell lines Survivin and E2F1 showed similar effects. The impact of silencing STAT3 or SRF showed little influence on the amount of cells in all three cell lines. This study shows that RNAi succeeds in silencing gene expression and reducing the number of cells in differing dimensions depending on the transfected cell line and used siRNA.
-
Zhong, Jian-Bin; Li, Xie; Zhong, Si-Ming; Liu, Jiu-Di; Chen, Chi-Bang; Wu, Xiao-Yan
2017-09-27
Brain-derived neurotrophic factor (BDNF) plays an important role in neuronal cell apoptosis. The antisense RNA of brain-derived neurotrophic factor (BDNF-AS) is a natural antisense transcript that is transcribed opposite the gene that encodes BDNF. The aim of this study was to determine whether knockdown of BDNF-AS can suppress hypoxia/reoxygenation (H/R)-induced neuronal cell apoptosis and whether this is mediated by the BDNF-TrkB-PI3K/Akt pathway. We detected the expression of BDNF and BDNF-AS in brain tissue from 20 patients with cerebral infarction and five patients with other diseases (but no cerebral ischemia). We found that BDNF expression was significantly downregulated in patients with cerebral infarction, whereas the expression of BDNF-AS was significantly upregulated. In both human cortical neurons (HCN2) and human astrocytes, H/R significantly induced the expression of BDNF-AS, but significantly decreased BDNF expression. H/R also significantly induced apoptosis and reduced the mitochondrial membrane potential in these cells. Following downregulation of BDNF-AS by siRNA in human cortical neurons and human astrocyte cells, BDNF expression was significantly upregulated and the H/R-induced upregulation of BDNF-AS was significantly attenuated. BDNF-AS siRNA inhibited H/R-induced cell apoptosis and ameliorated the H/R-induced suppression of mitochondrial membrane potential. H/R inhibited the expression of BDNF, p-AKT/AKT, and TrKB, and this inhibition was recovered by BDNF-AS siRNA. In summary, this study indicates that BDNF-AS siRNA induces activation of the BDNF-TrkB-PI3K/Akt pathway following H/R-induced neurotoxicity. These findings will be useful toward the application of BDNF-AS siRNA for the treatment of neurodegenerative diseases.
-
Mitogen Activated Protein Kinase Phosphatase-1 (MKP-1) in Retinal Ischemic Preconditioning
Dreixler, John C.; Bratton, Anthony; Du, Eugenie; Shaikh, Afzhal R.; Savoie, Brian; Michael, Alexander; Marcet, Marcus; Roth, Steven
2011-01-01
We previously described the phenomenon of retinal ischemic preconditioning (IPC) and we have shown the role of various signaling proteins in the protective pathways, including the mitogen-activated protein kinase p38. In this study we examined the role in IPC of mitogen-activated protein kinase phosphatase-1 (MKP-1), which inactivates p38. Ischemia was produced by elevation of intraocular pressure above systolic arterial blood pressure in adult Wistar rats. Preconditioning was produced by transient retinal ischemia for 5 min, 24 h prior to ischemia. Small interfering RNA (siRNA) to MKP-1 or a control non-silencing siRNA, was injected into the vitreous 6 h prior to IPC. Recovery was assessed by electroretinography (ERG) and histology. The a- and b-waves, and oscillatory potentials (OPs), measured before and 1 week after ischemia, were then normalized relative to pre-ischemic baseline, and corrected for diurnal variation in the normal non-ischemic eye. The P2, or post-photoreceptor component of the ERG (which reflects function of the rod bipolar cells in the inner retina), was derived using the Hood-Birch model. MKP-1 was localized in specific retinal cells using immunohistochemistry; levels of mitogen-activated protein kinases were measured using Western blotting. Injection of siRNA to MKP-1 significantly attenuated the protective effect of IPC as reflected by decreased recovery of the electroretinogram a- and b-waves and the P2 after ischemia. The injection of siRNA to MKP-1 reduced the number of cells in the retinal ganglion cell and outer nuclear layers after IPC and ischemia. Blockade of MKP-1 by siRNA also increased the activation of p38 at 24 h following IPC. MKP-1 siRNA did not alter the levels of phosphorylated jun N-terminal kinase (JNK) or extracellular signal-regulated kinase (ERK) after IPC. The results suggest the involvement of dual-specificity phosphatase MKP-1 in IPC and that MKP-1 is involved in IPC by regulating levels of activated MAPK p38. PMID:21094639
-
2012-01-01
Background Oxidative Stress contributes to the pathogenesis of many diseases. The NRF2/KEAP1 axis is a key transcriptional regulator of the anti-oxidant response in cells. Nrf2 knockout mice have implicated this pathway in regulating inflammatory airway diseases such as asthma and COPD. To better understand the role the NRF2 pathway has on respiratory disease we have taken a novel approach to define NRF2 dependent gene expression in a relevant lung system. Methods Normal human lung fibroblasts were transfected with siRNA specific for NRF2 or KEAP1. Gene expression changes were measured at 30 and 48 hours using a custom Affymetrix Gene array. Changes in Eotaxin-1 gene expression and protein secretion were further measured under various inflammatory conditions with siRNAs and pharmacological tools. Results An anti-correlated gene set (inversely regulated by NRF2 and KEAP1 RNAi) that reflects specific NRF2 regulated genes was identified. Gene annotations show that NRF2-mediated oxidative stress response is the most significantly regulated pathway, followed by heme metabolism, metabolism of xenobiotics by Cytochrome P450 and O-glycan biosynthesis. Unexpectedly the key eosinophil chemokine Eotaxin-1/CCL11 was found to be up-regulated when NRF2 was inhibited and down-regulated when KEAP1 was inhibited. This transcriptional regulation leads to modulation of Eotaxin-1 secretion from human lung fibroblasts under basal and inflammatory conditions, and is specific to Eotaxin-1 as NRF2 or KEAP1 knockdown had no effect on the secretion of a set of other chemokines and cytokines. Furthermore, the known NRF2 small molecule activators CDDO and Sulphoraphane can also dose dependently inhibit Eotaxin-1 release from human lung fibroblasts. Conclusions These data uncover a previously unknown role for NRF2 in regulating Eotaxin-1 expression and further the mechanistic understanding of this pathway in modulating inflammatory lung disease. PMID:23061798
-
Fourtounis, Jimmy; Wang, I-Ming; Mathieu, Marie-Claude; Claveau, David; Loo, Tenneille; Jackson, Aimee L; Peters, Mette A; Therien, Alex G; Boie, Yves; Crackower, Michael A
2012-10-12
Oxidative Stress contributes to the pathogenesis of many diseases. The NRF2/KEAP1 axis is a key transcriptional regulator of the anti-oxidant response in cells. Nrf2 knockout mice have implicated this pathway in regulating inflammatory airway diseases such as asthma and COPD. To better understand the role the NRF2 pathway has on respiratory disease we have taken a novel approach to define NRF2 dependent gene expression in a relevant lung system. Normal human lung fibroblasts were transfected with siRNA specific for NRF2 or KEAP1. Gene expression changes were measured at 30 and 48 hours using a custom Affymetrix Gene array. Changes in Eotaxin-1 gene expression and protein secretion were further measured under various inflammatory conditions with siRNAs and pharmacological tools. An anti-correlated gene set (inversely regulated by NRF2 and KEAP1 RNAi) that reflects specific NRF2 regulated genes was identified. Gene annotations show that NRF2-mediated oxidative stress response is the most significantly regulated pathway, followed by heme metabolism, metabolism of xenobiotics by Cytochrome P450 and O-glycan biosynthesis. Unexpectedly the key eosinophil chemokine Eotaxin-1/CCL11 was found to be up-regulated when NRF2 was inhibited and down-regulated when KEAP1 was inhibited. This transcriptional regulation leads to modulation of Eotaxin-1 secretion from human lung fibroblasts under basal and inflammatory conditions, and is specific to Eotaxin-1 as NRF2 or KEAP1 knockdown had no effect on the secretion of a set of other chemokines and cytokines. Furthermore, the known NRF2 small molecule activators CDDO and Sulphoraphane can also dose dependently inhibit Eotaxin-1 release from human lung fibroblasts. These data uncover a previously unknown role for NRF2 in regulating Eotaxin-1 expression and further the mechanistic understanding of this pathway in modulating inflammatory lung disease.
-
Keil, Jason M.; Liu, Xuwen; Antonetti, David A.
2013-01-01
Purpose. Glucocorticoids (GCs) effectively reduce retinal edema and induce vascular barrier properties but possess unwanted side effects. Understanding GC induction of barrier properties may lead to more effective and specific therapies. Previous work identified the occludin enhancer element (OEE) as a GC-responsive cis-element in the promoters of multiple junctional genes, including occludin, claudin-5, and cadherin-9. Here, we identify two OEE-binding factors and determine their contribution to GC induction of tight junction (TJ) gene expression and endothelial barrier properties. Methods. OEE-binding factors were isolated from human retinal endothelial cells (HREC) using DNA affinity purification followed by MALDI-TOF MS/MS. Chromatin immunoprecipitation (ChIP) assays determined in situ binding. siRNA was used to evaluate the role of trans-acting factors in transcription of TJ genes in response to GC stimulation. Paracellular permeability was determined by quantifying flux through a cell monolayer, whereas transendothelial electrical resistance (TER) was measured using the ECIS system. Results. MS/MS analysis of HREC nuclear extracts identified the heterodimer of transcription factors p54/NONO (p54) and polypyrimidine tract-binding protein-associated splicing factor (PSF) as OEE-binding factors, which was confirmed by ChIP assay from GC-treated endothelial cells and rat retina. siRNA knockdown of p54 demonstrated that this factor is necessary for GC induction of occludin and claudin-5 expression. Further, p54 knockdown ablated the pro-barrier effects of GC treatment. Conclusions. p54 is essential for GC-mediated expression of occludin, claudin-5, and barrier induction, and the p54/PSF heterodimer may contribute to normal blood-retinal barrier (BRB) induction in vivo. Understanding the mechanism of GC induction of BRB properties may provide novel therapies for macular edema. PMID:23640037
-
Keil, Jason M; Liu, Xuwen; Antonetti, David A
2013-06-12
Glucocorticoids (GCs) effectively reduce retinal edema and induce vascular barrier properties but possess unwanted side effects. Understanding GC induction of barrier properties may lead to more effective and specific therapies. Previous work identified the occludin enhancer element (OEE) as a GC-responsive cis-element in the promoters of multiple junctional genes, including occludin, claudin-5, and cadherin-9. Here, we identify two OEE-binding factors and determine their contribution to GC induction of tight junction (TJ) gene expression and endothelial barrier properties. OEE-binding factors were isolated from human retinal endothelial cells (HREC) using DNA affinity purification followed by MALDI-TOF MS/MS. Chromatin immunoprecipitation (ChIP) assays determined in situ binding. siRNA was used to evaluate the role of trans-acting factors in transcription of TJ genes in response to GC stimulation. Paracellular permeability was determined by quantifying flux through a cell monolayer, whereas transendothelial electrical resistance (TER) was measured using the ECIS system. MS/MS analysis of HREC nuclear extracts identified the heterodimer of transcription factors p54/NONO (p54) and polypyrimidine tract-binding protein-associated splicing factor (PSF) as OEE-binding factors, which was confirmed by ChIP assay from GC-treated endothelial cells and rat retina. siRNA knockdown of p54 demonstrated that this factor is necessary for GC induction of occludin and claudin-5 expression. Further, p54 knockdown ablated the pro-barrier effects of GC treatment. p54 is essential for GC-mediated expression of occludin, claudin-5, and barrier induction, and the p54/PSF heterodimer may contribute to normal blood-retinal barrier (BRB) induction in vivo. Understanding the mechanism of GC induction of BRB properties may provide novel therapies for macular edema.
-
Matsushita, Kazuyuki; Shimada, Hideaki; Ueda, Yasuji; Inoue, Makoto; Hasegawa, Mamoru; Tomonaga, Takeshi; Matsubara, Hisahiro; Nomura, Fumio
2014-01-01
AIM: To investigate a novel therapeutic strategy to target and suppress c-myc in human cancers using far up stream element (FUSE)-binding protein-interacting repressor (FIR). METHODS: Endogenous c-Myc suppression and apoptosis induction by a transient FIR-expressing vector was examined in vivo via a HA-tagged FIR (HA-FIR) expression vector. A fusion gene-deficient, non-transmissible, Sendai virus (SeV) vector encoding FIR cDNA, SeV/dF/FIR, was prepared. SeV/dF/FIR was examined for its gene transduction efficiency, viral dose dependency of antitumor effect and apoptosis induction in HeLa (cervical squamous cell carcinoma) cells and SW480 (colon adenocarcinoma) cells. Antitumor efficacy in a mouse xenograft model was also examined. The molecular mechanism of the anti-tumor effect and c-Myc suppression by SeV/dF/FIR was examined using Spliceostatin A (SSA), a SAP155 inhibitor, or SAP155 siRNA which induce c-Myc by increasing FIR∆exon2 in HeLa cells. RESULTS: FIR was found to repress c-myc transcription and in turn the overexpression of FIR drove apoptosis through c-myc suppression. Thus, FIR expressing vectors are potentially applicable for cancer therapy. FIR is alternatively spliced by SAP155 in cancer cells lacking the transcriptional repression domain within exon 2 (FIR∆exon2), counteracting FIR for c-Myc protein expression. Furthermore, FIR forms a complex with SAP155 and inhibits mutual well-established functions. Thus, both the valuable effects and side effects of exogenous FIR stimuli should be tested for future clinical application. SeV/dF/FIR, a cytoplasmic RNA virus, was successfully prepared and showed highly efficient gene transduction in in vivo experiments. Furthermore, in nude mouse tumor xenograft models, SeV/dF/FIR displayed high antitumor efficiency against human cancer cells. SeV/dF/FIR suppressed SSA-activated c-Myc. SAP155 siRNA, potentially produces FIR∆exon2, and led to c-Myc overexpression with phosphorylation at Ser62. HA-FIR suppressed endogenous c-Myc expression and induced apoptosis in HeLa and SW480 cells. A c-myc transcriptional suppressor FIR expressing SeV/dF/FIR showed high gene transduction efficiency with significant antitumor effects and apoptosis induction in HeLa and SW480 cells. CONCLUSION: SeV/dF/FIR showed strong tumor growth suppression with no significant side effects in an animal xenograft model, thus SeV/dF/FIR is potentially applicable for future clinical cancer treatment. PMID:24764668
-
URI Regulation of Androgen Receptor-Mediated Cell Growth
2013-07-01
R2TP/ Prefoldin -like cochaperone are involved in the cytoplasmic assembly of RNA polymerase II . Mol Cell 39, 912- 924. Chen, C.D., Welsbie, D.S., Tran...primers specific for the promoter of the chosen genes II . Test and titrate antibodies against the identified transcription factors in immuno...LNCaP prostate cancer cells ii . Measure KAP1 target gene expression changes (NOXA, p21, BAX) upon siRNA knockdown of ART-27 in LNCaP cells We
-
Aldosterone induces clonal β-cell failure through glucocorticoid receptor
Chen, Fang; Liu, Jia; Wang, Yanyang; Wu, Tijun; Shan, Wei; Zhu, Yunxia; Han, Xiao
2015-01-01
Aldosterone excess causes insulin resistance in peripheral tissues and directly impairs the function of clonal β-cell. The aim of this study was to investigate the molecular mechanisms involved in the aldosterone-induced impairment of clonal β-cells. As expected, aldosterone induced apoptosis and β-cell dysfunction, including impairment of insulin synthesis and secretion, which were reversed by Glucocorticoid receptor (GR) antagonists or GR-specific siRNA. However, mineralocorticoid receptor (MR) antagonists or MR-specific siRNA had no effect on impairment of clonal β-cells induced by aldosterone. Besides, aldosterone significantly decreased expression and activity of MafA, while activated JNK and p38 MAPK in a GR-dependent manner. In addition, JNK inhibitors (SP600125) and/or p38 inhibitors (SB203580) could abolish the effect of aldosterone on MafA expression and activity. Importantly, overexpression of JNK1 or p38 reversed the protective effect of a GR antagonist on the decrease of MafA expression and activity. Furthermore, aldosterone inhibits MafA expression at the transcriptional and post-transcriptional level through activation of JNK and p38, respectively. Consequently, overexpression of MafA increased synthesis and secretion of insulin, and decreased apoptosis in clonal β-cells exposed to aldosterone. These findings identified aldosterone as an inducer of clonal β-cell failure that operates through the GR-MAPK-MafA signaling pathway. PMID:26287126
-
Roles of plant hormones in the regulation of host-virus interactions.
Alazem, Mazen; Lin, Na-Sheng
2015-06-01
Hormones are tuners of plant responses to biotic and abiotic stresses. They are involved in various complicated networks, through which they modulate responses to different stimuli. Four hormones primarily regulate plant defence to pathogens: salicylic acid (SA), jasmonic acid (JA), ethylene (Et) and abscisic acid (ABA). In susceptible plants, viral infections result in hormonal disruption, which manifests as the simultaneous induction of several antagonistic hormones. However, these antagonistic hormones may exhibit some sequential accumulation in resistant lines. Virus propagation is usually restricted by the activation of the small interfering RNA (siRNA) antiviral machinery and/or SA signalling pathway. Several studies have investigated these two systems, using different model viruses. However, the roles of hormones other than SA, especially those with antagonistic properties, such as ABA, have been neglected. Increasing evidence indicates that hormones control components of the small RNA system, which regulates many processes (including the siRNA antiviral machinery and the microRNA system) at the transcriptional or post-transcriptional level. Consequently, cross-talk between the antagonistic SA and ABA pathways modulates plant responses at multiple levels. In this review, we summarize recent findings on the different roles of hormones in the regulation of plant-virus interactions, which are helping us to elucidate the fine tuning of viral and plant systems by hormones. © 2014 THE AUTHORS. MOLECULAR PLANT PATHOLOGY PUBLISHED BY JOHN WILEY & SONS LTD AND BSPP.
-
NASA Astrophysics Data System (ADS)
Gai, Ying-Ping; Li, Yi-Qun; Guo, Fang-Yue; Yuan, Chuan-Zhong; Mo, Yao-Yao; Zhang, Hua-Liang; Wang, Hong; Ji, Xian-Ling
2014-06-01
The yellow dwarf disease associated with phytoplasmas is one of the most devastating diseases of mulberry and the pathogenesis involved in the disease is poorly understood. To analyze the molecular mechanisms mediating gene expression in mulberry-phytoplasma interaction, the comprehensive sRNA changes of mulberry leaf in response to phytoplasma-infection were examined. A total of 164 conserved miRNAs and 23 novel miRNAs were identified, and 62 conserved miRNAs and 13 novel miRNAs were found to be involved in the response to phytoplasma-infection. Meanwhile, target genes of the responsive miRNAs were identified by sequencing of the degradome library. In addition, the endogenous siRNAs were sequenced, and their expression profiles were characterized. Interestingly, we found that phytoplasma infection induced the accumulation of mul-miR393-5p which was resulted from the increased transcription of MulMIR393A, and mul-miR393-5p most likely initiate the biogenesis of siRNAs from TIR1 transcript. Based on the results, we can conclude that phytoplasma-responsive sRNAs modulate multiple hormone pathways and play crucial roles in the regulation of development and metabolism. These responsive sRNAs may work cooperatively in the response to phytoplasma-infection and be responsible for some symptoms in the infected plants.
-
Bielski, Elizabeth; Zhong, Qian; Mirza, Hamad; Brown, Matthew; Molla, Ashura; Carvajal, Teresa; da Rocha, Sandro R P
2017-07-15
The regulation of genes utilizing the RNA interference (RNAi) mechanism via the delivery of synthetic siRNA has great potential in the treatment of a variety of lung diseases. However, the delivery of siRNA to the lungs is challenging due to the poor bioavailability of siRNA when delivered intraveneously, and difficulty in formulating and maintaining the activity of free siRNA when delivered directly to the lungs using inhalation devices. The use of non-viral vectors such as cationic dendrimers can help enhance the stability of siRNA and its delivery to the cell cytosol. Therefore, in this work, we investigate the ability of a triphenylphosphonium (TPP) modified generation 4 poly(amidoamine) (PAMAM) dendrimer (G4NH 2 -TPP) to enhance the in vitro transfection efficiency of siRNA in a model of the pulmonary epithelium and their aerosol formulations in pressurized metered dose inhalers (pMDIs) and dry powder inhalers (DPIs). Complexes of siRNA and G4NH 2 -TPP were prepared with varying TPP densities and increasing N/P ratios. The complexation efficiency was modulated by the presence of the TPP on the dendrimer surface, allowing for a looser complexation compared to unmodified dendrimer as determined by gel electrophoresis and polyanion competition assay. An increase in TPP density and N/P ratio led to an increase in the in vitro gene knockdown of stably green fluorescent protein (eGFP) expressing lung alveolar epithelial (A549) cells. G4NH 2 -12TPP dendriplexes (G4NH 2 PAMAM dendrimers containing 12 TPP molecules on the surface complexed with siRNA) at N/P ratio 30 showed the highest in vitro gene knockdown efficiency. To assess the potential of TPP-dendriplexes for pulmonary use, we also developed micron particle technologies for both pMDIs and DPIs and determined their aerosol characteristics utilizing an Andersen Cascade Impactor (ACI). Mannitol microparticles encapsulating 12TPP-dendriplexes were shown to be effective in producing aerosols suitable for deep lung deposition for both pMDI formulations (fine particle fraction of 50-53%) and DPI formulations (fine particle fraction of 39%) with no impact on the in vitro gene knockdown efficiency of the siRNA. This work demonstrates the potential benefits of utilizing TPP-conjugated dendrimers in the formation of dendriplexes for siRNA delivery to the pulmonary epithelium and their aerosol formulation for local delivery to the lungs using portable inhalers. Copyright © 2017 Elsevier B.V. All rights reserved.
-
Ciccarelli, Carmela; Marampon, Francesco; Scoglio, Arianna; Mauro, Annunziata; Giacinti, Cristina; De Cesaris, Paola; Zani, Bianca M
2005-01-01
Background p21WAF1, implicated in the cell cycle control of both normal and malignant cells, can be induced by p53-dependent and independent mechanisms. In some cells, MEKs/ERKs regulate p21WAF1 transcriptionally, while in others they also affect the post-transcriptional processes. In myogenic differentiation, p21WAF1 expression is also controlled by the myogenic transcription factor MyoD. We have previously demonstrated that the embryonal rhabdomyosarcoma cell line undergoes growth arrest and myogenic differentiation following treatments with TPA and the MEK inhibitor U0126, which respectively activate and inhibit the ERK pathway. In this paper we attempt to clarify the mechanism of ERK-mediated and ERK-independent growth arrest and myogenic differentiation of embryonal and alveolar rhabdomyosarcoma cell lines, particularly as regards the expression of the cell cycle inhibitor p21WAF1. Results p21WAF1 expression and growth arrest are induced in both embryonal (RD) and alveolar (RH30) rhabdomyosarcoma cell lines following TPA or MEK/ERK inhibitor (U0126) treatments, whereas myogenic differentiation is induced in RD cells alone. Furthermore, the TPA-mediated post-transcriptional mechanism of p21WAF1-enhanced expression in RD cells is due to activation of the MEK/ERK pathway, as shown by transfections with constitutively active MEK1 or MEK2, which induces p21WAF1 expression, and with ERK1 and ERK2 siRNA, which prevents p21WAF1 expression. By contrast, U0126-mediated p21WAF1 expression is controlled transcriptionally by the p38 pathway. Similarly, myogenin and MyoD expression is induced both by U0126 and TPA and is prevented by p38 inhibition. Although MyoD and myogenin depletion by siRNA prevents U0126-mediated p21WAF1 expression, the over-expression of these two transcription factors is insufficient to induce p21WAF1. These data suggest that the transcriptional mechanism of p21WAF1 expression in RD cells is rescued when MEK/ERK inhibition relieves the functions of myogenic transcription factors. Notably, the forced expression of p21WAF1 in RD cells causes growth arrest and the reversion of anchorage-independent growth. Conclusion Our data provide evidence of the key role played by the MEK/ERK pathway in the growth arrest of Rhabdomyosarcoma cells. The results of this study suggest that the targeting of MEK/ERKs to rescue p21WAF1 expression and myogenic transcription factor functions leads to the reversal of the Rhabdomyosarcoma phenotype. PMID:16351709
-
Ciccarelli, Carmela; Marampon, Francesco; Scoglio, Arianna; Mauro, Annunziata; Giacinti, Cristina; De Cesaris, Paola; Zani, Bianca M
2005-12-13
p21WAF1, implicated in the cell cycle control of both normal and malignant cells, can be induced by p53-dependent and independent mechanisms. In some cells, MEKs/ERKs regulate p21WAF1 transcriptionally, while in others they also affect the post-transcriptional processes. In myogenic differentiation, p21WAF1 expression is also controlled by the myogenic transcription factor MyoD. We have previously demonstrated that the embryonal rhabdomyosarcoma cell line undergoes growth arrest and myogenic differentiation following treatments with TPA and the MEK inhibitor U0126, which respectively activate and inhibit the ERK pathway. In this paper we attempt to clarify the mechanism of ERK-mediated and ERK-independent growth arrest and myogenic differentiation of embryonal and alveolar rhabdomyosarcoma cell lines, particularly as regards the expression of the cell cycle inhibitor p21WAF1. p21WAF1 expression and growth arrest are induced in both embryonal (RD) and alveolar (RH30) rhabdomyosarcoma cell lines following TPA or MEK/ERK inhibitor (U0126) treatments, whereas myogenic differentiation is induced in RD cells alone. Furthermore, the TPA-mediated post-transcriptional mechanism of p21WAF1-enhanced expression in RD cells is due to activation of the MEK/ERK pathway, as shown by transfections with constitutively active MEK1 or MEK2, which induces p21WAF1 expression, and with ERK1 and ERK2 siRNA, which prevents p21WAF1 expression. By contrast, U0126-mediated p21WAF1 expression is controlled transcriptionally by the p38 pathway. Similarly, myogenin and MyoD expression is induced both by U0126 and TPA and is prevented by p38 inhibition. Although MyoD and myogenin depletion by siRNA prevents U0126-mediated p21WAF1 expression, the over-expression of these two transcription factors is insufficient to induce p21WAF1. These data suggest that the transcriptional mechanism of p21WAF1 expression in RD cells is rescued when MEK/ERK inhibition relieves the functions of myogenic transcription factors. Notably, the forced expression of p21WAF1 in RD cells causes growth arrest and the reversion of anchorage-independent growth. Our data provide evidence of the key role played by the MEK/ERK pathway in the growth arrest of Rhabdomyosarcoma cells. The results of this study suggest that the targeting of MEK/ERKs to rescue p21WAF1 expression and myogenic transcription factor functions leads to the reversal of the Rhabdomyosarcoma phenotype.
-
Takahashi, Hironobu; Wang, Yuwei; Grainger, David W
2010-11-01
Fibrous encapsulation of surgically implanted devices is associated with elevated proliferation and activation of fibroblasts in tissues surrounding these implants, frequently causing foreign body complications. Here we test the hypothesis that inhibition of the expression of mammalian target of rapamycin (mTOR) in fibroblasts can mitigate the soft tissue implant foreign body response by suppressing fibrotic responses around implants. In this study, mTOR was knocked down using small interfering RNA (siRNA) conjugated with branched polyethylenimine (bPEI) in fibroblastic lineage cells in serum-based cell culture as shown by both gene and protein analysis. This mTOR knock-down led to an inhibition in fibroblast proliferation by 70% and simultaneous down-regulation in the expression of type I collagen in fibroblasts in vitro. These siRNA/bPEI complexes were released from poly(ethylene glycol) (PEG)-based hydrogel coatings surrounding model polymer implants in a subcutaneous rodent model in vivo. No significant reduction in fibrous capsule thickness and mTOR expression in the foreign body capsules were observed. The siRNA inefficacy in this in vivo implant model was attributed to siRNA dosing limitations in the gel delivery system, and lack of targeting ability of the siRNA complex specifically to fibroblasts. While in vitro data supported mTOR knock-down in fibroblast cultures, in vivo siRNA delivery must be further improved to produce clinically relevant effects on fibrotic encapsulation around implants. Copyright © 2010 Elsevier B.V. All rights reserved.
-
Wang, Shouyu; Xu, Hong; Zou, Lifang; Xie, Jinyang; Wu, Hong; Wu, Bing; Yi, Zhihua; Lv, Qiulan; Zhang, Xi; Ying, Mofeng; Liu, Shuangmei; Li, Guilin; Gao, Yun; Xu, Changshui; Zhang, Chunping; Xue, Yun; Liang, Shangdong
2016-03-01
Some long non-coding RNAs (lncRNAs) participate in physiological processes that maintain cellular and tissue homeostasis, and thus, the dysregulated expression of lncRNAs is involved in the onset and progression of many pathological conditions. Research has indicated that the genetic knockout of some lncRNAs in mice resulted in peri- or postnatal lethality or developmental defects. Diabetes mellitus (DM) is a major cause of peripheral neuropathy. Our studies showed that the expression levels of lncRNA uc.48+ in the diabetic rat dorsal root ganglia (DRG) and the DM patients' serum samples were increased. It suggested that lncRNA uc.48+ was involved in the pathophysiological process of DM. The aim of this study was to investigate the effects of lncRNA uc.48+ small interfering RNA (siRNA) on diabetic neuropathic pain (DNP) mediated by the P2X3 receptor in the DRG. The values of the mechanical withdrawal threshold (MWT) and thermal withdrawal latency (TWL) were measured by the von Frey test and Hargreaves' test, respectively. The levels of P2X3 protein and messenger RNA (mRNA) in the DRG were detected by reverse transcription-polymerase chain reaction (RT-PCR), immunohistochemistry, and western blotting. The experiments showed that the MWT and TWL values in DM rats were lower than those in the control rats. The MWT and TWL values in DM rats treated with lncRNA uc.48+ siRNA were increased compared to those in DM rats, but there was no significant difference between the DM rat group and the DM + scramble siRNA group. The levels of P2X3 protein and mRNA in the DM DRG were higher than those in the control, while the levels of P2X3 protein and mRNA in the DG of DM rats treated with uc.48+ siRNA were significantly decreased compared to those in DM rats. The expression levels of TNF-α in the DRG of DM rats treated with uc.48+ siRNA were significantly decreased compared to those in the DM group. The phosphorylation and activation of ERK1/2 in the DM DRG were decreased by uc.48+ siRNA treatment. Therefore, uc.48+ siRNA treatment may alleviate the DNP by inhibiting the excitatory transmission mediated by the P2X3 receptor in DRG.
-
Kyrychenko, Sergii; Tishkin, Sergey; Dosenko, Victor; Ivanova, Irina; Novokhatska, Tatiana; Soloviev, Anatoly
2012-01-01
It is likely that large-conductance Ca²⁺-activated K⁺ (BK(Ca)) channels channelopathy tightly involved in vascular malfunctions and arterial hypertension development. In the present study, we compared the results of siRNAs-induced α-BK(Ca) gene silencing and vascular abnormalities produced by whole-body ionized irradiation in rats. The experimental design comprised RT-PCR and patch clamp technique, thoracic aorta smooth muscle (SM) contractile recordings and arterial blood pressure (BP) measurements on the 30th day after whole body irradiation (6Gy) and following siRNAs KCNMA1 gene silencing in vivo. The expression profile of BK(Ca) mRNA transcripts in SM was significantly decreased in siRNAs-treated rats in a manner similar to irradiated SM. In contrast, the mRNA levels of K(v) and K(ATP) were significantly increased while L-type calcium channels mRNA transcripts demonstrated tendency to increment. The SMCs obtained from irradiated animals and after KCNMA1 gene silencing showed a significant decrease in total K⁺ current density amplitude. Paxilline (500 nM)-sensitive components of outward current were significantly decreased in both irradiated and gene silencing SMCs. KCNMA1 gene silencing increased SM sensitivity to norepinephrine while Ach-induced relaxation had decreased. The silencing of KCNMA1 had no significant effect on BP while radiation produced sustained arterial hypertension. Therefore, radiation alters the form and function of the BK(Ca) channel and this type of channelopathy may contribute to related vascular abnormalities. Nevertheless, it is unlikely that BK(Ca) can operate as a crucial factor for radiation-induced arterial hypertension. Copyright © 2012 Elsevier Inc. All rights reserved.
-
Expression of a non-coding RNA in ectromelia virus is required for normal plaque formation.
Esteban, David J; Upton, Chris; Bartow-McKenney, Casey; Buller, R Mark L; Chen, Nanhai G; Schriewer, Jill; Lefkowitz, Elliot J; Wang, Chunlin
2014-02-01
Poxviruses are dsDNA viruses with large genomes. Many genes in the genome remain uncharacterized, and recent studies have demonstrated that the poxvirus transcriptome includes numerous so-called anomalous transcripts not associated with open reading frames. Here, we characterize the expression and role of an apparently non-coding RNA in orthopoxviruses, which we call viral hairpin RNA (vhRNA). Using a bioinformatics approach, we predicted expression of a transcript not associated with an open reading frame that is likely to form a stem-loop structure due to the presence of a 21 nt palindromic sequence. Expression of the transcript as early as 2 h post-infection was confirmed by northern blot and analysis of publicly available vaccinia virus infected cell transcriptomes. The transcription start site was determined by RACE PCE and transcriptome analysis, and early and late promoter sequences were identified. Finally, to test the function of the transcript we generated an ectromelia virus knockout, which failed to form plaques in cell culture. The important role of the transcript in viral replication was further demonstrated using siRNA. Although the function of the transcript remains unknown, our work contributes to evidence of an increasingly complex poxvirus transcriptome, suggesting that transcripts such as vhRNA not associated with an annotated open reading frame can play an important role in viral replication.
-
Oya, Eriko; Kato, Hiroaki; Chikashige, Yuji; Tsutsumi, Chihiro; Hiraoka, Yasushi; Murakami, Yota
2013-01-01
Heterochromatin at the pericentromeric repeats in fission yeast is assembled and spread by an RNAi-dependent mechanism, which is coupled with the transcription of non-coding RNA from the repeats by RNA polymerase II. In addition, Rrp6, a component of the nuclear exosome, also contributes to heterochromatin assembly and is coupled with non-coding RNA transcription. The multi-subunit complex Mediator, which directs initiation of RNA polymerase II-dependent transcription, has recently been suggested to function after initiation in processes such as elongation of transcription and splicing. However, the role of Mediator in the regulation of chromatin structure is not well understood. We investigated the role of Mediator in pericentromeric heterochromatin formation and found that deletion of specific subunits of the head domain of Mediator compromised heterochromatin structure. The Mediator head domain was required for Rrp6-dependent heterochromatin nucleation at the pericentromere and for RNAi-dependent spreading of heterochromatin into the neighboring region. In the latter process, Mediator appeared to contribute to efficient processing of siRNA from transcribed non-coding RNA, which was required for efficient spreading of heterochromatin. Furthermore, the head domain directed efficient transcription in heterochromatin. These results reveal a pivotal role for Mediator in multiple steps of transcription-coupled formation of pericentromeric heterochromatin. This observation further extends the role of Mediator to co-transcriptional chromatin regulation.
-
Polo-like kinase 1, a new therapeutic target in hepatocellular carcinoma
Mok, Wei Chuen; Wasser, Shanthi; Tan, Theresa; Lim, Seng Gee
2012-01-01
AIM: To investigate the role of polo-like kinase 1 (PLK1) as a therapeutic target for hepatocellular carcinoma (HCC). METHODS: PLK1 gene expression was evaluated in HCC tissue and HCC cell lines. Gene knockdown with short-interfering RNA (siRNA) was used to study PLK1 gene and protein expression using real-time reverse transcription polymerase chain reaction (RT-PCR) and Western blotting, and cell proliferation using 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2(4-sulfophenyl)-2H-tetrazolium (MTS) and bromodeoxyuridine (BrdU) assays. Apoptosis was evaluated using the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay, and caspase-inhibition assay. Huh-7 cells were transplanted into nude mice and co-cultured with PLK1 siRNA or control siRNA, and tumor progression was compared with controls. RESULTS: RT-PCR showed that PLK1 was overexpressed 12-fold in tumor samples compared with controls, and also was overexpressed in Huh-7 cells. siRNA against PLK1 showed a reduction in PLK1 gene and protein expression of up to 96% in Huh-7 cells, and a reduction in cell proliferation by 68% and 92% in MTS and BrdU cell proliferation assays, respectively. There was a 3-fold increase in apoptosis events, and TUNEL staining and caspase-3 assays suggested that this was caspase-independent. The pan-caspase inhibitor Z-VAD-FMK was unable to rescue the apoptotic cells. Immnofluorescence co-localized endonuclease-G to fragmented chromosomes, implicating it in apoptosis. Huh-7 cells transplanted subcutaneously into nude mice showed tumor regression in siPLK1-treated mice, but not in controls. CONCLUSION: Knockdown of PLK1 overexpression in HCC was shown to be a potential therapeutic target, leading to apoptosis through the endonuclease-G pathway. PMID:22826617
-
George, Joseph; Banik, Naren L.; Ray, Swapan K.
2011-01-01
Human telomerase reverse transcriptase (hTERT) is the catalytic component of telomerase that facilitates tumor cell invasion and proliferation. Telomerase and hTERT are remarkably upregulated in majority of cancers including glioblastoma. Interferon-gamma (IFN-γ) modulates several cellular activities including cell cycle and multiplication through transcriptional regulation. The present investigation was designed to unravel the molecular mechanisms of the inhibition of cell proliferation, migration, and invasion of human glioblastoma SNB-19 and LN-18 cell lines after knockdown of hTERT using a plasmid vector based siRNA and concurrent treatment with IFN-γ. We observed more than 80% inhibition of cell proliferation, migration, and invasion of both cell lines after the treatment with combination of hTERT siRNA and IFN-γ. Our studies also showed accumulation of apoptotic cells in subG1 phase and an increase in cell population in G0/G1 with a reduction in G2/M phase indicating cell cycle arrest in G0/G1 phase for apoptosis. Semiquantitative and real-time RT-PCR analyses demonstrated significant downregulation of c- Myc and upregulation of p21 Waf1 and p27 Kip1. Western blotting confirmed the downregulation of the molecules involved in cell proliferation, migration, and invasion and also showed upregulation of cell cycle inhibitors. In conclusion, our study demonstrated that knockdown of hTERT siRNA and concurrent treatment with IFN-γ effectively inhibited cell proliferation, migration, and invasion in glioblastoma cells through downregulation of the molecules involved in these processes and cell cycle inhibition. Therefore, the combination of hTERT siRNA and IFN-γ offers a potential therapeutic strategy for controlling growth of human glioblastoma cells. PMID:20394835
-
George, Joseph; Banik, Naren L.; Ray, Swapan K.
2009-01-01
Purpose The limitless invasive and proliferative capacities of tumor cells are associated with telomerase and expression of its catalytic component, human telomerase reverse transcriptase (hTERT). Interferon-γ (IFN-γ) modulates several cellular activities including signaling pathways and cell cycle through transcriptional regulation. Experimental Design Using a recombinant plasmid with hTERT siRNA cDNA, we down regulated hTERT during IFN-γ treatment in human glioblastoma SNB-19 and LN-18 cell lines and examined whether such a combination could inhibit angiogenesis and tumor growth in nude mice. In vitro angiogenesis assay was performed using co-culture of tumor cells with human microvascular endothelial cells. In vivo angiogenesis assay was performed using diffusion chambers under the dorsal skin of nude mice. In vivo imaging of intracerebral tumorigenesis and longitudinal solid tumor development studies were conducted in nude mice. Results In vitro and in vivo angiogenesis assays demonstrated inhibition of capillary-like network formation of microvascular endothelial cells and neovascularization under dorsal skin of nude mice, respectively. We observed inhibition of intracerebral tumorigenesis and subcutaneous solid tumor formation in nude mice after treatment with combination of hTERT siRNA and IFN-γ. Western blotting of solid tumor samples demonstrated significant down regulation of the molecules that regulate cell invasion, angiogenesis, and tumor progression. Conclusions Our study demonstrated that combination of hTERT siRNA and IFN-γ effectively inhibited angiogenesis and tumor progression through down regulation of molecules involved in these processes. Therefore, combination of hTERT siRNA and IFN-γ is a promising therapeutic strategy for controlling growth of human glioblastoma. PMID:19934306
-
Hsc70 facilitates TGF-β-induced activation of Smad2/3 in fibroblastic NRK-49F cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ikezaki, Midori; Higashimoto, Natsuki; Matsumura, Ko
Heat-shock cognate protein 70 (Hsc70), a molecular chaperone constitutively expressed in the cell, is involved in the regulation of several cellular signaling pathways. In this study, we found that TGF-β-induced phosphorylation and nuclear translocation of Smad2/3 were suppressed in fibroblastic NRK-49F cells treated with small interfering RNA (siRNA) for Hsc70. In the cells underexpressing Hsc70, transcriptional induction of connective tissue growth factor (CTGF), a target gene of the TGF-β signaling, was also suppressed in the early phase of TGF-β stimulation. Upon stimulation with TGF-β, Hsc70 interacted with Smad2/3, suggesting functional interactions of Hsc70 and Smad2/3 for the activation of TGF-β-inducedmore » Smad signaling. Although the expression of heat-shock protein 70 (Hsp70) was upregulated in the cells treated with Hsc70 siRNA, TGF-β-induced Smad activation was not affected in the cells overexpressing Hsp70. Collectively, these results indicate that Hsc70, but not Hsp70, supportively regulates TGF-β-induced Smad signaling in NRK-49F cells. - Highlights: • Hsc70 siRNA treatment suppressed the expression of Hsc70 but induced the expression of Hsp70 in NRK-49F cells. • Hsc70 siRNA treatment suppressed the activation of Smad2/3 in the cells treated with TGF-β. • Hsc70 interacted with Smad2/3 on stimulation with TGF-β in the cells. • Hsp70 did not influence the TGF-β-induced activation of Smad2/3 in the cells overexpressing Hsp70.« less
-
Human organotypic retinal flat-mount culture (HORFC) as a model for retinitis pigmentosa11.
Azizzadeh Pormehr, Leila; Daftarian, Narsis; Ahmadian, Shahin; Rezaei Kanavi, Mozhgan; Ahmadieh, Hamid; Shafiezadeh, Mahshid
2018-05-10
The splicing factor PRPF31 is the most commonly mutated general splicing factor in the retinitis pigmentosa. We used a rapid, convenient and cost effective transfection method with an efficient PRPF31 knockdown in HORFC in order to study the effect of PRPF31 downregulation on retinal gene expressions in an ex vivo model. Modified calcium phosphate method was used to transfect HORFC by PRPF31 siRNA. Different times and doses of siRNA for transfection were assayed and optimum condition was obtained. PRPF31 mRNA and protein downregulation were assessed by qRTPCR and Western blot. The tissue viability of HORFC was measured using the MTT. ImageJ analysis on stained retinal sections by immunohistochemistry was used for thickness measurement of outer nuclear photoreceptor layer. The PRPF31 gene downregulation effects on retinal specific gene expression were analyzed by qRTPCR. A total of 50 nM of PRPF31 siRNA transfection after 63 h in HORFC, showed the optimum reduction in the level of PRPF31 mRNA and protein as shown by qRTPCR and Western blot (over 90% and 50% respectively). The PRPF31 mRNA silencing with calcium phosphate had no effect on cell viability in the period of the experiment. Thickness measurement of outer nuclear photoreceptor layer with IHC showed the significant reduction after 63 h of study (P value = 0.02). siRNA induced PRPF31 knockdown, led to reduction of retinal specific mRNA gene expression involved in phototransduction (RHO, GNAT1, RP1), photoreceptor structure (ROM1, FSCN2, CA4, SEMA4) and transcription factor (CRX) (fold change >5), after 63 h. © 2018 Wiley Periodicals, Inc.
-
Role of IKKalpha in the EGFR Signaling Regulation
2012-09-01
Stem Cell Biology Epithelial– Mesenchymal Transition Induced by TNF-a Requires NF-kB–Mediated Transcriptional Upregulation of Twist1 Chia-Wei Li1, Weiya... mesenchymal markers in MCF10A-p65 cells with Twist1 siRNA. D, abrogation of p65- mediated cancer stem cell population by Twist1 suppression. E...Mani SA, Guo W, Liao MJ, Eaton EN, Ayyanan A, Zhou AY, et al. The epithelial- mesenchymal transition generates cells with properties of stem cells . Cell
-
ERIC Educational Resources Information Center
McNulty, Susan E.; Barrett, Ruth M.; Vogel-Ciernia, Annie; Malvaez, Melissa; Hernandez, Nicole; Davatolhagh, M. Felicia; Matheos, Dina P.; Schiffman, Aaron; Wood, Marcelo A.
2012-01-01
"Nr4a1" and "Nr4a2" are transcription factors and immediate early genes belonging to the nuclear receptor Nr4a family. In this study, we examine their role in long-term memory formation for object location and object recognition. Using siRNA to block expression of either "Nr4a1" or "Nr4a2", we found that "Nr4a2" is necessary for both long-term…
-
Nonproteolytic Roles of 19S ATPases in Transcription of CIITApIV Genes
Maganti, Nagini; Moody, Tomika D.; Truax, Agnieszka D.; Thakkar, Meghna; Spring, Alexander M.; Germann, Markus W.; Greer, Susanna F.
2014-01-01
Accumulating evidence shows the 26S proteasome is involved in the regulation of gene expression. We and others have demonstrated that proteasome components bind to sites of gene transcription, regulate covalent modifications to histones, and are involved in the assembly of activator complexes in mammalian cells. The mechanisms by which the proteasome influences transcription remain unclear, although prior observations suggest both proteolytic and non-proteolytic activities. Here, we define novel, non-proteolytic, roles for each of the three 19S heterodimers, represented by the 19S ATPases Sug1, S7, and S6a, in mammalian gene expression using the inflammatory gene CIITApIV. These 19S ATPases are recruited to induced CIITApIV promoters and also associate with CIITA coding regions. Additionally, these ATPases interact with elongation factor PTEFb complex members CDK9 and Hexim-1 and with Ser5 phosphorylated RNA Pol II. Both the generation of transcripts from CIITApIV and efficient recruitment of RNA Pol II to CIITApIV are negatively impacted by siRNA mediated knockdown of these 19S ATPases. Together, these results define novel roles for 19S ATPases in mammalian gene expression and indicate roles for these ATPases in promoting transcription processes. PMID:24625964
-
Pang, Jinke; Zhang, Geng; Lin, Yong; Xie, Zhanglian; Liu, Hongyan; Tang, Libo; Lu, Mengji; Yan, Ran; Guo, Haitao; Sun, Jian; Hou, Jinlin; Zhang, Xiaoyong
2017-01-03
Hepatitis B Virus (HBV) replication in hepatocytes is restricted by the host innate immune system and related intracellular signaling pathways. Transforming growth factor β-activated kinase 1 (TAK1) is a key mediator of toll-like receptors and pro-inflammatory cytokine signaling pathways. Here, we report that silencing or inhibition of endogenous TAK1 in hepatoma cell lines leads to an upregulation of HBV replication, transcription, and antigen expression. In contrast, overexpression of TAK1 significantly suppresses HBV replication, while an enzymatically inactive form of TAK1 exerts no effect. By screening TAK1-associated signaling pathways with inhibitors and siRNAs, we found that the MAPK-JNK pathway was involved in TAK1-mediated HBV suppression. Moreover, TAK1 knockdown or JNK pathway inhibition induced the expression of farnesoid X receptor α, a transcription factor that upregulates HBV transcription. Finally, ectopic expression of TAK1 in a HBV hydrodynamic injection mouse model resulted in lower levels of HBV DNA and antigens in both liver and serum. In conclusion, our data suggest that TAK1 inhibits HBV primarily at viral transcription level through activation of MAPK-JNK pathway, thus TAK1 represents an intrinsic host restriction factor for HBV replication in hepatocytes.
-
Marasco, Michelle; Li, Weiyi; Lynch, Michael
2017-01-01
Abstract All eukaryotes have three essential nuclear multisubunit RNA polymerases, abbreviated as Pol I, Pol II and Pol III. Plants are remarkable in having two additional multisubunit RNA polymerases, Pol IV and Pol V, which synthesize noncoding RNAs that coordinate RNA-directed DNA methylation for silencing of transposons and a subset of genes. Based on their subunit compositions, Pols IV and V clearly evolved as specialized forms of Pol II, but their catalytic properties remain undefined. Here, we show that Pols IV and V differ from one another, and Pol II, in nucleotide incorporation rate, transcriptional accuracy and the ability to discriminate between ribonucleotides and deoxyribonucleotides. Pol IV transcription is considerably more error-prone than Pols II or V, which may be tolerable in its synthesis of short RNAs that serve as precursors for siRNAs targeting non-identical members of transposon families. By contrast, Pol V exhibits high fidelity transcription, similar to Pol II, suggesting a need for Pol V transcripts to faithfully reflect the DNA sequence of target loci to which siRNA–Argonaute silencing complexes are recruited. PMID:28977461
-
Fan, Yu; Wang, Ye; Wang, Ke
2015-12-18
Cyclooxygenase-2-derived prostaglandin E2 (PGE2), a bioactive eicosanoid, has been implicated in many biological processes including reproduction, inflammation and tumor growth. We previously showed that PGE2 stimulated lung cancer cell growth and progression through PGE2 receptor EP2/EP4-mediated kinase signaling pathways. However, the role of PGE2 in controlling lung airway epithelial cell phenotype remains unknown. We evaluated the effects of c-Jun and 3-phosphoinositede dependent protein kinase-1 (PDK1) in mediating epithelial cell hyperplasia induced by PGE2. The bronchial epithelial cell lines BEAS-2B and HBEc14-KT were cultured and then treated with PGE2. PDK1 small interfering RNA (siRNA) and a PDK1 inhibitor, an antagonist of the PGE2 receptor subtype EP4 and EP4 siRNA, c-Jun siRNA, and overexpressions of c-Jun and PDK1 have been used to evaluate the effects on cell proliferation. We demonstrated that PGE2 increased normal bronchial epithelial cell proliferation through induction of PDK1, an ankyrin repeat-containing Ser/Thr kinase implicated in the induction of apoptosis and the suppression of tumor growth. PDK1 siRNA and a PDK1 inhibitor blocked the effects of PGE2 on normal cell growth. The PGE2-induced PDK1 expression was blocked by an antagonist of the PGE2 receptor subtype EP4 and by EP4 siRNA. In addition, we showed that induction of PDK1 by PGE2 was associated with induction of the transcription factor, c-Jun protein. Silencing of c-Jun using siRNA and point mutations of c-Jun sites in the PDK1 gene promoter resulted in blockade of PDK1 expression and promoter activity induced by PGE2. In contrast, overexpression of c-Jun induced PDK1 gene promoter activity and expression followed increased cell proliferation. PGE2 increases normal bronchial epithelial cell proliferation through increased PDK1 gene expression that is dependent on EP4 and induction of c-Jun. Therewith, our data suggest a new role of c-Jun and PDK1 in mediating epithelial cell hyperplasia induced by PGE2.
-
Su, Wen-Pin; Cheng, Fong-Yu; Shieh, Dar-Bin; Yeh, Chen-Sheng; Su, Wu-Chou
2012-01-01
Background: Effective cancer chemotherapy remains an important issue in cancer treatment, and signal transducer and activator of transcription-3 (Stat3) activation leads to cellular resistance of anticancer agents. Polymers are ideal vectors to carry both chemotherapeutics and small interfering ribonucleic acid (siRNA) to enhance antitumor efficacy. In this paper, poly(lactic-co-glycolic acid) (PLGA) nanoparticles loaded with paclitaxel and Stat3 siRNA were successfully synthesized, and their applications in cancer cells were investigated. Methods: Firstly, paclitaxel was enclosed by PLGA nanoparticles through solvent evaporation. They were then coated with cationic polyethylenimine polymer (PLGA-PEI-TAX), enabling it to carry Stat3 siRNA on its surface through electrostatic interactions (PLGA-PEI-TAX-S3SI). The size, zeta potential, deliver efficacy, and release profile of the PLGA nanocomplexes were characterized in vitro. The cellular uptake, intracellular nanoparticle trajectory, and subsequent cellular events were evaluated after treatment with various PLGA nanocomplexes in human lung cancer A549 cells and A549-derived paclitaxel-resistant A549/T12 cell lines with α-tubulin mutation. Results: A549 and A549/T12 cells contain constitutively activated Stat3, and silencing Stat3 by siRNA made both cancer cells more sensitive to paclitaxel. Therefore, PLGA-PEI-TAX-S3SI was synthesized to test its therapeutic role in A549 and A549/T12 cells. Transmission electron microscopy showed the size of PLGA-PEI-TAX-S3SI to be around 250 nm. PLGA-PEI nanoparticles were nontoxic. PLGA-PEI-TAX was taken up by A549 and A549/T12 cells more than free paclitaxel, and they induced more condensed microtubule bundles and had higher cytotoxicity in these cancer cells. Moreover, the yellowish fluorescence observed in the cytoplasm of the cancer cells indicates that the PLGA-PEI nanoparticles were still simultaneously delivering Oregon Green paclitaxel and cyanine-5-labeled Stat3 siRNA 3 hours after treatment. Furthermore, after the cancer cells were incubated with the synthesized PLGA nanocomplexes, PLGA-PEI-TAX-S3SI suppressed Stat3 expression and induced more cellular apoptosis in A549 and A549/T12 cells compared with PLGA-PEI-TAX. Conclusion: The PLGA-PEI-TAX-S3SI complex provides a new therapeutic strategy to control cancer cell growth. PMID:22904633
-
Miesen, Pascal; Ivens, Alasdair; Buck, Amy H; van Rij, Ronald P
2016-02-01
In Aedes mosquitoes, infections with arthropod-borne viruses (arboviruses) trigger or modulate the expression of various classes of viral and host-derived small RNAs, including small interfering RNAs (siRNAs), PIWI interacting RNAs (piRNAs), and microRNAs (miRNAs). Viral siRNAs are at the core of the antiviral RNA interference machinery, one of the key pathways that limit virus replication in invertebrates. Besides siRNAs, Aedes mosquitoes and cells derived from these insects produce arbovirus-derived piRNAs, the best studied examples being viruses from the Togaviridae or Bunyaviridae families. Host miRNAs modulate the expression of a large number of genes and their levels may change in response to viral infections. In addition, some viruses, mostly with a DNA genome, express their own miRNAs to regulate host and viral gene expression. Here, we perform a comprehensive analysis of both viral and host-derived small RNAs in Aedes aegypti Aag2 cells infected with dengue virus 2 (DENV), a member of the Flaviviridae family. Aag2 cells are competent in producing all three types of small RNAs and provide a powerful tool to explore the crosstalk between arboviral infection and the distinct RNA silencing pathways. Interestingly, besides the well-characterized DENV-derived siRNAs, a specific population of viral piRNAs was identified in infected Aag2 cells. Knockdown of Piwi5, Ago3 and, to a lesser extent, Piwi6 results in reduction of vpiRNA levels, providing the first genetic evidence that Aedes PIWI proteins produce DENV-derived small RNAs. In contrast, we do not find convincing evidence for the production of virus-derived miRNAs. Neither do we find that host miRNA expression is strongly changed upon DENV2 infection. Finally, our deep-sequencing analyses detect 30 novel Aedes miRNAs, complementing the repertoire of regulatory small RNAs in this important vector species.
-
Miesen, Pascal; Ivens, Alasdair; Buck, Amy H.; van Rij, Ronald P.
2016-01-01
In Aedes mosquitoes, infections with arthropod-borne viruses (arboviruses) trigger or modulate the expression of various classes of viral and host-derived small RNAs, including small interfering RNAs (siRNAs), PIWI interacting RNAs (piRNAs), and microRNAs (miRNAs). Viral siRNAs are at the core of the antiviral RNA interference machinery, one of the key pathways that limit virus replication in invertebrates. Besides siRNAs, Aedes mosquitoes and cells derived from these insects produce arbovirus-derived piRNAs, the best studied examples being viruses from the Togaviridae or Bunyaviridae families. Host miRNAs modulate the expression of a large number of genes and their levels may change in response to viral infections. In addition, some viruses, mostly with a DNA genome, express their own miRNAs to regulate host and viral gene expression. Here, we perform a comprehensive analysis of both viral and host-derived small RNAs in Aedes aegypti Aag2 cells infected with dengue virus 2 (DENV), a member of the Flaviviridae family. Aag2 cells are competent in producing all three types of small RNAs and provide a powerful tool to explore the crosstalk between arboviral infection and the distinct RNA silencing pathways. Interestingly, besides the well-characterized DENV-derived siRNAs, a specific population of viral piRNAs was identified in infected Aag2 cells. Knockdown of Piwi5, Ago3 and, to a lesser extent, Piwi6 results in reduction of vpiRNA levels, providing the first genetic evidence that Aedes PIWI proteins produce DENV-derived small RNAs. In contrast, we do not find convincing evidence for the production of virus-derived miRNAs. Neither do we find that host miRNA expression is strongly changed upon DENV2 infection. Finally, our deep-sequencing analyses detect 30 novel Aedes miRNAs, complementing the repertoire of regulatory small RNAs in this important vector species. PMID:26914027
-
2011-01-01
Background Small RNA (sRNA) regulatory pathways (SRRPs) are important to anti-viral defence in mosquitoes. To identify critical features of the virus infection process in Dengue serotype 2 (DENV2)-infected Ae. aegypti, we deep-sequenced small non-coding RNAs. Triplicate biological replicates were used so that rigorous statistical metrics could be applied. Results In addition to virus-derived siRNAs (20-23 nts) previously reported for other arbovirus-infected mosquitoes, we show that PIWI pathway sRNAs (piRNAs) (24-30 nts) and unusually small RNAs (usRNAs) (13-19 nts) are produced in DENV-infected mosquitoes. We demonstrate that a major catalytic enzyme of the siRNA pathway, Argonaute 2 (Ago2), co-migrates with a ~1 megadalton complex in adults prior to bloodfeeding. sRNAs were cloned and sequenced from Ago2 immunoprecipitations. Viral sRNA patterns change over the course of infection. Host sRNAs were mapped to the published aedine transcriptome and subjected to analysis using edgeR (Bioconductor). We found that sRNA profiles are altered early in DENV2 infection, and mRNA targets from mitochondrial, transcription/translation, and transport functional categories are affected. Moreover, small non-coding RNAs (ncRNAs), such as tRNAs, spliceosomal U RNAs, and snoRNAs are highly enriched in DENV-infected samples at 2 and 4 dpi. Conclusions These data implicate the PIWI pathway in anti-viral defense. Changes to host sRNA profiles indicate that specific cellular processes are affected during DENV infection, such as mitochondrial function and ncRNA levels. Together, these data provide important progress in understanding the DENV2 infection process in Ae. aegypti. PMID:21356105
-
Dong, Lijie; Nian, Hong; Shao, Yan; Zhang, Yan; Li, Qiutang; Yi, Yue; Tian, Fang; Li, Wenbo; Zhang, Hong; Zhang, Xiaomin; Wang, Fei; Li, Xiaorong
2015-05-01
Pathological retinal neovascularization, including retinopathy of prematurity and age-related macular degeneration, is the most common cause of blindness worldwide. Insulin-like growth factor-1 (IGF-1) has a direct mitogenic effect on endothelial cells, which is the basis of angiogenesis. Vascular endothelial growth factor (VEGF) activation in response to IGF-1 is well documented; however, the molecular mechanisms responsible for the termination of IGF-1 signaling are still not completely elucidated. Here, we show that the polypyrimidine tract-binding protein-associated splicing factor (PSF) is a potential negative regulator of VEGF expression induced by IGF stimulation. Functional analysis demonstrated that ectopic expression of PSF inhibits IGF-1-stimulated transcriptional activation and mRNA expression of the VEGF gene, whereas knockdown of PSF increased IGF-1-stimulated responses. PSF recruited Hakai to the VEGF transcription complex, resulting in inhibition of IGF-1-mediated transcription. Transfection with Hakai siRNA reversed the PSF-mediated transcriptional repression of VEGF gene transcription. In summary, these results show that PSF can repress the transcriptional activation of VEGF stimulated by IGF-1 via recruitment of the Hakai complex and delineate a novel regulatory mechanism of IGF-1/VEGF signaling that may have implications in the pathogenesis of neovascularization in ocular diseases.
-
Ke, Rui; Liu, Lu; Zhu, Yanting; Li, Shaojun; Xie, Xinming; Li, Fangwei; Song, Yang; Yang, Lan; Gao, Li; Li, Manxiang
2016-01-01
It has been shown that activation of adenosine monophosphate-activated protein kinase (AMPK) suppresses proliferation of a variety of tumor cells as well as nonmalignant cells. In this study, we used post-transcriptional gene silencing with small interfering RNA (siRNA) to specifically examine the effect of AMPK on pulmonary arterial smooth muscle cells (PASMCs) proliferation and to further elucidate its underlying molecular mechanisms. Our results showed that knockdown of AMPKα2 promoted primary cultured PASMCs proliferation; this was accompanied with the elevation of phosphorylation of mammalian target of rapamycin (mTOR) and S-phase kinase-associated protein 2 (Skp2) protein level and reduction of p27Kip1. Importantly, prior silencing of mTOR with siRNA abolished AMPKα2 knockdown-induced Skp2 upregulation, p27Kip1 reduction as well as PASMCs proliferation. Furthermore, pre-depletion of Skp2 by siRNA also eliminated p27Kip1 downregulation and PASMCs proliferation caused by AMPKα2 knockdown. Taken together, our study indicates that AMPKα2 isoform plays an important role in regulation of PASMCs proliferation by modulating mTOR/Skp2/p27Kip1 axis, and suggests that activation of AMPKα2 might have potential value in the prevention and treatment of pulmonary arterial hypertension. PMID:27258250
-
Inamura, Kentaro; Togashi, Yuki; Ninomiya, Hironori; Shimoji, Takashi; Noda, Tetsuo; Ishikawa, Yuichi
2008-01-01
Previously, using microarray and real-time RT-PCR analysis, we established that HOXB2 is an adverse prognostic indicator for Stage I lung adenocarcinomas. HOXB2 is one of the homeobox master development-controlling genes regulating morphogenesis and cell differentiation. The molecular functions of HOXB2 were analyzed with a small interfering RNA (siRNA) approach in HOP-62 human non-small cell lung cancer (NSCLC) cells featuring high HOXB2 expression. Matrigel invasion assays and microarray gene expression analysis were compared between the HOXB2-siRNA cells and the control cells. The Matrigel invasion assays showed attenuation of HOXB2 expression by siRNA to result in a significant decrease of invasiveness compared to the control cells (p = 0.0013, paired t-test). On microarray gene expression analysis, up-regulation of many metastasis-related genes and others correlating with HOXB2 expression was observed in the control case. With attenuation of HOXB2 expression, downregulation was noted for laminins alpha 4 and 5, involved in enriched signaling, and for Mac-2BP (Mac-2 binding protein) and integrin beta 4 amongst the genes having an enriched glycoprotein ontology. HOXB2 promotes invasion of lung cancer cells through the regulation of metastasis-related genes.
-
Upregulation of LYAR induces neuroblastoma cell proliferation and survival.
Sun, Yuting; Atmadibrata, Bernard; Yu, Denise; Wong, Matthew; Liu, Bing; Ho, Nicholas; Ling, Dora; Tee, Andrew E; Wang, Jenny; Mungrue, Imran N; Liu, Pei Y; Liu, Tao
2017-09-01
The N-Myc oncoprotein induces neuroblastoma by regulating gene transcription and consequently causing cell proliferation. Paradoxically, N-Myc is well known to induce apoptosis by upregulating pro-apoptosis genes, and it is not clear how N-Myc overexpressing neuroblastoma cells escape N-Myc-mediated apoptosis. The nuclear zinc finger protein LYAR has recently been shown to modulate gene expression by forming a protein complex with the protein arginine methyltransferase PRMT5. Here we showed that N-Myc upregulated LYAR gene expression by binding to its gene promoter. Genome-wide differential gene expression studies revealed that knocking down LYAR considerably upregulated the expression of oxidative stress genes including CHAC1, which depletes intracellular glutathione and induces oxidative stress. Although knocking down LYAR expression with siRNAs induced oxidative stress, neuroblastoma cell growth inhibition and apoptosis, co-treatment with the glutathione supplement N-acetyl-l-cysteine or co-transfection with CHAC1 siRNAs blocked the effect of LYAR siRNAs. Importantly, high levels of LYAR gene expression in human neuroblastoma tissues predicted poor event-free and overall survival in neuroblastoma patients, independent of the best current markers for poor prognosis. Taken together, our data suggest that LYAR induces proliferation and promotes survival of neuroblastoma cells by repressing the expression of oxidative stress genes such as CHAC1 and suppressing oxidative stress, and identify LYAR as a novel co-factor in N-Myc oncogenesis.
-
Tchurikov, Nickolai A; Fedoseeva, Daria M; Gashnikova, Natalya M; Sosin, Dmitri V; Gorbacheva, Maria A; Alembekov, Ildar R; Chechetkin, Vladimir R; Kravatsky, Yuri V; Kretova, Olga V
2016-05-25
Highly active antiretroviral therapy has greatly reduced the morbidity and mortality of AIDS. However, many of the antiretroviral drugs are toxic with long-term use, and all currently used anti-HIV agents generate drug-resistant mutants. Therefore, there is a great need for new approaches to AIDS therapy. RNAi is a powerful means of inhibiting HIV-1 production in human cells. We propose to use RNAi for gene therapy of HIV/AIDS. Previously we identified a number of new biologically active siRNAs targeting several moderately conserved regions in HIV-1 transcripts. Here we analyze the heterogeneity of nucleotide sequences in three RNAi targets in sequences encoding the reverse transcriptase and integrase domains of current isolates of HIV-1 subtype A in Russia. These data were used to generate genetic constructs expressing short hairpin RNAs 28-30-bp in length that could be processed in cells into siRNAs. After transfection of the constructs we observed siRNAs that efficiently attacked the selected targets. We expect that targeting several viral genes important for HIV-1 reproduction will help overcome the problem of viral adaptation and will prevent the appearance of RNAi escape mutants in current virus strains, an important feature of gene therapy of HIV/AIDS. Copyright © 2016 Elsevier B.V. All rights reserved.
-
d'Angelo, Ivana; Costabile, Gabriella; Durantie, Estelle; Brocca, Paola; Rondelli, Valeria; Russo, Annapina; Russo, Giulia; Miro, Agnese; Quaglia, Fabiana; Petri-Fink, Alke; Rothen-Rutishauser, Barbara; Ungaro, Francesca
2017-10-16
Nowadays, the downregulation of genes involved in the pathogenesis of severe lung diseases through local siRNA delivery appears an interesting therapeutic approach. In this study, we propose novel hybrid lipid-polymer nanoparticles (hNPs) consisting of poly(lactic-co-glycolic) acid (PLGA) and dipalmitoyl phosphatidylcholine (DPPC) as siRNA inhalation system. A panel of DPPC/PLGA hNPs was prepared by emulsion/solvent diffusion and fully characterized. A combination of model siRNAs against the sodium transepithelial channel (ENaC) was entrapped in optimized hNPs comprising or not poly(ethylenimine) (PEI) as third component. siRNA-loaded hNPs were characterized for encapsulation efficiency, release kinetics, aerodynamic properties, and stability in artificial mucus (AM). The fate and cytotoxicity of hNPs upon aerosolization on a triple cell co-culture model (TCCC) mimicking human epithelial airway barrier were assessed. Finally, the effect of siRNA-loaded hNPs on ENaC protein expression at 72 hours was evaluated in A549 cells. Optimized muco-inert hNPs encapsulating model siRNA with high efficiency were produced. The developed hNPs displayed a hydrodynamic diameter of ∼150 nm, a low polydispersity index, a negative ζ potential close to -25 mV, and a peculiar triphasic siRNA release lasting for 5 days, which slowed down in the presence of PEI. siRNA formulations showed optimal in vitro aerosol performance after delivery with a vibrating mesh nebulizer. Furthermore, small-angle X-ray scattering analyses highlighted an excellent stability upon incubation with AM, confirming the potential of hNPs for direct aerosolization on mucus-lined airways. Studies in TCCC confirmed that fluorescent hNPs are internalized inside airway epithelial cells and do not exert any cytotoxic or acute proinflammatory effect. Finally, a prolonged inhibition of ENaC protein expression was observed in A549 cells upon treatment with siRNA-loaded hNPs. Results demonstrate the great potential of hNPs as carriers for pulmonary delivery of siRNA, prompting toward investigation of their therapeutic effectiveness in severe lung diseases.
-
Hua, Ping; Liu, Li-Bao; Liu, Jia-Liang; Wang, Meng; Jiang, Hui-Qi; Zeng, Kuan; Yang, Yan-Qi; Yang, Song-Ran
2013-09-01
Transplantation of bone marrow mesenchymal stem cells is a promising new strategy for the repair of infarcted cardiac tissue. However, the majority of transplanted bone marrow mesenchymal stem cells (BMSCs) die soon after transplantation, due in part to oxidative stress in the ischemic region. Oxidative stress is known to induce apoptosis through the activation of caspase-3. The aim of this study is to determine whether small interfering RNA targeting caspase-3 can inhibit the apoptosis of rat BMSCs in vitro. Caspase-3 siRNA expression vectors were prepared and transfected into rat BMSCs in the presence of liposomes. Western blot assay and real-time polymerase chain reaction (RT-PCR) were performed to detect caspase-3 expression. A retrovirus packaging system was employed to package 293FT cells producing caspase-3 siRNA virus, which were transfected into rat BMSCs. Those stably expressing caspase-3 siRNA were screened by Western blot assay and RT-PCR to determine caspase-3 expression levels. Stable transfection of caspase-3 siRNA significantly decreased caspase-3 protein (0.26 ± 0.001 vs. 0.42 ± 0.004, P < 0.05) and mRNA expression (0.19 ± 0.002 vs. 1, P < 0.05) in BMSCs compared to non-transfected BMSCs. Cells were incubated in H2O2 to induce apoptosis, which was detected by TUNEL staining, and BMSC morphology was not altered by either transient or stable transfection of caspase-3 siRNA. H2O2-induced apoptosis of BMSCs stably transfected with caspase-3 siRNA was dramatically reduced compared to that of normal BMSCs (11.0 ± 3.2 vs. 25.8 ± 4.2, P < 0.05). Caspase-3 knockdown BMSCs are thus more resistant to apoptosis than normal BMSCs, potentially increasing their survival rates under conditions that cause oxidative stress.
-
Li, Wenting; Wang, Kejun; Kang, Shimeng; Deng, Shoulong; Han, Hongbing; Lian, Ling; Lian, Zhengxing
2015-01-01
Foot and mouth disease induced by foot and mouth disease virus (FMDV) is severe threat to cloven-hoofed domestic animals. The gene 3Dpol in FMDV genome encodes the viral RNA polymerase, a vital element for FMDV replication. In this study, a conserved 3D-7414shRNA targeting FMDV-3Dpol gene was designed and injected into pronuclear embryos to produce the transgenic goats. Sixty-one goats were produced, of which, seven goats positively integrated 3D-7414shRNA. Loss of function assay demonstrated that siRNA effectively knockdown 3Dpol gene in skin epithelium cells of transgenic goats. Subsequently, the tongue epithelium cells from transgenic and non-transgenic goats were infected with FMDV O/YS/CHA/05 strain. A significant decrease of virus titres and virus copy number was observed in cells of transgenic goats compared with that of non-transgenic goats, which indicated that 3D-7414siRNA inhibited FMDV replication by interfering FMDV-3Dpol gene. Furthermore, we found that expression of TLR7, RIG-I and TRAF6 was lower in FMDV infected cells from transgenic goats compared to that from non-transgenic goats, which might result from lower virus copy number in transgenic goats’ cells. In conclusion, we successfully produced transgenic goats highly expressing 3D-7414siRNA targeting 3Dpol gene, and the tongue epithelium cells from the transgenic goats showed effective resistance to FMDV. PMID:26671568
-
Jiwaji, Meesbah; Sandison, Mairi E.; Reboud, Julien; Stevenson, Ross; Daly, Rónán; Barkess, Gráinne; Faulds, Karen; Kolch, Walter; Graham, Duncan; Girolami, Mark A.; Cooper, Jonathan M.; Pitt, Andrew R.
2014-01-01
Introduction Gene therapy continues to grow as an important area of research, primarily because of its potential in the treatment of disease. One significant area where there is a need for better understanding is in improving the efficiency of oligonucleotide delivery to the cell and indeed, following delivery, the characterization of the effects on the cell. Methods In this report, we compare different transfection reagents as delivery vehicles for gold nanoparticles functionalized with DNA oligonucleotides, and quantify their relative transfection efficiencies. The inhibitory properties of small interfering RNA (siRNA), single-stranded RNA (ssRNA) and single-stranded DNA (ssDNA) sequences targeted to human metallothionein hMT-IIa are also quantified in HeLa cells. Techniques used in this study include fluorescence and confocal microscopy, qPCR and Western analysis. Findings We show that the use of transfection reagents does significantly increase nanoparticle transfection efficiencies. Furthermore, siRNA, ssRNA and ssDNA sequences all have comparable inhibitory properties to ssDNA sequences immobilized onto gold nanoparticles. We also show that functionalized gold nanoparticles can co-localize with autophagosomes and illustrate other factors that can affect data collection and interpretation when performing studies with functionalized nanoparticles. Conclusions The desired outcome for biological knockdown studies is the efficient reduction of a specific target; which we demonstrate by using ssDNA inhibitory sequences targeted to human metallothionein IIa gene transcripts that result in the knockdown of both the mRNA transcript and the target protein. PMID:24926959
-
Javan, Bita; Shahbazi, Majid
2017-01-01
Transcriptional targeting is the best approach for specific gene therapy. Hypoxia is a common feature of the tumour microenvironment. Therefore, targeting gene expression in hypoxic cells by placing transgene under the control of a hypoxia-responsive promoter can be a good strategy for cancer-specific gene therapy. The hypoxia-inducible gene expression system has been investigated more in suicide gene therapy and it can also be of great help in knocking down cancer gene therapy with siRNAs. However, this system needs to be optimised to have maximum efficacy with minimum side effects in normal tissues. The combination of tissue-/tumour-specific promoters with HRE core sequences has been found to enhance the specificity and efficacy of this system. In this review, hypoxia-inducible gene expression system as well as gene therapy strategies targeting tumour hypoxia will be discussed. This review will also focus on hypoxia-inducible tumour-specific promoters as a dual-targeting transcriptional regulation systems developed for cancer-specific gene therapy. PMID:28798809
-
Synthetic RNAs for Gene Regulation: Design Principles and Computational Tools
DOE Office of Scientific and Technical Information (OSTI.GOV)
Laganà, Alessandro, E-mail: alessandro.lagana@osumc.edu; Shasha, Dennis; Croce, Carlo Maria
The use of synthetic non-coding RNAs for post-transcriptional regulation of gene expression has not only become a standard laboratory tool for gene functional studies but it has also opened up new perspectives in the design of new and potentially promising therapeutic strategies. Bioinformatics has provided researchers with a variety of tools for the design, the analysis, and the evaluation of RNAi agents such as small-interfering RNA (siRNA), short-hairpin RNA (shRNA), artificial microRNA (a-miR), and microRNA sponges. More recently, a new system for genome engineering based on the bacterial CRISPR-Cas9 system (Clustered Regularly Interspaced Short Palindromic Repeats), was shown to havemore » the potential to also regulate gene expression at both transcriptional and post-transcriptional level in a more specific way. In this mini review, we present RNAi and CRISPRi design principles and discuss the advantages and limitations of the current design approaches.« less
-
The HTLV-1 Tax Oncoprotein Represses Ku80 Gene Expression
Ducu, Razvan I.; Dayaram, Tajhal; Marriott, Susan J.
2011-01-01
The HTLV-I oncoprotein Tax interferes with DNA double strand break repair. Since non-homologous end joining (NHEJ) is a major pathway used to repair DNA double strand breaks we examined the effect of Tax on this pathway, with particular interest in the expression and function of Ku80, a critical component of the NHEJ pathway. Tax expression decreased Ku80 mRNA and protein levels, and repressed transcription from the Ku80 promoter. Conversely, Ku80 mRNA increased following siRNA knockdown of Tax in HTLV-I infected cells. Tax expression was associated with an elevated number of micronuclei and nucleoplasmic bridges, hallmarks of improper DNA double strand break repair. Our studies identified Tax as a transcriptional repressor of Ku80 that correlates with decreased DNA repair function. The reduction of Ku80 transcription by Tax may deplete the cell of an essential DNA break binding protein, resulting in reduced repair of DNA double strand breaks and accumulation genomic mutations. PMID:21571351
-
Differentiation of NUT Midline Carcinoma by Epigenomic Reprogramming
Schwartz, Brian E.; Hofer, Matthias D.; Lemieux, Madeleine E.; Bauer, Daniel E.; Cameron, Michael J.; West, Nathan H.; Agoston, Elin S.; Reynoird, Nicolas; Khochbin, Saadi; Ince, Tan A.; Christie, Amanda; Janeway, Katherine A.; Vargas, Sara O.; Perez-Atayde, Antonio R.; Aster, Jon C.; Sallan, Stephen E.; Kung, Andrew L.; Bradner, James E.; French, Christopher A.
2011-01-01
NUT midline carcinoma (NMC) is a lethal pediatric tumor defined by the presence of BRD-NUT fusion proteins that arrest differentiation. Here we explore the mechanisms underlying the ability of BRD4-NUT to prevent squamous differentiation. In both gain-of and loss-of-expression assays we find that expression of BRD4-NUT is associated with globally decreased histone acetylation and transcriptional repression. Bulk chromatin acetylation can be restored by treatment of NMC cells with histone deacetylase inhibitors (HDACi), engaging a program of squamous differentiation and arrested growth in vitro that closely mimics the effects of siRNA mediated attenuation of BRD4-NUT expression. The potential therapeutic utility of HDACi differentiation therapy was established in three different NMC xenograft models, where it produced significant growth inhibition and a survival benefit. Based on these results and translational studies performed with patient-derived primary tumor cells, a child with NMC was treated with the FDA-approved HDAC inhibitor, vorinostat. An objective response was obtained after five weeks of therapy, as determined by positron emission tomography. These findings provide preclinical support for trials of HDACi in patients with NMC. PMID:21447744
-
Expression of the proto-oncogene Pokemon in colorectal cancer--inhibitory effects of an siRNA.
Zhao, Gan-Ting; Yang, Li-Juan; Li, Xi-Xia; Cui, Hui-Lin; Guo, Rui
2013-01-01
This study aimed to investigate expression of the proto-oncogene POK erythroid myeloid ontogenic factor (Pokemon) in colorectal cancer (CRC), and assess inhibitory effects of a small interference RNA (siRNA) expression vector in SW480 and SW620 cells. Semi-quantitative reverse transcription-polymerase chain reaction (PCR) and immunohistochemistry were performed to determine mRNA and protein expression levels of Pokemon in CRC tissues. Indirect immunofluorescence staining was applied to investigate the location of Pokemon in SW480 and SW620 cells. The siRNA expression vectors that were constructed to express a short hairpin RNA against Pokemon were transfected to the SW480 and SW620 cells with a liposome. Expression levels of Pokemon mRNA and protein were examined by real-time quantitative-fluorescent PCR and western blot analysis. The effects of Pokemon silencing on proliferation of SW480 and SW620 cells were evaluated with reference to growth curves with MTT assays. The mRNA expression level of Pokemon in tumor tissues (0.845 ± 0.344) was significantly higher than that in adjacent tumor specimens (0.321 ± 0.197). The positive expression ratio of Pokemon protein in CRC (87.0%) was significantly higher than that in the adjacent tissues (19.6%). Strong fluorescence staining of Pokemon protein was observed in the cytoplasm of the SW480 and SW620 cells. The inhibition ratios of Pokemon mRNA and protein in the SW480 cells were 83.1% and 73.5% at 48 and 72 h, respectively, compared with those of the negative control cells with the siRNA. In the SW620 cells, the inhibition ratios of Pokemon mRNA and protein were 76.3% and 68.7% at 48 and 72 h, respectively. MTT showed that Pokemon gene silencing inhibited the proliferation of SW480 and SW620 cells. Overexpression of Pokemon in CRC may have a function in carcinogenesis and progression. siRNA expression vectors could effectively inhibit mRNA and protein expression of Pokemon in SW480 and SW620 cells, thereby reducing malignant cell proliferation.
-
Liu, N; Shi, H G; Zhang, W; Gu, B
2016-11-09
Objective: To investigate the crosstalk between canonical Wnt/β-catenin and noncanonical Wnt/Ca 2+ pathway in osteoblast differentiation process of periodontal ligament stem cell (PDLSC) in inflammatory microenvironments. Methods: PDLSCs were obtained from human healthy individuals(H-PDLSC) and patients with periodontitis(P-PDLSC). The H/P-PDLSCs were transfected with β-catenin siRNA. Cell morphology was observed under fluorescent microscope and transfection efficiency was easured by Western blotting after transfection of PDLSC. The mRNA expressions of Runt-related transcription factor 2(Runx2), β-catenin and nemo like kinase(NLK) were detected by real time PCR, the protein expressions of calcium/calmodulin-dependent protein kinase Ⅱ (CaMK Ⅱ) and NLK were examined by Western blotting and the CaMK Ⅱ was observed by immunofluorescence staining, respectively. Results: The β-catenin expressions in H/P-PDLSCs were inhibited specifically and efficiently by treatment of β-catenin-siRNA for 24 h. After a 3-day-osteogenic process, results of real-time quantitative PCR showed that the Runx2 mRNA expression in P-PDLSC siRNA β-catenin transfected group(4.553 ± 0.659) was significantly higher than that in P-PDLSC empty plasmid control group(1.918 ± 0.315) ( P= 0.000). A similar trend was observed in the NLK mRNA expression tests(7.341 ± 1.331 vs. 5.664 ± 0.792) ( P= 0.030). Accordingly, the protein expression levels of CaMK Ⅱ, NLK were higher in P-PDLSC siRNA β-catenin transfected group than that in P-PDLSC empty plasmid control group in osteogenic differentiation condition for 3 days. CaMKⅡ was more strongly induced in P-PDLSC siRNA β-catenin group than that in P-PDLSC empty plasmid control group after PDLSC cultured in osteogenic medium for 3 days. Conclusions: Both canonical Wnt/β-catenin and noncanonical Wnt/Ca 2+ pathway could regulate the osteogenic differentiation potential of P-PDLSC. Suppression of β-catenin by siRNA promoted osteogenic differentiation via increasing noncanonical Wnt signaling pathway of PDLSC in inflammatory microenvironments.
-
Xiao, Jie; Yin, Songmei; Li, Yiqing; Xie, Shuangfeng; Nie, Danian; Ma, Liping; Wang, Xiuju; Wu, Yudan; Feng, Jianhong
2009-08-01
S-phase kinase-associated protein 2 (SKP2) gene is a tumor suppressor gene, and is involved in the ubiquitin-mediated degradation of P27kip1. SKP2 and P27kip1 affect the proceeding and prognosis of leukemia through regulating the proliferation, apoptosis and differentiation of leukemia cells. In this study, we explored the mechanism of reversing of HL-60/A drug resistance through SKP2 down-regulation. HL-60/A cells were nucleofected by Amaxa Nucleofector System with SKP2 siRNA. The gene and protein expression levels of Skp2, P27kip1, and multi-drug resistance associated protein (MRP) were determined by reverse transcription-polymerase chain reaction and western blot analysis, respectively. The cell cycle was analyzed by flow cytometry. The 50% inhibitory concentration value was calculated using cytotoxic analysis according to the death rate of these two kinds of cells under different concentrations of chemotherapeutics to compare the sensitivity of the cells. HL-60/A cells showed multi-drug resistance phenotype characteristic by cross-resistance to adriamycin, daunorubicin, and arabinosylcytosine, due to the expression of MRP. We found that the expression of SKP2 was higher in HL-60/A cells than in HL-60 cells, but the expression of P27kip1 was lower. The expression of SKP2 in HL-60/A cells nucleofected by SKP2 siRNA was down-regulated whereas the protein level of P27kip1 was up-regulated. Compared with the MRP expression level in the control group (nucleofected by control siRNA), the mRNA and protein expression levels of MRP in HL-60/A cells nucleofected by SKP2 siRNA were lower, and the latter cells were more sensitive to adriamycin, daunorubicin, and arabinosylcytosine. Down-regulating the SKP2 expression and arresting cells in the G0/G1 phase improve drug sensitivity of leukemia cells with down-regulated MRP expression.
-
Takahashi, Hironobu; Wang, Yuwei; Grainger, David W.
2010-01-01
Fibrous encapsulation of surgically implant devices is associated with elevated proliferation and activation of fibroblasts in tissues surrounding these implants, frequently causing foreign body complications. Here we test the hypothesis that inhibition of the expression of mammalian target of rapamycin (mTOR) in fibroblasts can mitigate the soft tissue implant foreign body response by suppressing fibrotic responses around implants. In this study, mTOR was knocked down using small interfering RNA conjugated with branched cationic polyethylenimine (bPEI) in fibroblastic lineage cells in serum-based cell culture as shown by both gene and protein analysis. This mTOR knockdown led to an inhibition in fibroblast proliferation by 70% and simultaneous down-regulation in the expression of type I collagen in fibroblasts in vitro. These siRNA/bPEI complexes were released from poly(ethylene glycol) (PEG)-based hydrogel coatings surrounding model polymer implants in a subcutaneous rodent model in vivo. No significant reduction in fibrous capsule thickness and mTOR expression in the foreign body capsules was observed. Observed siRNA inefficacy in this in vivo implant model was attributed to siRNA dosing limitations in the gel delivery system, and lack of targeting ability of the siRNA complex specifically to fibroblasts. While in vitro data supported mTOR knock-down in fibroblast cultures, in vivo siRNA delivery must be further improved to produce clinically relevant effects on fibrotic encapsulation around implants. PMID:20727922
-
Zhang, P; Wang, J G; Wan, J G; Liu, W Q
2010-01-01
The frequent disease outbreaks caused by avian influenza virus not only affect the poultry industry but also pose a threat to human safety. To address the problem, RNA interference (RNAi) has recently been widely used as a potential antiviral approach. Transgenesis in combination with RNAi to specifically inhibit avian enza virus gene expression has been proposed to make chickens resistant to the infection. For the transgenic breeding, screening in vitro efficient siRNAs as the candidate genes is one of the most important tasks. Here, we combined an online search tool and a series of bioinformatics programs with a set of rules for designing siRNAs targeted towards different mRNA regions of H5N1 avian influenza virus. Five rational siRNAs were chosen by this method, five U6 promoter-driven shRNA expression plasmids containing the siRNA genes were constructed and used for producing stably transfected MDCK cells. The data obtained by virus titration, IFA, PI-stained flow cytometry, real-time quantitative RT-PCR, and DAS-ELISA analyses showed that all five stably transfected cell lines we re resistant to virusreplication when exposed to 100 CCID50 of avian influenza virus H5N1. Finally, most effective plasmids (pSi-604i and pSi-1597i) as the candidates for making the transgenic chickens were chosen. These findings provide baseline information on use of RNAi technique for breeding transgenic chickens resistant to avian influenza virus.
-
Wang, Meizhen; Wu, Bin; Chen, Chao; Lu, Shanfa
2015-03-01
Increasing evidence suggests that long non-coding RNAs (lncRNAs) play significant roles in plants. However, little is known about lncRNAs in Panax ginseng C. A. Meyer, an economically significant medicinal plant species. A total of 3,688 mRNA-like non-coding RNAs (mlncRNAs), a class of lncRNAs, were identified in P. ginseng. Approximately 40% of the identified mlncRNAs were processed into small RNAs, implying their regulatory roles via small RNA-mediated mechanisms. Eleven miRNA-generating mlncRNAs also produced siRNAs, suggesting the coordinated production of miRNAs and siRNAs in P. ginseng. The mlncRNA-derived small RNAs might be 21-, 22-, or 24-nt phased and could be generated from both or only one strand of mlncRNAs, or from super long hairpin structures. A full-length mlncRNA, termed MAR (multiple-function-associated mlncRNA), was cloned. It generated the most abundant siRNAs. The MAR siRNAs were predominantly 24-nt and some of them were distributed in a phased pattern. A total of 228 targets were predicted for 71 MAR siRNAs. Degradome sequencing validated 68 predicted targets involved in diverse metabolic pathways, suggesting the significance of MAR in P. ginseng. Consistently, MAR was detected in all tissues analyzed and responded to methyl jasmonate (MeJA) treatment. It sheds light on the function of mlncRNAs in plants. © 2014 Institute of Botany, Chinese Academy of Sciences.
-
NASA Astrophysics Data System (ADS)
Hsu, Yih-Chih
2016-03-01
Photodynamic therapy is a novel therapeutic modality to treat cancer by using a photosensitizer which is activated by a light source to produce reactive oxygen species and mediates tumours oxygen-independent hypoxic conditions. Vascular endothelial growth factor (VEGF) is one of the primary factors that affect tumor angiogenesis. Another emerging treatment to cure cancer is the use of interference RNA to silence a specific mRNA sequence. Such treatment requires a delivery system such as liposomes. The nanoparticle size measured was about 30 nm. Cellular uptake study was performed to verify that the nanoparticles have a sigma receptor mediated pathway. Non-targeted LCP NPs did not show significant difference with or without haloperidol but has a lower intensity as than targeted LCP NPs. These results confirm that LCP NPs have a receptor mediated pathway. Cell viability was found to decrease at 25 nM of transfected VEGF siRNA. Combined therapy of PDT and VEGF siRNA showed significant response as compared with PDT and gene therapy alone. In vivo toxicity assay with mice treated with targeted LCP NPs containing control siRNA or VEGF siRNA and non-targeted LCP NPs containing VEGF siRNA did not show any significant difference with the PBS injected group which suggests that there is no toxicity with the dose. It suggests that PDT combined with targeted gene therapy has a potential mean to achieve better therapeutic outcome.
-
2014-01-01
Background Despite advances in the treatment of heart failure, mortality remains high, particularly in individuals with diabetes. Activated transforming growth factor beta (TGF-β) contributes to the pathogenesis of the fibrotic interstitium observed in diabetic cardiomyopathy. We hypothesized that high glucose enhances the activity of the transcriptional co-activator p300, leading to the activation of TGF-β via acetylation of Smad2; and that by inhibiting p300, TGF-β activity will be reduced and heart failure prevented in a clinically relevant animal model of diabetic cardiomyopathy. Methods p300 activity was assessed in H9c2 cardiomyoblasts under normal glucose (5.6 mmol/L—NG) and high glucose (25 mmol/L—HG) conditions. 3H-proline incorporation in cardiac fibroblasts was also assessed as a marker of collagen synthesis. The role of p300 activity in modifying TGF-β activity was investigated with a known p300 inhibitor, curcumin or p300 siRNA in vitro, and the functional effects of p300 inhibition were assessed using curcumin in a hemodynamically validated model of diabetic cardiomyopathy – the diabetic TG m(Ren-2)27 rat. Results In vitro, H9c2 cells exposed to HG demonstrated increased p300 activity, Smad2 acetylation and increased TGF-β activity as assessed by Smad7 induction (all p < 0.05 c/w NG). Furthermore, HG induced 3H-proline incorporation as a marker of collagen synthesis (p < 0.05 c/w NG). p300 inhibition, using either siRNA or curcumin reduced p300 activity, Smad acetylation and TGF-β activity (all p < 0.05 c/w vehicle or scrambled siRNA). Furthermore, curcumin therapy reduced 3H-proline incorporation in HG and TGF-β stimulated fibroblasts (p < 0.05 c/w NG). To determine the functional significance of p300 inhibition, diabetic Ren-2 rats were randomized to receive curcumin or vehicle for 6 weeks. Curcumin treatment reduced cardiac hypertrophy, improved diastolic function and reduced extracellular matrix production, without affecting glycemic control, along with a reduction in TGF-β activity as assessed by Smad7 activation (all p < 0.05 c/w vehicle treated diabetic animals). Conclusions These findings suggest that high glucose increases the activity of the transcriptional co-regulator p300, which increases TGF-β activity via Smad2 acetylation. Modulation of p300 may be a novel strategy to treat diabetes induced heart failure. PMID:24886336
-
Kim, Jeong-Yub; Kim, Jeong-Chul; Lee, Ji-Yun; Park, Myung-Jin
2018-07-01
Breast cancer stem cells (BCSCs) are a small subpopulation of breast cancer cells that have been proposed to be a primary cause of failure of therapies, including ionizing radiation (IR). Their embryonic stem-like signature is associated with poor clinical outcome. In the present study, the function of octamer-binding transcription factor 4 (Oct4), an embryonic stem cell factor, in the resistance of BCSCs to IR was investigated. Mammosphere cells exhibited increased expression of stemness-associated genes, including Oct4 and sex‑determining region Y‑box 2 (Sox2), and were more resistant to IR compared with serum-cultured monolayer cells. IR‑resistant MCF7 cells also exhibited significantly increased expression of Oct4. To investigate the possible involvement of Oct4 in IR resistance of breast cancer cells, cells were transfected with Oct4. Ectopic expression of Oct4 increased the clonogenic survival of MCF7 cells following IR, which was reversed by treatment with small interfering RNA (siRNA) targeting Oct4. Oct4 expression decreased phosphorylated histone H2AX (γ-H2AX) focus formation and suppressed IR‑induced premature senescence in these cells. Mammosphere, IR‑resistant and Oct4‑overexpressing MCF7 cells exhibited enhanced phosphorylation of signal transducer and activation of transcription 3 (STAT3) (Tyr705) and inhibitor of nuclear factor κB (NF‑κB), and blockade of these pathways with siRNA against STAT3 and/or specific inhibitors of STAT3 and NF‑κB significantly increased IR‑induced senescence. Secretome analysis revealed that Oct4 upregulated interleukin 24 (IL‑24) expression through STAT3 and NF‑κB signaling, and siRNA against IL‑24 increased IR‑induced senescence, whereas recombinant human IL‑24 suppressed it. The results of the present study indicated that Oct4 confers IR resistance on breast cancer cells by suppressing IR‑induced premature senescence through STAT3- and NF‑κB-mediated IL‑24 production.
-
Application of small RNA technology for improved control of parasitic helminths.
Britton, Collette; Winter, Alan D; Marks, Neil D; Gu, Henry; McNeilly, Tom N; Gillan, Victoria; Devaney, Eileen
2015-08-15
Over the last decade microRNAs (miRNAs) and small interfering RNAs (siRNAs) have emerged as important regulators of post-transcriptional gene expression. miRNAs are short, non-coding RNAs that regulate a variety of processes including cancer, organ development and immune function. This class of small RNAs bind with partial complementarity to their target mRNA sequences, most often in the 3'UTR, to negatively regulate gene expression. In parasitic helminths, miRNAs are being increasingly studied for their potential roles in development and host-parasite interactions. The availability of genome data, combined with small RNA sequencing, has paved the way to profile miRNAs expressed at particular developmental stages for many parasitic helminths. While some miRNAs are conserved across species, others appear to be unique to specific parasites, suggesting important roles in adaptation and survival in the host environment. Some miRNAs are released from parasites, in exosomes or in protein complexes, and the potential effects of these on host immune function are being increasingly studied. In addition, release of miRNAs from schistosome and filarial parasites into host plasma can be exploited for the development of specific and sensitive diagnostic biomarkers of infection. Interfering with miRNA function, as well as silencing key components of the pathways they regulate, will progress our understanding of parasite development and provide a novel approach to therapeutic control. RNA interference (RNAi) by siRNAs has proven to be inconsistent in parasitic nematodes. However, the recent successes reported for schistosome and liver fluke RNAi, encourage further efforts to enhance delivery of RNA and improve in vitro culture systems and assays to monitor phenotypic effects in nematodes. These improvements are important for the establishment of reliable functional genomic platforms for novel drug and vaccine development. In this review we focus on the important roles of miRNAs and siRNAs in post-transcriptional gene regulation in veterinary parasitic helminths and the potential value of these in parasite diagnosis and control. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
-
The Nuclear Death Domain Protein p84N5; a Candidate Breast Cancer Susceptibility Gene
2005-05-01
DATES COVERED ( Leave blank) May 2005 Annual (1 May 04 - 30 Apr 05) 4. TITLE AND SUBTITLE 5. FUNDING NUMBERS The Nuclear Death Domain Protein p84N5; a...p84N5 targeted siRNAs effectively reduced the protein levels of p84N5, but did not affect the levels of non- targeted transcripts such as P-actin...p84N5. Cell proliferation and apoptosis (data not shown) was examined using Guava ViaCount and Nexin assays, respectively. Plotted is the number of
-
Syring, Isabella; Klümper, Niklas; Offermann, Anne; Braun, Martin; Deng, Mario; Boehm, Diana; Queisser, Angela; von Mässenhausen, Anne; Brägelmann, Johannes; Vogel, Wenzel; Schmidt, Doris; Majores, Michael; Schindler, Anne; Kristiansen, Glen; Müller, Stefan C; Ellinger, Jörg; Shaikhibrahim, Zaki; Perner, Sven
2016-04-26
The Mediator complex is a key regulator of gene transcription and several studies demonstrated altered expressions of particular subunits in diverse human diseases, especially cancer. However a systematic study deciphering the transcriptional expression of the Mediator across different cancer entities is still lacking.We therefore performed a comprehensive in silico cancer vs. benign analysis of the Mediator complex subunits (MEDs) for 20 tumor entities using Oncomine datasets. The transcriptional expression profiles across almost all cancer entities showed differentially expressed MEDs as compared to benign tissue. Differential expression of MED8 in renal cell carcinoma (RCC) and MED12 in lung cancer (LCa) were validated and further investigated by immunohistochemical staining on tissue microarrays containing large numbers of specimen. MED8 in clear cell RCC (ccRCC) associated with shorter survival and advanced TNM stage and showed higher expression in metastatic than primary tumors. In vitro, siRNA mediated MED8 knockdown significantly impaired proliferation and motility in ccRCC cell lines, hinting at a role for MED8 to serve as a novel therapeutic target in ccRCC. Taken together, our Mediator complex transcriptome proved to be a valid tool for identifying cancer-related shifts in Mediator complex composition, revealing that MEDs do exhibit cancer specific transcriptional expression profiles.
-
Sjaarda, Calvin P; Abubaker, Kamal S; Castle, Alan J
2015-01-01
Laccases are used by fungi for several functions including defence responses to stresses associated with attack by other fungi. Laccase activity changes and the induction of two laccase genes, lcc1 and lcc2, in Agaricus bisporus were measured in response to toxic extracts of medium in which Trichoderma aggressivum, the cause of green mould disease, was grown. A strain of A. bisporus that shows resistance to the extracts showed higher basal levels and greater enzymatic activity after extract exposure than did a sensitive strain. Furthermore, pre-incubation of T. aggressivum extract with laccases reduced toxicity. Faster induction and greater numbers of lcc2 transcripts in response to the extract were noted in the resistant strain than in the sensitive strain. The timing and increase in lcc2 transcript abundance mirrored changes in total laccase activity. No correlation between resistance and lcc1 transcription was apparent. Transcript abundance in transformants with a siRNA construct homologous to both genes varied widely. A strong negative correlation between transcript abundance and sensitivity of the transformant to toxic extract was observed in plate assays. These results indicated that laccase activity and in particular that encoded by lcc2 contributes to toxin metabolism and by extension green mould disease resistance. PMID:25824278
-
Deleavey, Glen F.; Watts, Jonathan K.; Alain, Tommy; Robert, Francis; Kalota, Anna; Aishwarya, Veenu; Pelletier, Jerry; Gewirtz, Alan M.; Sonenberg, Nahum; Damha, Masad J.
2010-01-01
We report that combining a DNA analog (2′F-ANA) with rigid RNA analogs [2′F-RNA and/or locked nucleic acid (LNA)] in siRNA duplexes can produce gene silencing agents with enhanced potency. The favored conformations of these two analogs are different, and combining them in a 1–1 pattern led to reduced affinity, whereas alternating short continuous regions of individual modifications increased affinity relative to an RNA:RNA duplex. Thus, the binding affinity at key regions of the siRNA duplex could be tuned by changing the pattern of incorporation of DNA-like and RNA-like nucleotides. These heavily or fully modified duplexes are active against a range of mRNA targets. Effective patterns of modification were chosen based on screens using two sequences targeting firefly luciferase. We then applied the most effective duplex designs to the knockdown of the eIF4E binding proteins 4E-BP1 and 4E-BP2. We identified modified duplexes with potency comparable to native siRNA. Modified duplexes showed dramatically enhanced stability to serum nucleases, and were characterized by circular dichroism and thermal denaturation studies. Chemical modification significantly reduced the immunostimulatory properties of these siRNAs in human peripheral blood mononuclear cells. PMID:20413581
-
Hu, Zhi; Mao, Jian-Hua; Curtis, Christina; ...
2016-07-01
Background: High mitotic activity is associated with the genesis and progression of many cancers. Small molecule inhibitors of mitotic apparatus proteins are now being developed and evaluated clinically as anticancer agents. With clinical trials of several of these experimental compounds underway, it is important to understand the molecular mechanisms that determine high mitotic activity, identify tumor subtypes that carry molecular aberrations that confer high mitotic activity, and to develop molecular markers that distinguish which tumors will be most responsive to mitotic apparatus inhibitors. Methods: We identified a coordinately regulated mitotic apparatus network by analyzing gene expression profiles for 53 malignantmore » and non-malignant human breast cancer cell lines and two separate primary breast tumor datasets. We defined the mitotic network activity index (MNAI) as the sum of the transcriptional levels of the 54 coordinately regulated mitotic apparatus genes. The effect of those genes on cell growth was evaluated by small interfering RNA (siRNA). Results: High MNAI was enriched in basal-like breast tumors and was associated with reduced survival duration and preferential sensitivity to i nhibitors of the mitotic apparatus proteins, polo-like kinase, centromere associated protein E and aurora kinase designated GSK462364, GSK923295 and GSK1070916, respectively. Co-amplification of regions of chromosomes 8q24, 10p15-p12, 12p13, and 17q24-q25 was associated with the transcriptional upregulation of this network of 54 mitotic apparatus genes, and we identify transcription factors that localize to these regions and putatively regulate mitotic activity. Knockdown of the mitotic network by siRNA identified 22 genes that might be considered as additional therapeutic targets for this clinically relevant patient subgroup. Conclusions: We define a molecular signature which may guide therapeutic approaches for tumors with high mitotic network activity.« less
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hu, Zhi; Mao, Jian-Hua; Curtis, Christina
Background: High mitotic activity is associated with the genesis and progression of many cancers. Small molecule inhibitors of mitotic apparatus proteins are now being developed and evaluated clinically as anticancer agents. With clinical trials of several of these experimental compounds underway, it is important to understand the molecular mechanisms that determine high mitotic activity, identify tumor subtypes that carry molecular aberrations that confer high mitotic activity, and to develop molecular markers that distinguish which tumors will be most responsive to mitotic apparatus inhibitors. Methods: We identified a coordinately regulated mitotic apparatus network by analyzing gene expression profiles for 53 malignantmore » and non-malignant human breast cancer cell lines and two separate primary breast tumor datasets. We defined the mitotic network activity index (MNAI) as the sum of the transcriptional levels of the 54 coordinately regulated mitotic apparatus genes. The effect of those genes on cell growth was evaluated by small interfering RNA (siRNA). Results: High MNAI was enriched in basal-like breast tumors and was associated with reduced survival duration and preferential sensitivity to i nhibitors of the mitotic apparatus proteins, polo-like kinase, centromere associated protein E and aurora kinase designated GSK462364, GSK923295 and GSK1070916, respectively. Co-amplification of regions of chromosomes 8q24, 10p15-p12, 12p13, and 17q24-q25 was associated with the transcriptional upregulation of this network of 54 mitotic apparatus genes, and we identify transcription factors that localize to these regions and putatively regulate mitotic activity. Knockdown of the mitotic network by siRNA identified 22 genes that might be considered as additional therapeutic targets for this clinically relevant patient subgroup. Conclusions: We define a molecular signature which may guide therapeutic approaches for tumors with high mitotic network activity.« less
-
Novel mechanism of regulation of the DNA repair enzyme OGG1 in tuberin-deficient cells
Habib, Samy L.; Bhandari, Besant K.; Sadek, Nahed; Abboud-Werner, Sherry L.; Abboud, Hanna E.
2010-01-01
Tuberin (protein encodes by tuberous sclerosis complex 2, Tsc2) deficiency is associated with the decrease in the DNA repair enzyme 8-oxoG-DNA glycosylase (OGG1) in tumour kidney of tuberous sclerosis complex (TSC) patients. The purpose of this study was to elucidate the mechanisms by which tuberin regulates OGG1. The partial deficiency in tuberin expression that occurs in the renal proximal tubular cells and kidney cortex of the Eker rat is associated with decreased activator protein 4 (AP4) and OGG1 expression. A complete deficiency in tuberin is associated with loss of AP4 and OGG1 expression in kidney tumour from Eker rats and the accumulation of significant levels of 8-oxo-deoxyguanosine. Knockdown of tuberin expression in human renal epithelial cells (HEK293) with small interfering RNA (siRNA) also resulted in a marked decrease in the expression of AP4 and OGG1. In contrast, overexpression of tuberin in HEK293 cells increased the expression of AP4 and OGG1 proteins. Downregulation of AP4 expression using siRNA resulted in a significant decrease in the protein expression of OGG1. Immunoprecipitation studies show that AP4 is associated with tuberin in cells. Gel shift analysis and chromatin immunoprecipitation identified the transcription factor AP4 as a positive regulator of the OGG1 promoter. AP4 DNA-binding activity is significantly reduced in Tsc2−/− as compared with Tsc2+/+ cells. Transcriptional activity of the OGG1 promoter is also decreased in tuberin-null cells compared with wild-type cells. These data indicate a novel role for tuberin in the regulation of OGG1 through the transcription factor AP4. This regulation may be important in the pathogenesis of kidney tumours in patients with TSC disease. PMID:20837600
-
Yamazaki, Hiroki; Iwano, Tomomi; Otsuka, Saori; Kagawa, Yumiko; Hoshino, Yuki; Hosoya, Kenji; Okumura, Masahiro; Takagi, Satoshi
2015-04-01
Transitional cell carcinoma (TCC) in dogs is an aggressive malignant neoplasm, originating in the epithelium of the urinary bladder. The DEK nuclear protein is overexpressed in several types of human bladder cancer, where it is involved in chromatin reconstruction, gene transcription and apoptosis. Since DEK represents a potential therapeutic target for canine TCC, this study was designed to investigate DEK expression in canine TCC and to determine the effects of DEK mRNA silencing on TCC cells in vitro. The gene expression profiles of seven selected cancer-associated genes was assessed in four canine TCC cell lines and expression of DEK protein was evaluated in bladder tissue biopsies from healthy dogs and those affected with cystitis or TCC. After transfection of four canine TCC cell lines with DEK-specific or scrambled siRNA, annexin V staining was performed to evaluate apoptosis, and methylthiazole tetrazolium assays were performed to assess both cell viability and sensitivity to carboplatin. DEK mRNA expression was relatively high in canine TCC cells and expression of the DEK protein was significantly greater in TCC tumours compared with the other tissue samples. After transfection with DEK-specific siRNA, apoptosis, cell growth inhibition, and enhanced sensitivity to carboplatin were observed in all TCC cells assessed. These research findings suggest that DEK could be a potential therapeutic target for canine TCC. Copyright © 2015 Elsevier Ltd. All rights reserved.
-
Role of RNA interference (RNAi) in the Moss Physcomitrella patens.
Arif, Muhammad Asif; Frank, Wolfgang; Khraiwesh, Basel
2013-01-14
RNA interference (RNAi) is a mechanism that regulates genes by either transcriptional (TGS) or posttranscriptional gene silencing (PTGS), required for genome maintenance and proper development of an organism. Small non-coding RNAs are the key players in RNAi and have been intensively studied in eukaryotes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs are synthesized from a short hairpin structure while siRNAs are derived from long double-stranded RNAs (dsRNA). Both miRNA and siRNAs control the expression of cognate target RNAs by binding to reverse complementary sequences mediating cleavage or translational inhibition of the target RNA. They also act on the DNA and cause epigenetic changes such as DNA methylation and histone modifications. In the last years, the analysis of plant RNAi pathways was extended to the bryophyte Physcomitrella patens, a non-flowering, non-vascular ancient land plant that diverged from the lineage of seed plants approximately 450 million years ago. Based on a number of characteristic features and its phylogenetic key position in land plant evolution P. patens emerged as a plant model species to address basic as well as applied topics in plant biology. Here we summarize the current knowledge on the role of RNAi in P. patens that shows functional overlap with RNAi pathways from seed plants, and also unique features specific to this species.
-
High-Throughput Silencing Using the CRISPR-Cas9 System: A Review of the Benefits and Challenges.
Wade, Mark
2015-09-01
The clustered regularly interspaced short palindromic repeats (CRISPR)/Cas system has been seized upon with a fervor enjoyed previously by small interfering RNA (siRNA) and short hairpin RNA (shRNA) technologies and has enormous potential for high-throughput functional genomics studies. The decision to use this approach must be balanced with respect to adoption of existing platforms versus awaiting the development of more "mature" next-generation systems. Here, experience from siRNA and shRNA screening plays an important role, as issues such as targeting efficiency, pooling strategies, and off-target effects with those technologies are already framing debates in the CRISPR field. CRISPR/Cas can be exploited not only to knockout genes but also to up- or down-regulate gene transcription-in some cases in a multiplex fashion. This provides a powerful tool for studying the interaction among multiple signaling cascades in the same genetic background. Furthermore, the documented success of CRISPR/Cas-mediated gene correction (or the corollary, introduction of disease-specific mutations) provides proof of concept for the rapid generation of isogenic cell lines for high-throughput screening. In this review, the advantages and limitations of CRISPR/Cas are discussed and current and future applications are highlighted. It is envisaged that complementarities between CRISPR, siRNA, and shRNA will ensure that all three technologies remain critical to the success of future functional genomics projects. © 2015 Society for Laboratory Automation and Screening.
-
Liu, Rong-Yu; Cleary, Leonard J.; Byrne, John H.
2011-01-01
Accumulating evidence suggests that the transcriptional activator CREB1 is important for serotonin (5-HT)-induced long-term facilitation (LTF) of the sensorimotor synapse in Aplysia. Moreover, creb1 is among the genes activated by CREB1, suggesting a role for this protein beyond the induction phase of LTF. The time course of the requirement for CREB1 synthesis in the consolidation of long-term facilitation was examined using RNA interference (RNAi) techniques in sensorimotor co-cultures. Injection of CREB1 small-interfering RNA (siRNA) immediately or 10 h after 5-HT treatment blocked LTF when measured at 24 h and 48 h after treatment. In contrast, CREB1 siRNA did not block LTF when injected 16 h after 5-HT treatment. These results demonstrate that creb1 expression must be sustained for a relatively long time in order to support the consolidation of LTF. In addition, LTF is also accompanied by a long-term increase in the excitability (LTE) of sensory neurons (SNs). Because LTE was observed in the isolated SN after 5-HT treatment, this long-term change was intrinsic to that element of the circuit. LTE was blocked when CREB1 siRNA was injected into isolated SNs immediately after 5-HT treatment. These data suggest that 5-HT-induced CREB1 synthesis is required for consolidation of both LTF and LTE. PMID:21543617
-
Marasco, Michelle; Li, Weiyi; Lynch, Michael; Pikaard, Craig S
2017-11-02
All eukaryotes have three essential nuclear multisubunit RNA polymerases, abbreviated as Pol I, Pol II and Pol III. Plants are remarkable in having two additional multisubunit RNA polymerases, Pol IV and Pol V, which synthesize noncoding RNAs that coordinate RNA-directed DNA methylation for silencing of transposons and a subset of genes. Based on their subunit compositions, Pols IV and V clearly evolved as specialized forms of Pol II, but their catalytic properties remain undefined. Here, we show that Pols IV and V differ from one another, and Pol II, in nucleotide incorporation rate, transcriptional accuracy and the ability to discriminate between ribonucleotides and deoxyribonucleotides. Pol IV transcription is considerably more error-prone than Pols II or V, which may be tolerable in its synthesis of short RNAs that serve as precursors for siRNAs targeting non-identical members of transposon families. By contrast, Pol V exhibits high fidelity transcription, similar to Pol II, suggesting a need for Pol V transcripts to faithfully reflect the DNA sequence of target loci to which siRNA-Argonaute silencing complexes are recruited. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
-
Kim, Hyun Jin; Takemoto, Hiroyasu; Yi, Yu; Zheng, Meng; Maeda, Yoshinori; Chaya, Hiroyuki; Hayashi, Kotaro; Mi, Peng; Pittella, Frederico; Christie, R James; Toh, Kazuko; Matsumoto, Yu; Nishiyama, Nobuhiro; Miyata, Kanjiro; Kataoka, Kazunori
2014-09-23
For systemic delivery of siRNA to solid tumors, a size-regulated and reversibly stabilized nanoarchitecture was constructed by using a 20 kDa siRNA-loaded unimer polyion complex (uPIC) and 20 nm gold nanoparticle (AuNP). The uPIC was selectively prepared by charge-matched polyionic complexation of a poly(ethylene glycol)-b-poly(L-lysine) (PEG-PLL) copolymer bearing ∼40 positive charges (and thiol group at the ω-end) with a single siRNA bearing 40 negative charges. The thiol group at the ω-end of PEG-PLL further enabled successful conjugation of the uPICs onto the single AuNP through coordinate bonding, generating a nanoarchitecture (uPIC-AuNP) with a size of 38 nm and a narrow size distribution. In contrast, mixing thiolated PEG-PLLs and AuNPs produced a large aggregate in the absence of siRNA, suggesting the essential role of the preformed uPIC in the formation of nanoarchitecture. The smart uPIC-AuNPs were stable in serum-containing media and more resistant against heparin-induced counter polyanion exchange, compared to uPICs alone. On the other hand, the treatment of uPIC-AuNPs with an intracellular concentration of glutathione substantially compromised their stability and triggered the release of siRNA, demonstrating the reversible stability of these nanoarchitectures relative to thiol exchange and negatively charged AuNP surface. The uPIC-AuNPs efficiently delivered siRNA into cultured cancer cells, facilitating significant sequence-specific gene silencing without cytotoxicity. Systemically administered uPIC-AuNPs showed appreciably longer blood circulation time compared to controls, i.e., bare AuNPs and uPICs, indicating that the conjugation of uPICs onto AuNP was crucial for enhancing blood circulation time. Finally, the uPIC-AuNPs efficiently accumulated in a subcutaneously inoculated luciferase-expressing cervical cancer (HeLa-Luc) model and achieved significant luciferase gene silencing in the tumor tissue. These results demonstrate the strong potential of uPIC-AuNP nanoarchitectures for systemic siRNA delivery to solid tumors.
-
Rebamipide inhibits gastric cancer growth by targeting survivin and Aurora-B
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tarnawski, A.; University of California, Irvine, CA 92697; E-mail: andrzej.tarnawski@med.va.gov
Rebamipide accelerates healing of gastric ulcers and gastritis but its actions on gastric cancer are not known. Survivin, an anti-apoptosis protein, is overexpressed in stem, progenitor, and cancer cells. In gastric cancer, increased and sustained survivin expression provides survival advantage and facilitates tumor progression and resistance to anti-cancer drugs. Aurora-B kinase is essential for chromosome alignment and mitosis progression but surprisingly its role in gastric cancer has not been explored. We examined in human gastric cancer AGS cells: (1) survivin expression, (2) localization of survivin and Aurora-B (3) cell proliferation, and (4) effects of specific survivin siRNA and/or rebamipide (freemore » radical scavenging drug) on survivin and Aurora-B expression and cell proliferation. Survivin and Aurora-B are strongly expressed in human AGS gastric cancer cells and co-localize during mitosis. Survivin siRNA significantly reduces AGS cell viability. Rebamipide significantly downregulates in AGS cell survivin expression, its association with Aurora-B and cell proliferation. Rebamipide-induced downregulation of survivin is at the transcription level and does not involve ubiquitin-proteasome pathway.« less
-
An in vitro reprogrammable antiviral RISC with size-preferential ribonuclease activity.
Omarov, Rustem T; Ciomperlik, Jessica; Scholthof, Herman B
2016-03-01
Infection of Nicotiana benthamiana plants with Tomato bushy stunt virus (TBSV) mutants compromised for silencing suppression induces formation of an antiviral RISC (vRISC) that can be isolated using chromatography procedures. The isolated vRISC sequence-specifically degrades TBSV RNA in vitro, its activity can be down-regulated by removing siRNAs, and re-stimulated by exogenous supply of siRNAs. vRISC is most effective at hydrolyzing the ~4.8kb genomic RNA, but less so for a ~2.2kb TBSV subgenomic mRNA (sgRNA1), while the 3' co-terminal sgRNA2 of ~0.9kb appears insensitive to vRISC cleavage. Moreover, experiments with in vitro generated 5' co-terminal viral transcripts show that RNAs of ~2.7kb are efficiently cleaved while those of ~1.1kb or shorter are unaffected. The isolated antiviral ribonuclease complex fails to degrade ~0.4kb defective interfering RNAs (DIs) in vitro, agreeing with findings that in plants DIs are not targeted by silencing. Copyright © 2016. Published by Elsevier Inc.
-
Ju, Zhihai; Ma, Jinhui; Wang, Chen; Yu, Jie; Qiao, Yeru; Hei, Feilong
2017-04-01
The pro-inflammatory activation of pulmonary microvascular endothelial cells resulting in continuous expression of cellular adhesion molecules, and subsequently recruiting primed neutrophils to form a firm neutrophils-endothelium (PMN-EC) adhesion, has been examined and found to play a vital role in acute lung injury (ALI). RNA interference (RNAi) is a cellular process through harnessing a natural pathway silencing target gene based on recognition and subsequent degradation of specific mRNA sequences. It opens a promising approach for precision medicine. However, this application was hampered by many obstacles, such as immunogenicity, instability, toxicity problems, and difficulty in across the biological membrane. In this study, we reprogrammed urine exfoliated renal epithelial cells into human induced pluripotent stem cells (huiPSCs) and purified the exosomes (Exo) from huiPSCs as RNAi delivery system. Through choosing the episomal system to deliver transcription factors, we obtained a non-integrating huiPSCs. Experiments in both vitro and vivo demonstrated that these huiPSCs possess the pluripotent properties. The exosomes of huiPSCs isolated by differential centrifugation were visualized by transmission electron microscopy (TEM) showing a typical exosomal appearance with an average diameter of 122 nm. Immunoblotting confirmed the presence of the typical exosomal markers, including CD63, TSG 101, and Alix. Co-cultured PKH26-labeled exosomes with human primary pulmonary microvascular endothelial cells (HMVECs) confirmed that they could be internalized by recipient cells at a time-dependent manner. Then, electroporation was used to introduce siRNA against intercellular adhesion molecule-1 (ICAM-1) into exosomes to form an Exo/siRNA compound. The Exo/siRNA compound efficiently delivered the target siRNA into HMVECs causing selective gene silencing, inhibiting the ICAM-1 protein expression, and PMN-EC adhesion induced by lipopolysaccharide (LPS). These data suggest that huiPSCs exosomes could be used as a natural gene delivery vector to transport therapeutic siRNAs for alleviating inflammatory responses in recipient cells.
-
Mead, Timothy J.; Koch, Christopher D.; Biscotti, Charles V.; Falcone, Tommaso; Apte, Suneel S.
2017-01-01
Context: Leiomyomas have abundant extracellular matrix (ECM), with upregulation of versican, a large proteoglycan. Objective: We investigated ADAMTS (a disintegrin-like and metalloprotease with thrombospondin type 1 motifs) protease-mediated versican cleavage in myometrium and leiomyoma and the effect of versican knockdown in leiomyoma cells. Design: We used quantitative reverse transcription polymerase chain reaction (qRT-PCR), western blotting, immunohistochemistry, and RNA in situ hybridization for analysis of myometrium, leiomyoma and immortalized myometrium and leiomyoma cells. Short interfering RNA (siRNA) was used to knockdown versican in leiomyoma cells. Setting: This study was performed in an academic laboratory. Patients: Study subjects were women with symptomatic or asymptomatic leiomyoma. Main Outcome Measures: We quantified messenger RNAs (mRNAs) for versican splice variants. We identified ADAMTS-cleaved versican in myometrium and leiomyoma and ADAMTS messenger RNAs and examined the effect of VCAN siRNA on smooth muscle differentiation and expression of estrogen and progesterone receptors. Results: The women in the symptomatic group (n = 7) had larger leiomyoma (P = 0.01), heavy menstrual bleeding (P < 0.01), and lower hemoglobin levels (P = 0.02) compared with the asymptomatic group (n = 7), but were similar in age and menopausal status. Versican V0 and V1 isoforms were upregulated in the leiomyomas of symptomatic versus asymptomatic women (P = 0.03 and P = 0.04, respectively). Abundant cleaved versican was detected in leiomyoma and myometrium, as well as in myometrial and leiomyoma cell lines. ADAMTS4 (P = 0.03) and ADAMTS15 (P = 0.04) were upregulated in symptomatic leiomyomas. VCAN siRNA did not effect cell proliferation, apoptosis, or smooth muscle markers, but reduced ESR1 and PR-A expression (P = 0.001 and P = 0.002, respectively). Conclusions: Versican in myometrium, leiomyomas and in the corresponding immortalized cells is cleaved by ADAMTS proteases. VCAN siRNA suppresses production of estrogen receptor 1 and progesterone receptor-A. These findings have implications for leiomyoma growth. PMID:28323982
-
Gueye, Ndeye-Aicha; Mead, Timothy J; Koch, Christopher D; Biscotti, Charles V; Falcone, Tommaso; Apte, Suneel S
2017-05-01
Leiomyomas have abundant extracellular matrix (ECM), with upregulation of versican, a large proteoglycan. We investigated ADAMTS (a disintegrin-like and metalloprotease with thrombospondin type 1 motifs) protease-mediated versican cleavage in myometrium and leiomyoma and the effect of versican knockdown in leiomyoma cells. We used quantitative reverse transcription polymerase chain reaction (qRT-PCR), western blotting, immunohistochemistry, and RNA in situ hybridization for analysis of myometrium, leiomyoma and immortalized myometrium and leiomyoma cells. Short interfering RNA (siRNA) was used to knockdown versican in leiomyoma cells. This study was performed in an academic laboratory. Study subjects were women with symptomatic or asymptomatic leiomyoma. We quantified messenger RNAs (mRNAs) for versican splice variants. We identified ADAMTS-cleaved versican in myometrium and leiomyoma and ADAMTS messenger RNAs and examined the effect of VCAN siRNA on smooth muscle differentiation and expression of estrogen and progesterone receptors. The women in the symptomatic group (n = 7) had larger leiomyoma (P = 0.01), heavy menstrual bleeding (P < 0.01), and lower hemoglobin levels (P = 0.02) compared with the asymptomatic group (n = 7), but were similar in age and menopausal status. Versican V0 and V1 isoforms were upregulated in the leiomyomas of symptomatic versus asymptomatic women (P = 0.03 and P = 0.04, respectively). Abundant cleaved versican was detected in leiomyoma and myometrium, as well as in myometrial and leiomyoma cell lines. ADAMTS4 (P = 0.03) and ADAMTS15 (P = 0.04) were upregulated in symptomatic leiomyomas. VCAN siRNA did not effect cell proliferation, apoptosis, or smooth muscle markers, but reduced ESR1 and PR-A expression (P = 0.001 and P = 0.002, respectively). Versican in myometrium, leiomyomas and in the corresponding immortalized cells is cleaved by ADAMTS proteases. VCAN siRNA suppresses production of estrogen receptor 1 and progesterone receptor-A. These findings have implications for leiomyoma growth. Copyright © 2017 by the Endocrine Society
-
Zhelev, Zhivko; Bakalova, Rumiana; Ohba, Hideki; Ewis, Ashraf; Ishikawa, Mitsuru; Shinohara, Yasuo; Baba, Yoshinobu
2004-07-16
Short 21-mer double-stranded/small-interfering RNAs (ds/siRNAs) were designed to target bcr-abl mRNA in chronic myelogenous leukemia. The ds/siRNAs were transfected into bcr-abl-positive K-562 (derived from blast crisis chronic myelogenous leukemia), using lipofectamine. Penetrating of ds/siRNAs into the cells was detected by fluorescent confocal microscopy, using fluorescein-labeled ds/siRNAs. The cells were treated with mix of three siRNA sequences (3 x 60 nM) during 6 days with three repetitive transfections. The siRNA-treatment was accompanied with significant reduction of bcr-abl mRNA, p210, protein tyrosine kinase activity and cell proliferation index. Treatment of cells with Glivec (during 8 days with four repetitive doses, 180 nM single dose) resulted in analogous reduction of cell proliferation activity, stronger suppression of protein tyrosine kinase activity, and very low reduction of p210. siRNA-mix and Glivec did not affect significantly the viability of normal lymphocytes. Microarray analysis of siRNA- and Glivec-treated K-562 cells demonstrated that both pathways of bcr-abl suppression were accompanied with overexpression and suppression of many different oncogenes, apoptotic/antiapoptotic and cell proliferation factors. The following genes of interest were found to decrease in relatively equal degree in both siRNA- and Glivec-treated cells: Bcd orf1 and orf2 proto-oncogene, chromatin-specific transcription elongation factor FACT 140-kDa subunit mRNA, gene encoding splicing factor SF1, and mRNA for Tec protein tyrosine kinase. siRNA-mix and Glivec provoked overexpression of the following common genes: c-jun proto-oncogene, protein kinase C-alpha, pvt-1 oncogene homologue (myc activator), interleukin-6, 1-8D gene from interferon-inducible gene family, tumor necrosis factor receptor superfamily (10b), and STAT-induced STAT inhibitor.
-
Genetic Manipulation of Schistosoma haematobium, the Neglected Schistosome
Rinaldi, Gabriel; Okatcha, Tunika I.; Popratiloff, Anastas; Ayuk, Mary A.; Suttiprapa, Sutas; Mann, Victoria H.; Liang, Yung-san; Lewis, Fred A.; Loukas, Alex; Brindley, Paul J.
2011-01-01
Background Minimal information on the genome and proteome of Schistosoma haematobium is available, in marked contrast to the situation with the other major species of human schistosomes for which draft genome sequences have been reported. Accordingly, little is known about functional genomics in S. haematobium, including the utility or not of RNA interference techniques that, if available, promise to guide development of new interventions for schistosomiasis haematobia. Methods/Findings Here we isolated and cultured developmental stages of S. haematobium, derived from experimentally infected hamsters. Targeting different developmental stages, we investigated the utility of soaking and/or square wave electroporation in order to transfect S. haematobium with nucleic acid reporters including Cy3-labeled small RNAs, messenger RNA encoding firefly luciferase, and short interfering RNAs (siRNAs). Three hours after incubation of S. haematobium eggs in 50 ng/µl Cy3-labeled siRNA, fluorescent foci were evident indicating that labeled siRNA had penetrated into miracidia developing within the egg shell. Firefly luciferase activity was detected three hours after square wave electroporation of the schistosome eggs and adult worms in 150 ng/µl of mRNA. RNA interference knockdown (silencing) of reporter luciferase activity was seen following the introduction of dsRNA specific for luciferase mRNA in eggs, schistosomules and mixed sex adults. Moreover, introduction of an endogenous gene-specific siRNA into adult schistosomes silenced transcription of tetraspanin 2 (Sh-tsp-2), the apparent orthologue of the Schistosoma mansoni gene Sm-tsp-2 which encodes the surface localized structural and signaling protein Sm-TSP-2. Together, knockdown of reporter luciferase and Sh-tsp-2 indicated the presence of an intact RNAi pathway in S. haematobium. Also, we employed laser scanning confocal microscopy to view the adult stages of S. haematobium. Conclusions These findings and approaches should facilitate analysis of gene function in S. haematobium, which in turn could facilitate the characterization of prospective intervention targets for this neglected tropical disease pathogen. PMID:22022628
-
Rho GTPases and Regulation of Cell Migration and Polarization in Human Corneal Epithelial Cells
Hou, Aihua; Toh, Li Xian; Gan, Kah Hui; Lee, Khee Jin Ryan; Manser, Edward; Tong, Louis
2013-01-01
Purpose Epithelial cell migration is required for regeneration of tissues and can be defective in a number of ocular surface diseases. This study aimed to determine the expression pattern of Rho family small G-proteins in human corneal epithelial cells to test their requirement in directional cell migration. Methods Rho family small G-protein expression was assessed by reverse transcription-polymerase chain reaction. Dominant-inhibitory constructs encoding Rho proteins or Rho protein targeting small interfering RNA were transfected into human corneal epithelial large T antigen cells, and wound closure rate were evaluated by scratch wounding assay, and a complementary non-traumatic cell migration assay. Immunofluorescence staining was performed to study cell polarization and to assess Cdc42 downstream effector. Results Cdc42, Chp, Rac1, RhoA, TC10 and TCL were expressed in human corneal epithelial cells. Among them, Cdc42 and TCL were found to significantly affect cell migration in monolayer scratch assays. These results were confirmed through the use of validated siRNAs directed to Cdc42 and TCL. Scramble siRNA transfected cells had high percentage of polarized cells than Cdc42 or TCL siRNA transfected cells at the wound edge. We showed that the Cdc42-specific effector p21-activated kinase 4 localized predominantly to cell-cell junctions in cell monolayers, but failed to translocate to the leading edge in Cdc42 siRNA transfected cells after monolayer wounding. Conclusion Rho proteins expressed in cultured human corneal epithelial cells, and Cdc42, TCL facilitate two-dimensional cell migration in-vitro. Although silencing of Cdc42 and TCL did not noticeably affect the appearance of cell adhesions at the leading edge, the slower migration of these cells indicates both GTP-binding proteins play important roles in promoting cell movement of human corneal epithelial cells. PMID:24130842
-
Fitzgerald, Kathleen A; Guo, Jianfeng; Raftery, Rosanne M; Castaño, Irene Mencía; Curtin, Caroline M; Gooding, Matt; Darcy, Raphael; O' Brien, Fergal J; O' Driscoll, Caitriona M
2016-09-25
siRNA has emerged as a potential therapeutic for the treatment of prostate cancer but effective delivery remains a major barrier to its clinical application. This study aimed to develop and characterise a 3D in vitro co-culture model to simulate prostate cancer bone metastasis and to assess the ability of the model to investigate nanoparticle-mediated siRNA delivery and gene knockdown. PC3 or LNCaP prostate cancer cells were co-cultured with hFOB 1.19 osteoblast cells in 2D on plastic tissue culture plates and in 3D on collagen scaffolds mimicking the bone microenvironment. To characterise the co-culture model, cell proliferation, enzyme secretion and the utility of two different gene delivery vectors to mediate siRNA uptake and gene knockdown were assessed. Cell proliferation was reduced by∼50% by day 7 in the co-culture system relative to monoculture (PC3 and LNCaP co-cultures, in 2D and 3D) and an enhanced level of MMP9 (a marker of bone metastasis) was secreted into the media (1.2-4-fold increase depending on the co-culture system). A cationic cyclodextrin gene delivery vector proved significantly less toxic in the co-culture system relative to the commercially available vector Lipofectamine 2000(®). In addition, knockdown of both the GAPDH gene (minimum 15%) and RelA subunit of the NF-κB transcription factor (minimum 20%) was achieved in 2D and 3D cell co-cultures. Results indicate that the prostate cancer-osteoblast in vitro co-culture model was more physiologically relevant vs the monoculture. This model has the potential to help improve the design and efficacy of gene delivery formulations, to more accurately predict in vivo performance and, therefore, to reduce the risk of product failure in late-stage clinical development. Copyright © 2016 Elsevier B.V. All rights reserved.
-
Naghitorabi, Mojgan; Mir Mohammad Sadeghi, Hamid; Mohammadi Asl, Javad; Rabbani, Mohammad; Jafarian-Dehkordi, Abbas
2017-01-01
Promoter methylation is one of the main epigenetic mechanisms that leads to the inactivation of tumor suppressor genes during carcinogenesis. Due to the reversible nature of DNA methylation, many studies have been performed to correct theses epigenetic defects by inhibiting DNA methyltransferases (DNMTs). In this case novel therapeutics especially siRNA oligonucleotides have been used to specifically knock down the DNMTs at mRNA level. Also many studies have focused on transcriptional gene silencing in mammalian cells via siRNA mediated promoter methylation. The present study was designed to assess the role of siRNA mediated promoter methylation in DNMT3B knockdown and alteration of promoter methylation of Cadherin-1 (CDH1), Glutathione S-Transferase Pi 1(GSTP1), and DNMT3B genes in MDA-MB-453 cell line. MDA-MB-453 cells were transfected with siDNMT targeting DNMT3B promoter and harvested at 24 and 48 h post transfection to monitor gene silencing and promoter methylation respectively. DNMT3B expression was monitored by quantitative RT-PCR method. Promoter methylation was quantitatively evaluated using differential high resolution melting analysis. A non-significant 20% reduction in DNMT3B mRNA level was shown only after first transfection with siDNMT, which was not reproducible. Promoter methylation levels of DNMT3B, CDH1, and GSTP1 were detected at about 15%, 70% and 10% respectively, in the MDA-MB-453 cell line, with no significant change after transfection. Our results indicated that siDNMT sequence were not able to affect promoter methylation and silencing of DNMT3B in MDA-MB-453 cells. However, quantitation of methylation confirmed a hypermethylated phenotype at CDH1 and GSTP1 promoters as well as a differential methylation pattern at DNMT3B promoter in breast cancer.
-
Israni, B; Rajam, M V
2017-04-01
RNA interference mediated gene silencing, which is triggered by double-stranded RNA (dsRNA), has become a important tool for functional genomics studies in various systems, including insects. Bacterially produced dsRNA employs the use of a bacterial strain lacking in RNaseIII activity and harbouring a vector with dual T7 promoter sites, which allow the production of intact dsRNA molecules. Here, we report an assessment of the functional relevance of the ecdysone receptor, insect intestinal mucin and sericotropin genes through silencing by dsRNA in two lepidopteran insect pests, Helicoverpa armigera and Plutella xylostella, both of which cause serious crop losses. Oral feeding of dsRNA led to significant reduction in transcripts of the target insect genes, which caused significant larval mortality with various moulting anomalies and an overall developmental delay. We also found a significant decrease in reproductive potential in female moths, with a drop in egg laying and compromised egg hatching from treated larvae as compared to controls. dsRNA was stable in the insect gut and was efficiently processed into small interfering RNAs (siRNAs), thus accounting for the phenotypes observed in the present work. The study revealed the importance of these genes in core insect processes, which are essential for insect development and survival. © 2016 The Royal Entomological Society.
-
Lin, Ai-Hsuan; Chen, Haw-Wen; Liu, Cheng-Tze; Tsai, Chia-Wen; Lii, Chong-Kuei
2012-07-04
Numerous genes expression is regulated in response to amino acid shortage, which helps organisms adapt to amino acid limitation. The expression of the π class of glutathione (GSH) S-transferase (GSTP), a highly inducible phase II detoxification enzyme, is regulated mainly by activates activating protein 1 (AP-1) binding to the enhancer I of GSTP (GPEI). Here we show the critical role of nuclear factor erythroid-2-related factor 2 (Nrf2) in up-regulating GSTP gene transcription. Primary rat hepatocytes were cultured in a methionine-restricted medium, and immunoblotting and RT-PCR analyses showed that methionine restriction time-dependently increased GSTP protein and mRNA expression over a 48 h period. Nrf2 translocation to the nucleus, nuclear proteins binding to GPEI, and antioxidant response element (ARE) luciferase reporter activity were increased by methionine restriction as well as by l-buthionine sulfoximine (BSO), a GSH synthesis inhibitor. Transfection with Nrf2 siRNA knocked down Nrf2 expression and reversed the methionine-induced GSTP expression and GPEI binding activity. Chromatin immunoprecipitation assay confirmed the binding of Nrf2 to the GPEI. Phosphorylation of extracellular signal-regulated kinase 2 (ERK2) was increased in methionine-restricted and BSO-treated cells. ERK2 siRNA abolished methionine restriction-induced Nrf2 nuclear translocation, GPEI binding activity, ARE-luciferase reporter activity, and GSTP expression. Our results suggest that the up-regulation of GSTP gene transcription in response to methionine restriction likely occurs via the ERK-Nrf2-GPEI signaling pathway.
-
Knowles, Helen J; Schaefer, Karl-Ludwig; Dirksen, Uta; Athanasou, Nicholas A
2010-07-16
Hypoxia regulates gene expression via the transcription factor HIF (Hypoxia-Inducible Factor). Little is known regarding HIF expression and function in primary bone sarcomas. We describe HIF expression and phenotypic effects of hypoxia, hypoglycaemia and HIF in Ewing's sarcoma and osteosarcoma. HIF-1alpha and HIF-2alpha immunohistochemistry was performed on a Ewing's tumour tissue array. Ewing's sarcoma and osteosarcoma cell lines were assessed for HIF pathway induction by Western blot, luciferase assay and ELISA. Effects of hypoxia, hypoglycaemia and isoform-specific HIF siRNA were assessed on proliferation, apoptosis and migration. 17/56 Ewing's tumours were HIF-1alpha-positive, 15 HIF-2alpha-positive and 10 positive for HIF-1alpha and HIF-2alpha. Expression of HIF-1alpha and cleaved caspase 3 localised to necrotic areas. Hypoxia induced HIF-1alpha and HIF-2alpha in Ewing's and osteosarcoma cell lines while hypoglycaemia specifically induced HIF-2alpha in Ewing's. Downstream transcription was HIF-1alpha-dependent in Ewing's sarcoma, but regulated by both isoforms in osteosarcoma. In both cell types hypoglycaemia reduced cellular proliferation by >or= 45%, hypoxia increased apoptosis and HIF siRNA modulated hypoxic proliferation and migration. Co-localisation of HIF-1alpha and necrosis in Ewing's sarcoma suggests a role for hypoxia and/or hypoglycaemia in in vivo induction of HIF. In vitro data implicates hypoxia as the primary HIF stimulus in both Ewing's and osteosarcoma, driving effects on proliferation and apoptosis. These results provide a foundation from which to advance understanding of HIF function in the pathobiology of primary bone sarcomas.
-
Han, Yue; Wang, Lu; Yao, Qing-Ping; Zhang, Ping; Liu, Bo; Wang, Guo-Liang; Shen, Bao-Rong; Cheng, Binbin; Wang, Yingxiao; Jiang, Zong-Lai; Qi, Ying-Xin
2015-05-01
The dysfunction of vascular endothelial cells (ECs) influenced by flow shear stress is crucial for vascular remodeling. However, the roles of nuclear envelope (NE) proteins in shear stress-induced EC dysfunction are still unknown. Our results indicated that, compared with normal shear stress (NSS), low shear stress (LowSS) suppressed the expression of two types of NE proteins, Nesprin2 and LaminA, and increased the proliferation and apoptosis of ECs. Targeted small interfering RNA (siRNA) and gene overexpression plasmid transfection revealed that Nesprin2 and LaminA participate in the regulation of EC proliferation and apoptosis. A protein/DNA array was further used to detect the activation of transcription factors in ECs following transfection with target siRNAs and overexpression plasmids. The regulation of AP-2 and TFIID mediated by Nesprin2 and the activation of Stat-1, Stat-3, Stat-5 and Stat-6 by LaminA were verified under shear stress. Furthermore, using Ingenuity Pathway Analysis software and real-time RT-PCR, the effects of Nesprin2 or LaminA on the downstream target genes of AP-2, TFIID, and Stat-1, Stat-3, Stat-5 and Stat-6, respectively, were investigated under LowSS. Our study has revealed that NE proteins are novel mechano-sensitive molecules in ECs. LowSS suppresses the expression of Nesprin2 and LaminA, which may subsequently modulate the activation of important transcription factors and eventually lead to EC dysfunction. Copyright © 2015 Elsevier B.V. All rights reserved.
-
Li, Shuxia; Liu, Jinxin; Liu, Zhongyuan; Li, Xiaorong; Wu, Feijie; He, Yuke
2014-01-01
Many heat stress transcription factors (Hsfs) and heat shock proteins (Hsps) have been identified to play important roles in the heat tolerance of plants. However, many of the key factors mediating the heat response pathways remain unknown. Here, we report that two genes, which are targets of TAS1 (trans-acting siRNA precursor 1)–derived small interfering RNAs that we named HEAT-INDUCED TAS1 TARGET1 (HTT1) and HTT2, are involved in thermotolerance. Microarray analysis revealed that the HTT1 and HTT2 genes were highly upregulated in Arabidopsis thaliana seedlings in response to heat shock. Overexpression of TAS1a, whose trans-acting small interfering RNAs target the HTT genes, elevated accumulation of TAS1-siRNAs and reduced expression levels of the HTT genes, causing weaker thermotolerance. By contrast, overexpression of HTT1 and HTT2 upregulated several Hsf genes, leading to stronger thermotolerance. In heat-tolerant plants overexpressing HsfA1a, the HTT genes were upregulated, especially at high temperatures. Meanwhile, HsfA1a directly activated HTT1 and HTT2 through binding to their promoters. HTT1 interacted with the heat shock proteins Hsp70-14 and Hsp40 and NUCLEAR FACTOR Y, SUBUNIT C2. Taken together, these results suggest that HTT1 mediates thermotolerance pathways because it is targeted by TAS1a, mainly activated by HsfA1a, and acts as cofactor of Hsp70-14 complexes. PMID:24728648
-
Ren, Gang; Eskandari, Parisa; Wang, Siqian; Smas, Cynthia M
2016-01-15
The gene for Small Adipocyte Factor 1, Smaf1 (also known as adipogenin, ADIG), encodes a ∼600 base transcript that is highly upregulated during 3T3-L1 in vitro adipogenesis and markedly enriched in adipose tissues. Based on the lack of an obvious open reading frame in the Smaf1 transcript, it is not known if the Smaf1 gene is protein coding or non-coding RNA. Using a peptide from a putative open reading frame of Smaf1 as antigen, we generated antibodies for western analysis. Our studies prove that Smaf1 encodes an adipose-enriched protein which in western blot analysis migrates at ∼10 kDa. Rapid induction of Smaf1 protein occurs during in vitro adipogenesis and its expression in 3T3-L1 adipocytes is positively regulated by insulin and glucose. Moreover, siRNA studies reveal that expression of Smaf1 in adipocytes is wholly dependent on PPARγ. On the other hand, use of siRNA for Smaf1 to nearly abolish its protein expression in adipocytes revealed that Smaf1 does not have a major role in adipocyte triglyceride accumulation, lipolysis or insulin-stimulated pAkt induction. However, immunolocalization studies using HA-tagged Smaf1 reveal enrichment at adipocyte lipid droplets. Together our findings show that Smaf1 is a novel small protein endogenous to adipocytes and that Smaf1 expression is closely tied to PPARγ-mediated signals and the adipocyte phenotype. Copyright © 2015 Elsevier Inc. All rights reserved.
-
Xie, Yuan; Yu, Nian; Chen, Yan; Zhang, Kang; Ma, Hai-Yan; Di, Qing
2017-01-01
Overexpression of P-glycoprotein (P-gp) in the brain is an important mechanism involved in drug-resistant epilepsy (DRE). High-mobility group box 1 (HMGB1), an inflammatory cytokine, significantly increases following seizures and may be involved in upregulation of P-gp. However, the underlying mechanisms remain elusive. The aim of the present study was to evaluate the role of HMGB1 and its downstream signaling components, receptor for advanced glycation end-product (RAGE) and nuclear factor-κB (NF-κB), on P-gp expression in rat brains during status epilepticus (SE). Small interfering RNA (siRNA) was administered to rats prior to induction of SE by pilocarpine, to block transcription of the genes encoding HMGB1 and RAGE, respectively. An inhibitor of NF-κB, pyrrolidinedithiocarbamic acid (PDTC), was utilized to inhibit activation of NF-κB. The expression levels of HMGB1, RAGE, phosphorylated-NF-κB p65 (p-p65) and P-gp were detected by western blotting. The relative mRNA expression levels of the genes encoding these proteins were measured using reverse transcription-quantitative polymerase chain reaction and the cellular localization of the proteins was determined by immunofluorescence. Pre-treatment with HMGB1 siRNA reduced the expression levels of RAGE, p-p65 and P-gp. PDTC reduced the expression levels of P-gp. These findings suggested that overexpression of P-gp during seizures may be regulated by HMGB1 via the RAGE/NF-κB signaling pathway, and may be a novel target for treating DRE. PMID:28627626
-
Traf2 interacts with Smad4 and regulates BMP signaling pathway in MC3T3-E1 osteoblasts
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shimada, Koichi, E-mail: shimada-ki@dent.nihon-u.ac.jp; Division of Advanced Dental Treatment, Dental Research Center, Nihon University School of Dentistry, Tokyo; Ikeda, Kyoko
2009-12-18
Bone morphogenetic proteins (BMPs) play important roles in osteoblast differentiation and maturation. In mammals, the BMP-induced receptor-regulated Smads form complexes with Smad4. These complexes translocate and accumulate in the nucleus, where they regulate the transcription of various target genes. However, the function of Smad4 remains unclear. We performed a yeast two-hybrid screen using Smad4 as bait and a cDNA library derived from bone marrow, to indentify the proteins interacting with Smad4. cDNA clones for Tumor necrosis factor (TNF) receptor-associated factor 2 (Traf2) were identified, and the interaction between the endogenous proteins was confirmed in the mouse osteoblast cell line MC3T3-E1.more » To investigate the function of Traf2, we silenced it with siRNA. The level of BMP-2 protein in the medium, the expression levels of the Bmp2 gene and BMP-induced transcription factor genes, including Runx2, Dlx5, Msx2, and Sp7, and the phosphorylated-Smad1 protein level were increased in cells transfected with Traf2 siRNA. The nuclear accumulation of Smad1 increased with TNF-{alpha} stimulation for 30 min at Traf2 silencing. These results suggest that the TNF-{alpha}-stimulated nuclear accumulation of Smad1 may be dependent on Traf2. Thus, the interaction between Traf2 and Smad4 may play a role in the cross-talk between TNF-{alpha} and BMP signaling pathways.« less
-
Nelson, Christopher E; Kintzing, James R; Hanna, Ann; Shannon, Joshua M; Gupta, Mukesh K; Duvall, Craig L
2013-10-22
A family of pH-responsive diblock polymers composed of poly[(ethylene glycol)-b-[(2-(dimethylamino)ethyl methacrylate)-co-(butyl methacrylate)], PEG-(DMAEMA-co-BMA), was reversible addition-fragmentation chain transfer (RAFT) synthesized with 0-75 mol % BMA in the second polymer block. The relative mole % of DMAEMA and BMA was varied in order to identify a polymer that can be used to formulate PEGylated, siRNA-loaded polyplex nanoparticles (NPs) with an optimized balance of cationic and hydrophobic content in the NP core based on siRNA packaging, cytocompatibility, blood circulation half-life, endosomal escape, and in vivo bioactivity. The polymer with 50:50 mol % of DMAEMA:BMA (polymer "50 B") in the RAFT-polymerized block efficiently condensed siRNA into 100 nm NPs that displayed pH-dependent membrane disruptive behavior finely tuned for endosomal escape. In vitro delivery of siRNA with polymer 50 B produced up to 94% protein-level knockdown of the model gene luciferase. The PEG corona of the NPs blocked nonspecific interactions with constituents of human whole blood, and the relative hydrophobicity of polymer 50 B increased NP stability in the presence of human serum or the polyanion heparin. When injected intravenously, 50 B NPs enhanced blood circulation half-life 3-fold relative to more standard PEG-DMAEMA (0 B) NPs (p < 0.05), due to improved stability and a reduced rate of renal clearance. The 50 B NPs enhanced siRNA biodistribution to the liver and other organs and significantly increased gene silencing in the liver, kidneys, and spleen relative to the benchmark polymer 0 B (p < 0.05). These collective findings validate the functional significance of tuning the balance of cationic and hydrophobic content of polyplex NPs utilized for systemic siRNA delivery in vivo.
-
Raja, Priya; Jackel, Jamie N; Li, Sizhun; Heard, Isaac M; Bisaro, David M
2014-03-01
Arabidopsis encodes five double-stranded RNA binding (DRB) proteins. DRB1 and DRB2 are involved in microRNA (miRNA) biogenesis, while DRB4 functions in cytoplasmic posttranscriptional small interfering RNA (siRNA) pathways. DRB3 and DRB5 are not involved in double-stranded RNA (dsRNA) processing but assist in silencing transcripts targeted by DRB2-associated miRNAs. The goal of this study was to determine which, if any, of the DRB proteins might also participate in a nuclear siRNA pathway that leads to geminivirus genome methylation. Here, we demonstrate that DRB3 functions with Dicer-like 3 (DCL3) and Argonaute 4 (AGO4) in methylation-mediated antiviral defense. Plants employ repressive viral genome methylation as an epigenetic defense against geminiviruses, using an RNA-directed DNA methylation (RdDM) pathway similar to that used to suppress endogenous invasive DNAs such as transposons. Chromatin methylation inhibits virus replication and transcription, and methylation-deficient host plants are hypersusceptible to geminivirus infection. Using a panel of drb mutants, we found that drb3 plants uniquely exhibit a similar hypersensitivity and that viral genome methylation is substantially reduced in drb3 compared to wild-type plants. In addition, like dcl3 and ago4 mutants, drb3 plants fail to recover from infection and cannot accomplish the viral genome hypermethylation that is invariably observed in asymptomatic, recovered tissues. Small RNA analysis, bimolecular fluorescence complementation, and coimmunoprecipitation experiments show that DRB3 acts downstream of siRNA biogenesis and suggest that it associates with DCL3 and AGO4 in distinct subnuclear compartments. These studies reveal that in addition to its previously established role in the miRNA pathway, DRB3 also functions in antiviral RdDM. Plants use RNA-directed DNA methylation (RdDM) as an epigenetic defense against geminiviruses. RNA silencing pathways in Arabidopsis include five double-stranded RNA binding proteins (DRBs) related to Drosophila R2D2 and mammalian TRBP and PACT. While DRB proteins have defined roles in miRNA and cytoplasmic siRNA pathways, a role in nuclear RdDM was elusive. Here, we used the geminivirus system to show that DRB3 is involved in methylation-mediated antiviral defense. Beginning with a panel of Arabidopsis drb mutants, we demonstrated that drb3 plants uniquely show enhanced susceptibility to geminiviruses. Further, like dcl3 and ago4 mutants, drb3 plants fail to hypermethylate the viral genome, a requirement for host recovery. We also show that DRB3 physically interacts with the RdDM pathway components DCL3 and AGO4 in the nucleus. This work highlights the utility of geminiviruses as models for de novo RdDM and places DRB3 protein in this fundamental epigenetic pathway.
-
Dennis, Andrew P; Lonard, David M; Nawaz, Zafar; O'Malley, Bert W
2005-03-01
In the present study, we investigated the involvement of protein degradation via the 26S proteasome during progesterone receptor (PR)-mediated transcription in T-47D cells containing a stably integrated MMTV-CAT reporter construct (CAT0 cells). Progesterone induced CAT and HSD11beta2 transcription while co-treatment with the proteasome inhibitor, MG132, blocked PR-induced transcription in a time-dependent fashion. MG132 treatment also inhibited transcription of beta-actin and cyclophilin, but not two proteasome subunit genes, PSMA1 and PSMC1, indicating that proteasome inhibition affects a subset of RNA polymerase II (RNAP(II))-regulated genes. Progesterone-mediated recruitment of RNAP(II) was blocked by MG132 treatment at time points later than 1 h that was not dependent on the continued presence of PR, associated cofactors, and components of the general transcription machinery, supporting the concept that proteasome-mediated degradation is needed for continued transcription. Surprisingly, progesterone-mediated acetylation of histone H4 was inhibited by MG132 with the concomitant recruitment of HDAC3, NCoR, and SMRT. We demonstrate that the steady-state protein levels of SMRT and NCoR are higher in the presence of MG132 in CAT0 cells, consistent with other reports that SMRT and NCoR are targets of the 26S proteasome. However, inhibition of histone deacetylation by trichostatin A (TSA) treatment or SMRT/NCoR knockdown by siRNA did not restore MG132-inhibited progesterone-dependent transcription. Therefore, events other than histone deacetylation and stability of SMRT and NCoR must also play a role in inhibition of PR-mediated transcription.
-
Identification of phasiRNAs in wild rice (Oryza rufipogon).
Liu, Yang; Wang, Yu; Zhu, Qian-Hao; Fan, Longjiang
2013-08-01
Plant miRNAs can trigger the production of phased, secondary siRNAs from either non-coding or protein-coding genes. In this study, at least 864 and 3,961 loci generating 21-nt and 24-nt phased siRNAs (phasiRNAs),respectively, were identified in three tissues from wild rice. Of these phasiRNA-producing loci, or PHAS genes, biogenesis of phasiRNAs in at least 160 of 21-nt and 254 of 24-nt loci could be triggered by interaction with miRNA(s). Developing seeds had more PHAS genes than leaves and roots. Genetic constrain on miRNA-triggered PHAS genes suggests that phasiRNAs might be one of the driving forces contributed to rice domestication.
-
Stc1: A Critical Link between RNAi and Chromatin Modification Required for Heterochromatin Integrity
Bayne, Elizabeth H.; White, Sharon A.; Kagansky, Alexander; Bijos, Dominika A.; Sanchez-Pulido, Luis; Hoe, Kwang-Lae; Kim, Dong-Uk; Park, Han-Oh; Ponting, Chris P.; Rappsilber, Juri; Allshire, Robin C.
2010-01-01
Summary In fission yeast, RNAi directs heterochromatin formation at centromeres, telomeres, and the mating type locus. Noncoding RNAs transcribed from repeat elements generate siRNAs that are incorporated into the Argonaute-containing RITS complex and direct it to nascent homologous transcripts. This leads to recruitment of the CLRC complex, including the histone methyltransferase Clr4, promoting H3K9 methylation and heterochromatin formation. A key question is what mediates the recruitment of Clr4/CLRC to transcript-bound RITS. We have identified a LIM domain protein, Stc1, that is required for centromeric heterochromatin integrity. Our analyses show that Stc1 is specifically required to establish H3K9 methylation via RNAi, and interacts both with the RNAi effector Ago1, and with the chromatin-modifying CLRC complex. Moreover, tethering Stc1 to a euchromatic locus is sufficient to induce silencing and heterochromatin formation independently of RNAi. We conclude that Stc1 associates with RITS on centromeric transcripts and recruits CLRC, thereby coupling RNAi to chromatin modification. PMID:20211136
-
Long Non-coding RNA, PANDA, Contributes to the Stabilization of p53 Tumor Suppressor Protein.
Kotake, Yojiro; Kitagawa, Kyoko; Ohhata, Tatsuya; Sakai, Satoshi; Uchida, Chiharu; Niida, Hiroyuki; Naemura, Madoka; Kitagawa, Masatoshi
2016-04-01
P21-associated noncoding RNA DNA damage-activated (PANDA) is induced in response to DNA damage and represses apoptosis by inhibiting the function of nuclear transcription factor Y subunit alpha (NF-YA) transcription factor. Herein, we report that PANDA affects regulation of p53 tumor-suppressor protein. U2OS cells were transfected with PANDA siRNAs. At 72 h post-transfection, cells were subjected to immunoblotting and quantitative reverse transcription-polymerase chain reaction. Depletion of PANDA was associated with decreased levels of p53 protein, but not p53 mRNA. The stability of p53 protein was markedly reduced by PANDA silencing. Degradation of p53 protein by silencing PANDA was prevented by treatment of MG132, a proteasome inhibitor. Moreover, depletion of PANDA prevented accumulation of p53 protein, as a result of DNA damage, induced by the genotoxic agent etoposide. These results suggest that PANDA stabilizes p53 protein in response to DNA damage, and provide new insight into the regulatory mechanisms of p53. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
-
Endogenous small RNAs and antibacterial immunity in plants.
Jin, Hailing
2008-08-06
Small RNAs are non-coding regulatory RNA molecules that control gene expression by mediating mRNA degradation, translational inhibition, or chromatin modification. Virus-derived small RNAs induce silencing of viral RNAs and are essential for antiviral defense in both animal and plant systems. The role of host endogenous small RNAs on antibacterial immunity has only recently been recognized. Host disease resistance and defense responses are achieved by activation and repression of a large array of genes. Certain endogenous small RNAs in plants, including microRNAs (miRNAs) and small interfering RNAs (siRNAs), are induced or repressed in response to pathogen attack and subsequently regulate the expression of genes involved in disease resistance and defense responses by mediating transcriptional or post-transcriptional gene silencing. Thus, these small RNAs play an important role in gene expression reprogramming in plant disease resistance and defense responses. This review focuses on the recent findings of plant endogenous small RNAs in antibacterial immunity.
-
The Cell Cycle Regulator CCDC6 Is a Key Target of RNA-Binding Protein EWS
Duggimpudi, Sujitha; Larsson, Erik; Nabhani, Schafiq; Borkhardt, Arndt; Hoell, Jessica I
2015-01-01
Genetic translocation of EWSR1 to ETS transcription factor coding region is considered as primary cause for Ewing sarcoma. Previous studies focused on the biology of chimeric transcription factors formed due to this translocation. However, the physiological consequences of heterozygous EWSR1 loss in these tumors have largely remained elusive. Previously, we have identified various mRNAs bound to EWS using PAR-CLIP. In this study, we demonstrate CCDC6, a known cell cycle regulator protein, as a novel target regulated by EWS. siRNA mediated down regulation of EWS caused an elevated apoptosis in cells in a CCDC6-dependant manner. This effect was rescued upon re-expression of CCDC6. This study provides evidence for a novel functional link through which wild-type EWS operates in a target-dependant manner in Ewing sarcoma. PMID:25751255
-
NASA Astrophysics Data System (ADS)
Itakura, Shoko; Hama, Susumu; Matsui, Ryo; Kogure, Kentaro
2016-05-01
Condensing siRNA with cationic polymers is a major strategy used in the development of siRNA carriers that can avoid degradation by nucleases and achieve effective delivery of siRNA into the cytoplasm. However, ineffective release of siRNA from such condensed forms into the cytoplasm is a limiting step for induction of RNAi effects, and can be attributed to tight condensation of siRNA with the cationic polymers, due to potent electrostatic interactions. Here, we report that siRNA condensed with a slightly acidic pH-sensitive peptide (SAPSP), whose total charge is inverted from positive to negative in response to cytoplasmic pH, is effectively released via electrostatic repulsion of siRNA with negatively charged SAPSP at cytoplasmic pH (7.4). The condensed complex of siRNA and positively-charged SAPSP at acidic pH (siRNA/SAPSP) was found to result in almost complete release of siRNA upon charge inversion of SAPSP at pH 7.4, with the resultant negatively-charged SAPSP having no undesirable interactions with endogenous mRNA. Moreover, liposomes encapsulating siRNA/SAPSP demonstrated knockdown efficiencies comparable to those of commercially available siRNA carriers. Taken together, SAPSP may be very useful as a siRNA condenser, as it facilitates effective cytoplasmic release of siRNA, and subsequent induction of specific RNAi effects.Condensing siRNA with cationic polymers is a major strategy used in the development of siRNA carriers that can avoid degradation by nucleases and achieve effective delivery of siRNA into the cytoplasm. However, ineffective release of siRNA from such condensed forms into the cytoplasm is a limiting step for induction of RNAi effects, and can be attributed to tight condensation of siRNA with the cationic polymers, due to potent electrostatic interactions. Here, we report that siRNA condensed with a slightly acidic pH-sensitive peptide (SAPSP), whose total charge is inverted from positive to negative in response to cytoplasmic pH, is effectively released via electrostatic repulsion of siRNA with negatively charged SAPSP at cytoplasmic pH (7.4). The condensed complex of siRNA and positively-charged SAPSP at acidic pH (siRNA/SAPSP) was found to result in almost complete release of siRNA upon charge inversion of SAPSP at pH 7.4, with the resultant negatively-charged SAPSP having no undesirable interactions with endogenous mRNA. Moreover, liposomes encapsulating siRNA/SAPSP demonstrated knockdown efficiencies comparable to those of commercially available siRNA carriers. Taken together, SAPSP may be very useful as a siRNA condenser, as it facilitates effective cytoplasmic release of siRNA, and subsequent induction of specific RNAi effects. Electronic supplementary information (ESI) available: De-condensation of siRNA cores by addition of heparin; time-lapse moving image of the siRNA release. See DOI: 10.1039/c5nr08365f
-
Cho, Min Chul; Cho, Sung Yong; Yoon, Cheol Yong; Lee, Seung Bae; Kwak, Cheol; Kim, Hyeon Hoe; Jeong, Hyeon
2015-01-01
To investigate the role of EphA2 in malignant cellular behavior in renal cell carcinoma (RCC) cells and whether FAK/RhoA signaling can act as downstream effectors of EphA2 on RCC cells. Expression of EphA2 protein in non-metastatic RCC (Caki-2 and A498), metastatic RCC cells (Caki-1 and ACHN), HEK-293 cells and prostate cancer cells (PC-3 and DU-145; positive controls of EphA2 expression) was evaluated by Western blot. Changes in mRNA or protein expression of EphA2, FAK or membrane-bound RhoA following EphA2, FAK or RhoA small interfering RNA (siRNA) transfection were determined by reverse transcription polymerase chain reaction or Western blot. The effect of siRNA treatment on cellular viability, apoptosis and invasion was analyzed by cell counting kit-8, Annexin-V and modified Matrigel-Boyden assays, respectively. In all RCC cell lines, the expression of EphA2 protein was detectable at variable levels; however, in HEK-293 cells, EphA2 expression was very low. Treatment with EphA2 siRNA significantly reduced the expression of EphA2 mRNA and protein in all RCC cell lines. For non-metastatic RCC cells (Caki-2 and A498) but not metastatic RCC cells (Caki-1 and ACHN), cellular viability, invasiveness, resistance to apoptosis, expression of membrane-bound RhoA protein and FAK phosphorylation were significantly decreased in EphA2 siRNA-treated cells compared to the control. In non-metastatic RCC cells, FAK siRNA significantly attenuated the invasiveness, resistance to apoptosis, as well as expression of membrane-bound RhoA protein without changing protein expression of EphA2. RhoA siRNA significantly decreased the malignant cellular behavior and expression of membrane-bound RhoA protein without changing EphA2 protein expression or FAK phosphorylation. Our data provide the first functional evidence that the EphA2/FAK/RhoA signaling pathway plays a critical role in the malignant cellular behavior of RCC and appears to be functional particularly in the early stage of malignant progression of non-metastatic RCC.
-
Suzuki, Jun-ichi; Ogawa, Masahito; Takayama, Kiyoshi; Taniyama, Yoshiaki; Morishita, Ryuichi; Hirata, Yasunobu; Nagai, Ryozo; Isobe, Mitsuaki
2010-03-02
The purpose of this study was to investigate the efficiency of small interfering ribonucleic acid (siRNA) in murine arteries. We transfected it using a nonviral ultrasound-microbubble-mediated in vivo gene delivery system. siRNA is an effective methodology to suppress gene function. The siRNA can be synthesized easily; however, a major obstacle in the use of siRNA as therapeutics is the difficulty involved in effective in vivo delivery. To investigate the efficiency of nonviral ultrasound-microbubble-mediated in vivo siRNA delivery, we used a fluorescein-labeled siRNA, green fluorescent protein (GFP) siRNA, and intercellular adhesion molecule (ICAM)-1 siRNA in murine arteries. Murine femoral arteries were injured using flexible wires to establish arterial injury. The fluorescein-labeled siRNA and GFP siRNA showed that this nonviral approach could deliver siRNA into target arteries effectively without any tissue damage and systemic adverse effects. ICAM-1 siRNA transfection into murine injured arteries significantly suppressed the development of neointimal formation in comparison to those in the control group. Immunohistochemistry revealed that accumulation of T cells and adhesion molecule positive cells was observed in nontreated injured arteries, whereas siRNA suppressed accumulation. The nonviral ultrasound-microbubble delivery of siRNA ensures effective transfection into target arteries. ICAM-1 siRNA has the potential to suppress arterial neointimal formation. Transfection of siRNA can be beneficial for the clinical treatment of cardiovascular and other inflammatory diseases. Copyright 2010 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.
-
Fu, Fang-Fang; Dawe, R Kelly; Gent, Jonathan I
2018-06-08
Plants make use of distinct types of DNA methylation characterized by their DNA methyltransferases and modes of regulation. One type, RNA-directed DNA methylation (RdDM), is guided by small interfering RNAs (siRNAs) to the edges of transposons that are close to genes, areas called mCHH islands in maize (Zea mays). Another type, chromomethylation, is guided by histone H3 lysine 9 methylation to heterochromatin across the genome. We examined DNA methylation and small RNA expression in plant tissues that were mutant for both copies of the genes encoding chromomethylases as well as mutants for both copies of the genes encoding DECREASED DNA METHYLATION1 (DDM1)-type nucleosome remodelers, which facilitate chromomethylation. Both sets of double mutants were nonviable but produced embryos and endosperm. RdDM was severely compromised in the double mutant embryos, both in terms of DNA methylation and siRNAs. Loss of 24-nt siRNA from mCHH islands was coupled with a gain of 21-, 22-, and 24-nt siRNAs in heterochromatin. These results reveal a requirement for both chromomethylation and DDM1-type nucleosome remodeling for RdDM in mCHH islands, which we hypothesize is due to dilution of RdDM components across the genome when heterochromatin is compromised. © 2018 American Society of Plant Biologists. All rights reserved.
-
Daraiseh, Susan I; Kassardjian, Ari; Alexander, Karen E; Rizkallah, Raed; Hurt, Myra M
2018-05-25
Yin Yang 1 (YY1) is a multifunctional transcription factor that can activate or repress transcription depending on the promotor and/or the co-factors recruited. YY1 is phosphorylated in various signaling pathways and is critical for different biological functions including embryogenesis, apoptosis, proliferation, cell-cycle regulation and tumorigenesis. Here we report that YY1 is a substrate for c-Abl kinase phosphorylation at conserved residue Y254 in the spacer region. Pharmacological inhibition of c-Abl kinase by imatinib, nilotinib and GZD824, knock-down of c-Abl using siRNA, and the use of c-Abl kinase-dead drastically reduces tyrosine phosphorylation of YY1. Both radioactive and non-radioactive in vitro kinase assays, as well as co-immunoprecipitation in different cell lines, show that the target of c-Abl phosphorylation is tyrosine residue 254. c-Abl phosphorylation has little effect on YY1 DNA binding ability or cellular localization in asynchronous cells. However, functional studies reveal that c-Abl mediated phosphorylation of YY1 regulates YY1's transcriptional ability in vivo. In conclusion, we demonstrate the novel role of c-Abl kinase in regulation of YY1's transcriptional activity, linking YY1 regulation with c-Abl tyrosine kinase signaling pathways. Copyright © 2018. Published by Elsevier B.V.
-
Silencing of sodium/hydrogen exchanger in the heart by direct injection of naked siRNA.
Morgan, Patricio E; Correa, María V; Ennis, Irene L; Ennis, Irene E; Diez, Ariel A; Pérez, Néstor G; Cingolani, Horacio E
2011-08-01
Cardiac Na(+)/H(+) exchanger (NHE1) hyperactivity is a central factor in cardiac remodeling following hypertension, myocardial infarction, ischemia-reperfusion injury, and heart failure. Treatment of these pathologies by inhibiting NHE1 is challenging because specific drugs that have been beneficial in experimental models were associated with undesired side effects in clinical practice. In the present work, small interference RNA (siRNA) produced in vitro to specifically silence NHE1 (siRNA(NHE1)) was injected once in vivo into the apex of the left ventricular wall of mouse myocardium. After 48 h, left ventricular NHE1 protein expression was reduced in siRNA(NHE1)-injected mice compared with scrambled siRNA by 33.2 ± 3.4% (n = 5; P < 0.05). Similarly, NHE1 mRNA levels were reduced by 20 ± 2.0% (n = 4). At 72 h, siRNA(NHE1) spreading was evident from the decrease in NHE1 expression in three portions of the myocardium (apex, medium, base). NHE1 function was assessed based on maximal velocity of intracellular pH (pH(i)) recovery (dpH(i)/dt) after an ammonium prepulse-induced acidic load. Maximal dpH(i)/dt was reduced to 14% in siRNA(NHE1)-isolated left ventricular papillary muscles compared with scrambled siRNA. In conclusion, only one injection of naked siRNA(NHE1) successfully reduced NHE1 expression and activity in the left ventricle. As has been previously suggested, extensive NHE1 expression reduction may indicate myocardial spread of siRNA molecules from the injection site through gap junctions, providing a valid technique not only for further research into NHE1 function, but also for consideration as a potential therapeutic strategy.
-
Felten, A; Brinckmann, D; Landsberg, G; Scheidtmann, K H
2013-10-10
We have recently identified apoptosis-antagonizing transcription factor (AATF), tumor-susceptibility gene 101 (TSG101) and zipper-interacting protein kinase (ZIPK) as novel coactivators of the androgen receptor (AR). The mechanisms of coactivation remained obscure, however. Here we investigated the interplay and interdependence between these coactivators and the AR using the endogenous prostate specific antigen (PSA) gene as model for AR-target genes. Chromatin immunoprecipitation in combination with siRNA-mediated knockdown revealed that recruitment of AATF and ZIPK to the PSA enhancer was dependent on AR, whereas recruitment of TSG101 was dependent on AATF. Association of AR and its coactivators with the PSA enhancer or promoter occurred in cycles. Dissociation of AR-transcription complexes was due to degradation because inhibition of the proteasome system by MG132 caused accumulation of AR at enhancer/promoter elements. Moreover, inhibition of degradation strongly reduced transcription, indicating that continued and efficient transcription is based on initiation, degradation and reinitiation cycles. Interestingly, knockdown of ZIPK by siRNA had a similar effect as MG132, leading to reduced transcription but enhanced accumulation of AR at androgen-response elements. In addition, knockdown of ZIPK, as well as overexpression of a dominant-negative ZIPK mutant, diminished polyubiquitination of AR. Furthermore, ZIPK cooperated with the E3 ligase Mdm2 in AR-dependent transactivation, assembled into a single complex on chromatin and phosphorylated Mdm2 in vitro. These results suggest that ZIPK has a crucial role in regulation of ubiquitination and degradation of the AR, and hence promoter clearance and efficient transcription.
-
Castillo, Andres; Wang, Lu; Koriyama, Chihaya; Eizuru, Yoshito; Jordan, King; Akiba, Suminori
2014-10-01
Previous studies have reported the detection of a truncated E1 mRNA generated from HPV-18 in HeLa cells. Although it is unclear whether a truncated E1 protein could function as a replicative helicase for viral replication, it would still retain binding sites for potential interactions with different host cell proteins. Furthermore, in this study, we found evidence in support of expression of full-length HPV-18 E1 mRNA in HeLa cells. To determine whether interactions between E1 and cellular proteins play an important role in cellular processes other than viral replication, genome-wide expression profiles of HPV-18 positive HeLa cells were compared before and after the siRNA knockdown of E1 expression. Differential expression and gene set enrichment analysis uncovered four functionally related sets of genes implicated in host defence mechanisms against viral infection. These included the toll-like receptor, interferon and apoptosis pathways, along with the antiviral interferon-stimulated gene set. In addition, we found that the transcriptional coactivator E1A-binding protein p300 (EP300) was downregulated, which is interesting given that EP300 is thought to be required for the transcription of HPV-18 genes in HeLa cells. The observed changes in gene expression produced via the silencing of HPV-18 E1 expression in HeLa cells indicate that in addition to its well-known role in viral replication, the E1 protein may also play an important role in mitigating the host's ability to defend against viral infection.
-
Apple miRNAs and tasiRNAs with novel regulatory networks
2012-01-01
Background MicroRNAs (miRNAs) and their regulatory functions have been extensively characterized in model species but whether apple has evolved similar or unique regulatory features remains unknown. Results We performed deep small RNA-seq and identified 23 conserved, 10 less-conserved and 42 apple-specific miRNAs or families with distinct expression patterns. The identified miRNAs target 118 genes representing a wide range of enzymatic and regulatory activities. Apple also conserves two TAS gene families with similar but unique trans-acting small interfering RNA (tasiRNA) biogenesis profiles and target specificities. Importantly, we found that miR159, miR828 and miR858 can collectively target up to 81 MYB genes potentially involved in diverse aspects of plant growth and development. These miRNA target sites are differentially conserved among MYBs, which is largely influenced by the location and conservation of the encoded amino acid residues in MYB factors. Finally, we found that 10 of the 19 miR828-targeted MYBs undergo small interfering RNA (siRNA) biogenesis at the 3' cleaved, highly divergent transcript regions, generating over 100 sequence-distinct siRNAs that potentially target over 70 diverse genes as confirmed by degradome analysis. Conclusions Our work identified and characterized apple miRNAs, their expression patterns, targets and regulatory functions. We also discovered that three miRNAs and the ensuing siRNAs exploit both conserved and divergent sequence features of MYB genes to initiate distinct regulatory networks targeting a multitude of genes inside and outside the MYB family. PMID:22704043
-
Zhao, Xinkai; Ning, Qiaoming; Sun, Xiaoning; Tian, De'an
2011-06-01
To investigate the relationship among Pokemon, NF-κ B p65 and Bcl-2 in hepatoma cells. HCC cell HepG2, SMMC7721 and human fetal liver cell line LO2 cells were used, and expression of Pokemon, NF-κ B p65 and Bcl-2 in three cells were detected by real-time PCR and western blot. Then siRNA of Pokemon was applied to inhibit the expression of Pokemon and NF-κ B p65 and apoptotic rate was determined by flow cytometric analysis. Expressions of Pokemon, NF-κ B p65 and Bcl-2 in human hepatoma cell HepG2, SMMC7721 expression were significantly higher than those in human embryonic stem cells LO2. siRNA of Pokemon inhibited the expression of Pokemon, NF-κ B p65 and Bcl-2 in liver cancer cells, and significantly increased apoptosis of liver cells. While siRNA of NF-κ B p65 inhibited the expression of NF-κ B p65 and Bcl-2, but Pokemon expression in hepatoma cells had no significant change. The proto-oncogene Pokemon can inhibit P14ARF by specific transcription regulation of cell cycle and can induce tumors. In addition, Pokemon can regulate NF-κ B p65 through the expression of apoptosis repressor, and promote the development of liver cancer. It suggests signal network in the liver include the regulation of new non-classical NF-κ B regulatory pathway. Copyright © 2011 Hainan Medical College. Published by Elsevier B.V. All rights reserved.
-
Qureshi, Hamid Yaqoob; Ricci, Gemma; Zafarullah, Muhammad
2008-09-01
Transforming growth factor beta (TGF-beta1) promotes cartilage matrix synthesis and induces tissue inhibitor of metalloproteinases-3 (TIMP-3), which inhibits matrix metalloproteinases, aggrecanases and TNF-alpha-converting enzyme implicated in articular cartilage degradation and joint inflammation. TGF-beta1 activates Akt, ERK and Smad2 pathways in chondrocytes. Here we investigated previously unexplored roles of specific Smads in TGF-beta1 induction of TIMP-3 gene by pharmacological and genetic knockdown approaches. TGF-beta1-induced Smad2 phosphorylation and TIMP-3 protein expression could be inhibited by the Smad2/3 phosphorylation inhibitors, PD169316 and SB203580 and by Smad2-specific siRNA. Specific inhibitor of Smad3 (SIS3) and Smad3 siRNA abolished TGF-beta induction of TIMP-3. Smad2/3 siRNAs also down regulated TIMP-3 promoter-driven luciferase activities, suggesting transcriptional regulation. SiRNA-driven co-Smad4 knockdown abrogated TIMP-3 augmentation by TGF-beta. TIMP-3 promoter deletion analysis revealed that -828 deletion retains the original promoter activity while -333 and -167 deletions display somewhat reduced activity suggesting that most of the TGF-beta-responsive, cis-acting elements are found in the -333 fragment. Chromatin Immunoprecipitation (ChIP) analysis confirmed binding of Smad2 and Smad4 with the -940 and -333 promoter sequences. These results suggest that receptor-activated Smad2 and Smad3 and co-Smad4 critically mediate TGF-beta-stimulated TIMP-3 expression in human chondrocytes and TIMP-3 gene is a target of Smad signaling pathway.
-
Inhibition of acid sphingomyelinase disrupts LYNUS signaling and triggers autophagy.
Justice, Matthew J; Bronova, Irina; Schweitzer, Kelly S; Poirier, Christophe; Blum, Janice S; Berdyshev, Evgeny V; Petrache, Irina
2018-04-01
Activation of the lysosomal ceramide-producing enzyme, acid sphingomyelinase (ASM), by various stresses is centrally involved in cell death and has been implicated in autophagy. We set out to investigate the role of the baseline ASM activity in maintaining physiological functions of lysosomes, focusing on the lysosomal nutrient-sensing complex (LYNUS), a lysosomal membrane-anchored multiprotein complex that includes mammalian target of rapamycin (mTOR) and transcription factor EB (TFEB). ASM inhibition with imipramine or sphingomyelin phosphodiesterase 1 ( SMPD1 ) siRNA in human lung cells, or by transgenic Smpd1 +/- haploinsufficiency of mouse lungs, markedly reduced mTOR- and P70-S6 kinase (Thr 389)-phosphorylation and modified TFEB in a pattern consistent with its activation. Inhibition of baseline ASM activity significantly increased autophagy with preserved degradative potential. Pulse labeling of sphingolipid metabolites revealed that ASM inhibition markedly decreased sphingosine (Sph) and Sph-1-phosphate (S1P) levels at the level of ceramide hydrolysis. These findings suggest that ASM functions to maintain physiological mTOR signaling and inhibit autophagy and implicate Sph and/or S1P in the control of lysosomal function. Copyright © 2018 by the American Society for Biochemistry and Molecular Biology, Inc.
-
[Impact of Pax-8 gene interference on mitochondrial function and cardiomyocyte apoptosis].
Dai, Xiao-chun; Zhou, Xi; Huang, Xiao-yan; Wang, Liang-guo; Lin, Su; Yang, De-ye
2013-01-01
To observe the effects of paired box gene 8 (Pax-8) silencing by RNA interference on mitochondrial function and cardiomyocytes apoptosis. The cultured H9C2 (2-1) myocytes were divided into 3 groups: short interference RNA targeting Pax-8 (Pax-8 siRNA) group, non-specific siRNA group as the negative control (NC siRNA), and blank control group (BC siRNA). Fluorescence spectrophotometry was used to detect the activity of caspase-3. RT-PCR was performed to detect mRNA expression of Bcl2 and Bax. The protein expression of Bcl2, Bax and cytoplasm of Cytochrome was examined by Western blot. Changes of ΔΨm were detected by flow cytometry.ΔΨm with JC-1 monomer/polymer ratio was calculated for measuring mitochondrial depolarization proportion. Compared to NC siRNA and BC siRNA group (0.075 ± 0.021, 0.072 ± 0.019), the activity of caspase-3 in Pax-8 siRNA group (0.167 ± 0.012) was significantly increased (P < 0.05); Bcl2 mRNA and protein expression in Pax-8 siRNA group (0.61 ± 0.06, 0.94 ± 0.11) were significantly downregulated compared with NC siRNA group (0.90 ± 0.070, 1.39 ± 0.15) and BC siRNA group (0.94 ± 0.087, 1.49 ± 0.20) (P < 0.05); Bax mRNA and protein expression in Pax-8 siRNA group (1.05 ± 0.10, 1.25 ± 0.12) were markedly upregulated compared with NC siRNA group (0.72 ± 0.03, 0.99 ± 0.12) and BC siRNA group (0.64 ± 0.03, 0.92 ± 0.06), P < 0.05; cytosolic cytochrome expression in Pax-8 siRNA group (0.75 ± 0.14) was significantly upregulated compared with NC siRNA group (0.51 ± 0.06) and BC siRNA group (0.48 ± 0.07) (P < 0.05); JC-1 monomer/polymer ratio in Pax-8 siRNA group (0.163 ± 0.011) was significantly increased compared with NC siRNA group (0.092 ± 0.015) and BC siRNA group (0.072 ± 0.025) (P < 0.05) indicating mitochondrial membrane potential was significantly reduced in Pax-8 siRNA group. Above parameters were similar between NC siRNA group and BC siRNA group (P > 0.05). Inhibiting Pax-8 results in enhanced cardiomyocytes apoptosis through the mitochondrial pathway.
-
In vitro therapeutic effect of PDT combined with VEGF-A gene therapy
NASA Astrophysics Data System (ADS)
Lecaros, Rumwald Leo G.; Huang, Leaf; Hsu, Yih-Chih
2014-02-01
Vascular endothelial growth factor A (VEGF-A), commonly known as VEGF, is one of the primary factors that affect tumor angiogenesis. It was found to be expressed in cancer cell lines including oral squamous cell carcinoma. Photodynamic therapy (PDT) is a novel therapeutic modality to treat cancer by using a photosensitizer which is activated by a light source to produce reactive oxygen species and mediates oxygen-independent hypoxic conditions to tumor. Another emerging treatment to cure cancer is the use of interference RNA (e.g. siRNA) to silence a specific mRNA sequence. VEGF-A was found to be expressed in oral squamous cell carcinoma and overexpressed after 24 hour post-PDT by Western blot analysis. Cell viability was found to decrease at 25 nM of transfected VEGF-A siRNA. In vitro combined therapy of PDT and VEGF-A siRNA showed better response as compared with PDT and gene therapy alone. The results suggest that PDT combined with targeted gene therapy has a potential mean to achieve better therapeutic outcome.
-
Bard-Chapeau, Emilie A.; Szumska, Dorota; Jacob, Bindya; Chua, Belinda Q. L.; Chatterjee, Gouri C.; Zhang, Yi; Ward, Jerrold M.; Urun, Fatma; Kinameri, Emi; Vincent, Stéphane D.; Ahmed, Sayadi; Bhattacharya, Shoumo; Osato, Motomi; Perkins, Archibald S.; Moore, Adrian W.; Jenkins, Nancy A.; Copeland, Neal G.
2014-01-01
The ecotropic viral integration site 1 (Evi1) oncogenic transcription factor is one of a number of alternative transcripts encoded by the Mds1 and Evi1 complex locus (Mecom). Overexpression of Evi1 has been observed in a number of myeloid disorders and is associated with poor patient survival. It is also amplified and/or overexpressed in many epithelial cancers including nasopharyngeal carcinoma, ovarian carcinoma, ependymomas, and lung and colorectal cancers. Two murine knockout models have also demonstrated Evi1's critical role in the maintenance of hematopoietic stem cell renewal with its absence resulting in the death of mutant embryos due to hematopoietic failure. Here we characterize a novel mouse model (designated Evi1fl3) in which Evi1 exon 3, which carries the ATG start, is flanked by loxP sites. Unexpectedly, we found that germline deletion of exon3 produces a hypomorphic allele due to the use of an alternative ATG start site located in exon 4, resulting in a minor Evi1 N-terminal truncation and a block in expression of the Mds1-Evi1 fusion transcript. Evi1δex3/δex3 mutant embryos showed only a mild non-lethal hematopoietic phenotype and bone marrow failure was only observed in adult Vav-iCre/+, Evi1fl3/fl3 mice in which exon 3 was specifically deleted in the hematopoietic system. Evi1δex3/δex3 knockout pups are born in normal numbers but die during the perinatal period from congenital heart defects. Database searches identified 143 genes with similar mutant heart phenotypes as those observed in Evi1δex3/δex3 mutant pups. Interestingly, 42 of these congenital heart defect genes contain known Evi1-binding sites, and expression of 18 of these genes are also effected by Evi1 siRNA knockdown. These results show a potential functional involvement of Evi1 target genes in heart development and indicate that Evi1 is part of a transcriptional program that regulates cardiac development in addition to the development of blood. PMID:24586749
-
Designing highly active siRNAs for therapeutic applications.
Walton, S Patrick; Wu, Ming; Gredell, Joseph A; Chan, Christina
2010-12-01
The discovery of RNA interference (RNAi) generated considerable interest in developing short interfering RNAs (siRNAs) for understanding basic biology and as the active agents in a new variety of therapeutics. Early studies showed that selecting an active siRNA was not as straightforward as simply picking a sequence on the target mRNA and synthesizing the siRNA complementary to that sequence. As interest in applying RNAi has increased, the methods for identifying active siRNA sequences have evolved from focusing on the simplicity of synthesis and purification, to identifying preferred target sequences and secondary structures, to predicting the thermodynamic stability of the siRNA. As more specific details of the RNAi mechanism have been defined, these have been incorporated into more complex siRNA selection algorithms, increasing the reliability of selecting active siRNAs against a single target. Ultimately, design of the best siRNA therapeutics will require design of the siRNA itself, in addition to design of the vehicle and other components necessary for it to function in vivo. In this minireview, we summarize the evolution of siRNA selection techniques with a particular focus on one issue of current importance to the field, how best to identify those siRNA sequences likely to have high activity. Approaches to designing active siRNAs through chemical and structural modifications will also be highlighted. As the understanding of how to control the activity and specificity of siRNAs improves, the potential utility of siRNAs as human therapeutics will concomitantly grow. © 2010 The Authors Journal compilation © 2010 FEBS.
-
Bovine foamy virus transactivator BTas interacts with cellular RelB to enhance viral transcription.
Wang, Jian; Tan, Juan; Guo, Hongyan; Zhang, Qicheng; Jia, Rui; Xu, Xuan; Geng, Yunqi; Qiao, Wentao
2010-11-01
Viruses are obligate intracellular parasites that depend on cellular machinery for their efficient transcription and replication. In a previous study we reported that bovine foamy virus (BFV) is able to activate the nuclear factor κB (NF-κB) pathway through the action of its transactivator BTas to enhance viral transcription. However, the mechanism used by NF-κB to enhance BFV transcription remains elusive. To address this question, we employed a yeast two-hybrid assay to screen for BTas-interacting proteins. We found that RelB, a member of NF-κB protein family, interacts with BTas. We confirmed the putative RelB-BTas interaction in vitro and in vivo and identified the protein regions responsible for the RelB-BTas interaction. Using a luciferase reporter assay, we next showed that RelB enhances BFV transcription (BTas-induced long terminal repeat [LTR] transactivation) and that this process requires both the localization of the RelB-BTas interaction in the nucleus and the Rel homology domain of RelB. The knockdown of the cellular endogenous RelB protein using small interfering RNA (siRNA) significantly attenuated BTas-induced LTR transcription. The results of chromatin immunoprecipitation (ChIP) analysis showed that endogenous RelB binds to the viral LTR in BFV-infected cells. Together, these results suggest that BFV engages the RelB protein as a cotransactivator of BTas to enhance viral transcription. In addition, our findings indicate that BFV infection upregulates cellular RelB expression through BTas-induced NF-κB activation. Thus, this study demonstrates the existence of a positive-feedback circuit in which BFV utilizes the host's NF-κB pathway through the RelB protein for efficient viral transcription.
-
Alteration of BRCA1 expression affects alcohol-induced transcription of RNA Pol III-dependent genes.
Zhong, Qian; Shi, Ganggang; Zhang, Yanmei; Lu, Lei; Levy, Daniel; Zhong, Shuping
2015-02-01
Emerging evidence has indicated that alcohol consumption is an established risk factor for breast cancer. Deregulation of RNA polymerase III (Pol III) transcription enhances cellular Pol III gene production, leading to an increase in translational capacity to promote cell transformation and tumor formation. We have reported that alcohol intake increases Pol III gene transcription to promote cell transformation and tumor formation in vitro and in vivo. Studies revealed that tumor suppressors, pRb, p53, PTEN and Maf1 repress the transcription of Pol III genes. BRCA1 is a tumor suppressor and its mutation is tightly related to breast cancer development. However, it is not clear whether BRCA1 expression affects alcohol-induced transcription of Pol III genes. At the present studies, we report that restoring BRCA1 in HCC 1937 cells, which is a BRCA1 deficient cell line, represses Pol III gene transcription. Expressing mutant or truncated BRCA1 in these cells does not affect the ability of repression on Pol III genes. Our analysis has demonstrated that alcohol induces Pol III gene transcription. More importantly, overexpression of BRCA1 in estrogen receptor positive (ER+) breast cancer cells (MCF-7) decreases the induction of tRNA(Leu) and 5S rRNA genes by alcohol, whereas reduction of BRCA1 by its siRNA slightly increases the transcription of the class of genes. This suggests that BRCA1 is associated with alcohol-induced deregulation of Pol III genes. These studies for the first time demonstrate the role of BRCA1 in induction of Pol III genes by alcohol and uncover a novel mechanism of alcohol-associated breast cancer. Copyright © 2014 Elsevier B.V. All rights reserved.
-
Chen, Chen; Mei, Heng; Shi, Wei; Deng, Jun; Zhang, Bo; Guo, Tao; Wang, Huafang; Hu, Yu
2013-01-01
Injured endothelium is an important target for drug and/or gene therapy because brain microvascular endothelial cells (BMECs) play critical roles in various pathophysiological conditions. RNA-mediated gene silencing presents a new therapeutic approach for treating such diseases, but major challenge is to ensure minimal toxicity and target delivery of siRNA to injured BMECs. Injured BMECs overexpress tissue factor (TF), which the fusion protein EGFP-EGF1 could be targeted to. In this study, TNF alpha (TNF-α) was chosen as a stimulus for primary BMECs to produce injured endothelium in vitro. The EGFP-EGF1-PLGA nanoparticles (ENPs) with loaded TF-siRNA were used as a new carrier for targeted delivery to the injured BMECs. The nanoparticles then produced intracellular RNA interference against TF. We compared ENP-based transfections with NP-mediated transfections, and our studies show that the ENP-based transfections result in a more efficient downregulation of TF. Our findings also show that the TF siRNA-loaded ENPs had minimal toxicity, with almost 96% of the cells viable 24 h after transfection while Lipofectamine-based transfections resulted in only 75% of the cells. Therefore, ENP-based transfection could be used for efficient siRNA transfection to injured BMECs and for efficient RNA interference (RNAi). This transfection could serve as a potential treatment for diseases, such as stroke, atherosclerosis and cancer. PMID:23593330
-
Novel mechanism of transcriptional regulation of cell matrix protein through CREB
Habib, Samy L; Mohan, Sumathy; Liang, Sitai; Li, Baojie; Yadav, Mukesh
2015-01-01
The transcription mechanism(s) of renal cell matrix accumulation in diabetes does not explored. Phosphorylation of the transcription factor cAMP-responsive element binding protein (CREB) significantly increased in cells treated with high glucose (HG) compared to cell grown in normal glucose (NG). Cells pretreated with rapamycin before exposure to HG showed significant decrease phosphorylation of CREB, increase in AMPK activity and decrease protein/mRNA and promoter activity of fibronectin. In addition, cells transfected with siRNA against CREB showed significant increase in AMPK activity, decrease in protein/mRNA and promoter activity of fibronectin. Cells treated with HG showed nuclear localization of p-CREB while pretreated cells with rapamycin reversed HG effect. Moreover, gel shift analysis shows increase binding of CREB to fibronectin promoter in cells treated with HG while cells pretreated with rapamycin reversed the effect of HG. Furthermore, db/db mice treated with rapamycin showed significant increase in AMPK activity, decrease in expression of p-CREB and protein/mRNA of fibronectin. Strong staining of fibronectin and p-CREB was detected in kidney cortex of db/db mice while treated mice with rapamycin reversed hyperglycemia effect. In summary, our data provide a novel mechanism of transcriptional regulation of fibronectin through CREB that may be used as therapeutic approach to prevent diabetes complications. PMID:26115221
-
Tanudji, Marcel; Machalek, Dorothy; Arndt, Greg M; Rivory, Laurent
2010-02-01
Cotransfection of a mixture of siRNAs species is typically used when simultaneous targeting of more than one mRNA is required. However, competition between siRNAs could occur and reduce the activity of some siRNAs within the mixture. To further study the factors affecting the degree of competition between siRNAs, we cotransfected luciferase targeting siRNAs with various irrelevant (ie, nonluciferase targeting) siRNAs into cells and examined differences in their competition profiles by assessing the effect on luciferase expression. We show that the degree of competition varies between irrelevant siRNAs and occurs at the point of RISC loading. Although the competition profile appears to be related to the calculated RNA-induced silencing complex (RISC) loading potential, empirical testing is required to confirm the competitive effects. We also observed reduced competition with siRNAs in the Dicer-substrate format, presumably due to more efficient RISC loading as a consequence of the physical transfer of the processed siRNA from Dicer.
-
Efficient siRNA delivery system using carboxilated single-wall carbon nanotubes in cancer treatment.
Neagoe, Ioana Berindan; Braicu, Cornelia; Matea, Cristian; Bele, Constantin; Florin, Graur; Gabriel, Katona; Veronica, Chedea; Irimie, Alexandru
2012-08-01
Several functionalized carbon nanotubes have been designed and tested for the purpose of nucleic acid delivery. In this study, the capacity of SWNTC-COOH for siRNA deliverey were investigated delivery in parallel with an efficient commercial system. Hep2G cells were reverse-transfected with 50 nM siRNA (p53 siRNA, TNF-alphasiRNA, VEGFsiRNA) using the siPORT NeoFX (Ambion) transfection agent in paralel with SWNTC-COOH, functionalised with siRNA. The highest level of gene inhibition was observed in the cases treated with p53 siRNA gene; in the case of transfection with siPort, the NeoFX value was 33.8%, while in the case of SWNTC-COOH as delivery system for p53 siRNA was 37.5%. The gene silencing capacity for VEGF was 53.7%, respectively for TNF-alpha 56.7% for siPORT NeoFX delivery systems versus 47.7% (VEGF) and 46.5% (TNF-alpha) for SWNTC-COOH delivery system. SWNTC-COOH we have been showed to have to be an efficient carrier system. The results from the inhibition of gene expresion for both transfection systems were confirmed at protein level. Overall, the lowest mRNA expression was confirmed at protein level, especially in the case of p53 siRNA and TNF-alpha siRNA transfection. Less efficient reduction protein expressions were observed in the case of VEGF siRNA, for both transfection systems at 24 h; only at 48 h, there was a statistically significant reduction of VEGF protein expression. SWCNT-COOH determined an efficient delivery of siRNA. SWNTC-COOH, combined with suitable tumor markers like p53 siRNA, TNFalpha siRNA or VEGF siRNA can be used for the efficient delivery of siRNA.
-
Ambardekar, Vishakha V.; Han, Huai-Yun; Varney, Michelle L.; Vinogradov, Serguei V.; Singh, Rakesh K.; Vetro, Joseph A.
2010-01-01
Polymer-siRNA complexes (siRNA polyplexes) are being actively developed to improve the therapeutic application of siRNA. A major limitation for many siRNA polyplexes, however, is insufficient mRNA suppression. Given that modifying the sense strand of siRNA with 3′ cholesterol (chol-siRNA) increases the activity of free nuclease-resistant siRNA in vitro and in vivo, we hypothesized that complexation of chol-siRNA can increase mRNA suppression by siRNA polyplexes. In this study, the characteristics and siRNA activity of self assembled polyplexes formed with chol-siRNA or unmodified siRNA were compared using three types of conventional, positively charged polymers: (i) biodegradable, cross-linked nanogels (BDNG) (ii) graft copolymers (PEI-PEG), and (iii) linear block copolymers (PLL10-PEG, and PLL50-PEG). Chol-siRNA did not alter complex formation or the resistance of polyplexes to siRNA displacement by heparin but increased nuclease protection by BDNG, PLL10-PEG, and PLL50-PEG polyplexes over polyplexes with unmodified siRNA. Chol-CYPB siRNA increased suppression of native CYPB mRNA in mammary microvascular endothelial cells (MVEC) by BDNG polyplexes (35%) and PLL10-PEG polyplexes (69%) over comparable CYPB siRNA polyplexes but had no effect on PEI-PEG or PLL50-PEG polyplexes. Overall, these results indicate that complexation of chol-siRNA increases nuclease protection and mRNA suppression by select siRNA polyplexes. These results also suggest that polycationic block length is an important factor in increasing mRNA suppression by PLL-PEG chol-siRNA polyplexes in mammary MVEC. PMID:21047680
-
Ambardekar, Vishakha V; Han, Huai-Yun; Varney, Michelle L; Vinogradov, Serguei V; Singh, Rakesh K; Vetro, Joseph A
2011-02-01
Polymer-siRNA complexes (siRNA polyplexes) are being actively developed to improve the therapeutic application of siRNA. A major limitation for many siRNA polyplexes, however, is insufficient mRNA suppression. Given that modifying the sense strand of siRNA with 3' cholesterol (chol-siRNA) increases the activity of free nuclease-resistant siRNA in vitro and in vivo, we hypothesized that complexation of chol-siRNA can increase mRNA suppression by siRNA polyplexes. In this study, the characteristics and siRNA activity of self assembled polyplexes formed with chol-siRNA or unmodified siRNA were compared using three types of conventional, positively charged polymers: (i) biodegradable, cross-linked nanogels (BDNG) (ii) graft copolymers (PEI-PEG), and (iii) linear block copolymers (PLL10-PEG, and PLL50-PEG). Chol-siRNA did not alter complex formation or the resistance of polyplexes to siRNA displacement by heparin but increased nuclease protection by BDNG, PLL10-PEG, and PLL50-PEG polyplexes over polyplexes with unmodified siRNA. Chol-CYPB siRNA increased suppression of native CYPB mRNA in mammary microvascular endothelial cells (MVEC) by BDNG polyplexes (35%) and PLL10-PEG polyplexes (69%) over comparable CYPB siRNA polyplexes but had no effect on PEI-PEG or PLL50-PEG polyplexes. Overall, these results indicate that complexation of chol-siRNA increases nuclease protection and mRNA suppression by select siRNA polyplexes. These results also suggest that polycationic block length is an important factor in increasing mRNA suppression by PLL-PEG chol-siRNA polyplexes in mammary MVEC. Copyright © 2010 Elsevier Ltd. All rights reserved.
-
Inhibition of N-Myc down regulated gene 1 in in vitro cultured human glioblastoma cells
Said, Harun M; Polat, Buelent; Stein, Susanne; Guckenberger, Mathias; Hagemann, Carsten; Staab, Adrian; Katzer, Astrid; Anacker, Jelena; Flentje, Michael; Vordermark, Dirk
2012-01-01
AIM: To study short dsRNA oligonucleotides (siRNA) as a potent tool for artificially modulating gene expression of N-Myc down regulated gene 1 (NDRG1) gene induced under different physiological conditions (Normoxia and hypoxia) modulating NDRG1 transcription, mRNA stability and translation. METHODS: A cell line established from a patient with glioblastoma multiforme. Plasmid DNA for transfections was prepared with the Endofree Plasmid Maxi kit. From plates containing 5 × 107 cells, nuclear extracts were prepared according to previous protocols. The pSUPER-NDRG1 vectors were designed, two sequences were selected from the human NDRG1 cDNA (5’-GCATTATTGGCATGGGAAC-3’ and 5’-ATGCAGAGTAACGTGGAAG-3’. reverse transcription polymerase chain reaction was performed using primers designed using published information on β-actin and hypoxia-inducible factor (HIF)-1α mRNA sequences in GenBank. NDRG1 mRNA and protein level expression results under different conditions of hypoxia or reoxygenation were compared to aerobic control conditions using the Mann-Whitney U test. Reoxygenation values were also compared to the NDRG1 levels after 24 h of hypoxia (P < 0.05 was considered significant). RESULTS: siRNA- and iodoacetate (IAA)-mediated downregulation of NDRG1 mRNA and protein expression in vitro in human glioblastoma cell lines showed a nearly complete inhibition of NDRG1 expression when compared to the results obtained due to the inhibitory role of glycolysis inhibitor IAA. Hypoxia responsive elements bound by nuclear HIF-1 in human glioblastoma cells in vitro under different oxygenation conditions and the clearly enhanced binding of nuclear extracts from glioblastoma cell samples exposed to extreme hypoxic conditions confirmed the HIF-1 Western blotting results. CONCLUSION: NDRG1 represents an additional diagnostic marker for brain tumor detection, due to the role of hypoxia in regulating this gene, and it can represent a potential target for tumor treatment in human glioblastoma. The siRNA method can represent an elegant alternative to modulate the expression of the hypoxia induced NDRG1 gene and can help to monitor the development of the cancer disease treatment outcome through monitoring the expression of this gene in the patients undergoing the different therapeutic treatment alternatives available nowadays. PMID:22787578
-
Dual mechanisms of NF-kappaB inhibition in carnosol-treated endothelial cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lian, K.-C.; Chuang, J.-J.; Hsieh, C.-W.
2010-05-15
The increased adhesion of monocytes to injured endothelial layers is a critical early event in atherogenesis. Under inflammatory conditions, there is increased expression of specific cell adhesion molecules on activated vascular endothelial cells, which increases monocyte adhesion. In our current study, we demonstrate a putative mechanism for the anti-inflammatory effects of carnosol, a diterpene derived from the herb rosemary. Our results show that both carnosol and rosemary essential oils inhibit the adhesion of TNFalpha-induced monocytes to endothelial cells and suppress the expression of ICAM-1 at the transcriptional level. Moreover, carnosol was found to exert its inhibitory effects by blocking themore » degradation of the inhibitory protein IkappaBalpha in short term pretreatments but not in 12 h pretreatments. Our data show that carnosol reduces IKK-beta phosphorylation in pretreatments of less than 3 h. In TNFalpha-treated ECs, NF-kappaB nuclear translocation and transcriptional activity was abolished by up to 12 h of carnosol pretreatment and this was blocked by Nrf-2 siRNA. The long-term inhibitory effects of carnosol thus appear to be mediated through its induction of Nrf-2-related genes. The inhibition of ICAM-1 expression and p65 translocation is reversed by HO-1 siRNA. Carnosol also upregulates the Nrf-2-related glutathione synthase gene and thereby increases the GSH levels after 9 h of exposure. Treating ECs with a GSH synthesis inhibitor, BSO, blocks the inhibitory effects of carnosol. In addition, carnosol increases p65 glutathionylation. Hence, our present findings indicate that carnosol suppresses TNFalpha-induced singling pathways through the inhibition of IKK-beta activity or the upregulation of HO-1 expression. The resulting GSH levels are dependent, however, on the length of the carnosol pretreatment period.« less
-
Inhibition of Nogo-B promotes cardiac hypertrophy via endoplasmic reticulum stress.
Li, Junli; Wu, Wenchao; Xin, Yanguo; Zhao, Mingyue; Liu, Xiaojing
2018-05-14
Nogo-B is a key endoplasmic reticulum (ER) protein that regulates ER stress signaling. However, its role in cardiac hypertrophy remains poorly understood. ER stress is interrelated with autophagy in the process of cardiac hypertrophy. Therefore, we aimed to test the hypothesis that both ER stress and autophagy signaling mediate the function of Nogo-B in cardiac hypertrophy. Rat models of transverse aortic constriction (TAC), neonatal rat cardiomyocytes (NRCMs) stimulated with norepinephrine (Ne) and primary cardiac fibroblasts treated with transforming growth factor β1 (TGF-β1) were used in this study. The expression of Nogo-B and markers of ER stress were determined by quantitative RT-PCR, western blotting and immunofluorescence. Autophagy was measured by monitoring autophagic flux. Specific small interfering RNA (siRNA) of Nogo-B was transfected to investigate the role of Nogo-B in regulating cardiac hypertrophy. In TAC-induced hypertrophic heart tissues, Ne-treated hypertrophic cardiomyocytes and TGF-β1-stimulated cardiac fibroblasts, the expression of Nogo-B, and markers of ER stress were significantly elevated. Impairment of autophagic flux was observed in the activated cardiac fibroblasts. Down-regulation of Nogo-B by siRNA further exacerbated Ne-induced cardiomyocyte hypertrophy and TGF-β1-induced cardiac fibroblast activation. Gene silencing of Nogo-B promoted the activation of the ER stress pathway and the impairment of autophagic flux. Moreover, inhibition of Nogo-B activated the protein kinase RNA-like ER kinase (PERK)/activating transcriptional factor 4 (ATF4) and activating transcriptional factor 6 (ATF6) branches of ER stress pathways. These findings suggest that inhibition of Nogo-B promotes cardiomyocyte hypertrophy and cardiac fibroblast activation by activating the PERK/ATF4 signaling pathway and defects of autophagic flux. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sun, Yu; Wong, Nicholas; Guan, Yinghui
2008-04-25
Ovarian epithelial carcinomas (OEC) frequently exhibit amplifications at the 20q13 locus which is the site of several oncogenes, including the eukaryotic elongation factor EEF1A2 and the transcription factor ZNF217. We reported previously that overexpressed ZNF217 induces neoplastic characteristics in precursor cells of OEC. Unexpectedly, ZNF217, which is a transcriptional repressor, enhanced expression of eEF1A2. In this study, array comparative genomic hybridization, single nucleotide polymorphism and Affymetrix analysis of ZNF217-overexpressing cell lines confirmed consistently increased expression of eEF1A2 but not of other oncogenes, and revealed early changes in EEF1A2 gene copy numbers and increased expression at crisis during immortalization. We definedmore » the influence of eEF1A2 overexpression on immortalized ovarian surface epithelial cells, and investigated interrelationships between effects of ZNF217 and eEF1A2 on cellular phenotypes. Lentivirally induced eEF1A2 overexpression caused delayed crisis, apoptosis resistance and increases in serum-independence, saturation densities, and anchorage independence. siRNA to eEF1A2 reversed apoptosis resistance and reduced anchorage independence in eEF1A2-overexpressing lines. Remarkably, siRNA to eEF1A2 was equally efficient in inhibiting both anchorage independence and resistance to apoptosis conferred by ZNF217 overexpression. Our data define neoplastic properties that are caused by eEF1A2 in nontumorigenic ovarian cancer precursor cells, and suggest that eEF1A2 plays a role in mediating ZNF217-induced neoplastic progression.« less
-
Nerurkar, Pratibha V; Nishioka, Adrienne; Eck, Philip O; Johns, Lisa M; Volper, Esther; Nerurkar, Vivek R
2012-07-01
Renewed interest in alternative medicine among diabetic individuals prompted us to investigate anti-diabetic effects of Morinda citrifolia (noni) in high-fat diet (HFD)-fed mice. Type 2 diabetes is associated with increased glucose production due to the inability of insulin to suppress hepatic gluconeogenesis and promote glycolysis. Insulin inhibits gluconeogenesis by modulating transcription factors such as forkhead box O (FoxO1). Based on microarray analysis data, we tested the hypothesis that fermented noni fruit juice (fNJ) improves glucose metabolism via FoxO1 phosphorylation. C57BL/6 male mice were fed a HFD and fNJ for 12 weeks. Body weights and food intake were monitored daily. FoxO1 expression was analysed by real-time PCR and Western blotting. Specificity of fNJ-associated FoxO1 regulation of gluconeogenesis was confirmed by small interfering RNA (siRNA) studies using human hepatoma cells, HepG2. Supplementation with fNJ inhibited weight gain and improved glucose and insulin tolerance and fasting glucose in HFD-fed mice. Hypoglycaemic properties of fNJ were associated with the inhibition of hepatic FoxO1 mRNA expression, with a concomitant increase in FoxO1 phosphorylation and nuclear expulsion of the proteins. Gluconeogenic genes, phosphoenolpyruvate C kinase (PEPCK) and glucose-6-phosphatase (G6P), were significantly inhibited in mice fed a HFD+fNJ. HepG2 cells demonstrated more than 80 % inhibition of PEPCK and G6P mRNA expression in cells treated with FoxO1 siRNA and fNJ. These data suggest that fNJ improves glucose metabolism via FoxO1 regulation in HFD-fed mice.
-
Darvekar, Sagar Ramesh; Elvenes, Julianne; Brenne, Hanne Britt; Johansen, Terje; Sjøttem, Eva
2014-01-01
Organisms exposed to oxidative stress respond by orchestrating a stress response to prevent further damage. Intracellular levels of antioxidant agents increase, and damaged components are removed by autophagy induction. The KEAP1-NRF2 signaling pathway is the main pathway responsible for cell defense against oxidative stress and for maintaining the cellular redox balance at physiological levels. Sulforaphane, an isothiocyanate derived from cruciferous vegetables, is a potent inducer of KEAP1-NRF2 signaling and antioxidant response element driven gene expression. In this study, we show that sulforaphane enhances the expression of the transcriptional coregulator SPBP. The expression curve peaks 6–8 hours post stimulation, and parallels the sulforaphane-induced expression of NRF2 and the autophagy receptor protein p62/SQSTM1. Reporter gene assays show that SPBP stimulates the expression of p62/SQSTM1 via ARE elements in the promoter region, and siRNA mediated knock down of SPBP significantly decreases the expression of p62/SQSTM1 and the formation of p62/SQSTM1 bodies in HeLa cells. Furthermore, SPBP siRNA reduces the sulforaphane induced expression of NRF2, and the expression of the autophagy marker protein LC3B. Both these proteins contain ARE-like elements in their promoter regions. Over-expressed SPBP and NRF2 acts synergistically on the p62/SQSTM1 promoter and colocalize in nuclear speckles in HeLa cells. Collectively, these results suggest that SPBP is a coactivator of NRF2, and hence may be important for securing enhanced and sustained expression of NRF2 induced genes such as proteins involved in selective autophagy. PMID:24416372
-
Xia, Wenzheng; Zhuang, Lei; Deng, Xia; Hou, Meng
2017-11-01
Mesenchymal stem cell (MSC)‑based therapies have demonstrated efficacy in animal models of cardiovascular diseases. However, MSCs decrease in quantity and quality with age, which reduces their capacity for damage repair. Long noncoding (lnc) RNAs regulate gene transcription and the fate of post‑transcriptional mRNA, affecting a broad range of age‑associated physiological and pathological conditions, including cardiovascular disease and cancer cell senescence. However, the functional role of lncRNAs in stem cell senescence remains largely unknown. The present study isolated bone marrow‑derived MSCs from young (8‑week‑old) and aged (18‑month‑old) male C57BL/6 mice. Cell proliferation was measured using a Cell Counting kit‑8 assay, and the secretion of vascular endothelial growth factor, basic fibroblast growth factor, hepatocyte growth factor and insulin‑like growth factor was measured by ELISA. Western blotting was performed to investigate β‑catenin protein expression. Oxidative stress was evaluated by detecting reactive oxygen species, and the activity of superoxide dismutase and malondialdehyde. MSCs isolated from aged mice demonstrated reduced proliferation and paracrine signaling, and increased oxidative stress and expression of lincRNA‑p21compared with MSCs from younger mice. Silencing lincRNA‑p21 in aged MSCs using small interfering RNA (siRNA) enhanced cell growth and paracrine function, and decreased oxidative stress. These results were reversed when β‑catenin expression was silenced using siRNA. In conclusion, lincRNA‑p21 may serve a role in MSC senescence, and silencing lincRNA‑p21 may rejuvenate MSCs by interacting with the Wnt/β‑catenin signaling pathway. Targeting lincRNA‑p21 may therefore have important therapeutic implications for restoring endogenous MSCs in aged individuals.
-
Nerurkar, Pratibha V.; Nishioka, Adrienne; Eck, Philip O.; Nerurkar, Vivek R.
2016-01-01
Renewed interest in alternative medicine among diabetic individuals prompted us to investigate anti-diabetic effects of Morinda citrifolia (noni) in high-fat diet (HFD)-fed mice. Type 2 diabetes is associated with increased glucose production due to the inability of insulin to suppress hepatic gluconeogenesis and promote glycolysis. Insulin inhibits gluconeogenesis by modulating transcription factors such as forkhead box O (FoxO1). Based on microarray analysis data, we tested the hypothesis that fermented noni fruit juice (fNJ) improves glucose metabolism via FoxO1 phosphorylation. C57BL/6 male mice were fed a HFD and fNJ for 12 weeks. Body weights and food intake were monitored daily. FoxO1 expression was analysed by real-time PCR and Western blotting. Specificity of fNJ-associated FoxO1 regulation of gluconeogenesis was confirmed by small interfering RNA (siRNA) studies using human hepatoma cells, HepG2. Supplementation with fNJ inhibited weight gain and improved glucose and insulin tolerance and fasting glucose in HFD-fed mice. Hypoglycaemic properties of fNJ were associated with the inhibition of hepatic FoxO1 mRNA expression, with a concomitant increase in FoxO1 phosphorylation and nuclear expulsion of the proteins. Gluconeogenic genes, phosphoenolpyruvate C kinase (PEPCK) and glucose-6-phosphatase (G6P), were significantly inhibited in mice fed a HFD + fNJ. HepG2 cells demonstrated more than 80% inhibition of PEPCK and G6P mRNA expression in cells treated with FoxO1 siRNA and fNJ. These data suggest that fNJ improves glucose metabolism via FoxO1 regulation in HFD-fed mice. PMID:22011624
-
Song, Hun Min; Park, Gwang Hun; Koo, Jin Suk; Jeong, Hyung Jin; Jeong, Jin Boo
2017-01-01
Fruit from Vitex rotundifolia L. (VF) has been reported to initiate apoptosis in human colorectal cancer cells through the accumulation of reactive oxygen species. Since various regulatory factors are involved in the apoptotic pathway, further study of the potential mechanisms of VF associated with the induction of apoptosis may be important despite the fact that the molecular target of VF for apoptosis has already been elucidated. In this study, we showed a new potential mechanism for the relationship between VF-mediated ATF3 expression and apoptosis to better understand the apoptotic mechanism of VF in human colorectal cancer cells. VF reduced the cell viability and induced apoptosis in human colorectal cancer cells. VF treatment increased both the protein and mRNA level of ATF3 and upregulated ATF3 promoter activity. The cis-element responsible for ATF3 transcriptional activation by VF was CREB which is located between [Formula: see text]147 to [Formula: see text]85 of ATF3 promoter. Inhibitions of ERK1/2, p38, JNK and GSK3[Formula: see text] blocked VF-mediated ATF3 expression. ATF3 knockdown by ATF3 siRNA attenuated the cleavage of PARP by VF, while ATF3 overexpression increased VF-mediated cleaved PARP. ATF3 knockdown also attenuated VF-mediated cell viability and cell death. In addition, VF downregulated Bcl-2 expression at both protein and mRNA level. ATF3 knockdown by ATF3 siRNA blocked VF-mediated downregulation of Bcl-2. In conclusion, VF may activate ATF3 expression through transcriptional regulation and subsequently suppress Bcl-2 expression as an anti-apoptotic protein, which may result in the induction of apoptosis in human colorectal cancer cells.
-
Vasilatos, Shauna N.; Boric, Lamia; Shaw, Patrick G.; Davidson, Nancy E.
2013-01-01
Abnormal activities of histone lysine demethylases (KDMs) and lysine deacetylases (HDACs) are associated with aberrant gene expression in breast cancer development. However, the precise molecular mechanisms underlying the crosstalk between KDMs and HDACs in chromatin remodeling and regulation of gene transcription are still elusive. In this study, we showed that treatment of human breast cancer cells with inhibitors targeting the zinc cofactor dependent class I/II HDAC, but not NAD+ dependent class III HDAC, led to significant increase of H3K4me2 which is a specific substrate of histone lysine-specific demethylase 1 (LSD1) and a key chromatin mark promoting transcriptional activation. We also demonstrated that inhibition of LSD1 activity by a pharmacological inhibitor, pargyline, or siRNA resulted in increased acetylation of H3K9 (AcH3K9). However, siRNA knockdown of LSD2, a homolog of LSD1, failed to alter the level of AcH3K9, suggesting that LSD2 activity may not be functionally connected with HDAC activity. Combined treatment with LSD1 and HDAC inhibitors resulted in enhanced levels of H3K4me2 and AcH3K9, and exhibited synergistic growth inhibition of breast cancer cells. Finally, microarray screening identified a unique subset of genes whose expression was significantly changed by combination treatment with inhibitors of LSD1 and HDAC. Our study suggests that LSD1 intimately interacts with histone deacetylases in human breast cancer cells. Inhibition of histone demethylation and deacetylation exhibits cooperation and synergy in regulating gene expression and growth inhibition, and may represent a promising and novel approach for epigenetic therapy of breast cancer. PMID:21452019
-
Transcription factor Mohawk and the pathogenesis of human anterior cruciate ligament degradation
Nakahara, Hiroyuki; Hasegawa, Akihiko; Otabe, Koji; Ayabe, Fumiaki; Matsukawa, Tetsuya; Onizuka, Naoko; Ito, Yoshiaki; Ozaki, Toshifumi; Lotz, Martin K.; Asahara, Hiroshi
2013-01-01
Objective To investigate the expression and function of Mohawk (MKX) in human adult anterior cruciate ligament (ACL) tissues and ligament cells from normal and osteoarthritis-affected knees. Methods Knee joints were obtained at autopsy within 24-48 hours postmortem from 13 normal donors (age 36.9±11.0 years), 16 OA donors (age 79.7±11.4 years) and 8 old donors without OA (age 76.9±12.9 years). All cartilage surfaces were graded macroscopically. MKX expression was analyzed by immunohistochemistry and quantitative PCR. ACL-derived cells were used to study regulation of MKX expression by IL-1β. MKX was knocked down by siRNA to analyze function of MKX in extracellular matrix (ECM) production and differentiation in ACL-derived cells. Results The expression of MKX was significantly decreased in ACL-derived cells from OA knees compared with normal knees. Consistent with this finding, immunohistochemistry showed that MKX positive cells were significantly reduced in ACL tissues from OA donors in particular in cells located in disorientated fibers. In ACL-derived cells, IL-1β strongly suppressed MKX gene expression and reduced ligament ECM genes, COL1A1 and TNXB. On the other hand, SOX9, chondrocyte master transcription factor, was up regulated by IL-1β treatment. Importantly, knock down of MKX expression by siRNA upregulated SOX9 expression in ACL-derived cells, whereas the expression of COL1A1 and TNXB were decreased. Conclusion Reduced expression of MKX is a feature of degenerated ACL in OA-affected joints and this may be in part mediated by IL-1β. MKX appears necessary to maintain the tissue specific cellular differentiation status and ECM production in adult human tendons and ligaments. PMID:23686683
-
Skalniak, Lukasz; Dziendziel, Monika; Jura, Jolanta
2014-10-01
Recently, we have shown that the treatment of cells with proteasome inhibitor MG-132 results in the induction of expression of monocyte chemotactic protein-1 induced protein 1 (MCPIP1). MCPIP1 is a ribonuclease, responsible for the degradation of transcripts encoding certain pro-inflammatory cytokines. The protein is also known as an inhibitor of NF-κB transcription factor. Thanks to its molecular properties, MCPIP1 is considered as a regulator of inflammation, differentiation, and survival. Using siRNA technology, we show here that MCPIP1 expression contributes to the toxic properties of MG-132 in HeLa cells. The inhibition of proteasome by MG-132 and epoxomicin markedly increased MCPIP1 expression. While MG-132 induces HeLa cell death, down-regulation of MCPIP1 expression by siRNA partially protects HeLa cells from MG-132 toxicity and restores Nuclear factor-κB (NF-κB) activity, inhibited by MG-132 treatment. Inversely, overexpression of MCPIP1 decreased constitutive activity of NF-κB and limited the survival of HeLa cells, as we have shown in the previous study. Interestingly, although MG-132 decreased the expression of IκBα and increased p65 phosphorylation, the inhibition of constitutive NF-κB activity was observed in MG-132-treated cells. Since the elevated constitutive activity of NF-κB is one of the mechanisms providing increased survival of cancer cells, including HeLa cells, we propose that death-promoting properties of MCPIP1 in MG-132-treated HeLa cells may, at least partially, derive from the negative effect on the constitutive NF-κB activity.
-
Bramsen, Jesper B.; Pakula, Malgorzata M.; Hansen, Thomas B.; Bus, Claus; Langkjær, Niels; Odadzic, Dalibor; Smicius, Romualdas; Wengel, Suzy L.; Chattopadhyaya, Jyoti; Engels, Joachim W.; Herdewijn, Piet; Wengel, Jesper; Kjems, Jørgen
2010-01-01
Small interfering RNAs (siRNAs) are now established as the preferred tool to inhibit gene function in mammalian cells yet trigger unintended gene silencing due to their inherent miRNA-like behavior. Such off-target effects are primarily mediated by the sequence-specific interaction between the siRNA seed regions (position 2–8 of either siRNA strand counting from the 5′-end) and complementary sequences in the 3′UTR of (off-) targets. It was previously shown that chemical modification of siRNAs can reduce off-targeting but only very few modifications have been tested leaving more to be identified. Here we developed a luciferase reporter-based assay suitable to monitor siRNA off-targeting in a high throughput manner using stable cell lines. We investigated the impact of chemically modifying single nucleotide positions within the siRNA seed on siRNA function and off-targeting using 10 different types of chemical modifications, three different target sequences and three siRNA concentrations. We found several differently modified siRNAs to exercise reduced off-targeting yet incorporation of the strongly destabilizing unlocked nucleic acid (UNA) modification into position 7 of the siRNA most potently reduced off-targeting for all tested sequences. Notably, such position-specific destabilization of siRNA–target interactions did not significantly reduce siRNA potency and is therefore well suited for future siRNA designs especially for applications in vivo where siRNA concentrations, expectedly, will be low. PMID:20453030
-
2013-01-01
Carbon nanotubes are capable of penetrating the cell membrane and are widely considered as potential carriers for gene or drug delivery. Because the C-C and C=C bonds in carbon nanotubes are nonpolar, functionalization is required for carbon nanotubes to interact with genes or drugs as well as to improve their biocompatibility. In this study, polyethylenimine (PEI)-functionalized single-wall (PEI-NH-SWNTs) and multiwall carbon nanotubes (PEI-NH-MWNTs) were produced by direct amination method. PEI functionalization increased the positive charge on the surface of SWNTs and MWNTs, allowing carbon nanotubes to interact electrostatically with the negatively charged small interfering RNAs (siRNAs) and to serve as nonviral gene delivery reagents. PEI-NH-MWNTs and PEI-NH-SWNTs had a better solubility in water than pristine carbon nanotubes, and further removal of large aggregates by centrifugation produced a stable suspension of reduced particle size and improved homogeneity and dispersity. The amount of grafted PEI estimated by thermogravimetric analysis was 5.08% (w/w) and 5.28% (w/w) for PEI-NH-SWNTs and PEI-NH-MWNTs, respectively. For the assessment of cytotoxicity, various concentrations of PEI-NH-SWNTs and PEI-NH-MWNTs were incubated with human cervical cancer cells, HeLa-S3, for 48 h. PEI-NH-SWNTs and PEI-NH-MWNTs induced cell deaths in a dose-dependent manner but were less cytotoxic compared to pure PEI. As determined by electrophoretic mobility shift assay, siRNAs directed against glyceraldehyde-3-phosphate dehydrogenase (siGAPDH) were completely associated with PEI-NH-SWNTs or PEI-NH-MWNTs at a PEI-NH-SWNT/siGAPDH or PEI-NH-MWNT/siGAPDH mass ratio of 80:1 or 160:1, respectively. Furthermore, PEI-NH-SWNTs and PEI-NH-MWNTs successfully delivered siGAPDH into HeLa-S3 cells at PEI-NH-SWNT/siGAPDH and PEI-NH-MWNT/siGAPDH mass ratios of 1:1 to 20:1, resulting in suppression of the mRNA level of GAPDH to an extent similar to that of DharmaFECT, a common transfection reagent for siRNAs. Our results indicate that the PEI-NH-SWNTs and PEI-NH-MWNTs produced in this study are capable of delivering siRNAs into HeLa-S3 cells to suppress gene expression and may therefore be considered as novel nonviral gene delivery reagents. PMID:23742156
-
Hayashi, Junsuke; Nishigaki, Misa; Ochi, Yosuke; Wada, Shun-Ichi; Wada, Fumito; Nakagawa, Osamu; Obika, Satoshi; Harada-Shiba, Mariko; Urata, Hidehito
2018-07-01
Small interfering RNAs (siRNAs) are an active agent to induce gene silencing and they have been studied for becoming a biological and therapeutic tool. Various 2'-O-modified RNAs have been extensively studied to improve the nuclease resistance. However, the 2'-O-modified siRNA activities were often decreased by modification, since the bulky 2'-O-modifications inhibit to form a RNA-induced silencing complex (RISC). We developed novel prodrug-type 2'-O-methyldithiomethyl (MDTM) siRNA, which is converted into natural siRNA in an intracellular reducing environment. Prodrug-type 2'-O-MDTM siRNAs modified at the 5'-end side including 5'-end nucleotide and the seed region of the antisense strand exhibited much stronger gene silencing effect than non-prodrug-type 2'-O-methyl (2'-O-Me) siRNAs. Furthermore, the resistances for nuclease digestion of siRNAs were actually enhanced by 2'-O-MDTM modifications. Our results indicate that 2'-O-MDTM modifications improve the stability of siRNA in serum and they are able to be introduced at any positions of siRNA. Copyright © 2018 Elsevier Ltd. All rights reserved.
-
Vannitamby, Amanda; Seow, Huei Jiunn; Anderson, Gary; Vlahos, Ross; Thompson, Michelle; Steinfort, Daniel; Irving, Louis B; Bozinovski, Steven
2017-01-01
Matrix metalloproteinase-9 (MMP-9) is increased in a number of pathological lung conditions, where the proteinase contributes to deleterious remodelling of the airways. While both lung cancer and COPD are associated with increased MMP-9 expression, the cellular and molecular drivers of MMP-9 remain unresolved. In this study, MMP-9 transcript measured within the tumour region from patients with non-small-cell lung cancer (NSCLC) and coexisting COPD was found to be uniformly increased relative to adjacent tumour-free tissue. MMP-9 gene expression and immunohistochemistry identified tumour-associated neutrophils, but not macrophages, as a predominant source of this proteinase. In addition, PTEN gene expression was significantly reduced in tumour and there was evidence of epithelial MMP-9 expression. To explore whether PTEN can regulate epithelial MMP-9 expression, a small interfering (si)RNA knockdown strategy was used in Beas-2B bronchial epithelial cells. PTEN knockdown by siRNA selectively increased MMP-9 expression in response to lipopolysaccharide in a corticosteroid-insensitive manner. In summary, tumour-associated neutrophils represent an important source of MMP-9 in NSCLC, and loss of epithelial PTEN may further augment steroid-insensitive expression. PMID:28202627
-
Vertical silicon nanowires as a universal platform for delivering biomolecules into living cells
Shalek, Alex K.; Robinson, Jacob T.; Karp, Ethan S.; Lee, Jin Seok; Ahn, Dae-Ro; Yoon, Myung-Han; Sutton, Amy; Jorgolli, Marsela; Gertner, Rona S.; Gujral, Taranjit S.; MacBeath, Gavin; Yang, Eun Gyeong; Park, Hongkun
2010-01-01
A generalized platform for introducing a diverse range of biomolecules into living cells in high-throughput could transform how complex cellular processes are probed and analyzed. Here, we demonstrate spatially localized, efficient, and universal delivery of biomolecules into immortalized and primary mammalian cells using surface-modified vertical silicon nanowires. The method relies on the ability of the silicon nanowires to penetrate a cell’s membrane and subsequently release surface-bound molecules directly into the cell’s cytosol, thus allowing highly efficient delivery of biomolecules without chemical modification or viral packaging. This modality enables one to assess the phenotypic consequences of introducing a broad range of biological effectors (DNAs, RNAs, peptides, proteins, and small molecules) into almost any cell type. We show that this platform can be used to guide neuronal progenitor growth with small molecules, knock down transcript levels by delivering siRNAs, inhibit apoptosis using peptides, and introduce targeted proteins to specific organelles. We further demonstrate codelivery of siRNAs and proteins on a single substrate in a microarray format, highlighting this technology’s potential as a robust, monolithic platform for high-throughput, miniaturized bioassays. PMID:20080678
-
Senapedis, William T.; Kennedy, Caleb J.; Boyle, Patrick M.; Silver, Pamela A.
2011-01-01
Forkhead transcription factors (FOXOs) alter a diverse array of cellular processes including the cell cycle, oxidative stress resistance, and aging. Insulin/Akt activation directs phosphorylation and cytoplasmic sequestration of FOXO away from its target genes and serves as an endpoint of a complex signaling network. Using a human genome small interfering RNA (siRNA) library in a cell-based assay, we identified an extensive network of proteins involved in nuclear export, focal adhesion, and mitochondrial respiration not previously implicated in FOXO localization. Furthermore, a detailed examination of mitochondrial factors revealed that loss of uncoupling protein 5 (UCP5) modifies the energy balance and increases free radicals through up-regulation of uncoupling protein 3 (UCP3). The increased superoxide content induces c-Jun N-terminal kinase 1 (JNK1) kinase activity, which in turn affects FOXO localization through a compensatory dephosphorylation of Akt. The resulting nuclear FOXO increases expression of target genes, including mitochondrial superoxide dismutase. By connecting free radical defense and mitochondrial uncoupling to Akt/FOXO signaling, these results have implications in obesity and type 2 diabetes development and the potential for therapeutic intervention. PMID:21460183
-
Senapedis, William T; Kennedy, Caleb J; Boyle, Patrick M; Silver, Pamela A
2011-05-15
Forkhead transcription factors (FOXOs) alter a diverse array of cellular processes including the cell cycle, oxidative stress resistance, and aging. Insulin/Akt activation directs phosphorylation and cytoplasmic sequestration of FOXO away from its target genes and serves as an endpoint of a complex signaling network. Using a human genome small interfering RNA (siRNA) library in a cell-based assay, we identified an extensive network of proteins involved in nuclear export, focal adhesion, and mitochondrial respiration not previously implicated in FOXO localization. Furthermore, a detailed examination of mitochondrial factors revealed that loss of uncoupling protein 5 (UCP5) modifies the energy balance and increases free radicals through up-regulation of uncoupling protein 3 (UCP3). The increased superoxide content induces c-Jun N-terminal kinase 1 (JNK1) kinase activity, which in turn affects FOXO localization through a compensatory dephosphorylation of Akt. The resulting nuclear FOXO increases expression of target genes, including mitochondrial superoxide dismutase. By connecting free radical defense and mitochondrial uncoupling to Akt/FOXO signaling, these results have implications in obesity and type 2 diabetes development and the potential for therapeutic intervention.
-
Transcriptome-wide targets of alternative splicing by RBM4 and possible role in cancer.
Markus, M Andrea; Yang, Yee Hwa J; Morris, Brian J
2016-04-01
This study determined transcriptome-wide targets of the splicing factor RBM4 using Affymetrix GeneChip(®) Human Exon 1.0 ST Arrays and HeLa cells treated with RBM4-specific siRNA. This revealed 238 transcripts that were targeted for alternative splicing. Cross-linking and immunoprecipitation experiments identified 945 RBM4 targets in mouse HEK293 cells, 39% of which were ascribed to "alternative splicing" by in silico pathway analysis. Mouse embryonic stem cells transfected with Rbm4 siRNA hairpins exhibited reduced colony numbers and size consistent with involvement of RBM4 in cell proliferation. RBM4 cDNA probing of a cancer cDNA array involving 18 different tumor types from 13 different tissues and matching normal tissue found overexpression of RBM4 mRNA (p<0.01) in cervical, breast, lung, colon, ovarian and rectal cancers. Many RBM4 targets we identified have been implicated in these cancers. In conclusion, our findings reveal transcriptome-wide targets of RBM4 and point to potential cancer-related targets and mechanisms that may involve RBM4. Copyright © 2016 Elsevier Inc. All rights reserved.
-
Menon, Debashish U; Coarfa, Cristian; Xiao, Weimin; Gunaratne, Preethi H; Meller, Victoria H
2014-11-18
Highly differentiated sex chromosomes create a lethal imbalance in gene expression in one sex. To accommodate hemizygosity of the X chromosome in male fruit flies, expression of X-linked genes increases twofold. This is achieved by the male- specific lethal (MSL) complex, which modifies chromatin to increase expression. Mutations that disrupt the X localization of this complex decrease the expression of X-linked genes and reduce male survival. The mechanism that restricts the MSL complex to X chromatin is not understood. We recently reported that the siRNA pathway contributes to localization of the MSL complex, raising questions about the source of the siRNAs involved. The X-linked 1.688 g/cm(3) satellite related repeats (1.688(X) repeats) are restricted to the X chromosome and produce small RNA, making them an attractive candidate. We tested RNA from these repeats for a role in dosage compensation and found that ectopic expression of single-stranded RNAs from 1.688(X) repeats enhanced the male lethality of mutants with defective X recognition. In contrast, expression of double-stranded hairpin RNA from a 1.688(X) repeat generated abundant siRNA and dramatically increased male survival. Consistent with improved survival, X localization of the MSL complex was largely restored in these males. The striking distribution of 1.688(X) repeats, which are nearly exclusive to the X chromosome, suggests that these are cis-acting elements contributing to identification of X chromatin.
-
The impact of target site accessibility on the design of effective siRNAs.
Tafer, Hakim; Ameres, Stefan L; Obernosterer, Gregor; Gebeshuber, Christoph A; Schroeder, Renée; Martinez, Javier; Hofacker, Ivo L
2008-05-01
Small-interfering RNAs (siRNAs) assemble into RISC, the RNA-induced silencing complex, which cleaves complementary mRNAs. Despite their fluctuating efficacy, siRNAs are widely used to assess gene function. Although this limitation could be ascribed, in part, to variations in the assembly and activation of RISC, downstream events in the RNA interference (RNAi) pathway, such as target site accessibility, have so far not been investigated extensively. In this study we present a comprehensive analysis of target RNA structure effects on RNAi by computing the accessibility of the target site for interaction with the siRNA. Based on our observations, we developed a novel siRNA design tool, RNAxs, by combining known siRNA functionality criteria with target site accessibility. We calibrated our method on two data sets comprising 573 siRNAs for 38 genes, and tested it on an independent set of 360 siRNAs targeting four additional genes. Overall, RNAxs proves to be a robust siRNA selection tool that substantially improves the prediction of highly efficient siRNAs.
-
Effect of the Transient Pharmacological Inhibition of Mapk3/1 Pathway on Ovulation in Mice
Siddappa, Dayananda; Beaulieu, Élaine; Gévry, Nicolas; Roux, Philippe P.; Bordignon, Vilceu; Duggavathi, Raj
2015-01-01
Mitogen-activated protein kinase 3/1 (Mapk3/1) pathway is critical for LH signal transduction during ovulation. However, the mechanisms remain incompletely understood. We hypothesized that Mapk pathway regulates ovulation through transcriptional regulation of ovulatory genes. To test this hypothesis we used immature mice superovulated with equine and human chorionic gonadotropins (eCG and hCG) and PD0325901, to inhibit hCG-induced Mapk3/1 activity. Mice received either the inhibitor PD0325901 (25 μg/g, i.p.) or vehicle at 2h before hCG stimulation. Administration of the inhibitor abolished Mapk3/1 phosphorylation in granulosa cells. While vehicle-treated mice ovulated normally, there were no ovulations in inhibitor-treated mice. First, we analyzed gene expression in granulosa cells at 0h, 1h and 4h post-hCG. There was expected hCG-driven increase in mRNA abundance of many ovulation-related genes including Ptgs2 in vehicle-treated granulosa cells, but not (P<0.05) in inhibitor-treated group. There was also reduced mRNA and protein abundance of the transcription factor, early growth response 1 (Egr1) in inhibitor-treated granulosa cells. We then used GRMO2 cell-line to test if Egr1 is recruited to promoter of Ptgs2 followed by chromatin immunoprecipitation with either Egr1 or control antibody. Enrichment of the promoter regions in immunoprecipitants of Egr1 antibody indicated that Egr1 binds to the Ptgs2 promoter. We then knocked down Egr1 expression in mouse primary granulosa cells using siRNA technology. Treatment with Egr1-siRNA inhibited Egr1 transcript accumulation, which was associated with reduced expression of Ptgs2 when compared to control-siRNA treated granulosa cells. These data demonstrate that transient inhibition of LH-stimulated MAPK3/1 activity abrogates ovulation in mice. We conclude that Mapk3/1 regulates ovulation, at least in part, through Egr1 and its target gene, Ptgs2 in granulosa cells of ovulating follicles in mice. PMID:25803847
-
FUNCTION OF PHLOEM-BORNE INFORMATION MACROMOLECULES IN INTEGRATING PLANT GROWTH & DEVELOPMENT
DOE Office of Scientific and Technical Information (OSTI.GOV)
William J. Lucas
2012-11-12
Studies on higher plants have revealed the operation of cell-to-cell and long-distance communication networks that mediate the transport of information macromolecules, such as proteins and RNA. Based on the findings from this DOE-funded project and results from other groups, it is now well established that the enucleate sieve tube system of the angiosperms contains a complex set of proteins including RNA binding proteins as well as a unique population of RNA molecules, comprised of both mRNA and small RNA species. Hetero-grafting experiments demonstrated that delivery of such RNA molecules, into the scion, is highly correlated with changes in developmental phenotypes.more » Furthermore, over the course of this project, our studies showed that plasmodesmata and the phloem are intimately involved in the local and systemic spread of sequence-specific signals that underlie gene silencing in plants. Major advances were also made in elucidating the underlying mechanisms that operate to mediate the selective entry and exit of proteins and RNA into and out of the phloem translocation stream. Our pioneering studies identified the first plant protein with the capacity to both bind specifically to small RNA molecules (si-RNA) and mediate in the cell-to-cell movement of such siRNA. Importantly, studies conducted with support from this DOE program also yielded a detailed characterization of the first phloem-mobile RNP complex isolated from pumpkin, namely the CmRBP50-RNP complex. This RNP complex was shown to bind, in a sequence-specific manner, to a set of transcripts encoding for transcription factors. The remarkable stability of this CmRBP50-RNP complex allows for long-distance delivery of bound transcripts from mature leaves into developing tissues and organs. Knowledge gained from this project can be used to exert control over the long-distance signaling networks used by plants to integrate their physiological and developmental programs at a whole plant level. Eventually, this information will aid in the engineering of elite plant lines with optimal traits for plant growth under non-ideal conditions, enhanced biomass and/or seed yield, and directed carbon allocation for efficient and sustainable biofuels production.« less
-
Cho, Jun Sik; Lee, Shin-Wha; Kim, Yong-Man; Kim, Dongho; Kim, Dae-Yeon; Kim, Young-Tak
2015-05-01
This study was to identify small inhibitory RNAs (siRNAs) that are effective in inhibiting growth of cervical cancer cell lines harboring human papilloma virus (HPV) and to examine how siRNAs interact with interferon beta (IFN-β) and thimerosal. The HPV18-positive HeLa and C-4I cell lines were used. Four types of siRNAs were designed according to their target (both E6 and E7 vs. E6 only) and sizes (21- vs. 27-nucleotides); Ex-18E6/21, Ex-18E6/27, Sp-18E6/21, and Sp-18E6/27. Each siRNA-transfected cells were cultured with or without IFN-b and thimerosal and their viability was measured. The viabilities of HPV18-positive tumor cells were reduced by 21- and 27-nucleotide siRNAs in proportion to the siRNA concentrations. Of the two types of siRNAs, the 27-nucleotide siRNA constructs showed greater inhibitory efficacy. Sp-18E6 siRNAs, which selectively downregulates E6 protein only, were more effective than the E6- and E7-targeting Ex-18E6 siRNAs. siRNAs and IFN-β showed the synergistic effect to inhibit HeLa cell survival and the effect was proportional to both siRNA and IFN-β concentrations. Thimerosal in the presence of siRNA exerted a dose-dependent inhibition of C-4I cell survival. Finally, co-treatment with siRNA, IFN-β, and thimerosal induced the most profound decrease in the viability of both cell lines. Long (27-nucleotides) siRNAs targeting E6-E7 mRNAs effectively reduce the viability of HPV18-positive cervical cancer cells and show the synergistic effect in combination with IFN-b and thimerosal. It is necessary to find the rational design of siRNAs and effective co-factors to eradicate particular cervical cancer.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kubo, Takanori, E-mail: kubo-t@yasuda-u.ac.jp; Yanagihara, Kazuyoshi; Division of Genetics, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045
2012-10-05
Highlights: Black-Right-Pointing-Pointer SiRNAs conjugated with aromatic compounds (Ar-siRNAs) at 5 Prime -sense strand were synthesized. Black-Right-Pointing-Pointer Ar-siRNAs increased resistance against nuclease degradation. Black-Right-Pointing-Pointer Ar-siRNAs were thermodynamically stable compared with the unmodified siRNA. Black-Right-Pointing-Pointer High levels of cellular uptake and cytoplasmic localization were found. Black-Right-Pointing-Pointer Strong gene-silencing efficacy was exhibited in the Ar-siRNAs. -- Abstract: Short interference RNA (siRNA) is a powerful tool for suppressing gene expression in mammalian cells. In this study, we focused on the development of siRNAs conjugated with aromatic compounds in order to improve the potency of RNAi and thus to overcome several problems with siRNAs, suchmore » as cellular delivery and nuclease stability. The siRNAs conjugated with phenyl, hydroxyphenyl, naphthyl, and pyrenyl derivatives showed strong resistance to nuclease degradation, and were thermodynamically stable compared with unmodified siRNA. A high level of membrane permeability in HeLa cells was also observed. Moreover, these siRNAs exhibited enhanced RNAi efficacy, which exceeded that of locked nucleic acid (LNA)-modified siRNAs, against exogenous Renilla luciferase in HeLa cells. In particular, abundant cytoplasmic localization and strong gene-silencing efficacy were found in the siRNAs conjugated with phenyl and hydroxyphenyl derivatives. The novel siRNAs conjugated with aromatic compounds are promising candidates for a new generation of modified siRNAs that can solve many of the problems associated with RNAi technology.« less
-
Gizard, Florence; Zhao, Yue; Findeisen, Hannes M.; Qing, Hua; Cohn, Dianne; Heywood, Elizabeth B.; Jones, Karrie L.; Nomiyama, Takashi; Bruemmer, Dennis
2011-01-01
Members of the NR4A subgroup of the nuclear hormone receptor superfamily have emerged as key transcriptional regulators of proliferation and inflammation. NOR1 constitutes a ligand-independent transcription factor of this subgroup and induces cell proliferation; however, the transcriptional mechanisms underlying this mitogenic role remain to be defined. Here, we demonstrate that the F-box protein SKP2 (S phase kinase-associated protein 2), the substrate-specific receptor of the ubiquitin ligase responsible for the degradation of p27KIP1 through the proteasome pathway, constitutes a direct transcriptional target for NOR1. Mitogen-induced Skp2 expression is silenced in vascular smooth muscle cells (VSMC) isolated from Nor1-deficient mice or transfected with Nor1 siRNA. Conversely, adenovirus-mediated overexpression of NOR1 induces Skp2 expression in VSMC and decreases protein abundance of its target p27. Transient transfection experiments establish that NOR1 transactivates the Skp2 promoter through a nerve growth factor-induced clone B response element (NBRE). Electrophoretic mobility shift and chromatin immunoprecipitation assays further revealed that NOR1 is recruited to this NBRE site in the Skp2 promoter in response to mitogenic stimulation. In vivo Skp2 expression is increased during the proliferative response underlying neointima formation, and this transcriptional induction depends on the expression of NOR1. Finally, we demonstrate that overexpression of Skp2 rescues the proliferative arrest of Nor1-deficient VSMC. Collectively, these results characterize Skp2 as a novel NOR1-regulated target gene and detail a previously unrecognized transcriptional cascade regulating mitogen-induced VSMC proliferation. PMID:21868379
-
Bovine Foamy Virus Transactivator BTas Interacts with Cellular RelB To Enhance Viral Transcription▿
Wang, Jian; Tan, Juan; Guo, Hongyan; Zhang, Qicheng; Jia, Rui; Xu, Xuan; Geng, Yunqi; Qiao, Wentao
2010-01-01
Viruses are obligate intracellular parasites that depend on cellular machinery for their efficient transcription and replication. In a previous study we reported that bovine foamy virus (BFV) is able to activate the nuclear factor κB (NF-κB) pathway through the action of its transactivator BTas to enhance viral transcription. However, the mechanism used by NF-κB to enhance BFV transcription remains elusive. To address this question, we employed a yeast two-hybrid assay to screen for BTas-interacting proteins. We found that RelB, a member of NF-κB protein family, interacts with BTas. We confirmed the putative RelB-BTas interaction in vitro and in vivo and identified the protein regions responsible for the RelB-BTas interaction. Using a luciferase reporter assay, we next showed that RelB enhances BFV transcription (BTas-induced long terminal repeat [LTR] transactivation) and that this process requires both the localization of the RelB-BTas interaction in the nucleus and the Rel homology domain of RelB. The knockdown of the cellular endogenous RelB protein using small interfering RNA (siRNA) significantly attenuated BTas-induced LTR transcription. The results of chromatin immunoprecipitation (ChIP) analysis showed that endogenous RelB binds to the viral LTR in BFV-infected cells. Together, these results suggest that BFV engages the RelB protein as a cotransactivator of BTas to enhance viral transcription. In addition, our findings indicate that BFV infection upregulates cellular RelB expression through BTas-induced NF-κB activation. Thus, this study demonstrates the existence of a positive-feedback circuit in which BFV utilizes the host's NF-κB pathway through the RelB protein for efficient viral transcription. PMID:20844054
-
Lemay, Julie; Maidou-Peindara, Priscilla; Bader, Thomas; Ennifar, Eric; Rain, Jean-Christophe; Benarous, Richard; Liu, Lang Xia
2008-01-01
Reverse transcription of the genetic material of human immunodeficiency virus type 1 (HIV-1) is a critical step in the replication cycle of this virus. This process, catalyzed by reverse transcriptase (RT), is well characterized at the biochemical level. However, in infected cells, reverse transcription occurs in a multiprotein complex – the reverse transcription complex (RTC) – consisting of viral genomic RNA associated with viral proteins (including RT) and, presumably, as yet uncharacterized cellular proteins. Very little is known about the cellular proteins interacting with the RTC, and with reverse transcriptase in particular. We report here that HIV-1 reverse transcription is affected by the levels of a nucleocytoplasmic shuttling protein – the RNA-binding protein HuR. A direct protein-protein interaction between RT and HuR was observed in a yeast two-hybrid screen and confirmed in vitro by homogenous time-resolved fluorescence (HTRF). We mapped the domain interacting with HuR to the RNAse H domain of RT, and the binding domain for RT to the C-terminus of HuR, partially overlapping the third RRM RNA-binding domain of HuR. HuR silencing with specific siRNAs greatly impaired early and late steps of reverse transcription, significantly inhibiting HIV-1 infection. Moreover, by mutagenesis and immunoprecipitation studies, we could not detect the binding of HuR to the viral RNA. These results suggest that HuR may be involved in and may modulate the reverse transcription reaction of HIV-1, by an as yet unknown mechanism involving a protein-protein interaction with HIV-1 RT. PMID:18544151
-
Tabata, Takanori; Kokura, Kenji; Ten Dijke, Peter; Ishii, Shunsuke
2009-01-01
The products encoded by ski and its related gene, sno, (Ski and Sno) act as transcriptional co-repressors and interact with other co-repressors such as N-CoR/SMRT and mSin3A. Ski and Sno mediate transcriptional repression by various repressors, including Mad, Rb and Gli3. Ski/Sno also suppress transcription induced by multiple activators, such as Smads and c-Myb. In particular, the inhibition of TGF-beta-induced transcription by binding to Smads is correlated with the oncogenic activity of Ski and Sno. However, the molecular mechanism by which Ski and Sno mediate transcriptional repression remains unknown. In this study, we report the purification and characterization of Ski complexes. The Ski complexes purified from HeLa cells contained histone deacetylase 3 (HDAC3) and protein arginine methyltransferase 5 (PRMT5), in addition to multiple Smad proteins (Smad2, Smad3 and Smad4). Chromatin immunoprecipitation assays indicated that these components of the Ski complexes were localized on the SMAD7 gene promoter, which is the TGF-beta target gene, in TGF-beta-untreated HepG2 cells. Knockdown of these components using siRNA led to up-regulation of SMAD7 mRNA. These results indicate that Ski complexes serve to maintain a TGF-beta-responsive promoter at a repressed basal level via the activities of histone deacetylase and histone arginine methyltransferase.
-
A novel program to design siRNAs simultaneously effective to highly variable virus genomes.
Lee, Hui Sun; Ahn, Jeonghyun; Jun, Eun Jung; Yang, Sanghwa; Joo, Chul Hyun; Kim, Yoo Kyum; Lee, Heuiran
2009-07-10
A major concern of antiviral therapy using small interfering RNAs (siRNAs) targeting RNA viral genome is high sequence diversity and mutation rate due to genetic instability. To overcome this problem, it is indispensable to design siRNAs targeting highly conserved regions. We thus designed CAPSID (Convenient Application Program for siRNA Design), a novel bioinformatics program to identify siRNAs targeting highly conserved regions within RNA viral genomes. From a set of input RNAs of diverse sequences, CAPSID rapidly searches conserved patterns and suggests highly potent siRNA candidates in a hierarchical manner. To validate the usefulness of this novel program, we investigated the antiviral potency of universal siRNA for various Human enterovirus B (HEB) serotypes. Assessment of antiviral efficacy using Hela cells, clearly demonstrates that HEB-specific siRNAs exhibit protective effects against all HEBs examined. These findings strongly indicate that CAPSID can be applied to select universal antiviral siRNAs against highly divergent viral genomes.
-
Ultrasound-Targeted Microbubble Destruction to Deliver siRNA Cancer Therapy
Carson, Andrew R; McTiernan, Charles F; Lavery, Linda; Grata, Michelle; Leng, Xiaoping; Wang, Jianjun; Chen, Xucai; Villanueva, Flordeliza S
2012-01-01
Microbubble contrast agents can specifically deliver nucleic acids to target tissues when exposed to ultrasound treatment parameters that mediate microbubble destruction. In this study, we evaluated whether microbubbles and ultrasound targeted microbubble destruction (UTMD) could be used to enhance delivery of EGFR-directed small inhibitory RNA (siRNA) to murine squamous cell carcinomas. Custom designed microbubbles efficiently bound siRNA and mediated RNAse protection. UTMD-mediated delivery of microbubbles loaded with EGFR-directed siRNA to murine squamous carcinoma cells in vitro reduced EGFR expression and EGF-dependent growth, relative to delivery of control siRNA. Similarly, serial UTMD-mediated delivery of EGFR siRNA to squamous cell carcinoma in vivo decreased EGFR expression and increased tumor doubling times, relative to controls receiving EGFR siRNA loaded microbubbles but not ultrasound or control siRNA loaded microbubbles and UTMD. Taken together, our results offer a preclinical proof of concept for customized microbubbles and UTMD to deliver gene-targeted siRNA for cancer therapy. PMID:23010078
-
Khurana, Simran; Warburton, Alix
2017-01-01
We have shown previously that Sp100 (a component of the ND10 nuclear body) represses transcription, replication and establishment of incoming human papillomavirus (HPV) DNA in the early stages of infection. In this follow up study, we show that Sp100 does not substantially regulate viral infection in the maintenance phase, however at late stages of infection Sp100 interacts with amplifying viral genomes to repress viral processes. We find that Sp100 localizes to HPV16 replication foci generated in primary keratinocytes, to HPV31 replication foci that form in differentiated cells, and to HPV16 replication foci in CIN 1 cervical biopsies. To analyze this further, Sp100 was down regulated by siRNA treatment of differentiating HPV31 containing cells and levels of viral transcription and replication were assessed. This revealed that Sp100 represses viral transcription and replication in differentiated cells. Analysis of Sp100 binding to viral chromatin showed that Sp100 bound across the viral genome, and that binding increased at late stages of infection. Therefore, Sp100 represses the HPV life cycle at both early and late stages of infection. PMID:28968443
-
Cold shock protein YB-1 is involved in hypoxia-dependent gene transcription.
Rauen, Thomas; Frye, Bjoern C; Wang, Jialin; Raffetseder, Ute; Alidousty, Christina; En-Nia, Abdelaziz; Floege, Jürgen; Mertens, Peter R
2016-09-16
Hypoxia-dependent gene regulation is largely orchestrated by hypoxia-inducible factors (HIFs), which associate with defined nucleotide sequences of hypoxia-responsive elements (HREs). Comparison of the regulatory HRE within the 3' enhancer of the human erythropoietin (EPO) gene with known binding motifs for cold shock protein Y-box (YB) protein-1 yielded strong similarities within the Y-box element and 3' adjacent sequences. DNA binding assays confirmed YB-1 binding to both, single- and double-stranded HRE templates. Under hypoxia, we observed nuclear shuttling of YB-1 and co-immunoprecipitation assays demonstrated that YB-1 and HIF-1α physically interact with each other. Cellular YB-1 depletion using siRNA significantly induced hypoxia-dependent EPO production at both, promoter and mRNA level. Vice versa, overexpressed YB-1 significantly reduced EPO-HRE-dependent gene transcription, whereas this effect was minor under normoxia. HIF-1α overexpression induced hypoxia-dependent gene transcription through the same element and accordingly, co-expression with YB-1 reduced HIF-1α-mediated EPO induction under hypoxic conditions. Taken together, we identified YB-1 as a novel binding factor for HREs that participates in fine-tuning of the hypoxia transcriptome. Copyright © 2016 Elsevier Inc. All rights reserved.
-
Long Noncoding RNA PANDA Positively Regulates Proliferation of Osteosarcoma Cells.
Kotake, Yojiro; Goto, Taiki; Naemura, Madoka; Inoue, Yasutoshi; Okamoto, Haruna; Tahara, Keiichiro
2017-01-01
A long noncoding RNA, p21-associated ncRNA DNA damage-activated (PANDA), associates with nuclear transcription factor Y subunit alpha (NF-YA) and inhibits its binding to promoters of apoptosis-related genes, thereby repressing apoptosis in normal human fibroblasts. Here, we show that PANDA is involved in regulating proliferation in the U2OS human osteosarcoma cell line. U2OS cells were transfected with siRNAs against PANDA 72 h later and they were subjected to reverse transcription-polymerase chain reaction (RT-PCR), quantitative RT-PCR and cell-cycle analysis. PANDA was highly expressed in U2OS cells, and its expression was induced by DNA damage. Silencing PANDA caused arrest at the G 1 phase of the cell cycle, leading to inhibition of cell proliferation. Quantitative RT-PCR showed that silencing PANDA increased mRNA levels of the cyclin-dependent kinase inhibitor p18, which caused G 1 phase arrest. These results suggest that PANDA promotes G 1 -S transition by repressing p18 transcription, and thus promotes U2OS cell proliferation. Copyright© 2017 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
-
The HIV-1 transcriptional activator Tat has potent nucleic acid chaperoning activities in vitro.
Kuciak, Monika; Gabus, Caroline; Ivanyi-Nagy, Roland; Semrad, Katharina; Storchak, Roman; Chaloin, Olivier; Muller, Sylviane; Mély, Yves; Darlix, Jean-Luc
2008-06-01
The human immunodeficiency virus type 1 (HIV-1) is a primate lentivirus that causes the acquired immunodeficiency syndrome (AIDS). In addition to the virion structural proteins and enzyme precursors, that are Gag, Env and Pol, HIV-1 encodes several regulatory proteins, notably a small nuclear transcriptional activator named Tat. The Tat protein is absolutely required for virus replication since it controls proviral DNA transcription to generate the full-length viral mRNA. Tat can also regulate mRNA capping and splicing and was recently found to interfere with the cellular mi- and siRNA machinery. Because of its extensive interplay with nucleic acids, and its basic and disordered nature we speculated that Tat had nucleic acid-chaperoning properties. This prompted us to examine in vitro the nucleic acid-chaperoning activities of Tat and Tat peptides made by chemical synthesis. Here we report that Tat has potent nucleic acid-chaperoning activities according to the standard DNA annealing, DNA and RNA strand exchange, RNA ribozyme cleavage and trans-splicing assays. The active Tat(44-61) peptide identified here corresponds to the smallest known sequence with DNA/RNA chaperoning properties.
-
The HIV-1 transcriptional activator Tat has potent nucleic acid chaperoning activities in vitro
Kuciak, Monika; Gabus, Caroline; Ivanyi-Nagy, Roland; Semrad, Katharina; Storchak, Roman; Chaloin, Olivier; Muller, Sylviane; Mély, Yves; Darlix, Jean-Luc
2008-01-01
The human immunodeficiency virus type 1 (HIV-1) is a primate lentivirus that causes the acquired immunodeficiency syndrome (AIDS). In addition to the virion structural proteins and enzyme precursors, that are Gag, Env and Pol, HIV-1 encodes several regulatory proteins, notably a small nuclear transcriptional activator named Tat. The Tat protein is absolutely required for virus replication since it controls proviral DNA transcription to generate the full-length viral mRNA. Tat can also regulate mRNA capping and splicing and was recently found to interfere with the cellular mi- and siRNA machinery. Because of its extensive interplay with nucleic acids, and its basic and disordered nature we speculated that Tat had nucleic acid-chaperoning properties. This prompted us to examine in vitro the nucleic acid-chaperoning activities of Tat and Tat peptides made by chemical synthesis. Here we report that Tat has potent nucleic acid-chaperoning activities according to the standard DNA annealing, DNA and RNA strand exchange, RNA ribozyme cleavage and trans-splicing assays. The active Tat(44–61) peptide identified here corresponds to the smallest known sequence with DNA/RNA chaperoning properties. PMID:18442994
-
Yu, Dongliang; Meng, Yijun; Zuo, Ziwei; Xue, Jie; Wang, Huizhong
2016-01-01
Nat-siRNAs (small interfering RNAs originated from natural antisense transcripts) are a class of functional small RNA (sRNA) species discovered in both plants and animals. These siRNAs are highly enriched within the annealed regions of the NAT (natural antisense transcript) pairs. To date, great research efforts have been taken for systematical identification of the NATs in various organisms. However, developing a freely available and easy-to-use program for NAT prediction is strongly demanded by researchers. Here, we proposed an integrative pipeline named NATpipe for systematical discovery of NATs from de novo assembled transcriptomes. By utilizing sRNA sequencing data, the pipeline also allowed users to search for phase-distributed nat-siRNAs within the perfectly annealed regions of the NAT pairs. Additionally, more reliable nat-siRNA loci could be identified based on degradome sequencing data. A case study on the non-model plant Dendrobium officinale was performed to illustrate the utility of NATpipe. Finally, we hope that NATpipe would be a useful tool for NAT prediction, nat-siRNA discovery, and related functional studies. NATpipe is available at www.bioinfolab.cn/NATpipe/NATpipe.zip. PMID:26858106
-
Ancient origin and recent innovations of RNA polymerase IV and V
Huang, Yi; Kendall, Timmy; Forsythe, Evan S.; ...
2015-03-12
Small RNA-mediated chromatin modification is a conserved feature of eukaryotes. In flowering plants, the short interfering (si)RNAs that direct transcriptional silencing are abundant and subfunctionalization has led to specialized machinery responsible for synthesis and action of these small RNAs. In particular, plants possess polymerase (Pol) IV and Pol V, multi-subunit homologs of the canonical DNA-dependent RNA Pol II, as well as specialized members of the RNA-dependent RNA Polymerase (RDR), Dicer-like (DCL), and Argonaute (AGO) families. Together these enzymes are required for production and activity of Pol IV-dependent (p4-)siRNAs, which trigger RNA-directed DNA methylation (RdDM) at homologous sequences. p4-siRNAs accumulate highlymore » in developing endosperm, a specialized tissue found only in flowering plants, and are rare in nonflowering plants, suggesting that the evolution of flowers might coincide with the emergence of specialized RdDM machinery. Through comprehensive identification of RdDM genes from species representing the breadth of the land plant phylogeny, we describe the ancient origin of Pol IV and Pol V, suggesting that a nearly complete and functional RdDM pathway could have existed in the earliest land plants. We also uncover innovations in these enzymes that are coincident with the emergence of seed plants and flowering plants, and recent duplications that might indicate additional subfunctionalization. Phylogenetic analysis reveals rapid evolution of Pol IV and Pol V subunits relative to their Pol II counterparts and suggests that duplicates were retained and subfunctionalized through Escape from Adaptive Conflict. Finally, evolution within the carboxy-terminal domain of the Pol V largest subunit is particularly striking, where illegitimate recombination facilitated extreme sequence divergence.« less
-
Ancient origin and recent innovations of RNA polymerase IV and V
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huang, Yi; Kendall, Timmy; Forsythe, Evan S.
Small RNA-mediated chromatin modification is a conserved feature of eukaryotes. In flowering plants, the short interfering (si)RNAs that direct transcriptional silencing are abundant and subfunctionalization has led to specialized machinery responsible for synthesis and action of these small RNAs. In particular, plants possess polymerase (Pol) IV and Pol V, multi-subunit homologs of the canonical DNA-dependent RNA Pol II, as well as specialized members of the RNA-dependent RNA Polymerase (RDR), Dicer-like (DCL), and Argonaute (AGO) families. Together these enzymes are required for production and activity of Pol IV-dependent (p4-)siRNAs, which trigger RNA-directed DNA methylation (RdDM) at homologous sequences. p4-siRNAs accumulate highlymore » in developing endosperm, a specialized tissue found only in flowering plants, and are rare in nonflowering plants, suggesting that the evolution of flowers might coincide with the emergence of specialized RdDM machinery. Through comprehensive identification of RdDM genes from species representing the breadth of the land plant phylogeny, we describe the ancient origin of Pol IV and Pol V, suggesting that a nearly complete and functional RdDM pathway could have existed in the earliest land plants. We also uncover innovations in these enzymes that are coincident with the emergence of seed plants and flowering plants, and recent duplications that might indicate additional subfunctionalization. Phylogenetic analysis reveals rapid evolution of Pol IV and Pol V subunits relative to their Pol II counterparts and suggests that duplicates were retained and subfunctionalized through Escape from Adaptive Conflict. Finally, evolution within the carboxy-terminal domain of the Pol V largest subunit is particularly striking, where illegitimate recombination facilitated extreme sequence divergence.« less
-
Reiter, B C; Kamanga-Sollo, E; Pampusch, M S; White, M E; Dayton, W R
2014-07-01
The objective of this study was to assess the role of the epidermal growth factor receptor (EGFR) in estradiol-17β (E2)-stimulated proliferation of cultured bovine satellite cells (BSCs). Treatment of BSC cultures with AG1478 (a specific inhibitor of EGFR tyrosine kinase activity) suppresses E2-stimulated BSC proliferation (P < 0.05). In addition, E2-stimulated proliferation is completely suppressed (P < 0.05) in BSCs in which EGFR expression is silenced by treatment with EGFR small interfering RNA (siRNA). These results indicate that EGFR is required for E2 to stimulate proliferation in BSC cultures. Both AG1478 treatment and EGFR silencing also suppress proliferation stimulated by LR3-IGF-1 (an IGF1 analogue that binds normally to the insulin-like growth factor receptor (IGFR)-1 but has little or no affinity for IGF binding proteins) in cultured BSCs (P < 0.05). Even though EGFR siRNA treatment has no effect on IGFR-1β mRNA expression in cultured BSCs, IGFR-1β protein level is substantially reduced in BSCs treated with EGFR siRNA. These data suggest that EGFR silencing results in post-transcriptional modifications that result in decreased IGFR-1β protein levels. Although it is clear that functional EGFR is necessary for E2-stimulated proliferation of BSCs, the role of EGFR is not clear. Transactivation of EGFR may directly stimulate proliferation, or EGFR may function to maintain the level of IGFR-1β which is necessary for E2-stimulated proliferation. It also is possible that the role of EGFR in E2-stimulated BSC proliferation may involve both of these mechanisms. Copyright © 2014 Elsevier Inc. All rights reserved.
-
Moazeni, Maryam; Khoramizadeh, Mohammad Reza; Kordbacheh, Parivash; Sepehrizadeh, Zargham; Zeraati, Hojat; Noorbakhsh, Fatemeh; Teimoori-Toolabi, Ladan; Rezaie, Sassan
2012-09-01
The introduction of RNA silencing machinery in fungi has led to the promising application of RNAi methodology to knock down essential vital factor or virulence factor genes in the microorganisms. Efg1p is required for development of a true hyphal growth form which is known to be essential for interactions with human host cells and for the yeast's pathogenesis. In this paper, we describe the development of a system for presenting and studying the RNAi function on the EFG1 gene in C. albicans. The 19-nucleotide siRNA was designed on the basis of the cDNA sequence of the EFG1 gene in C. albicans and transfection was performed by use of a modified-PEG/LiAc method. To investigate EFG1 gene silencing in siRNA-treated cells, the yeasts were grown in human serum; to induce germ tubes a solid medium was used with the serum. Quantitative changes in expression of the EFG1 gene were analyzed by measuring the cognate EFG1 mRNA level by use of a quantitative real-time RT-PCR assay. Compared with the positive control, true hyphae formation was significantly reduced by siRNA at concentrations of 1 μM, 500 nM, and 100 nM (P < 0.05). In addition, siRNA at a concentration of 1 μM was revealed to inhibit expression of the EFG1 gene effectively (P < 0.05). On the basis of the potential of post-transcriptional gene silencing to control the expression of specific genes, these techniques may be regarded as promising means of drug discovery, with applications in biomedicine and functional genomics analysis.
-
Investigation of JAKs/STAT‐3 in lipopolysaccharide‐induced intestinal epithelial cells
Fu, L.; Wei, L.‐W.; Zhao, M.‐D.; Zhu, J.‐L.; Chen, S.‐Y.; Jia, X.‐B.
2016-01-01
Summary Janus‐activated kinase (JAKs)‐signal transducer and activator of transcription 3 (STAT‐3) signalling play critical roles in immunoregulation and immunopathology, which involve inflammatory responses and enteritis. JAK phosphorylates STAT‐3 in response to stimulation by cytokines or growth factors, and then activates or represses the gene expression. STAT‐3 is activated persistently in cancer cells and contributes to the malignant progression of various types of cancer and inflammation. To elucidate the different roles of JAKs in the activation of STAT‐3, the lipopolysaccharide‐induced primary intestinal epithelial cell (IEC) acute inflammatory model was established. Small interference RNAs (siRNAs) were then employed to attenuate the expression levels of JAKs. Real‐time quantitative reverse transcription–polymerase chain reaction (PCR) (qRT–PCR) revealed that JAK mRNA levels were reduced efficiently by JAK‐specific siRNAs. Under the IEC inflammatory model transfected with si‐JAK, which equates to effective silencing, qRT–PCR and Western blot assays, suggested that knockdowns of JAK attenuated the JAK‐induced down‐regulation of STAT‐3 at the mRNA or protein levels. In particular, JAK1 played a key role, which was consistent with the RNA‐Seq results. Subsequently, the expression levels of proinflammatory cytokines interleukin (IL)‐1β and tumour necrosis factor (TNF)‐α were down‐regulated in the IEC inflammatory model transfected with si‐JAK1. JAK1 appears as a direct activator for STAT‐3, whereas treatments targeting JAK1 repressed STAT‐3 sufficiently pathways in the IEC inflammatory model. Therefore, the control of JAK1 using siRNAs has the potential to be an effective strategy against enteritis. PMID:27357529
-
Kneidinger, Doris; Ibrišimović, Mirza; Lion, Thomas; Klein, Reinhard
2012-06-01
Human adenoviruses are a common threat to immunocompromised patients, e.g., HIV-positive individuals or solid-organ and, in particular, allogeneic stem cell transplant recipients. Antiviral drugs have a limited effect on adenoviruses, and existing treatment modalities often fail to prevent fatal outcome. Silencing of viral genes by short interfering RNAs (siRNAs) holds a great promise in the treatment of viral infections. The aim of the present study was to identify adenoviral candidate targets for RNA interference-mediated inhibition of adenoviral replication. We investigated the impact of silencing of a set of early, middle, and late viral genes on the replication of adenovirus 5 in vitro. Adenovirus replication was inhibited by siRNAs directed against the adenoviral E1A, DNA polymerase, preterminal protein (pTP), IVa2, hexon, and protease genes. Silencing of early and middle genes was more effective in inhibiting adenovirus multiplication than was silencing of late genes. A siRNA directed against the viral DNA polymerase mRNA decreased viral genome copy numbers and infectious virus progeny by several orders of magnitude. Since silencing of any of the early genes directly or indirectly affected viral DNA synthesis, our data suggest that reducing viral genome copy numbers is a more promising strategy for the treatment of adenoviral infections than is reducing the numbers of proteins necessary for capsid generation. Thus, adenoviral DNA replication was identified as a key target for RNAi-mediated inhibition of adenovirus multiplication. In addition, the E1A transcripts emerged as a second important target, because its knockdown markedly improved the viability of cells at late stages of infection. Copyright © 2012 Elsevier B.V. All rights reserved.
-
Shyu, Kou-Gi; Cheng, Wen-Pin; Wang, Bao-Wei; Chang, Hang
2014-03-01
The expression of MURC (muscle-restricted coiled-coil protein), a hypertrophy-regulated gene, increases during pressure overload. Hypoxia can cause myocardial hypertrophy; however, how hypoxia affects the regulation of MURC in cardiomyocytes undergoing hypertrophy is still unknown. The aim of the present study was to test the hypothesis that hypoxia induces MURC expression in cardiomyocytes during hypertrophy. The expression of MURC was evaluated in cultured rat neonatal cardiomyocytes subjected to hypoxia and in an in vivo model of AMI (acute myocardial infarction) to induce myocardial hypoxia in adult rats. MURC protein and mRNA expression were significantly enhanced by hypoxia. MURC proteins induced by hypoxia were significantly blocked after the addition of PD98059 or ERK (extracellular-signal-regulated kinase) siRNA 30 min before hypoxia. Gel-shift assay showed increased DNA-binding activity of SRF (serum response factor) after hypoxia. PD98059, ERK siRNA and an anti-TGF-β (transforming growth factor-β) antibody abolished the SRF-binding activity enhanced by hypoxia or exogenous administration of TGF-β. A luciferase promoter assay demonstrated increased transcriptional activity of SRF in cardiomyocytes by hypoxia. Increased βMHC (β-myosin heavy chain) and BNP (B-type natriuretic peptide) protein expression and increased protein synthesis was identified after hypoxia with the presence of MURC in hypertrophic cardiomyocytes. MURC siRNA inhibited the hypertrophic marker protein expression and protein synthesis induced by hypoxia. AMI in adult rats also demonstrated increased MURC protein expression in the left ventricular myocardium. In conclusion, hypoxia in cultured rat neonatal cardiomyocytes increased MURC expression via the induction of TGF-β, SRF and the ERK pathway. These findings suggest that MURC plays a role in hypoxia-induced hypertrophy in cardiomyocytes.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kang, Hyereen; Ko, Jesang; Jang, Sung-Wuk, E-mail: swjang@amc.seoul.kr
2012-06-22
Highlights: Black-Right-Pointing-Pointer We evaluated the effect of ANXA1 on promoting migration and invasion in MDA-MB-231 cells. Black-Right-Pointing-Pointer ANXA1 siRNA inhibits invasion and migration. Black-Right-Pointing-Pointer ANXA1 regulates MMP-9 expression and activity. Black-Right-Pointing-Pointer ANX-1 siRNA inhibits the activation of NF-{kappa}B in MDA-MB-231 cells. -- Abstract: Matrix metalloproteinase-9 (MMP-9) plays an important role in the invasion and metastasis of cancer cells. However, the regulatory mechanism of MMP-9 expression and its biological effects on breast cancer development remain obscure. In the current study, we examined the potential role of annexin A1 (ANXA1) in regulating migration and invasion in breast cancer cell lines. Both ANXA1more » mRNA and protein are expressed in the highly invasive, hormone-insensitive human breast cancer cell lines MDA-MB-231 and SKBr3, but not in the hormone-responsive cell lines MCF-7 and T47D. Downregulation of ANXA1 expression with specific small interfering RNAs (ANXA1 siRNA) in MDA-MB-231 cells resulted in decreased cancer cell migration and invasion. Ablation of ANXA1 expression decreases the expression of MMP-9 at both the mRNA and protein levels and also reduces the proteolytic activity of MMP-9 in MDA-MB-231 cells. Moreover, silencing ANXA1 also decreases the transcriptional activity of MMP-9 by the suppression of nuclear factor kappa-B (NF-{kappa}B) activity. Collectively, these results indicate that ANXA1 functions as a positive regulator of MMP-9 expression and invasion of breast cancer cells through specific activation of the NF-{kappa}B signaling pathway.« less
-
XRN2 is required for the degradation of target RNAs by RNase H1-dependent antisense oligonucleotides
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hori, Shin-Ichiro; Yamamoto, Tsuyoshi; Obika, Satoshi, E-mail: obika@phs.osaka-u.ac.jp
Antisense oligonucleotides (ASOs) can suppress the expression of a target gene by cleaving pre-mRNA and/or mature mRNA via RNase H1. Following the initial endonucleolytic cleavage by RNase H1, the target RNAs are degraded by a mechanism that is poorly understood. To better understand this degradation pathway, we depleted the expression of two major 5′ to 3′ exoribonucleases (XRNs), named XRN1 and XRN2, and analyzed the levels of 3′ fragments of the target RNAs in vitro. We found that the 3′ fragments of target pre-mRNA generated by ASO were almost completely degraded from their 5′ ends by nuclear XRN2 after RNase H1-mediatedmore » cleavage, whereas the 3′ fragments of mature mRNA were partially degraded by XRN2. In contrast to ASO, small interference RNA (siRNA) could reduce the expression level of only mature mRNA, and the 3′ fragment was degraded by cytoplasmic XRN1. Our findings indicate that the RNAs targeted by RNase H1-dependent ASO are rapidly degraded in the nucleus, contrary to the cytoplasmic degradation pathway mediated by siRNA. - Highlights: • We compared the degradation mechanism of the transcript targeted by ASO and siRNA. • We focused on two 5′ to 3′ exoribonucleases, cytoplasmic XRN1, and nuclear XRN2. • The 3′ fragment of target pre-mRNA generated by ASO was degraded by XRN2. • The 3′ fragment of target mRNA generated by ASO was partially degraded by XRN2. • XRN1 depletion promoted accumulation of the 3′ fragment of mRNA generated by siRNA.« less
-
Doss, C George Priya; Debottam, S; Debajyoti, C
2013-06-01
Gene therapy through antisense technology via intracellular delivery of a gene-silencing element is a promising approach to treat critical diseases like cancers. Ras acts as molecular switch, considered as one of the proto-oncogenes whose modification or mutation may promote tumor formation. The recent trends of nano-carrier-based drug delivery have gained superiority and proved to be 100 times more potent in drug delivery compared to standard therapies. The nano-based drug delivery has provided the basis of achieving successful target-specific drug delivery. Glutathione (GSH) is considered as one of the best and ubiquitous internal stimulus for swift destabilization of nano-transporters inside cells to accomplish proficient intracellular drug release. This concept has given a new hope to oncologists of modifying the existing drugs to be delivered to their desired destination. RNA interference is a primary tool in functional genomics to selectively silence messenger RNA (mRNA) expression, which can be exploited quickly to develop novel drugs against lethal disease target. Silencing of mRNA molecules using siRNA has also come of age to become one of the latest weapons developed in the concept of gene therapy. However, this strategy has severely failed to achieve target specificity especially to a tumor cell. In this context, we have proposed the incorporation of an antisense siRNA packed inside a GSH-responsive nano-transporter to be delivered specifically to a tumor cell against the sense mRNA of the Ras protein. It will limit the Ras-mediated activation of other proteins and transcription factors. Thus, it will knock down several differential gene expressions being regulated by Ras-activated pathways like enzyme-linked receptor kinase pathway. Henceforth, gene silencing technology through nano-drug delivery can be combined as a single weapon to terminate malignancy.
-
Human islet cells are killed by BID-independent mechanisms in response to FAS ligand.
Joglekar, Mugdha V; Trivedi, Prerak M; Kay, Thomas W; Hawthorne, Wayne J; O'Connell, Philip J; Jenkins, Alicia J; Hardikar, Anandwardhan A; Thomas, Helen E
2016-04-01
Cell death via FAS/CD95 can occur either by activation of caspases alone (extrinsic) or by activation of mitochondrial death signalling (intrinsic) depending on the cell type. The BH3-only protein BID is activated in the BCL-2-regulated or mitochondrial apoptosis pathway and acts as a switch between the extrinsic and intrinsic cell death pathways. We have previously demonstrated that islets from BID-deficient mice are protected from FAS ligand-mediated apoptosis in vitro. However, it is not yet known if BID plays a similar role in human beta cell death. We therefore aimed to test the role of BID in human islet cell apoptosis immediately after isolation from human cadaver donors, as well as after de-differentiation in vitro. Freshly isolated human islets or 10-12 day cultured human islet cells exhibited BID transcript knockdown after BID siRNA transfection, however they were not protected from FAS ligand-mediated cell death in vitro as determined by DNA fragmentation analysis using flow cytometry. On the other hand, the same cells transfected with siRNA for FAS-associated via death domain (FADD), a molecule in the extrinsic cell death pathway upstream of BID, showed significant reduction in cell death. De-differentiated islets (human islet-derived progenitor cells) also demonstrated similar results with no difference in cell death after BID knockdown as compared to scramble siRNA transfections. Our results indicate that BID-independent pathways are responsible for FAS-dependent human islet cell death. These results are different from those observed in mouse islets and therefore demonstrate potentially alternate pathways of FAS ligand-induced cell death in human and mouse islet cells.
-
Tai, Lydia Wai; Pan, Zhiqiang; Sun, Liting; Li, Haobo; Gu, Pan; Wong, Stanley Sau Ching; Chung, Sookja K; Cheung, Chi Wai
2018-05-27
Endothelin-1 (ET-1) and its receptors (ETAR/ETBR) emerge to be a key signaling axis in neuropathic pain processing and are recognized as new therapeutic targets. Yet, little is known on the functional regulation of ET-1 axis during neuropathic pain. Bioinformatics analysis indicated that paired box gene 2 (Pax2) or nuclear factor of activated T-cells 5 (NFAT5), two transcription factors involved in the modulation of neurotransmission, may regulate ET-1. Therefore, we hypothesized that ET-1 axis may be regulated by Pax2 or NFAT5 in the development of neuropathic pain. After partial sciatic nerve ligation (pSNL), rats displayed allodynia and hyperalgesia, which was associated with increased mRNA and protein expressions of spinal Pax2, NFAT5, and mRNA levels of ET-1 and ETAR, but not ETBR. Knockdown of Pax2 or NFAT5 with siRNA, or inhibition of ETAR with BQ-123 attenuated pSNL-induced pain-like behaviors. At molecular level, Pax2 siRNA, but not NFAT5 siRNA, downregulated ET-1 and ETAR, while ETAR inhibitor reduced NFAT5, indicating Pax2 in the upstream of ET-1 axis with NFAT5 in the downstream. Further, suppression of Pax2 (inhibiting ET-1) or impairment of ET-1 signaling (inhibition of ETAR and/or decrease of NFAT5) deactivated mitogen-activated protein kinases (MAPK) and nuclear factor-kappa B (NF-κB) signaling pathways, supporting the significance of functional regulation of ET-1 axis in neuropathic pain signaling. These findings demonstrate that Pax2 targeting ET-1-ETAR-NFAT5 is a novel regulatory mechanism underlying neuropathic pain. Copyright © 2018 IBRO. Published by Elsevier Ltd. All rights reserved.
-
Huschka, Ryan; Barhoumi, Aoune; Liu, Qing; Roth, Jack A.; Ji, Lin; Halas, Naomi J.
2013-01-01
The approach of RNA interference (RNAi)- using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein- is very useful in dissecting genetic function and holds significant promise as a molecular therapeutic. A major obstacle in achieving gene silencing with RNAi technology is the systemic delivery of therapeutic oligonucleotides. Here we demonstrate an engineered gold nanoshell (NS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on demand upon illumination with a near-infrared (NIR) laser. A poly(L)lysine peptide (PLL) epilayer covalently attached to the NS surface (NS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotides, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. Controlled release of the captured therapeutic oligonucleotides in each case is accomplished by continuous wave NIR laser irradiation at 800 nm, near the resonance wavelength of the nanoshell. Fluorescently tagged oligonucleotides were used to monitor the time-dependent release process and light-triggered endosomal release. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and gene silencing mediated by the NS-PLL carrying GFP gene-specific single-stranded DNA antisense oligonucleotide (AON-GFP), or a double-stranded siRNA (siRNA-GFP), in vitro. Light-triggered delivery resulted in ∼ 47% and ∼49% downregulation of the targeted GFP expression by AON-GFP and siRNA-GFP, respectively. Cytotoxicity induced by both the NS-PLL delivery vector and by laser irradiation is minimal, as demonstrated by a XTT cell proliferation assay. PMID:22862291
-
Wang, Lei; Griffel, Benjamin; Xu, Xiaoyang
2017-01-01
The effective delivery of small interfering RNA (siRNA) to tumor cells remains a challenge for applications in cancer therapy. The development of polymeric nanoparticles with high siRNA loading efficacy has shown great potential for cancer targets. Double emulsion solvent evaporation technique is a useful tool for encapsulation of hydrophilic molecules (e.g., siRNA). Here we describe a versatile platform for siRNA delivery based on PLGA-PEG-cationic lipid nanoparticles by using the double emulsion method. The resulting nanoparticles show high encapsulation efficiency for siRNA (up to 90%) and demonstrate effective downregulation of the target genes in vitro and vivo.
-
Hydroxychloroquine-conjugated gold nanoparticles for improved siRNA activity.
Perche, F; Yi, Y; Hespel, L; Mi, P; Dirisala, A; Cabral, H; Miyata, K; Kataoka, K
2016-06-01
Current technology of siRNA delivery relies on pharmaceutical dosage forms to route maximal doses of siRNA to the tumor. However, this rationale does not address intracellular bottlenecks governing silencing activity. Here, we tested the impact of hydroxychloroquine conjugation on the intracellular fate and silencing activity of siRNA conjugated PEGylated gold nanoparticles. Addition of hydroxychloroquine improved endosomal escape and increased siRNA guide strand distribution to the RNA induced silencing complex (RISC), both crucial obstacles to the potency of siRNA. This modification significantly improved gene downregulation in cellulo. Altogether, our data suggest the benefit of this modification for the design of improved siRNA delivery systems. Copyright © 2016 Elsevier Ltd. All rights reserved.
-
SiRNA Crosslinked Nanoparticles for the Treatment of Inflammation-induced Liver Injury.
Tang, Yaqin; Zeng, Ziying; He, Xiao; Wang, Tingting; Ning, Xinghai; Feng, Xuli
2017-02-01
RNA interference mediated by small interfering RNA (siRNA) provides a powerful tool for gene regulation, and has a broad potential as a promising therapeutic strategy. However, therapeutics based on siRNA have had limited clinical success due to their undesirable pharmacokinetic properties. This study presents pH-sensitive nanoparticles-based siRNA delivery systems (PNSDS), which are positive-charge-free nanocarriers, composed of siRNA chemically crosslinked with multi-armed poly(ethylene glycol) carriers via acid-labile acetal linkers. The unique siRNA crosslinked structure of PNSDS allows it to have minimal cytotoxicity, high siRNA loading efficiency, and a stimulus-responsive property that enables the selective intracellular release of siRNA in response to pH conditions. This study demonstrates that PNSDS can deliver tumor necrosis factor alpha (TNF-α) siRNA into macrophages and induce the efficient down regulation of the targeted gene in complete cell culture media. Moreover, PNSDS with mannose targeting moieties can selectively accumulate in mice liver, induce specific inhibition of macrophage TNF-α expression in vivo, and consequently protect mice from inflammation-induced liver damages. Therefore, this novel siRNA delivering platform would greatly improve the therapeutic potential of RNAi based therapies.
-
Induction and suppression of antiviral RNA interference by influenza A virus in mammalian cells.
Li, Yang; Basavappa, Megha; Lu, Jinfeng; Dong, Shuwei; Cronkite, D Alexander; Prior, John T; Reinecker, Hans-Christian; Hertzog, Paul; Han, Yanhong; Li, Wan-Xiang; Cheloufi, Sihem; Karginov, Fedor V; Ding, Shou-Wei; Jeffrey, Kate L
2016-12-05
Influenza A virus (IAV) causes annual epidemics and occasional pandemics, and is one of the best-characterized human RNA viral pathogens 1 . However, a physiologically relevant role for the RNA interference (RNAi) suppressor activity of the IAV non-structural protein 1 (NS1), reported over a decade ago 2 , remains unknown 3 . Plant and insect viruses have evolved diverse virulence proteins to suppress RNAi as their hosts produce virus-derived small interfering RNAs (siRNAs) that direct specific antiviral defence 4-7 by an RNAi mechanism dependent on the slicing activity of Argonaute proteins (AGOs) 8,9 . Recent studies have documented induction and suppression of antiviral RNAi in mouse embryonic stem cells and suckling mice 10,11 . However, it is still under debate whether infection by IAV or any other RNA virus that infects humans induces and/or suppresses antiviral RNAi in mature mammalian somatic cells 12-21 . Here, we demonstrate that mature human somatic cells produce abundant virus-derived siRNAs co-immunoprecipitated with AGOs in response to IAV infection. We show that the biogenesis of viral siRNAs from IAV double-stranded RNA (dsRNA) precursors in infected cells is mediated by wild-type human Dicer and potently suppressed by both NS1 of IAV as well as virion protein 35 (VP35) of Ebola and Marburg filoviruses. We further demonstrate that the slicing catalytic activity of AGO2 inhibits IAV and other RNA viruses in mature mammalian cells, in an interferon-independent fashion. Altogether, our work shows that IAV infection induces and suppresses antiviral RNAi in differentiated mammalian somatic cells.
-
Targeting the Blind Spot of Polycationic Nanocarrier-Based siRNA Delivery
Zheng, Mengyao; Pavan, Giovanni M.; Neeb, Manuel; Schaper, Andreas K.; Danani, Andrea; Klebe, Gerhard; Merkel, Olivia M.; Kissel, Thomas
2013-01-01
Polycationic nanocarriers attract increasing attention to the field of siRNA delivery. We investigated the self-assembly of siRNA vs pDNA with polycations, which are broadly used for nonviral gene and siRNA delivery. Although polyethyleneimine (PEI) was routinely adopted as siRNA carrier based on its efficacy in delivering pDNA, it has not been investigated yet why PEI efficiently delivers pDNA to cells but is controversially discussed in terms of efficacy for siRNA delivery. We are the first to investigate the self-assembly of PEI/siRNA vs PEI/pDNA and the steps of complexation and aggregation through different levels of hierarchy on the atomic and molecular scale with the novel synergistic use of molecular modeling, molecular dynamics simulation, isothermal titration calorimetry, and other characterization techniques. We are also the fist to elucidate atomic interactions, size, shape, stoichiometry, and association dynamics for polyplexes containing siRNA vs pDNA. Our investigation highlights differences in the hierarchical mechanism of formation of related polycation–siRNA and polycation–pDNA complexes. The results of fluorescence quenching assays indicated a biphasic behavior of siRNA binding with polycations where molecular reorganization of the siRNA within the polycations occurred at lower N/P ratios (nitrogen/phosphorus). Our results, for the first time, emphasize a biphasic behavior in siRNA complexation and the importance of low N/P ratios, which allow for excellent siRNA delivery efficiency. Our investigation highlights the formulation of siRNA complexes from a thermodynamic point of view and opens new perspectives to advance the rational design of new siRNA delivery systems. PMID:23036046
-
Fukunaga, Ryuya; Zamore, Phillip D
2014-01-01
The enzyme Dicer is central to the production of small silencing RNAs such as microRNAs (miRNAs) and small interfering RNAs (siRNAs). Like other insects, Drosophila melanogaster uses different Dicers to make siRNAs and miRNAs: Dicer-1 produces miRNAs from pre-miRNAs, whereas Dicer-2 generates siRNAs from long double-stranded RNA (dsRNA). How do the 2 Dicers achieve their substrate specificity? Here, we review recent findings that inorganic phosphate restricts the substrate specificity of Dicer-2 to long dsRNA. Inorganic phosphate inhibits Dicer-2 from binding and cleaving pre-miRNAs, without affecting the processing of long dsRNA. Crystal structures of a fragment of human Dicer in complex with an RNA duplex identify a phosphate-binding pocket that recognizes both the 5′-monophosphate of a substrate RNA and inorganic phosphate. We propose that inorganic phosphate occupies the phosphate-binding pocket in the fly Dicer-2, blocking binding of pre-miRNA and restricting pre-miRNA processing to Dicer-1. Thus, a small molecule can alter the substrate specificity of a nucleic acid-processing enzyme. PMID:24787225
-
Wu, Sheng-Hua; Wang, Ming-Jie; Lü, Jing; Chen, Xiao-Qing
2017-01-01
Previous studies have reported that lipoxin A4 (LXA4) may exert a renoprotective effect on ischemia/reperfusion injury in various animal models. The underlying mechanism of LXA4-induced renoprotection during ischemia/reperfusion injury remains to be elucidated. The present study investigated LXA4-induced protection on renal tubular cells subjected to hypoxia/reoxygenation (H/R) injury, and determined the effects of peroxisome proliferator-activated receptor-γ (PPARγ) and heme oxygenase-1 (HO-1) on LXA4 treatment. HK-2 human tubular epithelial cells exposed to H/R injury were pretreated with LXA4, signal molecule inhibitors or the HO-1 inhibitor zinc protoporphyrin-IX, or were transfected with PPARγ small interfering RNA (siRNA) or nuclear factor E2-related factor 2 (Nrf2) siRNA. The protein and mRNA expression levels of PPARγ and HO-1 were analyzed using western blotting and reverse transcription-quantitative polymerase chain reaction. Binding activity of Nrf2 to the HO-1 E1 enhancer was determined using chromatin immunoprecipitation. Nrf2 binding to the HO-1 antioxidant responsive element (ARE) was assessed using electrophoretic mobility shift assay. Preincubation of cells with LXA4 exposed to H/R injury led to a decreased production of inducible nitrogen oxide synthase, malondialdehyde, γ-glutamyl transpeptidase, leucine aminopeptidase and N-acetyl-β-glucosaminidase. In addition, LXA4 pretreatment increased cell viability, protein and mRNA expression levels of PPARγ and HO-1 and PPARγ and HO-1 promoter activity. SB20358 is a p38 mitogen-activated protein kinase (p38 MAPK) pathway inhibitor, which reduced LXA4-induced PPARγ expression levels. LXA4 treatment upregulated p38 MAPK activation, Nrf2 nuclear translocation and increased binding activity of Nrf2 to HO-1 ARE and E1 enhancer in cells exposed to H/R injury. Transfection of the cells with PPARγ siRNA reduced the LXA4-induced Nrf2 translocation. Transfection of the cells with PPARγ siRNA or Nrf2 siRNA also reduced the LXA4-induced increase in HO-1 expression. In conclusion, LXA4-induced protection of renal tubular cells against H/R injury was associated with the induction of PPARγ and HO-1, via activation of the p38 MAPK pathway, as well as Nrf2 nuclear translocation and binding to HO-1 ARE and E1 enhancer. Therefore, LXA4-induced renoprotection is associated with activation of the p38 MAPK/PPARγ/Nrf2-ARE/HO-1 pathway. PMID:28259922
-
Greaves, Ian K; Eichten, Steven R; Groszmann, Michael; Wang, Aihua; Ying, Hua; Peacock, W James; Dennis, Elizabeth S
2016-11-01
Hybrid Arabidopsis plants undergo epigenetic reprogramming producing decreased levels of 24-nt siRNAs and altered patterns of DNA methylation that can affect gene expression. Driving the changes in methylation are the processes trans-chromosomal methylation (TCM) and trans-chromosomal demethylation (TCdM). In TCM/TCdM the methylation state of one allele is altered to resemble the other allele. We show that Pol IV-dependent sRNAs are required to establish TCM events. The changes in DNA methylation and the associated changes in sRNA levels in the F1 hybrid can be maintained in subsequent generations and affect hundreds of regions in the F2 epigenome. The inheritance of these altered epigenetic states varies in F2 individuals, resulting in individuals with genetically identical loci displaying different epigenetic states and gene expression profiles. The change in methylation at these regions is associated with the presence of sRNAs. Loci without any sRNA activity can have altered methylation states, suggesting that a sRNA-independent mechanism may also contribute to the altered methylation state of the F1 and F2 generations.
-
Wang, Xu-Li; Ramusovic, Sergej; Nguyen, Thanh; Lu, Zheng-Rong
2007-01-01
Small interfering RNA (siRNA) is a promising new therapeutic modality that can specifically silence disease-related genes. The main challenge for successful clinical development of therapeutic siRNA is the lack of efficient delivery systems. In this study, we have designed and synthesized a small library of novel multifunctional siRNA carriers, polymerizable surfactants with pH-sensitive amphiphilicity based on the hypothesis that pH-sensitive amphiphilicity and environmentally sensitive siRNA release can result in efficient siRNA delivery. The polymerizable surfactants comprise a protonatable amino head group, two cysteine residues, and two lipophilic tails. The surfactants demonstrated pH-sensitive amphiphilic hemolytic activity or cell membrane disruption with rat red blood cells. Most of the surfactants resulted in low hemolysis at pH 7.4 and high hemolysis at reduced pH (6.5 and 5.4). The pH-sensitive cell membrane disruption can facilitate endosomal-lysosomal escape of siRNA delivery systems at the endosomal-lysosomal pH. The surfactants formed compact nanoparticles (160-260 nm) with siRNA at N/P ratios of 8 and 10 via charge complexation with the amino head group, lipophilic condensation, and autoxidative polymerization of dithiols. The siRNA complexes with the surfactants demonstrated low cytotoxicity. The cellular siRNA delivery efficiency and RNAi activity of the surfactants correlated well with their pH-sensitive amphiphilic cell membrane disruption. The surfactants mediated 40-88% silencing of luciferase expression with 100 nM siRNA and 35-75% with 20 nM siRNA in U87-luc cells. Some of the surfactants resulted in similar or higher gene silencing efficiency than TransFast. EHCO with no hemolytic activity at pH 7.4 and 6.5 and high hemolytic activity at pH 5.4 resulted in the best siRNA delivery efficiency. The polymerizable surfactants with pH-sensitive amphiphilicity are promising for efficient siRNA delivery.
-
Dendrimer Nanovectors for SiRNA Delivery.
Liu, Xiaoxuan; Peng, Ling
2016-01-01
Small interfering RNA (SiRNA) delivery remains a major challenge in RNAi-based therapy. Dendrimers are emerging as appealing nonviral vectors for SiRNA delivery thanks to their well-defined architecture and their unique cooperativity and multivalency confined within a nanostructure. We have recently demonstrated that structurally flexible poly(amidoamine) (PAMAM) dendrimers are safe and effective nanovectors for SiRNA delivery in various disease models in vitro and in vivo. The present chapter showcases these dendrimers can package different SiRNA molecules into stable and nanosized particles, which protect SiRNA from degradation and promote cellular uptake of SiRNA, resulting in potent gene silencing at both mRNA and protein level in the prostate cancer cell model. Our results demonstrate this set of flexible PAMAM dendrimers are indeed safe and effective nonviral vectors for SiRNA delivery and hold great promise for further applications in functional genomics and RNAi-based therapies.
-
Mousnier, Aurélie; Kubat, Nicole; Massias-Simon, Aurélie; Ségéral, Emmanuel; Rain, Jean-Christophe; Benarous, Richard; Emiliani, Stéphane; Dargemont, Catherine
2007-01-01
HIV-1 integrase, the viral enzyme responsible for provirus integration into the host genome, can be actively degraded by the ubiquitin–proteasome pathway. Here, we identify von Hippel–Lindau binding protein 1(VBP1), a subunit of the prefoldin chaperone, as an integrase cellular binding protein that bridges interaction between integrase and the cullin2 (Cul2)-based von Hippel–Lindau (VHL) ubiquitin ligase. We demonstrate that VBP1 and Cul2/VHL are required for proper HIV-1 expression at a step between integrase-dependent proviral integration into the host genome and transcription of viral genes. Using both an siRNA approach and Cul2/VHL mutant cells, we show that VBP1 and the Cul2/VHL ligase cooperate in the efficient polyubiquitylation of integrase and its subsequent proteasome-mediated degradation. Results presented here support a role for integrase degradation by the prefoldin–VHL–proteasome pathway in the integration–transcription transition of the viral replication cycle. PMID:17698809
-
Irisin Inhibits Hepatic Cholesterol Synthesis via AMPK-SREBP2 Signaling
Tang, Hong; Yu, Ruili; Liu, Shiying; Huwatibieke, Bahetiyaer; Li, Ziru; Zhang, Weizhen
2016-01-01
Irisin, a myokine released during exercise, promotes browning of subcutaneous adipose tissue and regulates energy homeostasis. Although exercise constantly reduces blood cholesterol, whether irisin is involved in the regulation of cholesterol remains largely unknown. In the present study, subcutaneous infusion of irisin for 2 weeks induced a reduction in plasma and hepatic cholesterol in high fat diet-induced obese (DIO) mice. These alterations were associated with an activation of 5′ AMP-activated protein kinase (AMPK) and inhibition of sterol regulatory element-binding transcription factor 2 (SREBP2) transcription and nuclear translocation. In primary hepatocytes from either lean or DIO mice, irisin significantly decreased cholesterol content via sequential activation of AMPK and inhibition of SREBP2. Suppression of AMPK by compound C or AMPKα1 siRNA blocked irisin-induced alterations in cholesterol contents and SREBP2. In conclusion, irisin could suppress hepatic cholesterol production via a mechanism dependent of AMPK and SREBP2 signaling. These findings suggest that irisin is a promising therapeutic target for treatment of hypercholesterolemia. PMID:27211556
-
Upregulation of survivin by leptin/STAT3 signaling in MCF-7 cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jiang Haiping; Tianjin Medical University Cancer Hospital, Tianjin; Yu Jinming
2008-03-28
Leptin and its receptors are overexpressed in breast cancer tissues and correlate with poor prognosis. Survivin, a member of the inhibitor of apoptosis protein (IAP) gene family, is generally upregulated in tumor tissues and prevents tumor cells from apoptosis. Here we showed that leptin upregulated survivin mRNA and protein expression in MCF-7 breast cancer cells. Meanwhile, leptin suppressed docetaxel-induced apoptosis by inhibiting caspase activity. Knockdown of signal transducer and activator transcription 3 (STAT3) expression by small interfering RNA (siRNA) blocked leptin-induced upregulation of survivin. TransAM ELISA showed that leptin increased nuclear translocation of active STAT3. In addition, chromatin immunoprecipitation (ChIP)more » assay detected an enhanced binding of STAT3 to survivin promoter in MCF-7 cells after treatment by leptin. Further studies showed that leptin enhanced the transcriptional activity of survivin promoter. Collectively, our findings identify leptin/STAT3 signaling as a novel pathway for survivin expression in breast cancer cells.« less
-
Piskun, Caroline M; Stein, Timothy J
2016-06-01
Canine osteosarcoma (OS) is an aggressive malignancy associated with poor outcomes. Therapeutic improvements are likely to develop from an improved understanding of signalling pathways contributing to OS development and progression. The Wnt signalling pathway is of interest for its role in osteoblast differentiation, its dysregulation in numerous cancer types, and the relative frequency of cytoplasmic accumulation of β-catenin in canine OS. This study aimed to determine the biological impact of inhibiting canonical Wnt signalling in canine OS, by utilizing either β-catenin siRNA or a dominant-negative T-cell factor (TCF) construct. There were no consistent, significant changes in cell line behaviour with either method compared to parental cell lines. Interestingly, β-catenin transcriptional activity was three-fold higher in normal canine primary osteoblasts compared to canine OS cell lines. These results suggest canonical Wnt signalling is minimally active in canine OS and its targeted inhibition is not a relevant therapeutic strategy. © 2013 John Wiley & Sons Ltd.
-
Ito, Shunsuke; Osaka, Mizuko; Edamatsu, Takeo; Itoh, Yoshiharu; Yoshida, Masayuki
2016-08-01
The aryl hydrocarbon receptor (AhR), a ligand-inducible transcription factor mediating toxic effects of dioxins and uremic toxins, has recently emerged as a pathophysiological regulator of immune-inflammatory conditions. Indoxyl sulfate, a uremic toxin, is associated with cardiovascular disease in patients with chronic kidney disease and has been shown to be a ligand for AhR. The aim of this study was to investigate the potential role of AhR in indoxyl sulfate-induced leukocyte-endothelial interactions. Endothelial cell-specific AhR knockout (eAhR KO) mice were produced by crossing AhR floxed mice with Tie2 Cre mice. Indoxyl sulfate was administered for 2 weeks, followed by injection of TNF-α. Leukocyte recruitment to the femoral artery was assessed by intravital microscopy. Vascular endothelial cells were transfected with siRNA specific to AhR (siAhR) and treated with indoxyl sulfate, followed by stimulation with TNF-α. Indoxyl sulfate dramatically enhanced TNF-α-induced leukocyte recruitment to the vascular wall in control animals but not in eAhR KO mice. In endothelial cells, siAhR significantly reduced indoxyl sulfate-enhanced leukocyte adhesion as well as E-selectin expression, whereas the activation of JNK and nuclear factor-κB was not affected. A luciferase assay revealed that the region between －153 and －146 bps in the E-selectin promoter was responsible for indoxyl sulfate activity via AhR. Mutational analysis of this region revealed that activator protein-1 (AP-1) is responsible for indoxyl sulfate-triggered E-selectin expression via AhR. AhR mediates indoxyl sulfate-enhanced leukocyte-endothelial interactions through AP-1 transcriptional activity, which may constitute a new mechanism of vascular inflammation in patients with renal disease.
-
Targeting GH-1 splicing as a novel pharmacological strategy for growth hormone deficiency type II.
Miletta, Maria Consolata; Flück, Christa E; Mullis, Primus-E
2017-01-15
Isolated growth hormone deficiency type II (IGHD II) is a rare genetic splicing disorder characterized by reduced growth hormone (GH) secretion and short stature. It is mainly caused by autosomal dominant-negative mutations within the growth hormone gene (GH-1) which results in missplicing at the mRNA level and the subsequent loss of exon 3, producing the 17.5-kDa GH isoform: a mutant and inactive GH protein that reduces the stability and the secretion of the 22-kDa GH isoform, the main biologically active GH form. At present, patients suffering from IGHD II are treated with daily injections of recombinant human GH (rhGH) in order to reach normal height. However, this type of replacement therapy, although effective in terms of growth, does not prevent the toxic effects of the 17.5-kDa mutant on the pituitary gland, which may eventually lead to other hormonal deficiencies. As the severity of the disease inversely correlates with the 17.5-kDa/22-kDa ratio, increasing the inclusion of exon 3 is expected to ameliorate disease symptoms. This review focuses on the recent advances in experimental and therapeutic strategies applicable to treat IGHD II in clinical and preclinical contexts. Several avenues for alternative IGHD II therapy will be discussed including the use of small interfering RNA (siRNA) and short hairpin RNA (shRNA) constructs that specifically target the exon 3-deleted transcripts as well as the application of histone deacetylase inhibitors (HDACi) and antisense oligonucleotides (AONs) to enhance full-length GH-1 transcription, correct GH-1 exon 3 splicing and manipulate GH pathway. Copyright © 2016 Elsevier Inc. All rights reserved.
-
Genetic and mechanistic diversity of piRNA 3' end formation
Handler, Dominik; Mohn, Fabio; Ameres, Stefan L.; Brennecke, Julius
2016-01-01
Small regulatory RNAs guide Argonaute (Ago) proteins in a sequence-specific manner to their targets and thereby play important roles in eukaryotic gene silencing1. Of the three small RNA classes, microRNAs and siRNAs are processed from double-stranded precursors into defined 21- to 23-mers by Dicer, an endoribonuclease with intrinsic ruler function. piRNAs—the 22-30 nt long guides for PIWI-clade Ago proteins that silence transposons in animal gonads—are generated Dicer-independently from single-stranded precursors2,3. piRNA 5' ends are defined either by Zucchini, a mitochondria-anchored endonuclease4,5, or by piRNA-guided target cleavage6,7. Formation of piRNA 3' ends is poorly understood. Here, we find that two genetically and mechanistically distinct pathways generate piRNA 3' ends in Drosophila. The initiating nucleases are either Zucchini or the PIWI-clade proteins Aubergine (Aub)/Ago3. While Zucchini-mediated cleavages directly define mature piRNA 3' ends8,9, Aub/Ago3-mediated cleavages liberate pre-piRNAs that require extensive resection by the 3'-to-5' exoribonuclease Nibbler/Mut-710–13. The relative activity of these two pathways dictates the extent to which piRNAs are fueled into cytoplasmic or nuclear PIWI-clade proteins and thereby sets the balance between post-transcriptional and transcriptional silencing. Strikingly, loss of both Zucchini and Nibbler reveals a minimal, Argonaute-driven small RNA biogenesis pathway where piRNA 5' and 3' ends are directly produced by closely spaced Aub/Ago3-mediated cleavage events. Our data establish a coherent blueprint for piRNA biogenesis, and set the stage for the mechanistic dissection of the processes that govern piRNA 3' end formation. PMID:27851737
-
Jin, Xin; Sun, Tingting; Zhao, Chuanke; Zheng, Yongxiang; Zhang, Yufan; Cai, Weijing; He, Qiuchen; Taira, Kaz; Zhang, Lihe; Zhou, Demin
2012-01-01
Strategies to regulate gene function frequently use small interfering RNAs (siRNAs) that can be made from their shRNA precursors via Dicer. However, when the duplex components of these siRNA effectors are expressed from their respective coding genes, the RNA interference (RNAi) activity is much reduced. Here, we explored the mechanisms of action of shRNA and siRNA and found the expressed siRNA, in contrast to short hairpin RNA (shRNA), exhibits strong strand antagonism, with the sense RNA negatively and unexpectedly regulating RNAi. Therefore, we altered the relative levels of strands of siRNA duplexes during their expression, increasing the level of the antisense component, reducing the level of the sense component, or both and, in this way we were able to enhance the potency of the siRNA. Such vector-delivered siRNA attacked its target effectively. These findings provide new insight into RNAi and, in particular, they demonstrate that strand antagonism is responsible for making siRNA far less potent than shRNA. PMID:22039150
-
Wu, Sherry Y; Yang, Xianbin; Gharpure, Kshipra M; Hatakeyama, Hiroto; Egli, Martin; McGuire, Michael H; Nagaraja, Archana S; Miyake, Takahito M; Rupaimoole, Rajesha; Pecot, Chad V; Taylor, Morgan; Pradeep, Sunila; Sierant, Malgorzata; Rodriguez-Aguayo, Cristian; Choi, Hyun J; Previs, Rebecca A; Armaiz-Pena, Guillermo N; Huang, Li; Martinez, Carlos; Hassell, Tom; Ivan, Cristina; Sehgal, Vasudha; Singhania, Richa; Han, Hee-Dong; Su, Chang; Kim, Ji Hoon; Dalton, Heather J; Kovvali, Chandra; Keyomarsi, Khandan; McMillan, Nigel A J; Overwijk, Willem W; Liu, Jinsong; Lee, Ju-Seog; Baggerly, Keith A; Lopez-Berestein, Gabriel; Ram, Prahlad T; Nawrot, Barbara; Sood, Anil K
2014-03-12
Improving small interfering RNA (siRNA) efficacy in target cell populations remains a challenge to its clinical implementation. Here, we report a chemical modification, consisting of phosphorodithioate (PS2) and 2'-O-Methyl (2'-OMe) MePS2 on one nucleotide that significantly enhances potency and resistance to degradation for various siRNAs. We find enhanced potency stems from an unforeseen increase in siRNA loading to the RNA-induced silencing complex, likely due to the unique interaction mediated by 2'-OMe and PS2. We demonstrate the therapeutic utility of MePS2 siRNAs in chemoresistant ovarian cancer mouse models via targeting GRAM domain containing 1B (GRAMD1B), a protein involved in chemoresistance. GRAMD1B silencing is achieved in tumours following MePS2-modified siRNA treatment, leading to a synergistic anti-tumour effect in combination with paclitaxel. Given the previously limited success in enhancing siRNA potency with chemically modified siRNAs, our findings represent an important advance in siRNA design with the potential for application in numerous cancer types.
-
Zhou, Yinjian; Zhang, Chunling; Liang, Wei
2014-11-10
RNA interference (RNAi) was intensively studied in the past decades due to its potential in therapy of diseases. The target specificity and universal treatment spectrum endowed siRNA advantages over traditional small molecules and protein drugs. However, barriers exist in the blood circulation system and the diseased tissues blocked the actualization of RNAi effect, which raised function versatility requirements to siRNA therapeutic agents. Appropriate functionalization of siRNAs is necessary to break through these barriers and target diseased tissues in local or systemic targeted application. In this review, we summarized that barriers exist in the delivery process and popular functionalized technologies for siRNA such as chemical modification and physical encapsulation. Preclinical targeted siRNA delivery and the current status of siRNA based RNAi therapeutic agents in clinical trial were reviewed and finally the future of siRNA delivery was proposed. The valuable experience from the siRNA agent delivery study and the RNAi therapeutic agents in clinical trial paved ways for practical RNAi therapeutics to emerge early. Copyright © 2014 Elsevier B.V. All rights reserved.
-
Chhabra, Arvind; Chakraborty, Nityo G.; Mukherji, Bijay
2008-01-01
Dendritic cells (DC) present antigenic epitopes to and activate T cells. They also polarize the ensuing T cell response to Th1 or Th2 type response, depending on their cytokine production profile. For example, IL-12 producing DC generate Th1 type T cell response whereas IL-10 producing DC is usually tolerogenic. Different strategies -- such as the use of cytokines and anti-cytokine antibodies, dominant negative forms of protein, anti-sense RNA etc. -- have been employed to influence the cytokine synthetic profile of DC as well as to make DC more immunogenic. Utilizing GFP expressing recombinant adenoviruses in association with lipid-mediated transfection of siRNA, we have silenced the endogenous IL-10 gene in DC. We show that IL-10 gene silenced DC produce more IL-12 and also generates a better cytolytic T cell response against the human melanoma associated epitope, MART-127−35, in-vitro. We also show that the GFP expressing adenoviral vector can be used to optimize the parameters for siRNA delivery in primary cells and show that RNA interference methodology can efficiently knock-down virus encoded genes transcribed at very high multiplicity of infection in DC. PMID:18249038
-
Rheiner, Steven; Reichel, Derek; Rychahou, Piotr; Izumi, Tadahide; Yang, Hsin-Sheng; Bae, Younsoo
2017-08-07
Poly(ethylene glycol)-conjugated polyethylenimine (PEG-PEI) is a widely studied cationic polymer used to develop non-viral vectors for siRNA therapy of genetic disorders including cancer. Cell lines stably expressing luciferase reporter protein typically evaluate the transfection efficacy of siRNA/PEG-PEI complexes, however recent findings revealed that PEG-PEI can reduce luciferase expression independent of siRNA. This study elucidates a cause of the false positive effect in luciferase assays by using polymer nanoassemblies (PNAs) made from PEG, PEI, poly-(l-lysine) (PLL), palmitate (PAL), and deoxycholate (DOC): PEG-PEI (2P), PEG-PEI-PAL (3P), PEG-PLL (2P'), PEG-PLL-PAL (3P'), and PEG-PEI-DOC (2PD). In vitro transfection and western blot assays of luciferase using a colorectal cancer cell line expressing luciferase (HT29/LUC) concluded that 2P and 2P' caused no luciferase expression reduction while hydrophobically modified PNAs induced a 35-50% reduction (3P'<2PD<3P). Although cell viability remained stagnant, 3P triggered cellular stress responses including increased membrane porosity and decreased ATP and cellular protein concentrations. Raman spectroscopy suggested that hydrophobic groups influence PNA conformation changes, which may have caused over-ubiquitination and degradation of luciferase in the cells. These results indicate that hydrophobically modified PEG-PEI induces cellular distress causing over-ubiquitination of the luciferase protein, producing false positive siRNA transfection in the luciferase assay. Copyright © 2017 Elsevier B.V. All rights reserved.
-
HIVsirDB: a database of HIV inhibiting siRNAs.
Tyagi, Atul; Ahmed, Firoz; Thakur, Nishant; Sharma, Arun; Raghava, Gajendra P S; Kumar, Manoj
2011-01-01
Human immunodeficiency virus (HIV) is responsible for millions of deaths every year. The current treatment involves the use of multiple antiretroviral agents that may harm patients due to their toxic nature. RNA interference (RNAi) is a potent candidate for the future treatment of HIV, uses short interfering RNA (siRNA/shRNA) for silencing HIV genes. In this study, attempts have been made to create a database HIVsirDB of siRNAs responsible for silencing HIV genes. HIVsirDB is a manually curated database of HIV inhibiting siRNAs that provides comprehensive information about each siRNA or shRNA. Information was collected and compiled from literature and public resources. This database contains around 750 siRNAs that includes 75 partially complementary siRNAs differing by one or more bases with the target sites and over 100 escape mutant sequences. HIVsirDB structure contains sixteen fields including siRNA sequence, HIV strain, targeted genome region, efficacy and conservation of target sequences. In order to facilitate user, many tools have been integrated in this database that includes; i) siRNAmap for mapping siRNAs on target sequence, ii) HIVsirblast for BLAST search against database, iii) siRNAalign for aligning siRNAs. HIVsirDB is a freely accessible database of siRNAs which can silence or degrade HIV genes. It covers 26 types of HIV strains and 28 cell types. This database will be very useful for developing models for predicting efficacy of HIV inhibiting siRNAs. In summary this is a useful resource for researchers working in the field of siRNA based HIV therapy. HIVsirDB database is accessible at http://crdd.osdd.net/raghava/hivsir/.
-
Misinterpreting the therapeutic effects of small interfering RNA caused by immune stimulation.
Robbins, Marjorie; Judge, Adam; Ambegia, Ellen; Choi, Catherine; Yaworski, Ed; Palmer, Lorne; McClintock, Kevin; MacLachlan, Ian
2008-10-01
Activation of innate immunity has direct effects in modulating viral replication, tumor growth, angiogenesis, and inflammatory and other immunological processes. It is now established that unmodified siRNA can activate this innate immune response and therefore there is real potential for siRNA to elicit nonspecific therapeutic effects in a wide range of disease models. Here we demonstrate that in a murine model of influenza infection, the antiviral activity of siRNA is due primarily to immune stimulation elicited by the active siRNA duplexes and is not the result of therapeutic RNA interference (RNAi) as previously reported. We show that the misinterpretation stems from the use of a particular control green fluorescent protein (GFP) siRNA that we identify as having unusually low immunostimulatory activity compared with the active anti-influenza siRNA. Curiously, this GFP siRNA has served as a negative control for a surprising number of groups reporting therapeutic effects of siRNA. The inert immunologic profile of the GFP sequence was unique among a broad panel of published siRNAs, all of which could elicit significant interferon induction from primary immune cells. This panel included eight active siRNAs against viral, angiogenic, and oncologic targets, the reported therapeutic efficacy of which was based on comparison with the nonimmunostimulatory GFP siRNA. These results emphasize the need for researchers to anticipate, monitor, and adequately control for siRNA-mediated immune stimulation and calls into question the interpretation of numerous published reports of therapeutic RNAi in vivo. The use of chemically modified siRNA with minimal immunostimulatory capacity will help to delineate more accurately the mechanism of action underlying such studies.
-
Multifunctional pH-Sensitive Amino Lipids for siRNA Delivery.
Gujrati, Maneesh; Vaidya, Amita; Lu, Zheng-Rong
2016-01-20
RNA interference (RNAi) represents a powerful modality for human disease therapy that can regulate gene expression signature using small interfering RNA (siRNA). Successful delivery of siRNA into the cytoplasm of target cells is imperative for efficient RNAi and also constitutes the primary stumbling block in the clinical applicability of RNAi. Significant progress has been made in the development of lipid-based siRNA delivery systems, which have practical advantages like simple chemistry and easy formulation of nanoparticles with siRNA. This review discusses the recent development of pH-sensitive amino lipids, with particular focus on multifunctional pH-sensitive amino lipids for siRNA delivery. The key components of these multifunctional lipids include a protonatable amino head group, distal lipid tails, and two cross-linkable thiol groups, which together facilitate the facile formation of stable siRNA-nanoparticles, easy surface modification for target-specific delivery, endosomal escape in response to the pH decrease during subcellular trafficking, and reductive dissociation of the siRNA-nanoparticles for cytoplasmic release of free siRNA. By virtue of these properties, multifunctional pH-sensitive lipids can mediate efficient cytosolic siRNA delivery and gene silencing. Targeted siRNA nanoparticles can be readily formulated with these lipids, without the need for other helper lipids, to promote systemic delivery of therapeutic siRNAs. Such targeted siRNA nanoparticles have been shown to effectively regulate the expression of cancer-related genes, resulting in significant efficacy in the treatment of aggressive tumors, including metastatic triple negative breast cancer. These multifunctional pH-sensitive lipids constitute a promising platform for the systemic and targeted delivery of therapeutic siRNA for the treatment of human diseases. This review summarizes the structure-property relationship of the multifunctional pH-sensitive lipids and their efficacy in in vitro and in vivo siRNA delivery and gene silencing.
-
Multi-task learning for cross-platform siRNA efficacy prediction: an in-silico study
2010-01-01
Background Gene silencing using exogenous small interfering RNAs (siRNAs) is now a widespread molecular tool for gene functional study and new-drug target identification. The key mechanism in this technique is to design efficient siRNAs that incorporated into the RNA-induced silencing complexes (RISC) to bind and interact with the mRNA targets to repress their translations to proteins. Although considerable progress has been made in the computational analysis of siRNA binding efficacy, few joint analysis of different RNAi experiments conducted under different experimental scenarios has been done in research so far, while the joint analysis is an important issue in cross-platform siRNA efficacy prediction. A collective analysis of RNAi mechanisms for different datasets and experimental conditions can often provide new clues on the design of potent siRNAs. Results An elegant multi-task learning paradigm for cross-platform siRNA efficacy prediction is proposed. Experimental studies were performed on a large dataset of siRNA sequences which encompass several RNAi experiments recently conducted by different research groups. By using our multi-task learning method, the synergy among different experiments is exploited and an efficient multi-task predictor for siRNA efficacy prediction is obtained. The 19 most popular biological features for siRNA according to their jointly importance in multi-task learning were ranked. Furthermore, the hypothesis is validated out that the siRNA binding efficacy on different messenger RNAs(mRNAs) have different conditional distribution, thus the multi-task learning can be conducted by viewing tasks at an "mRNA"-level rather than at the "experiment"-level. Such distribution diversity derived from siRNAs bound to different mRNAs help indicate that the properties of target mRNA have important implications on the siRNA binding efficacy. Conclusions The knowledge gained from our study provides useful insights on how to analyze various cross-platform RNAi data for uncovering of their complex mechanism. PMID:20380733
-
Multi-task learning for cross-platform siRNA efficacy prediction: an in-silico study.
Liu, Qi; Xu, Qian; Zheng, Vincent W; Xue, Hong; Cao, Zhiwei; Yang, Qiang
2010-04-10
Gene silencing using exogenous small interfering RNAs (siRNAs) is now a widespread molecular tool for gene functional study and new-drug target identification. The key mechanism in this technique is to design efficient siRNAs that incorporated into the RNA-induced silencing complexes (RISC) to bind and interact with the mRNA targets to repress their translations to proteins. Although considerable progress has been made in the computational analysis of siRNA binding efficacy, few joint analysis of different RNAi experiments conducted under different experimental scenarios has been done in research so far, while the joint analysis is an important issue in cross-platform siRNA efficacy prediction. A collective analysis of RNAi mechanisms for different datasets and experimental conditions can often provide new clues on the design of potent siRNAs. An elegant multi-task learning paradigm for cross-platform siRNA efficacy prediction is proposed. Experimental studies were performed on a large dataset of siRNA sequences which encompass several RNAi experiments recently conducted by different research groups. By using our multi-task learning method, the synergy among different experiments is exploited and an efficient multi-task predictor for siRNA efficacy prediction is obtained. The 19 most popular biological features for siRNA according to their jointly importance in multi-task learning were ranked. Furthermore, the hypothesis is validated out that the siRNA binding efficacy on different messenger RNAs(mRNAs) have different conditional distribution, thus the multi-task learning can be conducted by viewing tasks at an "mRNA"-level rather than at the "experiment"-level. Such distribution diversity derived from siRNAs bound to different mRNAs help indicate that the properties of target mRNA have important implications on the siRNA binding efficacy. The knowledge gained from our study provides useful insights on how to analyze various cross-platform RNAi data for uncovering of their complex mechanism.
-
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ying, Bo; Campbell, Robert B., E-mail: robert.campbell@mcphs.edu
2014-04-04
Highlights: • siRNA-lipid nanoparticles are solid particles not lipid bilayers with aqueous core. • High, but not low, PEG content can prevent nanoparticle encapsulation of siRNA. • PEG reduces cellular toxicity of cationic nanoparticles in vitro. • PEG reduces zeta potential while improving gene silencing of siRNA nanoparticles. • Kinesin spindle protein can be an effective target for tumor vascular targeting. - Abstract: The ideal siRNA delivery system should selectively deliver the construct to the target cell, avoid enzymatic degradation, and evade uptake by phagocytes. In the present study, we evaluated the importance of polyethylene glycol (PEG) on lipid-based carriermore » systems for encapsulating, and delivering, siRNA to tumor vessels using cellular models. Lipid nanoparticles containing different percentage of PEG were evaluated based on their physical chemical properties, density compared to water, siRNA encapsulation, toxicity, targeting efficiency and gene silencing in vitro. siRNA can be efficiently loaded into lipid nanoparticles (LNPs) when DOTAP is included in the formulation mixture. However, the total amount encapsulated decreased with increase in PEG content. In the presence of siRNA, the final formulations contained a mixed population of particles based on density. The major population which contains the majority of siRNA exhibited a density of 4% glucose, and the minor fraction associated with a decreased amount of siRNA had a density less than PBS. The inclusion of 10 mol% PEG resulted in a greater amount of siRNA associated with the minor fraction. Finally, when kinesin spindle protein (KSP) siRNA was encapsulated in lipid nanoparticles containing a modest amount of PEG, the proliferation of endothelial cells was inhibited due to the efficient knock down of KSP mRNA. The presence of siRNA resulted in the formation of solid lipid nanoparticles when prepared using the thin film and hydration method. LNPs with a relatively modest amount of PEG can sufficiently encapsulate siRNA, improve cellular uptake and the efficiency of gene silencing.« less
-
Stope, Matthias B; Schubert, Tina; Staar, Doreen; Rönnau, Cindy; Streitbörger, Andreas; Kroeger, Nils; Kubisch, Constanze; Zimmermann, Uwe; Walther, Reinhard; Burchardt, Martin
2012-06-01
Heat shock proteins (HSP) are involved in processes of folding, activation, trafficking and transcriptional activity of most steroid receptors including the androgen receptor (AR). Accumulating evidence links rising heat shock protein 27 (HSP27) levels with the development of castration-resistant prostate cancer. In order to study the functional relationship between HSP27 and the AR, we modulated the expression of the small heat shock protein HSP27 in human prostate cancer (PC) cell lines. HSP27 protein concentrations in LNCaP and PC-3 cells were modulated by over-expression or silencing of HSP27. The effects of HSP27 on AR protein and mRNA levels were monitored by Western blotting and quantitative RT-PCR. Treatment for the AR-positive LNCaP with HSP27-specific siRNA resulted in a down-regulation of AR levels. This down-regulation of protein was paralleled by a decrease in AR mRNA. Most interestingly, over-expression of HSP27 in PC-3 cells led to a significant increase in AR mRNA although the cells were unable to produce functional AR protein. The observation that HSP27 is involved in the regulation of AR mRNA by a yet unknown mechanism highlights the complexity of HSP27-AR signaling network.
-
Progress and perspective of inorganic nanoparticles based siRNA delivery system
Jiang, Ying; Huo, Shuaidong; Hardie, Joseph; Liang, Xing-Jie; Rotello, Vincent M.
2016-01-01
Introduction Small interfering RNA (siRNA) is an effective method for regulating the expression of proteins, even “undruggable” ones that are nearly impossible to target through traditional small molecule therapeutics. Delivery to the cell and then to the cytosol is the primary requirement for realization of therapeutic potential of siRNA. Areas covered We summarize recent advances in the design of inorganic nanoparticle with surface functionality and physicochemical properties engineered for siRNA delivery. Specifically, we discuss the main approaches developed so far to load siRNA into/onto NPs, and NP surface chemistry engineered for enhanced intracellular siRNA delivery, endosomal escape, and targeted delivery of siRNA to disease cells and tissues. Expert Opinion Several challenges remain in developing inorganic NPs for efficient and effective siRNA delivery. Getting the material to the chosen site is important, however the greatest hurdle may well be delivery into the cytosol, either through efficient endosomal escape or by direct cytosolic siRNA delivery. Effective delivery at the organismic and cellular level coupled with biocompatible vehicles with low immunogenic response will facilitate the clinical translation of RNAi for the treatment of genetic diseases. PMID:26735861
-
Wu, Sherry Y.; Yang, Xianbin; Gharpure, Kshipra M.; Hatakeyama, Hiroto; Egli, Martin; McGuire, Michael H.; Nagaraja, Archana S.; Miyake, Takahito M.; Rupaimoole, Rajesha; Pecot, Chad V.; Taylor, Morgan; Pradeep, Sunila; Sierant, Malgorzata; Rodriguez-Aguayo, Cristian; Choi, Hyun J.; Previs, Rebecca A.; Armaiz-Pena, Guillermo N.; Huang, Li; Martinez, Carlos; Hassell, Tom; Ivan, Cristina; Sehgal, Vasudha; Singhania, Richa; Han, Hee-Dong; Su, Chang; Kim, Ji Hoon; Dalton, Heather J.; Kowali, Chandra; Keyomarsi, Khandan; McMillan, Nigel A.J.; Overwijk, Willem W.; Liu, Jinsong; Lee, Ju-Seog; Baggerly, Keith A.; Lopez-Berestein, Gabriel; Ram, Prahlad T.; Nawrot, Barbara; Sood, Anil K.
2014-01-01
Improving small interfering RNA (siRNA) efficacy in target cell populations remains a challenge to its clinical implementation. Here, we report a chemical modification, consisting of phosphorodithioate (PS2) and 2’-O-Methyl (2’-OMe) MePS2 on one nucleotide that significantly enhances potency and resistance to degradation for various siRNAs. We find enhanced potency stems from an unforeseen increase in siRNA loading to the RNA-induced silencing complex, likely due to the unique interaction mediated by 2’-OMe and PS2. We demonstrate the therapeutic utility of MePS2 siRNAs in chemoresistant ovarian cancer mouse models via targeting GRAM Domain Containing 1B (GRAMD1B), a protein involved in chemoresistance. GRAMD1B silencing is achieved in tumors following MePS2-modified siRNA treatment, leading to a synergistic anti-tumor effect in combination with paclitaxel. Given the previously limited success in enhancing siRNA potency with chemically modified siRNAs, our findings represent an important advance in siRNA design with the potential for application in numerous cancer types. PMID:24619206
-
Intranasal delivery of antiviral siRNA.
Barik, Sailen
2011-01-01
Intranasal administration of synthetic siRNA is an effective modality of RNAi delivery for the prevention and therapy of respiratory diseases, including pulmonary infections. Vehicles used for nasal siRNA delivery include established as well as novel reagents, many of which have been recently optimized. In general, they all promote significant uptake of siRNA into the lower respiratory tract, including the lung. When properly designed and optimized, these siRNAs offer significant protection against respiratory viruses such as influenza virus, parainfluenza virus and respiratory syncytial virus (RSV). Nasally administered siRNA remains within the lung and does not access systemic blood flow, as judged by its absence in other major organs such as liver, heart, kidney, and skeletal muscle. Adverse immune reaction is generally not encountered, especially when immunogenic and/or off-target siRNA sequences and toxic vehicles are avoided. In fact, siRNA against RSV has entered Phase II clinical trials in human with promising results. Here, we provide a standardized procedure for using the nose as a specific route for siRNA delivery into the lung of laboratory animals. It should be clear that this simple and efficient system has enormous potential for therapeutics.
-
NFκB-mediated activation of the cellular FUT3, 5 and 6 gene cluster by herpes simplex virus type 1.
Nordén, Rickard; Samuelsson, Ebba; Nyström, Kristina
2017-11-01
Herpes simplex virus type 1 has the ability to induce expression of a human gene cluster located on chromosome 19 upon infection. This gene cluster contains three fucosyltransferases (encoded by FUT3, FUT5 and FUT6) with the ability to add a fucose to an N-acetylglucosamine residue. Little is known regarding the transcriptional activation of these three genes in human cells. Intriguingly, herpes simplex virus type 1 activates all three genes simultaneously during infection, a situation not observed in uninfected tissue, pointing towards a virus specific mechanism for transcriptional activation. The aim of this study was to define the underlying mechanism for the herpes simplex virus type 1 activation of FUT3, FUT5 and FUT6 transcription. The transcriptional activation of the FUT-gene cluster on chromosome 19 in fibroblasts was specific, not involving adjacent genes. Moreover, inhibition of NFκB signaling through panepoxydone treatment significantly decreased the induction of FUT3, FUT5 and FUT6 transcriptional activation, as did siRNA targeting of p65, in herpes simplex virus type 1 infected fibroblasts. NFκB and p65 signaling appears to play an important role in the regulation of FUT3, FUT5 and FUT6 transcriptional activation by herpes simplex virus type 1 although additional, unidentified, viral factors might account for part of the mechanism as direct interferon mediated stimulation of NFκB was not sufficient to induce the fucosyltransferase encoding gene cluster in uninfected cells. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
-
Petrova, Natalya S; Chernikov, Ivan V; Meschaninova, Mariya I; Dovydenko, Iiya S; Venyaminova, Aliya G; Zenkova, Marina A; Vlassov, Valentin V; Chernolovskaya, Elena L
2012-03-01
The conjugation of siRNA to molecules, which can be internalized into the cell via natural transport mechanisms, can result in the enhancement of siRNA cellular uptake. Herein, the carrier-free cellular uptake of nuclease-resistant anti-MDR1 siRNA equipped with lipophilic residues (cholesterol, lithocholic acid, oleyl alcohol and litocholic acid oleylamide) attached to the 5'-end of the sense strand via oligomethylene linker of various length was investigated. A convenient combination of H-phosphonate and phosphoramidite methods was developed for the synthesis of 5'-lipophilic conjugates of siRNAs. It was found that lipophilic siRNA are able to effectively penetrate into HEK293, HepG2 and KB-8-5 cancer cells when used in a micromolar concentration range. The efficiency of the uptake is dependent upon the type of lipophilic moiety, the length of the linker between the moiety and the siRNA and cell type. Among all the conjugates tested, the cholesterol-conjugated siRNAs with linkers containing from 6 to 10 carbon atoms demonstrate the optimal uptake and gene silencing properties: the shortening of the linker reduces the efficiency of the cellular uptake of siRNA conjugates, whereas the lengthening of the linker facilitates the uptake but retards the gene silencing effect and decreases the efficiency of the silencing.
-
Prabhakar, Neeraj; Zhang, Jixi; Desai, Diti; Casals, Eudald; Gulin-Sarfraz, Tina; Näreoja, Tuomas; Westermarck, Jukka; Rosenholm, Jessica M
2016-01-01
Small interfering RNA (siRNA) is a highly potent drug in gene-based therapy with the challenge being to deliver it in a sustained manner. The combination of mesoporous silica nanoparticles (MSNs) and polycations in the confined pore space allows for incorporation and controlled release of therapeutic siRNA payloads. We hereby constructed MSNs with expanded mesopores and pore-surface-hyperbranched poly(ethyleneimine) (PEI) tethered with redox-cleavable linkers that could carry a high payload of siRNA (120 mg·g−1). The developed nanocarriers were efficiently taken up by cancer cells and were subsequently able to escape to the cytoplasm from the endosomes, most likely owing to the integrated PEI. Triggered by the intracellular redox conditions, the siRNA was sustainably released inside the cells over a period of several days. Functionality of siRNAs was demonstrated by using cell-killing siRNA as cargo. Despite not being the aim of the developed system, in vitro experiments using cell-killing siRNAs showed that the efficacy of siRNA transfection was comparable to the commercial in vitro transfection agent Lipofectamine. Consequently, the developed MSN-based delivery system offers a potential approach to hybrid nanocarriers for more efficient and long-term siRNA delivery and, in a longer perspective, in vivo gene silencing for RNA interference (RNAi) therapy. PMID:27994460
-
Capacity of mesoporous bioactive glass nanoparticles to deliver therapeutic molecules
NASA Astrophysics Data System (ADS)
El-Fiqi, Ahmed; Kim, Tae-Hyun; Kim, Meeju; Eltohamy, Mohamed; Won, Jong-Eun; Lee, Eun-Jung; Kim, Hae-Won
2012-11-01
Inorganic bioactive nanomaterials are attractive for hard tissue regeneration, including nanocomponents for bone replacement composites and nanovehicles for delivering therapeutics. Bioactive glass nanoparticles (BGn) have recently gained potential usefulness as bone and tooth regeneratives. Here we demonstrate the capacity of the BGn with mesopores to load and deliver therapeutic molecules (drugs and particularly genes). Spherical BGn with sizes of 80-90 nm were produced to obtain 3-5 nm sized mesopores through a sono-reacted sol-gel process. A simulated body fluid test of the mesoporous BGn confirmed their excellent apatite forming ability and the cellular toxicity study demonstrated their good cell viability up to 100 μg ml-1. Small molecules like chemical drug (Na-ampicillin) and gene (small interfering RNA; siRNA) were introduced as model drugs considering the mesopore size of the nanoparticles. Moreover, amine-functionalization allowed switchable surface charge property of the BGn (from -20-30 mV to +20-30 mV). Loading of ampicillin or siRNA saturated within a few hours (~2 h) and reflected the mesopore structure. While the ampicillin released relatively rapidly (~12 h), the siRNA continued to release up to 3 days with almost zero-order kinetics. The siRNA-nanoparticles were easily taken up by the cells, with a transfection efficiency as high as ~80%. The silencing effect of siRNA delivered from the BGn, as examined by using bcl-2 model gene, showed dramatic down-regulation (~15% of control), suggesting the potential use of BGn as a new class of nanovehicles for genes. This, in conjunction with other attractive properties, including size- and mesopore-related high surface area and pore volume, tunable surface chemistry, apatite-forming ability, good cell viability and the possible ion-related stimulatory effects, will potentiate the usefulness of the BGn in hard tissue regeneration.Inorganic bioactive nanomaterials are attractive for hard tissue regeneration, including nanocomponents for bone replacement composites and nanovehicles for delivering therapeutics. Bioactive glass nanoparticles (BGn) have recently gained potential usefulness as bone and tooth regeneratives. Here we demonstrate the capacity of the BGn with mesopores to load and deliver therapeutic molecules (drugs and particularly genes). Spherical BGn with sizes of 80-90 nm were produced to obtain 3-5 nm sized mesopores through a sono-reacted sol-gel process. A simulated body fluid test of the mesoporous BGn confirmed their excellent apatite forming ability and the cellular toxicity study demonstrated their good cell viability up to 100 μg ml-1. Small molecules like chemical drug (Na-ampicillin) and gene (small interfering RNA; siRNA) were introduced as model drugs considering the mesopore size of the nanoparticles. Moreover, amine-functionalization allowed switchable surface charge property of the BGn (from -20-30 mV to +20-30 mV). Loading of ampicillin or siRNA saturated within a few hours (~2 h) and reflected the mesopore structure. While the ampicillin released relatively rapidly (~12 h), the siRNA continued to release up to 3 days with almost zero-order kinetics. The siRNA-nanoparticles were easily taken up by the cells, with a transfection efficiency as high as ~80%. The silencing effect of siRNA delivered from the BGn, as examined by using bcl-2 model gene, showed dramatic down-regulation (~15% of control), suggesting the potential use of BGn as a new class of nanovehicles for genes. This, in conjunction with other attractive properties, including size- and mesopore-related high surface area and pore volume, tunable surface chemistry, apatite-forming ability, good cell viability and the possible ion-related stimulatory effects, will potentiate the usefulness of the BGn in hard tissue regeneration. Electronic supplementary information (ESI) available. See DOI: 10.1039/c2nr31775c
-
Asgeirsdóttir, Sigridur A; Talman, Eduard G; de Graaf, Inge A; Kamps, Jan A A M; Satchell, Simon C; Mathieson, Peter W; Ruiters, Marcel H J; Molema, Grietje
2010-01-25
Applications of small-interfering RNA (siRNA) call for specific and efficient delivery of siRNA into particular cell types. We developed a novel, non-viral targeting system to deliver siRNA specifically into inflammation-activated endothelial cells. This was achieved by conjugating the cationic amphiphilic lipid SAINT to antibodies recognizing the inflammatory cell adhesion molecule E-selectin. These anti-E-selectin-SAINT lipoplexes (SAINTarg) maintained antigen recognition capacity of the parental antibody in vitro, and ex vivo in human kidney tissue slices subjected to inflammatory conditions. Regular SAINT mediated transfection resulted in efficient gene silencing in human microvascular endothelial cells (HMEC-1) and conditionally immortalized glomerular endothelial cells (ciGEnC). However, primary human umbilical vein endothelial cells (HUVEC) transfected poorly, a phenomenon that we could quantitatively correlate with a cell-type specific capacity to facilitate siRNA uptake. Importantly, SAINTarg increased siRNA uptake and transfection specificity for activated endothelial cells. Transfection with SAINTarg delivered significantly more siRNA into activated HUVEC, compared to transfection with non-targeted SAINT. The enhanced uptake of siRNA was corroborated by improved silencing of both gene- and protein expression of VE-cadherin in activated HUVEC, indicating that SAINTarg delivered functionally active siRNA into endothelial cells. The obtained results demonstrate a successful design of a small nucleotide carrier system with improved and specific siRNA delivery into otherwise difficult-to-transfect primary endothelial cells, which in addition reduced considerably the amount of siRNA needed for gene silencing. Copyright 2009 Elsevier B.V. All rights reserved.
-
Dorrell, Richard G; Hinksman, George A; Howe, Christopher J
2016-02-01
Plastids produce a vast diversity of transcripts. These include mature transcripts containing coding sequences, and their processing precursors, as well as transcripts that lack direct coding functions, such as antisense transcripts. Although plastid transcriptomes have been characterised for many plant species, less is known about the transcripts produced in other plastid lineages. We characterised the transcripts produced in the fucoxanthin-containing plastids of the dinoflagellate alga Karenia mikimotoi. This plastid lineage, acquired through tertiary endosymbiosis, utilises transcript processing pathways that are very different from those found in plants and green algae, including 3' poly(U) tail addition, and extensive substitutional editing of transcript sequences. We have sequenced the plastid transcriptome of K. mikimotoi, and have detected evidence for divergent evolution of fucoxanthin plastid genomes. We have additionally characterised polycistronic and monocistronic transcripts from two plastid loci, psbD-tRNA (Met)-ycf4 and rpl36-rps13-rps11. We find evidence for a range of transcripts produced from each locus that differ in terms of editing state, 5' end cleavage position, and poly(U) tail addition. Finally, we identify antisense transcripts in K. mikimotoi, which appear to undergo different processing events from the corresponding sense transcripts. Overall, our study provides insights into the diversity of transcripts and processing intermediates found in plastid lineages across the eukaryotes.
-
Selvakumar, Arti; Antony, Cecil; Singhal, Jhalak; Tiwari, Brijendra K.; Singh, Yogendra; Natarajan, Krishnamurthy
2014-01-01
Our previous work has demonstrated the roles played by L-type Voltage Gated Calcium Channels (VGCC) in regulating Mycobacterium tuberculosis (M. tb) survival and pathogenesis. Here we decipher mechanisms and pathways engaged by the pathogen to regulate VGCC expression in macrophages. We show that M. tb and its antigen Rv3416 use phospho-CREB (pCREB), Reactive Oxygen Species (ROS), Protein Kinase C (PKC) and Mitogen Activated Protein Kinase (MAPK) to modulate VGCC expression in macrophages. siRNA mediated knockdown of MyD88, IRAK1, IRAK2 or TRAF6 significantly inhibited antigen mediated VGCC expression. Inhibiting Protein Kinase C (PKC) or MEK-ERK1/2 further increased VGCC expression. Interestingly, inhibiting intracellular calcium release upregulated antigen mediated VGCC expression, while inhibiting extracellular calcium influx had no significant effect. siRNA mediated knockdown of transcription factors c-Jun, SOX5 and CREB significantly inhibited Rv3416 mediated VGCC expression. A dynamic reciprocal cross-regulation between ROS and pCREB was observed that in turn governed VGCC expression with ROS playing a limiting role in the process. Further dissection of the mechanisms such as the interplay between ROS and pCREB would improve our understanding of the regulation of VGCC expression during M. tb infection. PMID:24797940
-
Lavorgna, Alfonso
2012-01-01
The human T-cell leukemia virus type 1 (HTLV-1) Tax oncoprotein actively shuttles between the nucleus, where it interacts with transcriptional and splicing regulatory proteins, and the cytoplasm, where it activates NF-κB. Posttranslational modifications of Tax such as ubiquitination regulate its subcellular localization and hence its function; however, the regulation of Tax trafficking and NF-κB activation by host factors is poorly understood. By screening a deubiquitinating (DUB) enzyme small interfering RNA (siRNA) library, we identified the metalloprotease STAM-binding protein-like 1 (STAMBPL1) as a positive regulator of Tax-mediated NF-κB activation. Overexpression of wild-type STAMBPL1, but not a catalytically inactive mutant, enhanced Tax-mediated NF-κB activation, whereas silencing of STAMBPL1 with siRNA impaired Tax activation of both the canonical and noncanonical NF-κB signaling pathways. STAMBPL1 regulated Tax-induced NF-κB signaling indirectly by controlling Tax nuclear/cytoplasmic transport and was required for DNA damage-induced Tax nuclear export. Together, these results reveal that the deubiquitinase STAMBPL1 is a key regulator of Tax trafficking and function. PMID:22258247
-
Liu, Mengyang; Chen, Yuanli; Zhang, Ling; Wang, Qixue; Ma, Xingzhe; Li, Xiaoju; Xiang, Rong; Zhu, Yan; Qin, Shucun; Yu, Yang; Jiang, Xian-cheng; Duan, Yajun; Han, Jihong
2015-06-05
Cholesteryl ester transfer protein (CETP) transfers cholesteryl esters from high density lipoprotein to triglyceride-rich lipoproteins. CETP expression can be transcriptionally activated by liver X receptor (LXR). Etoposide and teniposide are DNA topoisomerase II (Topo II) inhibitors. Etoposide has been reported to inhibit atherosclerosis in rabbits with un-fully elucidated mechanisms. In this study we determined if Topo II activity can influence cholesterol metabolism by regulating hepatic CETP expression. Inhibition of Topo II by etoposide, teniposide, or Topo II siRNA increased CETP expression in human hepatic cell line, HepG2 cells, which was associated with increased CETP secretion and mRNA expression. Meanwhile, inhibition of LXR expression by LXR siRNA attenuated induction of CETP expression by etoposide and teniposide. Etoposide and teniposide induced LXRα expression and LXRα/β nuclear translocation while inhibiting expression of receptor interacting protein 140 (RIP140), an LXR co-repressor. In vivo, administration of teniposide moderately reduced serum lipid profiles, induced CETP expression in the liver, and activated reverse cholesterol transport in CETP transgenic mice. Our study demonstrates a novel function of Topo II inhibitors in cholesterol metabolism by activating hepatic CETP expression and reverse cholesterol transport. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
-
Varanasi, Venu G; Odatsu, Tetsurou; Bishop, Timothy; Chang, Joyce; Owyoung, Jeremy; Loomer, Peter M
2016-10-01
Bioactive glasses release ions, those enhance osteoblast collagen matrix synthesis and osteogenic marker expression during bone healing. Collagen matrix density and osteogenic marker expression depend on osteogenic transcription factors, (e.g., Osterix (OSX)). We hypothesize that enhanced expression and formation of collagen by Si(4+) depends on enhanced expression of OSX transcription. Experimental bioactive glass (6P53-b) and commercial Bioglass(TM) (45S5) were dissolved in basal medium to make glass conditioned medium (GCM). ICP-MS analysis was used to measure bioactive glass ion release rates. MC3T3-E1 cells were cultured for 20 days, and gene expression and extracellular matrix collagen formation was analyzed. In a separate study, siRNA was used to determine the effect of OSX knockdown on impacting the effect of Si(4+) on osteogenic markers and matrix collagen formation. Each bioactive glass exhibited similar ion release rates for all ions, except Mg(2+) released by 6P53-b. Gene expression results showed that GCM markedly enhanced many osteogenic markers, and 45S5 GCM showed higher levels of expression and collagen matrix fiber bundle density than 6P53-b GCM. Upon knockdown of OSX transcription, collagen type 5, alkaline phosphatase, and matrix density were not enhanced as compared to wild type cells. This study illustrates that the enhancement of elongated collagen fiber matrix formation by Si(±) depends on OSX transcription. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 104A: 2604-2615, 2016. © 2016 Wiley Periodicals, Inc.
-
Kim, Seung-Whan; Suh, Hyun-Woo; Yoo, Bo-Kyung; Kwon, Kisang; Yu, Kweon; Choi, Ji-Young; Kwon, O-Yu
2018-05-22
In this study, we show that INS-1 pancreatic β-cells treated for 2 h with hemolymph of larvae of rhinoceros beetle, Allomyrina dichotoma, secreted about twice as much insulin compared to control cells without such treatment. Activating transcription factor 3 (ATF3) was the highest upregulated gene in DNA chip analysis. The A. dichotoma hemolymph dose-dependently induced increased expression levels of genes encoding ATF3 and insulin. Conversely, treatment with ATF3 siRNA inhibited expression levels of both genes and curbed insulin secretion. These results suggest that the A. dichotoma hemolymph has potential for treating and preventing diabetes or diabetes-related complications.
-
Scott, Jaclyn C.; Brackney, Doug E.; Campbell, Corey L.; Bondu-Hawkins, Virginie; Hjelle, Brian; Ebel, Greg D.; Olson, Ken E.; Blair, Carol D.
2010-01-01
The exogenous RNA interference (RNAi) pathway is an important antiviral defense against arboviruses in mosquitoes, and virus-specific small interfering (si)RNAs are key components of this pathway. Understanding the biogenesis of siRNAs in mosquitoes could have important ramifications in using RNAi to control arbovirus transmission. Using deep sequencing technology, we characterized dengue virus type 2 (DENV2)-specific small RNAs produced during infection of Aedes aegypti mosquitoes and A. aegypti Aag2 cell cultures and compared them to those produced in the C6/36 Aedes albopictus cell line. We show that the size and mixed polarity of virus-specific small RNAs from DENV-infected A. aegypti cells indicate that they are products of Dicer-2 (Dcr2) cleavage of long dsRNA, whereas C6/36 cells generate DENV2-specific small RNAs that are longer and predominantly positive polarity, suggesting that they originate from a different small RNA pathway. Examination of virus-specific small RNAs after infection of the two mosquito cell lines with the insect-only flavivirus cell fusing agent virus (CFAV) corroborated these findings. An in vitro assay also showed that Aag2 A. aegypti cells are capable of siRNA production, while C6/36 A. albopictus cells exhibit inefficient Dcr2 cleavage of long dsRNA. Defective expression or function of Dcr2, the key initiator of the RNAi pathway, might explain the comparatively robust growth of arthropod-borne viruses in the C6/36 cell line, which has been used frequently as a surrogate for studying molecular interactions between arboviruses and cells of their mosquito hosts. PMID:21049014
-
Addition of poly (propylene glycol) to multiblock copolymer to optimize siRNA delivery.
Dai, Zhi; Arévalo, Maria T; Li, Junwei; Zeng, Mingtao
2014-01-01
Previous studies have examined different strategies for siRNA delivery with varying degrees of success. These include use of viral vectors, cationic liposomes, and polymers. Several copolymers were designed and synthesized based on blocks of poly(ethylene glycol) PEG, poly(propylene glycol) PPG, and poly(l-lysine). These were designated as P1, P2, and P3. We studied the copolymer self-assembly, siRNA binding, particle size, surface potential, architecture of the complexes, and siRNA delivery. Silencing of GFP using copolymer P3 to deliver GFP-specific siRNA to Neuro-2a cells expressing GFP was almost as effective as using Lipofectamine 2000, with minimal cytotoxicity. Thus, we have provided a new copolymer platform for siRNA delivery that we can continue to modify for improved delivery of siRNA in vitro and eventually in vivo.
-
Perche, Phanélie; Nothisen, Marc; Bagilet, Jérémy; Behr, Jean-Paul; Kotera, Mitsuharu; Remy, Jean-Serge
2013-08-28
Despite its considerable interest in human therapy, in vivo siRNA delivery is still suffering from hurdles of vectorization. We have shown recently efficient gene silencing by non-vectorized cationic siRNA. Here, we describe the synthesis and in vitro evaluation of new amphiphilic cationic siRNA. C₁₂-, (C₁₂)₂- and cholesteryl-spermine(x)-siRNA were capable of luciferase knockdown at nanomolar concentrations without vectorization (i.e. one to two orders of magnitude more potent than commercially available cholesteryl siRNA). Moreover, incubation in the presence of serum did not impair their efficiency. Finally, amphiphilic cationic siRNA was pre-loaded on albumin. In A549Luc cells in the presence of serum, these siRNA conjugates were highly effective and had low toxicity. Copyright © 2013. Published by Elsevier B.V.
-
Functional Nanostructures for Effective Delivery of Small Interfering RNA Therapeutics
Hong, Cheol Am; Nam, Yoon Sung
2014-01-01
Small interfering RNA (siRNA) has proved to be a powerful tool for target-specific gene silencing via RNA interference (RNAi). Its ability to control targeted gene expression gives new hope to gene therapy as a treatment for cancers and genetic diseases. However, siRNA shows poor pharmacological properties, such as low serum stability, off-targeting, and innate immune responses, which present a significant challenge for clinical applications. In addition, siRNA cannot cross the cell membrane for RNAi activity because of its anionic property and stiff structure. Therefore, the development of a safe, stable, and efficient system for the delivery of siRNA therapeutics into the cytoplasm of targeted cells is crucial. Several nanoparticle platforms for siRNA delivery have been developed to overcome the major hurdles facing the therapeutic uses of siRNA. This review covers a broad spectrum of non-viral siRNA delivery systems developed for enhanced cellular uptake and targeted gene silencing in vitro and in vivo and discusses their characteristics and opportunities for clinical applications of therapeutic siRNA. PMID:25285170
-
Current Progress of siRNA/shRNA Therapeutics in Clinical Trials
Burnett, John C.; Rossi, John J.; Tiemann, Katrin
2012-01-01
Through a mechanism known as RNA interference (RNAi), small interfering RNA (siRNA) molecules can target complementary mRNA strands for degradation, thus specifically inhibiting gene expression. The ability of siRNAs to inhibit gene expression offers a mechanism that can be exploited for novel therapeutics. Indeed, over the past decade, at least 21 siRNA therapeutics have been developed for more than a dozen diseases, including various cancers, viruses, and genetic disorders. Like other biological drugs, RNAi-based therapeutics often require a delivery vehicle to transport them to the targeted cells. Thus, the clinical advancement of numerous siRNA drugs has relied on the development of siRNA carriers including biodegradable nanoparticles, lipids, bacteria, and attenuated viruses. Most therapies permit systemic delivery of the siRNA drug, while others use ex vivo delivery by autologous cell therapy. For some of the drugs, advancements in bioengineering and nanotechnology have led to improved control of delivery and release of the siRNA. Likewise, progress in molecular biology has allowed for improved design of the siRNA molecules. Here, we provide an overview of siRNA therapeutics in clinical trials, including their clinical progress, the challenges they have encountered, and the future they hold in the treatment of human diseases. PMID:21744502
-
Engineering functional inorganic-organic hybrid systems: advances in siRNA therapeutics.
Shen, Jianliang; Zhang, Wei; Qi, Ruogu; Mao, Zong-Wan; Shen, Haifa
2018-03-21
Cancer treatment still faces a lot of obstacles such as tumor heterogeneity, drug resistance and systemic toxicities. Beyond the traditional treatment modalities, exploitation of RNA interference (RNAi) as an emerging approach has immense potential for the treatment of various gene-caused diseases including cancer. The last decade has witnessed enormous research and achievements focused on RNAi biotechnology. However, delivery of small interference RNA (siRNA) remains a key challenge in the development of clinical RNAi therapeutics. Indeed, functional nanomaterials play an important role in siRNA delivery, which could overcome a wide range of sequential physiological and biological obstacles. Nanomaterial-formulated siRNA systems have potential applications in protection of siRNA from degradation, improving the accumulation in the target tissues, enhancing the siRNA therapy and reducing the side effects. In this review, we explore and summarize the role of functional inorganic-organic hybrid systems involved in the siRNA therapeutic advancements. Additionally, we gather the surface engineering strategies of hybrid systems to optimize for siRNA delivery. Major progress in the field of inorganic-organic hybrid platforms including metallic/non-metallic cores modified with organic shells or further fabrication as the vectors for siRNA delivery is discussed to give credit to the interdisciplinary cooperation between chemistry, pharmacy, biology and medicine.
-
siRNAmod: A database of experimentally validated chemically modified siRNAs.
Dar, Showkat Ahmad; Thakur, Anamika; Qureshi, Abid; Kumar, Manoj
2016-01-28
Small interfering RNA (siRNA) technology has vast potential for functional genomics and development of therapeutics. However, it faces many obstacles predominantly instability of siRNAs due to nuclease digestion and subsequently biologically short half-life. Chemical modifications in siRNAs provide means to overcome these shortcomings and improve their stability and potency. Despite enormous utility bioinformatics resource of these chemically modified siRNAs (cm-siRNAs) is lacking. Therefore, we have developed siRNAmod, a specialized databank for chemically modified siRNAs. Currently, our repository contains a total of 4894 chemically modified-siRNA sequences, comprising 128 unique chemical modifications on different positions with various permutations and combinations. It incorporates important information on siRNA sequence, chemical modification, their number and respective position, structure, simplified molecular input line entry system canonical (SMILES), efficacy of modified siRNA, target gene, cell line, experimental methods, reference etc. It is developed and hosted using Linux Apache MySQL PHP (LAMP) software bundle. Standard user-friendly browse, search facility and analysis tools are also integrated. It would assist in understanding the effect of chemical modifications and further development of stable and efficacious siRNAs for research as well as therapeutics. siRNAmod is freely available at: http://crdd.osdd.net/servers/sirnamod.
-
Xie, Yuran; Kim, Na Hyung; Nadithe, Venkatareddy; Schalk, Dana; Thakur, Archana; Kılıç, Ayşe; Lum, Lawrence G.; Bassett, David JP; Merkel, Olivia M
2016-01-01
Asthma is a worldwide health problem. Activated T cells (ATCs) in the lung, particularly T helper 2 cells (Th2), are strongly associated with inducing airway inflammatory responses and chemoattraction of inflammatory cells in asthma. Small interfering RNA (siRNA) as a promising anti-sense molecule can specifically silence inflammation related genes in ATCs, however, lack of safe and efficient siRNA delivery systems limits the application of siRNA as a therapeutic molecule in asthma. Here, we designed a novel pulmonary delivery system of siRNA, transferrin-polyethylenimine (Tf-PEI), to selectively deliver siRNA to ATCs in the lung. Tf-PEI polyplexes demonstrated optimal physicochemical properties such as size, distribution, zeta-potential, and siRNA condensation efficiency. Moreover, in vitro studies showed significantly enhanced cellular uptake and gene knockdown mediated by Tf-PEI polyplexes in human primary ATCs. Biodistribution of polyplexes in a murine asthmatic model confirmed that Tf-PEI polyplexes can efficiently and selectively deliver siRNA to ATCs. In conclusion, the present work proves the feasibility to target ATCs in asthma via Tf receptor. This strategy could potentially be used to design an efficient siRNA delivery system for asthma therapy. PMID:27001893
-
Xie, Yuran; Kim, Na Hyung; Nadithe, Venkatareddy; Schalk, Dana; Thakur, Archana; Kılıç, Ayşe; Lum, Lawrence G; Bassett, David J P; Merkel, Olivia M
2016-05-10
Asthma is a worldwide health problem. Activated T cells (ATCs) in the lung, particularly T helper 2 cells (Th2), are strongly associated with inducing airway inflammatory responses and chemoattraction of inflammatory cells in asthma. Small interfering RNA (siRNA) as a promising anti-sense molecule can specifically silence inflammation related genes in ATCs, however, lack of safe and efficient siRNA delivery systems limits the application of siRNA as a therapeutic molecule in asthma. Here, we designed a novel pulmonary delivery system of siRNA, transferrin-polyethylenimine (Tf-PEI), to selectively deliver siRNA to ATCs in the lung. Tf-PEI polyplexes demonstrated optimal physicochemical properties such as size, distribution, zeta-potential, and siRNA condensation efficiency. Moreover, in vitro studies showed significantly enhanced cellular uptake and gene knockdown mediated by Tf-PEI polyplexes in human primary ATCs. Biodistribution of polyplexes in a murine asthmatic model confirmed that Tf-PEI polyplexes can efficiently and selectively deliver siRNA to ATCs. In conclusion, the present work proves the feasibility to target ATCs in asthma via Tf receptor. This strategy could potentially be used to design an efficient siRNA delivery system for asthma therapy. Copyright © 2016 Elsevier B.V. All rights reserved.
-
Intravenous siRNA of brain cancer with receptor targeting and avidin-biotin technology.
Xia, Chun-Fang; Zhang, Yufeng; Zhang, Yun; Boado, Ruben J; Pardridge, William M
2007-12-01
The effective delivery of short interfering RNA (siRNA) to brain following intravenous administration requires the development of a delivery system for transport of the siRNA across the brain capillary endothelial wall, which forms the blood-brain barrier in vivo. siRNA was delivered to brain in vivo with the combined use of a receptor-specific monoclonal antibody delivery system, and avidin-biotin technology. The siRNA was mono-biotinylated on either terminus of the sense strand, in parallel with the production of a conjugate of the targeting MAb and streptavidin. Rat glial cells (C6 or RG-2) were permanently transfected with the luciferase gene, and implanted in the brain of adult rats. Following the formation of intra-cranial tumors, the rats were treated with a single intravenous injection of 270 microg/kg of biotinylated siRNA attached to a transferrin receptor antibody via a biotin-streptavidin linker. The intravenous administration of the siRNA caused a 69-81% decrease in luciferase gene expression in the intracranial brain cancer in vivo. Brain delivery of siRNA following intravenous administration is possible with siRNAs that are targeted to brain with the combined use of receptor specific antibody delivery systems and avidin-biotin technology.
-
Current progress of siRNA/shRNA therapeutics in clinical trials.
Burnett, John C; Rossi, John J; Tiemann, Katrin
2011-09-01
Through a mechanism known as RNA interference (RNAi), small interfering RNA (siRNA) molecules can target complementary mRNA strands for degradation, thus specifically inhibiting gene expression. The ability of siRNAs to inhibit gene expression offers a mechanism that can be exploited for novel therapeutics. Indeed, over the past decade, at least 21 siRNA therapeutics have been developed for more than a dozen diseases, including various cancers, viruses, and genetic disorders. Like other biological drugs, RNAi-based therapeutics often require a delivery vehicle to transport them to the targeted cells. Thus, the clinical advancement of numerous siRNA drugs has relied on the development of siRNA carriers, including biodegradable nanoparticles, lipids, bacteria, and attenuated viruses. Most therapies permit systemic delivery of the siRNA drug, while others use ex vivo delivery by autologous cell therapy. Advancements in bioengineering and nanotechnology have led to improved control of delivery and release of some siRNA therapeutics. Likewise, progress in molecular biology has allowed for improved design of the siRNA molecules. Here, we provide an overview of siRNA therapeutics in clinical trials, including their clinical progress, the challenges they have encountered, and the future they hold in the treatment of human diseases. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
-
NASA Astrophysics Data System (ADS)
Jiang, Xinglu; Wang, Guobao; Liu, Ru; Wang, Yaling; Wang, Yongkui; Qiu, Xiaozhong; Gao, Xueyun
2013-07-01
To date, RNase degradation and endosome/lysosome trapping are still serious problems for siRNA-based molecular therapy, although different kinds of delivery formulations have been tried. In this report, a cell penetrating peptide (CPP, including a positively charged segment, a linear segment, and a hydrophobic segment) and a single wall carbon nanotube (SWCNT) are applied together by a simple method to act as a siRNA delivery system. The siRNAs first form a complex with the positively charged segment of CPP via electrostatic forces, and the siRNA-CPP further coats the surface of the SWCNT via hydrophobic interactions. This siRNA delivery system is non-sensitive to RNase and can avoid endosome/lysosome trapping in vitro. When this siRNA delivery system is studied in Hela cells, siRNA uptake was observed in 98% Hela cells, and over 70% mRNA of mammalian target of rapamycin (mTOR) is knocked down, triggering cell apoptosis on a significant scale. Our siRNA delivery system is easy to handle and benign to cultured cells, providing a very efficient approach for the delivery of siRNA into the cell cytosol and cleaving the target mRNA therein.
-
Kudsiova, Laila; Welser, Katharina; Campbell, Frederick; Mohammadi, Atefeh; Dawson, Natalie; Cui, Lili; Hailes, Helen C; Lawrence, M Jayne; Tabor, Alethea B
2016-03-01
Ternary nanocomplexes, composed of bifunctional cationic peptides, lipids and siRNA, as delivery vehicles for siRNA have been investigated. The study is the first to determine the optimal sequence and architecture of the bifunctional cationic peptide used for siRNA packaging and delivery using lipopolyplexes. Specifically three series of cationic peptides of differing sequence, degrees of branching and cell-targeting sequences were co-formulated with siRNA and vesicles prepared from a 1 : 1 molar ratio of the cationic lipid DOTMA and the helper lipid, DOPE. The level of siRNA knockdown achieved in the human alveolar cell line, A549-luc cells, in both reduced serum and in serum supplemented media was evaluated, and the results correlated to the nanocomplex structure (established using a range of physico-chemical tools, namely small angle neutron scattering, transmission electron microscopy, dynamic light scattering and zeta potential measurement); the conformational properties of each component (circular dichroism); the degree of protection of the siRNA in the lipopolyplex (using gel shift assays) and to the cellular uptake, localisation and toxicity of the nanocomplexes (confocal microscopy). Although the size, charge, structure and stability of the various lipopolyplexes were broadly similar, it was clear that lipopolyplexes formulated from branched peptides containing His-Lys sequences perform best as siRNA delivery agents in serum, with protection of the siRNA in serum balanced against efficient release of the siRNA into the cytoplasm of the cell.
-
Landry, Breanne; Aliabadi, Hamidreza Montazeri; Samuel, Anuja; Gül-Uludağ, Hilal; Jiang, Xiaoyan; Kutsch, Olaf; Uludağ, Hasan
2012-01-01
Use of small interfering RNA (siRNA) is a promising approach for AML treatment as the siRNA molecule can be designed to specifically target proteins that contribute to aberrant cell proliferation in this disease. However, a clinical-relevant means of delivering siRNA molecules must be developed, as the cellular delivery of siRNA is problematic. Here, we report amphiphilic carriers combining a cationic polymer (2 kDa polyethyleneimine, PEI2) with lipophilic moieties to facilitate intracellular delivery of siRNA to AML cell lines. Complete binding of siRNA by the designed carriers was achieved at a polymer:siRNA ratio of ≈ 0.5 and led to siRNA/polymer complexes of ≈ 100 nm size. While the native PEI2 did not display cytotoxicity on AML cell lines THP-1, KG-1 and HL-60, lipid-modification on PEI2 slightly increased the cytotoxicity, which was consistent with increased interaction of polymers with cell membranes. Cellular delivery of siRNA was dependent on the nature of lipid substituent and the extent of lipid substitution, and varied among the three AML cell lines used. Linoleic acid-substituted polymers performed best among the prepared polymers and gave a siRNA delivery equivalent to better performing commercial reagents. Using THP-1 cells and a reporter (GFP) and an endogenous (CXCR4) target, effective silencing of the chosen targets was achieved with 25 to 50 nM of siRNA concentrations, and without adversely affecting subsequent cell growth. We conclude that lipid-substituted PEI2 can serve as an effective delivery of siRNA to leukemic cells and could be employed in molecular therapy of leukemia.
-
Landry, Breanne; Aliabadi, Hamidreza Montazeri; Samuel, Anuja; Gül-Uludağ, Hilal; Jiang, Xiaoyan; Kutsch, Olaf; Uludağ, Hasan
2012-01-01
Use of small interfering RNA (siRNA) is a promising approach for AML treatment as the siRNA molecule can be designed to specifically target proteins that contribute to aberrant cell proliferation in this disease. However, a clinical-relevant means of delivering siRNA molecules must be developed, as the cellular delivery of siRNA is problematic. Here, we report amphiphilic carriers combining a cationic polymer (2 kDa polyethyleneimine, PEI2) with lipophilic moieties to facilitate intracellular delivery of siRNA to AML cell lines. Complete binding of siRNA by the designed carriers was achieved at a polymer:siRNA ratio of ∼0.5 and led to siRNA/polymer complexes of ∼100 nm size. While the native PEI2 did not display cytotoxicity on AML cell lines THP-1, KG-1 and HL-60, lipid-modification on PEI2 slightly increased the cytotoxicity, which was consistent with increased interaction of polymers with cell membranes. Cellular delivery of siRNA was dependent on the nature of lipid substituent and the extent of lipid substitution, and varied among the three AML cell lines used. Linoleic acid-substituted polymers performed best among the prepared polymers and gave a siRNA delivery equivalent to better performing commercial reagents. Using THP-1 cells and a reporter (GFP) and an endogenous (CXCR4) target, effective silencing of the chosen targets was achieved with 25 to 50 nM of siRNA concentrations, and without adversely affecting subsequent cell growth. We conclude that lipid-substituted PEI2 can serve as an effective delivery of siRNA to leukemic cells and could be employed in molecular therapy of leukemia. PMID:22952927
-
Tumor-targeted pH/redox dual-sensitive unimolecular nanoparticles for efficient siRNA delivery.
Chen, Guojun; Wang, Yuyuan; Xie, Ruosen; Gong, Shaoqin
2017-08-10
A unique pH/redox dual-sensitive cationic unimolecular nanoparticle (NP) enabling excellent endosomal/lysosomal escape and efficient siRNA decomplexation inside the target cells was developed for tumor-targeted delivery of siRNA. siRNA was complexed into the cationic core of the unimolecular NP through electrostatic interactions. The cationic core used for complexing siRNA contained reducible disulfide bonds that underwent intracellular reduction owing to the presence of high concentrations of reduced glutathione (GSH) inside the cells, thereby facilitating the decomplexation of siRNA from the unimolecular NPs. The cationic polymers were conjugated onto the hyperbranched core (H40) via a pH-sensitive bond, which further facilitated the decomplexation of siRNA from the NPs. In vitro studies on the siRNA release behaviors showed that dual stimuli (pH=5.3, 10mM GSH) induced the quickest release of siRNA from the NPs. In addition, the imidazole groups attached to the cationic polymer segments enhanced the endosomal/lysosomal escape of NPs via the proton sponge effect. Intracellular tracking studies revealed that siRNA delivered by unimolecular NPs was efficiently released to the cytosol. Moreover, the GE11 peptide, an anti-EGFR peptide, enhanced the cellular uptake of NPs in MDA-MB-468, an EFGR-overexpressing triple negative breast cancer (TNBC) cell line. The GE11-conjugated, GFP-siRNA-complexed NPs exhibited excellent GFP gene silencing efficiency in GFP-MDA-MB-468 TNBC cells without any significant cytotoxicity. Therefore, these studies suggest that this smart unimolecular NP could be a promising nanoplatform for targeted siRNA delivery to EFGR-overexpressing cancer cells. Copyright © 2017 Elsevier B.V. All rights reserved.
-
High-Throughput RNA Interference Screening: Tricks of the Trade
Nebane, N. Miranda; Coric, Tatjana; Whig, Kanupriya; McKellip, Sara; Woods, LaKeisha; Sosa, Melinda; Sheppard, Russell; Rasmussen, Lynn; Bjornsti, Mary-Ann; White, E. Lucile
2016-01-01
The process of validating an assay for high-throughput screening (HTS) involves identifying sources of variability and developing procedures that minimize the variability at each step in the protocol. The goal is to produce a robust and reproducible assay with good metrics. In all good cell-based assays, this means coefficient of variation (CV) values of less than 10% and a signal window of fivefold or greater. HTS assays are usually evaluated using Z′ factor, which incorporates both standard deviation and signal window. A Z′ factor value of 0.5 or higher is acceptable for HTS. We used a standard HTS validation procedure in developing small interfering RNA (siRNA) screening technology at the HTS center at Southern Research. Initially, our assay performance was similar to published screens, with CV values greater than 10% and Z′ factor values of 0.51 ± 0.16 (average ± standard deviation). After optimizing the siRNA assay, we got CV values averaging 7.2% and a robust Z′ factor value of 0.78 ± 0.06 (average ± standard deviation). We present an overview of the problems encountered in developing this whole-genome siRNA screening program at Southern Research and how equipment optimization led to improved data quality. PMID:23616418
-
Shirayama, Masaki; Stanney, William; Gu, Weifeng; Seth, Meetu; Mello, Craig C.
2014-01-01
Summary Argonaute proteins (AGOs) are key nuclease effectors of RNA interference (RNAi) [1]. Although purified AGOs can mediate a single round of target-RNA cleavage in vitro, accessory factors are required for short-interfering (si)RNAs loading and to achieve multiple-target turnover [2, 3]. To identify AGO co-factors we immunoprecipitated the C. elegans AGO WAGO-1, which engages amplified small RNAs during RNAi [4]. These studies identified a robust association between WAGO-1 and a conserved Vasa ATPase-related protein RDE-12. rde-12 mutants are deficient in RNAi including viral suppression, and fail to produce amplified secondary siRNAs and certain endogenous siRNAs (endo-siRNAs). RDE-12 co-localizes with WAGO-1 in germline P-granules and in cytoplasmic and peri-nuclear foci in somatic cells. These findings and our genetic studies suggest that RDE-12 is first recruited to target mRNA by upstream AGOs (RDE-1 and ERGO-1) where it promotes small-RNA amplification and/or WAGO-1 loading. Downstream of these events, RDE-12 forms an RNase-resistant (target mRNA-independent) complex with WAGO-1 and may thus have additional functions in target mRNA surveillance and silencing. PMID:24684931
-
Shirayama, Masaki; Stanney, William; Gu, Weifeng; Seth, Meetu; Mello, Craig C
2014-04-14
Argonaute (AGO) proteins are key nuclease effectors of RNAi. Although purified AGOs can mediate a single round of target RNA cleavage in vitro, accessory factors are required for small interfering RNA (siRNA) loading and to achieve multiple-target turnover. To identify AGO cofactors, we immunoprecipitated the C. elegans AGO WAGO-1, which engages amplified small RNAs during RNAi. These studies identified a robust association between WAGO-1 and a conserved Vasa ATPase-related protein RDE-12. rde-12 mutants are deficient in RNAi, including viral suppression, and fail to produce amplified secondary siRNAs and certain endogenous siRNAs (endo-siRNAs). RDE-12 colocalizes with WAGO-1 in germline P granules and in cytoplasmic and perinuclear foci in somatic cells. These findings and our genetic studies suggest that RDE-12 is first recruited to target mRNA by upstream AGOs (RDE-1 and ERGO-1), where it promotes small RNA amplification and/or WAGO-1 loading. Downstream of these events, RDE-12 forms an RNase-resistant (target mRNA-independent) complex with WAGO-1 and may thus have additional functions in target mRNA surveillance and silencing. Copyright © 2014 Elsevier Ltd. All rights reserved.
-
Kim, Jongkil; Chung, Kunho; Choi, Changseon; Beloor, Jagadish; Ullah, Irfan; Kim, Nahyeon; Lee, Kuen Yong; Lee, Sang-Kyung; Kumar, Priti
2016-01-26
Adipose tissue macrophage (ATM)-mediated inflammation is a key feature contributing to the adverse metabolic outcomes of dietary obesity. Recruitment of macrophages to obese adipose tissues (AT) can occur through the engagement of CCR2, the receptor for MCP-1 (monocyte chemoattractant protein-1), which is expressed on peripheral monocytes/macrophages. Here, we show that i.p. administration of a rabies virus glycoprotein-derived acetylcholine receptor-binding peptide effectively delivers complexed siRNA into peritoneal macrophages and ATMs in a mouse model of high-fat diet-induced obesity. Treatment with siRNA against CCR2 inhibited macrophage infiltration and accumulation in AT and, therefore, proinflammatory cytokines produced by macrophages. Consequently, the treatment significantly improved glucose tolerance and insulin sensitivity profiles, and also alleviated the associated symptoms of hepatic steatosis and reduced hepatic triglyceride production. These results demonstrate that disruption of macrophage chemotaxis to the AT through cell-targeted gene knockdown strategies can provide a therapeutic intervention for obesity-related metabolic diseases. The study also highlights a siRNA delivery approach for targeting specific monocyte subsets that contribute to obesity-associated inflammation without affecting the function of other tissue-resident macrophages that are essential for host homeostasis and survival.
-
Adenosine Deaminase Acting on RNA-1 (ADAR1) Inhibits HIV-1 Replication in Human Alveolar Macrophages
Levy, David N.; Li, Yonghua; Kumar, Rajnish; Burke, Sean A.; Dawson, Rodney; Hioe, Catarina E.; Borkowsky, William; Rom, William N.; Hoshino, Yoshihiko
2014-01-01
While exploring the effects of aerosol IFN-γ treatment in HIV-1/tuberculosis co-infected patients, we observed A to G mutations in HIV-1 envelope sequences derived from bronchoalveolar lavage (BAL) of aerosol IFN-γ-treated patients and induction of adenosine deaminase acting on RNA 1 (ADAR1) in the BAL cells. IFN-γ induced ADAR1 expression in monocyte-derived macrophages (MDM) but not T cells. ADAR1 siRNA knockdown induced HIV-1 expression in BAL cells of four HIV-1 infected patients on antiretroviral therapy. Similar results were obtained in MDM that were HIV-1 infected in vitro. Over-expression of ADAR1 in transformed macrophages inhibited HIV-1 viral replication but not viral transcription measured by nuclear run-on, suggesting that ADAR1 acts post-transcriptionally. The A to G hyper-mutation pattern observed in ADAR1 over-expressing cells in vitro was similar to that found in the lungs of HIV-1 infected patients treated with aerosol IFN-γ suggesting the model accurately represented alveolar macrophages. Together, these results indicate that ADAR1 restricts HIV-1 replication post-transcriptionally in macrophages harboring HIV-1 provirus. ADAR1 may therefore contribute to viral latency in macrophages. PMID:25272020
-
Greaves, Ian K.; Eichten, Steven R.; Groszmann, Michael; Wang, Aihua; Ying, Hua; Peacock, W. James; Dennis, Elizabeth S.
2016-01-01
Hybrid Arabidopsis plants undergo epigenetic reprogramming producing decreased levels of 24-nt siRNAs and altered patterns of DNA methylation that can affect gene expression. Driving the changes in methylation are the processes trans-chromosomal methylation (TCM) and trans-chromosomal demethylation (TCdM). In TCM/TCdM the methylation state of one allele is altered to resemble the other allele. We show that Pol IV-dependent sRNAs are required to establish TCM events. The changes in DNA methylation and the associated changes in sRNA levels in the F1 hybrid can be maintained in subsequent generations and affect hundreds of regions in the F2 epigenome. The inheritance of these altered epigenetic states varies in F2 individuals, resulting in individuals with genetically identical loci displaying different epigenetic states and gene expression profiles. The change in methylation at these regions is associated with the presence of sRNAs. Loci without any sRNA activity can have altered methylation states, suggesting that a sRNA-independent mechanism may also contribute to the altered methylation state of the F1 and F2 generations. PMID:27791153
-
Tian, Zhiqiang; Wang, Huaizhi; Jia, Zhengcai; Shi, Jinglei; Tang, Jun; Mao, Liwei; Liu, Hongli; Deng, Yijing; He, Yangdong; Ruan, Zhihua; Li, Jintao; Wu, Yuzhang; Ni, Bing
2010-12-01
Pokemon gene has crucial but versatile functions in cell differentiation, proliferation and tumorigenesis. It is a master regulator of the ARF-HDM2-p53 and Rb-E2F pathways. The facts that the expression of Pokemon is essential for tumor formation and many kinds of tumors over-express the Pokemon gene make it an attractive target for therapeutic intervention for cancer treatment. In this study, we used an RNAi strategy to silence the Pokemon gene in a cervical cancer model. To address the issues involving tumor specific delivery and durable expression of siRNA, we applied the Arg-Gly-Asp (RGD) peptide ligand and polylysine (K(18)) fusion peptide to encapsulate a recombinant retrovirus plasmid expressing a siRNA targeting the Pokemon gene and produced the 'mimoretrovirus'. At charge ratio 2.0 of fusion peptide/plasmid, the mimoretrovirus formed stable and homogenous nanoparticles, and provided complete DNase I protection and complete gel retardation. This nanoparticle inhibited SiHa cell proliferation and invasion, while it promoted SiHa cell apoptosis. The binding of the nanoparticle to SiHa cells was mediated via the RGD-integrin α(v)β(3) interaction, as evidenced by the finding that unconjugated RGD peptide inhibited this binding significantly. This tumor-targeting mimoretrovirus exhibited excellent anti-tumor capacity in vivo in a nude mouse model. Moreover, the mimoretrovirus inhibited tumor growth with a much higher efficiency than recombinant retrovirus expressing siRNA or the K(18)/P4 nanoparticle lacking the RGD peptide. Results suggest that the RNAi/RGD-based mimoretrovirus developed in this study represents a novel anti-tumor strategy that may be applicable to most research involving cancer therapy and, thus, has promising potential as a cervical cancer treatment.
-
Hlawaty, Hanna; San Juan, Aurélie; Jacob, Marie-Paule; Vranckx, Roger; Letourneur, Didier; Feldman, Laurent J
2009-01-01
Small interfering RNA (siRNA) delivery is a promising approach for the treatment of cardiovascular diseases. Matrix metalloproteinase (MMP) 2 over-expression in the arterial wall has been implicated in restenosis after percutaneous coronary intervention, as well as in spontaneous atherosclerotic plaque rupture. We hypothesized that in vivo local delivery of siRNA targeted at MMP2 (MMP2-siRNA) in the balloon-injured carotid artery of hypercholesterolemic rabbits may lead to inhibition of MMP2 expression. Two weeks after balloon injury, 5 micromol/l of Tamra-tagged MMP2-siRNA, scramble siRNA or saline was locally injected in the carotid artery and incubated for 1 h. Fluorescent microscopy studies showed the circumferential uptake of siRNA in the superficial layers of neointimal cells. MMP2 mRNA levels, measured by the real-time reverse transcriptase-polymerase chain reaction, was decreased by 79 +/- 25% in MMP2-siRNA- versus scramble siRNA-transfected arteries (p < 0.05). MMP2 activity, measured by gelatin zymography performed on the conditioned media of MMP2-siRNA versus scramble siRNA transfected arteries, decreased by 53 +/- 29%, 50 +/- 24% and 46 +/- 14% at 24, 48 and 72 h, respectively (p < 0.005 for all). No effect was observed on MMP9, pro-MMP9 and TIMP-2 levels. The results obtained in the present study suggest that significant inhibition of gene expression can be achieved with local delivery of siRNA in the arterial wall in vivo. (c) 2008 John Wiley & Sons, Ltd.
-
Systemic delivery of siRNA with cationic lipid assisted PEG-PLA nanoparticles for cancer therapy.
Yang, Xian-Zhu; Dou, Shuang; Sun, Tian-Meng; Mao, Cheng-Qiong; Wang, Hong-Xia; Wang, Jun
2011-12-10
Delivery of small interfering RNA (siRNA) has been one of the major hurdles for the application of RNA interference in therapeutics. Here, we describe a cationic lipid assisted polymeric nanoparticle system with stealthy property for efficient siRNA encapsulation and delivery, which was fabricated with poly(ethylene glycol)-b-poly(d,l-lactide), siRNA and a cationic lipid, using a double emulsion-solvent evaporation technique. By incorporation of the cationic lipid, the encapsulation efficiency of siRNA into the nanoparticles could be above 90% and the siRNA loading weight ratio was up to 4.47%, while the diameter of the nanoparticles was around 170 to 200nm. The siRNA retained its integrity within the nanoparticles, which were effectively internalized by cancer cells and escaped from the endosome, resulting in significant gene knockdown. This effect was demonstrated by significant down-regulation of luciferase expression in HepG2-luciferase cells which stably express luciferase, and suppression of polo-like kinase 1 (Plk1) expression in HepG2 cells, following delivery of specific siRNAs by the nanoparticles. Furthermore, the nanoparticles carrying siRNA targeting the Plk1 gene were found to induce remarkable apoptosis in both HepG2 and MDA-MB-435s cancer cells. Systemic delivery of specific siRNA by nanoparticles significantly inhibited luciferase expression in an orthotopic murine liver cancer model and suppressed tumor growth in a MDA-MB-435s murine xenograft model, suggesting its therapeutic promise in disease treatment. Copyright © 2011 Elsevier B.V. All rights reserved.
-
RNA helicase A is not required for RISC activity.
Liang, Xue-Hai; Crooke, Stanley T
2013-10-01
It has been shown that siRNAs can compete with each other or with endogenous miRNAs for RISC components. This competition may complicate the interpretations of phenotypes observed through siRNA-mediated knockdown of genes, especially those genes implicated in the RISC pathway. In this study, we re-examined the function of RNA helicase A (RHA), which has been previously proposed to function in RISC loading based on siRNA-mediated knockdown studies. Here we show that reduced RISC activity or loading of siRNAs was observed only in cells depleted of RHA using siRNA, but not using RNaseH-dependent antisense oligonucleotides (ASOs), suggesting that the impaired RISC function stems from the competition between pre-existing and newly transfected siRNAs, but not from reduction of the RHA protein. This view is further supported by the findings that cells depleted of a control protein, NCL1, using siRNA, but not ASO, exhibited similar defects on the loading and activity of a subsequently transfected siRNA. Transfection of RHA or NCL1 siRNAs, but not ASOs, reduced the levels of endogenous miRNAs, suggesting a competition mechanism. As a positive control, we showed that reduction of MOV10 by either siRNA or ASO decreased siRNA activity, confirming its role in RISC function. Together, our results indicate that RHA is not required for RISC activity or loading, and suggest that proper controls are required when using siRNAs to functionalize genes to avoid competition effects. © 2013. Published by Elsevier B.V. All rights reserved.
-
Single-step assembly of cationic lipid-polymer hybrid nanoparticles for systemic delivery of siRNA.
Yang, Xian-Zhu; Dou, Shuang; Wang, Yu-Cai; Long, Hong-Yan; Xiong, Meng-Hua; Mao, Cheng-Qiong; Yao, Yan-Dan; Wang, Jun
2012-06-26
The clinical success of therapeutics of small interfering RNA (siRNA) is still hindered by its delivery systems. Cationic polymer or lipid-based vehicles as the major delivery systems of siRNA cannot sufficiently satisfy siRNA therapeutic applications. It is hypothesized that cationic lipid-polymer hybrid nanoparticles may take advantage of both polymeric and lipid-based nanoparticles for siRNA delivery, while diminishing the shortcomings of both. In this study, cationic lipid-polymer hybrid nanoparticles were prepared by a single-step nanoprecipitation of a cationic lipid (N,N-bis(2-hydroxyethyl)-N-methyl-N-(2-cholesteryloxycarbonyl aminoethyl) ammonium bromide, BHEM-Chol) and amphiphilic polymers for systemic delivery of siRNA. The formed hybrid nanoparticles comprised a hydrophobic polylactide core, a hydrophilic poly(ethylene glycol) shell, and a cationic lipid monolayer at the interface of the core and the shell. Such hybrid nanoparticles exhibited excellent stability in serum and showed significantly improved biocompatibility compared to that of pure BHEM-Chol particles. The hybrid nanoparticles were capable of delivering siRNA into BT474 cells and facilitated the escape of loaded siRNA from the endosome into the cytoplasm. The hybrid nanoparticles carrying polo-like kinase 1 (Plk1)-specific siRNA (siPlk1) remarkably and specifically downregulated expression of the oncogene Plk1 and induced cancer cell apoptosis both in vitro and in vivo and significantly suppressed tumor growth following systemic administration. We demonstrate that this system is stable, nontoxic, highly efficient, and easy to scale up, bringing the clinical application of siRNA therapy one important step closer to reality.
-
PLGA microspheres encapsulating siRNA.
De Rosa, Giuseppe; Salzano, Giuseppina
2015-01-01
The therapeutic use of small interfering RNA (siRNA) represents a new and powerful approach to suppress the expression of pathologically genes. However, biopharmaceutical drawbacks, such as short half-life, poor cellular uptake, and unspecific distribution into the body, hamper the development of siRNA-based therapeutics. Poly(lactide-co-glycolide), (PLGA) microspheres can be a useful tool to overcome these issues. siRNA can be encapsulated into the PLGA microspheres, which protects the loaded nucleic acid against the enzymatic degradation. Moreover, PLGA microspheres can be injected directly into the action site, where the siRNA can be released in controlled manner, thus avoiding the need of frequent invasive administrations. The complete biodegradability of PLGA to monomers easily metabolized by the body, and its approval by FDA and EMA for parenteral administration, assure the safety of this copolymer and do not require the removal of the device after the complete drug release. In chapter, a basic protocol for the preparation of PLGA microspheres encapsulating siRNA is described. This protocol is based on a double emulsion/solvent evaporation technique, a well known and easy to reproduce method. This specific protocol has been developed to encapsulate a siRNA anti-TNFα in PLGA microspheres, and it has been designed and optimized to achieve high siRNA encapsulation efficiency and slow siRNA release in vitro. However, it can be extended also to other siRNA as well as other RNA or DNA-based oligonucleotides (miRNA, antisense, decoy, etc.). Depending on the applications, chemical modifications of the backbone and site-specific modification within the siRNA sequences could be required.
-
N-Alkyl-PEI Functional Iron Oxide Nanocluster for Efficient siRNA Delivery**
Liu, Gang; Xie, Jin; Zhang, Fan; Wang, Zhi-Yong; Luo, Kui; Zhu, Lei; Quan, Qi-Meng; Niu, Gang; Lee, Seulki
2013-01-01
Small interfering RNA (siRNA) is an emerging class of therapeutics, working by regulating the expression of a specific gene involved in disease progression. Despite the promises, effective transport of siRNA with minimal side effects remains a challenge. In this study, a non-viral nanoparticle gene carrier has been developed and its efficiency for siRNA delivery and transfection has been validated at both in vitro and in vivo levels. Such a nanocarrier, abbreviated as Alkyl-PEI2k-IO, was constructed with a core of iron oxide (IO) and a shell of alkylated PEI2000 (Alkyl-PEI2k). It was found to be able to bind with siRNA, resulting in well-dispersed nanoparticles with a controlled clustering structure and narrow size distribution. Electrophoresis studies showed that the Alkyl-PEI2k-IOs could retard siRNA completely at N/P ratios above 10, protect siRNA from enzymatic degradation in serum and release complexed siRNA efficiently in the presence of polyanionic heparin. The knockdown efficiency of the siRNA loaded nanocarriers was assessed with 4T1 cells stably expressing luciferase (fluc-4T1) and further, with a fluc-4T1 xenograft model. Significant downregulation of luciferase was observed, and unlike the high molecular weight analogs, the Alkyl-PEI2k coated IOs showed a good biocompatibility. In conclusion, Alkyl-PEI2k-IOs demonstrate highly efficient delivery of siRNA and an innocuous toxic profile, making it a potential carrier for gene therapy. PMID:21861295
-
Wan, Qun; Guan, Xueying; Yang, Nannan; Wu, Huaitong; Pan, Mengqiao; Liu, Bingliang; Fang, Lei; Yang, Shouping; Hu, Yan; Ye, Wenxue; Zhang, Hua; Ma, Peiyong; Chen, Jiedan; Wang, Qiong; Mei, Gaofu; Cai, Caiping; Yang, Donglei; Wang, Jiawei; Guo, Wangzhen; Zhang, Wenhua; Chen, Xiaoya; Zhang, Tianzhen
2016-06-01
Natural antisense transcripts (NATs) are commonly observed in eukaryotic genomes, but only a limited number of such genes have been identified as being involved in gene regulation in plants. In this research, we investigated the function of small RNA derived from a NAT in fiber cell development. Using a map-based cloning strategy for the first time in tetraploid cotton, we cloned a naked seed mutant gene (N1 ) encoding a MYBMIXTA-like transcription factor 3 (MML3)/GhMYB25-like in chromosome A12, GhMML3_A12, that is associated with fuzz fiber development. The extremely low expression of GhMML3_A12 in N1 is associated with NAT production, driven by its 3' antisense promoter, as indicated by the promoter-driven histochemical staining assay. In addition, small RNA deep sequencing analysis suggested that the bidirectional transcriptions of GhMML3_A12 form double-stranded RNAs and generate 21-22 nt small RNAs. Therefore, in a fiber-specific manner, small RNA derived from the GhMML3_A12 locus can mediate GhMML3_A12 mRNA self-cleavage and result in the production of naked seeds followed by lint fiber inhibition in N1 plants. The present research reports the first observation of gene-mediated NATs and siRNA directly controlling fiber development in cotton. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
-
Differential Sox10 Genomic Occupancy in Myelinating Glia
Lopez-Anido, Camila; Sun, Guannan; Koenning, Matthias; Srinivasan, Rajini; Hung, Holly A.; Emery, Ben; Keles, Sunduz; Svaren, John
2015-01-01
Myelin is formed by specialized myelinating glia: oligodendrocytes and Schwann cells in the central and peripheral nervous systems, respectively. While there are distinct developmental aspects and regulatory pathways in these two cell types, myelination in both systems requires the transcriptional activator Sox10. Sox10 interacts with cell type-specific transcription factors at some loci to induce myelin gene expression, but it is largely unknown how Sox10 transcriptional networks globally compare between oligodendrocytes and Schwann cells. We used in vivo ChIP-Seq analysis of spinal cord and peripheral nerve (sciatic nerve) to identify unique and shared Sox10 binding sites and assess their correlation with active enhancers and transcriptional profiles in oligodendrocytes and Schwann cells. Sox10 binding sites overlap with active enhancers and critical cell type-specific regulators of myelination, such as Olig2 and Myrf in oligodendrocytes, and Egr2/Krox20 in Schwann cells. Sox10 sites also associate with genes critical for myelination in both oligodendrocytes and Schwann cells, and are found within super-enhancers previously defined in brain. In Schwann cells, Sox10 sites contain binding motifs of putative partners in the Sp/Klf, Tead, and nuclear receptor protein families. Specifically, siRNA analysis of nuclear receptors Nr2f1 and Nr2f2 revealed downregulation of myelin genes Mbp and Ndrg1 in primary Schwann cells. Our analysis highlights different mechanisms that establish cell type-specific genomic occupancy of Sox10, which reflects the unique characteristics of oligodendrocyte and Schwann cell differentiation. PMID:25974668
-
Chandra, Partha K; Kundu, Anup K; Hazari, Sidhartha; Chandra, Sruti; Bao, Lili; Ooms, Tara; Morris, Gilbert F; Wu, Tong; Mandal, Tarun K; Dash, Srikanta
2012-01-01
Sustained antiviral responses of chronic hepatitis C virus (HCV) infection have improved recently by the use of direct-acting antiviral agents along with interferon (IFN)-α and ribavirin. However, the emergence of drug-resistant variants is expected to be a major problem. We describe here a novel combinatorial small interfering RNA (siRNA) nanosome-based antiviral approach to clear HCV infection. Multiple siRNAs targeted to the highly conserved 5′-untranslated region (UTR) of the HCV genome were synthesized and encapsulated into lipid nanoparticles called nanosomes. We show that siRNA can be repeatedly delivered to 100% of cells in culture using nanosomes without toxicity. Six siRNAs dramatically reduced HCV replication in both the replicon and infectious cell culture model. Repeated treatments with two siRNAs were better than a single siRNA treatment in minimizing the development of an escape mutant, resulting in rapid inhibition of viral replication. Systemic administration of combinatorial siRNA-nanosomes is well tolerated in BALB/c mice without liver injury or histological toxicity. As a proof-of-principle, we showed that systemic injections of siRNA nanosomes significantly reduced HCV replication in a liver tumor-xenotransplant mouse model of HCV. Our results indicate that systemic delivery of combinatorial siRNA nanosomes can be used to minimize the development of escape mutants and inhibition of HCV infection. PMID:22617108
-
Parvani, Jenny G; Jackson, Mark W
2017-04-01
Over the past decade, RNA interference (RNAi) has been ubiquitously utilized to study biological function in vitro ; however, limitations were associated with its utility in vivo More recently, small interfering RNA (siRNA) nanoparticles with improved biocompatibility have gained prevalence as a potential therapeutic option for the treatment of various diseases. The adaptability of siRNA nanoparticles enables the delivery of virtually any siRNA, which is especially advantageous for therapeutic applications in heterogeneous diseases that lack unifying molecular features, such as triple-negative breast cancer (TNBC). TNBC is an aggressive subtype of breast cancer that is stratified by the lack of estrogen receptor/progesterone receptor expression and HER2 amplification. There are currently no FDA-approved targeted therapies for the treatment of TNBCs, making cytotoxic chemotherapy the only treatment option available to these patients. In this review, we outline the current status of siRNA nanoparticles in clinical trials for cancer treatment and discuss the promising preclinical approaches that have utilized siRNA nanoparticles for TNBC treatment. Next, we address TNBC subtype-specific therapeutic interventions and highlight where and how siRNA nanoparticles fit into these strategies. Lastly, we point out ongoing challenges in the field of siRNA nanoparticle research that, if addressed, would significantly improve the efficacy of siRNA nanoparticles as a therapeutic option for cancer treatment. © 2017 Society for Endocrinology.
-
Targeted delivery of anti-coxsackievirus siRNAs using ligand-conjugated packaging RNAs.
Zhang, Huifang M; Su, Yue; Guo, Songchuan; Yuan, Ji; Lim, Travis; Liu, Jing; Guo, Peixuan; Yang, Decheng
2009-09-01
Coxsackievirus B3 (CVB3) is a common pathogen of myocarditis. We previously synthesized a siRNA targeting the CVB3 protease 2A (siRNA/2A) gene and achieved reduction of CVB3 replication by 92% in vitro. However, like other drugs under development, CVB3 siRNA faces a major challenge of targeted delivery. In this study, we investigated a novel approach to deliver CVB3 siRNAs to a specific cell population (e.g. HeLa cells containing folate receptor) using receptor ligand (folate)-linked packaging RNA (pRNA) from bacterial phage phi29. pRNA monomers can spontaneously form dimers and multimers under optimal conditions by base-pairing between their stem loops. By covalently linking a fluorescence-tag to folate, we delivered the conjugate specifically to HeLa cells without the need of transfection. We further demonstrated that pRNA covalently conjugated to siRNA/2A achieved an equivalent antiviral effect to that of the siRNA/2A alone. Finally, the drug targeted delivery was further evaluated by using pRNA monomers or dimers, which carried both the siRNA/2A and folate ligand and demonstrated that both of them strongly inhibited CVB3 replication. These data indicate that pRNA as a siRNA carrier can specifically deliver the drug to target cells via its ligand and specific receptor interaction and inhibit virus replication effectively.
-
Wei, Jie; Jones, Jeffrey; Kang, Jing; Card, Ananda; Krimm, Michael; Hancock, Paula; Pei, Yi; Ason, Brandon; Payson, Elmer; Dubinina, Natalya; Cancilla, Mark; Stroh, Mark; Burchard, Julja; Sachs, Alan B; Hochman, Jerome H; Flanagan, W Michael; Kuklin, Nelly A
2011-06-01
Deeper knowledge of pharmacokinetic and pharmacodynamic (PK/PD) concepts for RNA therapeutics is important to streamline the drug development process and for rigorous selection of best performing drug candidates. Here we characterized the PK/PD relationship for small interfering RNAs (siRNAs) targeting luciferase by examining siRNA concentration in plasma and liver, the temporal RNA-induced silencing complex binding profiles, mRNA reduction, and protein inhibition measured by noninvasive bioluminescent imaging. A dose-dependent and time-related decrease in bioluminescence was detected over 25 days after a single treatment of a lipid nanoparticle-formulated siRNA targeting luciferase messenger RNA. A direct relationship was observed between the degree of in vivo mRNA and protein reduction and the Argonaute2 (Ago2)-bound siRNA fraction but not with the total amount of siRNA found in the liver, suggesting that the Ago2-siRNA complex is the key determinant of target inhibition. These observations were confirmed for an additional siRNA that targets endogenously expressed Sjögren syndrome antigen B (Ssb) mRNA, indicating that our observations are not limited to a transgenic mouse system. Our data provide detailed information of the temporal regulation of siRNA liver delivery, Ago2 loading, mRNA reduction, and protein inhibition that are essential for the rapid and cost-effective clinical development of siRNAs therapeutics.
-
Robbins, Marjorie; Judge, Adam; MacLachlan, Ian
2009-06-01
Canonical small interfering RNA (siRNA) duplexes are potent activators of the mammalian innate immune system. The induction of innate immunity by siRNA is dependent on siRNA structure and sequence, method of delivery, and cell type. Synthetic siRNA in delivery vehicles that facilitate cellular uptake can induce high levels of inflammatory cytokines and interferons after systemic administration in mammals and in primary human blood cell cultures. This activation is predominantly mediated by immune cells, normally via a Toll-like receptor (TLR) pathway. The siRNA sequence dependency of these pathways varies with the type and location of the TLR involved. Alternatively nonimmune cell activation may also occur, typically resulting from siRNA interaction with cytoplasmic RNA sensors such as RIG1. As immune activation by siRNA-based drugs represents an undesirable side effect due to the considerable toxicities associated with excessive cytokine release in humans, understanding and abrogating this activity will be a critical component in the development of safe and effective therapeutics. This review describes the intracellular mechanisms of innate immune activation by siRNA, the design of appropriate sequences and chemical modification approaches, and suitable experimental methods for studying their effects, with a view toward reducing siRNA-mediated off-target effects.
-
Antibody mediated in vivo delivery of small interfering RNAs via cell-surface receptors.
Song, Erwei; Zhu, Pengcheng; Lee, Sang-Kyung; Chowdhury, Dipanjan; Kussman, Steven; Dykxhoorn, Derek M; Feng, Yi; Palliser, Deborah; Weiner, David B; Shankar, Premlata; Marasco, Wayne A; Lieberman, Judy
2005-06-01
Delivery of small interfering RNAs (siRNAs) into cells is a key obstacle to their therapeutic application. We designed a protamine-antibody fusion protein to deliver siRNA to HIV-infected or envelope-transfected cells. The fusion protein (F105-P) was designed with the protamine coding sequence linked to the C terminus of the heavy chain Fab fragment of an HIV-1 envelope antibody. siRNAs bound to F105-P induced silencing only in cells expressing HIV-1 envelope. Additionally, siRNAs targeted against the HIV-1 capsid gene gag, inhibited HIV replication in hard-to-transfect, HIV-infected primary T cells. Intratumoral or intravenous injection of F105-P-complexed siRNAs into mice targeted HIV envelope-expressing B16 melanoma cells, but not normal tissue or envelope-negative B16 cells; injection of F105-P with siRNAs targeting c-myc, MDM2 and VEGF inhibited envelope-expressing subcutaneous B16 tumors. Furthermore, an ErbB2 single-chain antibody fused with protamine delivered siRNAs specifically into ErbB2-expressing cancer cells. This study demonstrates the potential for systemic, cell-type specific, antibody-mediated siRNA delivery.
-
Erbb2 up-regulation of ADAM12 expression accelerates skin cancer progression.
Rao, Velidi H; Vogel, Kristen; Yanagida, Jodi K; Marwaha, Nitin; Kandel, Amrit; Trempus, Carol; Repertinger, Susan K; Hansen, Laura A
2015-10-01
Solar ultraviolet (UV) radiation can cause severe damage to the skin and is the primary cause of most skin cancer. UV radiation causes DNA damage leading to mutations and also activates the Erbb2/HER2 receptor through indirect mechanisms involving reactive oxygen species. We hypothesized that Erbb2 activation accelerates the malignant progression of UV-induced skin cancer. Following the induction of benign squamous papillomas by UV exposure of v-ras(Ha) transgenic Tg.AC mice, mice were treated topically with the Erbb2 inhibitor AG825 and tumor progression monitored. AG825 treatment reduced tumor volume, increased tumor regression, and delayed the development of malignant squamous cell carcinoma (SCC). Progression to malignancy was associated with increased Erbb2 and ADAM12 (A Disintegin And Metalloproteinase 12) transcripts and protein, while inhibition of Erbb2 blocked the increase in ADAM12 message upon malignant progression. Similarly, human SCC and SCC cell lines had increased ADAM12 protein and transcripts when compared to normal controls. To determine whether Erbb2 up-regulation of ADAM12 contributed to malignant progression of skin cancer, Erbb2 expression was modulated in cultured SCC cells using forced over-expression or siRNA targeting, demonstrating up-regulation of ADAM12 by Erbb2. Furthermore, ADAM12 transfection or siRNA targeting revealed that ADAM12 increased both the migration and invasion of cutaneous SCC cells. Collectively, these results suggest Erbb2 up-regulation of ADAM12 as a novel mechanism contributing to the malignant progression of UV-induced skin cancer. Inhibition of Erbb2/HER2 reduced tumor burden, increased tumor regression, and delayed the progression of benign skin tumors to malignant SCC in UV-exposed mice. Inhibition of Erbb2 suppressed the increase in metalloproteinase ADAM12 expression in skin tumors, which in turn increased migration and tumor cell invasiveness. © 2014 Wiley Periodicals, Inc.
-
Yang, Xinping; Lu, Hai; Yan, Bin; Romano, Rose-Anne; Bian, Yansong; Friedman, Jay; Duggal, Praveen; Allen, Clint; Chuang, Ryan; Ehsanian, Reza; Si, Han; Sinha, Satrajit; Van Waes, Carter; Chen, Zhong
2012-01-01
Head and neck squamous cell carcinoma (HNSCC) and many epithelial malignancies exhibit increased proliferation, invasion and inflammation, concomitant with aberrant nuclear activation of TP53 and NF-κB family members ΔNp63, c-REL and RELA. However, the mechanisms of crosstalk by which these transcription factors coordinate gene expression and the malignant phenotype remain elusive. Here we demonstrate thatΔNp63 regulates a cohort of genes involved in cell growth, survival, adhesion and inflammation, which substantially overlaps with the NF-κB transcriptome. ΔNp63 with c-REL and/or RELA are recruited to form novel binding complexes on p63 or NF-κB/REL sites of multiple target gene promoters. Overexpressed ΔNp63- or TNF-α-induced NF-κB and inflammatory cytokine IL-8 reporter activation depended upon RELA/c-REL regulatory binding sites. Depletion of RELA or ΔNp63 by siRNA significantly inhibited NF-κB-specific, or TNF-α-induced IL-8 reporter activation. ΔNp63 siRNA significantly inhibited proliferation, survival, and migration by HNSCC cells in vitro. Consistent with the above, an increase in nuclear ΔNp63 accompanied by increased proliferation (Ki67), and adhesion (β4 integrin) markers, and induced inflammatory cell infiltration was observed throughout HNSCC specimens, when compared to the basilar pattern of protein expression and minimal inflammation seen in non-malignant mucosa. Further, overexpression of ΔNp63α in squamous epithelia in transgenic mice leads to increased suprabasilar c-REL, Ki-67, and cytokine expression, together with epidermal hyperplasia and diffuse inflammation, similar to HNSCC. Our study reveals ΔNp63 as a master transcription factor that in coordination with NF-κB/RELs, orchestrates a broad gene program promoting epidermal hyperplasia, inflammation, and the malignant phenotype of HNSCC. PMID:21576089