Investigations in site response from ground motion observations in vertical arrays
NASA Astrophysics Data System (ADS)
Baise, Laurie Gaskins
The aim of the research is to improve the understanding of earthquake site response and to improve the techniques available to investigate issues in this field. Vertical array ground motion data paired with the empirical transfer function (ETF) methodology is shown to accurately characterize site response. This manuscript draws on methods developed in the field of signal processing and statistical time series analysis to parameterize the ETF as an autoregressive moving-average (ARMA) system which is justified theoretically, historically, and by example. Site response is evaluated at six sites in California, Japan, and Taiwan using ETF estimates, correlation analysis, and full waveform modeling. Correlation analysis is proposed as a required data quality evaluation imperative to any subsequent site response analysis. ETF estimates and waveform modeling are used to decipher the site response at sites with simple and complex geologic structure, which provide simple time-invariant and time-variant methods for evaluating both linear site transfer functions and nonlinear site response for sites experiencing liquefaction of the soils. The Treasure and Yerba Buena Island sites, however, require 2-D waveform modeling to accurately evaluate the effects of the shallow sedimentary basin. ETFs are used to characterize the Port Island site and corresponding shake table tests before, during, and after liquefaction. ETFs derived from the shake table tests were demonstrated to consistently predict the linear field ground response below 16 m depth and the liquefied behavior above 15 m depth. The liquefied interval response was demonstrated to gradually return to pre-liquefied conditions within several weeks of the 1995 Hyogo-ken Nanbu earthquake. Both the site's and the shake table test's response were shown to be effectively linear up to 0.5 g in the native materials below 16 m depth. The effective linearity of the site response at GVDA, Chiba, and Lotting up to 0.1 g, 0.33 g, and 0.49 g, respectively, further confirms that site response in the field may be more linear than expected from laboratory tests. Strong motions were predicted at these sites with normalized mean square error less than 0.10 using ETFs generated from weak motions. The Treasure Island site response was shown to be dominated by surface waves propagating in the shallow sediments of the San Francisco Bay. Low correlation of the ground motions recorded on rock at Yerba Buena Island and in rock beneath the Treasure Island site intimates that the Yerba Buena site is an inappropriate reference site for Treasure Island site response studies. Accurate simulation of the Treasure Island site response was achieved using a 2-D velocity structure comprised of a 100 m uniform soil basin (Vs = 400 m/s) over a weathered rock veneer (Vs = 1.5 km/s) to 200 m depth.
NASA Astrophysics Data System (ADS)
Molnar, S.; Cassidy, J. F.; Castellaro, S.; Cornou, C.; Crow, H.; Hunter, J. A.; Matsushima, S.; Sánchez-Sesma, F. J.; Yong, A.
2018-03-01
Nakamura (Q Rep Railway Tech Res Inst 30:25-33, 1989) popularized the application of the horizontal-to-vertical spectral ratio (HVSR) analysis of microtremor (seismic noise or ambient vibration) recordings to estimate the predominant frequency and amplification factor of earthquake shaking. During the following quarter century, popularity in the microtremor HVSR (MHVSR) method grew; studies have verified the stability of a site's MHVSR response over time and validated the MHVSR response with that of earthquake HVSR response. Today, MHVSR analysis is a popular reconnaissance tool used worldwide for seismic microzonation and earthquake site characterization in numerous regions, specifically, in the mapping of site period or fundamental frequency and inverted for shear-wave velocity depth profiles, respectively. However, the ubiquity of MHVSR analysis is predominantly a consequence of its ease in application rather than our full understanding of its theory. We present the state of the art in MHVSR analyses in terms of the development of its theoretical basis, current state of practice, and we comment on its future for applications in earthquake site characterization.
NASA Astrophysics Data System (ADS)
Molnar, S.; Cassidy, J. F.; Castellaro, S.; Cornou, C.; Crow, H.; Hunter, J. A.; Matsushima, S.; Sánchez-Sesma, F. J.; Yong, A.
2018-07-01
Nakamura (Q Rep Railway Tech Res Inst 30:25-33, 1989) popularized the application of the horizontal-to-vertical spectral ratio (HVSR) analysis of microtremor (seismic noise or ambient vibration) recordings to estimate the predominant frequency and amplification factor of earthquake shaking. During the following quarter century, popularity in the microtremor HVSR (MHVSR) method grew; studies have verified the stability of a site's MHVSR response over time and validated the MHVSR response with that of earthquake HVSR response. Today, MHVSR analysis is a popular reconnaissance tool used worldwide for seismic microzonation and earthquake site characterization in numerous regions, specifically, in the mapping of site period or fundamental frequency and inverted for shear-wave velocity depth profiles, respectively. However, the ubiquity of MHVSR analysis is predominantly a consequence of its ease in application rather than our full understanding of its theory. We present the state of the art in MHVSR analyses in terms of the development of its theoretical basis, current state of practice, and we comment on its future for applications in earthquake site characterization.
A Parametric Study of Nonlinear Seismic Response Analysis of Transmission Line Structures
Wang, Yanming; Yi, Zhenhua
2014-01-01
A parametric study of nonlinear seismic response analysis of transmission line structures subjected to earthquake loading is studied in this paper. The transmission lines are modeled by cable element which accounts for the nonlinearity of the cable based on a real project. Nonuniform ground motions are generated using a stochastic approach based on random vibration analysis. The effects of multicomponent ground motions, correlations among multicomponent ground motions, wave travel, coherency loss, and local site on the responses of the cables are investigated using nonlinear time history analysis method, respectively. The results show the multicomponent seismic excitations should be considered, but the correlations among multicomponent ground motions could be neglected. The wave passage effect has a significant influence on the responses of the cables. The change of the degree of coherency loss has little influence on the response of the cables, but the responses of the cables are affected significantly by the effect of coherency loss. The responses of the cables change little with the degree of the difference of site condition changing. The effect of multicomponent ground motions, wave passage, coherency loss, and local site should be considered for the seismic design of the transmission line structures. PMID:25133215
Hubley-Kozey, Cheryl L; Butler, Heather L; Kozey, John W
2012-08-01
Muscle synergies are important for spinal stability, but few studies examine temporal responses of spinal muscles to dynamic perturbations. This study examined activation amplitudes and temporal synergies among compartments of the back extensor and among abdominal wall muscles in response to dynamic bidirectional moments of force. We further examined whether responses were different between men and women. 19 women and 18 men performed a controlled transfer task. Surface electromyograms from bilateral sites over 6 back extensor compartments and 6 abdominal wall muscle sites were analyzed using principal component analysis. Key features were extracted from the measured electromyographic waveforms capturing amplitude and temporal variations among muscle sites. Three features explained 97% of the variance. Scores for each feature were computed for each measured waveform and analysis of variance found significant (p<.05) muscle main effects and a sex by muscle interaction. For the back extensors, post hoc analysis revealed that upper and more medial sites were recruited to higher amplitudes, medial sites responded to flexion moments, and the more lateral sites responded to lateral flexion moments. Women had more differences among muscle sites than men for the lateral flexion moment feature. For the abdominal wall muscles the oblique muscles responded with synergies related to fiber orientation, with women having higher amplitudes and more responsiveness to the lateral flexion moment than men. Synergies between the abdominal and back extensor sites as the moment demands change are discussed. These findings illustrate differential activation among erector spinae compartments and abdominal wall muscle sites supporting a highly organized pattern of response to bidirectional external moments with asynchronies more apparent in women. Copyright © 2012 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Chandran, Deepu; Anbazhagan, P.
2017-10-01
Recently, site response analysis has become a mandatory step for the design of important structures. Subsurface investigation is an essential step, from where the input parameters for the site response study like density, shear wave velocity (Vs), thickness and damping characteristics, etc, are obtained. Most site response studies at shallow bedrock sites are one-dimensional (1D) and are usually carried out by using Vs from multi-channel analysis of surface waves (MASW) or a standard penetration test (SPT) for N values with assumptions that soil layers are horizontal, uniform and homogeneous. These assumptions are not completely true in shallow bedrock regions as soil deposits are heterogeneous. The objective of this study is to generate the actual subsurface profiles in two-dimensions at shallow bedrock regions using integrated subsurface investigation testing. The study area selected for this work is Bangalore, India. Three survey lines were selected in Bangalore at two different locations; one at the Indian Institute of Science (IISc) Campus and the other at Whitefield. Geophysical surveys like ground penetrating radar (GPR) and 2D MASW were carried out at these survey lines. Geophysical test results are compared and validated with a conventional geotechnical SPT. At the IISc site, the soil profile is obtained from a trench excavated for a proposed pipeline used to compare the geophysical test results. Test results show that GPR is very useful to delineate subsurface layers, especially for shallow depths at both sites (IISc Campus and Whitefield). MASW survey results show variation of Vs values and layer thickness comparatively at deeper depths for both sites. They also show higher density soil strata with high Vs value obtained at the IISc Campus site, whereas at the Whitefield site weaker soil with low shear velocity is observed. Combining these two geophysical methods helped to generate representative 2D subsurface profiles. These subsurface profiles can be further used to understand the difference between 1D and 2D site response.
Zimmermann, Michael T; Oberg, Ann L; Grill, Diane E; Ovsyannikova, Inna G; Haralambieva, Iana H; Kennedy, Richard B; Poland, Gregory A
2016-01-01
Failure to achieve a protected state after influenza vaccination is poorly understood but occurs commonly among aged populations experiencing greater immunosenescence. In order to better understand immune response in the elderly, we studied epigenetic and transcriptomic profiles and humoral immune response outcomes in 50-74 year old healthy participants. Associations between DNA methylation and gene expression reveal a system-wide regulation of immune-relevant functions, likely playing a role in regulating a participant's propensity to respond to vaccination. Our findings show that sites of methylation regulation associated with humoral response to vaccination impact known cellular differentiation signaling and antigen presentation pathways. We performed our analysis using per-site and regionally average methylation levels, in addition to continuous or dichotomized outcome measures. The genes and molecular functions implicated by each analysis were compared, highlighting different aspects of the biologic mechanisms of immune response affected by differential methylation. Both cis-acting (within the gene or promoter) and trans-acting (enhancers and transcription factor binding sites) sites show significant associations with measures of humoral immunity. Specifically, we identified a group of CpGs that, when coordinately hypo-methylated, are associated with lower humoral immune response, and methylated with higher response. Additionally, CpGs that individually predict humoral immune responses are enriched for polycomb-group and FOXP2 transcription factor binding sites. The most robust associations implicate differential methylation affecting gene expression levels of genes with known roles in immunity (e.g. HLA-B and HLA-DQB2) and immunosenescence. We believe our data and analysis strategy highlight new and interesting epigenetic trends affecting humoral response to vaccination against influenza; one of the most common and impactful viral pathogens.
Jianwei Zhang; Robert Powers; William Oliver; Young David
2013-01-01
A meta-analysis was performed to determine response of stand basal area growth to competing vegetation control (CVC) in ponderosa pine (Pinus ponderosa) plantations grown at 29 sites across northern California. These studies were installed during the last 50 years on site indices from 11 to 35 m at 50 years and often included other treatments...
Molnar, S.; Cassidy, J. F.; Castellaro, S.; Cornou, C.; Crow, H.; Hunter, J. A.; Matsushima, S.; Sanchez-Sesma, F. J.; Yong, Alan
2018-01-01
Nakamura (Q Rep Railway Tech Res Inst 30:25–33, 1989) popularized the application of the horizontal-to-vertical spectral ratio (HVSR) analysis of microtremor (seismic noise or ambient vibration) recordings to estimate the predominant frequency and amplification factor of earthquake shaking. During the following quarter century, popularity in the microtremor HVSR (MHVSR) method grew; studies have verified the stability of a site’s MHVSR response over time and validated the MHVSR response with that of earthquake HVSR response. Today, MHVSR analysis is a popular reconnaissance tool used worldwide for seismic microzonation and earthquake site characterization in numerous regions, specifically, in the mapping of site period or fundamental frequency and inverted for shear-wave velocity depth profiles, respectively. However, the ubiquity of MHVSR analysis is predominantly a consequence of its ease in application rather than our full understanding of its theory. We present the state of the art in MHVSR analyses in terms of the development of its theoretical basis, current state of practice, and we comment on its future for applications in earthquake site characterization.
DOT National Transportation Integrated Search
2008-12-01
Shortly after the 1994 Northridge Earthquake, Caltrans geotechnical engineers charged with developing site-specific : response spectra for high priority California bridges initiated a research project aimed at broadening their perspective : from simp...
NASA Technical Reports Server (NTRS)
Butera, M. K.
1983-01-01
The correlation of canopy closure with the signal response of individual thematic mapper simulator (TMS) bands for selected forest sites in the San Juan National Forest, Colorado was investigated. Ground truth consisted of a photointerpreted determination of percent canopy closure of 0 to 100 percent for 32 sites. The sites selected were situated on plateaus at an elevation of approximately 3 km with slope or = 10 percent. The predominant tree species were ponderosa pine and aspen. The mean TMS response per band per site was calculated from data acquired by aircraft during mid-September, 1981. A correlation analysis of TMS response vs. canopy closure resulted in the following correlation coefficients for bands 1 through 7, respectively: -0.757, -0.663, -0.666, -0.088, -0.797, -0.763. Two model regressions were applied to the TMS data set to create a map of predicted percent forest canopy closure for the study area. Results indicated percent predictive accuracies of 71, 74, and 57 for percent canopy closure classes of 0-25, 25-75, and 75-100, respectively.
How Japanese students characterize information from web-sites.
Iwahara, A; Yamada, M; Hatta, T; Kawakami, A; Okamoto, M
2000-12-01
How 352 Japanese university students regard web-site information was investigated by two kinds of survey. Application of correspondence analysis and cluster analysis to the questionnaire responses to the web-site advertisement showed students regarded a web-site as a new alien medium which is different from current media. Students regarded web-sites as simply complicated, intellectual, and impermanent, or not memorable. Students got precise information from web-sites but they did not use it in making decisions to purchase goods.
Biphasic responses in multi-site phosphorylation systems.
Suwanmajo, Thapanar; Krishnan, J
2013-12-06
Multi-site phosphorylation systems are repeatedly encountered in cellular biology and multi-site modification is a basic building block of post-translational modification. In this paper, we demonstrate how distributive multi-site modification mechanisms by a single kinase/phosphatase pair can lead to biphasic/partial biphasic dose-response characteristics for the maximally phosphorylated substrate at steady state. We use simulations and analysis to uncover a hidden competing effect which is responsible for this and analyse how it may be accentuated. We build on this to analyse different variants of multi-site phosphorylation mechanisms showing that some mechanisms are intrinsically not capable of displaying this behaviour. This provides both a consolidated understanding of how and under what conditions biphasic responses are obtained in multi-site phosphorylation and a basis for discriminating between different mechanisms based on this. We also demonstrate how this behaviour may be combined with other behaviour such as threshold and bistable responses, demonstrating the capacity of multi-site phosphorylation systems to act as complex molecular signal processors.
Instantaneous polarization analysis of ambient noise recordings in site response investigations
NASA Astrophysics Data System (ADS)
Del Gaudio, Vincenzo
2017-07-01
A new procedure is proposed for analyses of ambient noise aimed at investigating complex cases of site response to seismic shaking. Information on site response characterized by several resonance frequencies and by amplifications varying with direction can be obtained by analysing instantaneous polarization properties of ambient noise recordings. Through this kind of analysis, it is possible to identify Rayleigh wave packets emerging from incoherent background noise for very short intervals. Analysing noise recordings passed through narrow-band filters with different central frequencies, variations of Rayleigh wave properties depending on frequencies can be estimated. In particular, one can calculate: (i) the instantaneous ratios H/V between the amplitudes of horizontal and vertical components of the elliptical particle motion and (ii) the azimuthal direction of the vertical plane containing such a motion. These can be determined on a large number of recording samples, providing the basis for statistical estimates. A preferential concentration of H/V peak values at site-specific frequencies and directions can reveal directional resonance phenomena. Furthermore, peak amplitudes can be related to site amplification factors and provide constraints for subsurface velocity modelling. Some tests, carried out on data acquired at sites with known response properties, gave indications on how to select the parameters of the analysis that optimize its implementation. In particular, preliminary trials, conducted on a limited number of frequencies, allow the selection of the parameters that, while providing a large number of instantaneous H/V estimates for Rayleigh waves, minimize their scattering. The analysis can then be refined and an H/V curve as function of frequency can be obtained with a higher spectral resolution. First tests showed that cases of directional resonance can be more effectively recognized with this technique and more details can be revealed on its properties (e.g. secondary peaks) in comparison to the Nakamura's method currently employed for ordinary noise analysis. For sites characterized by isotropic response or by differently oriented directional maxima, however, the presence of noise sources with an anisotropic spatial distribution, which excite signals with inhomogeneous distribution of energy through the examined spectral band, can make the correct interpretation of data more difficult.
An alternative approach to characterize nonlinear site effects
Zhang, R.R.; Hartzell, S.; Liang, J.; Hu, Y.
2005-01-01
This paper examines the rationale of a method of nonstationary processing and analysis, referred to as the Hilbert-Huang transform (HHT), for its application to a recording-based approach in quantifying influences of soil nonlinearity in site response. In particular, this paper first summarizes symptoms of soil nonlinearity shown in earthquake recordings, reviews the Fourier-based approach to characterizing nonlinearity, and offers justifications for the HHT in addressing nonlinearity issues. This study then uses the HHT method to analyze synthetic data and recordings from the 1964 Niigata and 2001 Nisqually earthquakes. In doing so, the HHT-based site response is defined as the ratio of marginal Hilbert amplitude spectra, alternative to the Fourier-based response that is the ratio of Fourier amplitude spectra. With the Fourier-based approach in studies of site response as a reference, this study shows that the alternative HHT-based approach is effective in characterizing soil nonlinearity and nonlinear site response.
Radioimmunoassays and 2-site immunoradiometric "sandwich" assays: basic principles.
Rodbard, D
1988-10-01
The "sandwich" or noncompetitive reagent-excess, 2-site immunoradiometric assay (2-site IRMA), ELISA, USERIA, and related techniques, have several advantages compared with the traditional or competitive radioimmunoassays. IRMAs can provide improved sensitivity and specificity. However, IRMAs present some practical problems with nonspecific binding, increased consumption of antibody, biphasic dose response curve, (high dose hook effect), and may require special techniques for dose response curve analysis. We anticipate considerable growth in the popularity and importance of 2-site IRMA.
75 FR 36715 - Advisory Committee on Reactor Safeguards; Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2010-06-28
... Seismic Input for Site Response and Soil Structure Interaction Analyses'' (Open)--The Committee will hold... Seismic Input for Site Response and Soil Structure Interaction Analyses.'' 9:30 a.m.-10:30 a.m.: Interim Staff Guidance (ISG) DC/COL-ISG-020, ``Implementation of Seismic Margin Analysis for New Reactors Based...
Statistical and Economic Techniques for Site-specific Nematode Management.
Liu, Zheng; Griffin, Terry; Kirkpatrick, Terrence L
2014-03-01
Recent advances in precision agriculture technologies and spatial statistics allow realistic, site-specific estimation of nematode damage to field crops and provide a platform for the site-specific delivery of nematicides within individual fields. This paper reviews the spatial statistical techniques that model correlations among neighboring observations and develop a spatial economic analysis to determine the potential of site-specific nematicide application. The spatial econometric methodology applied in the context of site-specific crop yield response contributes to closing the gap between data analysis and realistic site-specific nematicide recommendations and helps to provide a practical method of site-specifically controlling nematodes.
Lee, Jae Hoon; Kim, Joon Ha; Oh, Hee-Mock; An, Kwang-Guk
2013-01-01
The objectives of this study were to identify multi-level stressors at the DNA/biochemical level to the community level in fish in an urban stream and to develop an integrative health response (IHR) model for ecological health diagnosis. A pristine control site (S (c) ) and an impacted site (S (i) ) were selected from among seven pre-screened sites studied over seven years. Various chemical analyses indicated that nutrient enrichment (Nitrogen, Phosphorus) and organic pollution were significantly greater (t > 8.783, p < 0.01) at the S (i) site compared to the S (c) site. Single-cell gel electrophoresis (comet assays) of DNA-level impairment indicated significantly (t = 5.678, p < 0.01) greater tail intensity, expressed as % tail-DNA, at the S (i) site and genotoxic responses were detected in the downstream reach. Ethoxyresorufin-O-deethylase (EROD) assays, as a physiological bioindicator, were 2.8-fold higher (p < 0.05, NK-test after ANOVA) at the S (i) site. Tissue analysis using a necropsy-based health assessment index (NHAI) showed distinct internal organ disorders in three tissues, i.e., liver, kidney, and gill, at the S (i) site. Population-level analysis using the sentinel species Zacco platypus showed that the regression coefficient (b) was 3.012 for the S (i) site and 2.915 for the S (c) site, indicating population skewness in the downstream reach. Community-level health was impaired at the S (i) site based on an index of biological integrity (IBI), and physical habitat modifications were identified by a qualitative habitat evaluation index (QHEI). Overall, the model values for the integrative health response (IHR), developed using the star plot approach, were 3.22 (80.5%) at the S (c) site and 0.74 (18.5%) at the S (i) site, indicating that, overall, ecological health impairments were evident in the urban reach. Our study was based on multi-level approaches using biological organization and the results suggest that there is a pivotal point of linkage between mechanistic understanding and real ecological consequences of environmental stressors.
NASA Technical Reports Server (NTRS)
Grave, C.; Margold, D. W.
1973-01-01
Site selection, program planning, cost and design studies for support of the IMBLMS program were investigated. Accomplishments are reported for the following areas: analysis of responses to site selection criteria, space-oriented biotechnology, life sciences payload definition, and program information transfer.
A case study of alternative site response explanatory variables in Parkfield, California
Thompson, E.M.; Baise, L.G.; Kayen, R.E.; Morgan, E.C.; Kaklamanos, J.
2011-01-01
The combination of densely-spaced strong-motion stations in Parkfield, California, and spectral analysis of surface waves (SASW) profiles provides an ideal dataset for assessing the accuracy of different site response explanatory variables. We judge accuracy in terms of spatial coverage and correlation with observations. The performance of the alternative models is period-dependent, but generally we observe that: (1) where a profile is available, the square-root-of-impedance method outperforms VS30 (average S-wave velocity to 30 m depth), and (2) where a profile is unavailable, the topographic-slope method outperforms surficial geology. The fundamental site frequency is a valuable site response explanatory variable, though less valuable than VS30. However, given the expense and difficulty of obtaining reliable estimates of VS30 and the relative ease with which the fundamental site frequency can be computed, the fundamental site frequency may prove to be a valuable site response explanatory variable for many applications. ?? 2011 ASCE.
A Design Analysis Model for Developing World Wide Web Sites.
ERIC Educational Resources Information Center
Ma, Yan
2002-01-01
Examines the relationship between and among designers, text, and users of the Galter Health Sciences Library Web site at Northwestern University by applying reader-response criticism. Highlights include Web site design; comparison of designers' intentions with the actual organization of knowledge on the Web site; and compares designer's intentions…
Nonlinear site response in medium magnitude earthquakes near Parkfield, California
Rubinstein, Justin L.
2011-01-01
Careful analysis of strong-motion recordings of 13 medium magnitude earthquakes (3.7 ≤ M ≤ 6.5) in the Parkfield, California, area shows that very modest levels of shaking (approximately 3.5% of the acceleration of gravity) can produce observable changes in site response. Specifically, I observe a drop and subsequent recovery of the resonant frequency at sites that are part of the USGS Parkfield dense seismograph array (UPSAR) and Turkey Flat array. While further work is necessary to fully eliminate other models, given that these frequency shifts correlate with the strength of shaking at the Turkey Flat array and only appear for the strongest shaking levels at UPSAR, the most plausible explanation for them is that they are a result of nonlinear site response. Assuming this to be true, the observation of nonlinear site response in small (M M 6.5 San Simeon earthquake and the 2004 M 6 Parkfield earthquake).
Ghisi, Nédia C; Oliveira, Elton C; Mendonça Mota, Thais F; Vanzetto, Guilherme V; Roque, Aliciane A; Godinho, Jayson P; Bettim, Franciele Lima; Silva de Assis, Helena Cristina da; Prioli, Alberto J
2016-10-01
Aquatic pollutants produce multiple consequences in organisms, populations, communities and ecosystems, affecting the function of organs, reproductive state, population size, species survival and even biodiversity. In order to monitor the health of aquatic organisms, biomarkers have been used as effective tools in environmental risk assessment. The aim of this study is to evaluate, through a multivariate and integrative analysis, the response of the native species Hypostomus ancistroides over a pollution gradient in the main water supply body of northwestern Paraná state (Brazil). The condition factor, micronucleus test and erythrocyte nuclear abnormalities (ENA), comet assay, measurement of the cerebral and muscular enzyme acetylcholinesterase (AChE), and histopathological analysis of liver and gill were evaluated in fishes from three sites of the Pirapó River during the dry and rainy seasons. The multivariate general result showed that the interaction between the seasons and the sites was significant: there are variations in the rates of alterations in the biological parameters, depending on the time of year researched at each site. In general, the best results were observed for the site nearest the spring, and alterations in the parameters at the intermediate and downstream sites. In sum, the results of this study showed the necessity of a multivariate analysis, evaluating several biological parameters, to obtain an integrated response to the effects of the environmental pollutants on the organisms. Copyright © 2016 Elsevier Ltd. All rights reserved.
A Hierarchical Analysis of Tree Growth and Environmental Drivers Across Eastern US Temperate Forests
NASA Astrophysics Data System (ADS)
Mantooth, J.; Dietze, M.
2014-12-01
Improving predictions of how forests in the eastern United States will respond to future global change requires a better understanding of the drivers of variability in tree growth rates. Current inventory data lack the temporal resolution to characterize interannual variability, while existing growth records lack the extent required to assess spatial scales of variability. Therefore, we established a network of forest inventory plots across ten sites across the eastern US, and measured growth in adult trees using increment cores. Sites were chosen to maximize climate space explored, while within sites, plots were spread across primary environmental gradients to explore landscape-level variability in growth. Using the annual growth record available from tree cores, we explored the responses of trees to multiple environmental covariates over multiple spatial and temporal scales. We hypothesized that within and across sites growth rates vary among species, and that intraspecific growth rates increase with temperature along a species' range. We also hypothesized that trees show synchrony in growth responses to landscape-scale climatic changes. Initial analyses of growth increments indicate that across sites, trees with intermediate shade tolerance, e.g. Red Oak (Quercus rubra), tend to have the highest growth rates. At the site level, there is evidence for synchrony in response to large-scale climatic events (e.g. prolonged drought and above average temperatures). However, growth responses to climate at the landscape scale have yet to be detected. Our current analysis utilizes hierarchical Bayesian state-space modeling to focus on growth responses of adult trees to environmental covariates at multiple spatial and temporal scales. This predictive model of tree growth currently incorporates observed effects at the individual, plot, site, and landscape scale. Current analysis using this model shows a potential slowing of growth in the past decade for two sites in the northeastern US (Harvard Forest and Bartlett Experimental Forest), however more work is required to determine the robustness of this trend. Finally, these observations are being incorporated into ecosystem models using the Brown Dog informatics tools and the Predictive Ecosystem Analyzer (PEcAn) data assimilation workflow.
Interim Draft: Biological Sampling and Analysis Plan Outline ...
Standard Operation Procedures This interim sampling and analysis plan (SAP) outline was developed specifically as an outline of the output that will be generated by a developing on-line tool called the MicroSAP. The goal of the MicroSAP tool is to assist users with development of SAPs needed for site characterization, verification sampling, and post decontamination sampling stages of biological sampling and analysis activities in which the EPA would be responsible for conducting sampling. These activities could include sampling and analysis for a biological contamination incident, a research study, or an exercise. The development of this SAP outline did not consider the initial response of an incident, as it is assumed that the initial response would have been previously completed by another agency during the response, or the clearance phase, as it is assumed that separate committee would be established to make decisions regarding clearing a site. This outline also includes considerations for capturing the associated data quality objectives in the SAP.
NASA Astrophysics Data System (ADS)
Del Gaudio, Vincenzo; Wasowski, Janusz
2016-04-01
In the last few decades, we have witnessed a growing awareness of the role of site dynamic response to seismic shaking in slope failures during earthquakes. Considering the time and costs involved in acquiring accelerometer data on landslide prone slopes, the analysis of ambient noise offers a profitable investigative alternative. Standard procedures of ambient noise analysis, according to the technique known as HVNR or Nakamura's method, were originally devised to interpret data under simple site conditions similar to 1D layering (flat horizontal layering infinitely extended). In such cases, conditions of site amplification, characterized by a strong impedance contrast between a soft surface layer and a stiff bedrock, result in a single pronounced isotropic maximum of spectral ratios between horizontal and vertical component of ambient noise. However, previous studies have shown that the dynamic response of slopes affected by landslides is rather complex, being characterized by multiple resonance peaks with directional variability, thus, the use of standard techniques can encounter difficulties in providing reliable information. A new approach of data analysis has recently been proposed to exploit the potential of information content of Rayleigh waves present in ambient noise, with regard to the identification of frequency and orientation of directional resonance. By exploiting ground motion ellipticity this approach can also provide information on vertical distribution of S-wave velocity, which controls site amplification factors. The method, based on the identification of Rayleigh wave packets from instantaneous polarization properties of ambient noise, was first tested using synthetic signals in order to optimize the data processing system. Then the improved processing scheme is adopted to re-process and re-interpret the ambient noise data acquired on landslide prone slopes around Caramanico Terme (central Italy), at sites monitored also with accelerometer stations. The comparison of ambient noise analysis results with the outcomes of accelerometer monitoring reveals potential and limits of the new method for the investigations on slope dynamic response.
NASA Astrophysics Data System (ADS)
Cramer, C. H.; Dhar, M. S.
2017-12-01
The influence of deep sediment deposits of the Mississippi Embayment (ME) on the propagation of seismic waves is poorly understood and remains a major source of uncertainty for site response analysis. Many researchers have studied the effects of these deposits on seismic hazard of the area using available information at the time. In this study, we have used updated and newly available resources for seismic and liquefaction hazard analyses of the ME. We have developed an improved 3D geological model. Additionally, we used surface geological maps from Cupples and Van Arsdale (2013) to prepare liquefaction hazard maps. Both equivalent linear and nonlinear site response codes were used to develop site amplification distributions for use in generating hazard maps. The site amplification distributions are created using the Monte Carlo approach of Cramer et al. (2004, 2006) on a 0.1-degree grid. The 2014 National Seismic Hazard model and attenuation relations (Petersen et al., 2014) are used to prepare seismic hazard maps. Then liquefaction hazard maps are generated using liquefaction probability curves from Holzer (2011) and Cramer et al. (2015). Equivalent linear response (w/ increased precision, restricted nonlinear behavior with depth) shows similar hazard for the ME compared to nonlinear analysis (w/o pore pressure) results. At short periods nonlinear deamplification dominates the hazard, but at long periods resonance amplification dominates. The liquefaction hazard tends to be high in Holocene and late Pleistocene lowland sediments, even with lowered ground water levels, and low in Pleistocene loess of the uplands. Considering pore pressure effects in nonlinear site response analysis at a test site on the lowlands shows amplification of ground motion at short periods. PGA estimates from ME liquefaction and MMI observations are in the 0.25 to 0.4 g range. Our estimated M7.5 PGA hazard within 10 km of the fault can exceed this. Ground motion observations from liquefaction sites in New Zealand and Japan support PGAs below 0.4 g, except at sites within 20 km exhibiting pore-pressure induced acceleration spikes due to cyclic mobility where PGA ranges from 0.5 to 1.5 g. This study is being extended to more detailed seismic and liquefaction hazard studies in five western Tennessee counties under a five year grant from HUD.
Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S
2000-06-01
17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.
CADDIS Volume 4. Data Analysis: Selecting an Analysis Approach
An approach for selecting statistical analyses to inform causal analysis. Describes methods for determining whether test site conditions differ from reference expectations. Describes an approach for estimating stressor-response relationships.
NASA Astrophysics Data System (ADS)
Gunawan, I.; Cummins, P. R.; Ghasemi, H.; Suhardjono, S.
2012-12-01
Indonesia is very prone to natural disasters, especially earthquakes, due to its location in a tectonically active region. In September-October 2009 alone, intraslab and crustal earthquakes caused the deaths of thousands of people, severe infrastructure destruction and considerable economic loss. Thus, both intraslab and crustal earthquakes are important sources of earthquake hazard in Indonesia. Analysis of response spectra for these intraslab and crustal earthquakes are needed to yield more detail about earthquake properties. For both types of earthquakes, we have analysed available Indonesian seismic waveform data to constrain source and path parameters - i.e., low frequency spectral level, Q, and corner frequency - at reference stations that appear to be little influenced by site response.. We have considered these analyses for the main shocks as well as several aftershocks. We obtain corner frequencies that are reasonably consistent with the constant stress drop hypothesis. Using these results, we consider using them to extract information about site response form other stations form the Indonesian strong motion network that appear to be strongly affected by site response. Such site response data, as well as earthquake source parameters, are important for assessing earthquake hazard in Indonesia.
Melo-Braga, Marcella N.; Verano-Braga, Thiago; León, Ileana R.; Antonacci, Donato; Nogueira, Fábio C. S.; Thelen, Jay J.; Larsen, Martin R.; Palmisano, Giuseppe
2012-01-01
Grapevine (Vitis vinifera) is an economically important fruit crop that is subject to many types of insect and pathogen attack. To better elucidate the plant response to Lobesia botrana pathogen infection, we initiated a global comparative proteomic study monitoring steady-state protein expression as well as changes in N-glycosylation, phosphorylation, and Lys-acetylation in control and infected mesocarp and exocarp from V. vinifera cv Italia. A multi-parallel, large-scale proteomic approach employing iTRAQ labeling prior to three peptide enrichment techniques followed by tandem mass spectrometry led to the identification of a total of 3059 proteins, 1135 phosphorylation sites, 323 N-linked glycosylation sites and 138 Lys-acetylation sites. Of these, we could identify changes in abundance of 899 proteins. The occupancy of 110 phosphorylation sites, 10 N-glycosylation sites and 20 Lys-acetylation sites differentially changed during L. botrana infection. Sequence consensus analysis for phosphorylation sites showed eight significant motifs, two of which containing up-regulated phosphopeptides (X-G-S-X and S-X-X-D) and two containing down-regulated phosphopeptides (R-X-X-S and S-D-X-E) in response to pathogen infection. Topographical distribution of phosphorylation sites within primary sequences reveal preferential phosphorylation at both the N- and C termini, and a clear preference for C-terminal phosphorylation in response to pathogen infection suggesting induction of region-specific kinase(s). Lys-acetylation analysis confirmed the consensus X-K-Y-X motif previously detected in mammals and revealed the importance of this modification in plant defense. The importance of N-linked protein glycosylation in plant response to biotic stimulus was evident by an up-regulated glycopeptide belonging to the disease resistance response protein 206. This study represents a substantial step toward the understanding of protein and PTMs-mediated plant-pathogen interaction shedding light on the mechanisms underlying the grape infection. PMID:22778145
Physiological Analysis of Phototropic Responses in Arabidopsis.
Zeidler, Mathias
2016-01-01
Plants utilize light as sole energy source. To maximize light capture they are able to detect the light direction and orient themselves towards the light source. This phototropic response is mediated by the plant blue light photoreceptors phototropin1 and 2 (phot1 and phot2). Although fully differentiated plants also exhibit this response it can be best observed in etiolated seedlings. Differences in light between the illuminated and shaded site of a seedling stem lead to changes in the auxin-distribution, resulting in cell elongation on the shaded site. Since phototropism connects light perception, signaling, and auxin transport, it is of great interest to analyze this response with a fast and simple method.Here we describe a method to analyze the phototropic response of Arabidopsis seedlings. With numerous mutants available, its fast germination and its small size Arabidopsis is well suited for this analysis. Different genotypes can be simultaneously probed in less than a week.
Tanks Focus Area site needs assessment FY 1998
DOE Office of Scientific and Technical Information (OSTI.GOV)
NONE
This report documents the process used by the Tanks Focus Area (TFA) to analyze and develop responses to technology needs submitted by four major US Department of Energy (DOE) sites with radioactive tank waste problems, and the initial results of the analysis. The sites are the Hanford Site, Idaho National Engineering and Environmental Laboratory (INEEL), Oak Ridge Reservation (ORR), and Savannah River Site (SRS). This document describes the TFA`s process of collecting site needs, analyzing them, and creating technical responses to the sites. It also summarizes the information contained within the TFA needs database, portraying information provided by four majormore » DOE sites with tank waste problems. The overall TFA program objective is to deliver a tank technology program that reduces the current cost, and the operational and safety risks of tank remediation. The TFA`s continues to enjoy close, cooperative relationships with each site. During the past year, the TFA has fostered exchanges of technical information between sites. These exchanges have proven to be healthy for all concerned. The TFA recognizes that site technology needs often change, and the TFA must be prepared not only to amend its program in response, but to help the sites arrive at the best technical approach to solve revised site needs.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
MacDonell, M.M.; Peterson, J.M.
1991-11-01
The US Department of Energy, under its Surplus Facilities Management Program (SFMP), is responsible for cleanup activities at the Weldon Spring site, located near Weldon Spring, Missouri. The site consists of two noncontiguous areas: (1) a raffinate pits and chemical plant area and (2) a quarry. This engineering evaluation/cost analysis (EE/CA) report has been prepared to support a proposed removal action to manage 15 nonprocess buildings, identified as the 15 Series buildings, at the chemical plant on the Weldon Spring site. These buildings have been nonoperational for more than 20 years, and the deterioration that has occurred during this timemore » has resulted in a potential threat to site workers, the general public, and the environment. The EE/CA documentation of this proposed action is consistent with guidance from the US Environmental Protection Agency (EPA) that addresses removal actions at sites subject to the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) of 1980, as amended by the Superfund Amendments and Reauthorization Act of 1986. Actions at the Weldon Spring site are subject to CERCLA requirements because the site is on the EPA`s National Priorities List. The objectives of this report are to (1) identify alternatives for management of the nonprocess buildings; (2) document the selection of response activities that will mitigate the potential threat to workers, the public, and the environment associated with these buildings; and (3) address environmental impact associated with the proposed action.« less
Cartee, Lianne A; Miller, Charles A; van den Honert, Chris
2006-05-01
To determine the site of excitation on the spiral ganglion cell in response to electrical stimulation similar to that from a cochlear implant, single-fiber responses to electrical stimuli delivered by an electrode positioned in the scala tympani were compared to responses from stimuli delivered by an electrode placed in the internal auditory meatus. The response to intrameatal stimulation provided a control set of data with a known excitation site, the central axon of the spiral ganglion cell. For both intrameatal and scala tympani stimuli, the responses to single-pulse, summation, and refractory stimulus protocols were recorded. The data demonstrated that summation pulses, as opposed to single pulses, are likely to give the most insightful measures for determination of the site of excitation. Single-fiber summation data for both scala tympani and intrameatally stimulated fibers were analyzed with a clustering algorithm. Combining cluster analysis and additional numerical modeling data, it was hypothesized that the scala tympani responses corresponded to central excitation, peripheral excitation adjacent to the cell body, and peripheral excitation at a site distant from the cell body. Fibers stimulated by an intrameatal electrode demonstrated the greatest range of jitter measurements indicating that greater fiber independence may be achieved with intrameatal stimulation.
Prescribed burning cost recovery analysis on nonindustrial private forestland in North Carolina
Ronald J. Myers; William Powell; Mark Megalos
2012-01-01
A statewide internal analysis of prescribed burning costs was conducted by the North Carolina Division of Forest Resources (NCDFR) in 2008 to examine the regional differences of site preparation and silvicultural burning costs, and to determine which components were most responsible for losses or gains. This study analyzed actual costs for 90 site preparation (2,559...
Methods for the Analysis of Protein Phosphorylation-Mediated Cellular Signaling Networks
NASA Astrophysics Data System (ADS)
White, Forest M.; Wolf-Yadlin, Alejandro
2016-06-01
Protein phosphorylation-mediated cellular signaling networks regulate almost all aspects of cell biology, including the responses to cellular stimulation and environmental alterations. These networks are highly complex and comprise hundreds of proteins and potentially thousands of phosphorylation sites. Multiple analytical methods have been developed over the past several decades to identify proteins and protein phosphorylation sites regulating cellular signaling, and to quantify the dynamic response of these sites to different cellular stimulation. Here we provide an overview of these methods, including the fundamental principles governing each method, their relative strengths and weaknesses, and some examples of how each method has been applied to the analysis of complex signaling networks. When applied correctly, each of these techniques can provide insight into the topology, dynamics, and regulation of protein phosphorylation signaling networks.
NASA Astrophysics Data System (ADS)
Nampally, Subhadra; Padhy, Simanchal; Trupti, S.; Prabhakar Prasad, P.; Seshunarayana, T.
2018-05-01
We study local site effects with detailed geotechnical and geophysical site characterization to evaluate the site-specific seismic hazard for the seismic microzonation of the Chennai city in South India. A Maximum Credible Earthquake (MCE) of magnitude 6.0 is considered based on the available seismotectonic and geological information of the study area. We synthesized strong ground motion records for this target event using stochastic finite-fault technique, based on a dynamic corner frequency approach, at different sites in the city, with the model parameters for the source, site, and path (attenuation) most appropriately selected for this region. We tested the influence of several model parameters on the characteristics of ground motion through simulations and found that stress drop largely influences both the amplitude and frequency of ground motion. To minimize its influence, we estimated stress drop after finite bandwidth correction, as expected from an M6 earthquake in Indian peninsula shield for accurately predicting the level of ground motion. Estimates of shear wave velocity averaged over the top 30 m of soil (V S30) are obtained from multichannel analysis of surface wave (MASW) at 210 sites at depths of 30 to 60 m below the ground surface. Using these V S30 values, along with the available geotechnical information and synthetic ground motion database obtained, equivalent linear one-dimensional site response analysis that approximates the nonlinear soil behavior within the linear analysis framework was performed using the computer program SHAKE2000. Fundamental natural frequency, Peak Ground Acceleration (PGA) at surface and rock levels, response spectrum at surface level for different damping coefficients, and amplification factors are presented at different sites of the city. Liquefaction study was done based on the V S30 and PGA values obtained. The major findings suggest show that the northeast part of the city is characterized by (i) low V S30 values (< 200 m/s) associated with alluvial deposits, (ii) relatively high PGA value, at the surface, of about 0.24 g, and (iii) factor of safety and liquefaction below unity at three sites (no. 12, no. 37, and no. 70). Thus, this part of the city is expected to experience damage for the expected M6 target event.
NASA Astrophysics Data System (ADS)
Ballantyne, A. P.; Miller, J. B.; Bowling, D. R.; Tans, P. P.; Baker, I. T.
2013-12-01
The global cycles of water and carbon are inextricably linked through photosynthesis. This link is largely governed by stomatal conductance that regulates water loss to the atmosphere and carbon gain to the biosphere. Although extensive research has focused on the response of stomatal conductance to increased atmospheric CO2, much less research has focused on the response of stomatal conductance to concomitant climate change. Here we make use of intensive and extensive measurements of C isotopes in source CO2 to the atmosphere (del-bio) to make inferences about stomatal response to climatic factors at a single forest site and across a network of global observation sites. Based on intensive observations at the Niwot Ridge Ameriflux site we discover that del-bio is an excellent physical proxy of stomatal response during the growing season and this response is highly sensitive to atmospheric water vapor pressure deficit (VPD). We use these intensive single forest site observations to inform our analysis of the global observation network, focusing in on the growing season across an array of terrestrial sites. We find that stomatal response across most of these terrestrial sites is also highly sensitive to VPD. Lastly, we simulate the response of future climate change on stomatal response and discover that future increases in VPD may limit the biosphere's capacity to assimilate future CO2 emissions. These results have direct implications for the benchmarking of Earth System Models as stomatal conductance in many of these models does not vary as a function of VPD.
Climate Controls on Tree Growth Across Species and Sites in Northeastern Arizona
NASA Astrophysics Data System (ADS)
Schwan, M. R.; Guiterman, C. H.; Anchukaitis, K. J.
2016-12-01
Understanding how forests will respond to ongoing climate change is important for conservation and resource management. Conifer forests in the US Southwest are predicted to be particularly at risk from increased drought and higher temperatures projected to occur in the region. Tree-ring studies shed light on how trees respond to climate, but there remains considerable uncertainty as to which climate factors are most important, and which species are most at risk. Confounding climate and environmental factors, biological differences among species, and biogeography often complicate cross-species analysis. Here we present a multi-species, multivariate analysis of tree growth response to climate variability. We analyze data from three coexisting conifer tree species at two sites near Canyon de Chelly, Arizona. We use a high-resolution PRISM gridded climate dataset to determine the growth responses across species and sites to temperature and precipitation. We identify both common and differential responses in our data and use these to infer possible risks these forest communities may face under a changing climate.
Hartzell, S.; Carver, D.; Williams, R.A.; Harmsen, S.; Zerva, A.
2003-01-01
Ground-motion records from a 52-element dense seismic array near San Jose, California, are analyzed to obtain site response, shallow shear-wave velocity, and plane-wave propagation characteristics. The array, located on the eastern side of the Santa Clara Valley south of the San Francisco Bay, is sited over the Evergreen basin, a 7-km-deep depression with Miocene and younger deposits. Site response values below 4 Hz are up to a factor of 2 greater when larger, regional records are included in the analysis, due to strong surface-wave development within the Santa Clara Valley. The pattern of site amplification is the same, however, with local or regional events. Site amplification increases away from the eastern edge of the Santa Clara Valley, reaching a maximum over the western edge of the Evergreen basin, where the pre-Cenozoic basement shallows rapidly. Amplification then decreases further to the west. This pattern may be caused by lower shallow shear-wave velocities and thicker Quaternary deposits further from the edge of the Santa Clara Valley and generation/trapping of surface waves above the shallowing basement of the western Evergreen basin. Shear-wave velocities from the inversion of site response spectra based on smaller, local earthquakes compare well with those obtained independently from our seismic reflection/refraction measurements. Velocities from the inversion of site spectra that include larger, regional records do not compare well with these measurements. A mix of local and regional events, however, is appropriate for determination of site response to be used in seismic hazard evaluation, since large damaging events would excite both body and surface waves with a wide range in ray parameters. Frequency-wavenumber, plane-wave analysis is used to determine the backazimuth and apparent velocity of coherent phases at the array. Conventional, high-resolution, and multiple signal characterization f-k power spectra and stacked slowness power spectra are compared. These spectra show surface waves generated/ scattered at the edges of the Santa Clara Valley and possibly within the valley at the western edge of the Evergreen basin.
Zhang, Emma Xuxiao; Yang, Yinping; Di Shang, Richard; Simons, Joseph John Pyne; Quek, Boon Kiat; Yin, Xiao Feng; See, Wanhan; Oh, Olivia Seen Huey; Nandar, Khine Sein Tun; Ling, Vivienne Ruo Yun; Chan, Pei Pei; Wang, Zhaoxia; Goh, Rick Siow Mong; James, Lyn; Tey, Jeannie Su Hui
2015-01-01
We conducted in-depth analysis on the use of a popular Chinese social networking and microblogging site, Sina Weibo, to monitor an avian influenza A(H7N9) outbreak in China and to assess the value of social networking sites in the surveillance of disease outbreaks that occur overseas. Two data sets were employed for our analysis: a line listing of confirmed cases obtained from conventional public health information channels and case information from Weibo posts. Our findings showed that the level of activity on Weibo corresponded with the number of new cases reported. In addition, the reporting of new cases on Weibo was significantly faster than those of conventional reporting sites and non-local news media. A qualitative review of the functions of Weibo also revealed that Weibo enabled timely monitoring of other outbreak-relevant information, provided access to additional crowd-sourced epidemiological information and was leveraged by the local government as an interactive platform for risk communication and monitoring public sentiment on the policy response. Our analysis demonstrated the potential for social networking sites to be used by public health agencies to enhance traditional communicable disease surveillance systems for the global surveillance of overseas public health threats. Social networking sites also can be used by governments for calibration of response policies and measures and for risk communication.
Zhang, Emma Xuxiao; Yang, Yinping; Di Shang, Richard; Simons, Joseph John Pyne; Quek, Boon Kiat; Yin, Xiao Feng; See, Wanhan; Oh, Olivia Seen Huey; Nandar, Khine Sein Tun; Ling, Vivienne Ruo Yun; Chan, Pei Pei; Wang, Zhaoxia; Goh, Rick Siow Mong; James, Lyn
2015-01-01
We conducted in-depth analysis on the use of a popular Chinese social networking and microblogging site, Sina Weibo, to monitor an avian influenza A(H7N9) outbreak in China and to assess the value of social networking sites in the surveillance of disease outbreaks that occur overseas. Two data sets were employed for our analysis: a line listing of confirmed cases obtained from conventional public health information channels and case information from Weibo posts. Our findings showed that the level of activity on Weibo corresponded with the number of new cases reported. In addition, the reporting of new cases on Weibo was significantly faster than those of conventional reporting sites and non-local news media. A qualitative review of the functions of Weibo also revealed that Weibo enabled timely monitoring of other outbreak-relevant information, provided access to additional crowd-sourced epidemiological information and was leveraged by the local government as an interactive platform for risk communication and monitoring public sentiment on the policy response. Our analysis demonstrated the potential for social networking sites to be used by public health agencies to enhance traditional communicable disease surveillance systems for the global surveillance of overseas public health threats. Social networking sites also can be used by governments for calibration of response policies and measures and for risk communication. PMID:26306219
Earthquake site response in Santa Cruz, California
Carver, D.; Hartzell, S.H.
1996-01-01
Aftershocks of the 1989 Loma Prieta, California, earthquake are used to estimate site response in a 12-km2 area centered on downtown Santa Cruz. A total of 258 S-wave records from 36 aftershocks recorded at 33 sites are used in a linear inversion for site-response spectra. The inversion scheme takes advantage of the redundancy of the large data set for which several aftershocks are recorded at each site. The scheme decomposes the observed spectra into source, path, and site terms. The path term is specified before the inversion. The undetermined degree of freedom in the decomposition into source and site spectra is removed by specifying the site-response factor to be approximately 1.0 at two sites on crystalline bedrock. The S-wave site responses correlate well with the surficial geology and observed damage pattern of the mainshock. The site-response spectra of the floodplain sites, which include the heavily damaged downtown area, exhibit significant peaks. The largest peaks are between 1 and 4 Hz. Five floodplain sites have amplification factors of 10 or greater. Most of the floodplain site-response spectra also have a smaller secondary peak between 6 and 8 Hz. Residential areas built on marine terraces above the flood-plain experienced much less severe damage. Site-response spectra for these areas also have their largest peaks between 1 and 4 Hz, but the amplification is generally below 6. Several of these sites also have a secondary peak between 6 and 8 Hz. The response peaks seen at nearly all sites between 1 and 4 Hz are probably caused by the natural resonance of the sedimentary rock column. The higher amplifications at floodplain sites may be caused by surface waves generated at the basin margins. The secondary peak between 6 and 8 Hz at many sites may be a harmonic of the 1- to 4-Hz peaks. We used waveforms from a seven-station approximately linear array located on the floodplain to calculate the apparent velocity and azimuth of propagation of coherent arrivals within moving windows of the S-wave codas. The initial windows give results that are consistent with direct S-wave arrivals. The apparent velocities are high (greater than 4.0 km/sec), and azimuths are from the source. Waves arriving later than 2 sec after the direct S waves have apparent velocities of less than 1 km/ sec, indicating that they are surface waves, and arrive from divergent azimuths. This analysis indicates that after the direct S-wave arrival, long-duration shaking comes from surface waves that are generated at the basin margin and reverberate in the floodplain sediments.
John M. Kabrick; David R. Larsen; Stephen R. Shifley
1997-01-01
We conducted a study to identify pre-treatment trends in woody species density, diameter, and basal area among MOFEP sites, blocks, and treatment areas; relate woody species differences among sites, blocks, and treatment areas to differences in environmental conditions; and identify potential treatment response differences based upon our fmdings. Sites 2 through 5 had...
Craddick, Karen; Eccles, Dayl; Kwasnik, Abigail; O’Sullivan, Teresa A.
2015-01-01
Objective. To qualitatively analyze free-text responses gathered as part of a previously published survey in order to systematically identify common concerns facing pharmacy experiential education (EE) programs. Methods. In 2011, EE directors at all 118 accredited pharmacy schools in the US were asked in a survey to describe the most pressing issues facing their programs. Investigators performed qualitative, thematic analysis of responses and compared results against demographic data (institution type, class size, number of practice sites, number and type of EE faculty member/staff). Expert and novice investigators identified common themes via an iterative process. To check validity, additional expert and novice reviewers independently coded responses. The Cohen kappa coefficient was calculated and showed good agreement between investigators and reviewers. Results. Seventy-eight responses were received (66% response rate) representing 75% of publicly funded institutions and 71% of schools with class sizes 51-150. Themes identified as common concerns were site capacity, workload/financial support, quality assurance, preceptor development, preceptor stipends, assessment, onboarding, and support/recognition from administration. Good agreement (mean percent agreement 93%, ƙ range=0.59-0.92) was found between investigators and reviewers. Conclusion. Site capacity for student placements continues to be the foremost concern for many experiential education programs. New concerns about preceptor development and procedures for placing and orienting students at individual practice sites (ie, “onboarding”) have emerged and must be addressed as new accreditation standards are implemented. PMID:25741022
DOE Office of Scientific and Technical Information (OSTI.GOV)
Spears, Robert Edward; Coleman, Justin Leigh
Currently the Department of Energy (DOE) and the nuclear industry perform seismic soil-structure interaction (SSI) analysis using equivalent linear numerical analysis tools. For lower levels of ground motion, these tools should produce reasonable in-structure response values for evaluation of existing and new facilities. For larger levels of ground motion these tools likely overestimate the in-structure response (and therefore structural demand) since they do not consider geometric nonlinearities (such as gaping and sliding between the soil and structure) and are limited in the ability to model nonlinear soil behavior. The current equivalent linear SSI (SASSI) analysis approach either joins the soilmore » and structure together in both tension and compression or releases the soil from the structure for both tension and compression. It also makes linear approximations for material nonlinearities and generalizes energy absorption with viscous damping. This produces the potential for inaccurately establishing where the structural concerns exist and/or inaccurately establishing the amplitude of the in-structure responses. Seismic hazard curves at nuclear facilities have continued to increase over the years as more information has been developed on seismic sources (i.e. faults), additional information gathered on seismic events, and additional research performed to determine local site effects. Seismic hazard curves are used to develop design basis earthquakes (DBE) that are used to evaluate nuclear facility response. As the seismic hazard curves increase, the input ground motions (DBE’s) used to numerically evaluation nuclear facility response increase causing larger in-structure response. As ground motions increase so does the importance of including nonlinear effects in numerical SSI models. To include material nonlinearity in the soil and geometric nonlinearity using contact (gaping and sliding) it is necessary to develop a nonlinear time domain methodology. This methodology will be known as, NonLinear Soil-Structure Interaction (NLSSI). In general NLSSI analysis should provide a more accurate representation of the seismic demands on nuclear facilities their systems and components. INL, in collaboration with a Nuclear Power Plant Vender (NPP-V), will develop a generic Nuclear Power Plant (NPP) structural design to be used in development of the methodology and for comparison with SASSI. This generic NPP design has been evaluated for the INL soil site because of the ease of access and quality of the site specific data. It is now being evaluated for a second site at Vogtle which is located approximately 15 miles East-Northeast of Waynesboro, Georgia and adjacent to Savanna River. The Vogtle site consists of many soil layers spanning down to a depth of 1058 feet. The reason that two soil sites are chosen is to demonstrate the methodology across multiple soil sites. The project will drive the models (soil and structure) using successively increasing acceleration time histories with amplitudes. The models will be run in time domain codes such as ABAQUS, LS-DYNA, and/or ESSI and compared with the same models run in SASSI. The project is focused on developing and documenting a method for performing time domain, non-linear seismic soil structure interaction (SSI) analysis. Development of this method will provide the Department of Energy (DOE) and industry with another tool to perform seismic SSI analysis.« less
Positional differences in the wound transcriptome of skin and oral mucosa
2010-01-01
Background When compared to skin, oral mucosal wounds heal rapidly and with reduced scar formation. Recent studies suggest that intrinsic differences in inflammation, growth factor production, levels of stem cells, and cellular proliferation capacity may underlie the exceptional healing that occurs in oral mucosa. The current study was designed to compare the transcriptomes of oral mucosal and skin wounds in order to identify critical differences in the healing response at these two sites using an unbiased approach. Results Using microarray analysis, we explored the differences in gene expression in skin and oral mucosal wound healing in a murine model of paired equivalent sized wounds. Samples were examined from days 0 to 10 and spanned all stages of the wound healing process. Using unwounded matched tissue as a control, filtering identified 1,479 probe sets in skin wounds yet only 502 probe sets in mucosal wounds that were significantly differentially expressed over time. Clusters of genes that showed similar patterns of expression were also identified in each wound type. Analysis of functionally related gene expression demonstrated dramatically different reactions to injury between skin and mucosal wounds. To explore whether site-specific differences might be derived from intrinsic differences in cellular responses at each site, we compared the response of isolated epithelial cells from skin and oral mucosa to a defined in vitro stimulus. When cytokine levels were measured, epithelial cells from skin produced significantly higher amounts of proinflammatory cytokines than cells from oral mucosa. Conclusions The results provide the first detailed molecular profile of the site-specific differences in the genetic response to injury in mucosa and skin, and suggest the divergent reactions to injury may derive from intrinsic differences in the cellular responses at each site. PMID:20704739
Positional differences in the wound transcriptome of skin and oral mucosa.
Chen, Lin; Arbieva, Zarema H; Guo, Shujuan; Marucha, Phillip T; Mustoe, Thomas A; DiPietro, Luisa A
2010-08-12
When compared to skin, oral mucosal wounds heal rapidly and with reduced scar formation. Recent studies suggest that intrinsic differences in inflammation, growth factor production, levels of stem cells, and cellular proliferation capacity may underlie the exceptional healing that occurs in oral mucosa. The current study was designed to compare the transcriptomes of oral mucosal and skin wounds in order to identify critical differences in the healing response at these two sites using an unbiased approach. Using microarray analysis, we explored the differences in gene expression in skin and oral mucosal wound healing in a murine model of paired equivalent sized wounds. Samples were examined from days 0 to 10 and spanned all stages of the wound healing process. Using unwounded matched tissue as a control, filtering identified 1,479 probe sets in skin wounds yet only 502 probe sets in mucosal wounds that were significantly differentially expressed over time. Clusters of genes that showed similar patterns of expression were also identified in each wound type. Analysis of functionally related gene expression demonstrated dramatically different reactions to injury between skin and mucosal wounds. To explore whether site-specific differences might be derived from intrinsic differences in cellular responses at each site, we compared the response of isolated epithelial cells from skin and oral mucosa to a defined in vitro stimulus. When cytokine levels were measured, epithelial cells from skin produced significantly higher amounts of proinflammatory cytokines than cells from oral mucosa. The results provide the first detailed molecular profile of the site-specific differences in the genetic response to injury in mucosa and skin, and suggest the divergent reactions to injury may derive from intrinsic differences in the cellular responses at each site.
MEASUREMENT AND ANALYSIS OF VAPOR SENSORS USED AT UNDERGROUND STORAGE TANK SITES
This report is a continuation of an investigation to quantify the operating characteristics of vapor sensor technologies used at underground storage tank (UST) sites. n the previous study (EPA/600/R-92/219) the sensitivity, selectivity, and response time to simulated UST environm...
NASA Astrophysics Data System (ADS)
Biederman, J. A.; Scott, R. L.; Goulden, M.
2014-12-01
Climate change is predicted to increase the frequency and severity of water limitation, altering terrestrial ecosystems and their carbon exchange with the atmosphere. Here we compare site-level temporal sensitivity of annual carbon fluxes to interannual variations in water availability against cross-site spatial patterns over a network of 19 eddy covariance flux sites. This network represents one order of magnitude in mean annual productivity and includes western North American desert shrublands and grasslands, savannahs, woodlands, and forests with continuous records of 4 to 12 years. Our analysis reveals site-specific patterns not identifiable in prior syntheses that pooled sites. We interpret temporal variability as an indicator of ecosystem response to annual water availability due to fast-changing factors such as leaf stomatal response and microbial activity, while cross-site spatial patterns are used to infer ecosystem adjustment to climatic water availability through slow-changing factors such as plant community and organic carbon pools. Using variance decomposition, we directly quantify how terrestrial carbon balance depends on slow- and fast-changing components of gross ecosystem production (GEP) and total ecosystem respiration (TER). Slow factors explain the majority of variance in annual net ecosystem production (NEP) across the dataset, and their relative importance is greater at wetter, forest sites than desert ecosystems. Site-specific offsets from spatial patterns of GEP and TER explain one third of NEP variance, likely due to slow-changing factors not directly linked to water, such as disturbance. TER and GEP are correlated across sites as previously shown, but our site-level analysis reveals surprisingly consistent linear relationships between these fluxes in deserts and savannahs, indicating fast coupling of TER and GEP in more arid ecosystems. Based on the uncertainty associated with slow and fast factors, we suggest a framework for improved prediction of terrestrial carbon balance. We will also present results of ongoing work to quantify fast and slow contributions to the relationship between evapotranspiration and precipitation across a precipitation gradient.
Dowd, Carola D; Chronis, Demosthenis; Radakovic, Zoran S; Siddique, Shahid; Schmülling, Thomas; Werner, Tomáš; Kakimoto, Tatsuo; Grundler, Florian M W; Mitchum, Melissa G
2017-10-01
Cyst and root-knot nematodes are obligate parasites of economic importance with a remarkable ability to reprogram root cells into unique metabolically active feeding sites. Previous studies have suggested a role for cytokinin in feeding site formation induced by these two types of nematodes, but the mechanistic details have not yet been described. Using Arabidopsis as a host plant species, we conducted a comparative analysis of cytokinin genes in response to the beet cyst nematode (BCN), Heterodera schachtii, and the root-knot nematode (RKN), Meloidogyne incognita. We identified distinct differences in the expression of cytokinin biosynthesis, catabolism and signaling genes in response to infection by BCN and RKN, suggesting differential manipulation of the cytokinin pathway by these two nematode species. Furthermore, we evaluated Arabidopsis histidine kinase receptor mutant lines ahk2/3, ahk2/4 and ahk3/4 in response to RKN infection. Similar to our previous studies with BCN, these lines were significantly less susceptible to RKN without compromising nematode penetration, suggesting a requirement of cytokinin signaling in RKN feeding site formation. Moreover, an analysis of ahk double mutants using CycB1;1:GUS/ahk introgressed lines revealed contrasting differences in the cytokinin receptors mediating cell cycle activation in feeding sites induced by BCN and RKN. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.
Seal, S N; Davis, D L; Burch, J B
1991-05-01
The endogenous chicken vitellogenin II (VTGII) gene is transcribed exclusively in hepatocytes in response to estrogen. We previously identified two estrogen response elements (EREs) upstream of this gene. We now present an analysis of the VTGII promoter activated by these EREs in response to estrogen. Chimeric VTGII-CAT genes were cotransfected into LMH chicken hepatoma cells along with an estrogen receptor expression vector, and transient CAT expression was assayed after culturing the cells in the absence or presence of estrogen. An analysis of constructs bearing deletions downstream of the more proximal ERE indicated that promoter elements relevant to transcription in LMH cells extend to between -113 and -96. The relative importance of sequences within the VTGII promoter was examined by using 10 contiguous linker scanner mutations spanning the region from -117 to -24. Although most of these mutations compromised VTGII promoter function, one dramatically increased expression in LMH cells and also rendered the VTGII promoter capable of being activated by cis-linked EREs in fibroblasts cotransfected with an estrogen receptor expression vector. Gel retardation and DNase I footprinting assays revealed four factor-binding sites within this promoter. We demonstrate that three of these sites bind C/EBP, SP1, and USF (or related factors), respectively; the fourth site binds a factor that we denote TF-V beta. The biological relevance of these findings is suggested by the fact that three of these binding sites map to sites previously shown to be occupied in vivo in response to estrogen.
USDA-ARS?s Scientific Manuscript database
Herbicides are the most frequently used means of controlling weeds. For many herbicides the target site is known; however, it is considerably less clear how plant gene expression changes in response to herbicide exposure. Understanding which genes are activated in response to herbicides provides i...
2017-09-01
CANNOT BE ANALYZED ....... 17 7.0 COST BENEFIT ANALYSIS...20 7.3 COST BENEFIT ...sites and assess the performance and cost benefits of implementing AGC technologies. OBJECTIVES OF THE DEMONSTRATION The demonstrations were
Foredune Classification and Storm Response: Automated Analysis of Terrestrial Lidar DEMs
2015-06-15
since Hurricane Sandy. 041 20/3/2015 4 Figure 1. A. The study site in Duck , NC showing the alongshore coordinates of the local coordinate...waves on March 10: Hs = 4.8 m at 16 sec Coastal Lidar and Radar Imaging System (CLARIS) Nor’easter Storm Conditions Study Site: Duck , NC...Engineer Research and Development Center, Coastal & Hydraulics Laboratory, Coastal Observation & Analysis Branch, 1261 Duck Rd, Duck , NC 27949, USA
Seismic risk analysis for the Babcock and Wilcox facility, Leechburg, Pennsylvania
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1977-10-21
The results of a detailed seismic risk analysis of the Babcock and Wilcox Plutonium Fuel Fabrication facility at Leechburg, Pennsylvania are presented. This report focuses on earthquakes; the other natural hazards, being addressed in separate reports, are severe weather (strong winds and tornados) and floods. The calculational method used is based on Cornell's work (1968); it has been previously applied to safety evaluations of major projects. The historical seismic record was established after a review of available literature, consultation with operators of local seismic arrays and examination of appropriate seismic data bases. Because of the aseismicity of the region aroundmore » the site, an analysis different from the conventional closest approach in a tectonic province was adapted. Earthquakes as far from the site as 1,000 km were included, as were the possibility of earthquakes at the site. In addition, various uncertainties in the input were explicitly considered in the analysis. The results of the risk analysis, which include a Bayesian estimate of the uncertainties, are presented, expressed as return period accelerations. The best estimate curve indicates that the Babcock and Wilcox facility will experience 0.05 g every 220 years and 0.10 g every 1400 years. The bounding curves roughly represent the one standard deviation confidence limits about the best estimate, reflecting the uncertainty in certain of the input. Detailed examination of the results show that the accelerations are very insensitive to the details of the source region geometries or the historical earthquake statistics in each region and that each of the source regions contributes almost equally to the cumulative risk at the site. If required for structural analysis, acceleration response spectra for the site can be constructed by scaling the mean response spectrum for alluvium in WASH 1255 by these peak accelerations.« less
Putney Basketville Site Biomass CHP Analysis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hunsberger, Randolph; Mosey, Gail
2013-10-01
The U.S. Environmental Protection Agency (EPA) Office of Solid Waste and Emergency Response Center for Program Analysis developed the RE-Powering America's Land initiative to reuse contaminated sites for renewable energy generation when aligned with the community's vision for the site. The Putney, Vermont, Basketville site, formerly the location of a basket-making facility and a paper mill andwoolen mill, was selected for a feasibility study under the program. Biomass was chosen as the renewable energy resource based on abundant woody-biomass resources available in the area. Biomass combined heat and power (CHP) was selected as the technology due to nearby loads, includingmore » Putney Paper and Landmark College.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shoop, D.S.
1997-08-20
On the evening of May 14,1997, a chemical explosion Occurred at the Plutonium Reclamation Facility (PRF) in the 200 West Area(200-W) of the Hanford Site. The event warranted the declaration of an Alert emergency, activation of the Hanford Emergency Response Organization (BRO), and notification of offsite agencies. As a result of the emergency declaration, a subsequent evaluation was conducted to assess: 9 the performance of the emergency response organization o the occupational health response related to emergency activities o event notifications to offsite and environmental agencies. Additionally, the evaluation was designed to: 9 document the chronology of emergency and occupationalmore » health responses and environmental notifications connected with the explosion at the facility 0 assess the adequacy of the Hanford Site emergency preparedness activities; response readiness; and emergency management actions, occupational health, and environmental actions 0 provide an analysis of the causes of the deficiencies and weaknesses in the preparedness and response system that have been identified in the evaluation of the response a assign organizational responsibility to correct deficiencies and weaknesses a improve future performance 0 adjust elements of emergency implementing procedures and emergency preparedness activities.« less
NASA Astrophysics Data System (ADS)
Del Gaudio, Vincenzo; Wasowski, Janusz
2014-05-01
Several studies have shown that the dynamic response of landslide prone slopes to seismic shaking can play an important role in failure triggering during earthquakes. It was also demonstrated that slope seismic response is often characterised by directional resonance phenomena. Directivity can be revealed by the analysis of ambient noise recordings according to a technique known as HVNR method based on the analysis of azimuthal variation of spectral ratios between the spectral amplitude of horizontal H and vertical V component of noise recording. Directional resonance is then revealed by the presence of a preferential polarisation of H/V ratio peaks, whose frequencies correspond to resonance frequencies and whose amplitudes depend on the impedance contrast between surface material and bedrock. H/V ratio amplitudes can potentially provide information also on amplification factors. However, the relation is not straightforward depending on the nature of the waves contributing to the ambient noise. Thus, it is desirable to distinguish different kinds of noise wave packets, possibly isolating the contribution of Rayleigh waves, which appear to better reflect site response properties. To identify Rayleigh wave packets in noise recording a new approach was tested, based on a technique of analysis of instantaneous polarisation. The results are promising for the investigation of site response directional properties, particularly in the case of complex site conditions, where resonance can be characterised by multiple anisotropic peaks. In our preliminary tests of noise recordings carried out at a site located on a slope affected by landslides, only a small fraction of data samples (in the order of 1 %) were identified as Rayleigh type waves: this was likely due the fact that the noise recording was dominated by an overlapping of signals with different kinds of polarisation. Thus, it was possible to recognise Rayleigh polarisation only when the energy of this kind of wave was prevalent. However, from a relatively short noise recording (in the order of 30-45 minutes) one can obtain a high number (in the order of thousands) of estimates of H/V amplitude and azimuth, providing a robust statistics to recognise ground vibration properties reflecting site response. The tests on sites where directional resonance properties had been verified through the analysis of seismic event recordings, showed that more coherent observations can be obtained for H/V ratios and directivity estimates by selecting Rayleigh type data samples, rather than analysing the entire data set or SH-type wave packets.This offers the possibility of reducing the uncertainties in data interpretation related to the influence of the nature of the noise wavefield.
Soil Characterization and Site Response of Marine and Continental Environments
NASA Astrophysics Data System (ADS)
Contreras-Porras, R. S.; Huerta-Lopez, C. I.; Martinez-Cruzado, J. A.; Gaherty, J. B.; Collins, J. A.
2009-05-01
An in situ soil properties study was conducted to characterize both site and shallow layer sediments under marine and continental environments. Data from the SCoOBA (Sea of Cortez Ocean Bottom Array) seismic experiment and in land ambient vibration measurements on the urban areas of Tijuana, B. C., and Ensenada, B. C., Mexico were used in the analysis. The goal of this investigation is to identify and to analyze the effect of the physical/geotechnical properties of the ground on the site response upon seismic excitations in both marine and continental environments. The time series were earthquakes and background noise recorded within interval of 10/2005 to 10/2006 in the Gulf of California (GoC) with very-broadband Ocean Bottom Seismographs (OBS), and ambient vibration measurements collected during different time periods on Tijuana and Ensenada urban areas. The data processing and analysis was conducted by means of the H/V Spectral Ratios (HVSPR) of multi component data, the Random Decrement Method (RDM), and Blind Deconvolution (BD). This study presents ongoing results of a long term project to characterize the local site response of soil layers upon dynamic excitations using digital signal processing algorithms on time series, as well as the comparison between the results these methodologies are providing.
Cranswick, E.
1988-01-01
Due to hardware developments in the last decade, the high-frequency end of the frequency band of seismic waves analyzed for source mechanisms has been extended into the audio-frequency range (>20 Hz). In principle, the short wavelengths corresponding to these frequencies can provide information about the details of seismic sources, but in fact, much of the "signal" is the site response of the nearsurface. Several examples of waveform data recorded at "hard rock" sites, which are generally assumed to have a "flat" transfer function, are presented to demonstrate the severe signal distortions, including fmax, produced by near-surface structures. Analysis of the geology of a number of sites indicates that the overall attenuation of high-frequency (>1 Hz) seismic waves is controlled by the whole-path-Q between source and receiver but the presence of distinct fmax site resonance peaks is controlled by the nature of the surface layer and the underlying near-surface structure. Models of vertical decoupling of the surface and nearsurface and horizontal decoupling of adjacent sites on hard rock outcrops are proposed and their behaviour is compared to the observations of hard rock site response. The upper bound to the frequency band of the seismic waves that contain significant source information which can be deconvolved from a site response or an array response is discussed in terms of fmax and the correlation of waveform distortion with the outcrop-scale geologic structure of hard rock sites. It is concluded that although the velocity structures of hard rock sites, unlike those of alluvium sites, allow some audio-frequency seismic energy to propagate to the surface, the resulting signals are a highly distorted, limited subset of the source spectra. ?? 1988 Birkha??user Verlag.
Spencer, Jeffrey A.; Major, Michael L.; Misra, Ravi P.
1999-01-01
Serum response factor (SRF) plays a central role in the transcriptional response of mammalian cells to a variety of extracellular signals. It is a key regulator of many cellular early response genes which are believed to be involved in cell growth and differentiation. The mechanism by which SRF activates transcription in response to mitogenic agents has been extensively studied; however, significantly less is known about regulation of the SRF gene itself. Previously, we identified distinct regulatory elements in the SRF promoter that play a role in activation, including a consensus ETS domain binding site, a consensus overlapping Sp/Egr-1 binding site, and two SRF binding sites. We further showed that serum induces SRF by a mechanism that requires an intact SRF binding site, also termed a CArG box. In the present study we demonstrate that in response to stimulation of cells by a purified growth factor, basic fibroblast growth factor (bFGF), the SRF promoter is upregulated by a complex pathway that involves at least two independent mechanisms: a CArG box-independent mechanism that is mediated by an ETS binding site, and a novel CArG box-dependent mechanism that requires both an Sp factor binding site and the CArG motifs for maximal stimulation. Our analysis indicates that the CArG/Sp element activation mechanism is mediated by distinct signaling pathways. The CArG box-dependent component is targeted by a Rho-mediated pathway, and the Sp binding site-dependent component is targeted by a Ras-mediated pathway. Both SRF and bFGF have been implicated in playing an important role in mediating cardiogenesis during development. The implications of our findings for SRF expression during development are discussed. PMID:10330138
Federal Register 2010, 2011, 2012, 2013, 2014
2013-11-27
..., 2000. LSS provides CBP with forensic and scientific analysis in trade enforcement. The field laboratories use mobile labs to provide on- site emergency response and analysis at the border. \\2\\ CBP...
Analysis of the Source and Ground Motions from the 2017 M8.2 Tehuantepec and M7.1 Puebla Earthquakes
NASA Astrophysics Data System (ADS)
Melgar, D.; Sahakian, V. J.; Perez-Campos, X.; Quintanar, L.; Ramirez-Guzman, L.; Spica, Z.; Espindola, V. H.; Ruiz-Angulo, A.; Cabral-Cano, E.; Baltay, A.; Geng, J.
2017-12-01
The September 2017 Tehuantepec and Puebla earthquakes were intra-slab earthquakes that together caused significant damage in broad regions of Mexico, including the states of Oaxaca, Chiapas, Morelos, Puebla, Mexico, and Mexico City. Ground motions in Mexico City have approximately the same angle of incidence from both earthquakes and potentially sample similar paths close to the city. We examine site effects and source terms by analysis of residuals between Ground-Motion Prediction Equations (GMPEs) and observed ground motions for both of these events at stations from the Servicio Sismólogico Nacional, Instituto de Ingeniería, and the Instituto de Geofísica Red del Valle de Mexico networks. GMPEs are a basis for seismic design, but also provide median ground motion values to act as a basis for comparison of individual earthquakes and site responses. First, we invert for finite-fault slip inversions for Tehuantepec with high-rate GPS, static GPS, tide gauge and DART buoy data, and for Puebla with high-rate GPS and strong motion data. Using the distance from the stations with ground motion observations to the derived slip models, we use the GMPEs of Garcia et al. (2005), Zhao et al. (2006), and Abrahamson, Silva and Kamai (2014), to compute predicted values of peak ground acceleration and velocity (PGA and PGV) and response spectral accelerations (SA). Residuals between observed and predicted ground motion parameters are then computed for each recording, and are decomposed into event and site components using a mixed effects regression. We analyze these residuals as an adjustment away from median ground motions in the region to glean information about the earthquake source properties, as well as local site response in and outside of the Mexico City basin. The event and site terms are then compared with available values of stress drop for the two earthquakes, and Vs30 values for the sites, respectively. This analysis is useful in determining which GMPE is most appropriate in the central Mexico region, important for future ground motion studies and rapid response products such as ShakeMap.
Tanks Focus Area Site Needs Assessment - FY 2001
DOE Office of Scientific and Technical Information (OSTI.GOV)
Allen, Robert W.; Josephson, Gary B.; Westsik, Joseph H.
2001-04-30
The TFA uses a systematic process for developing its annual program that draws from the tanks science and technology development needs expressed by the five DOE tank waste sites. TFA's annual program development process is iterative and involves the following steps: Collection of site needs; Needs analysis; Development of technical responses and initial prioritization; Refinement of the program for the next fiscal year; Formulation of the Corporate Review Budget (CRB); Preparation of Program Execution Guidance (PEG) for the next FY Revision of the Multiyear Program Plan (MYPP). This document describes the outcomes of the first phase of this process, frommore » collection of site needs to the initial prioritization of technical activities. The TFA received site needs in October - December 2000. A total of 170 site needs were received, an increase of 30 over the previous year. The needs were analyzed and integrated, where appropriate. Sixty-six distinct technical responses were drafted and prioritized. In addition, seven strategic tasks were approved to compete for available funding in FY 2002 and FY 2003. Draft technical responses were prepared and provided to the TFA Site Representatives and the TFA User Steering Group (USG) for their review and comment. These responses were discussed at a March 15, 2001, meeting where the TFA Management Team established the priority listing in preparation for input to the DOE Office of Science and Technology (OST) budget process. At the time of publication of this document, the TFA continues to finalize technical responses as directed by the TFA Management Team and clarify the intended work scopes for FY 2002 and FY 2003.« less
Hartzell, Stephen; Leeds, Alena L.; Ramirez-Guzman, Leonardo; Allen, James P.; Schmitt, Robert G.
2016-01-01
Thirty‐two accelerometers were deployed in the Livermore Valley, California, for approximately one year to study sedimentary basin effects. Many local and near‐regional earthquakes were recorded, including the 24 August 2014 Mw 6.0 Napa, California, earthquake. The resulting ground‐motion data set is used to quantify the seismic response of the Livermore basin, a major structural depression in the California Coast Range Province bounded by active faults. Site response is calculated by two methods: the reference‐site spectral ratio method and a source‐site spectral inversion method. Longer‐period (≥1 s) amplification factors follow the same general pattern as Bouguer gravity anomaly contours. Site response spectra are inverted for shallow shear‐wave velocity profiles, which are consistent with independent information. Frequency–wavenumber analysis is used to analyze plane‐wave propagation across the Livermore Valley and to identify basin‐edge‐induced surface waves with back azimuths different from the source back azimuth. Finite‐element simulations in a 3D velocity model of the region illustrate the generation of basin‐edge‐induced surface waves and point out strips of elevated ground velocities along the margins of the basin.
Saviane, Chiara; Silver, R Angus
2006-06-15
Synapses play a crucial role in information processing in the brain. Amplitude fluctuations of synaptic responses can be used to extract information about the mechanisms underlying synaptic transmission and its modulation. In particular, multiple-probability fluctuation analysis can be used to estimate the number of functional release sites, the mean probability of release and the amplitude of the mean quantal response from fits of the relationship between the variance and mean amplitude of postsynaptic responses, recorded at different probabilities. To determine these quantal parameters, calculate their uncertainties and the goodness-of-fit of the model, it is important to weight the contribution of each data point in the fitting procedure. We therefore investigated the errors associated with measuring the variance by determining the best estimators of the variance of the variance and have used simulations of synaptic transmission to test their accuracy and reliability under different experimental conditions. For central synapses, which generally have a low number of release sites, the amplitude distribution of synaptic responses is not normal, thus the use of a theoretical variance of the variance based on the normal assumption is not a good approximation. However, appropriate estimators can be derived for the population and for limited sample sizes using a more general expression that involves higher moments and introducing unbiased estimators based on the h-statistics. Our results are likely to be relevant for various applications of fluctuation analysis when few channels or release sites are present.
N Getov, Ilko; Gocheva-Hristova, Tanya; Lebanova, Hristina V; Grigorov, Evgeni E
2012-08-01
To analyse and assess the legislative and contractual obligations of the parties involved in the conduct of clinical trials, with identification of the needs for comprehensive contractual regulation of their rights and responsibilities. This survey has been carried out by means of review, analysis of comprehensiveness, comparative legislative analysis and assessment of compliance with the legislation of sample of investigator and site agreements governing the process of conducting clinical trials. The survey comprises analyses of contractual relations between the sponsor of the study and the investigator, and between the sponsor of the study and the trial site, respectively, relevant to clinical trials which are actually conducted in Bulgaria at the time of and following the survey. Comparative method based on pre-defined structured indices was employed to outline the major variances in the volume of responsibilities and obligations of the said parties to the clinical trial, as regulated by the investigator and site agreements. The analysis of comprehensiveness showed evident omissions in the regulation of relations and interactions between the parties to the agreements. The detailed contractual regulation providing for the statutory obligations and responsibilities of the parties involved in the conduct of clinical trials is a good guarantee for proper understanding of the obligations of each party and for compliance with their relevant responsibilities in view of protecting the rights of the participants in the clinical trials - patients or healthy volunteers.
Co-regulation analysis of co-expressed modules under cold and pathogen stress conditions in tomato.
Abedini, Davar; Rashidi Monfared, Sajad
2018-06-01
A primary mechanism for controlling the development of multicellular organisms is transcriptional regulation, which carried out by transcription factors (TFs) that recognize and bind to their binding sites on promoter region. The distance from translation start site, order, orientation, and spacing between cis elements are key factors in the concentration of active nuclear TFs and transcriptional regulation of target genes. In this study, overrepresented motifs in cold and pathogenesis responsive genes were scanned via Gibbs sampling method, this method is based on detection of overrepresented motifs by means of a stochastic optimization strategy that searches for all possible sets of short DNA segments. Then, identified motifs were checked by TRANSFAC, PLACE and Soft Berry databases in order to identify putative TFs which, interact to the motifs. Several cis/trans regulatory elements were found using these databases. Moreover, cross-talk between cold and pathogenesis responsive genes were confirmed. Statistical analysis was used to determine distribution of identified motifs on promoter region. In addition, co-regulation analysis results, illustrated genes in pathogenesis responsive module are divided into two main groups. Also, promoter region was crunched to six subareas in order to draw the pattern of distribution of motifs in promoter subareas. The result showed the majority of motifs are concentrated on 700 nucleotides upstream of the translational start site (ATG). In contrast, this result isn't true in another group. In other words, there was no difference between total and compartmentalized regions in cold responsive genes.
Models and methods to characterize site amplification from a pair of records
Safak, E.
1997-01-01
The paper presents a tutorial review of the models and methods that are used to characterize site amplification from the pairs of rock- and soil-site records, and introduces some new techniques with better theoretical foundations. The models and methods discussed include spectral and cross-spectral ratios, spectral ratios for downhole records, response spectral ratios, constant amplification factors, parametric models, physical models, and time-varying filters. An extensive analytical and numerical error analysis of spectral and cross-spectral ratios shows that probabilistically cross-spectral ratios give more reliable estimates of site amplification. Spectral ratios should not be used to determine site amplification from downhole-surface recording pairs because of the feedback in the downhole sensor. Response spectral ratios are appropriate for low frequencies, but overestimate the amplification at high frequencies. The best method to be used depends on how much precision is required in the estimates.
Case study: development of and stakeholder responses to a nursing home consumer information system.
O'Meara, Janis; Kitchener, Martin; Collier, Eric; Lyons, Margaret; de Billwiller-Kiss, Ana; Simon, Lisa Payne; Harrington, Charlene
2005-01-01
California Nursing Home Search (www.calnhs.org), launched in October 2002, provides information about nursing home quality to a broad range of stakeholders. This case study discusses the process of developing a consumer-oriented nursing home Web site and presents an analysis of postlaunch responses from a number of sources (i.e., media, outreach, Web site use, correspondence, meetings, interviews) to determine the impact of the site and how it can be improved and used as an example. Consumers found the Web site valuable, but some needed clarification on navigation. Providers had complaints about the use of quality ratings and concerns about public availability of the data. Most discharge planners and care managers do not use Internet resources to find facilities. Feedback, modifications, updates, and outreach are needed on a continuous basis to ensure the site is a helpful tool for all stakeholders.
Seedling growth responses to phosphorus reflect adult distribution patterns of tropical trees.
Zalamea, Paul-Camilo; Turner, Benjamin L; Winter, Klaus; Jones, F Andrew; Sarmiento, Carolina; Dalling, James W
2016-10-01
Soils influence tropical forest composition at regional scales. In Panama, data on tree communities and underlying soils indicate that species frequently show distributional associations to soil phosphorus. To understand how these associations arise, we combined a pot experiment to measure seedling responses of 15 pioneer species to phosphorus addition with an analysis of the phylogenetic structure of phosphorus associations of the entire tree community. Growth responses of pioneers to phosphorus addition revealed a clear tradeoff: species from high-phosphorus sites grew fastest in the phosphorus-addition treatment, while species from low-phosphorus sites grew fastest in the low-phosphorus treatment. Traits associated with growth performance remain unclear: biomass allocation, phosphatase activity and phosphorus-use efficiency did not correlate with phosphorus associations; however, phosphatase activity was most strongly down-regulated in response to phosphorus addition in species from high-phosphorus sites. Phylogenetic analysis indicated that pioneers occur more frequently in clades where phosphorus associations are overdispersed as compared with the overall tree community, suggesting that selection on phosphorus acquisition and use may be strongest for pioneer species with high phosphorus demand. Our results show that phosphorus-dependent growth rates provide an additional explanation for the regional distribution of tree species in Panama, and possibly elsewhere. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
Development of a Moldable, Biodegradable Polymeric Bone Repair Material
1994-03-30
minimally encapsulated by fibrous tissue. Histomorphometric analysis of day 14 specimens showed a very mild foreign body response in terms of area. This...significant visual evidence of foreign body response seen for any Atrix test article. A mass of dense fibrotic tissue was found near the defect site...article in the defect and medullary cavity. The test article was minimally encapsulated by fibrotic tissue. Histomorphometric analysis showed this
NASA Astrophysics Data System (ADS)
Gannon, J. P.; Zimmer, M. A.
2017-12-01
The balance between surficial watershed properties (e.g. topography) and subsurface watershed properties (e.g. soil depth, horizonation) as drivers of runoff characteristics is not well understood. We addressed this knowledge gap by investigating long-term ( 20 years) daily discharge and precipitation for 74 USGS in-stream gaging sites across the Appalachian Mountain and Piedmont regions of North Carolina, USA. Gaging sites included in this analysis had <10% developed land and ranged in size from 14.1 - 4390 km2. Thirty-five sites were located in the Piedmont Region, which is typically classified as a low relief landscape with deep, highly weathered soils and shallow, clay-rich soil horizons. Thirty-nine sites were located in the Appalachian Mountains, which are typically classified as a steeper landscape with comparatively shallow, highly weathered soils. We calculated an annual baseflow index (BFI) for each site to investigate the changes in stormflow generation in each gaged watershed. We also conducted a stepwise multiple linear regression analysis to identify which landscape and climate characteristics contributed to individual watershed runoff responses. Our results showed that watersheds in the Appalachian Mountain region had BFIs that were generally higher and less dependent on the rainfall of the corresponding year, as compared to the Piedmont region. This suggests that while the Appalachian Mountain region is steeper with comparatively shallower soils, the effective storage is higher than watersheds in the Piedmont. In contrast, while the Piedmont region has deep soils, the shallow soil horizon impeding layers produce flashier runoff responses and a shorter watershed memory. More work is needed to further understand the balance between critical zone structure and watershed structure on runoff responses across a range of landscape types.
1980-11-01
the rapid, partial removal or covering of contamination to reduce the radiation exposure rate as quickly as practicable to a point where priority work ...should be responsible for planning and implementing all decontamination activities. He could be a city en- gineer, public works engineer, industrial safety...responsibility for a local civil defense or emergency preparedness program. DisaterAnalysis - A review and determination of the extent of damage sufere bya
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rodgers, A; Tkalcic, H; McCallen, D
2005-03-18
Between 2001-2004 the Las Vegas Seismic Response Project has sought to understand the response of Las Vegas Valley (LVV) to seismic excitation. In this study, the author report the findings of this project with an emphasis on ground motions in LVV from nuclear explosions at the Nevada Test Site (NTS). These ground motions are used to understand building structural response and damage as well as human perception. Historical nuclear explosion observations are augmented with earthquake recordings from a temporary deployment of seismometers to improve spatial coverage of LVV. The nuclear explosions were conducted between 1968 and 1989 and were recordedmore » at various sites within Las Vegas. The data from past nuclear tests were used to constrain ground motions in LVV and to gain a predictive capability of ground motions for possible future nuclear tests at NTS. Analysis of ground motion data includes peak ground motions (accelerations and velocities) and amplification of basin sites relative to hard rock sites (site response). Site response was measured with the Standard Spectral Ratios (SSR) technique relative to hard rock reference sites on the periphery of LVV. The site response curves indicate a strong basin amplification of up to a factor of ten at frequencies between 0.5-2 Hz. Amplifications are strongest in the central and northern portions of LVV, where the basin is deeper than 1 km based on the reported basin depths of Langenheim et al (2001a). They found a strong correlation between amplification and basin depth and shallow shear wave velocities. Amplification below 1 Hz is strongly controlled by slowness-averaged shear velocities to depths of 30 and 100 meters. Depth averaged shear velocities to 10 meters has modest control of amplifications between 1-3 Hz. Modeling reveals that low velocity material in the shallow layers (< 200 m) effectively controls amplification. They developed a method to scale nuclear explosion ground motion time series to sites around LVV that have no historical record of explosions. The method is also used to scale nuclear explosion ground motions to different yields. They also present a range of studies to understand basin structure and response performed on data from the temporary deployment.« less
1995-06-01
ground water temperature readings. Temperature affects the types and growth rates of bacteria that can be supported in the ground water environment...vaies for hydrogeologic conditions similar to those found at the site. The results of this study suggest that dissolved-phase BTEX contamination...OC information to help substantiate the overall site conditions . Please 0 address. Response: Sample depth designations have been clarified in Table
Choi, Ji Won; Lim, Hyung Woo; Lee, Jin Young; Lee, Won Il; Lee, Eun Kyung; Chang, Choo Hoon; Yang, Jae Young
2016-01-01
Background It is widely accepted that cervical interlaminar steroid injection (CIESI) is more effective in treating radicular pain than axial neck pain, but without direct comparison. And the differences of effect after CIESI according to MRI findings are inconsistent. In this retrospective study, we evaluated the therapeutic response of CIESI according to pain sites, durations, MRI findings, and other predictive factors altogether, unlike previous studies, which evaluated them separately. Methods The medical records of 128 patients who received fluoroscopy guided CIESI were analyzed. We evaluated the therapeutic response (more than a 50% reduction on the visual analog scale [VAS] by their second visit) after CIESI by (1) pain site; neck pain without radicular pain/radicular pain with or without neck pain, (2) pain duration; acute/chronic (more than 6 month), and (3) findings of MRI; herniated intervertebral disc (HIVD)/spinal stenosis, respectively and altogether. Results Eighty-eight patients (68%) responded to CIESI, and there were no significant differences in demographic data, initial VAS score, or laboratory findings. And there were no significant differences in the response rate relating to pain site, pain duration, or MRI findings, respectively. In additional analysis, acute radicular pain with HIVD patients showed significantly better response than chronic neck pain with spinal stenosis (P = 0.04). Conclusions We cannot find any sole predictive factor of therapeutic response to the CIESI. But the patients having acute radicular pain with HIVD showed the best response, and those having other chronic neck pain showed the worst response to CIESI. PMID:27103964
Wang, F; Samudio, I; Safe, S
2001-01-01
The rat creatine kinase B (CKB) gene is induced by estrogen in the uterus, and constructs containing rat CKB gene promoter inserts are highly estrogen-responsive in cell culture. Analysis of the upstream -568 to -523 region of the promoter in HeLa cells has identified an imperfect palindromic estrogen response element (ERE) that is required for hormone inducibility. Analysis of the CKB gene promoter in MCF-7 breast cancer cells confirmed that pCKB7 (containing the -568 to -523 promoter insert) was estrogen-responsive in transient transfection studies. However, mutation and deletion analysis of this region of the promoter showed that two GC-rich sites and the concensus ERE were functional cis-elements that bound estrogen receptor alpha (ERalpha)/Sp1 and ERalpha proteins, respectively. The role of these elements was confirmed in gel mobility shift and chromatin immunoprecipitation assays and transfection studies in MDA-MB-231 and Schneider Drosophila SL-2 cells. These results show that transcriptional activation of CKB by estrogen is dependent, in part, on ERalpha/Sp1 action which is cell context-dependent. Copyright 2001 Wiley-Liss, Inc.
Three-dimensional site response at KiK-net downhole arrays
Thompson, Eric M.; Tanaka, Yasuo; Baise, Laurie G.; Kayen, Robert E.
2010-01-01
Ground motions at two Kiban-Kyoshin Network (KiK-net) strong motion downhole array sites in Hokkaido, Japan (TKCH08 in Taiki and TKCH05 in Honbetsu) illustrate the importance of three-dimensional (3D) site effects. These sites recorded the M8.0 2003 Tokachi-Oki earthquake, with recorded accelerations above 0.4 g at both sites as well as numerous ground motions from smaller events. Weak ground motions indicate that site TKCH08 is well modeled with the assumption of plane SH waves traveling through a 1D medium (SH1D), while TKCH05 is characteristic of a poor fit to the SH1D theoretical response. We hypothesized that the misfit at TKCH05results from the heterogeneity of the subsurface. To test this hypothesis, we measured four S-wave velocity profiles in the vicinity (< 300 m) of each site with the spectral analysis of surface waves (SASW) method. This KiK-net site pair is ideal for assessing the relative importance of 3D site effects and nonlinear site effects. The linear ground motions at TKCH05 isolate the 3D site effects, as we hypothesized from the linear ground motions and confirmed with our subsequent SASW surveys. The Tokachi-Oki time history at TKCH08 isolates the effects of nonlinearity from spatial heterogeneity because the 3D effects are negligible. The Tokachi-Oki time history at TKCH05 includes both nonlinear and 3D site effects. Comparisons of the accuracy of the SH1D model predictions of these surface time histories from the downhole time histories indicates that the 3D site effects are at least as important as nonlinear effects in this case. The errors associated with the assumption of a 1D medium and 1D wave propagation will be carried into a nonlinear analysis that relies on these same assumptions. Thus, the presence of 3D effects should be ruled out prior to a 1D nonlinear analysis. The SH1D residuals show that 3D effects can be mistaken for nonlinear effects.
Full long-term design response analysis of a wave energy converter
Coe, Ryan G.; Michelen, Carlos; Eckert-Gallup, Aubrey; ...
2017-09-21
Efficient design of wave energy converters requires an accurate understanding of expected loads and responses during the deployment lifetime of a device. A study has been conducted to better understand best-practices for prediction of design responses in a wave energy converter. A case-study was performed in which a simplified wave energy converter was analyzed to predict several important device design responses. The application and performance of a full long-term analysis, in which numerical simulations were used to predict the device response for a large number of distinct sea states, was studied. Environmental characterization and selection of sea states for thismore » analysis at the intended deployment site were performed using principle-components analysis. The full long-term analysis applied here was shown to be stable when implemented with a relatively low number of sea states and convergent with an increasing number of sea states. As the number of sea states utilized in the analysis was increased, predicted response levels did not change appreciably. Furthermore, uncertainty in the response levels was reduced as more sea states were utilized.« less
Full long-term design response analysis of a wave energy converter
DOE Office of Scientific and Technical Information (OSTI.GOV)
Coe, Ryan G.; Michelen, Carlos; Eckert-Gallup, Aubrey
Efficient design of wave energy converters requires an accurate understanding of expected loads and responses during the deployment lifetime of a device. A study has been conducted to better understand best-practices for prediction of design responses in a wave energy converter. A case-study was performed in which a simplified wave energy converter was analyzed to predict several important device design responses. The application and performance of a full long-term analysis, in which numerical simulations were used to predict the device response for a large number of distinct sea states, was studied. Environmental characterization and selection of sea states for thismore » analysis at the intended deployment site were performed using principle-components analysis. The full long-term analysis applied here was shown to be stable when implemented with a relatively low number of sea states and convergent with an increasing number of sea states. As the number of sea states utilized in the analysis was increased, predicted response levels did not change appreciably. Furthermore, uncertainty in the response levels was reduced as more sea states were utilized.« less
James M. Vose; Jose Manuel Maass
1999-01-01
Long-term monitoring of ecological and hydrological processes is critical to understanding ecosystem function and responses to anthropogenic and natural disturbances. Much of the world's knowledge of ecosystem responses to disturbance comes from long-term studies on gaged watersheds. However, there are relatively few long-term sites due to the large cost and...
Oltedal, Leif; Bartsch, Hauke; Sørhaug, Ole Johan Evjenth; Kessler, Ute; Abbott, Christopher; Dols, Annemieke; Stek, Max L; Ersland, Lars; Emsell, Louise; van Eijndhoven, Philip; Argyelan, Miklos; Tendolkar, Indira; Nordanskog, Pia; Hamilton, Paul; Jorgensen, Martin Balslev; Sommer, Iris E; Heringa, Sophie M; Draganski, Bogdan; Redlich, Ronny; Dannlowski, Udo; Kugel, Harald; Bouckaert, Filip; Sienaert, Pascal; Anand, Amit; Espinoza, Randall; Narr, Katherine L; Holland, Dominic; Dale, Anders M; Oedegaard, Ketil J
2017-01-01
Major depression, currently the world's primary cause of disability, leads to profound personal suffering and increased risk of suicide. Unfortunately, the success of antidepressant treatment varies amongst individuals and can take weeks to months in those who respond. Electroconvulsive therapy (ECT), generally prescribed for the most severely depressed and when standard treatments fail, produces a more rapid response and remains the most effective intervention for severe depression. Exploring the neurobiological effects of ECT is thus an ideal approach to better understand the mechanisms of successful therapeutic response. Though several recent neuroimaging studies show structural and functional changes associated with ECT, not all brain changes associate with clinical outcome. Larger studies that can address individual differences in clinical and treatment parameters may better target biological factors relating to or predictive of ECT-related therapeutic response. We have thus formed the Global ECT-MRI Research Collaboration (GEMRIC) that aims to combine longitudinal neuroimaging as well as clinical, behavioral and other physiological data across multiple independent sites. Here, we summarize the ECT sample characteristics from currently participating sites, and the common data-repository and standardized image analysis pipeline developed for this initiative. This includes data harmonization across sites and MRI platforms, and a method for obtaining unbiased estimates of structural change based on longitudinal measurements with serial MRI scans. The optimized analysis pipeline, together with the large and heterogeneous combined GEMRIC dataset, will provide new opportunities to elucidate the mechanisms of ECT response and the factors mediating and predictive of clinical outcomes, which may ultimately lead to more effective personalized treatment approaches.
NASA Astrophysics Data System (ADS)
Assimaki, D.; Li, W.; Steidl, J. M.; Schmedes, J.
2007-12-01
The assessment of strong motion site response is of great significance, both for mitigating seismic hazard and for performing detailed analyses of earthquake source characteristics. There currently exists, however, large degree of uncertainty concerning the mathematical model to be employed for the computationally efficient evaluation of local site effects, and the site investigation program necessary to evaluate the nonlinear input model parameters and ensure cost-effective predictions; and while site response observations may provide critical constraints on interpretation methods, the lack of a statistically significant number of in-situ strong motion records prohibits statistical analyses to be conducted and uncertainties to be quantified based entirely on field data. In this paper, we combine downhole observations and broadband ground motion synthetics for characteristic site conditions the Los Angeles Basin, and investigate the variability in ground motion estimation introduced by the site response assessment methodology. In particular, site-specific regional velocity and attenuation structures are initially compiled using near-surface geotechnical data collected at downhole geotechnical arrays, inverse low-strain velocity and attenuation profiles at these sites obtained by inversion of weak motion records and the crustal velocity structure at the corresponding locations obtained from the Southern California Earthquake Centre Community Velocity Model. Successively, broadband ground motions are simulated by means of a hybrid low/high-frequency finite source model with correlated random parameters for rupture scenaria of weak, medium and large magnitude events (M =3.5-7.5). Observed estimates of site response at the stations of interest are first compared to the ensemble of approximate and incremental nonlinear site response models. Parametric studies are next conducted for each fixed magnitude (fault geometry) scenario by varying the source-to-site distance and source parameters for the ensemble of site conditions. Elastic, equivalent linear and nonlinear simulations are implemented for the deterministic description of the base-model velocity and attenuation structures and nonlinear soil properties, to examine the variability in ground motion predictions as a function of ground motion amplitude and frequency content, and nonlinear site response methodology. The modeling site response uncertainty introduced in the broadband ground motion predictions is reported by means of the COV of site amplification, defined as the ratio of the predicted peak ground acceleration (PGA) and spectral acceleration (SA) at short and long periods to the corresponding intensity measure on the ground surface of a typical NEHRP BC boundary profile (Vs30=760m/s), for the ensemble of approximate and incremental nonlinear models implemented. A frequency index is developed to describe the frequency content of incident ground motion. In conjunction with the rock-outcrop acceleration level, this index is used to identify the site and ground motion conditions where incremental nonlinear analyses should be employed in lieu of approximate methodologies. Finally, the effects of modeling uncertainty in ground response analysis is evaluated in the estimation of site amplification factors, which are successively compared to recently published factors of the New Generation Attenuation Relations (NGA) and the currently employed Seismic Code Provisions (NEHRP).
Toxicology profiles of chemical and radiological contaminants at Hanford
DOE Office of Scientific and Technical Information (OSTI.GOV)
Harper, B.L.; Strenge, D.L.; Stenner, R.D.
1995-07-01
This document summarizes toxicology information required under Section 3.3 (Toxicity Assessment) of HSRAM, and can also be used to develop the short toxicology profiles required in site assessments (described in HSRAM, Section 3.3.5). Toxicology information is used in the dose-response step of the risk assessment process. The dose-response assessment describes the quantitative relationship between the amount of exposure to a substance and the extent of toxic injury or disease. Data are derived from animal studies or, less frequently, from studies in exposed human populations. The risks of a substance cannot be ascertained with any degree of confidence unless dose-response relationsmore » are quantified. This document summarizes dose-response information available from the US Environmental Protection Agency (EPA). The contaminants selected for inclusion in this document represent most of the contaminants found at Hanford (both radiological and chemical), based on sampling and analysis performed during site investigations, and historical information on waste disposal practices at the Hanford Site.« less
We are testing the influence of wetland morphology (protected vs. riverine) and biogeography (upper vs. lower Great Lakes) on algal responses to nutrients in Great Lakes Coastal wetlands. Principal components analysis using nutrient-specific GIS data was used to select sites wit...
NASA Astrophysics Data System (ADS)
Dhakal, Yadab P.; Kubo, Hisahiko; Suzuki, Wataru; Kunugi, Takashi; Aoi, Shin; Fujiwara, Hiroyuki
2016-04-01
Strong ground motions from the 2015 Mw 7.8 Gorkha, Nepal, earthquake and its eight aftershocks recorded by a strong-motion seismograph at Kantipath (KATNP), Kathmandu, were analyzed to assess the ground-motion characteristics and site effects at this location. Remarkably large elastic pseudo-velocity responses exceeding 300 cm/s at 5 % critical damping were calculated for the horizontal components of the mainshock recordings at peak periods of 4-5 s. Conversely, the short-period ground motions of the mainshock were relatively weak despite the proximity of the site to the source fault. The horizontal components of all large-magnitude (Mw ≥ 6.3) aftershock recordings showed peak pseudo-velocity responses at periods of 3-4 s. Ground-motion prediction equations (GMPEs) describing the Nepal Himalaya region have not yet been developed. A comparison of the observational data with GMPEs for Japan showed that with the exception of the peak ground acceleration (PGA) of the mainshock, the observed PGAs and peak ground velocities at the KATNP site are generally well described by the GMPEs for crustal and plate interface events. A comparison of the horizontal-to-vertical ( H/ V) spectral ratios for the S-waves of the mainshock and aftershock recordings suggested that the KATNP site experienced a considerable nonlinear site response, which resulted in the reduced amplitudes of short-period ground motions. The GMPEs were found to underestimate the response values at the peak periods (approximately 4-5 s) of the large-magnitude events. The deep subsurface velocity model of the Kathmandu basin has not been well investigated. Therefore, a one-dimensional velocity model was constructed for the deep sediments beneath the recording station based on an analysis of the H/ V spectral ratios for S-wave coda from aftershock recordings, and it was revealed that the basin sediments strongly amplified the long-period components of the ground motions of the mainshock and large-magnitude aftershocks.
Stochastic ground motion simulation
Rezaeian, Sanaz; Xiaodan, Sun; Beer, Michael; Kougioumtzoglou, Ioannis A.; Patelli, Edoardo; Siu-Kui Au, Ivan
2014-01-01
Strong earthquake ground motion records are fundamental in engineering applications. Ground motion time series are used in response-history dynamic analysis of structural or geotechnical systems. In such analysis, the validity of predicted responses depends on the validity of the input excitations. Ground motion records are also used to develop ground motion prediction equations(GMPEs) for intensity measures such as spectral accelerations that are used in response-spectrum dynamic analysis. Despite the thousands of available strong ground motion records, there remains a shortage of records for large-magnitude earthquakes at short distances or in specific regions, as well as records that sample specific combinations of source, path, and site characteristics.
Sensitivity analysis of machine-learning models of hydrologic time series
NASA Astrophysics Data System (ADS)
O'Reilly, A. M.
2017-12-01
Sensitivity analysis traditionally has been applied to assessing model response to perturbations in model parameters, where the parameters are those model input variables adjusted during calibration. Unlike physics-based models where parameters represent real phenomena, the equivalent of parameters for machine-learning models are simply mathematical "knobs" that are automatically adjusted during training/testing/verification procedures. Thus the challenge of extracting knowledge of hydrologic system functionality from machine-learning models lies in their very nature, leading to the label "black box." Sensitivity analysis of the forcing-response behavior of machine-learning models, however, can provide understanding of how the physical phenomena represented by model inputs affect the physical phenomena represented by model outputs.As part of a previous study, hybrid spectral-decomposition artificial neural network (ANN) models were developed to simulate the observed behavior of hydrologic response contained in multidecadal datasets of lake water level, groundwater level, and spring flow. Model inputs used moving window averages (MWA) to represent various frequencies and frequency-band components of time series of rainfall and groundwater use. Using these forcing time series, the MWA-ANN models were trained to predict time series of lake water level, groundwater level, and spring flow at 51 sites in central Florida, USA. A time series of sensitivities for each MWA-ANN model was produced by perturbing forcing time-series and computing the change in response time-series per unit change in perturbation. Variations in forcing-response sensitivities are evident between types (lake, groundwater level, or spring), spatially (among sites of the same type), and temporally. Two generally common characteristics among sites are more uniform sensitivities to rainfall over time and notable increases in sensitivities to groundwater usage during significant drought periods.
Development of a site analysis tool for distributed wind projects
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shaw, Shawn
The Cadmus Group, Inc., in collaboration with the National Renewable Energy Laboratory (NREL) and Encraft, was awarded a grant from the Department of Energy (DOE) to develop a site analysis tool for distributed wind technologies. As the principal investigator for this project, Mr. Shawn Shaw was responsible for overall project management, direction, and technical approach. The product resulting from this project is the Distributed Wind Site Analysis Tool (DSAT), a software tool for analyzing proposed sites for distributed wind technology (DWT) systems. This user-friendly tool supports the long-term growth and stability of the DWT market by providing reliable, realistic estimatesmore » of site and system energy output and feasibility. DSAT-which is accessible online and requires no purchase or download of software-is available in two account types; Standard: This free account allows the user to analyze a limited number of sites and to produce a system performance report for each; and Professional: For a small annual fee users can analyze an unlimited number of sites, produce system performance reports, and generate other customizable reports containing key information such as visual influence and wind resources. The tool’s interactive maps allow users to create site models that incorporate the obstructions and terrain types present. Users can generate site reports immediately after entering the requisite site information. Ideally, this tool also educates users regarding good site selection and effective evaluation practices.« less
Uus, K; Bamford, J; Taylor, R
2006-01-01
The primary aim of this analysis was to prospectively assess the full economic costs associated with implementing Newborn Hearing Screening Programme (NHSP) based on a two-stage screen, transient evoked otoacoustic emissions followed, if there is no clear response, by automated auditory brainstem response. Economic data were also collected from the Infant Distraction Test Screening (IDTS) service performed by health visitors at around eight months of age, which was being phased out. A comparison of costs and outcomes associated with NHSP and IDTS was conducted. 20 NHSP sites were invited to provide detailed cost data on NHSP implementation and 14 of these sites were selected to provide costs on the IDTS service that was being supplanted. There was marked variability in the costs. Given the higher yield of NHSP sites, the average cost per case detected across NHSP sites (31,410 pounds/case) was approximately half that of IDTS sites (69,919 pounds/case). Including family costs, the average total cost per case of NHSP (34,826 pounds/case) was almost a quarter of IDTS (117,942 pounds/case). Family costs and cost per case associated with NHSP are considerably less than that with IDTS. These findings support the policy of implementation of NHSP and the phasing out of the IDTS.
Vs30 mapping at selected sites within the Greater Accra Metropolitan Area
NASA Astrophysics Data System (ADS)
Nortey, Grace; Armah, Thomas K.; Amponsah, Paulina
2018-06-01
A large part of Accra is underlain by a complex distribution of shallow soft soils. Within seismically active zones, these soils hold the most potential to significantly amplify seismic waves and cause severe damage, especially to structures sited on soils lacking sufficient stiffness. This paper presents preliminary site classification for the Greater Accra Metropolitan Area of Ghana (GAMA), using experimental data from two-dimensional (2-D) Multichannel Analysis of Surface Wave (MASW) technique. The dispersive characteristics of fundamental mode Rayleigh type surface waves were utilized for imaging the shallow subsurface layers (approx. up to 30 m depth) by estimating the 1D (depth) and 2D (depth and surface location) shear wave velocities at 5 selected sites. The average shear wave velocity for 30 m depth (Vs30), which is critical in evaluating the site response of the upper 30 m, was estimated and used for the preliminary site classification of the GAM area, as per NEHRP (National Earthquake Hazards Reduction Program). Based on the Vs30 values obtained in the study, two common site types C, and D corresponding to shallow (>6 m < 30 m) weathered rock and deep (up 30 m thick) stiff soils respectively, have been identified within the study area. Lower velocity profiles are inferred for the residual soils (sandy to silty clays), derived from the Accraian Formation that lies mainly within Accra central. Stiffer soil sites lie to the north of Accra, and to the west near Nyanyano. The seismic response characteristics over the residual soils in the GAMA have become apparent using the MASW technique. An extensive site effect map and a more robust probabilistic seismic hazard analysis can now be efficiently built for the metropolis, by considering the site classes and design parameters obtained from this study.
NASA Astrophysics Data System (ADS)
Silva, Lucas C. R.; Gómez-Guerrero, Armando; Doane, Timothy A.; Horwath, William R.
2015-06-01
In this study we show that the effect of rising atmospheric CO2 levels on forest productivity is influenced by changes in nutrient availability caused by nitrogen (N) deposition. We used a dual-isotope approach (δ15N and δ13C), combined with dendrochronological and nutritional analyses, to evaluate the response of two dominant tree species in natural forest ecosystems near Mexico City (Pinus hartwegii—pine; Abies religiosa—fir). Our analysis focuses on changes that occurred over the past 50 years at two sites, one under high and one under low N deposition rates. Analyses of carbon isotope composition indicate increasing water-use efficiency in response to rising CO2 levels for both species and sites but this effect did not lead to improved tree growth. The magnitude and direction of shifts in 13C discrimination indicate a process of acclimation that varied with the rate of N deposition and species traits. Since the 1960s, strong negative responses to N deposition have been observed in fir trees, which showed altered foliar nutrition and growth decline, while the negative impacts of N deposition on pine trees remained undetectable until the 1990s. In recent years, both species have shown significant growth decline under high N deposition despite increasing atmospheric CO2. Multivariate analysis of leaf nutrients indicates that growth decline was prompted by depleted soil macronutrient (P, K, and Ca) and micronutrient (Cu, Fe, Zn, and Mn) availability. At both sites, fir trees were a better indicator of N deposition due to differences in canopy rainfall interception.
Sinai, A; Crone, N E; Wied, H M; Franaszczuk, P J; Miglioretti, D; Boatman-Reich, D
2009-01-01
We compared intracranial recordings of auditory event-related responses with electrocortical stimulation mapping (ESM) to determine their functional relationship. Intracranial recordings and ESM were performed, using speech and tones, in adult epilepsy patients with subdural electrodes implanted over lateral left cortex. Evoked N1 responses and induced spectral power changes were obtained by trial averaging and time-frequency analysis. ESM impaired perception and comprehension of speech, not tones, at electrode sites in the posterior temporal lobe. There was high spatial concordance between ESM sites critical for speech perception and the largest spectral power (100% concordance) and N1 (83%) responses to speech. N1 responses showed good sensitivity (0.75) and specificity (0.82), but poor positive predictive value (0.32). Conversely, increased high-frequency power (>60Hz) showed high specificity (0.98), but poorer sensitivity (0.67) and positive predictive value (0.67). Stimulus-related differences were observed in the spatial-temporal patterns of event-related responses. Intracranial auditory event-related responses to speech were associated with cortical sites critical for auditory perception and comprehension of speech. These results suggest that the distribution and magnitude of intracranial auditory event-related responses to speech reflect the functional significance of the underlying cortical regions and may be useful for pre-surgical functional mapping.
Intracranial mapping of auditory perception: Event-related responses and electrocortical stimulation
Sinai, A.; Crone, N.E.; Wied, H.M.; Franaszczuk, P.J.; Miglioretti, D.; Boatman-Reich, D.
2010-01-01
Objective We compared intracranial recordings of auditory event-related responses with electrocortical stimulation mapping (ESM) to determine their functional relationship. Methods Intracranial recordings and ESM were performed, using speech and tones, in adult epilepsy patients with subdural electrodes implanted over lateral left cortex. Evoked N1 responses and induced spectral power changes were obtained by trial averaging and time-frequency analysis. Results ESM impaired perception and comprehension of speech, not tones, at electrode sites in the posterior temporal lobe. There was high spatial concordance between ESM sites critical for speech perception and the largest spectral power (100% concordance) and N1 (83%) responses to speech. N1 responses showed good sensitivity (0.75) and specificity (0.82), but poor positive predictive value (0.32). Conversely, increased high-frequency power (>60 Hz) showed high specificity (0.98), but poorer sensitivity (0.67) and positive predictive value (0.67). Stimulus-related differences were observed in the spatial-temporal patterns of event-related responses. Conclusions Intracranial auditory event-related responses to speech were associated with cortical sites critical for auditory perception and comprehension of speech. Significance These results suggest that the distribution and magnitude of intracranial auditory event-related responses to speech reflect the functional significance of the underlying cortical regions and may be useful for pre-surgical functional mapping. PMID:19070540
Comparison of fish and macroinvertebrates as bioindicators of Neotropical streams.
Ruaro, Renata; Gubiani, Éder André; Cunico, Almir Manoel; Moretto, Yara; Piana, Pitágoras Augusto
2016-01-01
The biomonitoring of aquatic ecosystems in developing countries faces several limitations, especially related to gathering resources. The present study aimed at comparing the responses of fish and benthic macroinvertebrates to environmental change, to identify which group best indicates the differences between reference and impacted streams in southern Brazil. We determined reference and impacted sites based on physical and chemical variables of the water. For the analysis and comparison of biological responses, we calculated 22 metrics and submitted them to a discriminant analysis. We selected from this analysis only six metrics, which showed that the two studied assemblages respond differently to environmental change. A larger number of metrics were selected for macroinvertebrates than for fish in the separate analysis. The metrics selected for macroinvertebrates in the pooled analysis (i.e., fish and macroinvertebrates together) were different from those selected in the separate analysis for macroinvertebrates alone. However, the metrics selected for fish in the pooled analysis were the same selected in the separate analysis for fish alone. The macroinvertebrate assemblage was more effective for distinguishing reference from impacted sites. We suggest the use of macroinvertebrates as bioindicators of Neotropical streams, especially in situations in which time and money are short.
Sutherland, Jayne S.; Lalor, Maeve K.; Black, Gillian F.; Ambrose, Lyn R.; Loxton, Andre G.; Chegou, Novel N.; Kassa, Desta; Mihret, Adane; Howe, Rawleigh; Mayanja-Kizza, Harriet; Gomez, Marie P.; Donkor, Simon; Franken, Kees; Hanekom, Willem; Klein, Michel R.; Parida, Shreemanta K.; Boom, W. Henry; Thiel, Bonnie A.; Crampin, Amelia C.; Ota, Martin; Walzl, Gerhard; Ottenhoff, Tom H. M.; Dockrell, Hazel M.; Kaufmann, Stefan H. E.
2013-01-01
Background Tuberculosis (TB) remains a global health threat with 9 million new cases and 1.4 million deaths per year. In order to develop a protective vaccine, we need to define the antigens expressed by Mycobacterium tuberculosis (Mtb), which are relevant to protective immunity in high-endemic areas. Methods We analysed responses to 23 Mtb antigens in a total of 1247 subjects with different HIV and TB status across 5 geographically diverse sites in Africa (South Africa, The Gambia, Ethiopia, Malawi and Uganda). We used a 7-day whole blood assay followed by IFN-γ ELISA on the supernatants. Antigens included PPD, ESAT-6 and Ag85B (dominant antigens) together with novel resuscitation-promoting factors (rpf), reactivation proteins, latency (Mtb DosR regulon-encoded) antigens, starvation-induced antigens and secreted antigens. Results There was variation between sites in responses to the antigens, presumably due to underlying genetic and environmental differences. When results from all sites were combined, HIV- subjects with active TB showed significantly lower responses compared to both TST- and TST+ contacts to latency antigens (Rv0569, Rv1733, Rv1735, Rv1737) and the rpf Rv0867; whilst responses to ESAT-6/CFP-10 fusion protein (EC), PPD, Rv2029, TB10.3, and TB10.4 were significantly higher in TST+ contacts (LTBI) compared to TB and TST- contacts fewer differences were seen in subjects with HIV co-infection, with responses to the mitogen PHA significantly lower in subjects with active TB compared to those with LTBI and no difference with any antigen. Conclusions Our multi-site study design for testing novel Mtb antigens revealed promising antigens for future vaccine development. The IFN-γ ELISA is a cheap and useful tool for screening potential antigenicity in subjects with different ethnic backgrounds and across a spectrum of TB and HIV infection states. Analysis of cytokines other than IFN-γ is currently on-going to determine correlates of protection, which may be useful for vaccine efficacy trials. PMID:24040170
Sutherland, Jayne S; Lalor, Maeve K; Black, Gillian F; Ambrose, Lyn R; Loxton, Andre G; Chegou, Novel N; Kassa, Desta; Mihret, Adane; Howe, Rawleigh; Mayanja-Kizza, Harriet; Gomez, Marie P; Donkor, Simon; Franken, Kees; Hanekom, Willem; Klein, Michel R; Parida, Shreemanta K; Boom, W Henry; Thiel, Bonnie A; Crampin, Amelia C; Ota, Martin; Walzl, Gerhard; Ottenhoff, Tom H M; Dockrell, Hazel M; Kaufmann, Stefan H E
2013-01-01
Tuberculosis (TB) remains a global health threat with 9 million new cases and 1.4 million deaths per year. In order to develop a protective vaccine, we need to define the antigens expressed by Mycobacterium tuberculosis (Mtb), which are relevant to protective immunity in high-endemic areas. We analysed responses to 23 Mtb antigens in a total of 1247 subjects with different HIV and TB status across 5 geographically diverse sites in Africa (South Africa, The Gambia, Ethiopia, Malawi and Uganda). We used a 7-day whole blood assay followed by IFN-γ ELISA on the supernatants. Antigens included PPD, ESAT-6 and Ag85B (dominant antigens) together with novel resuscitation-promoting factors (rpf), reactivation proteins, latency (Mtb DosR regulon-encoded) antigens, starvation-induced antigens and secreted antigens. There was variation between sites in responses to the antigens, presumably due to underlying genetic and environmental differences. When results from all sites were combined, HIV- subjects with active TB showed significantly lower responses compared to both TST(-) and TST(+) contacts to latency antigens (Rv0569, Rv1733, Rv1735, Rv1737) and the rpf Rv0867; whilst responses to ESAT-6/CFP-10 fusion protein (EC), PPD, Rv2029, TB10.3, and TB10.4 were significantly higher in TST(+) contacts (LTBI) compared to TB and TST(-) contacts fewer differences were seen in subjects with HIV co-infection, with responses to the mitogen PHA significantly lower in subjects with active TB compared to those with LTBI and no difference with any antigen. Our multi-site study design for testing novel Mtb antigens revealed promising antigens for future vaccine development. The IFN-γ ELISA is a cheap and useful tool for screening potential antigenicity in subjects with different ethnic backgrounds and across a spectrum of TB and HIV infection states. Analysis of cytokines other than IFN-γ is currently on-going to determine correlates of protection, which may be useful for vaccine efficacy trials.
Maintenance Plan for the Composite Analysis of the Hanford Site, Southeast Washington.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lehman, L. L.; Nichols, W. E.
The U.S. Department of Energy (DOE) manuals for radioactive waste management, DOE M 435.1-1 Chg 21 and DOE-STD-5002-2017, require that the Hanford Site maintain site performance assessments and composite analyses (CAs). This document describes the plan for maintaining the CA that supports waste disposal and remedial actions for the Hanford Site. An initial CA of the site was issued in 1998, conditionally approved in 1999, received further analysis to satisfy conditions in an addendum in 2001, and was approved in 2002. This document meets the maintenance plan requirements described in DOE M 435.1-1 Chg 2 and DOE-STD-5002-2017 and implements themore » requirements of the disposal authorization related to the CA for the U.S. Department of Energy, Richland Operations Office, the responsible field office, and its contractors.« less
Uncertainty in Vs30-based site response
Thompson, Eric M.; Wald, David J.
2016-01-01
Methods that account for site response range in complexity from simple linear categorical adjustment factors to sophisticated nonlinear constitutive models. Seismic‐hazard analysis usually relies on ground‐motion prediction equations (GMPEs); within this framework site response is modeled statistically with simplified site parameters that include the time‐averaged shear‐wave velocity to 30 m (VS30) and basin depth parameters. Because VS30 is not known in most locations, it must be interpolated or inferred through secondary information such as geology or topography. In this article, we analyze a subset of stations for which VS30 has been measured to address effects of VS30 proxies on the uncertainty in the ground motions as modeled by GMPEs. The stations we analyze also include multiple recordings, which allow us to compute the repeatable site effects (or empirical amplification factors [EAFs]) from the ground motions. Although all methods exhibit similar bias, the proxy methods only reduce the ground‐motion standard deviations at long periods when compared to GMPEs without a site term, whereas measured VS30 values reduce the standard deviations at all periods. The standard deviation of the ground motions are much lower when the EAFs are used, indicating that future refinements of the site term in GMPEs have the potential to substantially reduce the overall uncertainty in the prediction of ground motions by GMPEs.
Study of Site Response in the Seattle and Tacoma Basins, Washington, Using Spectral Ratio Methods
NASA Astrophysics Data System (ADS)
Keshvardoost, R.; Wolf, L. W.
2014-12-01
Sedimentary basins are known to have a pronounced influence on earthquake-generated ground motions, affecting both predominant frequencies and wave amplification. These site characteristics are important elements in estimating ground shaking and seismic hazard. In this study, we use three-component broadband and strong motion seismic data from three recent earthquakes to determine site response characteristics in the Seattle and Tacoma basins, Washington. Resonant frequencies and relative amplification of ground motions were determined using Fourier spectral ratios of velocity and acceleration records from the 2012 Mw 6.1 Vancouver Island earthquake, the 2012 Mw 7.8 Queen Charlotte Island earthquake, and the 2014 Mw 6.6 Vancouver Island earthquake. Recordings from sites within and adjacent to the Seattle and Tacoma basins were selected for the study based on their signal to noise ratios. Both the Standard Spectral Ratio (SSR) and the Horizontal-to-Vertical Spectral Ratio (HVSR) methods were used in the analysis, and results from each were compared to examine their agreement and their relation to local geology. Although 57% of the sites (27 out of 48) exhibited consistent results between the two methods, other sites varied considerably. In addition, we use data from the Seattle Liquefaction Array (SLA) to evaluate the site response at 4 different depths. Results indicate that resonant frequencies remain the same at different depths but amplification decreases significantly over the top 50 m.
NASA Astrophysics Data System (ADS)
Pilz, Marco; Parolai, Stefano; Leyton, Felipe; Campos, Jaime; Zschau, Jochen
2009-08-01
Situated in an active tectonic region, Santiago de Chile, the country's capital with more than six million inhabitants, faces tremendous earthquake risk. Macroseismic data for the 1985 Valparaiso event show large variations in the distribution of damage to buildings within short distances, indicating strong effects of local sediments on ground motion. Therefore, a temporary seismic network was installed in the urban area for recording earthquake activity and a study was carried out aiming to estimate site amplification derived from horizontal-to-vertical (H/V) spectral ratios from earthquake data (EHV) and ambient noise (NHV), as well as using the standard spectral ratio (SSR) technique with a nearby reference station located on igneous rock. The results lead to the following conclusions: (1) The analysis of earthquake data shows significant dependence on the local geological structure with respect to amplitude and duration. (2) An amplification of ground motion at frequencies higher than the fundamental one can be found. This amplification would not be found when looking at NHV ratios alone. (3) The analysis of NHV spectral ratios shows that they can only provide a lower bound in amplitude for site amplification. (4) P-wave site responses always show lower amplitudes than those derived by S waves, and sometimes even fail to provide some frequencies of amplification. (5) No variability in terms of time and amplitude is observed in the analysis of the H/V ratio of noise. (6) Due to the geological conditions in some parts of the investigated area, the fundamental resonance frequency of a site is difficult to estimate following standard criteria proposed by the SESAME consortium, suggesting that these are too restrictive under certain circumstances.
Analysis of biweight site chronologies: relative weights of individual trees over time
Kurt H. Riitters
1990-01-01
The relative weights on individual trees in a biweight site chronology can indicate the consistency of tree growth responses to macroclimate and can be the basis for stratifying trees in climate-growth analyses. This was explored with 45 years of ring-width indices for 200 trees from five even-aged jack pine (Pinus hanksiana Lamb.) stands. Average individual-tree...
Martin de Luis; Katarina Cufar; Alfredo Di Filippo; Klemen Novak; Andreas Papadopoulos; Gianluca Piovesan; Cyrille B. K. Rathgeber; José Raventós; Miguel Angel Saz; Kevin T. Smith
2013-01-01
We investigated the variability of the climate-growth relationship of Aleppo pine across its distribution range in the Mediterranean Basin. We constructed a network of tree-ring index chronologies from 63 sites across the region. Correlation function analysis identified the relationships of tree-ring index to climate factors for each site. We also estimated the...
Deployment Requirements for U.S. Coast Guard Pollution Response Equipment. Volume I. Analysis.
DOT National Transportation Integrated Search
1979-02-01
This report presents the results of a study to examine the siting and equipment requirements that would have to be met by the U.S. Coast Guard to provide an adequate response within six hours for spills of up to 10,000 tons (28,000,000 gals.)of oil i...
Deployment Requirements for U.S. Coast Guard Pollution Response Equipment : Volume I. Analysis.
DOT National Transportation Integrated Search
1978-02-01
This report presents the results of a study to examine the siting and equipment requirements that would have to be met by the U.S. Coast Guard to provide an adequate response within six hours for spills of up to 10,000 tons (28,000,000 gals.)of oil i...
Unmanned and Unattended Response Capability for Homeland Defense
DOE Office of Scientific and Technical Information (OSTI.GOV)
BENNETT, PHIL C.
2002-11-01
An analysis was conducted of the potential for unmanned and unattended robotic technologies for forward-based, immediate response capabilities that enables access and controlled task performance. The authors analyze high-impact response scenarios in conjunction with homeland security organizations, such as the NNSA Office of Emergency Response, the FBI, the National Guard, and the Army Technical Escort Unit, to cover a range of radiological, chemical and biological threats. They conducted an analysis of the potential of forward-based, unmanned and unattended robotic technologies to accelerate and enhance emergency and crisis response by Homeland Defense organizations. Response systems concepts were developed utilizing new technologiesmore » supported by existing emerging threats base technologies to meet the defined response scenarios. These systems will pre-position robotic and remote sensing capabilities stationed close to multiple sites for immediate action. Analysis of assembled systems included experimental activities to determine potential efficacy in the response scenarios, and iteration on systems concepts and remote sensing and robotic technologies, creating new immediate response capabilities for Homeland Defense.« less
NASA Astrophysics Data System (ADS)
Trostyansky, S. N.; Kalach, A. V.; Lavlinsky, V. V.; Lankin, O. V.
2018-03-01
Based on the analysis of the dynamic model of panel data by region, including fire statistics for surveillance sites and statistics of a set of regional socio-economic indicators, as well as the time of rapid response of the state fire service to fires, the probability of fires in the surveillance sites and the risk of human death in The result of such fires from the values of the corresponding indicators for the previous year, a set of regional social-economics factors, as well as regional indicators time rapid response of the state fire service in the fire. The results obtained are consistent with the results of the application to the fire risks of the model of a rational offender. Estimation of the economic equivalent of human life from data on surveillance objects for Russia, calculated on the basis of the analysis of the presented dynamic model of fire risks, correctly agrees with the known literary data. The results obtained on the basis of the econometric approach to fire risks allow us to forecast fire risks at the supervisory sites in the regions of Russia and to develop management solutions to minimize such risks.
Are Microbial Nanowires Responsible for Geoelectrical Changes at Hydrocarbon Contaminated Sites?
NASA Astrophysics Data System (ADS)
Hager, C.; Atekwana, E. A.; Gorby, Y. A.; Duris, J. W.; Allen, J. P.; Atekwana, E. A.; Ownby, C.; Rossbach, S.
2007-05-01
Significant advances in near-surface geophysics and biogeophysics in particular, have clearly established a link between geoelectrical response and the growth and enzymatic activities of microbes in geologic media. Recent studies from hydrocarbon contaminated sites suggest that the activities of distinct microbial populations, specifically syntrophic, sulfate reducing, and dissimilatory iron reducing microbial populations are a contributing factor to elevated sediment conductivity. However, a fundamental mechanistic understanding of the processes and sources resulting in the measured electrical response remains uncertain. The recent discovery of bacterial nanowires and their electron transport capabilities suggest that if bacterial nanowires permeate the subsurface, they may in part be responsible for the anomalous conductivity response. In this study we investigated the microbial population structure, the presence of nanowires, and microbial-induced alterations of a hydrocarbon contaminated environment and relate them to the sediments' geoelectrical response. Our results show that microbial communities varied substantially along the vertical gradient and at depths where hydrocarbons saturated the sediments, ribosomal intergenic spacer analysis (RISA) revealed signatures of microbial communities adapted to hydrocarbon impact. In contrast, RISA profiles from a background location showed little community variations with depth. While all sites showed evidence of microbial activity, a scanning electron microscope (SEM) study of sediment from the contaminated location showed pervasive development of "nanowire-like structures" with morphologies consistent with nanowires from laboratory experiments. SEM analysis suggests extensive alteration of the sediments by microbial Activity. We conclude that, excess organic carbon (electron donor) but limited electron acceptors in these environments cause microorganisms to produce nanowires to shuttle the electrons as they seek for distant electron acceptors. Hence, electron flow via bacterial nanowires may contribute to the geoelectrical response.
Research on response spectrum of dam based on scenario earthquake
NASA Astrophysics Data System (ADS)
Zhang, Xiaoliang; Zhang, Yushan
2017-10-01
Taking a large hydropower station as an example, the response spectrum based on scenario earthquake is determined. Firstly, the potential source of greatest contribution to the site is determined on the basis of the results of probabilistic seismic hazard analysis (PSHA). Secondly, the magnitude and epicentral distance of the scenario earthquake are calculated according to the main faults and historical earthquake of the potential seismic source zone. Finally, the response spectrum of scenario earthquake is calculated using the Next Generation Attenuation (NGA) relations. The response spectrum based on scenario earthquake method is less than the probability-consistent response spectrum obtained by PSHA method. The empirical analysis shows that the response spectrum of scenario earthquake considers the probability level and the structural factors, and combines the advantages of the deterministic and probabilistic seismic hazard analysis methods. It is easy for people to accept and provide basis for seismic engineering of hydraulic engineering.
DOE Office of Scientific and Technical Information (OSTI.GOV)
None
2004-04-17
The projects application goals are to: (1) To understand bacterial stress-response to the unique stressors in metal/radionuclide contamination sites; (2) To turn this understanding into a quantitative, data-driven model for exploring policies for natural and biostimulatory bioremediation; (3) To implement proposed policies in the field and compare results to model predictions; and (4) Close the experimental/computation cycle by using discrepancies between models and predictions to drive new measurements and construction of new models. The projects science goals are to: (1) Compare physiological and molecular response of three target microorganisms to environmental perturbation; (2) Deduce the underlying regulatory pathways that controlmore » these responses through analysis of phenotype, functional genomic, and molecular interaction data; (3) Use differences in the cellular responses among the target organisms to understand niche specific adaptations of the stress and metal reduction pathways; (4) From this analysis derive an understanding of the mechanisms of pathway evolution in the environment; and (5) Ultimately, derive dynamical models for the control of these pathways to predict how natural stimulation can optimize growth and metal reduction efficiency at field sites.« less
Lee, Li-Ang; Lo, Yu-Lun; Yu, Jen-Fang; Lee, Gui-She; Ni, Yung-Lun; Chen, Ning-Hung; Fang, Tuan-Jen; Huang, Chung-Guei; Cheng, Wen-Nuan; Li, Hsueh-Yu
2016-01-01
Snoring sounds generated by different vibrators of the upper airway may be useful indicators of obstruction sites in patients with obstructive sleep apnea hypopnea syndrome (OSAHS). This study aimed to investigate associations between snoring sounds, obstruction sites, and surgical responses (≥50% reduction in the apnea-hypopnea index [AHI] and <10 events/hour) in patients with OSAHS. This prospective cohort study recruited 36 OSAHS patients for 6-hour snoring sound recordings during in-lab full-night polysomnography, drug-induced sleep endoscopy (DISE), and relocation pharyngoplasty. All patients received follow-up polysomnography after 6 months. Fifteen (42%) patients with at least two complete obstruction sites defined by DISE were significantly, positively associated with maximal snoring sound intensity (40–300 Hz; odds ratio [OR], 1.25, 95% confidence interval [CI] 1.05–1.49) and body mass index (OR, 1.48, 95% CI 1.02–2.15) after logistic regression analysis. Tonsil obstruction was significantly, inversely correlated with mean snoring sound intensity (301–850 Hz; OR, 0.84, 95% CI 0.74–0.96). Moreover, baseline tonsil obstruction detected by either DISE or mean snoring sound intensity (301–850 Hz), and AHI could significantly predict the surgical response. Our findings suggest that snoring sound detection may be helpful in determining obstruction sites and predict surgical responses. PMID:27471038
Long, Andrew J.; Mahler, Barbara J.
2013-01-01
Many karst aquifers are rapidly filled and depleted and therefore are likely to be susceptible to changes in short-term climate variability. Here we explore methods that could be applied to model site-specific hydraulic responses, with the intent of simulating these responses to different climate scenarios from high-resolution climate models. We compare hydraulic responses (spring flow, groundwater level, stream base flow, and cave drip) at several sites in two karst aquifers: the Edwards aquifer (Texas, USA) and the Madison aquifer (South Dakota, USA). A lumped-parameter model simulates nonlinear soil moisture changes for estimation of recharge, and a time-variant convolution model simulates the aquifer response to this recharge. Model fit to data is 2.4% better for calibration periods than for validation periods according to the Nash–Sutcliffe coefficient of efficiency, which ranges from 0.53 to 0.94 for validation periods. We use metrics that describe the shapes of the impulse-response functions (IRFs) obtained from convolution modeling to make comparisons in the distribution of response times among sites and between aquifers. Time-variant IRFs were applied to 62% of the sites. Principal component analysis (PCA) of metrics describing the shapes of the IRFs indicates three principal components that together account for 84% of the variability in IRF shape: the first is related to IRF skewness and temporal spread and accounts for 51% of the variability; the second and third largely are related to time-variant properties and together account for 33% of the variability. Sites with IRFs that dominantly comprise exponential curves are separated geographically from those dominantly comprising lognormal curves in both aquifers as a result of spatial heterogeneity. The use of multiple IRF metrics in PCA is a novel method to characterize, compare, and classify the way in which different sites and aquifers respond to recharge. As convolution models are developed for additional aquifers, they could contribute to an IRF database and a general classification system for karst aquifers.
NASA Astrophysics Data System (ADS)
White, Joshua S.; Matthews, Jeanna N.; Stacy, John L.
2012-06-01
Phishing website analysis is largely still a time-consuming manual process of discovering potential phishing sites, verifying if suspicious sites truly are malicious spoofs and if so, distributing their URLs to the appropriate blacklisting services. Attackers increasingly use sophisticated systems for bringing phishing sites up and down rapidly at new locations, making automated response essential. In this paper, we present a method for rapid, automated detection and analysis of phishing websites. Our method relies on near real-time gathering and analysis of URLs posted on social media sites. We fetch the pages pointed to by each URL and characterize each page with a set of easily computed values such as number of images and links. We also capture a screen-shot of the rendered page image, compute a hash of the image and use the Hamming distance between these image hashes as a form of visual comparison. We provide initial results demonstrate the feasibility of our techniques by comparing legitimate sites to known fraudulent versions from Phishtank.com, by actively introducing a series of minor changes to a phishing toolkit captured in a local honeypot and by performing some initial analysis on a set of over 2.8 million URLs posted to Twitter over a 4 days in August 2011. We discuss the issues encountered during our testing such as resolvability and legitimacy of URL's posted on Twitter, the data sets used, the characteristics of the phishing sites we discovered, and our plans for future work.
Lamb, T J; Graham, A L; Le Goff, L; Allen, J E
2005-09-01
This study examines the capacity of the mammalian host to fully compartmentalize the response to infection with type 1 vs. type 2 inducing organisms that infect different sites in the body. For this purpose, C57BL/6 mice were infected with the rodent filarial nematode Litomosoides sigmodontis followed by footpad infection with the protozoan parasite Leishmania major. In this host, nematode infection is established in the thoracic cavity but no microfilariae circulate in the bloodstream. We utilized quantitative ELISPOT analysis of IL-4 and IFN-gamma producing cells to assess cytokine bias and response magnitude in the lymph nodes draining the sites of infection as well as more systemic responses in the spleen and serum. Contrary to other systems where co-infection has a major impact on bias, cytokine ratios were unaltered in either local lymph node. The most notable effect of co-infection was an unexpected increase in the magnitude of the IFN-gamma response to L. major in mice previously infected with L. sigmodontis. Further, lesion development was significantly delayed in these mice. Thus, despite the ability of the immune system to appropriately compartmentalize the immune response, interactions between responses at distinct infection sites can alter disease progression.
Response of spectral vegetation indices to soil moisture in grasslands and shrublands
Zhang, Li; Ji, Lei; Wylie, Bruce K.
2011-01-01
The relationships between satellite-derived vegetation indices (VIs) and soil moisture are complicated because of the time lag of the vegetation response to soil moisture. In this study, we used a distributed lag regression model to evaluate the lag responses of VIs to soil moisture for grasslands and shrublands at Soil Climate Analysis Network sites in the central and western United States. We examined the relationships between Moderate Resolution Imaging Spectroradiometer (MODIS)-derived VIs and soil moisture measurements. The Normalized Difference Vegetation Index (NDVI) and Normalized Difference Water Index (NDWI) showed significant lag responses to soil moisture. The lag length varies from 8 to 56 days for NDVI and from 16 to 56 days for NDWI. However, the lag response of NDVI and NDWI to soil moisture varied among the sites. Our study suggests that the lag effect needs to be taken into consideration when the VIs are used to estimate soil moisture.
Posttest analysis of the 1:6-scale reinforced concrete containment
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pfeiffer, P.A.; Kennedy, J.M.; Marchertas, A.H.
A prediction of the response of the Sandia National Laboratories 1:6- scale reinforced concrete containment model test was made by Argonne National Laboratory. ANL along with nine other organizations performed a detailed nonlinear response analysis of the 1:6-scale model containment subjected to overpressurization in the fall of 1986. The two-dimensional code TEMP-STRESS and the three-dimensional NEPTUNE code were utilized (1) to predict the global response of the structure, (2) to identify global failure sites and the corresponding failure pressures and (3) to identify some local failure sites and pressure levels. A series of axisymmetric models was studied with the two-dimensionalmore » computer program TEMP-STRESS. The comparison of these pretest computations with test data from the containment model has provided a test for the capability of the respective finite element codes to predict global failure modes, and hence serves as a validation of these codes. Only the two-dimensional analyses will be discussed in this paper. 3 refs., 10 figs.« less
Seismic responses of two adjacent buildings. I. Data and analyses
Çelebi, Mehmet
1993-01-01
In this two-part paper, responses of two, adjacent, seven-story buildings in Norwalk, California, to the Whittier-Narrows, Calif, earthquake of Oct. 1, 1987 are studied. Building A, instrumented according to code recommendations, and building B, extensively instrumented, are offset by 16.3 m from one another. The data set includes motions from the superstructure of both buildings, from a downhole below the foundation of building B, and from three free-field sites. Part I of the paper includes descriptions of the buildings, site, instrumentation, and analysis of the data of each building. System identification and spectral analysis techniques are employed in part I. Building A has identical first-mode frequencies of 0.65 Hz for both building axes. The strong-motion response characteristics of building A are considerably different than those determined from low-amplitude tests. Building B has fundamental modes at 0.76 Hz and 0.83 Hz in the major and minor axes, respectively. Torsional and diaphragm effects in building B are negligible.
NASA Astrophysics Data System (ADS)
Rouini, N.; Lepley, K. S.; Messaoudene, M.
2017-12-01
Remote sensing and dendrochronology are valuable tools in the face of climate change and land use change, yet the connection between these resources remains largely unexploited. Research on forest fragmentation is mainly focused on animal groups, while our work focuses on tree communities. We link tree-rings and remotely-sensed Normalized Difference Vegetation Index (NDVI) using seasonal correlation analysis to investigate forest primary productivity response to fragmentation. Tree core samples from Quercus afares have been taken from two sites within the Guerrouche Forest in northeastern Algeria. The first site is located within a very fragmented area while the second site is intact. Fragmentation is estimated to have occurred with the construction of a road in 1930. We find raw tree-ring width chronologies from each site reveal growth release in the disturbed site after 1930. The means of each chronology for the 1930 to 2016 period are statistically different (p < 0.01). Based on these preliminary results we hypothesize that reconstructed primary productivity (NDVI) will be higher in the fragmented site after fragmentation took place.
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Empirical Green's function analysis: Taking the next step
Hough, S.E.
1997-01-01
An extension of the empirical Green's function (EGF) method is presented that involves determination of source parameters using standard EGF deconvolution, followed by inversion for a common attenuation parameter for a set of colocated events. Recordings of three or more colocated events can thus be used to constrain a single path attenuation estimate. I apply this method to recordings from the 1995-1996 Ridgecrest, California, earthquake sequence; I analyze four clusters consisting of 13 total events with magnitudes between 2.6 and 4.9. I first obtain corner frequencies, which are used to infer Brune stress drop estimates. I obtain stress drop values of 0.3-53 MPa (with all but one between 0.3 and 11 MPa), with no resolved increase of stress drop with moment. With the corner frequencies constrained, the inferred attenuation parameters are very consistent; they imply an average shear wave quality factor of approximately 20-25 for alluvial sediments within the Indian Wells Valley. Although the resultant spectral fitting (using corner frequency and ??) is good, the residuals are consistent among the clusters analyzed. Their spectral shape is similar to the the theoretical one-dimensional response of a layered low-velocity structure in the valley (an absolute site response cannot be determined by this method, because of an ambiguity between absolute response and source spectral amplitudes). I show that even this subtle site response can significantly bias estimates of corner frequency and ??, if it is ignored in an inversion for only source and path effects. The multiple-EGF method presented in this paper is analogous to a joint inversion for source, path, and site effects; the use of colocated sets of earthquakes appears to offer significant advantages in improving resolution of all three estimates, especially if data are from a single site or sites with similar site response.
Test-retest and between-site reliability in a multicenter fMRI study.
Friedman, Lee; Stern, Hal; Brown, Gregory G; Mathalon, Daniel H; Turner, Jessica; Glover, Gary H; Gollub, Randy L; Lauriello, John; Lim, Kelvin O; Cannon, Tyrone; Greve, Douglas N; Bockholt, Henry Jeremy; Belger, Aysenil; Mueller, Bryon; Doty, Michael J; He, Jianchun; Wells, William; Smyth, Padhraic; Pieper, Steve; Kim, Seyoung; Kubicki, Marek; Vangel, Mark; Potkin, Steven G
2008-08-01
In the present report, estimates of test-retest and between-site reliability of fMRI assessments were produced in the context of a multicenter fMRI reliability study (FBIRN Phase 1, www.nbirn.net). Five subjects were scanned on 10 MRI scanners on two occasions. The fMRI task was a simple block design sensorimotor task. The impulse response functions to the stimulation block were derived using an FIR-deconvolution analysis with FMRISTAT. Six functionally-derived ROIs covering the visual, auditory and motor cortices, created from a prior analysis, were used. Two dependent variables were compared: percent signal change and contrast-to-noise-ratio. Reliability was assessed with intraclass correlation coefficients derived from a variance components analysis. Test-retest reliability was high, but initially, between-site reliability was low, indicating a strong contribution from site and site-by-subject variance. However, a number of factors that can markedly improve between-site reliability were uncovered, including increasing the size of the ROIs, adjusting for smoothness differences, and inclusion of additional runs. By employing multiple steps, between-site reliability for 3T scanners was increased by 123%. Dropping one site at a time and assessing reliability can be a useful method of assessing the sensitivity of the results to particular sites. These findings should provide guidance toothers on the best practices for future multicenter studies.
Wagle, Pradeep; Xiao, Xiangming; Kolb, Thomas E.; ...
2016-05-31
Here, understanding the differences in carbon and water vapor fluxes of spatially distributed evergreen needleleaf forests (ENFs) is crucial for accurately estimating regional or global carbon and water budgets and when predicting the responses of ENFs to current and future climate. We compared the fluxes of ten AmeriFlux ENF sites to investigate cross-site variability in net ecosystem exchange of carbon (NEE), gross primary production (GPP), and evapotranspiration (ET). We used wavelet cross-correlation analysis to examine responses of NEE and ET to common climatic drivers over multiple timescales and also determined optimum values of air temperature (T a) and vapor pressuremore » deficit (VPD) for NEE and ET.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wagle, Pradeep; Xiao, Xiangming; Kolb, Thomas E.
Here, understanding the differences in carbon and water vapor fluxes of spatially distributed evergreen needleleaf forests (ENFs) is crucial for accurately estimating regional or global carbon and water budgets and when predicting the responses of ENFs to current and future climate. We compared the fluxes of ten AmeriFlux ENF sites to investigate cross-site variability in net ecosystem exchange of carbon (NEE), gross primary production (GPP), and evapotranspiration (ET). We used wavelet cross-correlation analysis to examine responses of NEE and ET to common climatic drivers over multiple timescales and also determined optimum values of air temperature (T a) and vapor pressuremore » deficit (VPD) for NEE and ET.« less
Li, Jie; Overall, Christopher C.; Johnson, Rudd C.; ...
2015-09-21
The alternative sigma factor σ E functions to maintain bacterial homeostasis and membrane integrity in response to extracytoplasmic stress by regulating thousands of genes both directly and indirectly. The transcriptional regulatory network governed by σ E in Salmonella and E. coli has been examined using microarray, however a genome-wide analysis of σ E–binding sites inSalmonella has not yet been reported. We infected macrophages with Salmonella Typhimurium over a select time course. Using chromatin immunoprecipitation followed by high-throughput DNA sequencing (ChIP-seq), 31 σ E–binding sites were identified. Seventeen sites were new, which included outer membrane proteins, a quorum-sensing protein, a cellmore » division factor, and a signal transduction modulator. The consensus sequence identified for σ E in vivo binding was similar to the one previously reported, except for a conserved G and A between the -35 and -10 regions. One third of the σ E–binding sites did not contain the consensus sequence, suggesting there may be alternative mechanisms by which σ E modulates transcription. By dissecting direct and indirect modes of σ E-mediated regulation, we found that σ E activates gene expression through recognition of both canonical and reversed consensus sequence. Lastly, new σ E regulated genes ( greA, luxS, ompA and ompX) are shown to be involved in heat shock and oxidative stress responses.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Jie; Overall, Christopher C.; Johnson, Rudd C.
The alternative sigma factor σ E functions to maintain bacterial homeostasis and membrane integrity in response to extracytoplasmic stress by regulating thousands of genes both directly and indirectly. The transcriptional regulatory network governed by σ E in Salmonella and E. coli has been examined using microarray, however a genome-wide analysis of σ E–binding sites inSalmonella has not yet been reported. We infected macrophages with Salmonella Typhimurium over a select time course. Using chromatin immunoprecipitation followed by high-throughput DNA sequencing (ChIP-seq), 31 σ E–binding sites were identified. Seventeen sites were new, which included outer membrane proteins, a quorum-sensing protein, a cellmore » division factor, and a signal transduction modulator. The consensus sequence identified for σ E in vivo binding was similar to the one previously reported, except for a conserved G and A between the -35 and -10 regions. One third of the σ E–binding sites did not contain the consensus sequence, suggesting there may be alternative mechanisms by which σ E modulates transcription. By dissecting direct and indirect modes of σ E-mediated regulation, we found that σ E activates gene expression through recognition of both canonical and reversed consensus sequence. Lastly, new σ E regulated genes ( greA, luxS, ompA and ompX) are shown to be involved in heat shock and oxidative stress responses.« less
Shah, Nameeta; Lin, Biaoyang; Sibenaller, Zita; Ryken, Timothy; Lee, Hwahyung; Yoon, Jae-Geun; Rostad, Steven; Foltz, Greg
2011-01-07
O⁶-methylguanine DNA-methyltransferase (MGMT) promoter methylation has been identified as a potential prognostic marker for glioblastoma patients. The relationship between the exact site of promoter methylation and its effect on gene silencing, and the patient's subsequent response to therapy, is still being defined. The aim of this study was to comprehensively characterize cytosine-guanine (CpG) dinucleotide methylation across the entire MGMT promoter and to correlate individual CpG site methylation patterns to mRNA expression, protein expression, and progression-free survival. To best identify the specific MGMT promoter region most predictive of gene silencing and response to therapy, we determined the methylation status of all 97 CpG sites in the MGMT promoter in tumor samples from 70 GBM patients using quantitative bisulfite sequencing. We next identified the CpG site specific and regional methylation patterns most predictive of gene silencing and improved progression-free survival. Using this data, we propose a new classification scheme utilizing methylation data from across the entire promoter and show that an analysis based on this approach, which we call 3R classification, is predictive of progression-free survival (HR = 5.23, 95% CI [2.089-13.097], p<0.0001). To adapt this approach to the clinical setting, we used a methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) test based on the 3R classification and show that this test is both feasible in the clinical setting and predictive of progression free survival (HR = 3.076, 95% CI [1.301-7.27], p = 0.007). We discuss the potential advantages of a test based on this promoter-wide analysis and compare it to the commonly used methylation-specific PCR test. Further prospective validation of these two methods in a large independent patient cohort will be needed to confirm the added value of promoter wide analysis of MGMT methylation in the clinical setting.
Shah, Nameeta; Lin, Biaoyang; Sibenaller, Zita; Ryken, Timothy; Lee, Hwahyung; Yoon, Jae-Geun; Rostad, Steven; Foltz, Greg
2011-01-01
O6-methylguanine DNA-methyltransferase (MGMT) promoter methylation has been identified as a potential prognostic marker for glioblastoma patients. The relationship between the exact site of promoter methylation and its effect on gene silencing, and the patient's subsequent response to therapy, is still being defined. The aim of this study was to comprehensively characterize cytosine-guanine (CpG) dinucleotide methylation across the entire MGMT promoter and to correlate individual CpG site methylation patterns to mRNA expression, protein expression, and progression-free survival. To best identify the specific MGMT promoter region most predictive of gene silencing and response to therapy, we determined the methylation status of all 97 CpG sites in the MGMT promoter in tumor samples from 70 GBM patients using quantitative bisulfite sequencing. We next identified the CpG site specific and regional methylation patterns most predictive of gene silencing and improved progression-free survival. Using this data, we propose a new classification scheme utilizing methylation data from across the entire promoter and show that an analysis based on this approach, which we call 3R classification, is predictive of progression-free survival (HR = 5.23, 95% CI [2.089–13.097], p<0.0001). To adapt this approach to the clinical setting, we used a methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) test based on the 3R classification and show that this test is both feasible in the clinical setting and predictive of progression free survival (HR = 3.076, 95% CI [1.301–7.27], p = 0.007). We discuss the potential advantages of a test based on this promoter-wide analysis and compare it to the commonly used methylation-specific PCR test. Further prospective validation of these two methods in a large independent patient cohort will be needed to confirm the added value of promoter wide analysis of MGMT methylation in the clinical setting. PMID:21249131
Determination of Shear Wave Velocity in Offshore Terengganu for Ground Response Analysis
NASA Astrophysics Data System (ADS)
Mazlina, M.; Liew, M. S.; Adnan, A.; Harahap, I. S. H.; Hamid, N. A.
2018-04-01
Amount of vibration received in any location can be analysed by conducting ground response analysis. Even though there are three different methods available in this analysis, One Dimensional ground response analysis method has been widely used. Shear wave velocity is one of the key parameters in this analysis. A lot of correlations have been formulated to determine shear wave velocity with cone penetration test. In this study, correlations developed for Quaternary geological age have been selected. Six equations have been adopted comprise of all soil and soil type dependent correlations. Two platforms sites consist of clay and combination of clay and sand have been analysed. Shear velocity to be used in ground response analysis has been obtained. Results have been illustrated in graphs where shear velocity for each case has been plotted. In avoiding under or over predicting of shear wave velocity, the average of all soil and soil type dependent results will be used as final Vs value.
Earthquake ground motion: Chapter 3
Luco, Nicolas; Kircher, Charles A.; Crouse, C. B.; Charney, Finley; Haselton, Curt B.; Baker, Jack W.; Zimmerman, Reid; Hooper, John D.; McVitty, William; Taylor, Andy
2016-01-01
Most of the effort in seismic design of buildings and other structures is focused on structural design. This chapter addresses another key aspect of the design process—characterization of earthquake ground motion into parameters for use in design. Section 3.1 describes the basis of the earthquake ground motion maps in the Provisions and in ASCE 7 (the Standard). Section 3.2 has examples for the determination of ground motion parameters and spectra for use in design. Section 3.3 describes site-specific ground motion requirements and provides example site-specific design and MCER response spectra and example values of site-specific ground motion parameters. Section 3.4 discusses and provides an example for the selection and scaling of ground motion records for use in various types of response history analysis permitted in the Standard.
2015-07-01
electromagnetic induction (EMI) sensor. A total of 2,116 targets were selected from the dynamic data for cued investigation, and 1,398 targets were...geophysical mapping DSB Defense Science Board EE/CA Engineering Evaluation/Cost Analysis EMI electromagnetic induction ESTCP Environmental Security...performed a live site demonstration project using the Geometrics MetalMapper advanced electromagnetic induction (EMI) sensor at the former Southwestern
Hazardous Waste Site Analysis (Small Site Technology)
1990-08-01
Act HSRT - Hazardous Substance Response Trust (Superfund Trust) HSWA - Hdzardeus and Solid Waste Amendments (to RCRA) NAAQSD - National Ambient Air...impoundments (basically, any area where hazardous substances are located). * Under CERCLA, "Environment" includes surface and groundwater, ambient air, land...34 provisions with permit requirements for new source construction). " Ambient Air Quality standards (NAAQs) have been issued for six "criteria" pollutants
Foliar Analysis For Predicting Loblolly Pine Response To Phosphurus Fertilization on Wet Sites
Carol G. Wells; D.M. Crutchfield
1969-01-01
Loblolly pine (Pinus taeda L.) planted in the South Carolina Coastal Plain on wetsites which had been ditched and bedded responded to P fertilization. Under conditions of severe P deficiency) tree height increased 82 percent in 3 years from application of 25 or 50 pounds of P per acre at planting. First-year growth data from four sites show that...
NASA Astrophysics Data System (ADS)
West, Loyd Travis
Site characterization is an essential aspect of hazard analysis and the time-averaged shear-wave velocity to 30 m depth "Vs30" for site-class has become a critical parameter in site-specific and probabilistic hazard analysis. Yet, the general applicability of Vs30 can be ambiguous and much debate and research surround its application. In 2007, in part to mitigate the uncertainty associated with the use of Vs30 in Las Vegas Valley, the Clark County Building Department (CCBD) in collaboration with the Nevada System of Higher Education (NSHE) embarked on an endeavor to map Vs30 using a geophysical methods approach for a site-class microzonation map of over 500 square miles (1500 km2) in southern Nevada. The resulting dataset, described by Pancha et al. (2017), contains over 10,700 1D shear-wave-velocity-depth profiles (SWVP) that constitute a rich database of 3D shear-wave velocity structure that is both laterally and vertical heterogenous. This study capitalizes on the uniquely detailed and spatially dense CCBD database to carry out sensitivity tests on the detailed shear-wave-velocity-profiles and the Vs30 utilizing 1D and 3D site-response approaches. Sensitivity tests are derived from the 1D oscillator response of a single-degree-of-freedom-oscillator and from 3D finite-difference deterministic simulations up to 15 Hz frequency using similar model parameters. Results demonstrate that the detailed SWVP are amplifying ground motions by roughly 50% over the simple Vs30 models, above 4.6 Hz frequency. Numerical simulations also depict significant lateral resonance, focusing, and scattering from seismic energy attributed to the 3D small-scale heterogeneities of the shear-wave-velocity profiles that result in a 70% increase in peak ground velocity. Additionally, PGV ratio maps clearly establish that the increased amplification from the detailed SWVPs is consistent throughout the model space. As a corollary, this study demonstrates the use of finite-differencing numerical based methods to simulate ground motions at high frequencies, up to 15 Hz.
PHILIS (PORTABLE HIGH-THROUGHPUT INTEGRATED LABORATORY IDENTIFICATION SYSTEM)
These mobile laboratory assets, for the on-site analysis of chemical warfare agent (CWA) and toxic industrial compound (TIC) contaminated environmental samples, are part of the evolving Environmental Response Laboratory Network (ERLN).
Modeling learning in brain stem and cerebellar sites responsible for VOR plasticity
NASA Technical Reports Server (NTRS)
Quinn, K. J.; Didier, A. J.; Baker, J. F.; Peterson, B. W.
1998-01-01
A simple model of vestibuloocular reflex (VOR) function was used to analyze several hypotheses currently held concerning the characteristics of VOR plasticity. The network included a direct vestibular pathway and an indirect path via the cerebellum. An optimization analysis of this model suggests that regulation of brain stem sites is critical for the proper modification of VOR gain. A more physiologically plausible learning rule was also applied to this network. Analysis of these simulation results suggests that the preferred error correction signal controlling gain modification of the VOR is the direct output of the accessory optic system (AOS) to the vestibular nuclei vs. a signal relayed through the cerebellum via floccular Purkinje cells. The potential anatomical and physiological basis for this conclusion is discussed, in relation to our current understanding of the latency of the adapted VOR response.
Forget the Desk Job: Current Roles and Responsibilities in Entry-Level Reference Job Advertisements
ERIC Educational Resources Information Center
Detmering, Robert; Sproles, Claudene
2012-01-01
This study examines the evolving roles and responsibilities of entry-level academic reference positions, as stated in recent job advertisements posted on the American Library Association's JobLIST Web site and other sources. Findings from a content analysis of these advertisements indicate that current entry-level reference positions in academic…
NASA Astrophysics Data System (ADS)
Farrugia, D.; Galea, P. M.; D'Amico, S.
2016-12-01
The Maltese archipelago is characterised by a four layer sequence of limestones and clays. The Lower Coralline Limestone is the oldest exposed layer, overlain by the Globigerina Limestone. Some parts of the islands are characterised by Upper Coralline Limestone plateaus and hillcaps covering a soft Blue Clay layer which can be up to 75 m thick. The BC layer introduces a velocity inversion in the stratigraphy, and makes the Vs30 parameter not always suitable for seismic microzonation purposes. Such a layer may still produce amplification effects, however would not contribute to the numerical mean of Vs in the upper 30m. In this study, site response analysis for the Maltese islands is conducted, with particular attention being given to sites described above. Array and single-station measurements of ambient noise were first carried out at numerous sites in Malta. Surface wave dispersion and H/V curves were jointly inverted using a genetic algorithm, so that the Vs profiles were obtained. The stochastic extended-fault algorithm EXSIM was used to simulate historical and recent earthquakes at the bedrock. These were used in conjunction with the equivalent-linear programme SHAKE2000 to carry out the site-specific response analysis, using the derived geophysical models. Maps of ground motion parameters, such as peak ground acceleration and spectral accelerations, confirm that the clay, even when buried under a hard outcropping layer can still produce significant amplifications at frequencies which are of engineering interest when considering the recent urbanisation patterns. The results of this project will give important, and previously unavailable information and predictions about the behaviour of local lithotypes in response to earthquake ground shaking while also contributing knowledge about the issue of buried low velocity layers.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Coppersmith , Kevin J.; Bommer, Julian J.; Bryce, Robert W.
Under the sponsorship of the US Department of Energy (DOE) and the electric utility Energy Northwest, the Pacific Northwest National Laboratory (PNNL) is conducting a probabilistic seismic hazard analysis (PSHA) within the framework of a SSHAC Level 3 procedure (Senior Seismic Hazard Analysis Committee; Budnitz et al., 1997). Specifically, the project is being conducted following the guidelines and requirements specified in NUREG-2117 (USNRC, 2012b) and consistent with approach given in the American Nuclear Standard ANSI/ANS-2.29-2008 Probabilistic Seismic Hazard Analysis. The collaboration between DOE and Energy Northwest is spawned by the needs of both organizations for an accepted PSHA with highmore » levels of regulatory assurance that can be used for the design and safety evaluation of nuclear facilities. DOE committed to this study after performing a ten-year review of the existing PSHA, as required by DOE Order 420.1C. The study will also be used by Energy Northwest as a basis for fulfilling the NRC’s 10CFR50.54(f) requirement that the western US nuclear power plants conduct PSHAs in conformance with SSHAC Level 3 procedures. The study was planned and is being carried out in conjunction with a project Work Plan, which identifies the purpose of the study, the roles and responsibilities of all participants, tasks and their associated schedules, Quality Assurance (QA) requirements, and project deliverables. New data collection and analysis activities are being conducted as a means of reducing the uncertainties in key inputs to the PSHA. It is anticipated that the results of the study will provide inputs to the site response analyses at multiple nuclear facility sites within the Hanford Site and at the Columbia Generating Station.« less
NASA Astrophysics Data System (ADS)
Yee, Eric
In this thesis I address a series of issues related to ground failure and ground motions during earthquakes. A major component is the evaluation of cyclic volumetric strain behavior of unsaturated soils, more commonly known as seismic compression, from advanced laboratory testing. Another major component is the application of nonlinear and equivalent linear ground response analyses to large-strain problems involving highly nonlinear dynamic soil behavior. These two components are merged in the analysis of a truly unique and crucial field case history of nonlinear site response and seismic compression. My first topic concerns dynamic soil testing for relatively small strain dynamic soil properties such as threshold strains, gammatv. Such testing is often conducted using specialized devices such as dual-specimen simple-shear, as devices configured for large strain testing produce noisy signals in the small strain range. Working with a simple shear device originally developed for large-strain testing, I extend its low-strain capabilities by characterizing noisy signals and utilizing several statistical methods to extract meaningful responses in the small strain range. I utilize linear regression of a transformed variable to estimate the cyclic shear strain from a noisy signal and the confidence interval on its amplitude. I utilize Kernel regression with the Nadaraya-Watson estimator and a Gaussian kernel to evaluate vertical strain response. A practical utilization of these techniques is illustrated by evaluating threshold shear strains for volume change with a procedure that takes into account uncertainties in the measured shear and vertical strains. My second topic concerns the seismic compression characteristics of non-plastic and low-plasticity silty sands with varying fines content (10 ≤ FC ≤ 60%). Simple shear testing was performed on various sand-fines mixtures at a range of modified Proctor relative compaction levels ( RC) and degrees-of-saturation (S). Aside from the expected strong influence of RC, increasing fines content is found to generally decrease volume change for fines fractions consisting of silts and clayey silts with moderate to low plasticity. With truly non-plastic fines (rock flour), cyclic volume change increases with FC. Some materials also exhibit an effect of as-compacted saturation in which moderate saturation levels associated with high matric suction cause volume change to decrease. A preliminary empirical model to capture these effects is presented. The balance of the dissertation is related to a case history of strongly nonlinear site response and seismic compression associated with a free-field downhole array installed near the Service Hall at the Kashiwazaki-Kariwa nuclear power plant, which recorded strong ground motions from the Mw 6.6 2007 Niigata-ken Chuetsu-oki earthquake. Site conditions at the array consist of about 70 m of medium-dense sands overlying clayey bedrock, with ground water located at 45 m. Ground shaking at the bedrock level had geometric mean peak accelerations of 0.55 g which is reduced to 0.4 g at the ground surface, indicating nonlinear site response. Ground settlements of approximately 15+/-5 cm occurred at the site. A site investigation was performed to develop relevant soil properties for ground response and seismic compression analysis, including shear wave velocities, shear strength, relative density, and modulus reduction and damping curves. (Abstract shortened by UMI.)
Awate, Sunita; Wilson, Heather L; Singh, Baljit; Babiuk, Lorne A; Mutwiri, George
2014-05-01
Poly[di(sodiumcarboxylatoethylphenoxy)phosphazene] (PCEP) has shown great potential as a vaccine adjuvant, but the mechanisms that mediate its adjuvant activity have not been investigated. Previously, we had reported the potential of PCEP to induce cytokines and chemokines at the site of injection. Hence, we hypothesized that PCEP creates strong immuno-competent environment leading to recruitment of immune cells at the injection site. Intramuscular injection of mice with PCEP induced significant recruitment of neutrophils, macrophages, monocytes, dendritic cells (DCs), and lymphocytes at the site of injection as well as in the draining lymph nodes. Flow cytometric analysis showed that the majority of the recruited immune cells took up and/or were associated with PCEP at the injection site, with lymphocytes taking up PCEP in lesser quantity. Further, confocal analysis revealed intracytoplasmic lysosomal localization of PCEP in recruited immune cells. These observations suggest that recruitment of distinct immune cells to the site of injection site may be an important mechanism by which PCEP potentiates immune responses to antigens. Copyright © 2014 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sollome, James; Martin, Elizabeth
MicroRNAs (miRNAs) regulate gene expression by binding mRNA and inhibiting translation and/or inducing degradation of the associated transcripts. Expression levels of miRNAs have been shown to be altered in response to environmental toxicants, thus impacting cellular function and influencing disease risk. Transcription factors (TFs) are known to be altered in response to environmental toxicants and play a critical role in the regulation of miRNA expression. To date, environmentally-responsive TFs that are important for regulating miRNAs remain understudied. In a state-of-the-art analysis, we utilized an in silico bioinformatic approach to characterize potential transcriptional regulators of environmentally-responsive miRNAs. Using the miRStart database,more » genomic sequences of promoter regions for all available human miRNAs (n = 847) were identified and promoter regions were defined as − 1000/+500 base pairs from the transcription start site. Subsequently, the promoter region sequences of environmentally-responsive miRNAs (n = 128) were analyzed using enrichment analysis to determine overrepresented TF binding sites (TFBS). While most (56/73) TFs differed across environmental contaminants, a set of 17 TFs was enriched for promoter binding among miRNAs responsive to numerous environmental contaminants. Of these, one TF was common to miRNAs altered by the majority of environmental contaminants, namely SWI/SNF-related, matrix-associated, actin-dependent regulator of chromatin, subfamily A, member 3 (SMARCA3). These identified TFs represent candidate common transcriptional regulators of miRNAs perturbed by environmental toxicants. - Highlights: • Transcription factors that regulate environmentally-modulated miRNA expression are understudied • Transcription factor binding sites (TFBS) located within DNA promoter regions of miRNAs were identified. • Specific transcription factors may serve as master regulators of environmentally-mediated microRNA expression.« less
Douglas-fir displays a range of growth responses to ...
Douglas-fir (Pseudotsuga menziesii var. menziesii (Mirb.) Franco) growth in the Pacific Northwest is affected by climatic, edaphic factors and Swiss needle cast (SNC) disease. We examine Douglas-fir growth responses to temperature, dewpoint deficit (DPD), soil moisture, and SNC using time series intervention analysis of intra-annual tree-ring width data collected at nine forest stands in western Oregon, USA. The effects of temperature and SNC were similar in importance on tree growth at all sites. Previous-year DPD during the annual drought period was a key factor limiting growth regionally. Winter temperature was more important at high elevation cool sites, whereas summer temperature was more important at warm and dry sites. Growth rate increased with summer temperature to an optimum (Topt) then decreased at higher temperatures. At drier sites, temperature and water affected growth interactively such that Topt decreased with decreasing summer soil moisture. With climate change, growth rates increased at high elevation sites and declined at mid-elevation inland sites since ~1990. Growth response to climate is masked by SNC regionally. We conclude that as temperature rises and precipitation patterns shift towards wetter winters and drier summers, Douglas-fir will experience greater temperature and water stress and an increase in severity of SNC. By the end of the 21st century, climate models predict hotter, drier summers and warmer, wetter winters in the Pac
Cultrera, G.; Boore, D.M.; Joyner, W.B.; Dietel, C.M.
1999-01-01
Ground-motion recordings obtained at the Van Norman Complex from the 1994 Northridge, California, mainshock and its aftershocks constitute an excellent data set for the analysis of soil response as a function of ground-motion amplitude. We searched for nonlinear response by comparing the Fourier spectral ratios of two pairs of sites for ground motions of different levels, using data from permanent strong-motion recorders and from specially deployed portable instruments. We also compared the amplitude dependence of the observed ratios with the amplitude dependence of the theoretical ratios obtained from 1-D linear and 1-D equivalent-linear transfer functions, using recently published borehole velocity profiles at the sites to provide the low-strain material properties. One pair of sites was at the Jensen Filtration Plant (JFP); the other pair was the Rinaldi Receiving Station (RIN) and the Los Angeles Dam (LAD). Most of the analysis was concentrated on the motions at the Jensen sites. Portable seismometers were installed at the JFP to see if the motions inside the structures housing the strong-motion recorders differed from nearby free-field motions. We recorded seven small earthquakes and found that the high-frequency, low-amplitude motions in the administration building were about 0.3 of those outside the building. This means that the lack of high frequencies on the strong-motion recordings in the administration building relative to the generator building is not due solely to nonlinear soil effects. After taking into account the effects of the buildings, however, analysis of the suite of strong- and weak-motion recordings indicates that nonlinearity occurred at the JFP. As predicted by equivalent-linear analysis, the largest events (the mainshock and the 20 March 1994 aftershock) show a significant deamplification of the high-frequency motion relative to the weak motions from aftershocks occurring many months after the mainshock. The weak-motion aftershocks recorded within 12 hours of the mainshock, however, show a relative deamplification similar to that in the mainshock. The soil behavior may be a consequence of a pore pressure buildup during large-amplitude motion that was not dissipated until sometime later. The motions at (RIN) and (LAD) are from free-field sites. The comparison among spectral ratios of the mainshock, weak-motion coda waves of the mainshock, and an aftershock within ten minutes of the mainshock indicate that some nonlinearity occurred, presumably at (RIN) because it is the softer site. The spectral ratio for the mainshock is between that calculated for pure linear response and that calculated from the equivalent-linear method, using commonly used modulus reduction and damping ratio curves. In contrast to the Jensen sites, the ratio of motions soon after the high-amplitude portion of the mainshock differs from the ratio of the mainshock motions, indicating the mechanical properties of the soil returned to the low-strain values as the high-amplitude motion ended. This may indicate a type of nonlinear soil response different from that affecting motion at the Jensen administration building.
Responses of riparian reptile communities to damming and urbanization
Hunt, Stephanie D.; Guzy, Jacquelyn C.; Price, Steven J.; Halstead, Brian J.; Eskew, Evan A.; Dorcas, Michael E.
2013-01-01
Various anthropogenic pressures, including habitat loss, threaten reptile populations worldwide. Riparian zones are critical habitat for many reptile species, but these habitats are also frequently modified by anthropogenic activities. Our study investigated the effects of two riparian habitat modifications-damming and urbanization-on overall and species-specific reptile occupancy patterns. We used time-constrained search techniques to compile encounter histories for 28 reptile species at 21 different sites along the Broad and Pacolet Rivers of South Carolina. Using a hierarchical Bayesian analysis, we modeled reptile occupancy responses to a site's distance upstream from dam, distance downstream from dam, and percent urban land use. The mean occupancy response by the reptile community indicated that reptile occupancy and species richness were maximized when sites were farther upstream from dams. Species-specific occupancy estimates showed a similar trend of lower occupancy immediately upstream from dams. Although the mean occupancy response of the reptile community was positively related to distance downstream from dams, the occupancy response to distance downstream varied among species. Percent urban land use had little effect on the occupancy response of the reptile community or individual species. Our results indicate that the conditions of impoundments and subsequent degradation of the riparian zones upstream from dams may not provide suitable habitat for a number of reptile species.
Manzano-León, Natalia; Quintana, Raúl; Sánchez, Brisa; Serrano, Jesús; Vega, Elizabeth; Vázquez-López, Inés; Rojas-Bracho, Leonora; López-Villegas, Tania; O’Neill, Marie S.; Vadillo-Ortega, Felipe; De Vizcaya-Ruiz, Andrea; Rosas, Irma
2015-01-01
Spatial variation in particulate matter–related health and toxicological outcomes is partly due to its composition. We studied spatial variability in particle composition and induced cellular responses in Mexico City to complement an ongoing epidemiologic study. We measured elements, endotoxins, and polycyclic aromatic hydrocarbons in two particle size fractions collected in five sites. We compared the in vitro proinflammatory response of J774A.1 and THP-1 cells after exposure to particles, measuring subsequent TNFα and IL-6 secretion. Particle composition varied by site and size. Particle constituents were subjected to principal component analysis, identifying three components: C1 (Si, Sr, Mg, Ca, Al, Fe, Mn, endotoxin), C2 (polycyclic aromatic hydrocarbons), and C3 (Zn, S, Sb, Ni, Cu, Pb). Induced TNFα levels were higher and more heterogeneous than IL-6 levels. Cytokines produced by both cell lines only correlated with C1, suggesting that constituents associated with soil induced the inflammatory response and explain observed spatial differences. PMID:23335408
Gonsky, R; Deem, R L; Bream, J H; Young, H A; Targan, S R
2006-07-01
This study examines mucosa-specific regulatory pathways involved in modulation of interferon-gamma (IFN-gamma) in lamina propria T cells. Previous studies identified mucosa-specific CD2 cis-elements within the -204 to -108 bp IFNG promoter. Within this region, a single-site nucleotide polymorphism, -179G/T, imparts tumor necrosis factor-alpha stimulation of IFNG in peripheral blood lymphocytes, and is linked with accelerated AIDS progression. We discovered a putative estrogen response element (ERE) introduced by the -179T, which displays selective activation in peripheral blood mononuclear cells (PBMC) vs lamina propria mononuclear cells (LPMC). Transfection of PBMC with constructs containing the -179G or -179T site revealed CD2-mediated enhancement of the -179T compared to -179G allele, although, in LPMC, a similar level of expression was detected. Electrophoretic mobility shift assay (EMSA) analysis demonstrated CD2-mediated nucleoprotein binding to the -179T but not the -179G in PBMC. In LPMC, binding is constitutive to both -179G and -179T regions. Sequence and EMSA analysis suggests that the -179T allele creates an ERE-like binding site capable of binding recombinant estrogen receptor. Estrogen response element transactivation is enhanced by CD2 signaling, but inhibited by estrogen in PBMC but not in LPMC, although expression of estrogen receptor was similar. This is the first report to describe a potential molecular mechanism responsible for selectively controlling IFN-gamma production in LPMC.
NASA Astrophysics Data System (ADS)
Mahura, A. G.; Baklanov, A. A.
2003-10-01
The probabilistic analysis of atmospheric transport patterns from most important nuclear risk sites in the Euro-Arctic region is performed employing the methodology developed within the "Arctic Risk" Project of the NARP Programme (Baklanov and Mahura, 2003). The risk sites are the nuclear power plants in the Northwest Russia, Finland, Sweden, Lithuania, United Kingdom, and Germany as well as the Novaya Zemlya test site of Russia. The geographical regions of interest are the Northern and Central European countries and Northwest Russia. In this study, the employed research tools are the trajectory model to calculate a multiyear dataset of forward trajectories that originated over the risk site locations, and a set of statistical methods (including exploratory, cluster, and probability fields analyses) for analysis of trajectory modelling results. The probabilistic analyses of trajectory modelling results for eleven sites are presented as a set of various indicators of the risk sites possible impact on geographical regions and countries of interest. The nuclear risk site possible impact (on a particular geographical region, territory, country, site, etc.) due to atmospheric transport from the site after hypothetical accidental release of radioactivity can be properly estimated based on a combined interpretation of the indicators (simple characteristics, atmospheric transport pathways, airflow and fast transport probability fields, maximum reaching distance and maximum possible impact zone, typical transport time and precipitation factor fields) for different time periods (annual, seasonal, and monthly) for any selected site (both separately for each site or grouped for several sites) in the Euro-Arctic region. Such estimation could be the useful input information for the decision-making process, risk assessment, and planning of emergency response systems for sites of nuclear, chemical, and biological danger.
Predicting water table response to rainfall events, central Florida.
van Gaalen, J F; Kruse, S; Lafrenz, W B; Burroughs, S M
2013-01-01
A rise in water table in response to a rainfall event is a complex function of permeability, specific yield, antecedent soil-water conditions, water table level, evapotranspiration, vegetation, lateral groundwater flow, and rainfall volume and intensity. Predictions of water table response, however, commonly assume a linear relationship between response and rainfall based on cumulative analysis of water level and rainfall logs. By identifying individual rainfall events and responses, we examine how the response/rainfall ratio varies as a function of antecedent water table level (stage) and rainfall event size. For wells in wetlands and uplands in central Florida, incorporating stage and event size improves forecasting of water table rise by more than 30%, based on 10 years of data. At the 11 sites studied, the water table is generally least responsive to rainfall at smallest and largest rainfall event sizes and at lower stages. At most sites the minimum amount of rainfall required to induce a rise in water table is fairly uniform when the water table is within 50 to 100 cm of land surface. Below this depth, the minimum typically gradually increases with depth. These observations can be qualitatively explained by unsaturated zone flow processes. Overall, response/rainfall ratios are higher in wetlands and lower in uplands, presumably reflecting lower specific yields and greater lateral influx in wetland sites. Pronounced depth variations in rainfall/response ratios appear to correlate with soil layer boundaries, where corroborating data are available. © 2012, The Author(s). Groundwater © 2012, National Ground Water Association.
Site Response for Micro-Zonation from Small Earthquakes
NASA Astrophysics Data System (ADS)
Gospe, T. B.; Hutchings, L.; Liou, I. Y. W.; Jarpe, S.
2017-12-01
We have developed a method to obtain absolute geologic site response from small earthquakes using inexpensive instrumentation that enables us to perform micro-zonation inexpensively and in a short amount of time. We record small earthquakes (M<3) at several sites simultaneously and perform inversion to obtain actual absolute site response. The key to the inversion is that recordings at several stations from an earthquake have the same moment, source corner frequency and whole path Q effect on their spectra, but have individual Kappa and spectral amplification as a function of frequency. When these source and path effects are removed and corrections for different propagation distances are performed, we are left with actual site response. We develop site response functions from 0.5 to 25.0 Hz. Cities situated near active and dangerous faults experience small earthquakes on a regular basis. We typically record at least ten small earthquakes over time to stabilize the uncertainly. Of course, dynamic soil modeling is necessary to scale our linear site response to non-linear regime for large earthquakes. Our instrumentation is very inexpensive and virtually disposable, and can be placed throughout a city at a high density. Operation only requires turning on a switch, and data processing is automated to minimize human labor. We have installed a test network and implemented our full methodology in upper Napa Valley, California where there is variable geology and nearby rock outcrop sites, and a supply of small earthquakes from the nearby Geysers development area. We test several methbods of obtaining site response. We found that rock sites have a site response of their own and distort the site response estimate based upon spectral ratios with soil sites. Also, rock sites may not even be available near all sites throughout a city. Further, H/V site response estimates from earthquakes are marginally better, but vertical motion also has a site response of its own. H/V spectral ratios of noise don't provide accurate site response estimates either. Vs30 only provides one amplification number and doesn't account for the variable three-dimensional structure beneath sites. We conclude that absolute site response obtained directly from earthquakes is the best, and possibly, the only way to get accurate site response estimates.
Comprehensive sieve analysis of breakthrough HIV-1 sequences in the RV144 vaccine efficacy trial.
Edlefsen, Paul T; Rolland, Morgane; Hertz, Tomer; Tovanabutra, Sodsai; Gartland, Andrew J; deCamp, Allan C; Magaret, Craig A; Ahmed, Hasan; Gottardo, Raphael; Juraska, Michal; McCoy, Connor; Larsen, Brendan B; Sanders-Buell, Eric; Carrico, Chris; Menis, Sergey; Kijak, Gustavo H; Bose, Meera; Arroyo, Miguel A; O'Connell, Robert J; Nitayaphan, Sorachai; Pitisuttithum, Punnee; Kaewkungwal, Jaranit; Rerks-Ngarm, Supachai; Robb, Merlin L; Kirys, Tatsiana; Georgiev, Ivelin S; Kwong, Peter D; Scheffler, Konrad; Pond, Sergei L Kosakovsky; Carlson, Jonathan M; Michael, Nelson L; Schief, William R; Mullins, James I; Kim, Jerome H; Gilbert, Peter B
2015-02-01
The RV144 clinical trial showed the partial efficacy of a vaccine regimen with an estimated vaccine efficacy (VE) of 31% for protecting low-risk Thai volunteers against acquisition of HIV-1. The impact of vaccine-induced immune responses can be investigated through sieve analysis of HIV-1 breakthrough infections (infected vaccine and placebo recipients). A V1/V2-targeted comparison of the genomes of HIV-1 breakthrough viruses identified two V2 amino acid sites that differed between the vaccine and placebo groups. Here we extended the V1/V2 analysis to the entire HIV-1 genome using an array of methods based on individual sites, k-mers and genes/proteins. We identified 56 amino acid sites or "signatures" and 119 k-mers that differed between the vaccine and placebo groups. Of those, 19 sites and 38 k-mers were located in the regions comprising the RV144 vaccine (Env-gp120, Gag, and Pro). The nine signature sites in Env-gp120 were significantly enriched for known antibody-associated sites (p = 0.0021). In particular, site 317 in the third variable loop (V3) overlapped with a hotspot of antibody recognition, and sites 369 and 424 were linked to CD4 binding site neutralization. The identified signature sites significantly covaried with other sites across the genome (mean = 32.1) more than did non-signature sites (mean = 0.9) (p < 0.0001), suggesting functional and/or structural relevance of the signature sites. Since signature sites were not preferentially restricted to the vaccine immunogens and because most of the associations were insignificant following correction for multiple testing, we predict that few of the genetic differences are strongly linked to the RV144 vaccine-induced immune pressure. In addition to presenting results of the first complete-genome analysis of the breakthrough infections in the RV144 trial, this work describes a set of statistical methods and tools applicable to analysis of breakthrough infection genomes in general vaccine efficacy trials for diverse pathogens.
Comprehensive Sieve Analysis of Breakthrough HIV-1 Sequences in the RV144 Vaccine Efficacy Trial
Edlefsen, Paul T.; Rolland, Morgane; Hertz, Tomer; Tovanabutra, Sodsai; Gartland, Andrew J.; deCamp, Allan C.; Magaret, Craig A.; Ahmed, Hasan; Gottardo, Raphael; Juraska, Michal; McCoy, Connor; Larsen, Brendan B.; Sanders-Buell, Eric; Carrico, Chris; Menis, Sergey; Bose, Meera; Arroyo, Miguel A.; O’Connell, Robert J.; Nitayaphan, Sorachai; Pitisuttithum, Punnee; Kaewkungwal, Jaranit; Rerks-Ngarm, Supachai; Robb, Merlin L.; Kirys, Tatsiana; Georgiev, Ivelin S.; Kwong, Peter D.; Scheffler, Konrad; Pond, Sergei L. Kosakovsky; Carlson, Jonathan M.; Michael, Nelson L.; Schief, William R.; Mullins, James I.; Kim, Jerome H.; Gilbert, Peter B.
2015-01-01
The RV144 clinical trial showed the partial efficacy of a vaccine regimen with an estimated vaccine efficacy (VE) of 31% for protecting low-risk Thai volunteers against acquisition of HIV-1. The impact of vaccine-induced immune responses can be investigated through sieve analysis of HIV-1 breakthrough infections (infected vaccine and placebo recipients). A V1/V2-targeted comparison of the genomes of HIV-1 breakthrough viruses identified two V2 amino acid sites that differed between the vaccine and placebo groups. Here we extended the V1/V2 analysis to the entire HIV-1 genome using an array of methods based on individual sites, k-mers and genes/proteins. We identified 56 amino acid sites or “signatures” and 119 k-mers that differed between the vaccine and placebo groups. Of those, 19 sites and 38 k-mers were located in the regions comprising the RV144 vaccine (Env-gp120, Gag, and Pro). The nine signature sites in Env-gp120 were significantly enriched for known antibody-associated sites (p = 0.0021). In particular, site 317 in the third variable loop (V3) overlapped with a hotspot of antibody recognition, and sites 369 and 424 were linked to CD4 binding site neutralization. The identified signature sites significantly covaried with other sites across the genome (mean = 32.1) more than did non-signature sites (mean = 0.9) (p < 0.0001), suggesting functional and/or structural relevance of the signature sites. Since signature sites were not preferentially restricted to the vaccine immunogens and because most of the associations were insignificant following correction for multiple testing, we predict that few of the genetic differences are strongly linked to the RV144 vaccine-induced immune pressure. In addition to presenting results of the first complete-genome analysis of the breakthrough infections in the RV144 trial, this work describes a set of statistical methods and tools applicable to analysis of breakthrough infection genomes in general vaccine efficacy trials for diverse pathogens. PMID:25646817
NASA Astrophysics Data System (ADS)
Kocur, C. M.; Lomheim, L.; Boparai, H. K.; Chowdhury, A. I.; Weber, K.; Austrins, L. M.; Sleep, B.; O'Carroll, D. M.; Edwards, E.
2014-12-01
Injection of carboxymethyl-cellulose stabilized nanoscale Zero Valent Iron (CMC/nZVI) has received significant attention in the last decade as an emerging alternative for in-situ remediation of chlorinated solvents and other recalcitrant compounds. There has also been some indication that injection of nZVI will create conditions that will stimulate in-situ microbial populations, leading to further contaminant degradation. Carboxy-methyl cellulose (CMC) is commonly used for nZVI synthesis as it provides steric stabilization for the nanoparticles, however, the CMC is equally important as a subsurface amendment as it may act as a fermentable substrate for microorganisms in-situ. In this study, microbial communities were monitored over a 2.5 year period following the injection of CMC/nZVI at a chlorinated solvent remediation site. Dehalococcoides spp. genetic markers and vinyl chloride reductase genes (vcrA) were targeted in the 16s RNA using quantitative polymerase chain reaction (qPCR). This analysis was complimented with a suite of aqueous chlorinated ethene, ethane, and methane compounds to monitor degradation. Following the injection of CMC/nZVI a decline of parent chlorinated compound concentrations was observed as well as the emergence of daughter products. A period of abiotic nZVI oxidation is believed to be responsible for a portion of the degradation at the site, however, a prolonged period of contaminant degradation followed and is believed to be the result of organohalide-respiring microorganisms native to the site. Further analysis was performed on the microbial samples using 454 pyrotag sequencing of amplified 16S rRNA genes to obtain the genetic profile of the microbial community. Of particular interest within this large genomic profile is the characterization of the stable population of important organohalide-respiring microorganisms on site. Results suggest that there is a distinctly different response in the organohalide-respiring microbial community in areas of the site where CMC/nZVI amendments were injected compared to a background response.
Rogora, M; Frate, L; Carranza, M L; Freppaz, M; Stanisci, A; Bertani, I; Bottarin, R; Brambilla, A; Canullo, R; Carbognani, M; Cerrato, C; Chelli, S; Cremonese, E; Cutini, M; Di Musciano, M; Erschbamer, B; Godone, D; Iocchi, M; Isabellon, M; Magnani, A; Mazzola, L; Morra di Cella, U; Pauli, H; Petey, M; Petriccione, B; Porro, F; Psenner, R; Rossetti, G; Scotti, A; Sommaruga, R; Tappeiner, U; Theurillat, J-P; Tomaselli, M; Viglietti, D; Viterbi, R; Vittoz, P; Winkler, M; Matteucci, G
2018-05-15
Mountain ecosystems are sensitive and reliable indicators of climate change. Long-term studies may be extremely useful in assessing the responses of high-elevation ecosystems to climate change and other anthropogenic drivers from a broad ecological perspective. Mountain research sites within the LTER (Long-Term Ecological Research) network are representative of various types of ecosystems and span a wide bioclimatic and elevational range. Here, we present a synthesis and a review of the main results from ecological studies in mountain ecosystems at 20 LTER sites in Italy, Switzerland and Austria covering in most cases more than two decades of observations. We analyzed a set of key climate parameters, such as temperature and snow cover duration, in relation to vascular plant species composition, plant traits, abundance patterns, pedoclimate, nutrient dynamics in soils and water, phenology and composition of freshwater biota. The overall results highlight the rapid response of mountain ecosystems to climate change, with site-specific characteristics and rates. As temperatures increased, vegetation cover in alpine and subalpine summits increased as well. Years with limited snow cover duration caused an increase in soil temperature and microbial biomass during the growing season. Effects on freshwater ecosystems were also observed, in terms of increases in solutes, decreases in nitrates and changes in plankton phenology and benthos communities. This work highlights the importance of comparing and integrating long-term ecological data collected in different ecosystems for a more comprehensive overview of the ecological effects of climate change. Nevertheless, there is a need for (i) adopting co-located monitoring site networks to improve our ability to obtain sound results from cross-site analysis, (ii) carrying out further studies, in particular short-term analyses with fine spatial and temporal resolutions to improve our understanding of responses to extreme events, and (iii) increasing comparability and standardizing protocols across networks to distinguish local patterns from global patterns. Copyright © 2017 Elsevier B.V. All rights reserved.
Boulton, Stephen; Selvaratnam, Rajeevan; Ahmed, Rashik; Melacini, Giuseppe
2018-01-01
Mapping allosteric sites is emerging as one of the central challenges in physiology, pathology, and pharmacology. Nuclear Magnetic Resonance (NMR) spectroscopy is ideally suited to map allosteric sites, given its ability to sense at atomic resolution the dynamics underlying allostery. Here, we focus specifically on the NMR CHEmical Shift Covariance Analysis (CHESCA), in which allosteric systems are interrogated through a targeted library of perturbations (e.g., mutations and/or analogs of the allosteric effector ligand). The atomic resolution readout for the response to such perturbation library is provided by NMR chemical shifts. These are then subject to statistical correlation and covariance analyses resulting in clusters of allosterically coupled residues that exhibit concerted responses to the common set of perturbations. This chapter provides a description of how each step in the CHESCA is implemented, starting from the selection of the perturbation library and ending with an overview of different clustering options.
Spatiotemporal recruitment of human DNA polymerase delta to sites of UV damage
Chea, Jennifer; Zhang, Sufang; Zhao, Hong; Zhang, Zhongtao; Lee, Ernest Y.C.; Darzynkiewicz, Zbigniew; Lee, Marietta Y.W.T.
2012-01-01
Human DNA polymerase δ (Pol δ) is involved in various DNA damage responses in addition to its central role in DNA replication. The Pol δ4 holoenzyme consists of four subunits, p125, p50, p68 and p12. It has been established that the p12 subunit is rapidly degraded in response to DNA damage by UV leading to the in vivo conversion of Pol δ4 to Pol δ3, a trimeric form lacking the p12 subunit. We provide the first analysis of the time-dependent recruitment of the individual Pol δ subunits to sites of DNA damage produced by UV irradiation through 5 μm polycarbonate filters by immunofluorescence microscopy and laser scanning cytometry (LSC). Quantitative analysis demonstrates that the recruitments of the three large subunits was near complete by 2 h and did not change significantly up to 4 h after UV exposure. However, the recruitment of p12 was incomplete even at 4 h, with about 70% of the Pol δ lacking the p12 subunit. ChIP analysis of Pol δ after global UV irradiation further demonstrates that only p125, p50 and p68 were present. Thus, Pol δ3 is the predominant form of Pol δ at sites of UV damage as a result of p12 degradation. Using LSC, we have further confirmed that Pol δ was recruited to CPD damage sites in all phases of the cell cycle. Collectively, our results show that Pol δ at the DNA damage site is the Pol δ trimer lacking p12 regardless of the cell cycle phase. PMID:22801543
Advanced Signal Processing & Classification: UXO Standardized Test Site Data
2012-04-01
magnetic polarizability tensor , and represent the response of the target along each of three principal axes. In order to reduce the number of fit...Oldenburg-Billings (POB) model – GPA version The full POB analysis assumes an axially symmetric (axial and transverse) tensor dipolar target response, and... tensor , and represent the response of the target along each of three principal axes. The β’s are in turn expressed in terms of an empirical five
The Structural Basis of ATP as an Allosteric Modulator
Wang, Qi; Shen, Qiancheng; Li, Shuai; Nussinov, Ruth; Zhang, Jian
2014-01-01
Adenosine-5’-triphosphate (ATP) is generally regarded as a substrate for energy currency and protein modification. Recent findings uncovered the allosteric function of ATP in cellular signal transduction but little is understood about this critical behavior of ATP. Through extensive analysis of ATP in solution and proteins, we found that the free ATP can exist in the compact and extended conformations in solution, and the two different conformational characteristics may be responsible for ATP to exert distinct biological functions: ATP molecules adopt both compact and extended conformations in the allosteric binding sites but conserve extended conformations in the substrate binding sites. Nudged elastic band simulations unveiled the distinct dynamic processes of ATP binding to the corresponding allosteric and substrate binding sites of uridine monophosphate kinase, and suggested that in solution ATP preferentially binds to the substrate binding sites of proteins. When the ATP molecules occupy the allosteric binding sites, the allosteric trigger from ATP to fuel allosteric communication between allosteric and functional sites is stemmed mainly from the triphosphate part of ATP, with a small number from the adenine part of ATP. Taken together, our results provide overall understanding of ATP allosteric functions responsible for regulation in biological systems. PMID:25211773
Anbazhagan, P; SivakumarBabu, G L; Lakshmikanthan, P; VivekAnand, K S
2016-03-01
Seismic design of landfills requires an understanding of the dynamic properties of municipal solid waste (MSW) and the dynamic site response of landfill waste during seismic events. The dynamic response of the Mavallipura landfill situated in Bangalore, India, is investigated using field measurements, laboratory studies and recorded ground motions from the intraplate region. The dynamic shear modulus values for the MSW were established on the basis of field measurements of shear wave velocities. Cyclic triaxial testing was performed on reconstituted MSW samples and the shear modulus reduction and damping characteristics of MSW were studied. Ten ground motions were selected based on regional seismicity and site response parameters have been obtained considering one-dimensional non-linear analysis in the DEEPSOIL program. The surface spectral response varied from 0.6 to 2 g and persisted only for a period of 1 s for most of the ground motions. The maximum peak ground acceleration (PGA) obtained was 0.5 g and the minimum and maximum amplifications are 1.35 and 4.05. Amplification of the base acceleration was observed at the top surface of the landfill underlined by a composite soil layer and bedrock for all ground motions. Dynamic seismic properties with amplification and site response parameters for MSW landfill in Bangalore, India, are presented in this paper. This study shows that MSW has less shear stiffness and more amplification due to loose filling and damping, which need to be accounted for seismic design of MSW landfills in India. © The Author(s) 2016.
McKenzie, D.; Hessl, Amy E.; Peterson, D.L.
2001-01-01
We explored spatial patterns of low-frequency variability in radial tree growth among western North American conifer species and identified predictors of the variability in these patterns. Using 185 sites from the International Tree-Ring Data Bank, each of which contained 10a??60 raw ring-width series, we rebuilt two chronologies for each site, using two conservative methods designed to retain any low-frequency variability associated with recent environmental change. We used factor analysis to identify regional low-frequency patterns in site chronologies and estimated the slope of the growth trend since 1850 at each site from a combination of linear regression and time-series techniques. This slope was the response variable in a regression-tree model to predict the effects of environmental gradients and species-level differences on growth trends. Growth patterns at 27 sites from the American Southwest were consistent with quasi-periodic patterns of drought. Either 12 or 32 of the 185 sites demonstrated patterns of increasing growth between 1850 and 1980 A.D., depending on the standardization technique used. Pronounced growth increases were associated with high-elevation sites (above 3000 m) and high-latitude sites in maritime climates. Future research focused on these high-elevation and high-latitude sites should address the precise mechanisms responsible for increased 20th century growth.
Colombini, Manuela; Dockerty, Colleen; Mayhew, Susannah H
2017-06-01
This systematic review synthesizes 11 studies of health-sector responses to intimate partner violence (IPV) in low- and middle-income countries. The services that were most comprehensive and integrated in their responsiveness to IPV were primarily in primary health and antenatal care settings. Findings suggest that the following facilitators are important: availability of clear guidelines, policies, or protocols; management support; intersectoral coordination with clear, accessible on-site and off-site referral options; adequate and trained staff with accepting and empathetic attitudes toward survivors of IPV; initial and ongoing training for health workers; and a supportive and supervised environment in which to enact new IPV protocols. A key characteristic of the most integrated responses was the connection or "linkages" between different individual factors. Irrespective of their service entry point, what emerged as crucial was a connected systems-level response, with all elements implemented in a coordinated manner. © 2017 The Population Council, Inc.
Colombini, Manuela; Dockerty, Colleen; Mayhew, Susannah H.
2017-01-01
This systematic review synthesizes 11 studies of health‐sector responses to intimate partner violence (IPV) in low‐ and middle‐income countries. The services that were most comprehensive and integrated in their responsiveness to IPV were primarily in primary health and antenatal care settings. Findings suggest that the following facilitators are important: availability of clear guidelines, policies, or protocols; management support; intersectoral coordination with clear, accessible on‐site and off‐site referral options; adequate and trained staff with accepting and empathetic attitudes toward survivors of IPV; initial and ongoing training for health workers; and a supportive and supervised environment in which to enact new IPV protocols. A key characteristic of the most integrated responses was the connection or “linkages” between different individual factors. Irrespective of their service entry point, what emerged as crucial was a connected systems‐level response, with all elements implemented in a coordinated manner. PMID:28422291
Phung, Dung; Huang, Cunrui; Rutherford, Shannon; Dwirahmadi, Febi; Chu, Cordia; Wang, Xiaoming; Nguyen, Minh; Nguyen, Nga Huy; Do, Cuong Manh; Nguyen, Trung Hieu; Dinh, Tuan Anh Diep
2015-05-01
The present study is an evaluation of temporal/spatial variations of surface water quality using multivariate statistical techniques, comprising cluster analysis (CA), principal component analysis (PCA), factor analysis (FA) and discriminant analysis (DA). Eleven water quality parameters were monitored at 38 different sites in Can Tho City, a Mekong Delta area of Vietnam from 2008 to 2012. Hierarchical cluster analysis grouped the 38 sampling sites into three clusters, representing mixed urban-rural areas, agricultural areas and industrial zone. FA/PCA resulted in three latent factors for the entire research location, three for cluster 1, four for cluster 2, and four for cluster 3 explaining 60, 60.2, 80.9, and 70% of the total variance in the respective water quality. The varifactors from FA indicated that the parameters responsible for water quality variations are related to erosion from disturbed land or inflow of effluent from sewage plants and industry, discharges from wastewater treatment plants and domestic wastewater, agricultural activities and industrial effluents, and contamination by sewage waste with faecal coliform bacteria through sewer and septic systems. Discriminant analysis (DA) revealed that nephelometric turbidity units (NTU), chemical oxygen demand (COD) and NH₃ are the discriminating parameters in space, affording 67% correct assignation in spatial analysis; pH and NO₂ are the discriminating parameters according to season, assigning approximately 60% of cases correctly. The findings suggest a possible revised sampling strategy that can reduce the number of sampling sites and the indicator parameters responsible for large variations in water quality. This study demonstrates the usefulness of multivariate statistical techniques for evaluation of temporal/spatial variations in water quality assessment and management.
1983-10-01
sites should be collected and correlated to vegetational response through ordination or factor analysis techniques. 3. If site-specific methods are...specified number of samples is collected . If the 40 ."l ’ - - - .. -’-. - : -. .~ -, .4 .- . -.- , - ...... rb. . o* . -.% o - .- * .-.- v- . J...only, although the data collected were sufficient for determination of such parameters as density, cover, frequency, basal area, and importance value
Tabouret, Emeline; Houillier, Caroline; Martin-Duverneuil, Nadine; Blonski, Marie; Soussain, Carole; Ghesquières, Herve; Houot, Roch; Larrieu, Delphine; Soubeyran, Pierre; Gressin, Remy; Gyan, Emmanuel; Chinot, Olivier; Taillandier, Luc; Choquet, Sylvain; Alentorn, Agusti; Leclercq, Delphine; Omuro, Antonio; Tanguy, Marie-Laure
2017-01-01
Abstract Background. Our aim was to review MRI characteristics of patients with primary CNS lymphoma (PCNSL) enrolled in a randomized phase II trial and to evaluate their potential prognostic value and patterns of relapse, including T2 fluid attenuated inversion recovery (FLAIR) MRI abnormalities. Methods. Neuroimaging findings in 85 patients with PCNSL enrolled in a prospective trial were reviewed blinded to outcomes. MRI characteristics and responses according to International PCNSL Collaborative Group (IPCG) criteria were correlated with progression-free survival (PFS) and overall survival (OS). Results. Multivariate analysis showed that objective response at 2 months (P < .001) and at end of treatment (P = .015) were predictors of prolonged OS. Infratentorial location (P = .008) and large (>11.4 cm3) enhancing tumor volume (P = .006) were associated with poor OS and PFS, respectively. Ratio of change in product of largest diameters at early MRI evaluation but not timing of complete response achievement (early vs delayed) was prognostic for OS. Sixty-nine patients relapsed. Relapse in the brain (n = 52) involved an initial enhancing site, a different site, or both in 46%, 40%, and 14% of patients, respectively. At baseline, non-enhancing T2-FLAIR hypersignal lesions distant from the enhancing tumor site were detected in 18 patients. These lesions markedly decreased (>50%) in 16 patients after chemotherapy, supporting their neoplastic nature. Of these patients, 10/18 relapsed, half (n = 5) in the initially non-enhancing T2-FLAIR lesions. Conclusions. Baseline tumor size and infratentorial localization are of prognostic value in PCNSL. Our findings provide evidence that non-enhancing FLAIR abnormalities may add to overall tumor burden, suggesting that response criteria should be refined to incorporate evaluation of T2-weighted/FLAIR sequences. PMID:27994065
What is EPA Doing about Pet Coke in Chicago?
In response to complaints of windblown dust believed to originate from petroleum coke (petcoke) storage pile sites, operated by KCBX Terminals and Beemsterboer Slag; EPA ordered sample analysis and air quality monitoring under the Clean Air Act.
Okamura, Kyoko; Bernstein, Judith; Fidler, Anne T
2002-01-01
The Internet has become a major source of health information for women, but information placed on the World Wide Web does not routinely undergo a peer review process before dissemination. In this study, we present an analysis of 197 infertility-related Web sites for quality and accountability, using JAMA's minimal core standards for responsible print. Only 2% of the web sites analyzed met all four recommended standards, and 50.8% failed to report any of the four. Commercial web sites were more likely to fail to meet minimum standards (71.2%) than those with educational (46.8%) or supportive (29.8%) elements. Web sites with educational and informational components were most common (70.6%), followed by commercial sites (52.8%) and sites that offered a forum for infertility support and activism (28.9%). Internet resources available to infertile patients are at best variable. The current state of infertility-related materials on the World Wide Web offers unprecedented opportunities to improve services to a growing number of e-health users. Because of variations in quality of site content, women's health clinicians must assume responsibility for a new role as information monitor. This study provides assessment tools clinicians can apply and share with clients.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wong, K.K.
'To provide increased knowledge of stress responses of indigenous microbes at contaminated sites as well as using microbes as molecular probes for monitoring the performance and effectiveness of bioremediation, the authors propose to identify the stress-inducible genes and promoters from two soil bacteria, Deinococcus radiodurans and Sphingomonas F199. These organisms represent two phylogenetically distinct groups of soil bacteria, each of which has specific features of interest for bioremediation. D. radiodurans exhibits high resistance to external stress; F199 is a deep subsurface (Savannah River Site) organism with unique degradative capabilities. Research Statement To realize the full potential of bioremediation, an understandingmore » of microbial community and individual bacterial responses to the stresses encountered at contaminated sites is needed. Knowledge about genetic responses of soil and subsurface bacteria to environmental stresses, which include low nutrients, low oxygen, and mixed pollutants, will allow extrapolation of basic principles to field applications either using indigenous bacteria or genetically engineered microorganisms. Defining bacterial responses to those stresses presents an opportunity for improving bioremediation strategies, and should contribute to environmental management and restoration actions that would reduce the cost and time required to achieve DOE''s cleanup goals.'« less
Li, Pei-qing; Fang, Xiang-min; Chen, Fu-sheng; Wang, Fang-chao; Yu, Jin-rong; Wan, Song-ze; Li, Zu-yao
2015-11-01
Topsoil of green space including typical forest, shrub and grassland were collected to measure their water soluble organic carbon ( WSOC) before and after incubation of 30 days at 5, 15, 25, 35 and, 45 °C. The results showed the average values of WSOC were higher in urban than in rural green spaces, but the percentage of WSOC to total organic carbon (TOC) showed an opposite trend. No significant changes were found among the three green space types in WSOC and WSOC/TOC. Response of WSOC in green space to incubation temperature was generally highest in urban sites, followed by suburban sites, and lowest in rural sites at the incubation temperature of 5 °C, but showed an opposite trend at the temperature of 45 °C. Response coefficient of WSOC to temperature change was lower in forest and shrub than in grassland, but increased along the urban-rural gradient. Further analysis showed that WSOC positively correlated with TOC, total nitrogen and available phosphorus, and the response coefficient of WSOC to temperature change negatively correlated with available phosphorus. In summary, exogenous substances input might lead to the accumulation of WSOC in urban green space, however, urban environment was helpful to maintain the stability of WSOC, which might be due to the enrichment of available phosphorus in urban sites.
Park, Dan M.; Akhtar, Md. Sohail; Ansari, Aseem Z.; Landick, Robert; Kiley, Patricia J.
2013-01-01
Despite the importance of maintaining redox homeostasis for cellular viability, how cells control redox balance globally is poorly understood. Here we provide new mechanistic insight into how the balance between reduced and oxidized electron carriers is regulated at the level of gene expression by mapping the regulon of the response regulator ArcA from Escherichia coli, which responds to the quinone/quinol redox couple via its membrane-bound sensor kinase, ArcB. Our genome-wide analysis reveals that ArcA reprograms metabolism under anaerobic conditions such that carbon oxidation pathways that recycle redox carriers via respiration are transcriptionally repressed by ArcA. We propose that this strategy favors use of catabolic pathways that recycle redox carriers via fermentation akin to lactate production in mammalian cells. Unexpectedly, bioinformatic analysis of the sequences bound by ArcA in ChIP-seq revealed that most ArcA binding sites contain additional direct repeat elements beyond the two required for binding an ArcA dimer. DNase I footprinting assays suggest that non-canonical arrangements of cis-regulatory modules dictate both the length and concentration-sensitive occupancy of DNA sites. We propose that this plasticity in ArcA binding site architecture provides both an efficient means of encoding binding sites for ArcA, σ70-RNAP and perhaps other transcription factors within the same narrow sequence space and an effective mechanism for global control of carbon metabolism to maintain redox homeostasis. PMID:24146625
Treatability studies performed in support of an engineering evaluation/cost analysis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Myers, J.M.; Mueller, J.P.; Sundquist, J.A.
1995-12-31
The Southern Shipbuilding Corporation (SSC) site is located on 54 acres of wooded land adjacent to Bayou Bonfouca, approximately 1.8 miles downstream of the Bayou Bonfouca National Priorities List (NPL) Superfund site in Slidell, St. Tammany Parish, Louisiana. Two one-acre, impoundments on the SSC site were used to store wastes generated from vessel cleaning. Wastes stored in the impoundments are migrating into Bayou Bonfouca, which empties into Lake Pontchartrain. In addition, the impoundments are frequently invaded by flood waters. The US EPA Emergency Response Branch (EPA-ERB) performed a site investigation which indicated that the majority of the contamination is petroleum-relatedmore » and that the compounds of concern are polycyclic aromatic hydrocarbons (PARs). The wastes are generally contained with the two impoundments and surrounding soils. As part of an Engineering Evaluation/Cost Basis (EE/CA) of potential response action alternatives, four treatability studies were performed. A thermal treatment (incineration) study was performed at the EPA`s Incineration Research Facility (IRF). Biodegradation remedy selection feasibility assessment was conducted on-site. A remedy screening soil washing study was also performed by TAT. A solidification/stabilization (S/S) study was conducted through EPA`s Risk Reduction Engineering Laboratory (RREL) to ascertain if the PAHs could be immobilized within a solid matrix. Experimental objectives, dead methodology and conclusions for these studies are presented as they relate to potential response actions being evaluated at the SSC site.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gustafson, F.W.; Todd, M.E.
1993-09-01
The release of large volumes of water to waste disposal cribs at the Hanford Site`s 100-N Area caused contaminants, principally strontium-90, to be carried toward the Columbia River through the groundwater. Since shutdown of the N Reactor, these releases have been discontinued, although small water flows continue to be discharged to the 1325-N crib. Most of the contamination which is now transported to the river is occurring as a result of the natural groundwater movement. The contaminated groundwater at N Springs flows into the river through seeps and springs along the river`s edge. An expedited response action (ERA) has beenmore » proposed to eliminate or restrict the flux of strontium-90 into the river. A cost benefit analysis of potential remedial alternatives was completed that recommends the alternative which best meets given selection criteria prescribed by the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA). The methodology used for evaluation, cost analysis, and alternative recommendation is the engineering evaluation/cost analysis (EE/CA). Complete remediation of the contaminated groundwater beneath 100-N Area was not a principal objective of the analysis. The objective of the cost benefit analysis was to identify a remedial alternative that optimizes the degree of benefit produced for the costs incurred.« less
Afshin Pourmokhtarian; Charles T. Driscoll; John L. Campbell; Katharine Hayhoe; Anne M. K. Stoner; Mary Beth Adams; Douglas Burns; Ivan Fernandez; Myron J. Mitchell; James B. Shanley
2016-01-01
A cross-site analysis was conducted on seven diverse, forested watersheds in the northeastern United States to evaluate hydrological responses (evapotranspiration, soil moisture, seasonal and annual streamflow, and water stress) to projections of future climate. We used output from four atmosphereâocean general circulation models (AOGCMs; CCSM4, HadGEM2-CC, MIROC5, and...
Assessment of semi-volatile organic compounds in drinking water sources in Jiangsu, China.
Wu, Yifeng; Jia, Yongzhi; Lu, Xiwu
2013-08-01
Many xenobiotic compounds, especially organic pollutants in drinking water, can cause threats to human health and natural ecosystems. The ability to predict the level of pollutants and identify their source is crucial for the design of pollutant risk reduction plans. In this study, 25 semi-volatile organic compounds (SVOCs) were assessed at 16 monitoring sites of drinking water sources in Jiangsu, east China, to evaluate water quality conditions and source of pollutants. Four multivariate statistical techniques were used for this analysis. The correlation test indicated that 25 SVOCs parameters variables had a significant spatial variability (P<0.05). The results of correlation analysis, principal component analysis (PCA) and cluster analysis (CA) suggested that at least four sources, i.e., agricultural residual pesticides, industrial sewage, water transportation vehicles and miscellaneous sources, were responsible for the presence of SVOCs in the drinking water sites examined, accounting for 89.6% of the total variance in the dataset. The analysis of site similarity showed that 16 sites could be divided into high, moderate, and low pollutant level groups at (D(link)/D(max))×25<10, and each group had primary typical SVOCs. These results provide useful information for developing appropriate strategies for contaminants control in drinking water sources. Copyright © 2013 Elsevier Inc. All rights reserved.
Kulal, Rithesh; Thomas, Biju; Ravi, M. S.; Shetty, Suchetha
2013-01-01
Background: Therapeutic goal in patients with cleft lip and palate is esthetics and long-term health of the stomatognathic system. Patients with cleft lip and palate routinely require extensive and prolonged orthodontic treatment. The osseous structures are absent or poorly developed in the osseous clefts and may be traumatized in the course of orthodontic therapy; hence require constant monitoring during orthodontic treatment. The aim of the study was to evaluate the tissue response of cleft palate patients by quantitative analysis of enzyme activity during orthodontic treatment and assess any difference in the tissue response with that of noncleft patients undergoing orthodontic treatment. Materials and Methods: 20 patients requiring orthodontic treatment agedbetween 15 to 25 years were included to participate in the studyof which ten were cleft palate patients (group I) and ten noncleft patients (group II). The GCF samples were collected at incisor and molar sites during orthodontic treatment on days as per the study design in both the groups. The GCF enzymatic levels were estimated and compared. Results: Both groups showed significant increased enzyme activity at the incisor site compared to molar site corresponding to the phases of tooth movement. Conclusion: There was significant difference in enzyme activity between the incisor adjacent to the cleft site and molar site. There was no difference in the tissue response between cleft palate patients and noncleft patients during orthodontic treatment. PMID:24049331
Schons-Fonseca, Luciane; da Silva, Josefa B; Milanez, Juliana S; Domingos, Renan H; Smith, Janet L; Nakaya, Helder I; Grossman, Alan D; Ho, Paulo L; da Costa, Renata M A
2016-02-18
We determined the effects of DNA damage caused by ultraviolet radiation on gene expression in Leptospira interrogans using DNA microarrays. These data were integrated with DNA binding in vivo of LexA1, a regulator of the DNA damage response, assessed by chromatin immunoprecipitation and massively parallel DNA sequencing (ChIP-seq). In response to DNA damage, Leptospira induced expression of genes involved in DNA metabolism, in mobile genetic elements and defective prophages. The DNA repair genes involved in removal of photo-damage (e.g. nucleotide excision repair uvrABC, recombinases recBCD and resolvases ruvABC) were not induced. Genes involved in various metabolic pathways were down regulated, including genes involved in cell growth, RNA metabolism and the tricarboxylic acid cycle. From ChIP-seq data, we observed 24 LexA1 binding sites located throughout chromosome 1 and one binding site in chromosome 2. Expression of many, but not all, genes near those sites was increased following DNA damage. Binding sites were found as far as 550 bp upstream from the start codon, or 1 kb into the coding sequence. Our findings indicate that there is a shift in gene expression following DNA damage that represses genes involved in cell growth and virulence, and induces genes involved in mutagenesis and recombination. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Deactivation of the E. coli pH stress sensor CadC by cadaverine.
Haneburger, Ina; Fritz, Georg; Jurkschat, Nicole; Tetsch, Larissa; Eichinger, Andreas; Skerra, Arne; Gerland, Ulrich; Jung, Kirsten
2012-11-23
At acidic pH and in the presence of lysine, the pH sensor CadC activates transcription of the cadBA operon encoding the lysine/cadaverine antiporter CadB and the lysine decarboxylase CadA. In effect, these proteins contribute to acid stress adaptation in Escherichia coli. cadBA expression is feedback inhibited by cadaverine, and a cadaverine binding site is predicted within the central cavity of the periplasmic domain of CadC on the basis of its crystallographic analysis. Our present study demonstrates that this site only partially accounts for the cadaverine response in vivo. Instead, evidence for a second, pivotal binding site was collected, which overlaps with the pH-responsive patch of amino acids located at the dimer interface of the periplasmic domain. The temporal response of the E. coli Cad module upon acid shock was measured and modeled for two CadC variants with mutated cadaverine binding sites. These studies supported a cascade-like binding and deactivation model for the CadC dimer: binding of cadaverine within the pair of central cavities triggers a conformational transition that exposes two further binding sites at the dimer interface, and the occupation of those stabilizes the inactive conformation. Altogether, these data represent a striking example for the deactivation of a pH sensor. Copyright © 2012 Elsevier Ltd. All rights reserved.
Ozasa, Kazunari; Won, June; Song, Simon; Tamaki, Shun; Ishikawa, Takahiro; Maeda, Mizuo
2017-01-01
The adaptation to a strong light is one of the essential characteristics of green algae, yet lacking relatively the information about the photophobic responses of Eukaryotic microalgae. We investigated the photophobic step-up responses of Euglena gracilis over a time course of several hours with alternated repetition of blue-light pulse illumination and spatially patterned blue-light illumination. Four distinctive photophobic motions in response to strong blue light were identified in a trace image analysis, namely on-site rotation, running and tumbling, continuous circular swimming, and unaffected straightforward swimming. The cells cultured in autotrophic conditions under weak light showed mainly the on-site rotation response at the beginning of blue-light illumination, but they acquired more blue-light tolerant responses of running and tumbling, circular swimming, or straightforward swimming. The efficiency of escaping from a blue-light illuminated area improved markedly with the development of these photophobic motions. Time constant of 3.0 h was deduced for the evolution of photophobic responses of E. gracilis. The nutrient-rich metabolic status of the cells resulting from photosynthesis during the experiments, i.e., the accumulation of photosynthesized nutrient products in balance between formation and consumption, was the main factor responsible for the development of photophobic responses. The reduction-oxidation status in and around E. gracilis cells did not affect their photophobic responses significantly, unlike the case of photophobic responses and phototaxis of Chlamydomonas reinhardtii cells. This study shows that the evolution of photophobic motion type of E. gracilis is dominated mainly by the nutrient metabolic status of the cells. The fact suggests that the nutrient-rich cells have a higher threshold for switching the flagellar motion from straightforward swimming to rotation under a strong light. PMID:28234984
Ahmad, I; Maria, V L; Oliveira, M; Serafim, A; Bebianno, M J; Pacheco, M; Santos, M A
2008-11-15
The present research work aimed to investigate the damage vs. protection responses in gill of European sea bass (Dicentrarchus labrax) captured at a polluted coastal lagoon, Ria de Aveiro (Portugal), as a tool to evaluate the human impacts on environmental health. Damage was assessed as DNA strand breakage and lipid peroxidation (LPO) whereas protection was evaluated by measuring catalase (CAT), glutathione peroxidase (GPX), glutathione reductase (GR), glutathione S-transferase (GST), total glutathione (GSHt), thiols and metallothioneins (MT). Fish were caught at five locations: Gafanha (GAF), Rio Novo do Príncipe (RIO), Laranjo (LAR) and Vagos (VAG) presenting each a different recognized source of contamination, and Torreira (TOR), assumed as reference site. Among the surveyed sites, gill damage was observed only at GAF, as measured by DNA integrity loss and LPO increase. An overall induction in enzymatic antioxidant protection was perceptible in fish from GAF and VAG, expressed as higher GPX, GR and GST activities. In addition, LAR fish showed elevated GST and CAT activities. Thiols content was higher in all study sites irrespective to the pollution spectrum, whereas GSHt increase was only observed at GAF and VAG. The highest MT level was detected in fish from VAG and the lowest level from RIO suggesting a low contamination degree on this particular site. Globally, the results expressed site-specific response patterns, signalling two critical areas - GAF and VAG. Additionally, a joint analysis (damage vs. protection) allowed the following ordering of surveyed sites according to the contamination degree and risk to fish health; GAF>VAG>LAR>RIO>TOR. D. labrax gill responses demonstrated their efficacy as early warning signals of the contaminants presence. Moreover, the adopted approach, considering simultaneously protection responses and damaging effects, also revealed its usefulness on the pollution extent assessment.
Saravanan, Kandasamy; Kalaiarasi, Chinnasamy; Kumaradhas, Poomani
2017-12-01
Acetylcholinesterase (AChE) is an important enzyme responsible for Alzheimer's disease, as per report, keto-enol form of curcumin inhibits this enzyme. The present study aims to understand the binding mechanism of keto-enol curcumin with the recombinant human Acetylcholinesterase (rhAChE) from its conformational flexibility, intermolecular interactions, charge density distribution, and the electrostatic properties at the active site of rhAChE. To accomplish this, a molecular docking analysis of curcumin with the rhAChE was performed, which gives the structure and conformation of curcumin in the active site of rhAChE. Further, the charge density distribution and the electrostatic properties of curcumin molecule (lifted from the active site of rhAChE) were determined from the high level density functional theory (DFT) calculations coupled with the charge density analysis. On the other hand, the curcumin molecule was optimized (gas phase) using DFT method and further, the structure and charge density analysis were also carried out. On comparing the conformation, charge density distribution and the electrostatic potential of the active site form of curcumin with the corresponding gas phase form reveals that the above said properties are significantly altered when curcumin is present in the active site of rhAChE. The conformational stability and the interaction of curcumin in the active site are also studied using molecular dynamics simulation, which shows a large variation in the conformational geometry of curcumin as well as the intermolecular interactions.
NASA Astrophysics Data System (ADS)
Massa, Marco; Barani, Simone; Lovati, Sara
2014-06-01
The paper presents an extensive review of topographic effects in seismology taking into account the knowledge of 40 yr of scientific literature. An overview of topographic effects based on experimental observations and numerical modelling is presented with the aim of highlighting meaning and causes of these phenomena as well as possible correlations between site response (fundamental frequency, amplification level) and geometrical (width and shape ratio of a relief) parameters. After a thorough summary of topographic effects, the paper focuses on five Italian sites whose seismic response is potentially affected by local morphology, as already evidenced by previous studies. In this study, seismic data recorded at these sites are analysed computing directional spectral ratios both in terms of horizontal to vertical spectral ratios (HVSRs) and, wherever possible, in terms of standard spectral ratios (SSRs). The analysis lead to the conclusion that wavefield tends to be polarized along a direction perpendicular to the main axis of a topographic irregularity, direction along which ground motion amplification is maximum. The final section of the article compares and contrasts different spectral ratio techniques in order to examine their effectiveness and reliability in detecting topographic effects. The examples discussed in the paper show that site responses based on HVSRs rather than SSR measurements could lead to misinterpretation of ground response results, both as concerns the definition of the site fundamental frequency and amplification level. Results and findings of this work will be used as starting point to discuss the influence of topographic effects on ground motion prediction equations and regulations for design. These topics will be discussed in the companion article.
Analysis of Evolutionary Processes of Species Jump in Waterfowl Parvovirus
Fan, Wentao; Sun, Zhaoyu; Shen, Tongtong; Xu, Danning; Huang, Kehe; Zhou, Jiyong; Song, Suquan; Yan, Liping
2017-01-01
Waterfowl parvoviruses are classified into goose parvovirus (GPV) and Muscovy duck parvovirus (MDPV) according to their antigenic features and host preferences. A novel duck parvovirus (NDPV), identified as a new variant of GPV, is currently infecting ducks, thus causing considerable economic loss. This study analyzed the molecular evolution and population dynamics of the emerging parvovirus capsid gene to investigate the evolutionary processes concerning the host shift of NDPV. Two important amino acids changes (Asn-489 and Asn-650) were identified in NDPV, which may be responsible for host shift of NDPV. Phylogenetic analysis indicated that the currently circulating NDPV originated from the GPV lineage. The Bayesian Markov chain Monte Carlo tree indicated that the NDPV diverged from GPV approximately 20 years ago. Evolutionary rate analyses demonstrated that GPV evolved with 7.674 × 10-4 substitutions/site/year, and the data for MDPV was 5.237 × 10-4 substitutions/site/year, whereas the substitution rate in NDPV branch was 2.25 × 10-3 substitutions/site/year. Meanwhile, viral population dynamics analysis revealed that the GPV major clade, including NDPV, grew exponentially at a rate of 1.717 year-1. Selection pressure analysis showed that most sites are subject to strong purifying selection and no positively selected sites were found in NDPV. The unique immune-epitopes in waterfowl parvovirus were also estimated, which may be helpful for the prediction of antibody binding sites against NDPV in ducks. PMID:28352261
NYSDOT consideration of potential intermodal sites for Long Island.
DOT National Transportation Integrated Search
2011-06-09
This Study was prepared in response to the Governor's directive to conduct an extensive analysis of the feasibility of a truck/rail : facility on Long Island. It was designed to answer three questions: : Is an intermodal truck/rail transfer facil...
Multiple-methods investigation of recharge at a humid-region fractured rock site, Pennsylvania, USA
Heppner, C.S.; Nimmo, J.R.; Folmar, G.J.; Gburek, W.J.; Risser, D.W.
2007-01-01
Lysimeter-percolate and well-hydrograph analyses were combined to evaluate recharge for the Masser Recharge Site (central Pennsylvania, USA). In humid regions, aquifer recharge through an unconfined low-porosity fractured-rock aquifer can cause large magnitude water-table fluctuations over short time scales. The unsaturated hydraulic characteristics of the subsurface porous media control the magnitude and timing of these fluctuations. Data from multiple sets of lysimeters at the site show a highly seasonal pattern of percolate and exhibit variability due to both installation factors and hydraulic property heterogeneity. Individual event analysis of well hydrograph data reveals the primary influences on water-table response, namely rainfall depth, rainfall intensity, and initial water-table depth. Spatial and seasonal variability in well response is also evident. A new approach for calculating recharge from continuous water-table elevation records using a master recession curve (MRC) is demonstrated. The recharge estimated by the MRC approach when assuming a constant specific yield is seasonal to a lesser degree than the recharge estimate resulting from the lysimeter analysis. Partial reconciliation of the two recharge estimates is achieved by considering a conceptual model of flow processes in the highly-heterogeneous underlying fractured porous medium. ?? Springer-Verlag 2007.
NASA Astrophysics Data System (ADS)
Yoon, S.; Won, M.; Jang, K.; Lim, J.
2016-12-01
As there has been a recent increase in the case of forest fires in North Korea descending southward through the De-Militarized Zone (DMZ), ensuring proper response to such events has been a challenge. Therefore, in order to respond and manage these forest fires appropriately, an improvement in the forest fire predictability through integration of mountain weather information observed at the most optimal site is necessary. This study is a proactive case in which a spatial analysis and an on-site assessment method were developed for selecting an optimum site for a mountain weather observation in national forest. For spatial analysis, the class 1 and 2 forest fire danger areas for the past 10 years, accessibility maximum 100m, Automatic Weather Station (AWS) redundancy within 2.5km, and mountain terrains higher than 200m were analyzed. A final overlay analysis was performed to select the candidates for the field assessment. The sites selected through spatial analysis were quantitatively evaluated based on the optimal meteorological environment, forest and hiking trail accessibility, AWS redundancy, and supply of wireless communication and solar powered electricity. The sites with total score of 70 and higher were accepted as adequate. At the final selected sites, an AMOS was established, and integration of mountain and Korea Meteorological Administration (KMA) weather data improved the forest fire predictability in South Korea by 10%. Given these study results, we expect that establishing an automatic mountain meteorology observation station at the optimal sites in inaccessible area and integrating mountain weather data will improve the predictability of forest fires.
Jaiswal, Ritu; Johnson, Michael S; Pokharel, Deep; Krishnan, S Rajeev; Bebawy, Mary
2017-02-06
Breast cancer is the most frequently diagnosed cancer in women. Resident macrophages at distant sites provide a highly responsive and immunologically dynamic innate immune response against foreign infiltrates. Despite extensive characterization of the role of macrophages and other immune cells in malignant tissues, there is very little known about the mechanisms which facilitate metastatic breast cancer spread to distant sites of immunological integrity. The mechanisms by which a key healthy defense mechanism fails to protect distant sites from infiltration by metastatic cells in cancer patients remain undefined. Breast tumors, typical of many tumor types, shed membrane vesicles called microparticles (MPs), ranging in size from 0.1-1 μm in diameter. MPs serve as vectors in the intercellular transfer of functional proteins and nucleic acids and in drug sequestration. In addition, MPs are also emerging to be important players in the evasion of cancer cell immune surveillance. A comparative analysis of effects of MPs isolated from human breast cancer cells and non-malignant human brain endothelial cells were examined on THP-1 derived macrophages in vitro. MP-mediated effects on cell phenotype and functionality was assessed by cytokine analysis, cell chemotaxis and phagocytosis, immunolabelling, flow cytometry and confocal imaging. Student's t-test or a one-way analysis of variance (ANOVA) was used for comparison and statistical analysis. In this paper we report on the discovery of a new cellular basis for immune evasion, which is mediated by breast cancer derived MPs. MPs shed from multidrug resistant (MDR) cells were shown to selectively polarize macrophage cells to a functionally incapacitated state and facilitate their engulfment by foreign cells. We propose this mechanism may serve to physically disrupt the inherent immune response prior to cancer cell colonization whilst releasing mediators required for the recruitment of distant immune cells. These findings introduce a new paradigm in cancer cell biology with significant implications in understanding breast cancer colonization at distant sites. Most importantly, this is also the first demonstration that MPs serve as conduits in a parallel pathway supporting the cellular survival of MDR cancer cells through immune evasion.
Influence of Prolonged Spaceflight on Heart Rate and Oxygen Uptake Kinetics
NASA Astrophysics Data System (ADS)
Hoffmann, U.; Moore, A.; Drescher, U.
2013-02-01
During prolonged spaceflight, physical training is used to minimize cardiovascular deconditioning. Measurement of the kinetics of cardiorespiratory parameters, in particular the kinetic analysis of heart rate, respiratory and muscular oxygen uptake, provides useful information with regard to the efficiency and regulation of the cardiorespiratory system. Practically, oxygen uptake kinetics can only be measured at the lung site (V’O2 resp). The dynamics of V’O2 resp, however, is not identical with the dynamics at the site of interest: skeletal muscle. Eight Astronauts were tested pre- and post-flight using pseudo random binary workload changes between 30 and 80 W. Their kinetic responses of heart rate, respiratory as well as muscular V’O2 kinetics were estimated by using time-series analysis. Statistical analysis revealed that the kinetic responses of respiratory as well as muscular V’O2 kinetics are slowed post-flight than pre-flight. Heart rate seems not to be influenced following flight. The influence of other factors (e. g. astronauts’ exercise training) may impact these parameters and is an area for future studies.
De Haene, Lucia; Dalgaard, Nina Thorup; Montgomery, Edith; Grietens, Hans; Verschueren, Karine
2013-06-01
Although forced migration research on refugee family functioning clearly points to the potential breakdown of parental availability and responsiveness in the context of cumulative migration stressors, studies exploring attachment security in refugee children are surprisingly lacking so far. The authors report their findings from a 2-site, small-scale administration of an attachment measure, adapted for use with refugee children aged between 4 and 9 years from a reliable and validated doll-play procedure. We evaluated interrater reliability and conducted a qualitative analysis of refugee children's narrative response to identify migration-specific representational markers of attachment quality. The level of agreement among 3 independent coders ranged between .54 to 1.00 for both study samples, providing initial psychometric evidence of the measure's value in assessing child attachment security in this population. The exploratory analysis of migration-related narrative markers pointed to specific parameters to be used in parent-child observational assessments in future validation of the attachment measure, such as parental withdrawal or trauma-communication within the parent-child dyad. Copyright © 2013 International Society for Traumatic Stress Studies.
Transcriptional analysis of the bglP gene from Streptococcus mutans.
Cote, Christopher K; Honeyman, Allen L
2006-04-21
An open reading frame encoding a putative antiterminator protein, LicT, was identified in the genomic sequence of Streptococcus mutans. A potential ribonucleic antitermination (RAT) site to which the LicT protein would potentially bind has been identified immediately adjacent to this open reading frame. The licT gene and RAT site are both located 5' to a beta-glucoside PTS regulon previously described in S. mutans that is responsible for esculin utilization in the presence of glucose. It was hypothesized that antitermination is the regulatory mechanism that is responsible for the control of the bglP gene expression, which encodes an esculin-specific PTS enzyme II. To localize the promoter activity associated with the bglP locus, a series of transcriptional lacZ gene fusions was formed on a reporter shuttle vector using various DNA fragments from the bglP promoter region. Subsequent beta-galactosidase assays in S. mutans localized the bglP promoter region and identified putative -35 and -10 promoter elements. Primer extension analysis identified the bglP transcriptional start site. In addition, a terminated bglP transcript formed by transcriptional termination was identified via transcript mapping experiments. The physical location of these genetic elements, the RAT site and the promoter regions, and the identification of a short terminated mRNA support the hypothesis that antitermination regulates the bglP transcript.
Transcriptional analysis of the bglP gene from Streptococcus mutans
Cote, Christopher K; Honeyman, Allen L
2006-01-01
Background An open reading frame encoding a putative antiterminator protein, LicT, was identified in the genomic sequence of Streptococcus mutans. A potential ribonucleic antitermination (RAT) site to which the LicT protein would potentially bind has been identified immediately adjacent to this open reading frame. The licT gene and RAT site are both located 5' to a beta-glucoside PTS regulon previously described in S. mutans that is responsible for esculin utilization in the presence of glucose. It was hypothesized that antitermination is the regulatory mechanism that is responsible for the control of the bglP gene expression, which encodes an esculin-specific PTS enzyme II. Results To localize the promoter activity associated with the bglP locus, a series of transcriptional lacZ gene fusions was formed on a reporter shuttle vector using various DNA fragments from the bglP promoter region. Subsequent beta-galactosidase assays in S. mutans localized the bglP promoter region and identified putative -35 and -10 promoter elements. Primer extension analysis identified the bglP transcriptional start site. In addition, a terminated bglP transcript formed by transcriptional termination was identified via transcript mapping experiments. Conclusion The physical location of these genetic elements, the RAT site and the promoter regions, and the identification of a short terminated mRNA support the hypothesis that antitermination regulates the bglP transcript. PMID:16630357
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lacommare, Kristina S H; Stadler, Michael; Aki, Hirohisa
The addition of storage technologies such as flow batteries, conventional batteries, and heat storage can improve the economic as well as environmental attractiveness of on-site generation (e.g., PV, fuel cells, reciprocating engines or microturbines operating with or without CHP) and contribute to enhanced demand response. In order to examine the impact of storage technologies on demand response and carbon emissions, a microgrid's distributed energy resources (DER) adoption problem is formulated as a mixed-integer linear program that has the minimization of annual energy costs as its objective function. By implementing this approach in the General Algebraic Modeling System (GAMS), the problemmore » is solved for a given test year at representative customer sites, such as schools and nursing homes, to obtain not only the level of technology investment, but also the optimal hourly operating schedules. This paper focuses on analysis of storage technologies in DER optimization on a building level, with example applications for commercial buildings. Preliminary analysis indicates that storage technologies respond effectively to time-varying electricity prices, i.e., by charging batteries during periods of low electricity prices and discharging them during peak hours. The results also indicate that storage technologies significantly alter the residual load profile, which can contribute to lower carbon emissions depending on the test site, its load profile, and its adopted DER technologies.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Whelan, G.; Hartz, K.E.; Hilliard, N.D.
1990-04-01
Congress and the public have mandated much closer scrutiny of the management of chemically hazardous and radioactive mixed wastes. Legislative language, regulatory intent, and prudent technical judgment, call for using scientifically based studies to assess current conditions and to evaluate and select costeffective strategies for mitigating unacceptable situations. The NCP requires that a Remedial Investigation (RI) and a Feasibility Study (FS) be conducted at each site targeted for remedial response action. The goal of the RI is to obtain the site data needed so that the potential impacts on public health or welfare or on the environment can be evaluatedmore » and so that the remedial alternatives can be identified and selected. The goal of the FS is to identify and evaluate alternative remedial actions (including a no-action alternative) in terms of their cost, effectiveness, and engineering feasibility. The NCP also requires the analysis of impacts on public health and welfare and on the environment; this analysis is the endangerment assessment (EA). In summary, the RI, EA, and FS processes require assessment of the contamination at a site, of the potential impacts in public health or the environment from that contamination, and of alternative RAs that could address potential impacts to the environment. 35 refs., 7 figs., 1 tab.« less
Pourmokhtarian, Afshin; Driscoll, Charles T.; Campbell, John L.; Hayhoe, Katharine; Stoner, Anne M. K.; Adams, Mary Beth; Burns, Douglas; Fernandez, Ivan; Mitchell, Myron J.; Shanley, James B.
2017-01-01
A cross-site analysis was conducted on seven diverse, forested watersheds in the northeastern United States to evaluate hydrological responses (evapotranspiration, soil moisture, seasonal and annual streamflow, and water stress) to projections of future climate. We used output from four atmosphere–ocean general circulation models (AOGCMs; CCSM4, HadGEM2-CC, MIROC5, and MRI-CGCM3) included in Phase 5 of the Coupled Model Intercomparison Project, coupled with two Representative Concentration Pathways (RCP 8.5 and 4.5). The coarse resolution AOGCMs outputs were statistically downscaled using an asynchronous regional regression model to provide finer resolution future climate projections as inputs to the deterministic dynamic ecosystem model PnET-BGC. Simulation results indicated that projected warmer temperatures and longer growing seasons in the northeastern United States are anticipated to increase evapotranspiration across all sites, although invoking CO2 effects on vegetation (growth enhancement and increases in water use efficiency (WUE)) diminish this response. The model showed enhanced evapotranspiration resulted in drier growing season conditions across all sites and all scenarios in the future. Spruce-fir conifer forests have a lower optimum temperature for photosynthesis, making them more susceptible to temperature stress than more tolerant hardwood species, potentially giving hardwoods a competitive advantage in the future. However, some hardwood forests are projected to experience seasonal water stress, despite anticipated increases in precipitation, due to the higher temperatures, earlier loss of snow packs, longer growing seasons, and associated water deficits. Considering future CO2effects on WUE in the model alleviated water stress across all sites. Modeled streamflow responses were highly variable, with some sites showing significant increases in annual water yield, while others showed decreases. This variability in streamflow responses poses a challenge to water resource management in the northeastern United States. Our analyses suggest that dominant vegetation type and soil type are important attributes in determining future hydrological responses to climate change.
Pourmokhtarian, Afshin; Driscoll, Charles T; Campbell, John L; Hayhoe, Katharine; Stoner, Anne M K; Adams, Mary Beth; Burns, Douglas; Fernandez, Ivan; Mitchell, Myron J; Shanley, James B
2017-02-01
A cross-site analysis was conducted on seven diverse, forested watersheds in the northeastern United States to evaluate hydrological responses (evapotranspiration, soil moisture, seasonal and annual streamflow, and water stress) to projections of future climate. We used output from four atmosphere-ocean general circulation models (AOGCMs; CCSM4, HadGEM2-CC, MIROC5, and MRI-CGCM3) included in Phase 5 of the Coupled Model Intercomparison Project, coupled with two Representative Concentration Pathways (RCP 8.5 and 4.5). The coarse resolution AOGCMs outputs were statistically downscaled using an asynchronous regional regression model to provide finer resolution future climate projections as inputs to the deterministic dynamic ecosystem model PnET-BGC. Simulation results indicated that projected warmer temperatures and longer growing seasons in the northeastern United States are anticipated to increase evapotranspiration across all sites, although invoking CO 2 effects on vegetation (growth enhancement and increases in water use efficiency (WUE)) diminish this response. The model showed enhanced evapotranspiration resulted in drier growing season conditions across all sites and all scenarios in the future. Spruce-fir conifer forests have a lower optimum temperature for photosynthesis, making them more susceptible to temperature stress than more tolerant hardwood species, potentially giving hardwoods a competitive advantage in the future. However, some hardwood forests are projected to experience seasonal water stress, despite anticipated increases in precipitation, due to the higher temperatures, earlier loss of snow packs, longer growing seasons, and associated water deficits. Considering future CO 2 effects on WUE in the model alleviated water stress across all sites. Modeled streamflow responses were highly variable, with some sites showing significant increases in annual water yield, while others showed decreases. This variability in streamflow responses poses a challenge to water resource management in the northeastern United States. Our analyses suggest that dominant vegetation type and soil type are important attributes in determining future hydrological responses to climate change. © 2016 John Wiley & Sons Ltd.
Dunn, Christopher P.; Scott, Michael L.
1987-01-01
The influence of thermal disturbance and site characteristics on distribution of herbs was studied in portions of a 3020 ha wetland in the southeastern USA. Presence-absence of 52 species in 130 0.25 m2 plots was determined from four sites with different disturbance histories and from an undisturbed site. Data from the four disturbed sites were ordinated by detrended correspondence analysis. Differences in species composition among sites (coarse scale) were associated with water depth, light, and substrate type. Within a site (at a fine scale), correlation of environmental variables with ordination scores at a chronically disturbed site was weakly correlated with light (r=0.50). At two sites with episodic disturbance, species composition correlated significantly and positively with substrate and water depth. At a recovering site, vegetation patterns were moderately correlated with water depth (r=−0.52). Species richness was correlated with substrate type along the disturbance gradient. Our results are consistent the intermediate disturbance hypothesis and the subsidy-stress gradient concept.
Computer and internet use by ophthalmologists and trainees in an academic centre.
Somal, Kirandeep; Lam, Wai-Ching; Tam, Eric
2009-06-01
The purpose of this study was to determine computer, internet, and department web site use by members of the Department of Ophthalmology and Vision Sciences at the University of Toronto in Toronto, Ont. Cross-sectional analysis. Eighty-eight members of the Department of Ophthalmology and Vision Sciences who responded to a survey. One hundred forty-eight department members (93 staff, 24 residents, and 31 fellows) were invited via e-mail to complete an online survey looking at computer and internet use. Participation was voluntary. Individuals who did not fill in an online response were sent a paper copy of the survey. No identifying fields were used in the data analysis. A response rate of 59% (88/148) was obtained. Fifty-nine percent of respondents described their computer skill as "good" or better; 86.4% utilized a computer in their clinical practice. Performance of computer-related tasks included accessing e-mail (98.9%), accessing medical literature (87.5%), conducting personal affairs (83%), and accessing conference/round schedules (65.9%). The survey indicated that 89.1% of respondents accessed peer-reviewed material online, including eMedicine (60.2%) and UpToDate articles (48.9%). Thirty-three percent of department members reported never having visited the department web site. Impediments to web site use included information not up to date (27.3%), information not of interest (22.1%), and difficulty locating the web site (20.8%). The majority of ophthalmologists and trainees in an academic centre utilize computer and internet resources for various tasks. A weak linear correlation was found between lower age of respondent and higher self-evaluated experience with computers (r = -0.43). Although use of the current department web site was low, respondents were interested in seeing improvements to the web site to increase its utility.
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
NYSDOT consideration of potential intermodal sites for Long Island : appendices.
DOT National Transportation Integrated Search
2011-06-09
This Study was prepared in response to the Governor's directive to conduct an extensive analysis of the feasibility of a truck/rail facility on Long Island. It was designed to answer three questions: Is an intermodal truck/rail transfer facility ...
NASA Astrophysics Data System (ADS)
Rinderer, M.; McGlynn, B. L.; van Meerveld, I. H. J.
2016-12-01
Groundwater measurements can help us to improve our understanding of runoff generation at the catchment-scale but typically only provide point-scale data. These measurements, therefore, need to be interpolated or upscaled in order to obtain information about catchment scale groundwater dynamics. Our approach used data from 51 spatially distributed groundwater monitoring sites in a Swiss pre-alpine catchment and time series clustering to define six groundwater response clusters. Each of the clusters was characterized by distinctly different site characteristics (i.e., Topographic Wetness Index and curvature), which allowed us to assign all unmonitored locations to one of these clusters. Time series modeling and the definition of response thresholds (i.e., the depth of more transmissive soil layers) allowed us to derive maps of the spatial distribution of active (i.e., responding) locations across the catchment at 15 min time intervals. Connectivity between all active locations and the stream network was determined using a graph theory approach. The extent of the active and connected areas differed during events and suggests that not all active locations directly contributed to streamflow. Gate keeper sites prevented connectivity of upslope locations to the channel network. Streamflow dynamics at the catchment outlet were correlated to catchment average connectivity dynamics. In a sensitivity analysis we tested six different groundwater levels for a site to be considered "active", which showed that the definition of the threshold did not significantly influence the conclusions drawn from our analysis. This study is the first one to derive patterns of groundwater dynamics based on empirical data (rather than interpolation) and provides insight into the spatio-temporal evolution of the active and connected runoff source areas at the catchment-scale that is critical to understanding the dynamics of water quantity and quality in streams.
Refining the site conceptual model at a former uranium mill site in Riverton, Wyoming, USA
Dam, William; Campbell, Sam; Johnson, Ray; ...
2015-07-07
Milling activities at a former uranium mill site near Riverton, Wyoming, USA, contaminated the shallow groundwater beneath and downgradient of the site. Although the mill operated for <6 years (1958-1963), its impact remains an environmental liability. Groundwater modeling predicted that contaminant concentrations were declining steadily, which confirmed the conceptual site model (CSM). However, local flooding in 2010 mobilized contaminants that migrated downgradient from the Riverton site and resulted in a dramatic increase in groundwater contaminant concentrations. This observation indicated that the original CSM was inadequate to explain site conditions and needed to be refined. In response to the new observationsmore » after the flood, a collaborative investigation to better understand site conditions and processes commenced. This investigation included installing 103 boreholes to collect soil and groundwater samples, sampling and analysis of evaporite minerals along the bank of the Little Wind River, an analysis of evaportranspiration in the shallow aquifer, and sampling naturally organic-rich sediments near groundwater discharge areas. The enhanced characterization revealed that the existing CSM did not account for high uranium concentrations in groundwater remaining on the former mill site and groundwater plume stagnation near the Little Wind River. Observations from the flood and subsequent investigations indicate that additional characterization is still needed to continue refining the CSM and determine the viability of the natural flushing compliance strategy. Additional sampling, analysis, and testing of soil and groundwater are necessary to investigate secondary contaminant sources, mobilization of contaminants during floods, geochemical processes, contaminant plume stagnation, distribution of evaporite minerals and organic-rich sediments, and mechanisms and rates of contaminant transfer from soil to groundwater. Future data collection will be used to continually revise the CSM and evaluate the compliance strategy at the site.« less
Management of the Space Physics Analysis Network (SPAN)
NASA Technical Reports Server (NTRS)
Green, James L.; Thomas, Valerie L.; Butler, Todd F.; Peters, David J.; Sisson, Patricia L.
1990-01-01
Here, the purpose is to define the operational management structure and to delineate the responsibilities of key Space Physics Analysis Network (SPAN) individuals. The management structure must take into account the large NASA and ESA science research community by giving them a major voice in the operation of the system. Appropriate NASA and ESA interfaces must be provided so that there will be adequate communications facilities available when needed. Responsibilities are delineated for the Advisory Committee, the Steering Committee, the Project Scientist, the Project Manager, the SPAN Security Manager, the Internetwork Manager, the Network Operations Manager, the Remote Site Manager, and others.
Stephenson, William J.; Odum, Jackson K.; McNamara, Daniel E.; Williams, Robert A.; Angster, Stephen J
2014-01-01
We characterize shear-wave velocity versus depth (Vs profile) at 16 portable seismograph sites through the epicentral region of the 2011 Mw 5.8 Mineral (Virginia, USA) earthquake to investigate ground-motion site effects in the area. We used a multimethod acquisition and analysis approach, where active-source horizontal shear (SH) wave reflection and refraction as well as active-source multichannel analysis of surface waves (MASW) and passive-source refraction microtremor (ReMi) Rayleigh wave dispersion were interpreted separately. The time-averaged shear-wave velocity to a depth of 30 m (Vs30), interpreted bedrock depth, and site resonant frequency were estimated from the best-fit Vs profile of each method at each location for analysis. Using the median Vs30 value (270–715 m/s) as representative of a given site, we estimate that all 16 sites are National Earthquake Hazards Reduction Program (NEHRP) site class C or D. Based on a comparison of simplified mapped surface geology to median Vs30 at our sites, we do not see clear evidence for using surface geologic units as a proxy for Vs30 in the epicentral region, although this may primarily be because the units are similar in age (Paleozoic) and may have similar bulk seismic properties. We compare resonant frequencies calculated from ambient noise horizontal:vertical spectral ratios (HVSR) at available sites to predicted site frequencies (generally between 1.9 and 7.6 Hz) derived from the median bedrock depth and average Vs to bedrock. Robust linear regression of HVSR to both site frequency and Vs30 demonstrate moderate correlation to each, and thus both appear to be generally representative of site response in this region. Based on Kendall tau rank correlation testing, we find that Vs30 and the site frequency calculated from average Vs to median interpreted bedrock depth can both be considered reliable predictors of weak-motion site effects in the epicentral region.
2012-01-01
Objective To examine the efficacy of different radiation doses after achievement of a complete response to chemotherapy in diffuse large B-cell lymphoma (DLBCL). Methods Patients with stage I-IV DLBCL treated from 1995–2009 at Duke Cancer Institute who achieved a complete response to chemotherapy were reviewed. In-field control, event-free survival, and overall survival were calculated using the Kaplan-Meier method. Dose response was evaluated by grouping treated sites by delivered radiation dose. Results 105 patients were treated with RT to 214 disease sites. Chemotherapy (median 6 cycles) was R-CHOP (65%), CHOP (26%), R-CNOP (2%), or other (7%). Post-chemotherapy imaging was PET/CT (88%), gallium with CT (1%), or CT only (11%). The median RT dose was 30 Gy (range, 12–40 Gy). The median radiation dose was higher for patients with stage I-II disease compared with patients with stage III-IV disease (30 versus 24.5 Gy, p < 0.001). Five-year in-field control, event-free survival, and overall survival for all patients was 94% (95% CI: 89-99%), 84% (95% CI: 77-92%), and 91% (95% CI: 85-97%), respectively. Six patients developed an in-field recurrence at 10 sites, without a clear dose response. In-field failure was higher at sites ≥ 10 cm (14% versus 4%, p = 0.06). Conclusion In-field control was excellent with a combined modality approach when a complete response was achieved after chemotherapy without a clear radiation dose response. PMID:22720801
New dimension analyses with error analysis for quaking aspen and black spruce
NASA Technical Reports Server (NTRS)
Woods, K. D.; Botkin, D. B.; Feiveson, A. H.
1987-01-01
Dimension analysis for black spruce in wetland stands and trembling aspen are reported, including new approaches in error analysis. Biomass estimates for sacrificed trees have standard errors of 1 to 3%; standard errors for leaf areas are 10 to 20%. Bole biomass estimation accounts for most of the error for biomass, while estimation of branch characteristics and area/weight ratios accounts for the leaf area error. Error analysis provides insight for cost effective design of future analyses. Predictive equations for biomass and leaf area, with empirically derived estimators of prediction error, are given. Systematic prediction errors for small aspen trees and for leaf area of spruce from different site-types suggest a need for different predictive models within species. Predictive equations are compared with published equations; significant differences may be due to species responses to regional or site differences. Proportional contributions of component biomass in aspen change in ways related to tree size and stand development. Spruce maintains comparatively constant proportions with size, but shows changes corresponding to site. This suggests greater morphological plasticity of aspen and significance for spruce of nutrient conditions.
Seismic risk assessment of architectural heritages in Gyeongju considering local site effects
NASA Astrophysics Data System (ADS)
Park, H.-J.; Kim, D.-S.; Kim, D.-M.
2013-02-01
A seismic risk assessment is conducted for cultural heritage sites in Gyeongju, the capital of Korea's ancient Silla Kingdom. Gyeongju, home to UNESCO World Heritage sites, contains remarkable artifacts of Korean Buddhist art. An extensive geotechnical survey including a series of in situ tests is presented, providing pertinent soil profiles for site response analyses on thirty cultural heritage sites. After the shear wave velocity profiles and dynamic material properties were obtained, site response analyses were carried out at each historical site and the amplification characteristics, site period, and response spectrum of the site were determined for the earthquake levels of 2400 yr and 1000 yr return periods based on the Korean seismic hazard map. Response spectrum and corresponding site coefficients obtained from site response analyses considering geologic conditions differ significantly from the current Korean seismic code. This study confirms the importance of site-specific ground response analyses considering local geological conditions. Results are given in the form of the spatial distribution of bedrock depth, site period, and site amplification coefficients, which are particularly valuable in the context of a seismic vulnerability study. This study presents the potential amplification of hazard maps and provides primary data on the seismic risk assessment of each cultural heritage.
Feagan, Brian; Sandborn, William J; Rutgeerts, Paul; Levesque, Barrett G; Khanna, Reena; Huang, Bidan; Zhou, Qian; Maa, Jen-Fue; Wallace, Kori; Lacerda, Ana; Thakkar, Roopal B; Robinson, Anne M
2018-04-23
Clinical trial endpoints for Crohn's disease (CD) activity correlate poorly with mucosal inflammation; to assess treatment efficacy, patient-reported outcomes and endoscopic assessments are preferred. This study assessed the impact on treatment efficacy estimations of using different definitions of clinical and endoscopic remission and endoscopic response, and of using site- or central-based endoscopy evaluation. This post hoc analysis of data fromEXTEND (extend the safety and efficacy of adalimumab through endoscopic healing), a placebo (PBO)-controlled, randomized trial of adalimumab (ADA) for mucosal healing, included adults with moderate-to-severe CD. Subsets of patients meeting specified Simplified Endoscopic Score for CD (SES-CD) inclusion criteria, according to site or central reading, and baseline stool frequency (SF) and/or abdominal pain score (AP) thresholds were evaluated. Various endpoint definitions based on the Crohn's Disease Activity Index (CDAI), its SF and AP components, SES-CD, and composite endpoints were compared between treatment groups. Increased stringency of Week 12 clinical endpoints compared to CDAI<150 to SF≤3.0/1.5&AP≤1.0 reduced PBO response rates by ≥12% and increased treatment effects by ≤10%. Amending the SES-CD endpoint from ≤4 to ≤2 reduced the treatment effect from 24% to 8%. Composite endpoints further diminished response rates and effect sizes. Site-based evaluation was associated with lower remission rates versus central reading in the PBO group and, thus, greater ADA-related treatment effects. This analysis is the first to demonstrate that increasing the stringency of clinical and endoscopic endpoint definitions in CD trials, especially lowering SF or SES-CD definitions, reduces the ability to detect treatment-related change in CD activity; focus on endpoints that reflect clinical change is warranted.
Mancini, Michele; Wade, Alan G; Perugi, Giulio; Lenox-Smith, Alan; Schacht, Alexander
2014-04-01
An increasing rate of antidepressant trials fail due to large placebo responses. This analysis aimed to identify variables influencing signal detection in clinical trials of major depressive disorder. Patient-level data of randomized patients with a duloxetine dose ≥ 60 mg/day were obtained from Lilly. Total scores of the Hamilton Depression Rating scale (HAM-D) were used as efficacy endpoints. In total, 4661 patients from 14 studies were included in the analysis. The overall effect size (ES), based on the HAM-D total score at endpoint, between duloxetine and placebo was -0.272. Although no statistically significant interactions were found, the following results for factors influencing ES were seen: a very low ES (-0.157) in patients in the lowest baseline HAM-D category and in patients recruited in the last category of the recruitment period (-0.122). A higher ES in patients recruited in centers with a site-size at but not more than 2.5 times the average site-size for the study (-0.345). Study characteristics that resulted in low signal detection in our database were: <80% study completers, a HAM-D placebo response >5 points, a high variability of placebo response (SD > 7 points HAM-D), >6 post baseline visits per study, and use of an active control drug. Simpler trial designs, more homogeneous and mid-sized study sites, a primary analysis based on a higher cutoff blinded to investigators to avoid the influence of score inflation in mild patients and, if possible, studies without an active control group could lead to a better signal detection of antidepressive efficacy. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
32 CFR Appendix A to Part 179 - Tables of the Munitions Response Site Prioritization Protocol
Code of Federal Regulations, 2010 CFR
2010-07-01
... 32 National Defense 1 2010-07-01 2010-07-01 false Tables of the Munitions Response Site... OF DEFENSE CLOSURES AND REALIGNMENT MUNITIONS RESPONSE SITE PRIORITIZATION PROTOCOL (MRSPP) Pt. 179, App. A Appendix A to Part 179—Tables of the Munitions Response Site Prioritization Protocol The tables...
32 CFR Appendix A to Part 179 - Tables of the Munitions Response Site Prioritization Protocol
Code of Federal Regulations, 2012 CFR
2012-07-01
... 32 National Defense 1 2012-07-01 2012-07-01 false Tables of the Munitions Response Site... OF DEFENSE CLOSURES AND REALIGNMENT MUNITIONS RESPONSE SITE PRIORITIZATION PROTOCOL (MRSPP) Pt. 179, App. A Appendix A to Part 179—Tables of the Munitions Response Site Prioritization Protocol The tables...
32 CFR Appendix A to Part 179 - Tables of the Munitions Response Site Prioritization Protocol
Code of Federal Regulations, 2014 CFR
2014-07-01
... 32 National Defense 1 2014-07-01 2014-07-01 false Tables of the Munitions Response Site... OF DEFENSE CLOSURES AND REALIGNMENT MUNITIONS RESPONSE SITE PRIORITIZATION PROTOCOL (MRSPP) Pt. 179, App. A Appendix A to Part 179—Tables of the Munitions Response Site Prioritization Protocol The tables...
32 CFR Appendix A to Part 179 - Tables of the Munitions Response Site Prioritization Protocol
Code of Federal Regulations, 2011 CFR
2011-07-01
... 32 National Defense 1 2011-07-01 2011-07-01 false Tables of the Munitions Response Site... OF DEFENSE CLOSURES AND REALIGNMENT MUNITIONS RESPONSE SITE PRIORITIZATION PROTOCOL (MRSPP) Pt. 179, App. A Appendix A to Part 179—Tables of the Munitions Response Site Prioritization Protocol The tables...
32 CFR Appendix A to Part 179 - Tables of the Munitions Response Site Prioritization Protocol
Code of Federal Regulations, 2013 CFR
2013-07-01
... 32 National Defense 1 2013-07-01 2013-07-01 false Tables of the Munitions Response Site... OF DEFENSE CLOSURES AND REALIGNMENT MUNITIONS RESPONSE SITE PRIORITIZATION PROTOCOL (MRSPP) Pt. 179, App. A Appendix A to Part 179—Tables of the Munitions Response Site Prioritization Protocol The tables...
Karpati, Amy S; Handel, Steven N; Dighton, John; Horton, Thomas R
2011-08-01
The presence and quality of the belowground mycorrhizal fungal community could greatly influence plant community structure and host species response. This study tests whether mycorrhizal fungal communities in areas highly impacted by anthropogenic disturbance and urbanization are less species rich or exhibit lower host root colonization rates when compared to those of less disturbed systems. Using a soil bioassay, we sampled the ectomycorrhizal fungal (EMF) communities associating with Quercus rubra (northern red oak) seedlings in soil collected from seven sites: two mature forest reference sites and five urban sites of varying levels of disturbance. Morphological and polymerase chain reaction-restriction fragment length polymorphism analyses of fungi colonizing root tips revealed that colonization rates and fungal species richness were significantly lower on root systems of seedlings grown in disturbed site soils. Analysis of similarity showed that EMF community composition was not significantly different among several urban site soils but did differ significantly between mature forest sites and all but one urban site. We identified a suite of fungal species that occurred across several urban sites. Lack of a diverse community of belowground mutualists could be a constraint on urban plant community development, especially of late-successional woodlands. Analysis of urban EMF communities can add to our understanding of urban plant community structure and should be addressed during ecological assessment before pragmatic decisions to restore habitats are framed.
Stoy, Paul C; Trowbridge, Amy M; Bauerle, William L
2014-02-01
Most models of photosynthetic activity assume that temperature is the dominant control over physiological processes. Recent studies have found, however, that photoperiod is a better descriptor than temperature of the seasonal variability of photosynthetic physiology at the leaf scale. Incorporating photoperiodic control into global models consequently improves their representation of the seasonality and magnitude of atmospheric CO2 concentration. The role of photoperiod versus that of temperature in controlling the seasonal variability of photosynthetic function at the canopy scale remains unexplored. We quantified the seasonal variability of ecosystem-level light response curves using nearly 400 site years of eddy covariance data from over eighty Free Fair-Use sites in the FLUXNET database. Model parameters describing maximum canopy CO2 uptake and the initial slope of the light response curve peaked after peak temperature in about 2/3 of site years examined, emphasizing the important role of temperature in controlling seasonal photosynthetic function. Akaike's Information Criterion analyses indicated that photoperiod should be included in models of seasonal parameter variability in over 90% of the site years investigated here, demonstrating that photoperiod also plays an important role in controlling seasonal photosynthetic function. We also performed a Granger causality analysis on both gross ecosystem productivity (GEP) and GEP normalized by photosynthetic photon flux density (GEP n ). While photoperiod Granger-caused GEP and GEP n in 99 and 92% of all site years, respectively, air temperature Granger-caused GEP in a mere 32% of site years but Granger-caused GEP n in 81% of all site years. Results demonstrate that incorporating photoperiod may be a logical step toward improving models of ecosystem carbon uptake, but not at the expense of including enzyme kinetic-based temperature constraints on canopy-scale photosynthesis.
NASA Astrophysics Data System (ADS)
Hale, V. Cody; McDonnell, Jeffrey J.
2016-02-01
The effect of bedrock permeability and underlying catchment boundaries on stream base flow mean transit time (MTT) and MTT scaling relationships in headwater catchments is poorly understood. Here we examine the effect of bedrock permeability on MTT and MTT scaling relations by comparing 15 nested research catchments in western Oregon; half within the HJ Andrews Experimental Forest and half at the site of the Alsea Watershed Study. The two sites share remarkably similar vegetation, topography, and climate and differ only in bedrock permeability (one poorly permeable volcanic rock and the other more permeable sandstone). We found longer MTTs in the catchments with more permeable fractured and weathered sandstone bedrock than in the catchments with tight, volcanic bedrock (on average, 6.2 versus 1.8 years, respectively). At the permeable bedrock site, 67% of the variance in MTT across catchments scales was explained by drainage area, with no significant correlation to topographic characteristics. The poorly permeable site had opposite scaling relations, where MTT showed no correlation to drainage area but the ratio of median flow path length to median flow path gradient explained 91% of the variance in MTT across seven catchment scales. Despite these differences, hydrometric analyses, including flow duration and recession analysis, and storm response analysis, show that the two sites share relatively indistinguishable hydrodynamic behavior. These results show that similar catchment forms and hydrologic regimes hide different subsurface routing, storage, and scaling behavior—a major issue if only hydrometric data are used to define hydrological similarity for assessing land use or climate change response.
The HTLV-I tax protein transcriptionally modulates OX40 antigen expression.
Pankow, R; Dürkop, H; Latza, U; Krause, H; Kunzendorf, U; Pohl, T; Bulfone-Paus, S
2000-07-01
OX40 is a member of the TNF receptor family, expressed on activated T cells. It is the only costimulatory T cell molecule known to be specifically up-regulated in human T cell leukemia virus type-I (HTLV-I)-producing cells. In a T cell line, OX40 surface expression was shown to be induced by HTLV-I Tax alone. To understand molecular mechanisms of OX40 gene regulation and modulation by HTLV-I Tax, we have cloned the human OX40 gene and analyzed its 5'-flanking region. By reporter gene analysis with progressive 5' deletions from nucleotides -1259 to -64, we have defined a 157-bp DNA fragment as a minimal promoter for constitutive expression. In addition, we show that in the OX40+ cell line, Co, Tax is able to further increase OX40 surface expression. Up-regulation of OX40 promoter activity by Tax requires two upstream NF-kappaB sites, which are not active in the constitutive OX40 expression. Their deletion abrogates Tax responsiveness in reporter gene analysis. The site-directed mutagenesis of each NF-kappaB site demonstrates that cooperative NF-kappaB binding is a prerequisite for Tax-directed activity as neither site alone is sufficient for a full Tax responsiveness of the OX40 promoter. Upon Tax expression, both sites bind p65 and c-Rel. These data provide new insight into the direct regulation of OX40 by Tax and add to our understanding of the possible role of the OX40/OX40 ligand system in the proliferation of HTLV-I+ T cells.
Tong, Chao; Lin, Yaqiu; Zhang, Cunfang; Shi, Jianquan; Qi, Hongfang; Zhao, Kai
2015-10-01
Toll-like receptors (TLR) are key components of innate immunity that play significant roles in immune defense against pathogens invasion. Recent frequent outbreaks of the "white spot disease" caused by parasitic infection in farmed Tibetan fishes had resulted in great economic losses. However, to our knowledge, the roles of TLRs in mediating immune response to parasitic infection in Tibetan fishes remain to be determined. Here, we performed data-mining on a widely-farmed Tibetan fish (Gymnocypris przewalskii or Gp) transcriptome to determine the genetic variation and expression pattern of TLRs. We totally obtained 14 GpTLRs and identified 5 with a complete coding sequence. Phylogenetic analysis verified their identities and supported the classification of TLRs into six families as in other vertebrates. The TLR family motifs, such as leucine rich repeat (LRR) and Toll/interleukin (IL)-1 receptor (TIR) domain, are conserved in GpTLR1-5. Selective pressure test demonstrated that all known GpTLRs are under purifying selection, except GpTLR4 underwent positive selection. Further, site model analysis suggested that 11 positively selected sites are found in LRR domain of GpTLR4. Three positively selected sites are located on outside surface of TLR4 3D structure, indicating that function of GpTLR4 may be affected. Tissue specific expression analysis showed all GpTLRs are present in gill, head-kidney and spleen but the relative abundance varied among tissues. In response to parasite Ichthyophthirius multifiliis infection, 5 GpTLR (GpTLR1, -2, -4, -9 and -20) expressions were induced. Intriguingly, GpTLR4 was significantly up-regulated in gills, while GpTLR19 and GpTLR21 unexpectedly showed no any change. In summary, these results revealed the first genomic resources of TLR family and several parasitic infection responsive TLRs in Tibetan fish. These findings provide key information for future studies aiming to understand the molecular mechanisms underlying the immune response to pathogen invasion in Tibetan fishes. Copyright © 2015 Elsevier Ltd. All rights reserved.
Jean, Marc C.; Chen, Bei; Molinari, Noelle-Angelique M.; LeBlanc, Tanya T.
2017-01-01
Objectives. To assess whether Primary Care Emergency Preparedness Network member sites reported indicators of preparedness for public health emergencies compared with nonmember sites. The network—a collaboration between government and New York City primary care associations—offers technical assistance to primary care sites to improve disaster preparedness and response. Methods. In 2015, we administered an online questionnaire to sites regarding facility characteristics and preparedness indicators. We estimated differences between members and nonmembers with natural logarithm–linked binomial models. Open-ended assessments identified preparedness gaps. Results. One hundred seven sites completed the survey (23.3% response rate); 47 (43.9%) were nonmembers and 60 (56.1%) were members. Members were more likely to have completed hazard vulnerability analysis (risk ratio [RR] = 1.94; 95% confidence interval [CI] = 1.28, 2.93), to have identified essential services for continuity of operations (RR = 1.39; 95% CI = 1.03, 1.86), to have memoranda of understanding with external partners (RR = 2.49; 95% CI = 1.42, 4.36), and to have completed point-of-dispensing training (RR = 4.23; 95% CI = 1.76, 10.14). Identified preparedness gaps were improved communication, resource availability, and train-the-trainer programs. Public Health Implications. Primary Care Emergency Preparedness Network membership is associated with improved public health emergency preparedness among primary care sites. PMID:28892448
Kuroda, Yasushige; Mori, Toshinori; Yagi, Kazunori; Makihata, Naoko; Kawahara, Yoichiro; Nagao, Mahiko; Kittaka, Shigeharu
2005-08-16
Active reaction centers for ammonia on titanium oxyhydroxide were explored to direct the search for an efficient sol-gel method for the synthesis of a titanium oxynitride (TiO2-xNx) sample with an efficient responsiveness to the visible light constituting a main part of the solar spectrum. The results lead to the conclusion that the site giving IR bands at around 2195 cm(-1) for the adsorbed CO molecules at 300 K is a reactive site and behaves as Lewis acid site in the coordination environment of distorted five-coordinate Ti4+ ions. Ammonia molecules are adsorbed on such a site to form -NH2 and -OH species during the heat treatments at a temperature above 373 K, and they are ultimately incorporated into the TiO2 lattice as nitride through the dehydration at higher temperatures of up to 723 K, resulting in the formation of an anatase type of TiO2-xNx.
Are treelines advancing? A global meta-analysis of treeline response to climate warming.
Harsch, Melanie A; Hulme, Philip E; McGlone, Matt S; Duncan, Richard P
2009-10-01
Treelines are temperature sensitive transition zones that are expected to respond to climate warming by advancing beyond their current position. Response to climate warming over the last century, however, has been mixed, with some treelines showing evidence of recruitment at higher altitudes and/or latitudes (advance) whereas others reveal no marked change in the upper limit of tree establishment. To explore this variation, we analysed a global dataset of 166 sites for which treeline dynamics had been recorded since 1900 AD. Advance was recorded at 52% of sites with only 1% reporting treeline recession. Treelines that experienced strong winter warming were more likely to have advanced, and treelines with a diffuse form were more likely to have advanced than those with an abrupt or krummholz form. Diffuse treelines may be more responsive to warming because they are more strongly growth limited, whereas other treeline forms may be subject to additional constraints.
A hyper-temporal remote sensing protocol for high-resolution mapping of ecological sites
Karl, Jason W.
2017-01-01
Ecological site classification has emerged as a highly effective land management framework, but its utility at a regional scale has been limited due to the spatial ambiguity of ecological site locations in the U.S. or the absence of ecological site maps in other regions of the world. In response to these shortcomings, this study evaluated the use of hyper-temporal remote sensing (i.e., hundreds of images) for high spatial resolution mapping of ecological sites. We posit that hyper-temporal remote sensing can provide novel insights into the spatial variability of ecological sites by quantifying the temporal response of land surface spectral properties. This temporal response provides a spectral ‘fingerprint’ of the soil-vegetation-climate relationship which is central to the concept of ecological sites. Consequently, the main objective of this study was to predict the spatial distribution of ecological sites in a semi-arid rangeland using a 28-year time series of normalized difference vegetation index from Landsat TM 5 data and modeled using support vector machine classification. Results from this study show that support vector machine classification using hyper-temporal remote sensing imagery was effective in modeling ecological site classes, with a 62% correct classification. These results were compared to Gridded Soil Survey Geographic database and expert delineated maps of ecological sites which had a 51 and 89% correct classification, respectively. An analysis of the effects of ecological state on ecological site misclassifications revealed that sites in degraded states (e.g., shrub-dominated/shrubland and bare/annuals) had a higher rate of misclassification due to their close spectral similarity with other ecological sites. This study identified three important factors that need to be addressed to improve future model predictions: 1) sampling designs need to fully represent the range of both within class (i.e., states) and between class (i.e., ecological sites) spectral variability through time, 2) field sampling protocols that accurately characterize key soil properties (e.g., texture, depth) need to be adopted, and 3) additional environmental covariates (e.g. terrain attributes) need to be evaluated that may help further differentiate sites with similar spectral signals. Finally, the proposed hyper-temporal remote sensing framework may provide a standardized approach to evaluate and test our ecological site concepts through examining differences in vegetation dynamics in response to climatic variability and other drivers of land-use change. Results from this study demonstrate the efficacy of the hyper-temporal remote sensing approach for high resolution mapping of ecological sites, and highlights its utility in terms of reduced cost and time investment relative to traditional manual mapping approaches. PMID:28414731
A hyper-temporal remote sensing protocol for high-resolution mapping of ecological sites.
Maynard, Jonathan J; Karl, Jason W
2017-01-01
Ecological site classification has emerged as a highly effective land management framework, but its utility at a regional scale has been limited due to the spatial ambiguity of ecological site locations in the U.S. or the absence of ecological site maps in other regions of the world. In response to these shortcomings, this study evaluated the use of hyper-temporal remote sensing (i.e., hundreds of images) for high spatial resolution mapping of ecological sites. We posit that hyper-temporal remote sensing can provide novel insights into the spatial variability of ecological sites by quantifying the temporal response of land surface spectral properties. This temporal response provides a spectral 'fingerprint' of the soil-vegetation-climate relationship which is central to the concept of ecological sites. Consequently, the main objective of this study was to predict the spatial distribution of ecological sites in a semi-arid rangeland using a 28-year time series of normalized difference vegetation index from Landsat TM 5 data and modeled using support vector machine classification. Results from this study show that support vector machine classification using hyper-temporal remote sensing imagery was effective in modeling ecological site classes, with a 62% correct classification. These results were compared to Gridded Soil Survey Geographic database and expert delineated maps of ecological sites which had a 51 and 89% correct classification, respectively. An analysis of the effects of ecological state on ecological site misclassifications revealed that sites in degraded states (e.g., shrub-dominated/shrubland and bare/annuals) had a higher rate of misclassification due to their close spectral similarity with other ecological sites. This study identified three important factors that need to be addressed to improve future model predictions: 1) sampling designs need to fully represent the range of both within class (i.e., states) and between class (i.e., ecological sites) spectral variability through time, 2) field sampling protocols that accurately characterize key soil properties (e.g., texture, depth) need to be adopted, and 3) additional environmental covariates (e.g. terrain attributes) need to be evaluated that may help further differentiate sites with similar spectral signals. Finally, the proposed hyper-temporal remote sensing framework may provide a standardized approach to evaluate and test our ecological site concepts through examining differences in vegetation dynamics in response to climatic variability and other drivers of land-use change. Results from this study demonstrate the efficacy of the hyper-temporal remote sensing approach for high resolution mapping of ecological sites, and highlights its utility in terms of reduced cost and time investment relative to traditional manual mapping approaches.
NASA Astrophysics Data System (ADS)
Niinemets, Ülo; Keenan, Trevor
2017-04-01
Major light gradients, characteristically 10- to 50-fold, constitute the most prominent feature of plant canopies. These gradients drive within-canopy variation in foliage structural, chemical and physiological traits. As a key acclimation response to variation in light availability, foliage photosynthetic capacity per area (Aarea) increases with increasing light availability within the canopy, maximizing whole canopy photosynthesis. Recently, a worldwide database including 831 within-canopy gradients with standardized light estimates for 304 species belonging to major vascular plant functional types was constructed and within-canopy variation in photosynthetic acclimation was characterized (Niinemets Ü, Keenan TF, Hallik L (2015) Tansley review. A worldwide analysis of within-canopy variations in leaf structural, chemical and physiological traits across plant functional types. The New Phytologist 205: 973-993). However, the understanding of how within-canopy photosynthetic gradients vary during the growing season and in response to site and stand characteristics is still limited. Here we analyzed temporal, environmental and site (nutrient availability, stand density, ambient CO2 concentration, water availability) sources of variation in within-canopy photosynthetic acclimation in different plant functional types. Variation in key structural (leaf dry mass per unit area, MA), chemical (nitrogen content per dry mass, NM, and area, NA) and physiological (photosynthetic nitrogen use efficiency, EN) photosynthetic capacity per dry mass, Amass and area, Aarea) was examined. The analysis demonstrates major, typically 1.5-2-fold, time-, environment and site-dependent modifications in within-canopy variation in foliage photosynthetic capacity. However, the magnitude and direction of temporal and environmental variations in plasticity significantly varied among functional types. Species with longer leaf life span and low rates of canopy expansion or flush-type canopy formation had lower within canopy plasticity during the growing season and in response to environmental and site modifications than species with high rates of canopy expansion and leaf turnover. The fast canopy-expanding species that grow in highly dynamic light environments, actively modified Aarea by nitrogen reallocation among and partitioning within leaves. In contrast, species with low rate of leaf turnover generally exhibited a passive acclimation response with variation in Aarea primarily determined by light-dependent modifications in leaf structure during leaf growth. Due to limited reacclimation capacity in species with low leaf turnover, within-canopy variation in Aarea decreased with increasing leaf age in these species. Furthermore, the plasticity responded less to modifications in environmental and site characteristics than in species with faster leaf turnover. This analysis concludes that the rate of leaf turnover is the key trait determining the temporal variation and environmental responses of canopy photosynthetic acclimation.
Lopes, Priscila Diniz; Okino, Cintia Hiromi; Fernando, Filipe Santos; Pavani, Caren; Casagrande, Viviane Mariguela; Lopez, Renata F V; Montassier, Maria de Fátima Silva; Montassier, Helio José
2018-05-03
Avian infectious bronchitis virus (IBV) is one of the most important viral diseases of poultry. The mucosa of upper respiratory tract, specially the trachea, is the primary replication site for this virus. However, conventional inactivate IBV vaccines usually elicit reduced mucosal immune responses and local protection. Thus, an inactivated IBV vaccine containing BR-I genotype strain encapsulated in chitosan nanoparticles (IBV-CS) was produced by ionic gelation method to be administered by oculo-nasal route to chickens. IBV-CS vaccine administered alone resulted in markedly mucosal immune responses, characterized by high levels of anti-IBV IgA isotype antibodies and IFNγ gene expression at 1dpi. The association of live attenuated Massachusetts IBV and IBV-CS vaccine also induced strong mucosal immune responses, though a switch from IgA isotype to IgG was observed, and IFNγ gene expression peak was late (at 5 dpi). Efficacy of IBV-CS was evaluated by tracheal ciliostasis analysis, histopathology examination, and viral load determination in the trachea and kidney. The results indicated that IBV-CS vaccine administered alone or associated with a live attenuated heterologous vaccine induced both humoral and cell-mediated immune responses at the primary site of viral replication, and provided an effective protection against IBV infection at local (trachea) and systemic (kidney) sites. Copyright © 2018 Elsevier Ltd. All rights reserved.
2012-05-01
tilted metamorphic rock . Typically, the surface layer of the soil is a brown gravelly silt with sand, about 4 inches thick. The subsoil is yellowish red...site setup, the placement of 200 seed items for use in measuring the capabilities of the advanced EMI sensors tested, the subsequent collection of...advanced sensors. The second team was responsible for the cued survey of 1,491 of the 2,143 targets using the MetalMapper, one of the advanced
Androgen-responsive gene database: integrated knowledge on androgen-responsive genes.
Jiang, Mei; Ma, Yunsheng; Chen, Congcong; Fu, Xuping; Yang, Shu; Li, Xia; Yu, Guohua; Mao, Yumin; Xie, Yi; Li, Yao
2009-11-01
Androgen signaling plays an important role in many biological processes. Androgen Responsive Gene Database (ARGDB) is devoted to providing integrated knowledge on androgen-controlled genes. Gene records were collected on the basis of PubMed literature collections. More than 6000 abstracts and 950 original publications were manually screened, leading to 1785 human genes, 993 mouse genes, and 583 rat genes finally included in the database. All the collected genes were experimentally proved to be regulated by androgen at the expression level or to contain androgen-responsive regions. For each gene important details of the androgen regulation experiments were collected from references, such as expression change, androgen-responsive sequence, response time, tissue/cell type, experimental method, ligand identity, and androgen amount, which will facilitate further evaluation by researchers. Furthermore, the database was integrated with multiple annotation resources, including National Center for Biotechnology Information, Gene Ontology, and Kyoto Encyclopedia of Genes and Genomes pathway, to reveal the biological characteristics and significance of androgen-regulated genes. The ARGDB web site is mainly composed of the Browse, Search, Element Scan, and Submission modules. It is user friendly and freely accessible at http://argdb.fudan.edu.cn. Preliminary analysis of the collected data was performed. Many disease pathways, such as prostate carcinogenesis, were found to be enriched in androgen-regulated genes. The discovered androgen-response motifs were similar to those in previous reports. The analysis results are displayed in the web site. In conclusion, ARGDB provides a unified gateway to storage, retrieval, and update of information on androgen-regulated genes.
Clinical outcomes of gastrointestinal stromal tumor in southern Thailand
Pornsuksiri, Kittima; Chewatanakornkul, Siripong; Kanngurn, Samornmas; Maneechay, Wanwisa; Chaiyapan, Walawee; Sangkhathat, Surasak
2012-01-01
AIM: To review a single institutional experience in clinical management of gastrointestinal stromal tumors (GIST) and analyze for factors determining treatment outcome. METHODS: Clinicopathological data of patients with a diagnosis of GIST who were treated at our institute during November 2004 to September 2009 were retrospectively reviewed. RESULTS: Ninety-nine cases were included in the analysis. Primary tumor sites were at the stomach in and small bowel in 44% and 33%, respectively. Thirty-one cases already had metastasis at presentation and the most common metastatic site was the liver. Sixty-four cases (65%) were in the high-risk category. Surgical treatment was performed in 77 cases (78%), 3 of whom received upfront targeted therapy. Complete resection was achieved in 56 cases (73% of operative cases) and of whom 27 developed local recurrence or distant metastasis at a median duration of 2 years. Imatinib was given as a primary therapy in unresectable cases (25 cases) and as an adjuvant in cases with residual tumor (21 cases). Targeted therapy gave partial response in 7 cases (15%), stable disease in 27 cases (57%) and progressive disease in 13 cases (28%). Four-year overall survival was 74% (95% CI: 61%-83%). Univariate survival analysis found that low-risk tumor, gastric site, complete resection and response to imatinib were associated with better survival. CONCLUSION: The overall outcomes of GIST can be predicted by risk-categorization. Surgery alone may not be a curative treatment for GIST. Response to targeted therapy is a crucial survival determinant in these patients. PMID:23444235
Metcalfe, R J; Shaw, M W; Russell, P E
2000-12-01
ABSTRACT Translocation of (14)C-labeled fluquinconazole was measured using combustion analysis and radio thin-layer-chromatographic analysis in seedling wheat leaves uninfected and infected with Mycosphaerella graminicola. Two isolates were used with differing sensitivity to demethylation inhibitor fungicides. Fluquinconazole was translocated acropetally, but not basipetally. Fluquinconazole accumulated around infection sites within 6 days after treatment. Accumulation occurred before M. graminicola hyphae had colonized the host mesophyll further than one host cell around the invasion site. This suggested that the accumulation was caused by a host response to infection. Infrared gas analysis showed that rates of transpiration and stomatal conductance in inoculated leaves were significantly increased very soon after inoculation but net photosynthesis was decreased. The actual mechanism of fungicide accumulation was not determined.
Using Ambient Noise for Investigating Cultural Heritage Sites and Evaluating Seismic Site Response
NASA Astrophysics Data System (ADS)
D'Amico, S.; Farrugia, D.; Galea, P. M.; Ruben, B. P., Sr.
2016-12-01
Recordings of ambient noise as well as use of the HVSR technique represent a common tool for evaluating seismic site response. In this study we applied such techniques to several cultural heritage sites located on the Maltese archipelago (Central Mediterranean). In particular, two of the Maltese watchtowers, built by the Knights of St. John between 1637 and 1659, were investigated together with the megalithic temple site of Mnajdra. Array data were acquired using the Micromed SoilSpy Rosina™ equipped with 4.5 Hz vertical geophones, setting the array in an L-shaped configuration. The Extended Spatial Autocorrelation (ESAC) technique was used to extract Rayleigh-wave dispersion curves. Moreover, single-station data close to the array was collected using a Tromino 3-component seismograph (www.tromino.eu), and the H/V curves were extracted. The dispersion curves and the H/V curves were jointly inverted using the Genetic Algorithm (GA) to obtain the shear-wave velocity profile. A fixed number of layers was used in the inversion and ranges for the layer thickness, P-wave and S-wave velocity, and density were specified. The obtained velocity profiles were used to compute the amplification function for the site based on the square root of the effective seismic impedance, also known as the quarter-wavelength approximation. This was used in the simulation of ground motion parameters at the site for various earthquakes using the stochastic one-dimensional site response analysis algorithm, Extended Source Simulation (EXSIM). In addition, the fundamental period and the damping ratio of the watchtowers was obtained by recording ambient vibrations. In the megalithic temples we were also able to evaluate the coverage of the soil deposits within the structure, comparing our results with previous study that used different geophysical techniques. In conclusion, this study enables us to map the seismic amplification hazard and provides primary data on the seismic risk assessment of each cultural heritage site.
Overview, Analysis and Research Results of a CERCLA Site: A Model Study? and the NAFT Experience
NASA Technical Reports Server (NTRS)
Hunt, Clinton, Jr.
2004-01-01
THe paper discusses the following: What do we want to accomplish? How do we want to accomplish it? When do we expect to complete each task? CERCLA stands for: Comprehensive, Environmental, Response, Compensation, Liability, and Act.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Husler, R.O.; Weir, T.J.
1991-01-01
An enhanced maintenance program is being established to characterize and monitor cables, components, and process response at the Savannah River Site, Defense Waste Processing Facility. This facility was designed and constructed to immobilize the radioactive waste currently stored in underground storage tanks and is expected to begin operation in 1993. The plant is initiating the program to baseline and monitor instrument and control (I C) and electrical equipment, remote process equipment, embedded instrument and control cables, and in-cell jumper cables used in the facility. This program is based on the electronic characterization and diagnostic (ECAD) system which was modified tomore » include process response analysis and to meet rigid Department of Energy equipment requirements. The system consists of computer-automated, state-of-the-art electronics. The data that are gathered are stored in a computerized database for analysis, trending, and troubleshooting. It is anticipated that the data which are gathered and trended will aid in life extension for the facility.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Husler, R.O.; Weir, T.J.
1991-12-31
An enhanced maintenance program is being established to characterize and monitor cables, components, and process response at the Savannah River Site, Defense Waste Processing Facility. This facility was designed and constructed to immobilize the radioactive waste currently stored in underground storage tanks and is expected to begin operation in 1993. The plant is initiating the program to baseline and monitor instrument and control (I&C) and electrical equipment, remote process equipment, embedded instrument and control cables, and in-cell jumper cables used in the facility. This program is based on the electronic characterization and diagnostic (ECAD) system which was modified to includemore » process response analysis and to meet rigid Department of Energy equipment requirements. The system consists of computer-automated, state-of-the-art electronics. The data that are gathered are stored in a computerized database for analysis, trending, and troubleshooting. It is anticipated that the data which are gathered and trended will aid in life extension for the facility.« less
Estimating synaptic parameters from mean, variance, and covariance in trains of synaptic responses.
Scheuss, V; Neher, E
2001-10-01
Fluctuation analysis of synaptic transmission using the variance-mean approach has been restricted in the past to steady-state responses. Here we extend this method to short repetitive trains of synaptic responses, during which the response amplitudes are not stationary. We consider intervals between trains, long enough so that the system is in the same average state at the beginning of each train. This allows analysis of ensemble means and variances for each response in a train separately. Thus, modifications in synaptic efficacy during short-term plasticity can be attributed to changes in synaptic parameters. In addition, we provide practical guidelines for the analysis of the covariance between successive responses in trains. Explicit algorithms to estimate synaptic parameters are derived and tested by Monte Carlo simulations on the basis of a binomial model of synaptic transmission, allowing for quantal variability, heterogeneity in the release probability, and postsynaptic receptor saturation and desensitization. We find that the combined analysis of variance and covariance is advantageous in yielding an estimate for the number of release sites, which is independent of heterogeneity in the release probability under certain conditions. Furthermore, it allows one to calculate the apparent quantal size for each response in a sequence of stimuli.
Ash cap influences on site productivity and fertilizer response in forests of the Inland Northwest
Mariann T. Garrison-Johnston; Peter G. Mika; Dan L. Miller; Phil Cannon; Leonard R. Johnson
2007-01-01
Data from 139 research sites throughout the Inland Northwest were analyzed for effects of ash cap on site productivity, nutrient availability and fertilization response. Stand productivity and nitrogen (N) fertilizer response were greater on sites with ash cap than on sites without. Where ash was present, depth of ash had no effect on site productivity or N fertilizer...
Schmidt, Andreas; Trentini, Débora Broch; Spiess, Silvia; Fuhrmann, Jakob; Ammerer, Gustav; Mechtler, Karl; Clausen, Tim
2014-01-01
Arginine phosphorylation is an emerging protein modification implicated in the general stress response of Gram-positive bacteria. The modification is mediated by the arginine kinase McsB, which phosphorylates and inactivates the heat shock repressor CtsR. In this study, we developed a mass spectrometric approach accounting for the peculiar chemical properties of phosphoarginine. The improved methodology was used to analyze the dynamic changes in the Bacillus subtilis arginine phosphoproteome in response to different stress situations. Quantitative analysis showed that a B. subtilis mutant lacking the YwlE arginine phosphatase accumulated a strikingly large number of arginine phosphorylations (217 sites in 134 proteins), however only a minor fraction of these sites was increasingly modified during heat shock or oxidative stress. The main targets of McsB-mediated arginine phosphorylation comprise central factors of the stress response system including the CtsR and HrcA heat shock repressors, as well as major components of the protein quality control system such as the ClpCP protease and the GroEL chaperonine. These findings highlight the impact of arginine phosphorylation in orchestrating the bacterial stress response. PMID:24263382
Schmidt, Andreas; Trentini, Débora Broch; Spiess, Silvia; Fuhrmann, Jakob; Ammerer, Gustav; Mechtler, Karl; Clausen, Tim
2014-02-01
Arginine phosphorylation is an emerging protein modification implicated in the general stress response of Gram-positive bacteria. The modification is mediated by the arginine kinase McsB, which phosphorylates and inactivates the heat shock repressor CtsR. In this study, we developed a mass spectrometric approach accounting for the peculiar chemical properties of phosphoarginine. The improved methodology was used to analyze the dynamic changes in the Bacillus subtilis arginine phosphoproteome in response to different stress situations. Quantitative analysis showed that a B. subtilis mutant lacking the YwlE arginine phosphatase accumulated a strikingly large number of arginine phosphorylations (217 sites in 134 proteins), however only a minor fraction of these sites was increasingly modified during heat shock or oxidative stress. The main targets of McsB-mediated arginine phosphorylation comprise central factors of the stress response system including the CtsR and HrcA heat shock repressors, as well as major components of the protein quality control system such as the ClpCP protease and the GroEL chaperonine. These findings highlight the impact of arginine phosphorylation in orchestrating the bacterial stress response.
Localization of the cutaneus trunci muscle reflex in horses.
Essig, Cynthia M; Merritt, Jonathan S; Stubbs, Narelle C; Clayton, Hilary M
2013-11-01
To determine the magnitude and location of skin movement attributable to the cutaneus trunci muscle reflex in response to localized stimulation of the skin of the dorsolateral aspect of the thoracic wall in horses. 8 horses. A grid of 56 reflective markers was applied to the lateral aspect of the body wall of each horse; markers were placed at 10-cm intervals in 7 rows and 8 columns. A motion analysis system with 10 infrared cameras was used to track movements of the markers in response to tactile stimulation of the dorsolateral aspect of the thoracic wall at the levels of T6, T11, and T16. Marker movement data determined after skin stimulation were used to create a skin deformation gradient tensor field, which was analyzed with custom software. The sites of maximal skin deformation were located close to the stimulation sites; the centers of the twitch responses were located a mean distance of 7.7 to 12.8 cm ventral and between 6.6 cm cranial and 3.1 cm caudal to the stimulation sites. Findings of this study may have implications for assessment of nerve conduction velocities of the cutaneus trunci muscle reflex and may enhance understanding of the responses of horses to placement of tack or other equipment on skin over the cutaneus trunci muscles.
Emmenegger, Eveline J.; Huang, C.; LaPatra, S.; Winton, James R.
1995-01-01
Summary ― Monoclonal antibodies against infectious hematopoietic necrosis virus have been used to react with recombinant expression products in immunoblots and to select neutralization-resistant mutants for sequence analysis. These strategies identified neutralizing and non-neutralizing antigenic sites on the viral glycoprotein. Synthetic peptides based upon the amino acid sequences of these antigenic sites were synthesized and were injected together with an adjuvant into rainbow trout. The constructs generally failed to stimulate neutralizing antibodies in the fish. These results indicate that we need to understand more about the ability of peptide antigens to stimulate fish immune systems.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gauntt, Randall O.; Mattie, Patrick D.; Bixler, Nathan E.
2014-02-01
This paper describes the knowledge advancements from the uncertainty analysis for the State-of- the-Art Reactor Consequence Analyses (SOARCA) unmitigated long-term station blackout accident scenario at the Peach Bottom Atomic Power Station. This work assessed key MELCOR and MELCOR Accident Consequence Code System, Version 2 (MACCS2) modeling uncertainties in an integrated fashion to quantify the relative importance of each uncertain input on potential accident progression, radiological releases, and off-site consequences. This quantitative uncertainty analysis provides measures of the effects on consequences, of each of the selected uncertain parameters both individually and in interaction with other parameters. The results measure the modelmore » response (e.g., variance in the output) to uncertainty in the selected input. Investigation into the important uncertain parameters in turn yields insights into important phenomena for accident progression and off-site consequences. This uncertainty analysis confirmed the known importance of some parameters, such as failure rate of the Safety Relief Valve in accident progression modeling and the dry deposition velocity in off-site consequence modeling. The analysis also revealed some new insights, such as dependent effect of cesium chemical form for different accident progressions. (auth)« less
NASA Astrophysics Data System (ADS)
George, Merin; John, Nimmy L.; Saravana Kumar, M.; Subashini, A.; Sajan, D.
2017-01-01
The FT-IR, FT-Raman and UV-visible spectral analysis of 4-chloro 4'-methoxy benzylidene aniline were done experimentally and interpreted with the aid of normal coordinate analysis based on density functional theory (DFT) at the B3LYP/6-311++G (d, p) level of theory. Natural Bond orbital analysis was performed to understand the charge transfer interactions and reactive sites within the system. HOMO-LUMO analysis and first static and dynamic hyperpolarizability calculations were carried out in order to confirm the NLO activity of CMOBA. Photophysical characterization was done to understand the fluorescence emission and lifetime of CMOBA leading to application in blue OLEDs. The Molecular Electrostatic Potential Map was simulated to identify the active sites for electrophilic and nucleophilic attack or the active sites of the molecule which can bind to proteins. Molecular docking analysis revealed its potential as an inhibitor for different proteins which are responsible for cancer and many inflammatory diseases such as rheumatoid arthritis, inflammatory bowel disease, Crohn's disease and psoriasis. Experimental studies of invitro antiproliferative effect by MTT assay verified the anticancer properties of CMOBA.
Pressure-specific and multiple pressure response of fish assemblages in European running waters☆
Schinegger, Rafaela; Trautwein, Clemens; Schmutz, Stefan
2013-01-01
We classified homogenous river types across Europe and searched for fish metrics qualified to show responses to specific pressures (hydromorphological pressures or water quality pressures) vs. multiple pressures in these river types. We analysed fish taxa lists from 3105 sites in 16 ecoregions and 14 countries. Sites were pre-classified for 15 selected pressures to separate unimpacted from impacted sites. Hierarchical cluster analysis was used to split unimpacted sites into four homogenous river types based on species composition and geographical location. Classification trees were employed to predict associated river types for impacted sites with four environmental variables. We defined a set of 129 candidate fish metrics to select the best reacting metrics for each river type. The candidate metrics represented tolerances/intolerances of species associated with six metric types: habitat, migration, water quality sensitivity, reproduction, trophic level and biodiversity. The results showed that 17 uncorrelated metrics reacted to pressures in the four river types. Metrics responded specifically to water quality pressures and hydromorphological pressures in three river types and to multiple pressures in all river types. Four metrics associated with water quality sensitivity showed a significant reaction in up to three river types, whereas 13 metrics were specific to individual river types. Our results contribute to the better understanding of fish assemblage response to human pressures at a pan-European scale. The results are especially important for European river management and restoration, as it is necessary to uncover underlying processes and effects of human pressures on aquatic communities. PMID:24003262
Mehta, Hiren J; Begnaud, Abbie; Penley, Andrea M; Wynne, John; Malhotra, Paras; Fernandez-Bussy, Sebastian; Cope, Jessica M; Shuster, Jonathan J; Jantz, Michael A
2015-12-01
A common pattern of recurrence in lung cancer after receiving full dose external beam radiation therapy (EBRT) to targeted sites is isolated mediastinal and hilar recurrence (IMHR). Treatment options for these patients are limited to palliative radiation, chemotherapy, and/or best supportive care. We describe our experience with treating IMHR with bronchoscopic endobronchial ultrasound (EBUS) guided intratumoral injection of cisplatin (ITC). Patients treated between Jan 2009-September 2014 with ITC for IMHR were included. Patient demographics, tumor histology, size, concurrent therapy, location, number of sites treated, treatment sessions, and encounters were abstracted. Responses were analyzed on follow-up scans 8-12 weeks after the last treatment session using RECIST 1.1 criteria. Locoregional recurrence, progression-free survival (PFS), and overall survival were measured. 50 sites were treated in 36 patients (19 males, 17 females) with mean age 61.9±8.5 years. Eight sites treated on subsequent encounters were excluded and one patient had an unevaluable response, leaving 35 patients and 41 sites for final analysis. 24/35 (69%) had complete or partial response (responders), whereas 11/35 (31%) had stable or progressive disease (non-responders). There were no significant differences in response based on histology, size, and concurrent therapy. Median survival for the group was 8 months (95% CI of 6-11 mo). Responders had significantly higher survival and PFS than non-responders. Two patients treated with concurrent EBRT, developed broncho-mediastinal fistula. EBUS guided intratumoral cisplatin for IMHR appears to be safe and effective, and may represent a new treatment paradigm for this patient population. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Kamalakaran, Sitharthan; Radhakrishnan, Senthil K; Beck, William T
2005-06-03
We developed a pipeline to identify novel genes regulated by the steroid hormone-dependent transcription factor, estrogen receptor, through a systematic analysis of upstream regions of all human and mouse genes. We built a data base of putative promoter regions for 23,077 human and 19,984 mouse transcripts from National Center for Biotechnology Information annotation and 8793 human and 6785 mouse promoters from the Data Base of Transcriptional Start Sites. We used this data base of putative promoters to identify potential targets of estrogen receptor by identifying estrogen response elements (EREs) in their promoters. Our program correctly identified EREs in genes known to be regulated by estrogen in addition to several new genes whose putative promoters contained EREs. We validated six genes (KIAA1243, NRIP1, MADH9, NME3, TPD52L, and ABCG2) to be estrogen-responsive in MCF7 cells using reverse transcription PCR. To allow for extensibility of our program in identifying targets of other transcription factors, we have built a Web interface to access our data base and programs. Our Web-based program for Promoter Analysis of Genome, PAGen@UIC, allows a user to identify putative target genes for vertebrate transcription factors through the analysis of their upstream sequences. The interface allows the user to search the human and mouse promoter data bases for potential target genes containing one or more listed transcription factor binding sites (TFBSs) in their upstream elements, using either regular expression-based consensus or position weight matrices. The data base can also be searched for promoters harboring user-defined TFBSs given as a consensus or a position weight matrix. Furthermore, the user can retrieve putative promoter sequences for any given gene together with identified TFBSs located on its promoter. Orthologous promoters are also analyzed to determine conserved elements.
Prieur, Xavier; Coste, Herve; Rodriguez, Joan C
2003-07-11
The newly identified apolipoprotein AV (apoAV) gene is a key player in determining plasma triglyceride concentrations. Because hypertriglyceridemia is a major independent risk factor in coronary artery disease, the understanding of the regulation of the expression of this gene is of considerable importance. We presently characterize the structure, the transcription start site, and the promoter of the human apoAV gene. Since the peroxisome proliferator-activated receptor-alpha (PPARalpha) and the farnesoid X-activated receptor (FXR) have been shown to modulate the expression of genes involved in triglyceride metabolism, we evaluated the potential role of these nuclear receptors in the regulation of apoAV transcription. Bile acids and FXR induced the apoAV gene promoter activity. 5'-Deletion, mutagenesis, and gel shift analysis identified a heretofore unknown element at positions -103/-84 consisting of an inverted repeat of two consensus receptor-binding hexads separated by 8 nucleotides (IR8), which was required for the response to bile acid-activated FXR. The isolated IR8 element conferred FXR responsiveness on a heterologous promoter. On the other hand, in apoAV-expressing human hepatic Hep3B cells, transfection of PPARalpha specifically enhanced apoAV promoter activity. By deletion, site-directed mutagenesis, and binding analysis, a PPARalpha response element located 271 bp upstream of the transcription start site was identified. Finally, treatment with a specific PPARalpha activator led to a significant induction of apoAV mRNA expression in hepatocytes. The identification of apoAV as a PPARalpha target gene has major implications with respect to mechanisms whereby pharmacological PPARalpha agonists may exert their beneficial hypotriglyceridemic actions.
NASA Astrophysics Data System (ADS)
Boldina, Inna; Beninger, Peter G.
2014-04-01
Despite its ubiquity and its role as an ecosystem engineer on temperate intertidal mudflats, little is known of the spatial ecology of the lugworm Arenicola marina. We estimated lugworm densities and analyzed the spatial distribution of A. marina on a French Atlantic mudflat subjected to long-term clam digging activities, and compared these to a nearby pristine reference mudflat, using a combination of geostatistical techniques: point-pattern analysis, autocorrelation, and wavelet analysis. Lugworm densities were an order of magnitude greater at the reference site. Although A. marina showed an aggregative spatial distribution at both sites, the characteristics and intensity of aggregation differed markedly between sites. The reference site showed an inhibition process (regular distribution) at distances <7.5 cm, whereas the impacted site showed a random distribution at this scale. At distances from 15 cm to several tens of meters, the spatial distribution of A. marina was clearly aggregated at both sites; however, the autocorrelation strength was much weaker at the impacted site. In addition, the non-impacted site presented multi-scale spatial distribution, which was not evident at the impacted site. The differences observed between the spatial distributions of the fishing-impacted vs. the non-impacted site reflect similar findings for other components of these two mudflat ecosystems, suggesting common community-level responses to prolonged mechanical perturbation: a decrease in naturally-occurring aggregation. This change may have consequences for basic biological characteristics such as reproduction, recruitment, growth, and feeding.
Lee, Alexandra J; Das, Suman R; Wang, Wei; Fitzgerald, Theresa; Pickett, Brett E; Aevermann, Brian D; Topham, David J; Falsey, Ann R; Scheuermann, Richard H
2015-05-01
Although a large number of immune epitopes have been identified in the influenza A virus (IAV) hemagglutinin (HA) protein using various experimental systems, it is unclear which are involved in protective immunity to natural infection in humans. We developed a data mining approach analyzing natural H1N1 human isolates to identify HA protein regions that may be targeted by the human immune system and can predict the evolution of IAV. We identified 16 amino acid sites experiencing diversifying selection during the evolution of prepandemic seasonal H1N1 strains and found that 11 sites were located in experimentally determined B-cell/antibody (Ab) epitopes, including three distinct neutralizing Caton epitopes: Sa, Sb, and Ca2 [A. J. Caton, G. G. Brownlee, J. W. Yewdell, and W. Gerhard, Cell 31:417-427, 1982, http://dx.doi.org/10.1016/0092-8674(82)90135-0]. We predicted that these diversified epitope regions would be the targets of mutation as the 2009 H1N1 pandemic (pH1N1) lineage evolves in response to the development of population-level protective immunity in humans. Using a chi-squared goodness-of-fit test, we identified 10 amino acid sites that significantly differed between the pH1N1 isolates and isolates from the recent 2012-2013 and 2013-2014 influenza seasons. Three of these sites were located in the same diversified B-cell/Ab epitope regions as identified in the analysis of prepandemic sequences, including Sa and Sb. As predicted, hemagglutination inhibition (HI) assays using human sera from subjects vaccinated with the initial pH1N1 isolate demonstrated reduced reactivity against 2013-2014 isolates. Taken together, these results suggest that diversifying selection analysis can identify key immune epitopes responsible for protective immunity to influenza virus in humans and thereby predict virus evolution. The WHO estimates that approximately 5 to 10% of adults and 20 to 30% of children in the world are infected by influenza virus each year. While an adaptive immune response helps eliminate the virus following acute infection, the virus rapidly evolves to evade the established protective memory immune response, thus allowing for the regular seasonal cycles of influenza virus infection. The analytical approach described here, which combines an analysis of diversifying selection with an integration of immune epitope data, has allowed us to identify antigenic regions that contribute to protective immunity and are therefore the key targets of immune evasion by the virus. This information can be used to determine when sequence variations in seasonal influenza virus strains have affected regions responsible for protective immunity in order to decide when new vaccine formulations are warranted. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
[Organising an investigation site: a national training reference document].
Cornu, Catherine; David, Frédérique; Duchossoy, Luc; Hansel-Esteller, Sylvie; Bertoye, Pierre-Henri; Giacomino, Alain; Mouly, Stéphane; Diebolt, Vincent; Blazejewski, Sylvie
2014-01-01
Several surveys have shown a declining performance of French investigators in conducting clinical trials. This is partly due to insufficient and heterogeneous investigator training and site organisation. A multidisciplinary group was set up to propose solutions. We describe the tools developed to improve study site organisation. This working group was made up of clinical research experts from academia, industry, drug regulatory authorities, general practice, and consulting. Methods and tools were developed to improve site organisation. The proposed tools mainly focus on increasing investigators' awareness of their responsibilities, their research environment, the importance of a thorough feasibility analysis, and the implementation of active patient recruitment strategies. These tools should be able to improve site organisation and performances in conducting clinical trials. © 2014 Société Française de Pharmacologie et de Thérapeutique.
Negureanu, Lacramioara; Salsbury, Freddie R.
2012-01-01
The cellular response to DNA damage signaling by MMR proteins is incompletely understood. It is generally accepted that MMR-dependent apoptosis pathway in response to DNA damage detection is independent of MMR's DNA repair function. In this study we investigate correlated motions in response to the binding of mismatched and PCL DNA fragments by MutSα, as derived from 50 ns molecular dynamics simulations. The protein dynamics in response to the mismatched and damaged DNA recognition suggests that MutSα signals their recognition through independent pathways providing evidence for the molecular origin of the MMR-dependent apoptosis. MSH2 subunit is indicated to play a key role in signaling both mismatched and damaged DNA recognition; localized and collective motions within the protein allow identifying sites on the MSH2 surface possible involved in recruiting proteins responsible for downstream events. Unlike in the mismatch complex, predicted key communication sites specific for the damage recognition are on the list of known cancer causing mutations or deletions. This confirms MSH2's role in signaling DNA-damage induced apoptosis and suggests that defects in MMR alone is sufficient to trigger tumorigenesis, supporting the experimental evidence that MMR-damage response function could protect from the early occurrence of tumors. Identifying these particular communication sites may have implications for the treatment of cancers that are not defective for MMR, but are unable to function optimally for MMR-dependent responses following DNA damage such as the case of resistance to cisplatin. PMID:22712459
Temporary disaster debris management site identification using binomial cluster analysis and GIS.
Grzeda, Stanislaw; Mazzuchi, Thomas A; Sarkani, Shahram
2014-04-01
An essential component of disaster planning and preparation is the identification and selection of temporary disaster debris management sites (DMS). However, since DMS identification is a complex process involving numerous variable constraints, many regional, county and municipal jurisdictions initiate this process during the post-disaster response and recovery phases, typically a period of severely stressed resources. Hence, a pre-disaster approach in identifying the most likely sites based on the number of locational constraints would significantly contribute to disaster debris management planning. As disasters vary in their nature, location and extent, an effective approach must facilitate scalability, flexibility and adaptability to variable local requirements, while also being generalisable to other regions and geographical extents. This study demonstrates the use of binomial cluster analysis in potential DMS identification in a case study conducted in Hamilton County, Indiana. © 2014 The Author(s). Disasters © Overseas Development Institute, 2014.
Baumgardner, Ralph E; Isil, Selma S; Bowser, Jon J; Fitzgerald, Kelley M
1999-11-01
The Clean Air Status and Trends Network (CASTNet) was implemented by the U.S. Environmental Protection Agency (EPA) in 1991 in response to Title IX of the Clean Air Amendments of 1990, which mandated the deployment of a national ambient air monitoring network to track progress of the implementation of emission reduction programs in terms of deposition, air quality, and changes to affected ecosystems. CASTNet evolved from the National Dry Deposition Network (NDDN). CASTNet currently consists of 45 sites in the eastern United States and 28 sites in the West. Each site measures sulfur dioxide (SO 2 ), nitric acid (HNO 3 ), particle sulfate (SO 4 = ), particle nitrate (NO 3 - ), and ozone. Nineteen sites collect precipitation samples. NDDN/CASTNet uses a uniform set of site-selection criteria which provides the data user with consistent measures to compare each site. These criteria also ensure that, to the extent possible, CASTNet sites are located away from local emission sources. This paper presents an analysis of SO 2 and SO 4 = concentration data collected from 1987 through 1996 at rural NDDN/CASTNet sites. Annual and seasonal variability is examined. Gradients of SO 2 and SO 4 = are discussed. The variability of the atmospheric mix of SO 2 and SO 4 = is explored spatially and seasonally. Data from CASTNet are also compared to SO 2 and SO 4 = data from concurrent monitoring studies in rural areas.
Restorative Practices as Formal and Informal Education
ERIC Educational Resources Information Center
Carter, Candice C.
2013-01-01
This article reviews restorative practices (RP) as education in formal and informal contexts of learning that are fertile sites for cultivating peace. Formal practices involve instruction about response to conflict, while informal learning occurs beyond academic lessons. The research incorporated content analysis and a critical examination of the…
MULTI-MEDIA SAMPLING AND ANALYSIS AT A BIOSOLIDS LAND APPLICATION SITE
In response to the recommendations of the National Academy of Sciences in their recent review of EPA's Biosolids program, a study has been planned which will measure the emissions released from biosolids land application. This presentation summarizes the plans for that study and...
Zlotnik, V.A.; McGuire, V.L.
1998-01-01
Using the developed theory and modified Springer-Gelhar (SG) model, an identification method is proposed for estimating hydraulic conductivity from multi-level slug tests. The computerized algorithm calculates hydraulic conductivity from both monotonic and oscillatory well responses obtained using a double-packer system. Field verification of the method was performed at a specially designed fully penetrating well of 0.1-m diameter with a 10-m screen in a sand and gravel alluvial aquifer (MSEA site, Shelton, Nebraska). During well installation, disturbed core samples were collected every 0.6 m using a split-spoon sampler. Vertical profiles of hydraulic conductivity were produced on the basis of grain-size analysis of the disturbed core samples. These results closely correlate with the vertical profile of horizontal hydraulic conductivity obtained by interpreting multi-level slug test responses using the modified SG model. The identification method was applied to interpret the response from 474 slug tests in 156 locations at the MSEA site. More than 60% of responses were oscillatory. The method produced a good match to experimental data for both oscillatory and monotonic responses using an automated curve matching procedure. The proposed method allowed us to drastically increase the efficiency of each well used for aquifer characterization and to process massive arrays of field data. Recommendations generalizing this experience to massive application of the proposed method are developed.Using the developed theory and modified Springer-Gelhar (SG) model, an identification method is proposed for estimating hydraulic conductivity from multi-level slug tests. The computerized algorithm calculates hydraulic conductivity from both monotonic and oscillatory well responses obtained using a double-packer system. Field verification of the method was performed at a specially designed fully penetrating well of 0.1-m diameter with a 10-m screen in a sand and gravel alluvial aquifer (MSEA site, Shelton, Nebraska). During well installation, disturbed core samples were collected every 0.6 m using a split-spoon sampler. Vertical profiles of hydraulic conductivity were produced on the basis of grain-size analysis of the disturbed core samples. These results closely correlate with the vertical profile of horizontal hydraulic conductivity obtained by interpreting multi-level slug test responses using the modified SG model. The identification method was applied to interpret the response from 474 slug tests in 156 locations at the MSEA site. More than 60% of responses were oscillatory. The method produced a good match to experimental data for both oscillatory and monotonic responses using an automated curve matching procedure. The proposed method allowed us to drastically increase the efficiency of each well used for aquifer characterization and to process massive arrays of field data. Recommendations generalizing this experience to massive application of the proposed method are developed.
NASA Astrophysics Data System (ADS)
Zhang, Y.; Li, S.
2014-12-01
Geologic carbon sequestration (GCS) is proposed for the Nugget Sandstone in Moxa Arch, a regional saline aquifer with a large storage potential. For a proposed storage site, this study builds a suite of increasingly complex conceptual "geologic" model families, using subsets of the site characterization data: a homogeneous model family, a stationary petrophysical model family, a stationary facies model family with sub-facies petrophysical variability, and a non-stationary facies model family (with sub-facies variability) conditioned to soft data. These families, representing alternative conceptual site models built with increasing data, were simulated with the same CO2 injection test (50 years at 1/10 Mt per year), followed by 2950 years of monitoring. Using the Design of Experiment, an efficient sensitivity analysis (SA) is conducted for all families, systematically varying uncertain input parameters. Results are compared among the families to identify parameters that have 1st order impact on predicting the CO2 storage ratio (SR) at both end of injection and end of monitoring. At this site, geologic modeling factors do not significantly influence the short-term prediction of the storage ratio, although they become important over monitoring time, but only for those families where such factors are accounted for. Based on the SA, a response surface analysis is conducted to generate prediction envelopes of the storage ratio, which are compared among the families at both times. Results suggest a large uncertainty in the predicted storage ratio given the uncertainties in model parameters and modeling choices: SR varies from 5-60% (end of injection) to 18-100% (end of monitoring), although its variation among the model families is relatively minor. Moreover, long-term leakage risk is considered small at the proposed site. In the lowest-SR scenarios, all families predict gravity-stable supercritical CO2 migrating toward the bottom of the aquifer. In the highest-SR scenarios, supercritical CO2 footprints are relatively insignificant by the end of monitoring.
Conformational Sampling and Binding Site Assessment of Suppression of Tumorigenicity 2 Ectodomain
Yang, Chao-Yie; Delproposto, James; Chinnaswamy, Krishnapriya; Brown, William Clay; Wang, Shuying; Stuckey, Jeanne A.; Wang, Xinquan
2016-01-01
Suppression of Tumorigenicity 2 (ST2), a member of the interleukin-1 receptor (IL-1R) family, activates type 2 immune responses to pathogens and tissue damage via binding to IL-33. Dysregulated responses contribute to asthma, graft-versus-host and autoinflammatory diseases and disorders. To study ST2 structure for inhibitor development, we performed the principal component (PC) analysis on the crystal structures of IL1-1R1, IL1-1R2, ST2 and the refined ST2 ectodomain (ST2ECD) models, constructed from previously reported small-angle X-ray scattering data. The analysis facilitates mapping of the ST2ECD conformations to PC subspace for characterizing structural changes. Extensive coverage of ST2ECD conformations was then obtained using the accelerated molecular dynamics simulations started with the IL-33 bound ST2ECD structure as instructed by their projected locations on the PC subspace. Cluster analysis of all conformations further determined representative conformations of ST2ECD ensemble in solution. Alignment of the representative conformations with the ST2/IL-33 structure showed that the D3 domain of ST2ECD (containing D1-D3 domains) in most conformations exhibits no clashes with IL-33 in the crystal structure. Our experimental binding data informed that the D1-D2 domain of ST2ECD contributes predominantly to the interaction between ST2ECD and IL-33 underscoring the importance of the D1-D2 domain in binding. Computational binding site assessment revealed one third of the total detected binding sites in the representative conformations may be suitable for binding to potent small molecules. Locations of these sites include the D1-D2 domain ST2ECD and modulation sites conformed to ST2ECD conformations. Our study provides structural models and analyses of ST2ECD that could be useful for inhibitor discovery. PMID:26735493
Yeka, Adoke; Nankabirwa, Joaniter; Mpimbaza, Arthur; Kigozi, Ruth; Arinaitwe, Emmanuel; Drakeley, Chris; Greenhouse, Bryan; Kamya, Moses R.; Dorsey, Grant; Staedke, Sarah G.
2015-01-01
Background Understanding the current epidemiology of malaria and the relationship between intervention coverage, transmission intensity, and burden of disease is important to guide control activities. We aimed to determine the prevalence of anemia, parasitemia, and serological responses to P. falciparum antigens, and factors associated with these indicators, in three different epidemiological settings in Uganda. Methods and Findings In 2012, cross-sectional surveys were conducted in 200 randomly selected households from each of three sites: Walukuba, Jinja district (peri-urban); Kihihi, Kanungu district (rural); and Nagongera, Tororo district (rural) with corresponding estimates of annual entomologic inoculation rates (aEIR) of 3.8, 26.6, and 125.0, respectively. Of 2737 participants, laboratory testing was done in 2227 (81.4%), including measurement of hemoglobin, parasitemia using microscopy, and serological responses to P. falciparum apical membrane antigen 1 (AMA-1) and merozoite surface protein 1, 19 kilodalton fragment (MSP-119). Analysis of laboratory results was restricted to 1949 (87.5%) participants aged ≤ 40 years. Prevalence of anemia (hemoglobin < 11.0 g/dL) was significantly higher in Walukuba (18.9%) and Nagongera (17.4%) than in Kihihi (13.1%), and was strongly associated with decreasing age for those ≤ 5 years at all sites. Parasite prevalence was significantly higher in Nagongera (48.3%) than in Walukuba (12.2%) and Kihihi (12.8%), and significantly increased with age to 11 years, and then significantly decreased at all sites. Seropositivity to AMA-1 was 53.3% in Walukuba, 63.0% in Kihihi, and 83.7% in Nagongera and was associated with increasing age at all sites. AMA-1 seroconversion rates strongly correlated with transmission intensity, while serological responses to MSP-119 did not. Conclusion Anemia was predominant in young children and parasitemia peaked by 11 years across 3 sites with varied transmission intensity. Serological responses to AMA-1 appeared to best reflect transmission intensity, and may be a more accurate indicator for malaria surveillance than anemia or parasitemia. PMID:25768015
Lee, Moon Young; Park, Chanjae; Berent, Robyn M.; Park, Paul J.; Fuchs, Robert; Syn, Hannah; Chin, Albert; Townsend, Jared; Benson, Craig C.; Redelman, Doug; Shen, Tsai-wei; Park, Jong Kun; Miano, Joseph M.; Sanders, Kenton M.; Ro, Seungil
2015-01-01
Genome-scale expression data on the absolute numbers of gene isoforms offers essential clues in cellular functions and biological processes. Smooth muscle cells (SMCs) perform a unique contractile function through expression of specific genes controlled by serum response factor (SRF), a transcription factor that binds to DNA sites known as the CArG boxes. To identify SRF-regulated genes specifically expressed in SMCs, we isolated SMC populations from mouse small intestine and colon, obtained their transcriptomes, and constructed an interactive SMC genome and CArGome browser. To our knowledge, this is the first online resource that provides a comprehensive library of all genetic transcripts expressed in primary SMCs. The browser also serves as the first genome-wide map of SRF binding sites. The browser analysis revealed novel SMC-specific transcriptional variants and SRF target genes, which provided new and unique insights into the cellular and biological functions of the cells in gastrointestinal (GI) physiology. The SRF target genes in SMCs, which were discovered in silico, were confirmed by proteomic analysis of SMC-specific Srf knockout mice. Our genome browser offers a new perspective into the alternative expression of genes in the context of SRF binding sites in SMCs and provides a valuable reference for future functional studies. PMID:26241044
Factors influencing the distribution of metastases and survival in metastatic breast carcinoma.
Barişta, I; Baltali, E; Güllü, I H; Güler, N; Celik, I; Saraçbaşi, O; Tekuzman, G; Kars, A; Ozişik, Y; Ruacan, S; Atahan, I L; Firat, D
1996-12-01
A total of 370 patients with metastatic breast, carcinoma who had been followed at Hacettepe Oncology Department between 1980 and 1991 were retrospectively analyzed for the factors influencing the distribution of metastases and survival. Median age was 47 years. Radical or modified radical mastectomies were performed in 199 (53.8%). Infiltrative ductal carcinoma was the most common pathologic subtype (69.4%). In 191 patients who were evaluated for estrogen receptor (ER) status, 101 (52.9%) were positive and 90 (47.1%) were negative. The distribution of first metastases did not differ between the soft tissue, bone, and visceral sites. The second, third, and fourth metastases were more common in visceral sites (p < 0.05). ER and menopausal status did not affect distribution. Mortality rate was significantly lower in the group having the first metastasis to the bone (p < 0.05). Of interest, first metastases were predominantly found in visceral sites in patients having radical or modified radical mastectomies (p < 0.05). Response to therapy, presence of initial metastases, axillary status, and age were the important factors influencing the overall survival in univariate analysis, whereas response to therapy, ER status, age, and presence of initial metastases were the important factors according to the multivariate analysis.
NASA Astrophysics Data System (ADS)
Soundararajan, Venky; Aravamudan, Murali
2014-12-01
The efficacy and mechanisms of therapeutic action are largely described by atomic bonds and interactions local to drug binding sites. Here we introduce global connectivity analysis as a high-throughput computational assay of therapeutic action - inspired by the Google page rank algorithm that unearths most ``globally connected'' websites from the information-dense world wide web (WWW). We execute short timescale (30 ps) molecular dynamics simulations with high sampling frequency (0.01 ps), to identify amino acid residue hubs whose global connectivity dynamics are characteristic of the ligand or mutation associated with the target protein. We find that unexpected allosteric hubs - up to 20Å from the ATP binding site, but within 5Å of the phosphorylation site - encode the Gibbs free energy of inhibition (ΔGinhibition) for select protein kinase-targeted cancer therapeutics. We further find that clinically relevant somatic cancer mutations implicated in both drug resistance and personalized drug sensitivity can be predicted in a high-throughput fashion. Our results establish global connectivity analysis as a potent assay of protein functional modulation. This sets the stage for unearthing disease-causal exome mutations and motivates forecast of clinical drug response on a patient-by-patient basis. We suggest incorporation of structure-guided genetic inference assays into pharmaceutical and healthcare Oncology workflows.
Report to the President of the United States on Sexual Assault Prevention and Response
2014-11-01
established research history based on laboratory- tested principles of memory retrieval, knowledge representation, and communication. AFOSI has been using CI...analysis methods, including scientific research , data analysis, focus groups , and on -site assessments to evaluate the Department’s SAPR program...131 Report to the President of the United States on SAPR DMDC’s focus group methodology employs a standard qualitative research approach to
Juleff, Nicholas; Windsor, Miriam; Lefevre, Eric A.; Gubbins, Simon; Hamblin, Pip; Reid, Elizabeth; McLaughlin, Kerry; Beverley, Peter C. L.; Morrison, Ivan W.; Charleston, Bryan
2009-01-01
The role of T-lymphocyte subsets in recovery from foot-and-mouth disease virus (FMDV) infection in calves was investigated by administering subset-specific monoclonal antibodies. The depletion of circulating CD4+ or WC1+ γδ T cells was achieved for a period extending from before challenge to after resolution of viremia and peak clinical signs, whereas CD8+ cell depletion was only partial. The depletion of CD4+ cells was also confirmed by analysis of lymph node biopsy specimens 5 days postchallenge. Depletion with anti-WC1 and anti-CD8 antibodies had no effect on the kinetics of infection, clinical signs, and immune responses following FMDV infection. Three of the four CD4+ T-cell-depleted calves failed to generate an antibody response to the nonstructural polyprotein 3ABC but generated a neutralizing antibody response similar to that in the controls, including rapid isotype switching to immunoglobulin G antibody. We conclude that antibody responses to sites on the surface of the virus capsid are T cell independent, whereas those directed against the nonstructural proteins are T cell dependent. CD4 depletion was found to substantially inhibit antibody responses to the G-H peptide loop VP1135-156 on the viral capsid, indicating that responses to this particular site, which has a more mobile structure than other neutralizing sites on the virus capsid, are T cell dependent. The depletion of CD4+ T cells had no adverse effect on the magnitude or duration of clinical signs or clearance of virus from the circulation. Overall, we conclude that CD4+ T-cell-independent antibody responses play a major role in the resolution of foot-and-mouth disease in cattle. PMID:19176618
DOE Office of Scientific and Technical Information (OSTI.GOV)
Weber, E.R.
1983-09-01
The appendixes for the Saguaro Power Plant includes the following: receiver configuration selection report; cooperating modes and transitions; failure modes analysis; control system analysis; computer codes and simulation models; procurement package scope descriptions; responsibility matrix; solar system flow diagram component purpose list; thermal storage component and system test plans; solar steam generator tube-to-tubesheet weld analysis; pipeline listing; management control schedule; and system list and definitions.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ford, K.A.; LaBarbera, A.R.
1988-11-01
The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase inmore » receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.« less
Rapid assessment of postfire plant invasions in coniferous forests of the western United States
Freeman, J.P.; Stohlgren, T.J.; Hunter, M.E.; Omi, Philip N.; Martinson, E.J.; Chong, G.W.; Brown, C.S.
2007-01-01
Fire is a natural part of most forest ecosystems in the western United States, but its effects on nonnative plant invasion have only recently been studied. Also, forest managers are engaging in fuel reduction projects to lessen fire severity, often without considering potential negative ecological consequences such as nonnative plant species introductions. Increased availability of light, nutrients, and bare ground have all been associated with high-severity fires and fuel treatments and are known to aid in the establishment of nonnative plant species. We use vegetation and environmental data collected after wildfires at seven sites in coniferous forests in the western United States to study responses of nonnative plants to wildfire. We compared burned vs. unburned plots and plots treated with mechanical thinning and/or prescribed burning vs. untreated plots for nonnative plant species richness and cover and used correlation analyses to infer the effect of abiotic site conditions on invasibility. Wildfire was responsible for significant increases in nonnative species richness and cover, and a significant decrease in native cover. Mechanical thinning and prescribed fire fuel treatments were associated with significant changes in plant species composition at some sites. Treatment effects across sites were minimal and inconclusive due to significant site and site x treatment interaction effects caused by variation between sites including differences in treatment and fire severities and initial conditions (e.g., nonnative species sources). We used canonical correspondence analysis (CCA) to determine what combinations of environmental variables best explained patterns of nonnative plant species richness and cover. Variables related to fire severity, soil nutrients, and elevation explained most of the variation in species composition. Nonnative species were generally associated with sites with higher fire severity, elevation, percentage of bare ground, and lower soil nutrient levels and lower canopy cover. Early assessments of postfire stand conditions can guide rapid responses to nonnative plant invasions. ?? 2007 by the Ecological Society of America.
Carter, J.L.; Purcell, A.H.; Fend, S.V.; Resh, V.H.
2009-01-01
Research that explores the biological response to urbanization on a site-specific scale is necessary for management of urban basins. Recent studies have proposed a method to characterize the biological response of benthic macroinvertebrates along an urban gradient for several climatic regions in the USA. Our study demonstrates how this general framework can be refined and applied on a smaller scale to an urbanized basin, the Santa Clara Basin (surrounding San Jose, California, USA). Eighty-four sampling sites on 14 streams in the Santa Clara Basin were used for assessing local stream conditions. First, an urban index composed of human population density, road density, and urban land cover was used to determine the extent of urbanization upstream from each sampling site. Second, a multimetric biological index was developed to characterize the response of macroinvertebrate assemblages along the urban gradient. The resulting biological index included metrics from 3 ecological categories: taxonomic composition ( Ephemeroptera, Plecoptera, and Trichoptera), functional feeding group (shredder richness), and habit ( clingers). The 90th-quantile regression line was used to define the best available biological conditions along the urban gradient, which we define as the predicted biological potential. This descriptor was then used to determine the relative condition of sites throughout the basin. Hierarchical partitioning of variance revealed that several site-specific variables (dissolved O2 and temperature) were significantly related to a site's deviation from its predicted biological potential. Spatial analysis of each site's deviation from its biological potential indicated geographic heterogeneity in the distribution of impaired sites. The presence and operation of local dams optimize water use, but modify natural flow regimes, which in turn influence stream habitat, dissolved O2, and temperature. Current dissolved O2 and temperature regimes deviate from natural conditions and appear to affect benthic macroinvertebrate assemblages. The assessment methods presented in our study provide finer-scale assessment tools for managers in urban basins. ?? North American Benthological Society.
Powell, Jeffrey R.
2003-01-01
Response of fish communities to cropland density and natural environmental setting were evaluated at 20 streams in the Eastern Highland Rim Ecoregion of the lower Tennessee River Basin during the spring of 1999. Sites were selected to represent a gradient of cropland densities in basins draining about 30 to 100 square miles. Fish communities were sampled by using a combination of seining and electrofishing techniques. A total of 10,550 individual fish, representing 63 species and 15 families, were collected during the study and included the families Cyprinidae (minnows), 18 species; Percidae (perch and darters), 12 species; and Centrarchidae (sunfish), 12 species. Assessments of environmental characteristics, including instream and terrestrial data and land-cover data, were conducted for each site. Instream measurements, such as depth, velocity, substrate type, and embeddedness, were recorded at 3 points across 11 equidistant transects at each site. Terrestrial measurements, such as bank angle, canopy angle, and canopy closure percentage, were made along the stream bank and midchannel areas. Water-quality data collected included pH, dissolved oxygen, specific conductivity, water temperature, nutrients, and fecal-indicator bacteria. Substrate embeddedness was the only variable correlated with both cropland density and fish communities (as characterized by ordination scores and several community level metrics). Multivariate and nonparametric correlation techniques were used to evaluate fish-community responses to physical and chemical factors associated with a cropland-density gradient, where the gradient was defined as the percentage of the basin in row crops. Principal component analysis and correspondence analysis suggest that the Eastern Highland Rim Ecoregion is composed of three subgroups of sites based on inherent physical and biological differences. Data for the subgroup containing the largest number of sites were then re-analyzed, revealing that several environmental variables, such as nutrient concentrations, stream gradient, bankfull width, and substrate embeddedness, were related to cropland density; however, only a subset of those variables (substrate embeddedness, elevation, and streamflow) were related to fish communities. Results from this analysis suggest that although many water-quality and habitat variables are covariant with cropland density, most of the variables do not significantly affect fish-community composition; instead, fish communities primarily respond to the cumulative effects of sedimentation.
Kuang, Yuan-wen; Zhou, Guo-yi; Wen, Da-zhi; Li, Jiong; Sun, Fang-fang
2011-09-01
Concentrations of polycyclic aromatic hydrocarbons (PAHs) were examined and potential sources of PAHs were identified from the dated tree-rings of Masson pine (Pinus massoniana L.) near two industrial sites (Danshuikeng, DSK and Xiqiaoshan, XQS) in the Pearl River Delta of south China. Total concentrations of PAHs (∑PAHs) were revealed with similar patterns of temporal trends in the tree-rings at both sites, suggesting tree-rings recorded the historical variation in atmospheric PAHs. The differences of individual PAHs and of ∑PAHs detected in the tree-rings between the two sites reflected the historical differences of airborne PAHs. Regional changes in industrial activities might contribute to the site-specific and period-specific patterns of the tree-ring PAHs. The diagnostic PAH ratios of Ant/(Ant + PA), FL/(FL + Pyr), and BaA/(BaA + Chr)) revealed that PAHs in the tree-rings at both sites mainly stemmed from the combustion process (pyrogenic sources). Principal component analysis further confirmed that wood burning, coal combustion, diesel, and gasoline-powered vehicular emissions were the dominant contributors of PAHs sources at DSK, while diesel combustion, gasoline and natural gas combustion, and incomplete coal combustion were responsible for the main origins of PAHs at XQS. Tree-ring analysis of PAHs was indicative of PAHs from a mixture of sources of combustion, thus minimizing the bias of short-term active air sampling.
Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis.
Meng, C X; Wei, W; Su, Z- L; Qin, S
2006-10-01
Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.
Tropical forest response to elevated CO2: Model-experiment integration at the AmazonFACE site.
NASA Astrophysics Data System (ADS)
Frankenberg, C.; Berry, J. A.; Guanter, L.; Joiner, J.
2014-12-01
The terrestrial biosphere's response to current and future elevated atmospheric carbon dioxide (eCO2) is a large source of uncertainty in future projections of the C cycle, climate and ecosystem functioning. In particular, the sensitivity of tropical rainforest ecosystems to eCO2 is largely unknown even though the importance of tropical forests for biodiversity, carbon storage and regional and global climate feedbacks is unambiguously recognized. The AmazonFACE (Free-Air Carbon Enrichment) project will be the first ecosystem scale eCO2 experiment undertaken in the tropics, as well as the first to be undertaken in a mature forest. AmazonFACE provides the opportunity to integrate ecosystem modeling with experimental observations right from the beginning of the experiment, harboring a two-way exchange, i.e. models provide hypotheses to be tested, and observations deliver the crucial data to test and improve ecosystem models. We present preliminary exploration of observed and expected process responses to eCO2 at the AmazonFACE site from the dynamic global vegetation model LPJ-GUESS, highlighting opportunities and pitfalls for model integration of tropical FACE experiments. The preliminary analysis provides baseline hypotheses, which are to be further developed with a follow-up multiple model inter-comparison. The analysis builds on the recently undertaken FACE-MDS (Model-Data Synthesis) project, which was applied to two temperate FACE experiments and exceeds the traditional focus on comparing modeled end-target output. The approach has proven successful in identifying well (and less well) represented processes in models, which are separated for six clusters also here; (1) Carbon fluxes, (2) Carbon pools, (3) Energy balance, (4) Hydrology, (5) Nutrient cycling, and (6) Population dynamics. Simulation performance of observed conditions at the AmazonFACE site (a.o. from Manaus K34 eddy flux tower) will highlight process-based model deficiencies, and aid the separation of uncertainties arising from general ecosystem responses and those responses related to eCO2.
de Luis, Martin; Čufar, Katarina; Di Filippo, Alfredo; Novak, Klemen; Papadopoulos, Andreas; Piovesan, Gianluca; Rathgeber, Cyrille B. K.; Raventós, José; Saz, Miguel Angel; Smith, Kevin T.
2013-01-01
We investigated the variability of the climate-growth relationship of Aleppo pine across its distribution range in the Mediterranean Basin. We constructed a network of tree-ring index chronologies from 63 sites across the region. Correlation function analysis identified the relationships of tree-ring index to climate factors for each site. We also estimated the dominant climatic gradients of the region using principal component analysis of monthly, seasonal, and annual mean temperature and total precipitation from 1,068 climatic gridpoints. Variation in ring width index was primarily related to precipitation and secondarily to temperature. However, we found that the dendroclimatic relationship depended on the position of the site along the climatic gradient. In the southern part of the distribution range, where temperature was generally higher and precipitation lower than the regional average, reduced growth was also associated with warm and dry conditions. In the northern part, where the average temperature was lower and the precipitation more abundant than the regional average, reduced growth was associated with cool conditions. Thus, our study highlights the substantial plasticity of Aleppo pine in response to different climatic conditions. These results do not resolve the source of response variability as being due to either genetic variation in provenance, to phenotypic plasticity, or a combination of factors. However, as current growth responses to inter-annual climate variability vary spatially across existing climate gradients, future climate-growth relationships will also likely be determined by differential adaptation and/or acclimation responses to spatial climatic variation. The contribution of local adaptation and/or phenotypic plasticity across populations to the persistence of species under global warming could be decisive for prediction of climate change impacts across populations. In this sense, a more complex forest dynamics modeling approach that includes the contribution of genetic variation and phenotypic plasticity can improve the reliability of the ecological inferences derived from the climate-growth relationships. PMID:24391786
Tropical forest response to elevated CO2: Model-experiment integration at the AmazonFACE site.
NASA Astrophysics Data System (ADS)
Fleischer, K.
2015-12-01
The terrestrial biosphere's response to current and future elevated atmospheric carbon dioxide (eCO2) is a large source of uncertainty in future projections of the C cycle, climate and ecosystem functioning. In particular, the sensitivity of tropical rainforest ecosystems to eCO2 is largely unknown even though the importance of tropical forests for biodiversity, carbon storage and regional and global climate feedbacks is unambiguously recognized. The AmazonFACE (Free-Air Carbon Enrichment) project will be the first ecosystem scale eCO2 experiment undertaken in the tropics, as well as the first to be undertaken in a mature forest. AmazonFACE provides the opportunity to integrate ecosystem modeling with experimental observations right from the beginning of the experiment, harboring a two-way exchange, i.e. models provide hypotheses to be tested, and observations deliver the crucial data to test and improve ecosystem models. We present preliminary exploration of observed and expected process responses to eCO2 at the AmazonFACE site from the dynamic global vegetation model LPJ-GUESS, highlighting opportunities and pitfalls for model integration of tropical FACE experiments. The preliminary analysis provides baseline hypotheses, which are to be further developed with a follow-up multiple model inter-comparison. The analysis builds on the recently undertaken FACE-MDS (Model-Data Synthesis) project, which was applied to two temperate FACE experiments and exceeds the traditional focus on comparing modeled end-target output. The approach has proven successful in identifying well (and less well) represented processes in models, which are separated for six clusters also here; (1) Carbon fluxes, (2) Carbon pools, (3) Energy balance, (4) Hydrology, (5) Nutrient cycling, and (6) Population dynamics. Simulation performance of observed conditions at the AmazonFACE site (a.o. from Manaus K34 eddy flux tower) will highlight process-based model deficiencies, and aid the separation of uncertainties arising from general ecosystem responses and those responses related to eCO2.
(En)Gendering Responsibility: A Critical News Analysis of Argentina's Education Reform, 2001-2002
ERIC Educational Resources Information Center
Robert, Sarah A.
2012-01-01
Education reform continues around the globe, though questioned and critiqued in relation to goals of democratizing educational decision-making. Newspapers are one site of contestation and negotiation where struggles over global reform discourses are contextualized in "obvious" and "natural" local language. In this article, I…
Study to Determine Seismic Response of Sonic Boom-Coupled Rayleigh Waves
1990-04-26
are compiled from the microtremor measurements carried out by Instituto de Ingenieria , UNAM and scientists from Japan (for a total of 181 sites...the accelerographs operated by Instituto de Ingenieria , UNAM. Using this new data and results from the analysis of previous accelerograms we present
76 FR 43319 - Record of Decision for the Continued Operation of the Y-12 National Security Complex
Federal Register 2010, 2011, 2012, 2013, 2014
2011-07-20
...; visual resources; site infrastructure; traffic and transportation; geology and soils; air quality and... excavation, soil characterization, transportation or disposal associated with the UPF. Response. The Y-12 Final SWEIS includes an analysis of the impacts of the UPF construction, including soil disturbance...
Neuroglian-mediated cell adhesion induces assembly of the membrane skeleton at cell contact sites
1996-01-01
The protein ankyrin links integral membrane proteins to the spectrin- based membrane skeleton. Ankyrin is often concentrated within restricted membrane domains of polarized epithelia and neurons, but the mechanisms responsible for membrane targeting and its segregation within a continuous lipid bilayer remain unexplained. We provide evidence that neuroglian, a cell adhesion molecule related to L1 and neurofascin, can transmit positional information directly to ankyrin and thereby polarize its distribution in Drosophila S2 tissue culture cells. Ankyrin was not normally associated with the plasma membrane of these cells. Upon expression of an inducible neuroglian minigene, however, cells aggregated into large clusters and ankyrin became concentrated at sites of cell-cell contact. Spectrin was also recruited to sites of cell contact in response to neuroglian expression. The accumulation of ankyrin at cell contacts required the presence of the cytoplasmic domain of neuroglian since a glycosyl phosphatidylinositol- linked form of neuroglian failed to recruit ankyrin to sites of cell- cell contact. Double-labeling experiments revealed that, whereas ankyrin was strictly associated with sites of cell-cell contact, neuroglian was more broadly distributed over the cell surface. A direct interaction between neuroglian and ankyrin was demonstrated using yeast two-hybrid analysis. Thus, neuroglian appears to be activated by extracellular adhesion so that ankyrin and the membrane skeleton selectively associate with sites of cell contact and not with other regions of the plasma membrane. PMID:8636238
Neuroglian-mediated cell adhesion induces assembly of the membrane skeleton at cell contact sites.
Dubreuil, R R; MacVicar, G; Dissanayake, S; Liu, C; Homer, D; Hortsch, M
1996-05-01
The protein ankyrin links integral membrane proteins to the spectrin-based membrane skeleton. Ankyrin is often concentrated within restricted membrane domains of polarized epithelia and neurons, but the mechanisms responsible for membrane targeting and its segregation within a continuous lipid bilayer remain unexplained. We provide evidence that neuroglian, a cell adhesion molecule related to L1 and neurofascin, can transmit positional information directly to ankyrin and thereby polarize its distribution in Drosophila S2 tissue culture cells. Ankyrin was not normally associated with the plasma membrane of these cells. Upon expression of an inducible neuroglian minigene, however, cells aggregated into large clusters and ankyrin became concentrated at sites of cell-cell contact. Spectrin was also recruited to sites of cell contact in response to neuroglian expression. The accumulation of ankyrin at cell contacts required the presence of the cytoplasmic domain of neuroglian since a glycosyl phosphatidylinositol-linked form of neuroglian failed to recruit ankyrin to sites of cell-cell contact. Double-labeling experiments revealed that, whereas ankyrin was strictly associated with sites of cell-cell contact, neuroglian was more broadly distributed over the cell surface. A direct interaction between neuroglian and ankyrin was demonstrated using yeast two-hybrid analysis. Thus, neuroglian appears to be activated by extracellular adhesion so that ankyrin and the membrane skeleton selectively associate with sites of cell contact and not with other regions of the plasma membrane.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dam, William; Campbell, Sam; Johnson, Ray
Milling activities at a former uranium mill site near Riverton, Wyoming, USA, contaminated the shallow groundwater beneath and downgradient of the site. Although the mill operated for <6 years (1958-1963), its impact remains an environmental liability. Groundwater modeling predicted that contaminant concentrations were declining steadily, which confirmed the conceptual site model (CSM). However, local flooding in 2010 mobilized contaminants that migrated downgradient from the Riverton site and resulted in a dramatic increase in groundwater contaminant concentrations. This observation indicated that the original CSM was inadequate to explain site conditions and needed to be refined. In response to the new observationsmore » after the flood, a collaborative investigation to better understand site conditions and processes commenced. This investigation included installing 103 boreholes to collect soil and groundwater samples, sampling and analysis of evaporite minerals along the bank of the Little Wind River, an analysis of evaportranspiration in the shallow aquifer, and sampling naturally organic-rich sediments near groundwater discharge areas. The enhanced characterization revealed that the existing CSM did not account for high uranium concentrations in groundwater remaining on the former mill site and groundwater plume stagnation near the Little Wind River. Observations from the flood and subsequent investigations indicate that additional characterization is still needed to continue refining the CSM and determine the viability of the natural flushing compliance strategy. Additional sampling, analysis, and testing of soil and groundwater are necessary to investigate secondary contaminant sources, mobilization of contaminants during floods, geochemical processes, contaminant plume stagnation, distribution of evaporite minerals and organic-rich sediments, and mechanisms and rates of contaminant transfer from soil to groundwater. Future data collection will be used to continually revise the CSM and evaluate the compliance strategy at the site.« less
Weber, Kristi; Story, Mary; Harnack, Lisa
2006-09-01
Americans are spending an increasing amount of time using "new media" like the Internet. There has been little research examining food and beverage Web sites' content and marketing practices, especially those that attract children and adolescents. The purpose of this study was to conduct a content analysis of food- and beverage-brand Web sites and the marketing techniques and advertising strategies present on these sites. The top five brands in eight food and beverage categories, 40 brands in total, were selected based on annual sales data from Brandweek magazine's annual "Superbrands" report. Data were collected using a standardized coding form. The results show a wide variety of Internet marketing techniques and advertising strategies targeting children and adolescents. "Advergaming" (games in which the advertised product is part of the game) was present on 63% of the Web sites. Half or more of the Web sites used cartoon characters (50%) or spokescharacters (55%), or had a specially designated children's area (58%) with a direct link from the homepage. With interactive media still in its developmental stage, there is a need to develop safeguards for children. Food and nutrition professionals need to advocate for responsible marketing techniques that will support the health of children.
Code of Federal Regulations, 2012 CFR
2012-07-01
... remedial action is required. Munitions response area (MRA) means any area on a defense site that is known... MRA comprises one or more munitions response sites. Munitions response site (MRS) means a discrete location within an MRA that is known to require a munitions response. Operational range means a range that...
Code of Federal Regulations, 2013 CFR
2013-07-01
... remedial action is required. Munitions response area (MRA) means any area on a defense site that is known... MRA comprises one or more munitions response sites. Munitions response site (MRS) means a discrete location within an MRA that is known to require a munitions response. Operational range means a range that...
Code of Federal Regulations, 2014 CFR
2014-07-01
... remedial action is required. Munitions response area (MRA) means any area on a defense site that is known... MRA comprises one or more munitions response sites. Munitions response site (MRS) means a discrete location within an MRA that is known to require a munitions response. Operational range means a range that...
Role of Plasticity at Different Sites across the Time Course of Cerebellar Motor Learning
Lisberger, Stephen G.
2014-01-01
Learning comprises multiple components that probably involve cellular and synaptic plasticity at multiple sites. Different neural sites may play their largest roles at different times during behavioral learning. We have used motor learning in smooth pursuit eye movements of monkeys to determine how and when different components of learning occur in a known cerebellar circuit. The earliest learning occurs when one climbing-fiber response to a learning instruction causes simple-spike firing rate of Purkinje cells in the floccular complex of the cerebellum to be depressed transiently at the time of the instruction on the next trial. Trial-over-trial depression and the associated learning in eye movement are forgotten in <6 s, but facilitate long-term behavioral learning over a time scale of ∼5 min. During 100 repetitions of a learning instruction, simple-spike firing rate becomes progressively depressed in Purkinje cells that receive climbing-fiber inputs from the instruction. In Purkinje cells that prefer the opposite direction of pursuit and therefore do not receive climbing-fiber inputs related to the instruction, simple-spike responses undergo potentiation, but more weakly and more slowly. Analysis of the relationship between the learned changes in simple-spike firing and learning in eye velocity suggests an orderly progression of plasticity: first on Purkinje cells with complex-spike (CS) responses to the instruction, later on Purkinje cells with CS responses to the opposite direction of instruction, and last in sites outside the cerebellar cortex. Climbing-fiber inputs appear to play a fast and primary, but nonexclusive, role in pursuit learning. PMID:24849344
Gonsalves, Sarah E.; Moses, Alan M.; Razak, Zak; Robert, Francois; Westwood, J. Timothy
2011-01-01
During heat shock (HS) and other stresses, HS gene transcription in eukaryotes is up-regulated by the transcription factor heat shock factor (HSF). While the identities of the major HS genes have been known for more than 30 years, it has been suspected that HSF binds to numerous other genes and potentially regulates their transcription. In this study, we have used a chromatin immunoprecipitation and microarray (ChIP-chip) approach to identify 434 regions in the Drosophila genome that are bound by HSF. We have also performed a transcript analysis of heat shocked Kc167 cells and third instar larvae and compared them to HSF binding sites. The heat-induced transcription profiles were quite different between cells and larvae and surprisingly only about 10% of the genes associated with HSF binding sites show changed transcription. There were also genes that showed changes in transcript levels that did not appear to correlate with HSF binding sites. Analysis of the locations of the HSF binding sites revealed that 57% were contained within genes with approximately 2/3rds of these sites being in introns. We also found that the insulator protein, BEAF, has enriched binding prior to HS to promoters of genes that are bound by HSF upon HS but that are not transcriptionally induced during HS. When the genes associated with HSF binding sites in promoters were analyzed for gene ontology terms, categories such as stress response and transferase activity were enriched whereas analysis of genes having HSF binding sites in introns identified those categories plus ones related to developmental processes and reproduction. These results suggest that Drosophila HSF may be regulating many genes besides the known HS genes and that some of these genes may be regulated during non-stress conditions. PMID:21264254
Gonsalves, Sarah E; Moses, Alan M; Razak, Zak; Robert, Francois; Westwood, J Timothy
2011-01-14
During heat shock (HS) and other stresses, HS gene transcription in eukaryotes is up-regulated by the transcription factor heat shock factor (HSF). While the identities of the major HS genes have been known for more than 30 years, it has been suspected that HSF binds to numerous other genes and potentially regulates their transcription. In this study, we have used a chromatin immunoprecipitation and microarray (ChIP-chip) approach to identify 434 regions in the Drosophila genome that are bound by HSF. We have also performed a transcript analysis of heat shocked Kc167 cells and third instar larvae and compared them to HSF binding sites. The heat-induced transcription profiles were quite different between cells and larvae and surprisingly only about 10% of the genes associated with HSF binding sites show changed transcription. There were also genes that showed changes in transcript levels that did not appear to correlate with HSF binding sites. Analysis of the locations of the HSF binding sites revealed that 57% were contained within genes with approximately 2/3rds of these sites being in introns. We also found that the insulator protein, BEAF, has enriched binding prior to HS to promoters of genes that are bound by HSF upon HS but that are not transcriptionally induced during HS. When the genes associated with HSF binding sites in promoters were analyzed for gene ontology terms, categories such as stress response and transferase activity were enriched whereas analysis of genes having HSF binding sites in introns identified those categories plus ones related to developmental processes and reproduction. These results suggest that Drosophila HSF may be regulating many genes besides the known HS genes and that some of these genes may be regulated during non-stress conditions.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
This report develops and applies a methodology for estimating strong earthquake ground motion. The motivation was to develop a much needed tool for use in developing the seismic requirements for structural designs. An earthquake`s ground motion is a function of the earthquake`s magnitude, and the physical properties of the earth through which the seismic waves travel from the earthquake fault to the site of interest. The emphasis of this study is on ground motion estimation in Eastern North America (east of the Rocky Mountains), with particular emphasis on the Eastern United States and southeastern Canada. Eastern North America is amore » stable continental region, having sparse earthquake activity with rare occurrences of large earthquakes. While large earthquakes are of interest for assessing seismic hazard, little data exists from the region to empirically quantify their effects. The focus of the report is on the attributes of ground motion in Eastern North America that are of interest for the design of facilities such as nuclear power plants. This document, Volume II, contains Appendices 2, 3, 5, 6, and 7 covering the following topics: Eastern North American Empirical Ground Motion Data; Examination of Variance of Seismographic Network Data; Soil Amplification and Vertical-to-Horizontal Ratios from Analysis of Strong Motion Data From Active Tectonic Regions; Revision and Calibration of Ou and Herrmann Method; Generalized Ray Procedure for Modeling Ground Motion Attenuation; Crustal Models for Velocity Regionalization; Depth Distribution Models; Development of Generic Site Effects Model; Validation and Comparison of One-Dimensional Site Response Methodologies; Plots of Amplification Factors; Assessment of Coupling Between Vertical & Horizontal Motions in Nonlinear Site Response Analysis; and Modeling of Dynamic Soil Properties.« less
Orris D. McCauley; George R., Jr. Trimble
1975-01-01
The relative or percentage value response after 12 years of selective cutting practices on low- and high-quality sites in Appalachian hardwoods amounted to a 119-percent increase on the low-quality site and 145 percent on the high-quality site. The absolute value or actual dollar response, on the other hand, showed that the low-quality site increased in value only $76/...
Slonecker, E. Terrence; Fisher, Gary B.
2011-01-01
This report represents a remote sensing research effort conducted by the U.S. Geological Survey in cooperation with the U.S. Environmental Protection Agency (EPA) for the EPA Office of Inspector General. The objective of this investigation was to explore the efficacy of remote sensing as a technology for postclosure monitoring of hazardous waste sites as defined under the Comprehensive Environmental Response Compensation and Liability Act of 1980 (Public Law 96-510, 42 U.S.C. §9601 et seq.), also known as \\"Superfund.\\" Five delisted Superfund sites in Maryland and Virginia were imaged with a hyperspectral sensor and visited for collection of soil, water, and spectral samples and inspection of general site conditions. This report evaluates traditional and hyperspectral imagery and field spectroscopic measurement techniques in the characterization and analysis of fugitive (anthropogenic, uncontrolled) contamination at previously remediated hazardous waste disposal sites.
Berniak, K; Rybak, P; Bernas, T; Zarębski, M; Biela, E; Zhao, H; Darzynkiewicz, Z; Dobrucki, J W
2013-10-01
A method of quantitative analysis of spatial (3D) relationship between discrete nuclear events detected by confocal microscopy is described and applied in analysis of a dependence between sites of DNA damage signaling (γH2AX foci) and DNA replication (EdU incorporation) in cells subjected to treatments with camptothecin (Cpt) or hydrogen peroxide (H2O2). Cpt induces γH2AX foci, likely reporting formation of DNA double-strand breaks (DSBs), almost exclusively at sites of DNA replication. This finding is consistent with the known mechanism of induction of DSBs by DNA topoisomerase I (topo1) inhibitors at the sites of collisions of the moving replication forks with topo1-DNA "cleavable complexes" stabilized by Cpt. Whereas an increased level of H2AX histone phosphorylation is seen in S-phase of cells subjected to H2O2, only a minor proportion of γH2AX foci coincide with DNA replication sites. Thus, the increased level of H2AX phosphorylation induced by H2O2 is not a direct consequence of formation of DNA lesions at the sites of moving DNA replication forks. These data suggest that oxidative stress induced by H2O2 and formation of the primary H2O2-induced lesions (8-oxo-7,8-dihydroguanosine) inhibits replication globally and triggers formation of γH2AX at various distances from replication forks. Quantitative analysis of a frequency of DNA replication sites and γH2AX foci suggests also that stalling of replicating forks by Cpt leads to activation of new DNA replication origins. © 2013 International Society for Advancement of Cytometry. Copyright © 2013 International Society for Advancement of Cytometry.
Li, Hong Lian; Gu, Xiao Hui; Li, Bi Jun; Chen, Xiao; Lin, Hao Ran; Xia, Jun Hong
2017-01-01
Hypoxia is a major cause of fish morbidity and mortality in the aquatic environment. Hypoxia-inducible factors are very important modulators in the transcriptional response to hypoxic stress. In this study, we characterized and conducted functional analysis of hypoxia-inducible factor HIF1α and its inhibitor HIF1αn in Nile tilapia (Oreochromis niloticus). By cloning and Sanger sequencing, we obtained the full length cDNA sequences for HIF1α (2686bp) and HIF1αn (1308bp), respectively. The CDS of HIF1α includes 15 exons encoding 768 amino acid residues and the CDS of HIF1αn contains 8 exons encoding 354 amino acid residues. The complete CDS sequences of HIF1α and HIF1αn cloned from tilapia shared very high homology with known genes from other fishes. HIF1α show differentiated expression in different tissues (brain, heart, gill, spleen, liver) and at different hypoxia exposure times (6h, 12h, 24h). HIF1αn expression level under hypoxia is generally increased (6h, 12h, 24h) and shows extremely highly upregulation in brain tissue under hypoxia. A functional determination site analysis in the protein sequences between fish and land animals identified 21 amino acid sites in HIF1α and 2 sites in HIF1αn as significantly associated sites (α = 0.05). Phylogenetic tree-based positive selection analysis suggested 22 sites in HIF1α as positively selected sites with a p-value of at least 95% for fish lineages compared to the land animals. Our study could be important for clarifying the mechanism of fish adaptation to aquatic hypoxia environment.
Li, Hong Lian; Gu, Xiao Hui; Li, Bi Jun; Chen, Xiao; Lin, Hao Ran; Xia, Jun Hong
2017-01-01
Hypoxia is a major cause of fish morbidity and mortality in the aquatic environment. Hypoxia-inducible factors are very important modulators in the transcriptional response to hypoxic stress. In this study, we characterized and conducted functional analysis of hypoxia-inducible factor HIF1α and its inhibitor HIF1αn in Nile tilapia (Oreochromis niloticus). By cloning and Sanger sequencing, we obtained the full length cDNA sequences for HIF1α (2686bp) and HIF1αn (1308bp), respectively. The CDS of HIF1α includes 15 exons encoding 768 amino acid residues and the CDS of HIF1αn contains 8 exons encoding 354 amino acid residues. The complete CDS sequences of HIF1α and HIF1αn cloned from tilapia shared very high homology with known genes from other fishes. HIF1α show differentiated expression in different tissues (brain, heart, gill, spleen, liver) and at different hypoxia exposure times (6h, 12h, 24h). HIF1αn expression level under hypoxia is generally increased (6h, 12h, 24h) and shows extremely highly upregulation in brain tissue under hypoxia. A functional determination site analysis in the protein sequences between fish and land animals identified 21 amino acid sites in HIF1α and 2 sites in HIF1αn as significantly associated sites (α = 0.05). Phylogenetic tree-based positive selection analysis suggested 22 sites in HIF1α as positively selected sites with a p-value of at least 95% for fish lineages compared to the land animals. Our study could be important for clarifying the mechanism of fish adaptation to aquatic hypoxia environment. PMID:28278251
DOE Office of Scientific and Technical Information (OSTI.GOV)
McManamay, Ryan A; Orth, Dr. Donald J; Dolloff, Dr. Charles A
2013-01-01
Sediment transport, one of the key processes of river systems, is altered or stopped by dams, leaving lower river reaches barren of sand and gravel, both of which are essential habitat for fish and macroinvertebrates. One way to compensate for losses in sediment is to supplement gravel to river reaches below impoundments. Because gravel addition has become a widespread practice, it is essential to evaluate the biotic response to restoration projects in order to improve the efficacy of future applications. The purpose of our study was to evaluate the response of the macroinvertebrate community to gravel addition in a high-gradient,more » regulated river in western North Carolina. We collected benthic macroinvertebrate samples from gravel-enhanced areas and unenhanced areas for 1 season before gravel addition, and for 4 seasons afterwards. Repeated measures multivariate analysis of variance indicated that the responses of macroinvertebrates to gravel addition were generally specific to individual taxa or particular functional feeding groups and did not lead to consistent patterns in overall family richness, diversity, density, or evenness. Non-metric multi-dimensional scaling showed that shifts in macroinvertebrate community composition were temporary and dependent upon site conditions and season. Correlations between macroinvertebrate response variables and substrate microhabitat variables existed with or without the inclusion of data from enhanced areas, which suggests that substrate-biotic relationships were present before gravel addition. A review of the current literature suggests that the responses of benthic macroinvertebrates to substrate restoration are inconsistent and dependent upon site conditions and the degree habitat improvement of pre-restoration site conditions.« less
Bendix, J.; Hupp, C.R.
2000-01-01
Changes in the macroinvertebrate community in response to flow variations in the Little Stour River, Kent, UK, were examined over a 6 year period (1992-1997). This period included the final year of the 1988-1992 drought, followed by some of the wettest conditions recorded this century and a second period of drought between 1996 and 1997. Each year, samples were collected from 15 sites during late-summer base-flow conditions. Correspondence analysis identified clear differences between samples from upstream and downstream sites, and between drought and non-drought years. Step-wise multiple regression was used to identify hydrological indicators of community variation. Several different indices were used to describe the macroinvertebrate community, including macroinvertebrate community abundance, number of families and species, and individual species. Site characteristics were fundamental in accounting for variation in the unstandardized macroinvertebrate community. However, when differences between sites were controlled, hydrological conditions were found to play a dominant role in explaining ecological variation. Indices of high discharge (or their absence), 4-7 months prior to sampling (i.e. winter-spring), were found to be the most important variables for describing the late-summer community The results are discussed in relation to the role of flow variability in shaping instream communities and management implications. Copyright ?? 2000 John Wiley & Sons, Ltd.Changes in the macroinvertebrate community in response to flow variations in the Little Stour River, Kent, UK, were examined over a 6 year period (1992-1997). This period included the final year of the 1988-1992 drought, followed by some of the wettest conditions recorded this century and a second period of drought between 1996 and 1997. Each year, samples were collected from 15 sites during late-summer base-flow conditions. Correspondence analysis identified clear differences between samples from upstream and downstream sites, and between drought and non-drought years. Step-wise multiple regression was used to identify hydrological indicators of community variation. Several different indices were used to describe the macroinvertebrate community, including macroinvertebrate community abundance, number of families and species, and individual species. Site characteristics were fundamental in accounting for variation in the unstandardized macroinvertebrate community. However, when differences between sites were controlled, hydrological conditions were found to play a dominant role in explaining ecological variation. Indices of high discharge (or their absence), 4-7 months prior to sampling (i.e. winter-spring), were found to be the most important variables for describing the late-summer community. The results are discussed in relation to the role of flow variability in shaping instream communities and management implications.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mileni, Mauro; Garfunkle, Joie; Ezzili, Cyrine
2010-11-03
Three cocrystal X-ray structures of the {alpha}-ketoheterocycle inhibitors 3-5 bound to a humanized variant of fatty acid amide hydrolase (FAAH) are disclosed and comparatively discussed alongside those of 1 (OL-135) and its isomer 2. These five X-ray structures systematically probe each of the three active site regions key to substrate or inhibitor binding: (1) the conformationally mobile acyl chain-binding pocket and membrane access channel responsible for fatty acid amide substrate and inhibitor acyl chain binding, (2) the atypical active site catalytic residues and surrounding oxyanion hole that covalently binds the core of the {alpha}-ketoheterocycle inhibitors captured as deprotonated hemiketals mimickingmore » the tetrahedral intermediate of the enzyme-catalyzed reaction, and (3) the cytosolic port and its uniquely important imbedded ordered water molecules and a newly identified anion binding site. The detailed analysis of their key active site interactions and their implications on the interpretation of the available structure-activity relationships are discussed providing important insights for future design.« less
Field-Effect Biosensors for On-Site Detection: Recent Advances and Promising Targets.
Choi, Jaebin; Seong, Tae Wha; Jeun, Minhong; Lee, Kwan Hyi
2017-10-01
There is an explosive interest in the immediate and cost-effective analysis of field-collected biological samples, as many advanced biodetection tools are highly sensitive, yet immobile. On-site biosensors are portable and convenient sensors that provide detection results at the point of care. They are designed to secure precision in highly ionic and heterogeneous solutions with minimal hardware. Among various methods that are capable of such analysis, field-effect biosensors are promising candidates due to their unique sensitivity, manufacturing scalability, and integrability with computational circuitry. Recent developments in nanotechnological surface modification show promising results in sensing from blood, serum, and urine. This report gives a particular emphasis on the on-site efficacy of recently published field-effect biosensors, specifically, detection limits in physiological solutions, response times, and scalability. The survey of the properties and existing detection methods of four promising biotargets, exosomes, bacteria, viruses, and metabolites, aims at providing a roadmap for future field-effect and other on-site biosensors. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Diagnosis of nutrient imbalances with vector analysis in agroforestry systems.
Isaac, Marney E; Kimaro, Anthony A
2011-01-01
Agricultural intensification has had unintended environmental consequences, including increased nutrient leaching and surface runoff and other agrarian-derived pollutants. Improved diagnosis of on-farm nutrient dynamics will have the advantage of increasing yields and will diminish financial and environmental costs. To achieve this, a management support system that allows for site-specific rapid evaluation of nutrient production imbalances and subsequent management prescriptions is needed for agroecological design. Vector diagnosis, a bivariate model to depict changes in yield and nutritional response simultaneously in a single graph, facilitates identification of nutritional status such as growth dilution, deficiency, sufficiency, luxury uptake, and toxicity. Quantitative data from cocoa agroforestry systems and pigeonpea intercropping trials in Ghana and Tanzania, respectively, were re-evaluated with vector analysis. Relative to monoculture, biomass increase in cocoa ( L.) under shade (35-80%) was accompanied by a 17 to 25% decline in P concentration, the most limiting nutrient on this site. Similarly, increasing biomass with declining P concentrations was noted for pigeonpea [ (L). Millsp.] in response to soil moisture availability under intercropping. Although vector analysis depicted nutrient responses, the current vector model does not consider non-nutrient resource effects on growth, such as ameliorated light and soil moisture, which were particularly active in these systems. We revisit and develop vector analysis into a framework for diagnosing nutrient and non-nutrient interactions in agroforestry systems. Such a diagnostic technique advances management decision-making by increasing nutrient precision and reducing environmental issues associated with agrarian-derived soil contamination. American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America.
Buckbinder, L; Miralles, V J; Reinberg, D
1989-01-01
We have examined the control of gene expression from the adenovirus early region III (Ad-EIII) promoter, which contains two previously defined elements, the AP1 and ATF sites. We found that the AP1 element is capable of mediating activation by the adenovirus immediate early (EIa) gene products. Consistent with studies demonstrating that the AP1 site mediates signal transduction in response to 12-O-tetradecanoylphorbol 13-acetate (TPA) we have shown that TPA can activate Ad-EIII expression and overcome the requirement for EIa. Together TPA and EIa elicited a synergistic response in expression from the Ad-EIII promoter during both transient expression assays and viral infections. This synergistic effect required the AP1 element. An EIII promoter construct, in which sequences upstream of the TATA box had been replaced with four AP1 sites, was responsive to TPA and EIa and in combination promoted the synergistic effect. The analysis of specific factors involved in transcription from the Ad-EIII indicated that proteins recognizing the ATF and AP1 sites were important in expression from this promoter in vitro. Purification of protein factors that specifically stimulated EIII expression resulted in the isolation of a set of factors of the AP1 family. Affinity purified AP1 recognized and activated transcription through both the AP1 and ATF elements. In addition, a protein fraction was identified with DNA binding activity specific for the ATF element. This fraction was dependent on the ATF site for transcriptional activity. Images PMID:2531661
Species-Specific Responses of Carnivores to Human-Induced Landscape Changes in Central Argentina
Caruso, Nicolás; Lucherini, Mauro; Fortin, Daniel; Casanave, Emma B.
2016-01-01
The role that mammalian carnivores play in ecosystems can be deeply altered by human-driven habitat disturbance. While most carnivore species are negatively affected, the impact of habitat changes is expected to depend on their ecological flexibility. We aimed to identify key factors affecting the habitat use by four sympatric carnivore species in landscapes of central Argentina. Camera trapping surveys were carried out at 49 sites from 2011 to 2013. Each site was characterized by 12 habitat attributes, including human disturbance and fragmentation. Four landscape gradients were created from Principal Component Analysis and their influence on species-specific habitat use was studied using Generalized Linear Models. We recorded 74 events of Conepatus chinga, 546 of Pseudalopex gymnocercus, 193 of Leopardus geoffroyi and 45 of Puma concolor. We found that the gradient describing sites away from urban settlements and with low levels of disturbance had the strongest influence. L. geoffroyi was the only species responding significantly to the four gradients and showing a positive response to modified habitats, which could be favored by the low level of persecution by humans. P. concolor made stronger use of most preserved sites with low proportion of cropland, even though the species also used sites with an intermediate level of fragmentation. A more flexible use of space was found for C. chinga and P. gymnocercus. Our results demonstrate that the impact of human activities spans across this guild of carnivores and that species-specific responses appear to be mediated by ecological and behavioral attributes. PMID:26950300
Federal Register 2010, 2011, 2012, 2013, 2014
2010-02-25
... Response Costs incurred at the Site. In exchange, the Settling Party will be granted a covenant not to sue... Costs Colorado Bumper Exchange Site, Pueblo, Pueblo County, CO AGENCY: Environmental Protection Agency... proposes to compromise a claim the United States has at this Site for Past Response Costs, as those terms...
Mainwaring, Douglas B.; Maguire, Douglas A.; Perakis, Steven S.
2014-01-01
Studies of nutrient limitation in Douglas-fir forests of the Pacific Northwest focus predominantly on nitrogen, yet many stands demonstrate negligible or even negative growth response to nitrogen fertilization. To understand what nutrients other than nitrogen may limit forest productivity in this region, we tested six fertilizer treatments for their ability to increase stem volume growth response of dominant and co-dominant trees in young Douglas-fir plantations across a range of foliar and soil chemistry in western Oregon and Washington. We evaluated responses to single applications of urea, lime, calcium chloride, or monosodium phosphate at 16 sites, and to two site-specific nutrients blends at 12 of these sites. Across sites, the average stem volume growth increased marginally with urea, lime, and phosphorus fertilization. Fertilization responses generally aligned with plant and soil indicators of nutrient limitation. Response to nitrogen addition was greatest on soils with low total nitrogen and high exchangeable calcium concentrations. Responses to lime and calcium chloride additions were greatest at sites with low foliar calcium and low soil pH. Response to phosphorus addition was greatest on sites with low foliar phosphorus and high soil pH. Blended fertilizers yielded only marginal growth increases at one site, with no consistent effect across sites. Overall, our results highlight that calcium and phosphorus can be important growth limiting nutrients on specific sites in nitrogen-rich Douglas-fir forests of the Pacific Northwest.
Disaster-related environmental health hazards: former lead smelting plants in the United States.
Wang, Yao; Kanter, Robert K
2014-02-01
Natural disasters exacerbate risks of hazardous environmental exposures and adverse health consequences. The present study determined the proportion of previously identified lead industrial sites in urban locations that are at high risk for dispersal of toxic chemicals by natural disasters. Geographic analysis from publicly available data identified former lead smelting plants that coincide with populated urban areas and with high-risk locations for natural disasters. From a total of 229 urban smelting sites, 66 (29%) were in relatively high-risk areas for natural disasters: flood (39), earthquake (29), tornado (3), and hurricane (2). States with urban sites at relatively high risk for natural disaster included California (15); Pennsylvania (14); New York (7); Missouri (6); Illinois (5); New Jersey (4); Kentucky (3); Florida, Oregon, and Ohio (2 each); and Indiana, Massachusetts, Rhode Island, Texas, Utah, and Washington (1 each). Incomplete historical records showed at least 10 smelting site locations were affected by natural disaster. Forgotten environmental hazards may remain hazardous in any community. Uncertainty about risks in disasters causes disruptive public anxiety that increases difficulties in community responses and recovery. Our professional and public responsibility is to seek a better understanding of the risks of latent environmental hazards.
Ibrahim, M M; Soliman, M F M
2010-09-01
Factors affecting prevalence and site preferences of heterophyid metacercariae (MC) were investigated in this study. A total of 173 specimens of a freshwater fish, Tilapia zilli were collected during autumn 2008, winter 2009 and summer 2009, from Ismailia fresh water canal, Egypt. Results showed that the total prevalence of heterophyid MC was 95.37%. The heterophyid MC consisted of Haplorchis yokogawi (47.4%), Pygidiopsis genata (21.4%), and Phagicola ascolonga (93.64%). H. yokogawi MC was detected in striated muscles, P. ascolonga in liver and kidney while, P. genata was detected in muscles, liver and kidney. The aggregation indices showed that all MC were aggregated and the P. genata was the most highly aggregated followed by H. yokogawi and then P. ascolonga. Responses of the heterophyid MC to host sex, weight and season greatly varied according to species of MC. Different responses of interaction for heterophyid MC intensity were found by GLIM analysis and this variation dependant on the type of infection (single or mixed infections). Factors affecting site preference of heterophid MC infection were discussed and further studies in other locations are required to examine the factors affecting site preference.
Phillips, P.J.; Ator, S.W.; Nystrom, E.A.
2007-01-01
The recent (late 2001) federally mandated phaseout of diazinon and chlorpyrifos insecticide use in outdoor urban settings has resulted in a rapid decline in concentrations of these insecticides in urban streams and rivers in the northeastern and midwestern United States. Assessment of temporal insecticide trends at 20 sites showed that significant step decreases in diazinon concentrations occurred at 90% of the sites after the phaseout, with concentrations generally decreasing by over 50% in summer samples. Chlorpyrifos concentrations showed significant step decreases in at least 1 season at 3 of the 4 sites with sufficient data for analysis. The decrease in diazinon concentrations in response to the phaseout resulted in a decline in the frequency of concentrations exceeding the acute invertebrate water-quality benchmark of 0.1 ??g/L from 10% of pre-phaseout summer samples to fewer than 1% of post-phaseout summer samples. Although some studies have indicated an increase in concentrations of carbaryl in response to the organophosphorous phaseout, carbaryl concentrations only increased at 1 site after the phaseout. A full assessment of the effect of the phaseout of diazinon and chlorpyrifos on surface water will require data on other insecticides used to replace these compounds.
Yang, Yongxin; Shen, Weijun; Zhao, Xiaowei; Zhao, Huiling; Huang, Dongwei; Cheng, Guanglong
2014-06-01
The aim of this study was to investigate the N-linked glycosylated protein profile of mammary tissue from healthy cows and cows with mastitis due to Escherichia coli, in order to understand the molecular mechanisms of the host response to mastitis. N-glycopeptides were enriched with a lectin mixture and identified through high-accuracy mass spectrometry. A total of 551 N-glycosylation sites, corresponding to 294 proteins, were identified in the mammary tissues of healthy cows; these glycoproteins were categorised into three functional groups and clustered into 11 specific pathways. A total of 511 N-glycosylation sites, corresponding to 283 glycosylated proteins, were detected in the mammary tissues of cows with E. coli mastitis. There were differences in N-glycosylation sites in 98 proteins in the mammary tissues of healthy cows and cows with mastitis due to E. coli. Most proteins with altered glycosylation were those involved in responses to stress, cell adhesion and the immune response, and were assigned to five specific pathways based on their gene ontology annotation. The results from this study show that the glycosylated protein profile in the mammary tissues of healthy and mastitic cows are different, and altered glycoproteins are associated with several pathways, including the lysosome and O-glycan biosynthesis pathways. Copyright © 2014. Published by Elsevier Ltd.
Genetic Basis for Variation in Wheat Grain Yield in Response to Varying Nitrogen Application.
Mahjourimajd, Saba; Taylor, Julian; Sznajder, Beata; Timmins, Andy; Shahinnia, Fahimeh; Rengel, Zed; Khabaz-Saberi, Hossein; Kuchel, Haydn; Okamoto, Mamoru; Langridge, Peter
2016-01-01
Nitrogen (N) is a major nutrient needed to attain optimal grain yield (GY) in all environments. Nitrogen fertilisers represent a significant production cost, in both monetary and environmental terms. Developing genotypes capable of taking up N early during development while limiting biomass production after establishment and showing high N-use efficiency (NUE) would be economically beneficial. Genetic variation in NUE has been shown previously. Here we describe the genetic characterisation of NUE and identify genetic loci underlying N response under different N fertiliser regimes in a bread wheat population of doubled-haploid lines derived from a cross between two Australian genotypes (RAC875 × Kukri) bred for a similar production environment. NUE field trials were carried out at four sites in South Australia and two in Western Australia across three seasons. There was genotype-by-environment-by-treatment interaction across the sites and also good transgressive segregation for yield under different N supply in the population. We detected some significant Quantitative Trait Loci (QTL) associated with NUE and N response at different rates of N application across the sites and years. It was also possible to identify lines showing positive N response based on the rankings of their Best Linear Unbiased Predictions (BLUPs) within a trial. Dissecting the complexity of the N effect on yield through QTL analysis is a key step towards elucidating the molecular and physiological basis of NUE in wheat.
Oleksiak, Marjorie F; Karchner, Sibel I; Jenny, Matthew J; Franks, Diana G; Welch, David B Mark; Hahn, Mark E
2011-05-24
Populations of Atlantic killifish (Fundulus heteroclitus) have evolved resistance to the embryotoxic effects of polychlorinated biphenyls (PCBs) and other halogenated and nonhalogenated aromatic hydrocarbons that act through an aryl hydrocarbon receptor (AHR)-dependent signaling pathway. The resistance is accompanied by reduced sensitivity to induction of cytochrome P450 1A (CYP1A), a widely used biomarker of aromatic hydrocarbon exposure and effect, but whether the reduced sensitivity is specific to CYP1A or reflects a genome-wide reduction in responsiveness to all AHR-mediated changes in gene expression is unknown. We compared gene expression profiles and the response to 3,3',4,4',5-pentachlorobiphenyl (PCB-126) exposure in embryos (5 and 10 dpf) and larvae (15 dpf) from F. heteroclitus populations inhabiting the New Bedford Harbor, Massachusetts (NBH) Superfund site (PCB-resistant) and a reference site, Scorton Creek, Massachusetts (SC; PCB-sensitive). Analysis using a 7,000-gene cDNA array revealed striking differences in responsiveness to PCB-126 between the populations; the differences occur at all three stages examined. There was a sizeable set of PCB-responsive genes in the sensitive SC population, a much smaller set of PCB-responsive genes in NBH fish, and few similarities in PCB-responsive genes between the two populations. Most of the array results were confirmed, and additional PCB-regulated genes identified, by RNA-Seq (deep pyrosequencing). The results suggest that NBH fish possess a gene regulatory defect that is not specific to one target gene such as CYP1A but rather lies in a regulatory pathway that controls the transcriptional response of multiple genes to PCB exposure. The results are consistent with genome-wide disruption of AHR-dependent signaling in NBH fish.
Schütte, B; El Hajj, N; Kuhtz, J; Nanda, I; Gromoll, J; Hahn, T; Dittrich, M; Schorsch, M; Müller, T; Haaf, T
2013-11-01
Aberrant sperm DNA methylation patterns, mainly in imprinted genes, have been associated with male subfertility and oligospermia. Here, we performed a genome-wide methylation analysis in sperm samples representing a wide range of semen parameters. Sperm DNA samples of 38 males attending a fertility centre were analysed with Illumina HumanMethylation27 BeadChips, which quantify methylation of >27 000 CpG sites in cis-regulatory regions of almost 15 000 genes. In an unsupervised analysis of methylation of all analysed sites, the patient samples clustered into a major and a minor group. The major group clustered with samples from normozoospermic healthy volunteers and, thus, may more closely resemble the normal situation. When correlating the clusters with semen and clinical parameters, the sperm counts were significantly different between groups with the minor group exhibiting sperm counts in the low normal range. A linear model identified almost 3000 CpGs with significant methylation differences between groups. Functional analysis revealed a broad gain of methylation in spermatogenesis-related genes and a loss of methylation in inflammation- and immune response-related genes. Quantitative bisulfite pyrosequencing validated differential methylation in three of five significant candidate genes on the array. Collectively, we identified a subgroup of sperm samples for assisted reproduction with sperm counts in the low normal range and broad methylation changes (affecting approximately 10% of analysed CpG sites) in specific pathways, most importantly spermatogenesis-related genes. We propose that epigenetic analysis can supplement traditional semen parameters and has the potential to provide new insights into the aetiology of male subfertility. © 2013 American Society of Andrology and European Academy of Andrology.
Comparing Low-Frequency Earthquakes During Triggered and Ambient Tremor in Taiwan
NASA Astrophysics Data System (ADS)
Alvarado Lara, F., Sr.; Ledezma, C., Sr.
2014-12-01
In South America, larger magnitude seismic events originate in the subduction zone between the Nazca and Continental plates, as opposed to crustal events. Crustal seismic events are important in areas very close to active fault lines; however, seismic hazard analyses incorporate crust events related to a maximum distance from the site under study. In order to use crustal events as part of a seismic hazard analysis, it is necessary to use the attenuation relationships which represent the seismic behavior of the site under study. Unfortunately, in South America the amount of compiled crustal event historical data is not yet sufficient to generate a firm regional attenuation relationship. In the absence of attenuation relationships for crustal earthquakes in the region, the conventional approach is to use attenuation relationships from other regions which have a large amount of compiled data and which have similar seismic conditions to the site under study. This practice permits the development of seismic hazard analysis work with a certain margin of accuracy. In South America, in the engineering practice, new generation attenuation relationships (NGA-W) are used among other alternatives in order to incorporate the effect of crustal events in a seismic hazard analysis. In 2014, the NGA-W Version 2 (NGA-W2) was presented with a database containing information from Taiwan, Turkey, Iran, USA, Mexico, Japan, and Alaska. This paper examines whether it is acceptable to utilize the NGA-W2 in seismic hazard analysis in South America. A comparison between response spectrums of the seismic risk prepared in accordance with NGA-W2 and actual response spectrums of crustal events from Argentina is developed in order to support the examination. The seismic data were gathered from equipment installed in the cities of Santiago, Chile and Mendoza, Argentina.
Revision of the Applicability of the NGA's in South America, Chile - Argentina.
NASA Astrophysics Data System (ADS)
Alvarado Lara, F., Sr.; Ledezma, C., Sr.
2015-12-01
In South America, larger magnitude seismic events originate in the subduction zone between the Nazca and Continental plates, as opposed to crustal events. Crustal seismic events are important in areas very close to active fault lines; however, seismic hazard analyses incorporate crust events related to a maximum distance from the site under study. In order to use crustal events as part of a seismic hazard analysis, it is necessary to use the attenuation relationships which represent the seismic behavior of the site under study. Unfortunately, in South America the amount of compiled crustal event historical data is not yet sufficient to generate a firm regional attenuation relationship. In the absence of attenuation relationships for crustal earthquakes in the region, the conventional approach is to use attenuation relationships from other regions which have a large amount of compiled data and which have similar seismic conditions to the site under study. This practice permits the development of seismic hazard analysis work with a certain margin of accuracy. In South America, in the engineering practice, new generation attenuation relationships (NGA-W) are used among other alternatives in order to incorporate the effect of crustal events in a seismic hazard analysis. In 2014, the NGA-W Version 2 (NGA-W2) was presented with a database containing information from Taiwan, Turkey, Iran, USA, Mexico, Japan, and Alaska. This paper examines whether it is acceptable to utilize the NGA-W2 in seismic hazard analysis in South America. A comparison between response spectrums of the seismic risk prepared in accordance with NGA-W2 and actual response spectrums of crustal events from Argentina is developed in order to support the examination. The seismic data were gathered from equipment installed in the cities of Santiago, Chile and Mendoza, Argentina.
Multiscale site-response mapping: A case study of Parkfield, California
Thompson, E.M.; Baise, L.G.; Kayen, R.E.; Morgan, E.C.; Kaklamanos, J.
2011-01-01
The scale of previously proposed methods for mapping site-response ranges from global coverage down to individual urban regions. Typically, spatial coverage and accuracy are inversely related.We use the densely spaced strong-motion stations in Parkfield, California, to estimate the accuracy of different site-response mapping methods and demonstrate a method for integrating multiple site-response estimates from the site to the global scale. This method is simply a weighted mean of a suite of different estimates, where the weights are the inverse of the variance of the individual estimates. Thus, the dominant site-response model varies in space as a function of the accuracy of the different models. For mapping applications, site-response models should be judged in terms of both spatial coverage and the degree of correlation with observed amplifications. Performance varies with period, but in general the Parkfield data show that: (1) where a velocity profile is available, the square-rootof- impedance (SRI) method outperforms the measured VS30 (30 m divided by the S-wave travel time to 30 m depth) and (2) where velocity profiles are unavailable, the topographic slope method outperforms surficial geology for short periods, but geology outperforms slope at longer periods. We develop new equations to estimate site response from topographic slope, derived from the Next Generation Attenuation (NGA) database.
Logistics Operations Management Center: Maintenance Support Baseline (LOMC-MSB)
NASA Technical Reports Server (NTRS)
Kurrus, R.; Stump, F.
1995-01-01
The Logistics Operations Management Center Maintenance Support Baseline is defined. A historical record of systems, applied to and deleted from, designs in support of future management and/or technical analysis is provided. All Flight elements, Ground Support Equipment, Facility Systems and Equipment and Test Support Equipment for which LOMC has responsibilities at Kennedy Space Center and other locations are listed. International Space Station Alpha Program documentation is supplemented. The responsibility of the Space Station Launch Site Support Office is established.
2016-03-01
Simpson. 2009. Development of guidelines for ammonia in estuarine and marine water systems. Marine Pollution Bulletin 58:1472–1476. Boardman, G. D...waters of the United States and ocean waters is a shared responsibility of the USACE and U.S. Environmental Protection Agency (USEPA) under the Marine ...waters of the United States and ocean waters is a shared responsibility of USEPA and the USACE. The Marine Protection, Research, and Sanctuaries Act
Site response for seattle and source parameters of earthquakes in the puget sound region
Frankel, A.; Carver, D.; Cranswick, E.; Meremonte, M.; Bice, T.; Overturf, D.
1999-01-01
We analyzed seismograms from 21 earthquakes (M(L) 2.0-4.9) recorded by digital seismographs we deployed in urban Seatte to determine site response and earthquake stress drops. The seismometers were situated on a wide variety of geologic units, including artificial fill (e.g., Kingdome, Harbor Island), Pleistocene age soils (glacial till and outwash deposits of Seattle's hills), modified land (downtown Seattle, Space Needle), and Tertiary sedimentary rock. Two mainshock-aftershock sequences were recorded: the June 1997 Bremerton sequence (mainshock M(L) 4.9) and the February 1997 South Seattle sequence (mainshock M(L) 3.5), along with other events in the Puget Sound region. We developed a new inversion procedure to estimate site response, source corner frequencies, and seismic moments from the S-wave spectra. This inversion uses corner frequencies determined from spectral ratios of mainshock-aftershock pairs as constraints. The site responses found from the inversion are not relative to the rock site but are relative to an idealized site with a flat frequency response. The response of the rock site is also found from the inversion. The inversion results show high response for the sites on artificial fill, more moderate amplication for most sites on stiff Pleistocene soils or modified land, and low response for the rock site. Some sites display resonances, such as a strong 2-Hz resonance at our site near the Kingdome, which is caused by the surficial layers of fill and younger alluvium. The sites in West Seattle exhibit high amplification, even though they are on relatively stiff soils of glacial outwash. This may be partly caused by basin surface waves produced by conversion of incident S waves. This high response in West Seattle is consistent with damage reports from the 1949 (m(b) 7.1) and 1965 (m(b) 6.5) earthquakes. Stress-drop estimates for the events we recorded were generally low, between 0.4 and 25 bars, although some of the events may have had higher stress drops that could not be resolved because of the limited passband. We calculated a stress drop of 24 bars for the Bremerton mainshock and 10 bars for the South Seattle mainshock.
NASA Astrophysics Data System (ADS)
Boudghene Stambouli, Ahmed; Zendagui, Djawad; Bard, Pierre-Yves; Derras, Boumédiène
2017-07-01
Most modern seismic codes account for site effects using an amplification factor (AF) that modifies the rock acceleration response spectra in relation to a "site condition proxy," i.e., a parameter related to the velocity profile at the site under consideration. Therefore, for practical purposes, it is interesting to identify the site parameters that best control the frequency-dependent shape of the AF. The goal of the present study is to provide a quantitative assessment of the performance of various site condition proxies to predict the main AF features, including the often used short- and mid-period amplification factors, Fa and Fv, proposed by Borcherdt (in Earthq Spectra 10:617-653, 1994). In this context, the linear, viscoelastic responses of a set of 858 actual soil columns from Japan, the USA, and Europe are computed for a set of 14 real accelerograms with varying frequency contents. The correlation between the corresponding site-specific average amplification factors and several site proxies (considered alone or as multiple combinations) is analyzed using the generalized regression neural network (GRNN). The performance of each site proxy combination is assessed through the variance reduction with respect to the initial amplification factor variability of the 858 profiles. Both the whole period range and specific short- and mid-period ranges associated with the Borcherdt factors Fa and Fv are considered. The actual amplification factor of an arbitrary soil profile is found to be satisfactorily approximated with a limited number of site proxies (4-6). As the usual code practice implies a lower number of site proxies (generally one, sometimes two), a sensitivity analysis is conducted to identify the "best performing" site parameters. The best one is the overall velocity contrast between underlying bedrock and minimum velocity in the soil column. Because these are the most difficult and expensive parameters to measure, especially for thick deposits, other more convenient parameters are preferred, especially the couple ( {V_{{{s}30}} ,f0 } ) that leads to a variance reduction in at least 60%. From a code perspective, equations and plots are provided describing the dependence of the short- and mid-period amplification factors Fa and Fv on these two parameters. The robustness of the results is analyzed by performing a similar analysis for two alternative sets of velocity profiles, for which the bedrock velocity is constrained to have the same value for all velocity profiles, which is not the case in the original set.[Figure not available: see fulltext.
NASA Astrophysics Data System (ADS)
Groby, Jean-Philippe; Wirgin, Armand
2008-02-01
We address the problem of the response to a seismic wave of an urban site consisting of Nb blocks overlying a soft layer underlain by a hard substratum. The results of a theoretical analysis, appealing to a space-frequency mode-matching (MM) technique, are compared to those obtained by a space-time finite-element (FE) technique. The two methods are shown to give rise to the same prediction of the seismic response for Nb = 1, 2 and 40 blocks. The mechanism of the interaction between blocks and the ground, as well as that of the mutual interaction between blocks, are studied. It is shown, in the first part of this paper, that the presence of a small number of blocks modifies the seismic disturbance in a manner which evokes qualitatively, but not quantitatively, what was observed during the 1985 Michoacan earthquake in Mexico City. Anomalous earthquake response at a much greater level, in terms of duration, peak and cumulative amplitude of motion, is shown, by a theoretical and numerical analysis in the second part of this paper, to be induced by the presence of a large (>=10) number of identical equi-spaced blocks that are present in certain districts of many cities.
NASA Astrophysics Data System (ADS)
Cakir, R.; Walsh, T. J.; Norman, D. K.
2017-12-01
We, Washington Geological Survey (WGS), have been performing multi-method near surface geophysical surveys to help assess potential earthquake damage at public schools in Washington. We have been conducting active and passive seismic surveys, and estimating Shear-wave velocity (Vs) profiles, then determining the NEHRP soil classifications based on Vs30m values at school sites in Washington. The survey methods we have used: 1D and 2D MASW and MAM, P- and S-wave refraction, horizontal-to-vertical spectral ratio (H/V), and 2ST-SPAC to measure Vs and Vp at shallow (0-70m) and greater depths at the sites. We have also run Ground Penetrating Radar (GPR) surveys at the sites to check possible horizontal subsurface variations along and between the seismic survey lines and the actual locations of the school buildings. The seismic survey results were then used to calculate Vs30m for determining the NEHRP soil classifications at school sites, thus soil amplification effects on the ground motions. Resulting shear-wave velocity profiles generated from these studies can also be used for site response and liquefaction potential studies, as well as for improvement efforts of the national Vs30m database, essential information for ShakeMap and ground motion modeling efforts in Washington and Pacific Northwest. To estimate casualties, nonstructural, and structural losses caused by the potential earthquakes in the region, we used these seismic site characterization results associated with structural engineering evaluations based on ASCE41 or FEMA 154 (Rapid Visual Screening) as inputs in FEMA Hazus-Advanced Engineering Building Module (AEBM) analysis. Compelling example surveys will be presented for the school sites in western and eastern Washington.
Reflex responses of lip muscles in young and older women.
Wohlert, A B
1996-06-01
The perioral reflex in response to innocuous mechanical stimulation of the lip vermilion was studied in 20 young and 20 older women. Responses to stimuli at the right and left sides of both the upper and lower lips were recorded. Results show significant specificity of response, especially for upper lip sites. Reflex response at the site of stimulation was greatest in amplitude and shortest in latency, followed by response at sites ipsilateral to the site of stimulation. Younger subjects showed greater localizing tendency than older subjects. Stimulation was significantly less likely to produce a reflex response in the older group. When reflex responses did occur, they were significantly lower in amplitude and longer in latency than the responses of the younger group. Nonetheless, reflex responses were common in both groups, with responses at the site of stimulation occurring 78% of the time in older women and 90% of the time in younger women. Every participant showed at least one reflex response to lip stimulation. Results suggest decreasing complexity of synaptic drive to the perioral system in old age but also show that reflexive response does not deteriorate completely, remaining an available element for motor control in normal older women.
Productivity responses of desert vegetation to precipitation patterns across a rainfall gradient.
Li, Fang; Zhao, Wenzhi; Liu, Hu
2015-03-01
The influences of previous-year precipitation and episodic rainfall events on dryland plants and communities are poorly quantified in the temperate desert region of Northwest China. To evaluate the thresholds and lags in the response of aboveground net primary productivity (ANPP) to variability in rainfall pulses and seasonal precipitation along the precipitation-productivity gradient in three desert ecosystems with different precipitation regimes, we collected precipitation data from 2000 to 2012 in Shandan (SD), Linze (LZ) and Jiuquan (JQ) in northwestern China. Further, we extracted the corresponding MODIS Normalized Difference Vegetation Index (NDVI, a proxy for ANPP) datasets at 250 m spatial resolution. We then evaluated different desert ecosystems responses using statistical analysis, and a threshold-delay model (TDM). TDM is an integrative framework for analysis of plant growth, precipitation thresholds, and plant functional type strategies that capture the nonlinear nature of plant responses to rainfall pulses. Our results showed that: (1) the growing season NDVIINT (INT stands for time-integrated) was largely correlated with the warm season (spring/summer) at our mildly-arid desert ecosystem (SD). The arid ecosystem (LZ) exhibited a different response, and the growing season NDVIINT depended highly on the previous year's fall/winter precipitation and ANPP. At the extremely arid site (JQ), the variability of growing season NDVIINT was equally correlated with the cool- and warm-season precipitation; (2) some parameters of threshold-delay differed among the three sites: while the response of NDVI to rainfall pulses began at about 5 mm for all the sites, the maximum thresholds in SD, LZ, and JQ were about 55, 35 and 30 mm respectively, increasing with an increase in mean annual precipitation. By and large, more previous year's fall/winter precipitation, and large rainfall events, significantly enhanced the growth of desert vegetation, and desert ecosystems should be much more adaptive under likely future scenarios of increasing fall/winter precipitation and large rainfall events. These results highlight the inherent complexity in predicting how desert ecosystems will respond to future fluctuations in precipitation.
The tyrosine kinase Stitcher activates Grainy head and epidermal wound healing in Drosophila.
Wang, Shenqiu; Tsarouhas, Vasilios; Xylourgidis, Nikos; Sabri, Nafiseh; Tiklová, Katarína; Nautiyal, Naumi; Gallio, Marco; Samakovlis, Christos
2009-07-01
Epidermal injury initiates a cascade of inflammation, epithelial remodelling and integument repair at wound sites. The regeneration of the extracellular barrier and damaged tissue repair rely on the precise orchestration of epithelial responses triggered by the injury. Grainy head (Grh) transcription factors induce gene expression to crosslink the extracellular barrier in wounded flies and mice. However, the activation mechanisms and functions of Grh factors in re-epithelialization remain unknown. Here we identify stitcher (stit), a new Grh target in Drosophila melanogaster. stit encodes a Ret-family receptor tyrosine kinase required for efficient epidermal wound healing. Live imaging analysis reveals that Stit promotes actin cable assembly during wound re-epithelialization. Stit activation also induces extracellular signal-regulated kinase (ERK) phosphorylation along with the Grh-dependent expression of stit and barrier repair genes at the wound sites. The transcriptional stimulation of stit on injury triggers a positive feedback loop increasing the magnitude of epithelial responses. Thus, Stit activation upon wounding coordinates cytoskeletal rearrangements and the level of Grh-mediated transcriptional wound responses.
Volti, Theodora; Burbidge, David; Collins, Clive; Asten, Michael W.; Odum, Jackson K.; Stephenson, William J.; Pascal, Chris; Holzschuh, Josef
2016-01-01
Although the time‐averaged shear‐wave velocity down to 30 m depth (VS30) can be a proxy for estimating earthquake ground‐motion amplification, significant controversy exists about its limitations when used as a single parameter for the prediction of amplification. To examine this question in absence of relevant strong‐motion records, we use a range of different methods to measure the shear‐wave velocity profiles and the resulting theoretical site amplification factors (AFs) for 30 sites in the Newcastle area, Australia, in a series of blind comparison studies. The multimethod approach used here combines past seismic cone penetrometer and spectral analysis of surface‐wave data, with newly acquired horizontal‐to‐vertical spectral ratio, passive‐source surface‐wave spatial autocorrelation (SPAC), refraction microtremor (ReMi), and multichannel analysis of surface‐wave data. The various measurement techniques predicted a range of different AFs. The SPAC and ReMi techniques have the smallest overall deviation from the median AF for the majority of sites. We show that VS30 can be related to spectral response above a period T of 0.5 s but not necessarily with the maximum amplification according to the modeling done based on the measured shear‐wave velocity profiles. Both VS30 and AF values are influenced by the velocity ratio between bedrock and overlying sediments and the presence of surficial thin low‐velocity layers (<2 m thick and <150 m/s), but the velocity ratio is what mostly affects the AF. At 0.2
ERIC Educational Resources Information Center
Clary, Renee M.; Wandersee, James H.
2009-01-01
In an online graduate paleontology course taken by practicing Earth Science teachers, we designed an investigation using teachers' local informal educational environments. Teachers (N = 28) were responsible for photographing, describing, and integrating fossil specimens from two informal sites into a paleoenvironmental analysis of the landscape in…
Price and Welfare Effects of Catastrophic Forest Damage from Southern Pine Beetle Epidemics
Thomas P. Holmes
1991-01-01
Southern pine beetle (Dendroctonus frontalis) epidemics are periodically responsible for catastrophic levels of mortality to southern yellow pine forests. Traditional forest damage appraisal techniques developed for site specific economic analysis are theoretically weak since they do not consider aggregate impacts across ecosystems and related markets. Because the...
Short-term effects of fuel reduction treatments on herpetofauna from the southeastern United States
Eran S. Kilpatrick; Thomas A. Waldrop; Joseph D. Lanham; Cathryn H. Greenberg; Tom H. Contreras
2010-01-01
Path analysis of fuel reduction treatments on herpetofauna across four southeastern sites of the National Fire and Fire Surrogate Study provided quantitative evidence relating changes in vegetation and fuels to herpetofauna response. Fuel reduction treatments included prescribed burning (B), a mechanical treatment (M), mechanical treatment followed by prescribed...
Federal Register 2010, 2011, 2012, 2013, 2014
2010-07-30
... Impact Statement for the General Management Plan (GMP/EIS) for Roosevelt-Vanderbilt National Historic Sites, Hyde Park, New York. The Abbreviated Final GMP/EIS includes an analysis of agency and public comments received on the Draft GMP/EIS with NPS responses, errata sheets detailing editorial corrections to...
Study of Faculty and Information Technology, 2014
ERIC Educational Resources Information Center
Dahlstrom, Eden; Brooks, D. Christopher
2014-01-01
In this inaugural year of the faculty technology study, EDUCAUSE Center for Analysis and Research (ECAR) partnered with 151 college/university sites yielding responses from 17,451 faculty respondents across 13 countries. The findings are exploratory in nature, as they cover new ground to help us tell a more comprehensive story about technology…
NASA Astrophysics Data System (ADS)
Moridis, G. J.; Reagan, M. T.; Queiruga, A. F.
2017-12-01
We analyze the gas production potential of recently discovered offshore hydrate deposits at the NGHP-02-09-A sSite in the Krishna-Godawari Basin of India, and the corresponding geomechanical system response during short- and long-term production. Using the most current data on the flow and geomechanical properties of the hydrate-bearing media and of the overburden, as well as information on the system boundaries, we investigate (a) the production rates of gas (CH4) and of water, their relative magnitudes and the reservoir thermal behavior in an effort to assess the viability of these deposits as energy sources, as well as (b) the potential subsidence and the effect of changing pressure and stress regimes on the porosity and permeability (and, consequently, on production). Additionally, we conduct a thorough sensitivity analysis in order to determine (a) the properties and conditions that control and dominate the system behavior, and (b) the range of the possible system response to production.
A Laser Photoacoustic Analysis of Residual CO2 and H2O in Larch Stems
Ageev, Boris; Ponomarev, Yurii; Sapozhnikova, Valeria; Savchuk, Dmitry
2014-01-01
Every so often, the results obtained from investigations into the effects of varying environmental conditions on the tree growth rate at the same sites and on the change in the carbon balance in plants, using traditional methods, are found to differ widely. We believe that the reason for the ambiguity of the data has to do with failure to account for the role of the residual CO2 (and H2O) in the tree wood exhibiting a climate response. In our earlier work, the results of a laser photoacoustic gas analysis of CO2 and H2O vacuum-desorbed from disc tree rings of evergreen conifer trees were presented. In this paper, laser photoacoustic measurements of tree ring gases in deciduous conifer trees and CO2 carbon isotope composition determined by means of a mass spectrometer are given. Conclusions are made regarding the response of annual larch CO2 disc tree ring distributions to climatic parameters (temperatures and precipitation). The data about the CO2 disc content for different sites are compared. PMID:25808838
Geomorphic degradations on the surface of venus: an analysis of venera 9 and venera 10 data.
Florensky, C P; Ronca, L B; Basilevsky, A T
1977-05-20
On the basis of the physical and chemical measurements made on the surface of Venus and transmitted back to Earth by the Soviet automatic landers Venera 9 and Venera 10, a geomorphically inactive environment should be expected. An analysis of the television photographs reveals, however, that at least two processes of degradation occur. One operates on a scale of decimeters to meters and is responsible for the fracturing of a layered source rock and the subsequent downslope movement of the fragments. Mass-wasting, perhaps activated by venusian quakes or by unknown geological processes, is likely to be the agent. Another geomorphic degradation process occurs on the scale of a centimeter or less and is responsible for the rounding of edges and the pitting of rock surfaces. The agents of this process are not known, but atmospheric action, perhaps in connection with volcanic episodes, may be the cause. From a geomorphic point of view, the landscape of the Venera 9 landing site can be considered young and that of the Venera 10 landing site, mature.
Holmberg, Maria; Aherne, Julian; Austnes, Kari; Beloica, Jelena; De Marco, Alessandra; Dirnböck, Thomas; Fornasier, Maria Francesca; Goergen, Klaus; Futter, Martyn; Lindroos, Antti-Jussi; Krám, Pavel; Neirynck, Johan; Nieminen, Tiina Maileena; Pecka, Tomasz; Posch, Maximilian; Pröll, Gisela; Rowe, Ed C; Scheuschner, Thomas; Schlutow, Angela; Valinia, Salar; Forsius, Martin
2018-05-31
Current climate warming is expected to continue in coming decades, whereas high N deposition may stabilize, in contrast to the clear decrease in S deposition. These pressures have distinctive regional patterns and their resulting impact on soil conditions is modified by local site characteristics. We have applied the VSD+ soil dynamic model to study impacts of deposition and climate change on soil properties, using MetHyd and GrowUp as pre-processors to provide input to VSD+. The single-layer soil model VSD+ accounts for processes of organic C and N turnover, as well as charge and mass balances of elements, cation exchange and base cation weathering. We calibrated VSD+ at 26 ecosystem study sites throughout Europe using observed conditions, and simulated key soil properties: soil solution pH (pH), soil base saturation (BS) and soil organic carbon and nitrogen ratio (C:N) under projected deposition of N and S, and climate warming until 2100. The sites are forested, located in the Mediterranean, forested alpine, Atlantic, continental and boreal regions. They represent the long-term ecological research (LTER) Europe network, including sites of the ICP Forests and ICP Integrated Monitoring (IM) programmes under the UNECE Convention on Long-range Transboundary Air Pollution (LRTAP), providing high quality long-term data on ecosystem response. Simulated future soil conditions improved under projected decrease in deposition and current climate conditions: higher pH, BS and C:N at 21, 16 and 12 of the sites, respectively. When climate change was included in the scenario analysis, the variability of the results increased. Climate warming resulted in higher simulated pH in most cases, and higher BS and C:N in roughly half of the cases. Especially the increase in C:N was more marked with climate warming. The study illustrates the value of LTER sites for applying models to predict soil responses to multiple environmental changes. Copyright © 2017 Elsevier B.V. All rights reserved.
Electrophysiological correlates of retrieval orientation in reality monitoring.
Rosburg, Timm; Mecklinger, Axel; Johansson, Mikael
2011-02-14
Retrieval orientation describes the modulation in the processing of retrieval cues by the nature of the targeted material in memory. Retrieval orientation is usually investigated by analyzing the cortical responses to new (unstudied) material when different memory contents are targeted. This approach avoids confounding effects of retrieval success. We investigated the neural correlates of retrieval orientation in reality monitoring with event-related potentials (ERPs) and assessed the impact of retrieval accuracy on obtained ERP measures. Thirty-two subjects studied visually presented object names that were followed either by a picture of that object (perceived condition) or by the instruction to mentally generate such a picture (imagine condition). Subsequently, subjects had to identify object names of one study condition and reject object names of the second study condition together with newly presented object names. The data analysis showed that object names were more accurately identified when they had been presented in the perceived condition. Two topographically distinct ERP effects of retrieval orientation were revealed: From 600 to 1100 ms after stimulus representation, ERPs were more positive at frontal electrode sites when object names from the imagine condition were targeted. The analysis of response-locked ERP data revealed an additional effect at posterior electrode sites, with more negative ERPs shortly after response onset when items from the imagine condition were targeted. The ERP effect at frontal electrode sites, but not at posterior electrode sites was modulated by relative memory accuracy, with stronger effects in subjects who had lower memory accuracy for items of the imagine condition. The findings are suggestive for a contribution of frontal brain areas to retrieval orientation processes in reality monitoring and indicate that neural correlates of retrieval orientation can be modulated by retrieval effort, with stronger activation of these correlates with increasing task demands. Copyright © 2010 Elsevier Inc. All rights reserved.
Pierce, Andrew; Williamson, Andrew; Jaworska, Ewa; Griffiths, John R.; Taylor, Sam; Walker, Michael; O’Dea, Mark Aspinall; Spooncer, Elaine; Unwin, Richard D.; Poolman, Toryn; Ray, David; Whetton, Anthony D.
2012-01-01
Mutated tyrosine kinases are associated with a number of different haematological malignancies including myeloproliferative disorders, lymphoma and acute myeloid leukaemia. The potential commonalities in the action of six of these leukemogenic proteins on nuclear proteins were investigated using systematic proteomic analysis. The effects on over 3600 nuclear proteins and 1500 phosphopeptide sites were relatively quantified in seven isogenic cell lines. The effects of the kinases were diverse although some commonalities were found. Comparison of the nuclear proteomic data with transcriptome data and cytoplasmic proteomic data indicated that the major changes are due to post-translational mechanisms rather than changes in mRNA or protein distribution. Analysis of the promoter regions of genes whose protein levels changed in response to the kinases showed the most common binding site found was that for NFκB whilst other sites such as those for the glucocorticoid receptor were also found. Glucocorticoid receptor levels and phosphorylation were decreased by all 6 PTKs. Whilst Glucocorticoid receptor action can potentiate NFκB action those proteins where genes have NFκB binding sites were in often regulated post-translationally. However all 6 PTKs showed evidence of NFkB pathway modulation via activation via altered IkB and NFKB levels. Validation of a common change was also undertaken with PMS2, a DNA mismatch repair protein. PMS2 nuclear levels were decreased in response to the expression of all 6 kinases, with no concomitant change in mRNA level or cytosolic protein level. Response to thioguanine, that requires the mismatch repair pathway, was modulated by all 6 oncogenic kinases. In summary common targets for 6 oncogenic PTKs have been found that are regulated by post-translational mechanisms. They represent potential new avenues for therapies but also demonstrate the post-translational regulation is a key target of leukaemogenic kinases. PMID:22745689
Chang, Ni-Bin; Ning, Shu-Kuang; Chen, Jen-Chang
2006-08-01
Due to increasing environmental consciousness in most countries, every utility that owns a commercial nuclear power plant has been required to have both an on-site and off-site emergency response plan since the 1980s. A radiation monitoring network, viewed as part of the emergency response plan, can provide information regarding the radiation dosage emitted from a nuclear power plant in a regular operational period and/or abnormal measurements in an emergency event. Such monitoring information might help field operators and decision-makers to provide accurate responses or make decisions to protect the public health and safety. This study aims to conduct an integrated simulation and optimization analysis looking for the relocation strategy of a long-term regular off-site monitoring network at a nuclear power plant. The planning goal is to downsize the current monitoring network but maintain its monitoring capacity as much as possible. The monitoring sensors considered in this study include the thermoluminescence dosimetry (TLD) and air sampling system (AP) simultaneously. It is designed for detecting the radionuclide accumulative concentration, the frequency of violation, and the possible population affected by a long-term impact in the surrounding area regularly while it can also be used in an accidental release event. With the aid of the calibrated Industrial Source Complex-Plume Rise Model Enhancements (ISC-PRIME) simulation model to track down the possible radionuclide diffusion, dispersion, transport, and transformation process in the atmospheric environment, a multiobjective evaluation process can be applied to achieve the screening of monitoring stations for the nuclear power plant located at Hengchun Peninsula, South Taiwan. To account for multiple objectives, this study calculated preference weights to linearly combine objective functions leading to decision-making with exposure assessment in an optimization context. Final suggestions should be useful for narrowing the set of scenarios that decision-makers need to consider in this relocation process.
Soil functional diversity analysis of a bauxite-mined restoration chronosequence.
Lewis, Dawn E; White, John R; Wafula, Denis; Athar, Rana; Dickerson, Tamar; Williams, Henry N; Chauhan, Ashvini
2010-05-01
Soil microorganisms are sensitive to environmental perturbations such that changes in microbial community structure and function can provide early signs of anthropogenic disturbances and even predict restoration success. We evaluated the bacterial functional diversity of un-mined and three chronosequence sites at various stages of rehabilitation (0, 10, and 20 years old) located in the Mocho Mountains of Jamaica. Samples were collected during the dry and wet seasons and analyzed for metal concentrations, microbial biomass carbon, bacterial numbers, and functional responses of soil microbiota using community-level physiological profile (CLPP) assays. Regardless of the season, un-mined soils consisted of higher microbial biomass and numbers than any of the rehabilitated sites. Additionally, the number and rate of substrates utilized and substrate evenness (the distribution of color development between the substrates) were significantly greater in the un-mined soils with carbohydrates being preferentially utilized than amino acids, polymers, carboxylic acids, and esters. To some extent, functional responses varied with the seasons but the least physiological activity was shown by the site rehabilitated in 1987 indicating long-term perturbation to this ecosystem. Small subunit ribosomal DNA (SSUrDNA)-denaturing gradient-gel electrophoresis analyses on the microbiota collected from the most preferred CLPP substrates followed by taxonomic analyses showed Proteobacteria, specifically the gamma-proteobacteria, as the most functionally active phyla, indicating a propensity of this phyla to out-compete other groups under the prevailing conditions. Additionally, multivariate statistical analyses, Shannon's diversity, and evenness indices, principal component analysis, biplot and un-weighted-pair-group method with arithmetic averages dendrograms further confirmed that un-mined sites were distinctly different from the rehabilitated soils.
Norman, Laura M.; Villarreal, Miguel; Pulliam, H. Ronald; Minckley, Robert L.; Gass, Leila; Tolle, Cindy; Coe, Michelle
2014-01-01
Desert marshes, or cienegas, are extremely biodiverse habitats imperiled by anthropogenic demands for water and changing climates. Given their widespread loss and increased recognition, remarkably little is known about restoration techniques. In this study, we examine the effects of gabions (wire baskets filled with rocks used as dams) on vegetation in the Cienega San Bernardino, in the Arizona, Sonora portion of the US-Mexico border, using a remote-sensing analysis coupled with field data. The Normalized Difference Vegetation Index (NDVI), used here as a proxy for plant biomass, is compared at gabion and control sites over a 27-year period during the driest months (May/June). Over this period, green-up occurred at most sites where there were gabions and at a few of the control sites where gabions had not been constructed. When we statistically controlled for differences among sites in source area, stream order, elevation, and interannual winter rainfall, as well as comparisons of before and after the initiation of gabion construction, vegetation increased around gabions yet did not change (or decreased) where there were no gabions. We found that NDVI does not vary with precipitation inputs prior to construction of gabions but demonstrates a strong response to precipitation after the gabions are built. Field data describing plant cover, species richness, and species composition document increases from 2000 to 2012 and corroborate reestablished biomass at gabions. Our findings validate that gabions can be used to restore riparian vegetation and potentially ameliorate drought conditions in a desert cienega.
Binding Pathway of Opiates to μ-Opioid Receptors Revealed by Machine Learning
NASA Astrophysics Data System (ADS)
Barati Farimani, Amir; Feinberg, Evan; Pande, Vijay
2018-02-01
Many important analgesics relieve pain by binding to the $\\mu$-Opioid Receptor ($\\mu$OR), which makes the $\\mu$OR among the most clinically relevant proteins of the G Protein Coupled Receptor (GPCR) family. Despite previous studies on the activation pathways of the GPCRs, the mechanism of opiate binding and the selectivity of $\\mu$OR are largely unknown. We performed extensive molecular dynamics (MD) simulation and analysis to find the selective allosteric binding sites of the $\\mu$OR and the path opiates take to bind to the orthosteric site. In this study, we predicted that the allosteric site is responsible for the attraction and selection of opiates. Using Markov state models and machine learning, we traced the pathway of opiates in binding to the orthosteric site, the main binding pocket. Our results have important implications in designing novel analgesics.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thiruselvam, Viswanathan; Sivaraman, Padavattan; Kumarevel, Thirumananseri, E-mail: kumarevel.thirumananseri@riken.jp
Highlights: • Crystal structure of ferritin was determined. • Endogenously expressed iron’s were identified. • Binuclear iron sites were observed at A and B active sites. - Abstract: Ferritin is an iron regulatory protein. It is responsible for storage and detoxification of excess iron thereby it regulates iron level in the body. Here we report the crystal structure of ferritin with two endogenously expressed Fe atoms binding in both the sites. The protein was purified and characterized by MALDI-TOF and N-terminal amino acid sequencing. The crystal belongs to I4 space group and it diffracted up to 2.5 Å. The structuralmore » analysis suggested that it crystallizes as hexamer and confirmed that it happened to be the first report of endogenously expressed Fe ions incorporated in both the A and B sites, situated in between the helices.« less
Site response and attenuation in the Puget Lowland, Washington State
Pratt, T.L.; Brocher, T.M.
2006-01-01
Simple spectral ratio (SSR) and horizontal-to-vertical (HN) site-response estimates at 47 sites in the Puget Lowland of Washington State document significant attenuation of 1.5- to 20-Hz shear waves within sedimentary basins there. Amplitudes of the horizontal components of shear-wave arrivals from three local earthquakes were used to compute SSRs with respect to the average of two bedrock sites and H/V spectral ratios with respect to the vertical component of the shear-wave arrivals at each site. SSR site-response curves at thick basin sites show peak amplifications of 2 to 6 at frequencies of 3 to 6 Hz, and decreasing spectra amplification with increasing frequency above 6 Hz. SSRs at nonbasin sites show a variety of shapes and larger resonance peaks. We attribute the spectral decay at frequencies above the amplification peak at basin sites to attenuation within the basin strata. Computing the frequency-independent, depth-dependent attenuation factor (Qs,int) from the SSR spectral decay between 2 and 20 Hz gives values of 5 to 40 for shallow sedimentary deposits and about 250 for the deepest sedimentary strata (7 km depth). H/V site responses show less spectral decay than the SSR responses but contain many of the same resonance peaks. We hypothesize that the H/V method yields a flatter response across the frequency spectrum than SSRs because the H/V reference signal (vertical component of the shear-wave arrivals) has undergone a degree of attenuation similar to the horizontal component recordings. Correcting the SSR site responses for attenuation within the basins by removing the spectral decay improves agreement between SSR and H/V estimates.
Predicting DNAPL Source Zone and Plume Response Using Site-Measured Characteristics
2017-05-19
FINAL REPORT Predicting DNAPL Source Zone and Plume Response Using Site- Measured Characteristics SERDP Project ER-1613 MAY 2017...Final Report 3. DATES COVERED (From - To) 2007 - 2017 4. TITLE AND SUBTITLE PREDICTING DNAPL SOURCE ZONE AND PLUME RESPONSE USING SITE- MEASURED ...historical record of concentration and head measurements , particularly in the near-source region. For each site considered, currently available data
Biological Response Modifiers in Rheumatoid Arthritis: Systematic Review and Meta-analysis of Safety
Tank, Nitishkumar D.; Karelia, Bharti N.; Vegada, Bhavisha N.
2017-01-01
Objective: To analyze available evidence on the safety of different biological response modifiers which are used for a treatment of rheumatoid arthritis (RA). Materials and Methods: We searched systematically for randomized controlled clinical trials on treatment of RA with different biological response modifiers, followed by a systematic review with meta-analysis. Trials were searched from MEDLINE and Cochrane Library databases. The following safety parameters reported in the selected trials were analyzed: number of patients suffering any adverse event (AE), withdrawal due to AEs, serious AE (SAEs), infections, serious infections, infusion reactions, injection site reactions, malignancies, and overall mortality. Undesired effects were estimated using combined relative risks (RR) and number needed to harm (NNH). Heterogeneity was evaluated by Cochrane's Q and I2 statistics. Results: According to inclusion criteria, a total of 43 trials (20,504 patients) were included in this study. A total number of AEs were found more with abatacept (RR: 1.05, NNH: 21.93). Withdrawal due to AEs was found with all biologicals, highest with anakinra (RR: 3.48, NNH: 15.70). Patients receiving newer tumor necrosis factor-alpha inhibitors, golimumab, were more likely to develop SAEs (RR: 2.44, NNH: 12.72) and infection (RR: 1.25, NNH: 10.09), and in certolizumab, serious infections (RR: 2.95, NNH: 37.31) were found more. Infusion reaction develops more with rituximab (RR: 1.52, NNH: 8.47). Etanercept showed the highest risk to develop infusion site reaction (RR: 5.33, NNH: 4.65). Biologicals showed no difference to their control counterparts in malignancy and mortality risk. Conclusion: This meta-analysis helps to clarify some frequently encountered and unanswered safety questions of different biological response modifiers, a new class of drugs, in the clinical care of RA patients. PMID:29081616
Developing a response to family violence in primary health care: the New Zealand experience.
Gear, Claire; Koziol-McLain, Jane; Wilson, Denise; Clark, Faye
2016-08-20
Despite primary health care being recognised as an ideal setting to effectively respond to those experiencing family violence, responses are not widely integrated as part of routine health care. A lack of evidence testing models and approaches for health sector integration, alongside challenges of transferability and sustainability, means the best approach in responding to family violence is still unknown. The Primary Health Care Family Violence Responsiveness Evaluation Tool was developed as a guide to implement a formal systems-led response to family violence within New Zealand primary health care settings. Given the difficulties integrating effective, sustainable responses to family violence, we share the experience of primary health care sites that embarked on developing a response to family violence, presenting the enablers, barriers and resources required to maintain, progress and sustain family violence response development. In this qualitative descriptive study data were collected from two sources. Firstly semi-structured focus group interviews were conducted during 24-month follow-up evaluation visits of primary health care sites to capture the enablers, barriers and resources required to maintain, progress and sustain a response to family violence. Secondly the outcomes of a group activity to identify response development barriers and implementation strategies were recorded during a network meeting of primary health care professionals interested in family violence prevention and intervention; findings were triangulated across the two data sources. Four sites, representing three PHOs and four general practices participated in the focus group interviews; 35 delegates from across New Zealand attended the network meeting representing a wider perspective on family violence response development within primary health care. Enablers and barriers to developing a family violence response were identified across four themes: 'Getting started', 'Building effective relationships', 'Sourcing funding' and 'Shaping a national approach to family violence'. The strong commitment of key people dedicated to addressing family violence is essential for response sustainability and would be strengthened by prioritising family violence response as a national health target with dedicated resourcing. Further analysis of the health care system as a complex adaptive system may provide insight into effective approaches to response development and health system integration.
Zhao, Qiang; Lv, Qin; Wang, Hailin
2015-08-15
We previously reported a fluorescence anisotropy (FA) approach for small molecules using tetramethylrhodamine (TMR) labeled aptamer. It relies on target-binding induced change of intramolecular interaction between TMR and guanine (G) base. TMR-labeling sites are crucial for this approach. Only terminal ends and thymine (T) bases could be tested for TMR labeling in our previous work, possibly causing limitation in analysis of different targets with this FA strategy. Here, taking the analysis of adenosine triphosphate (ATP) as an example, we demonstrated a success of conjugating TMR on other bases of aptamer adenine (A) or cytosine (C) bases and an achievement of full mapping various labeling sites of aptamers. We successfully constructed aptamer fluorescence anisotropy (FA) sensors for adenosine triphosphate (ATP). We conjugated single TMR on adenine (A), cytosine (C), or thymine (T) bases or terminals of a 25-mer aptamer against ATP and tested FA responses of 14 TMR-labeled aptamer to ATP. The aptamers having TMR labeled on the 16th base C or 23rd base A were screened out and exhibited significant FA-decreasing or FA-increasing responses upon ATP, respectively. These two favorable TMR-labeled aptamers enabled direct FA sensing ATP with a detection limit of 1 µM and the analysis of ATP in diluted serum. The comprehensive screening various TMR labeling sites of aptamers facilitates the successful construction of FA sensors using TMR-labeled aptamers. It will expand application of TMR-G interaction based aptamer FA strategy to a variety of targets. Copyright © 2015 Elsevier B.V. All rights reserved.
Enhanced long-term recollection for emotional pictures: evidence from high-density ERPs.
Weymar, Mathias; Löw, Andreas; Melzig, Christiane A; Hamm, Alfons O
2009-11-01
The present study used behavioral and electrophysiological measures to investigate the processes mediating long-term recognition memory for emotional and neutral pictures. The results show enhanced memory recollection for emotional arousing pictures compared to neutral low arousing pictures. In accordance with the behavioral data, we observed enhanced old/new effects in the ERPs for emotionally arousing pictures in the recollection-sensitive old/new component at centro-parietal sites (500-800 ms). Moreover, early old/new effects were present over frontal and parietal sites (300-500 ms) irrespective of picture contents. Analysis of the subjective awareness, indexed by the confidence ratings, showed that the late parietal old/new effect was increased for high confidence responses whereas the early component (300-500 ms) was mainly driven by low confidence responses, an indication for familiarity based recognition processes.
Changes in arctic and boreal ecosystem productivity in response to changes in growing season length
NASA Astrophysics Data System (ADS)
Hmimina, G.; Yu, R.; Billesbach, D. P.; Huemmrich, K. F.; Gamon, J. A.
2017-12-01
Large-scale greening and browning trends have been reported in northern terrestrial ecosystems over the last two decades. The greening is interpreted as an increased productivity in response to increases in temperature. Boreal and arctic ecosystem productivity is expected to increase as the length of growing seasons increases, resulting in a bigger northern carbon sink pool. While evidences of such greening based on the use of remotely-sensed vegetation indices are compelling, analysis over the sparse network of flux tower sites available in northern latitudes paint a more complex story, and raise some issues as to whether vegetation indices based on NIR reflectance at large spatial scales are suited to the analysis of very fragmented landscapes that exhibit strong patterns in snow and standing water cover. In a broader sense, whether "greenness" is a sufficiently good proxy of ecosystem productivity in northern latitudes is unclear. The current work focused on deriving continuous estimates of ecosystem potential productivity and photosynthesis limitation over a network of flux towers, and on analyzing the relationships between potential yearly productivity and the length of the growing season over time and space. A novel partitioning method was used to derive ecophysiological parameters from sparse carbon fluxes measurements, and those parameters were then used to delimit the growing season and to estimate potential yearly productivity over a wide range of ecosystems. The relationships obtained between those two metrics were then computed for each of the 23 studied sites, exhibiting a wide range of different responses to changes in growing season length. While an overall significant increasing productivity trend was found (R²=0.12) suggesting increased productivity, the more northern sites exhibited a consistent decreasing trend (0.11 The attribution of these trends to either changes in potential productivity or productivity limitation by abiotic factors will be discussed, as well as the potential of extending this analysis over space by using remote-sensing data along with flux tower data.
Marrus, Natasha; Faughn, Carley; Shuman, Jeremy; Petersen, Steve; Constantino, John; Povinelli, Daniel; Pruett, John R.
2011-01-01
Objective Comparative studies of social responsiveness, an ability that is impaired in autistic spectrum disorders, can inform our understanding of both autism and the cognitive architecture of social behavior. Because there is no existing quantitative measure of social responsiveness in chimpanzees, we generated a quantitative, cross-species (human-chimpanzee) social responsiveness measure. Method We translated the Social Responsiveness Scale (SRS), an instrument that quantifies human social responsiveness, into an analogous instrument for chimpanzees. We then retranslated this "Chimp SRS" into a human "Cross-Species SRS" (XSRS). We evaluated three groups of chimpanzees (n=29) with the Chimp SRS and typical and autistic spectrum disorder (ASD) human children (n=20) with the XSRS. Results The Chimp SRS demonstrated strong inter-rater reliability at the three sites (ranges for individual ICCs: .534–.866 and mean ICCs: .851–.970). As has been observed in humans, exploratory principal components analysis of Chimp SRS scores supports a single factor underlying chimpanzee social responsiveness. Human subjects' XSRS scores were fully concordant with their SRS scores (r=.976, p=.001) and distinguished appropriately between typical and ASD subjects. One chimpanzee known for inappropriate social behavior displayed a significantly higher score than all other chimpanzees at its site, demonstrating the scale's ability to detect impaired social responsiveness in chimpanzees. Conclusion Our initial cross-species social responsiveness scale proved reliable and discriminated differences in social responsiveness across (in a relative sense) and within (in a more objectively quantifiable manner) humans and chimpanzees. PMID:21515200
Sun, Huigai; Xia, Bolin; Wang, Xue; Gao, Fei; Zhou, Yijun
2017-10-17
Drought is one of the major abiotic stresses that negatively affects plant growth and development. Ammopiptanthus mongolicus is an ecologically important shrub in the mid-Asia desert region and used as a model for abiotic tolerance research in trees. Protein phosphorylation participates in the regulation of various biological processes, however, phosphorylation events associated with drought stress signaling and response in plants is still limited. Here, we conducted a quantitative phosphoproteomic analysis of the response of A. mongolicus roots to short-term drought stress. Data are available via the iProx database with project ID IPX0000971000. In total, 7841 phosphorylation sites were found from the 2019 identified phosphopeptides, corresponding to 1060 phosphoproteins. Drought stress results in significant changes in the abundance of 103 phosphopeptides, corresponding to 90 differentially-phosphorylated phosphoproteins (DPPs). Motif-x analysis identified two motifs, including [pSP] and [RXXpS], from these DPPs. Functional enrichment and protein-protein interaction analysis showed that the DPPs were mainly involved in signal transduction and transcriptional regulation, osmotic adjustment, stress response and defense, RNA splicing and transport, protein synthesis, folding and degradation, and epigenetic regulation. These drought-corresponsive phosphoproteins, and the related signaling and metabolic pathways probably play important roles in drought stress signaling and response in A. mongolicus roots. Our results provide new information for understanding the molecular mechanism of the abiotic stress response in plants at the posttranslational level.
Soundararajan, Venky; Aravamudan, Murali
2014-01-01
The efficacy and mechanisms of therapeutic action are largely described by atomic bonds and interactions local to drug binding sites. Here we introduce global connectivity analysis as a high-throughput computational assay of therapeutic action – inspired by the Google page rank algorithm that unearths most “globally connected” websites from the information-dense world wide web (WWW). We execute short timescale (30 ps) molecular dynamics simulations with high sampling frequency (0.01 ps), to identify amino acid residue hubs whose global connectivity dynamics are characteristic of the ligand or mutation associated with the target protein. We find that unexpected allosteric hubs – up to 20Å from the ATP binding site, but within 5Å of the phosphorylation site – encode the Gibbs free energy of inhibition (ΔGinhibition) for select protein kinase-targeted cancer therapeutics. We further find that clinically relevant somatic cancer mutations implicated in both drug resistance and personalized drug sensitivity can be predicted in a high-throughput fashion. Our results establish global connectivity analysis as a potent assay of protein functional modulation. This sets the stage for unearthing disease-causal exome mutations and motivates forecast of clinical drug response on a patient-by-patient basis. We suggest incorporation of structure-guided genetic inference assays into pharmaceutical and healthcare Oncology workflows. PMID:25465236
DOE Office of Scientific and Technical Information (OSTI.GOV)
Borde, Amy B.; Cullinan, Valerie I.; Diefenderfer, Heida L.
The Reference Site (RS) study is part of the research, monitoring, and evaluation (RME) effort developed by the Action Agencies (Bonneville Power Administration [BPA], U.S. Army Corps of Engineers, Portland District [USACE], and U.S. Bureau of Reclamation) in response to Federal Columbia River Power System (FCRPS) Biological Opinions (BiOp). While the RS study was initiated in 2007, data have been collected at relatively undisturbed reference wetland sites in the LCRE by PNNL and collaborators since 2005. These data on habitat structural metrics were previously summarized to provide baseline characterization of 51 wetlands throughout the estuarine and tidal freshwater portions ofmore » the 235-km LCRE; however, further analysis of these data has been limited. Therefore, in 2011, we conducted additional analyses of existing field data previously collected for the Columbia Estuary Ecosystem Restoration Program (CEERP) - including data collected by PNNL and others - to help inform the multi-agency restoration planning and ecosystem management work underway in the LCRE.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Holderman, Charlie
2009-02-19
The Kootenai River ecosystem has experienced numerous ecological changes since the early 1900s. Some of the largest impacts to habitat, biological communities, and ecological function resulted from levee construction along the 120 km of river upstream from Kootenay Lake, completed by the 1950s, and the construction and operation of Libby Dam, completed in 1972 on the river near Libby Montana. Levee construction isolated tens of thousands of hectares of historic functioning floodplain habitat from the river channel, eliminating nutrient production and habitat diversity crucial to the functioning of a large river-floodplain ecosystem. Libby Dam continues to create large changes inmore » the timing, duration, and magnitude of river flows, and greatly reduces sediment and nutrient transport to downstream river reaches. These changes have contributed to the ecological collapse of the post-development Kootenai River ecosystem and its native biological communities. In response to this artificial loss of nutrients, experimental nutrient addition was initiated in the Kootenay Lake's North Arm in 1992, the South Arm in 2004, and in the Kootenai River at the Idaho-Montana border during 2005. This report characterizes the macroinvertebrate community in the Kootenai River and its response to experimental nutrient addition during 2005 and 2006. This report also provides an initial evaluation of cascading trophic interactions in response to nutrient addition. Macroinvertebrates were sampled at 12 sites along a 325 km section of the Kootenai River, representing an upriver unimpounded reference reach, treatment and control canyon reach sites, and braided and meandering reach sites, all downstream from Libby Dam. Principle component analysis revealed that richness explained the greatest amount of variability in response to nutrient addition as did taxa from Acari, Coleoptera, Ephemeroptera, Plecoptera, and Trichoptera. Analysis of variance revealed that nutrient addition had a significant effect (p<0.0001) on invertebrate abundance, biomass, and richness at sites KR-9 and KR-9.1 combined (the zone of maximum biological response). Richness, a valuable ecological metric, increased more than abundance and biomass, which were subject to greater sampling bias. Cascading trophic interactions were observed as increased algal accrual, increased in-river invertebrate abundance, and increased invertebrate counts in mountain whitefish (Prosopium williamsonii) guts samples, but were not quantitatively tested. Sampling and analyses across trophic levels are currently ongoing and are expected to better characterize ecological responses to experimental nutrient addition in the Kootenai River.« less
Makhmoudova, Amina; Williams, Declan; Brewer, Dyanne; Massey, Sarah; Patterson, Jenelle; Silva, Anjali; Vassall, Kenrick A.; Liu, Fushan; Subedi, Sanjeena; Harauz, George; Siu, K. W. Michael; Tetlow, Ian J.; Emes, Michael J.
2014-01-01
Starch branching enzyme IIb (SBEIIb) plays a crucial role in amylopectin biosynthesis in maize endosperm by defining the structural and functional properties of storage starch and is regulated by protein phosphorylation. Native and recombinant maize SBEIIb were used as substrates for amyloplast protein kinases to identify phosphorylation sites on the protein. A multidisciplinary approach involving bioinformatics, site-directed mutagenesis, and mass spectrometry identified three phosphorylation sites at Ser residues: Ser649, Ser286, and Ser297. Two Ca2+-dependent protein kinase activities were partially purified from amyloplasts, termed K1, responsible for Ser649 and Ser286 phosphorylation, and K2, responsible for Ser649 and Ser297 phosphorylation. The Ser286 and Ser297 phosphorylation sites are conserved in all plant branching enzymes and are located at opposite openings of the 8-stranded parallel β-barrel of the active site, which is involved with substrate binding and catalysis. Molecular dynamics simulation analysis indicates that phospho-Ser297 forms a stable salt bridge with Arg665, part of a conserved Cys-containing domain in plant branching enzymes. Ser649 conservation appears confined to the enzyme in cereals and is not universal, and is presumably associated with functions specific to seed storage. The implications of SBEIIb phosphorylation are considered in terms of the role of the enzyme and the importance of starch biosynthesis for yield and biotechnological application. PMID:24550386
DOT National Transportation Integrated Search
2014-11-15
The simplified procedure in design codes for determining earthquake response spectra involves : estimating site coefficients to adjust available rock accelerations to site accelerations. Several : investigators have noted concerns with the site coeff...
Torres-Estrada, José Luis; Meza-Alvarez, R Amanda; Cibrián-Tovar, Juan; Rodríguez-López, Mario H; Arredondo-Jiménez, Juan I; Cruz-López, Leopoldo; Rojas-Leon, Julio C
2005-12-01
Oviposition response of gravid Anopheles albimanus Wiedemman (Diptera: Culicidae) females to water containing Brachiaria mutica, Cynodon dactylon, Jouvea straminea, Fimbristylis spadicea, and Ceratophyllum demersum was investigated. Gravid An. albimanus females deposited similar egg numbers in cups containing natural plants in water from natural breeding sites and in cups containing natural plants in distilled water. Gravid mosquitoes deposited significantly more eggs in cups containing natural plants in water from natural breeding sites than in cups containing artificial plants in water from the corresponding natural breeding sites. These results were confirmed in experiments conducted in a wind tunnel, indicating that female response is mediated by chemical cues from plants. Bioassays with organic extracts of all 5 plant species indicated that these extracts at 100%, 10%, and 1% concentrations had an oviposition repellent effect, while attractiveness was observed at 0.1%, 0.01%, and 0.001%. Gas chromatography and mass spectrometry analysis of the organic extracts found in all 5 plants showed a mixture of terpenoid and alcohol compounds, among them: guaiacol, phenol, isoeugenol, longifolene, caryophyllene, phenyl ethyl alcohol, and p-cresol. These results suggest that middle-range volatiles from plants may function as chemical cues for the female's oviposition response in this mosquito species.
Inland area contingency plan and maps for Pennsylvania (on CD-ROM). Data file
DOE Office of Scientific and Technical Information (OSTI.GOV)
NONE
1996-12-01
EPA Region III has assembled on this CD a multitude of environmental data, in both visual and textual formats. While targeted for Facility Response Planning under the Oil Pollution Act of 1990, this information will prove helpful to anyone in the environmental arena. Specifically, the CD will aid contingency planning and emergency response personnel. Combining innovative GIS technology with EPA`s state-specific data allows you to display maps, find and identify map features, look at tabular information about map features, and print out maps. The CD was designed to be easy to use and incorporates example maps as well as helpmore » sections describing the use of the environmental data on the CD, and introduces you to the IACP Viewer and its capabilities. These help features will make it easy for you to conduct analysis, produce maps, and browse the IACP Plan. The IACP data are included in two formats: shapefiles, which can be viewed with the IACP Viewer or ESRI`s ArcView software (Version 2.1 or higher), and ARC/INFO export files, which can be imported into ARC/INFO or converted to other GIS data formats. Point Data Sources: Sensitive Areas, Surface Drinking Water Intakes, Groundwater Intakes, Groundwater Supply Facilities, NPL (National Priority List) Sites, FRP (Facility Response Plan) Facilities, NPDES (National Pollutant Discharge Elimination System) Facilities, Hospitals, RCRA (Resource Conservation and Recovery Act) Sites, TRI (Toxic Release Inventory) Sites, CERCLA (Comprehensive Environmental Response, Compensation, and Liability Act) Sites Line Data Sources: TIGER Roads, TIGER Railroads, TIGER Hydrography, Pipelines Polygon Data Sources: State Boundaries, County Boundaries, Watershed Boundaries (8-digit HUC), TIGER Hydrography, Public Lands, Populated Places, IACP Boundaries, Coast Guard Boundaries, Forest Types, US Congressional Districts, One-half Mile Buffer of Surface Drinking Water Intakes.« less
Inland area contingency plan and maps for Virginia (on CD-ROM). Data file
DOE Office of Scientific and Technical Information (OSTI.GOV)
NONE
1996-12-01
EPA Region III has assembled on this CD a multitude of environmental data, in both visual and textual formats. While targeted for Facility Response Planning under the Oil Pollution Act of 1990, this information will prove helpful to anyone in the environmental arena. Specifically, the CD will aid contingency planning and emergency response personnel. Combining innovative GIS technology with EPA`s state-specific data allows you to display maps, find and identify map features, look at tabular information about map features, and print out maps. The CD was designed to be easy to use and incorporates example maps as well as helpmore » sections describing the use of the environmental data on the CD, and introduces you to the IACP Viewer and its capabilities. These help features will make it easy for you to conduct analysis, produce maps, and browse the IACP Plan. The IACP data are included in two formats: shapefiles, which can be viewed with the IACP Viewer or ESRI`s ArcView software (Version 2.1 or higher), and ARC/INFO export files, which can be imported into ARC/INFO or converted to other GIS data formats. Point Data Sources: Sensitive Areas, Surface Drinking Water Intakes, Groundwater Intakes, Groundwater Supply Facilities, NPL (National Priority List) Sites, FRP (Facility Response Plan) Facilities, NPDES (National Pollutant Discharge Elimination System) Facilities, Hospitals, RCRA (Resource Conservation and Recovery Act) Sites, TRI (Toxic Release Inventory) Sites, CERCLA (Comprehensive Environmental Response, Compensation, and Liability Act) Sites Line Data Sources: TIGER Roads, TIGER Railroads, TIGER Hydrography, Pipelines Polygon Data Sources: State Boundaries, County Boundaries, Watershed Boundaries (8-digit HUC), TIGER Hydrography, Public Lands, Populated Places, IACP Boundaries, Coast Guard Boundaries, Forest Types, US Congressional Districts, One-half Mile Buffer of Surface Drinking Water Intakes.« less
Bellas, Juan; Albentosa, Marina; Vidal-Liñán, Leticia; Besada, Victoria; Franco, M Ángeles; Fumega, José; González-Quijano, Amelia; Viñas, Lucía; Beiras, Ricardo
2014-05-01
This study undertakes an overall assessment of pollution in a large region (over 2500 km of coastline) of the N-NW Spanish coast, by combining the use of biochemical (AChE, GST, GPx) and physiological (SFG) responses to pollution, with chemical analyses in wild mussel populations (Mytilus galloprovincialis). The application of chemical analysis and biological techniques identified polluted sites and quantified the level of toxicity. High levels of pollutants were found in mussel populations located close to major cities and industrialized areas and, in general, average concentrations were higher in the Cantabrian than in the Iberian Atlantic coast. AChE activities ranged between 5.8 and 27.1 nmol/min/mg prot, showing inhibition in 12 sampling sites, according to available ecotoxicological criteria. GST activities ranged between 29.5 and 112.7 nmol/min/mg prot, and extreme variability was observed in GPx, showing activities between 2.6 and 64.5 nmol/min/mg prot. Regarding SFG, only 5 sites showed 'moderate stress' (SFG value below 20 J/g/h), and most sites presented a 'high potential growth' (>35 J/g/h) corresponding to a 'healthy state'. Multivariate statistical techniques applied to the chemical and biological data identified PCBs, organochlorine pesticides and BDEs as the main responsible of the observed toxicity. However, the alteration of biological responses caused by pollutants seems to be, in general, masked by biological variables, namely age and mussel condition, which have an effect on the mussels' response to pollutant exposure. Copyright © 2013 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Zha, Yuanyuan; Yeh, Tian-Chyi J.; Illman, Walter A.; Onoe, Hironori; Mok, Chin Man W.; Wen, Jet-Chau; Huang, Shao-Yang; Wang, Wenke
2017-04-01
Hydraulic tomography (HT) has become a mature aquifer test technology over the last two decades. It collects nonredundant information of aquifer heterogeneity by sequentially stressing the aquifer at different wells and collecting aquifer responses at other wells during each stress. The collected information is then interpreted by inverse models. Among these models, the geostatistical approaches, built upon the Bayesian framework, first conceptualize hydraulic properties to be estimated as random fields, which are characterized by means and covariance functions. They then use the spatial statistics as prior information with the aquifer response data to estimate the spatial distribution of the hydraulic properties at a site. Since the spatial statistics describe the generic spatial structures of the geologic media at the site rather than site-specific ones (e.g., known spatial distributions of facies, faults, or paleochannels), the estimates are often not optimal. To improve the estimates, we introduce a general statistical framework, which allows the inclusion of site-specific spatial patterns of geologic features. Subsequently, we test this approach with synthetic numerical experiments. Results show that this approach, using conditional mean and covariance that reflect site-specific large-scale geologic features, indeed improves the HT estimates. Afterward, this approach is applied to HT surveys at a kilometer-scale-fractured granite field site with a distinct fault zone. We find that by including fault information from outcrops and boreholes for HT analysis, the estimated hydraulic properties are improved. The improved estimates subsequently lead to better prediction of flow during a different pumping test at the site.
Redkiewicz, Patrycja; Stachyra, Anna; Sawicka, Róz∙a; Bocian, Katarzyna; Góra-Sochacka, Anna; Kosson, Piotr; Sirko, Agnieszka
2017-01-01
Influenza is one of the most important illnesses in the modern world, causing great public health losses each year due to the lack of medication and broadly protective, long-lasting vaccines. The development of highly immunogenic and safe vaccines is currently one of the major problems encountered in efficient influenza prevention. DNA vaccines represent a novel and powerful alternative to the conventional vaccine approaches. To improve the efficacy of the DNA vaccine against influenza H5N1, we inserted three repeated kappa B (κB) motifs, separated by a 5-bp nucleotide spacer, upstream of the cytomegalovirus promoter and downstream of the SV40 late polyadenylation signal. The κB motif is a specific DNA element (10pb-long) recognized by one of the most important transcription factors NFκB. NFκB is present in almost all animal cell types and upon cell stimulation under a variety of pathogenic conditions. NFκB is released from IκB and translocates to the nucleus and binds to κB sites, thereby leading to enhanced transcription and expression of downstream genes. We tested the variants of DNA vaccine with κB sites flanking the antigen expression cassette and without such sites in two animal models: chickens (broilers and layers) and mice (BALB/c). In chickens, the variant with κB sites stimulated stronger humoral response against the target antigen. In mice, the differences in humoral response were less apparent. Instead, it was possible to spot several gene expression differences in the spleens isolated from mice immunized with both variants. The results of our study indicate that modification of the sequence outside of the sequence encoding the antigen might enhance the immune response to the target but understanding the mechanisms responsible for this process requires further analysis. PMID:28883819
Chabli, A; Guitton, D; Fortin, S; Molotchnikoff, S
2000-03-01
The present study examined, in the superior colliculus (SC) of anaesthetised cats, the functional connectivity between superficial-layer neurones (SLNs) and tectoreticular neurones (TRNs: collicular output cells). TRNs were antidromically identified by electrical stimulation of the predorsal bundle. The auto- and cross-correlation histograms of visual responses of both types of neurones were recorded and analysed. A delayed, sharp peak in cross-correlograms allowed us to verify whether SLN and TRN cells were coupled; in addition, oscillatory activities were compared to verify if rhythmic responses of SLN sites were transmitted to TRN sites. We found that oscillatory activity was rarely observed in spontaneous activity of superficial (1/74) and TRN sites (1/48). Moving light bars induced oscillation in 31% (23/74) of the superficial-layer and in 23% (11/48) of the TRN sites. The strength of the rhythmic responses was determined by specific ranges of stimulus velocity in 83% (19/23) and 64% (7/11) of oscillating SLN and TRN sites, respectively. Frequencies of oscillations ranged between 5 and 125 Hz and were confined, for 53% of the cells, to the 5-20 Hz band. Thus, the band-width of frequencies of the stimulus-related oscillations in the superior colliculus was broader than the gamma range. Analysis of cross-correlation histograms revealed a significant predominant peak with a mean delay of 2.7+/-0.9 ms in 46% (17/37) of SLN-TRN pairs. Most correlated SLN-TRN pairs (88%: 15/17) had superimposed receptive fields, suggesting they were functionally interconnected. However, individual oscillatory frequencies of correlated and oscillatory SLN and TRN cells were never the same (0/8). Together, these results suggest that the neurones in collicular superficial layer contact TRNs and, consequently, support the idea that the superficial layers contribute to collicular outputs producing eye- and head-orienting movements.
Li, Xiaonuo; Chen, Weiping; Cundy, Andrew B; Chang, Andrew C; Jiao, Wentao
2018-03-15
Public perception towards contaminated site management, a not readily quantifiable latent parameter, was linked through structural equation modeling in this paper to 22 measurable/observable manifest variables associated with the extent of information dissemination and public knowledge of soil pollution, attitude towards remediation policies, and participation in risk mitigation processes. Data obtained through a survey of 412 community residents at four remediation sites in China were employed in the model validation. The outcomes showed that public perception towards contaminated site management might be explained through selected measurable parameters in five categories, namely information disclosure, knowledge of soil pollution, expectations of remediation and redevelopment outcomes, public participation, and site policy, along with their interactions. Among these, information dissemination and attitude towards management policies exhibited significant influence in promoting positive public perception. Based on these examples, responsible agencies therefore should focus on public accessibility to reliable information, and encourage public inputs into policies for contaminated site management, in order to gain public confidence during remediation and regeneration projects. Copyright © 2018 Elsevier Ltd. All rights reserved.
Saminathan, Thangasamy; Malkaram, Sridhar A; Patel, Dharmesh; Taylor, Kaitlyn; Hass, Amir; Nimmakayala, Padma; Huber, David H; Reddy, Umesh K
2015-09-01
Efficient postmining reclamation requires successful revegetation. By using RNA sequencing, we evaluated the growth response of two invasive plants, goutweed (Aegopodium podagraria L.) and mugwort (Artemisia vulgaris), grown in two Appalachian acid-mine soils (MS-I and -II, pH ∼ 4.6). Although deficient in macronutrients, both soils contained high levels of plant-available Al, Fe and Mn. Both plant types showed toxicity tolerance, but metal accumulation differed by plant and site. With MS-I, Al accumulation was greater for mugwort than goutweed (385 ± 47 vs 2151 ± 251 μg g-1). Al concentration was similar between mine sites, but its accumulation in mugwort was greater with MS-I than MS-II, with no difference in accumulation by site for goutweed. An in situ approach revealed deregulation of multiple factors such as transporters, transcription factors, and metal chelators for metal uptake or exclusion. The two plant systems showed common gene expression patterns for different pathways. Both plant systems appeared to have few common heavy-metal pathway regulators addressing mineral toxicity/deficiency in both mine sites, which implies adaptability of invasive plants for efficient growth at mine sites with toxic waste. Functional genomics can be used to screen for plant adaptability, especially for reclamation and phytoremediation of contaminated soils and waters.
Regional spectral analysis of three moderate earthquakes in Northeastern North America
Boatwright, John; Seekins, Linda C.
2011-01-01
We analyze Fourier spectra obtained from the horizontal components of broadband and accelerogram data from the 1997 Cap-Rouge, the 2002 Ausable Forks, and the 2005 Rivière-du-Loup earthquakes, recorded by Canadian and American stations sited on rock at hypocentral distances from 23 to 602 km. We check the recorded spectra closely for anomalies that might result from site resonance or source effects. We use Beresnev and Atkinson’s (1997) near-surface velocity structures and Boore and Joyner’s (1997) quarter-wave method to estimate site response at hard- and soft-rock sites. We revise the Street et al. (1975) model for geometrical spreading, adopting a crossover distance of ro=50 km instead of 100 km. We obtain an average attenuation of Q=410±25f0.50±0.03 for S+Lg+surface waves with ray paths in the Appalachian and southeastern Grenville Provinces. We correct the recorded spectra for attenuation and site response to estimate source spectral shape and radiated energy for these three earthquakes and the 1988 M 5.8 Saguenay earthquake. The Brune stress drops range from 130 to 419 bars, and the apparent stresses range from 39 to 63 bars. The corrected source spectral shapes of these earthquakes are somewhat variable for frequencies from 0.2 to 2 Hz, falling slightly below the fitted Brune spectra.
Davis, David A; Naiman, Nicole E; Wang, Victoria; Shrestha, Prabha; Haque, Muzammel; Hu, Duosha; Anagho, Holda A; Carey, Robert F; Davidoff, Katharine S; Yarchoan, Robert
2015-07-01
Kaposi's sarcoma-associated herpesvirus (KSHV), also known as human herpesvirus-8, is the causative agent of three hyperproliferative disorders: Kaposi's sarcoma, primary effusion lymphoma (PEL) and multicentric Castleman's disease. During viral latency a small subset of viral genes are produced, including KSHV latency-associated nuclear antigen (LANA), which help the virus thwart cellular defense responses. We found that exposure of KSHV-infected cells to oxidative stress, or other inducers of apoptosis and caspase activation, led to processing of LANA and that this processing could be inhibited with the pan-caspase inhibitor Z-VAD-FMK. Using sequence, peptide, and mutational analysis, two caspase cleavage sites within LANA were identified: a site for caspase-3 type caspases at the N-terminus and a site for caspase-1 and-3 type caspases at the C-terminus. Using LANA expression plasmids, we demonstrated that mutation of these cleavage sites prevents caspase-1 and caspase-3 processing of LANA. This indicates that these are the principal sites that are susceptible to caspase cleavage. Using peptides spanning the identified LANA cleavage sites, we show that caspase activity can be inhibited in vitro and that a cell-permeable peptide spanning the C-terminal cleavage site could inhibit cleavage of poly (ADP-ribose) polymerase and increase viability in cells undergoing etoposide-induced apoptosis. The C-terminal peptide of LANA also inhibited interleukin-1 beta (IL-1β) production from lipopolysaccharide-treated THP-1 cells by more than 50%. Furthermore, mutation of the two cleavage sites in LANA led to a significant increase in IL-1β production in transfected THP-1 cells; this provides evidence that these sites function to blunt the inflammasome, which is known to be activated in latently infected PEL cells. These results suggest that specific caspase cleavage sites in KSHV LANA function to blunt apoptosis as well as interfere with the caspase-1-mediated inflammasome, thus thwarting key cellular defense mechanisms.
Warren, Curtis R.; Grindel, Brian J.; Francis, Lewis; Carson, Daniel D.; Farach-Carson, Mary C.
2014-01-01
Perlecan/HSPG2, a heparan sulfate proteoglycan typically found at tissue borders including those separating epithelia and connective tissue, increases near sites of invasion of primary prostatic tumors as previously shown for other proteins involved in desmoplastic tissue reaction. Studies of prostate cancer cells and stromal cells from both prostate and bone, the major site for prostate cancer metastasis, showed that cancer cells and a subset of stromal cells increased production of perlecan in response to cytokines present in the tumor microenvironment. In silico analysis of the HSPG2 promoter revealed two conserved NFκB binding sites, in addition to the previously reported SMAD3 binding sites. By systematically transfecting cells with a variety of reporter constructs including sequences up to 2.6 kb from the start site of transcription, we identified an active cis element in the distal region of the HSPG2 promoter, and showed that it functions in regulating transcription of HSPG2. Treatment with TNF-α and/or TGFβ1 identified TNF-α as a major cytokine regulator of perlecan production. TNF-α treatment also triggered p65 nuclear translocation and binding to the HSPG2 regulatory region in stromal cells and cancer cells. In addition to stromal induction of perlecan production in the prostate, we identified a matrix-secreting bone marrow stromal cell type that may represent the source for increases in perlecan in the metastatic bone marrow environment. These studies implicate perlecan in cytokine-mediated, innate tissue responses to cancer cell invasion, a process we suggest reflects a modified wound healing tissue response co-opted by prostate cancer cells. PMID:24700612
Szota, Christopher; Farrell, Claire; Koch, John M; Lambers, Hans; Veneklaas, Erik J
2011-10-01
This study describes the physiological response of two co-occurring tree species (Eucalyptus marginata and Corymbia calophylla) to seasonal drought at low- and high-quality restored bauxite mine sites in south-western Australia. Seasonal changes in photosynthesis (A), stomatal conductance (g(s)), leaf water potential (ψ), leaf osmotic potential (ψ), leaf relative water content (RWC) and pressure-volume analysis were captured over an 18-month field study to (i) determine the nature and severity of physiological stress in relation to site quality and (ii) identify any physiological differences between the two species. Root system restriction at the low-quality site reduced maximum rates of gas exchange (g(s) and A) and increased water stress (midday ψ and daily RWC) in both species during drought. Both species showed high stomatal sensitivity during drought; however, E. marginata demonstrated a higher dehydration tolerance where ψ and RWC fell to -3.2 MPa and 73% compared with -2.4 MPa and 80% for C. calophylla. Corymbia calophylla showed lower g(s) and higher ψ and RWC during drought, indicating higher drought tolerance. Pressure-volume curves showed that cell-wall elasticity of E. marginata leaves increased in response to drought, while C. calophylla leaves showed lower osmotic potential at zero turgor in summer than in winter, indicating osmotic adjustment. Both species are clearly able to tolerate seasonal drought at hostile sites; however, by C. calophylla closing stomata earlier in the drought cycle, maintaining a higher water status during drought and having the additional mechanism of osmotic adjustment, it may have a greater capacity to survive extended periods of drought.
A framework to spatially cluster air pollution monitoring sites in US based on the PM2.5 composition
Austin, Elena; Coull, Brent A.; Zanobetti, Antonella; Koutrakis, Petros
2013-01-01
Background Heterogeneity in the response to PM2.5 is hypothesized to be related to differences in particle composition across monitoring sites which reflect differences in source types as well as climatic and topographic conditions impacting different geographic locations. Identifying spatial patterns in particle composition is a multivariate problem that requires novel methodologies. Objectives Use cluster analysis methods to identify spatial patterns in PM2.5 composition. Verify that the resulting clusters are distinct and informative. Methods 109 monitoring sites with 75% reported speciation data during the period 2003–2008 were selected. These sites were categorized based on their average PM2.5 composition over the study period using k-means cluster analysis. The obtained clusters were validated and characterized based on their physico-chemical characteristics, geographic locations, emissions profiles, population density and proximity to major emission sources. Results Overall 31 clusters were identified. These include 21 clusters with 2 or more sites which were further grouped into 4 main types using hierarchical clustering. The resulting groupings are chemically meaningful and represent broad differences in emissions. The remaining clusters, encompassing single sites, were characterized based on their particle composition and geographic location. Conclusions The framework presented here provides a novel tool which can be used to identify and further classify sites based on their PM2.5 composition. The solution presented is fairly robust and yielded groupings that were meaningful in the context of air-pollution research. PMID:23850585
Target organs in chronic bioassays of 533 chemical carcinogens
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gold, L.S.; Slone, T.H.; Manley, N.B.
1991-06-01
A compendium of carcinogenesis bioassay results organized by target organ is presented for 533 chemicals that are carcinogenic in at least one species. This compendium is based primarily on experiments in rats or mice; results in hamsters, nonhuman primates, and dogs are also reported. The compendium can be used to identify chemicals that induce tumors at particular sites, and to determine whether target sites are the same for chemicals positive in more than one species. The Carcinogenic Potency Database (CPDB), which includes results of 3969 experiments, is used in the analysis. The published CPDB includes details on each test, andmore » literature references. Chemical carcinogens are reported for 35 different target organs in rats or mice. More than 80% of the carcinogens in each of these species are positive in at least one of the 8 most frequent target sites; liver, lung, mammary gland, stomach, vascular system, kidney, hematopoietic system, and urinary bladder. An analysis is presented of how well one can predict the carcinogenic response in mice from results in rats, or vice versa. Among chemicals tested in both species, 76% of rat carcinogens are positive in mice, and 71% of mouse carcinogens are positive in rats. Prediction is less accurate to the same target site: 52% of rat carcinogens are positive in the same site in mice, and 48% of mouse carcinogens are positive in the same site in rats. The liver is the most frequent site in common between rats and mice.« less
Impact of storm-water outfalls on sediment quallity in corpus Christi Bay, Texas, USA
Carr, R. Scott; Montagna, Paul A.; Biedenbach, James M.; Kalke, Rick; Kennicutt, Mahlon C.; Hooten, Russell L.; Cripe, Geraldine
2000-01-01
To determine the quality of sediments and extent of contaminant impacts, a Sediment Quality Triad (SQT) study was conducted at 36 sites in the Corpus Christi Bay, Texas, USA, system. Fifteen of the 36 sites were located near storm-water outfalls, but 13 other sites (i.e., industrial and domestic outfalls, oil field–produced water discharges, and dredging activity) and eight reference sites were also evaluated. Sediment samples were collected and analyzed for physical–chemical characteristics, contaminant concentrations (metals, polycyclic aromatic hydrocarbons [PAHs], polychlorinated biphenyls [PCBs], and pesticides), toxicity (amphipod and mysid solid phase and sea urchin pore-water fertilization and embryological development tests), and a benthic index of biotic integrity (BIBI) composed of 10 independent metrics calculated for each site. This large data matrix was reduced using multivariate analysis to create new variables for each component representing overall means and containing most of the variance in the larger data set. The new variables were used to conduct the correlation analysis. Toxicity was significantly correlated with both chemistry and ecological responses, whereas no correlations between the benthic metrics and sediment chemistry were observed. Using the combined information from the SQT, four of the five most degraded sites were storm-water outfall sites. Although estuaries are naturally stressful environments because of salinity and temperature fluctuations, this ecosystem appears to have been compromised by anthropogenic influences similar to what has been observed for other heavily urbanized bay systems along the Texas and Gulf coast.
Yamamura, Daiki; Sano, Ayaka; Tateno, Takashi
2017-03-15
To examine local network properties of the mouse auditory cortex in vitro, we recorded extracellular spatiotemporal laminar profiles driven by short electric local stimulation on a planar multielectrode array substrate. The recorded local field potentials were subsequently evaluated using current source density (CSD) analysis to identify sources and sinks. Current sinks are thought to be an indicator of net synaptic current in the small volume of cortex surrounding the recording site. Thus, CSD analysis combined with multielectrode arrays enabled us to compare mean synaptic activity in response to small current stimuli on a layer-by-layer basis. We also used senescence-accelerated mice (SAM), some strains of which show earlier onset of age-related hearing loss, to examine the characteristic spatiotemporal CSD profiles stimulated by electrodes in specific cortical layers. Thus, the CSD patterns were classified into several clusters based on stimulation sites in the cortical layers. We also found some differences in CSD patterns between the two SAM strains in terms of aging according to principle component analysis with dimension reduction. For simultaneous two-site stimulation, we modeled the obtained CSD profiles as a linear superposition of the CSD profiles to individual single-site stimulation. The model analysis indicated the nonlinearity of spatiotemporal integration over stimulus-driven activity in a layer-specific manner. Finally, on the basis of these results, we discuss the auditory cortex local network properties and the effects of aging on these mouse strains. Copyright © 2017 Elsevier B.V. All rights reserved.
Lugo, Alessandra; Bosetti, Cristina; Peveri, Giulia; Rota, Matteo; Bagnardi, Vincenzo; Gallus, Silvano
2017-11-01
Only a limited number of meta-analyses providing risk curve functions of dose-response relationships between various smoking-related variables and cancer-specific risk are available. To identify all relevant original publications on the issue, we will conduct a series of comprehensive systematic reviews based on three subsequent literature searches: (1) an umbrella review, to identify meta-analyses, pooled analyses and systematic reviews published before 28 April 2017 on the association between cigarette smoking and the risk of 28 (namely all) malignant neoplasms; (2) for each cancer site, an updated review of original publications on the association between cigarette smoking and cancer risk, starting from the last available comprehensive review identified through the umbrella review; and (3) a review of all original articles on the association between cigarette smoking and site-specific cancer risk included in the publications identified through the umbrella review and the updated reviews. The primary outcomes of interest will be (1) the excess incidence/mortality of various cancers for smokers compared with never smokers; and (2) the dose-response curves describing the association between smoking intensity, duration and time since stopping and incidence/mortality for various cancers. For each cancer site, we will perform a meta-analysis by pooling study-specific estimates for smoking status. We will also estimate the dose-response curves for other smoking-related variables through random-effects meta-regression models based on a non-linear dose-response relationship framework. Ethics approval is not required for this study. Main results will be published in peer-reviewed journals and will also be included in a publicly available website. We will provide therefore the most complete and updated estimates on the association between various measures of cigarette smoking and site-specific cancer risk. This will allow us to obtain precise estimates on the cancer burden attributable to cigarette smoking. This protocol was registered in the International Prospective Register of Systematic Reviews (CRD42017063991). © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Fonseca, E; Cruz, J J; Dueñas, A; Gómez, A; Sánchez, P; Martín, G; Nieto, A; Soria, P; Muñoz, A; Gómez, J L; Pardal, J L
1996-01-01
Neoadjuvant chemotherapy for head and neck carcinoma is still an important treatment modality. The prognostic value of patient and tumor parameters has been extensively evaluated in several trials, yielding mixed results. We report the prognostic factors emerging from a group of patients undergoing neoadjuvant chemotherapy. From April 1986 to June 1992, 149 consecutive patients received cisplatin-5-fluorouracil-based neoadjuvant chemotherapy. After four courses of chemotherapy, patients underwent local-regional treatment with surgery, radiation or both. A variety of patient and tumor characteristics were evaluated as predictors for response to chemotherapy and survival. The complete response, partial response and no response rates to NAC were 52%, 33% and 15%, respectively. No parameters predicted response to chemotherapy. At a maximum follow-up of 87 months, overall survival was 39% and disease-free survival was 49%. Variables shown to be predictors of survival in univariate analyses were age, performance status, histology, site, T, N, stage, and response to chemotherapy. Using the Cox regression analysis, only complete response to induction chemotherapy (P = 0.0006), performance status (P = 0.03), stage (P = 0.01), age (P = 0.03) and primary tumor site (P = 0.04) emerged as independent prognostic factors for survival. Complete response to chemotherapy was confirmed as the strongest prognostic factor influencing survival. However, conventional clinicopathologic factors did not predict response, hence, potential prognostic biologic and molecular factors for response must be sought. At present, much effort must be made for the improvement of the complete response rate, which seems to be a requisite to prolong survival.
Seismic Hazard and Ground Motion Characterization at the Itoiz Dam (Northern Spain)
NASA Astrophysics Data System (ADS)
Rivas-Medina, A.; Santoyo, M. A.; Luzón, F.; Benito, B.; Gaspar-Escribano, J. M.; García-Jerez, A.
2012-08-01
This paper presents a new hazard-consistent ground motion characterization of the Itoiz dam site, located in Northern Spain. Firstly, we propose a methodology with different approximation levels to the expected ground motion at the dam site. Secondly, we apply this methodology taking into account the particular characteristics of the site and of the dam. Hazard calculations were performed following the Probabilistic Seismic Hazard Assessment method using a logic tree, which accounts for different seismic source zonings and different ground-motion attenuation relationships. The study was done in terms of peak ground acceleration and several spectral accelerations of periods coinciding with the fundamental vibration periods of the dam. In order to estimate these ground motions we consider two different dam conditions: when the dam is empty ( T = 0.1 s) and when it is filled with water to its maximum capacity ( T = 0.22 s). Additionally, seismic hazard analysis is done for two return periods: 975 years, related to the project earthquake, and 4,975 years, identified with an extreme event. Soil conditions were also taken into account at the site of the dam. Through the proposed methodology we deal with different forms of characterizing ground motion at the study site. In a first step, we obtain the uniform hazard response spectra for the two return periods. In a second step, a disaggregation analysis is done in order to obtain the controlling earthquakes that can affect the dam. Subsequently, we characterize the ground motion at the dam site in terms of specific response spectra for target motions defined by the expected values SA ( T) of T = 0.1 and 0.22 s for the return periods of 975 and 4,975 years, respectively. Finally, synthetic acceleration time histories for earthquake events matching the controlling parameters are generated using the discrete wave-number method and subsequently analyzed. Because of the short relative distances between the controlling earthquakes and the dam site we considered finite sources in these computations. We conclude that directivity effects should be taken into account as an important variable in this kind of studies for ground motion characteristics.
NASA Astrophysics Data System (ADS)
Wise, W. R.
2001-05-01
Research currently in progress will evaluate land development options on a 161 +/- HA site in North Central Florida lying within a 292+/- HA watershed that contributes to Bullfrog Creek in the Camp Blanding Wildlife Management Area. The research analyzes aspects of an emerging storm-water management philosophy, called low-impact development (LID) by Prince Georges County, Maryland. LID seeks to preserve site hydrology by reducing the area of disturbance on the site, preserving natural drainage features on the site and by utilizing BMPs that promote infiltration and slower transport of runoff. This research investigates the benefits and problems associated with this design philosophy, particularly in Florida. Two scenarios will be investigated: Low density residential and Medium density residential. Within each scenario the hydrologic response of the site under conventional and LID will be explored. Furthermore, the impact of using cluster developments in LIDs will be investigated. Parameters to be measured include: peak flow, runoff volume, pollutant load generated/removed by BMPs, peak-flow timing and base flow. HEC-HMS will be used for hydrologic modeling (soil moisture accounting module). Pollutant loads generated and removed will be based on published data for land use and BMPs. An economic analysis, based on the estimated construction costs of conventional and LID, will also be done. Further sensitivity analyses will be conducted on the effect that various watershed conditions have on the hydrologic response of the site developed as a LID. This research will provide insight to several questions. In the most general sense it will indicate whether this emerging design philosophy, much of which was developed in other regions of the country, is beneficial to Florida watersheds "as it is" and what, if any, alterations should be considered. Secondly, this research will show the impact of development with different site-planning options, for example cluster development versus deed restrictions on lots. Thirdly, the research will give insight to the applicability of this land-development approach under different allowable residential densities. Lastly, the effect of different physical characteristics on the watershed can be explored.
In silico analysis of miRNA-mediated gene regulation in OCA and OA genes.
Kamaraj, Balu; Gopalakrishnan, Chandrasekhar; Purohit, Rituraj
2014-12-01
Albinism is an autosomal recessive genetic disorder due to low secretion of melanin. The oculocutaneous albinism (OCA) and ocular albinism (OA) genes are responsible for melanin production and also act as a potential targets for miRNAs. The role of miRNA is to inhibit the protein synthesis partially or completely by binding with the 3'UTR of the mRNA thus regulating gene expression. In this analysis, we predicted the genetic variation that occurred in 3'UTR of the transcript which can be a reason for low melanin production thus causing albinism. The single nucleotide polymorphisms (SNPs) in 3'UTR cause more new binding sites for miRNA which binds with mRNA which leads to inhibit the translation process either partially or completely. The SNPs in the mRNA of OCA and OA genes can create new binding sites for miRNA which may control the gene expression and lead to hypopigmentation. We have developed a computational procedure to determine the SNPs in the 3'UTR region of mRNA of OCA (TYR, OCA2, TYRP1 and SLC45A2) and OA (GPR143) genes which will be a potential cause for albinism. We identified 37 SNPs in five genes that are predicted to create 87 new binding sites on mRNA, which may lead to abrogation of the translation process. Expression analysis confirms that these genes are highly expressed in skin and eye regions. It is well supported by enrichment analysis that these genes are mainly involved in eye pigmentation and melanin biosynthesis process. The network analysis also shows how the genes are interacting and expressing in a complex network. This insight provides clue to wet-lab researches to understand the expression pattern of OCA and OA genes and binding phenomenon of mRNA and miRNA upon mutation, which is responsible for inhibition of translation process at genomic levels.
Roman, C.T.; Peck, J.A.; Allen, J.R.; King, J.W.; Appleby, P.G.
1997-01-01
Sediment accumulation rates were determined at several sites throughout Nauset Marsh (Massachusetts, U.S.A.), a back-barrier lagoonal system, using feldspar marker horizons to evaluate short-term rates (1 to 2 year scales) and radiometric techniques to estimate rates over longer time scales (137Cs, 210Pb, 14C). The barrier spit fronting the Spartina-dominated study site has a complex geomorphic history of inlet migration and over-wash events. This study evaluates sediment accumulation rates in relation to inlet migration, storm events, and sea-level rise. The marker horizon technique displayed strong temporal and spatial variability in response to storm events and proximity to the inlet. Sediment accumulation rates of up to 24 mm year -1 were recorded in the immediate vicinity of the inlet during a period that included several major coastal storms, while feldspar sites remote from the inlet had substantially lower rates (trace accumulation to 2.2 mm year -1). During storm-free periods, accumulation rates did not exceed 6.7 mm year -1, but remained quite variable among sites. Based on 137Cs (3.8 to 4.5 mm year -1) and 210Pb (2.6 to 4.2 mm year -1) radiometric techniques, integrating sediment accumulation over decadal time scales, the marsh appeared to be keeping pace with the relative rate of sealevel rise from 1921 to 1993 of 2.4 mm year -1. At one site, the 210Pb-based sedimentation rate and rate of relative sea-level rise were nearly similar and peat rhizome analysis revealed that Distichlis spicata recently replaced this once S.patens site, suggesting that this portion of Nauset Marsh may be getting wetter, thus representing an initial response to wetland submergence. Horizon markers are useful in evaluating the role of short-term events, such as storms or inlet migration, influencing marsh sedimentation processes. However, sampling methods that integrate marsh sedimentation over decadal time scales are preferable when evaluating a systems response to sea-level rise.
Roman, C.T.; Peck, J.A.; Allen, J.R.; King, J.W.; Appleby, P.G.
1997-01-01
Sediment accumulation rates were determined at several sites throughout Nauset Marsh (Massachusetts, U.S.A.), a back-barrier lagoonal system, using feldspar marker horizons to evaluate short-term rates (1 to 2 year scales) and radiometric techniques to estimate rates over longer time scales (137Cs, 210Pb, 14C). The barrier spit fronting the Spartima-dominated study site has a complex geomorphic history of inlet migration and overwash events. This study evaluates sediment accumulation rates in relation to inlet migration, storm events and sea-level rise. The marker horizon technique displayed strong temporal and spatial variability in response to storm events and proximity to the inlet. Sediment accumulation rates of up to 24 mm year-1 were recorded in the immediate vicinity of the inlet during a period that included several major coastal storms, while feldspar sites remote from the inlet had substantially lower rates (trace accumulation to 2.2 mm year-1). During storm-free periods, accumulation rates did not exceed 6.7 mm year-1, but remained quite variable among sites. Based on 137Cs (3.8 to 4.5 mm year-1) and 210Pb (2.6 to 4.2 mm year-1) radiometric techniques, integrating sediment accumulation over decadal time scales, the marsh appeared to be keeping pace with the relative rate of sea-level rise from 1921 to 1993 of 2.4 mm year-1. At one site, the 210Pb-based sedimentation rate and rate of relative sea-level rise were nearly similar and peat rhizome analysis revealed that Distichlis spicata recently replaced this once S. patens site, suggesting that this portion of Nauset Marsh may be getting wetter, thus representing an initial response to wetland submergence. Horizon markers are useful in evaluating the role of short-term events, such as storms or inlet migration, influencing marsh sedimentation processes. However, sampling methods that integrate marsh sedimentation over decadal time scales are preferable when evaluating a systems response to sea-level rise.
Brown, Kyle S.; Oestmo, Simen; Pereira, Telmo; Ranhorn, Kathryn L.; Schoville, Benjamin J.; Marean, Curtis W.
2017-01-01
There are multiple hypotheses for human responses to glacial cycling in the Late Pleistocene, including changes in population size, interconnectedness, and mobility. Lithic technological analysis informs us of human responses to environmental change because lithic assemblage characteristics are a reflection of raw material transport, reduction, and discard behaviors that depend on hunter-gatherer social and economic decisions. Pinnacle Point Site 5–6 (PP5-6), Western Cape, South Africa is an ideal locality for examining the influence of glacial cycling on early modern human behaviors because it preserves a long sequence spanning marine isotope stages (MIS) 5, 4, and 3 and is associated with robust records of paleoenvironmental change. The analysis presented here addresses the question, what, if any, lithic assemblage traits at PP5-6 represent changing behavioral responses to the MIS 5-4-3 interglacial-glacial cycle? It statistically evaluates changes in 93 traits with no a priori assumptions about which traits may significantly associate with MIS. In contrast to other studies that claim that there is little relationship between broad-scale patterns of climate change and lithic technology, we identified the following characteristics that are associated with MIS 4: increased use of quartz, increased evidence for outcrop sources of quartzite and silcrete, increased evidence for earlier stages of reduction in silcrete, evidence for increased flaking efficiency in all raw material types, and changes in tool types and function for silcrete. Based on these results, we suggest that foragers responded to MIS 4 glacial environmental conditions at PP5-6 with increased population or group sizes, ‘place provisioning’, longer and/or more intense site occupations, and decreased residential mobility. Several other traits, including silcrete frequency, do not exhibit an association with MIS. Backed pieces, once they appear in the PP5-6 record during MIS 4, persist through MIS 3. Changing paleoenvironments explain some, but not all temporal technological variability at PP5-6. PMID:28355257
Wilkins, Jayne; Brown, Kyle S; Oestmo, Simen; Pereira, Telmo; Ranhorn, Kathryn L; Schoville, Benjamin J; Marean, Curtis W
2017-01-01
There are multiple hypotheses for human responses to glacial cycling in the Late Pleistocene, including changes in population size, interconnectedness, and mobility. Lithic technological analysis informs us of human responses to environmental change because lithic assemblage characteristics are a reflection of raw material transport, reduction, and discard behaviors that depend on hunter-gatherer social and economic decisions. Pinnacle Point Site 5-6 (PP5-6), Western Cape, South Africa is an ideal locality for examining the influence of glacial cycling on early modern human behaviors because it preserves a long sequence spanning marine isotope stages (MIS) 5, 4, and 3 and is associated with robust records of paleoenvironmental change. The analysis presented here addresses the question, what, if any, lithic assemblage traits at PP5-6 represent changing behavioral responses to the MIS 5-4-3 interglacial-glacial cycle? It statistically evaluates changes in 93 traits with no a priori assumptions about which traits may significantly associate with MIS. In contrast to other studies that claim that there is little relationship between broad-scale patterns of climate change and lithic technology, we identified the following characteristics that are associated with MIS 4: increased use of quartz, increased evidence for outcrop sources of quartzite and silcrete, increased evidence for earlier stages of reduction in silcrete, evidence for increased flaking efficiency in all raw material types, and changes in tool types and function for silcrete. Based on these results, we suggest that foragers responded to MIS 4 glacial environmental conditions at PP5-6 with increased population or group sizes, 'place provisioning', longer and/or more intense site occupations, and decreased residential mobility. Several other traits, including silcrete frequency, do not exhibit an association with MIS. Backed pieces, once they appear in the PP5-6 record during MIS 4, persist through MIS 3. Changing paleoenvironments explain some, but not all temporal technological variability at PP5-6.
Annis, Mandy L.; Brumbaugh, William G.; Chasar, Lia C.; Denslow, Nancy D.; Tillitt, Donald E.
2014-01-01
Methyl-mercury (MeHg) is a potent neuroendocrine disruptor that impairs reproductive processes in fish. The objectives of this study were to (1) characterize transcriptomic changes induced by MeHg exposure in the female largemouth bass (LMB) hypothalamus under controlled laboratory conditions, (2) investigate the health and reproductive impacts of MeHg exposure on male and female largemouth bass (LMB) in the natural environment, and (3) identify MeHg-associated gene expression patterns in whole brain of female LMB from MeHg-contaminated habitats. The laboratory experiment was a single injection of 2.5 μg MeHg/g body weight for 96 h exposure. The field survey compared river systems in Florida, USA with comparably lower concentrations of MeHg (Wekiva, Santa Fe, and St. Johns Rivers) in fish and one river system with LMB that contained elevated concentrations of MeHg (St. Marys River). Microarray analysis was used to quantify transcriptomic responses to MeHg exposure. Although fish at the high-MeHg site did not show overt health or reproductive impairment, there were MeHg-responsive genes and pathways identified in the laboratory study that were also altered in fish from the high-MeHg site relative to fish at the low-MeHg sites. Gene network analysis suggested that MeHg regulated the expression targets of neuropeptide receptor and steroid signaling, as well as structural components of the cell. Disease-associated gene networks related to MeHg exposure, based upon expression data, included cerebellum ataxia, movement disorders, and hypercalcemia. Gene responses in the CNS are consistent with the documented neurotoxicological and neuroendocrine disrupting effects of MeHg in vertebrates. PMID:24694518
Crop response to deep tillage - a meta-analysis
NASA Astrophysics Data System (ADS)
Schneider, Florian; Don, Axel; Hennings, Inga; Schmittmann, Oliver; Seidel, Sabine J.
2017-04-01
Subsoil, i.e. the soil layer below the topsoil, stores tremendous stocks of nutrients and can keep water even under drought conditions. Deep tillage may be a method to enhance the plant-availability of subsoil resources. However, in field trials, deep tillage effects on crop yields were inconsistent. Therefore, we conducted a meta-analysis of crop yield response to subsoiling, deep ploughing and deep mixing of soil profiles. Our search resulted in 1530 yield comparisons following deep and conventional control tillage on 67 experimental cropping sites. The vast majority of the data derived from temperate latitudes, from trials conducted in the USA (679 observations) and Germany (630 observations). On average, crop yield response to deep tillage was slightly positive (6% increase). However, individual deep tillage effects were highly scattered including about 40% yield depressions after deep tillage. Deep tillage on soils with root restrictive layers increased crop yields about 20%, while soils containing >70% silt increased the risk of yield depressions following deep tillage. Generally, deep tillage effects increased with drought intensity indicating deep tillage as climate adaptation measure at certain sites. Our results suggest that deep tillage can facilitate the plant-availability of subsoil nutrients, which increases crop yields if (i) nutrients in the topsoil are growth limiting, and (ii) deep tillage does not come at the cost of impairing topsoil fertility. On sites with root restrictive soil layers, deep tillage can be an effective measure to mitigate drought stress and improve the resilience of crops. However, deep tillage should only be performed on soils with a stable structure, i.e. <70% silt content. We will discuss the contribution of deep tillage options to enhance the sustainability of agricultural production by facilitating the uptake of nutrients and water from the subsoil.
Richter, Catherine A; Martyniuk, Christopher J; Annis, Mandy L; Brumbaugh, William G; Chasar, Lia C; Denslow, Nancy D; Tillitt, Donald E
2014-07-01
Methyl-mercury (MeHg) is a potent neuroendocrine disruptor that impairs reproductive processes in fish. The objectives of this study were to (1) characterize transcriptomic changes induced by MeHg exposure in the female largemouth bass (LMB) hypothalamus under controlled laboratory conditions, (2) investigate the health and reproductive impacts of MeHg exposure on male and female largemouth bass (LMB) in the natural environment, and (3) identify MeHg-associated gene expression patterns in whole brain of female LMB from MeHg-contaminated habitats. The laboratory experiment was a single injection of 2.5 μg MeHg/g body weight for 96 h exposure. The field survey compared river systems in Florida, USA with comparably lower concentrations of MeHg (Wekiva, Santa Fe, and St. Johns Rivers) in fish and one river system with LMB that contained elevated concentrations of MeHg (St. Marys River). Microarray analysis was used to quantify transcriptomic responses to MeHg exposure. Although fish at the high-MeHg site did not show overt health or reproductive impairment, there were MeHg-responsive genes and pathways identified in the laboratory study that were also altered in fish from the high-MeHg site relative to fish at the low-MeHg sites. Gene network analysis suggested that MeHg regulated the expression targets of neuropeptide receptor and steroid signaling, as well as structural components of the cell. Disease-associated gene networks related to MeHg exposure, based upon expression data, included cerebellum ataxia, movement disorders, and hypercalcemia. Gene responses in the CNS are consistent with the documented neurotoxicological and neuroendocrine disrupting effects of MeHg in vertebrates. Published by Elsevier Inc.
Schroeder, Anthony L.; Martinovic-Weigelt, Dalma; Ankley, Gerald T.; Lee, Kathy E.; Garcia-Reyero, Natalia; Perkins, Edward J.; Schoenfuss, Heiko L.; Villeneuve, Daniel L.
2017-01-01
Evaluating potential adverse effects of complex chemical mixtures in the environment is challenging. One way to address that challenge is through more integrated analysis of chemical monitoring and biological effects data. In the present study, water samples from five locations near two municipal wastewater treatment plants in the St. Croix River basin, on the border of MN and WI, USA, were analyzed for 127 organic contaminants. Known chemical-gene interactions were used to develop site-specific knowledge assembly models (KAMs) and formulate hypotheses concerning possible biological effects associated with chemicals detected in water samples from each location. Additionally, hepatic gene expression data were collected for fathead minnows (Pimephales promelas) exposed in situ, for 12 d, at each location. Expression data from oligonucleotide microarrays were analyzed to identify functional annotation terms enriched among the differentially-expressed probes. The general nature of many of the terms made hypothesis formulation on the basis of the transcriptome-level response alone difficult. However, integrated analysis of the transcriptome data in the context of the site-specific KAMs allowed for evaluation of the likelihood of specific chemicals contributing to observed biological responses. Thirteen chemicals (atrazine, carbamazepine, metformin, thiabendazole, diazepam, cholesterol, p-cresol, phenytoin, omeprazole, ethyromycin, 17β-estradiol, cimetidine, and estrone), for which there was statistically significant concordance between occurrence at a site and expected biological response as represented in the KAM, were identified. While not definitive, the approach provides a line of evidence for evaluating potential cause-effect relationships between components of a complex mixture of contaminants and biological effects data, which can inform subsequent monitoring and investigation.
Schroeder, Anthony L; Martinović-Weigelt, Dalma; Ankley, Gerald T; Lee, Kathy E; Garcia-Reyero, Natalia; Perkins, Edward J; Schoenfuss, Heiko L; Villeneuve, Daniel L
2017-02-01
Evaluating potential adverse effects of complex chemical mixtures in the environment is challenging. One way to address that challenge is through more integrated analysis of chemical monitoring and biological effects data. In the present study, water samples from five locations near two municipal wastewater treatment plants in the St. Croix River basin, on the border of MN and WI, USA, were analyzed for 127 organic contaminants. Known chemical-gene interactions were used to develop site-specific knowledge assembly models (KAMs) and formulate hypotheses concerning possible biological effects associated with chemicals detected in water samples from each location. Additionally, hepatic gene expression data were collected for fathead minnows (Pimephales promelas) exposed in situ, for 12 d, at each location. Expression data from oligonucleotide microarrays were analyzed to identify functional annotation terms enriched among the differentially-expressed probes. The general nature of many of the terms made hypothesis formulation on the basis of the transcriptome-level response alone difficult. However, integrated analysis of the transcriptome data in the context of the site-specific KAMs allowed for evaluation of the likelihood of specific chemicals contributing to observed biological responses. Thirteen chemicals (atrazine, carbamazepine, metformin, thiabendazole, diazepam, cholesterol, p-cresol, phenytoin, omeprazole, ethyromycin, 17β-estradiol, cimetidine, and estrone), for which there was statistically significant concordance between occurrence at a site and expected biological response as represented in the KAM, were identified. While not definitive, the approach provides a line of evidence for evaluating potential cause-effect relationships between components of a complex mixture of contaminants and biological effects data, which can inform subsequent monitoring and investigation. Published by Elsevier Ltd.
Magnotta, Scot M; Gogarten, Johann Peter
2002-01-01
Background Vacuolar type H+-ATPases play a critical role in the maintenance of vacuolar homeostasis in plant cells. V-ATPases are also involved in plants' defense against environmental stress. This research examined the expression and regulation of the catalytic subunit of the vacuolar type H+-ATPase in Arabidopsis thaliana and the effect of environmental stress on multiple transcripts generated by this gene. Results Evidence suggests that subunit A of the vacuolar type H+-ATPase is encoded by a single gene in Arabidopsis thaliana. Genome blot analysis showed no indication of a second subunit A gene being present. The single gene identified was shown by whole RNA blot analysis to be transcribed in all organs of the plant. Subunit A was shown by sequencing the 3' end of multiple cDNA clones to exhibit multi site polyadenylation. Four different poly (A) tail attachment sites were revealed. Experiments were performed to determine the response of transcript levels for subunit A to environmental stress. A PCR based strategy was devised to amplify the four different transcripts from the subunit A gene. Conclusions Amplification of cDNA generated from seedlings exposed to cold, salt stress, and etiolation showed that transcript levels for subunit A of the vacuolar type H+-ATPase in Arabidopsis were responsive to stress conditions. Cold and salt stress resulted in a 2–4 fold increase in all four subunit A transcripts evaluated. Etiolation resulted in a slight increase in transcript levels. All four transcripts appeared to behave identically with respect to stress conditions tested with no significant differential regulation. PMID:11985780
Richter, Catherine A.; Martyniuk, Christopher J.; Annis, Mandy L.; Brumbaugh, William G.; Chasar, Lia C.; Denslow, Nancy D.; Tillitt, Donald E.
2014-01-01
Methyl-mercury (MeHg) is a potent neuroendocrine disruptor that impairs reproductive processes in fish. The objectives of this study were to (1) characterize transcriptomic changes induced by MeHg exposure in the female largemouth bass (LMB) hypothalamus under controlled laboratory conditions, (2) investigate the health and reproductive impacts of MeHg exposure on male and female largemouth bass (LMB) in the natural environment, and (3) identify MeHg-associated gene expression patterns in whole brain of female LMB from MeHg-contaminated habitats. The laboratory experiment was a single injection of 2.5 μg MeHg/g body weight for 96 h exposure. The field survey compared river systems in Florida, USA with comparably lower concentrations of MeHg (Wekiva, Santa Fe, and St. Johns Rivers) in fish and one river system with LMB that contained elevated concentrations of MeHg (St. Marys River). Microarray analysis was used to quantify transcriptomic responses to MeHg exposure. Although fish at the high-MeHg site did not show overt health or reproductive impairment, there were MeHg-responsive genes and pathways identified in the laboratory study that were also altered in fish from the high-MeHg site relative to fish at the low-MeHg sites. Gene network analysis suggested that MeHg regulated the expression targets of neuropeptide receptor and steroid signaling, as well as structural components of the cell. Disease-associated gene networks related to MeHg exposure, based upon expression data, included cerebellum ataxia, movement disorders, and hypercalcemia. Gene responses in the CNS are consistent with the documented neurotoxicological and neuroendocrine disrupting effects of MeHg in vertebrates.
Federal Register 2010, 2011, 2012, 2013, 2014
2010-11-10
... partners, the comparative study will be designed and conducted for specific sites during intervals of both...' analysis of these measures is included in the Response to Public Comment section. Research The Navy provides a significant amount of funding and support to marine research. In the past five years [[Page...
Motion and Marking in Reflective Practice: Artifacts, Autobiographical Narrative and Sexuality
ERIC Educational Resources Information Center
Risner, Doug
2017-01-01
This paper introduces a reflective methodology of the body as a resource for reflective practice based on an analysis of my personal response and experience of autobiographical narrative. It offers an approach in which the movements and markings of the body serve as important sites for collecting additional evidence of the daily practices that…
Renewable energy production is expected to increase significantly in the next 25 years. The U.S. Environmental Protection Agency (EPA) Office of Solid Waste and Emergency Response (OSWER) Center for Program Analysis (OCPA) has initiated the RE-Powering America's Land Initiative to demonstrate the enormous potential that contaminated land and mining sites provide for developing renewable energy in the U.S.
USDA-ARS?s Scientific Manuscript database
Marek’s disease virus, a highly cell-associated oncogenic 'alpha-herpesvirus, is the causative agent of a T cell lymphoma and neuropathic disease called Marek’s disease. The skin is the only anatomical site where infectious enveloped cell-free virions are produced and shed into the environment. Stud...
Laura Phillips-Mao; Susan M. Galatowitsch; Stephanie A. Snyder; Robert G. Haight
2016-01-01
Incorporating climate change into conservation decision-making at site and population scales is challenging due to uncertainties associated with localized climate change impacts and population responses to multiple interacting impacts and adaptation strategies. We explore the use of spatially explicit population models to facilitate scenario analysis, a conservation...
Base Redevelopment Planning for BRAC Sites
2006-05-01
or the private sector, also may supplement core staff responsibilities. Pro - fessional consultants may provide legal, planning, real estate...Opportunities, and Threats ( SWOT ) Analysis: An evaluation of a community’s economic, social, and physical environmental strengths, weaknesses, opportunities...in this area compare to those elsewhere? Forecasted changes in employment and population trends can be translated into pro - jected demand for housing
Military Hazardous Wastes: An Overview and Analysis.
1981-12-01
the soil as fertilizers or soil conditioners * Mining overburden returned to the mine site Utility wastes (fly ash, flue gas desulfurization sludge...19 3.3.2 What Is the Significance of Superfund to Military Wastes? ...... ............... 20 3.4 Toxic Substances Control Act...Hazardous Wastes From Current and Future Operations .... ......... 34 4.4 Organizational Responsibilities ... ............. .. 42 5. CONTROL TECHNOLOGY
Horstmann, Nicola; Sahasrabhojane, Pranoti; Yao, Hui; Su, Xiaoping; Shelburne, Samuel A
2017-09-15
Control of the virulence regulator/sensor kinase (CovRS) two-component system (TCS) serves as a model for investigating the impact of signaling pathways on the pathogenesis of Gram-positive bacteria. However, the molecular mechanisms by which CovR, an OmpR/PhoB family response regulator, controls virulence gene expression are poorly defined, partly due to the labile nature of its aspartate phosphorylation site. To better understand the regulatory effect of phosphorylated CovR, we generated the phosphorylation site mutant strain 10870-CovR-D53E, which we predicted to have a constitutive CovR phosphorylation phenotype. Interestingly, this strain showed CovR activity only for a subset of the CovR regulon, which allowed for classification of CovR-influenced genes into D53E-regulated and D53E-nonregulated groups. Inspection of the promoter sequences of genes belonging to each group revealed distinct promoter architectures with respect to the location and number of putative CovR-binding sites. Electrophoretic mobility shift analysis demonstrated that recombinant CovR-D53E protein retains its ability to bind promoter DNA from both CovR-D53E-regulated and -nonregulated groups, implying that factors other than mere DNA binding are crucial for gene regulation. In fact, we found that CovR-D53E is incapable of dimerization, a process thought to be critical to OmpR/PhoB family regulator function. Thus, our global analysis of CovR-D53E indicates dimerization-dependent and dimerization-independent modes of CovR-mediated repression, thereby establishing distinct mechanisms by which this critical regulator coordinates virulence gene expression. IMPORTANCE Streptococcus pyogenes causes a wide variety of diseases, ranging from superficial skin and throat infections to life-threatening invasive infections. To establish these various disease manifestations, Streptococcus pyogenes requires tightly coordinated production of its virulence factor repertoire. Here, the response regulator CovR plays a crucial role. As an OmpR/PhoB family member, CovR is activated by phosphorylation on a conserved aspartate residue, leading to protein dimerization and subsequent binding to operator sites. Our transcriptome analysis using the monomeric phosphorylation mimic mutant CovR-D53E broadens this general notion by revealing dimerization-independent repression of a subset of CovR-regulated genes. Combined with promoter analyses, these data suggest distinct mechanisms of CovR transcriptional control, which allow for differential expression of virulence genes in response to environmental cues. Copyright © 2017 American Society for Microbiology.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gałuszka, Agnieszka, E-mail: Agnieszka.Galuszka@ujk.edu.pl; Migaszewski, Zdzisław M.; Namieśnik, Jacek
The recent rapid progress in technology of field portable instruments has increased their applications in environmental sample analysis. These instruments offer a possibility of cost-effective, non-destructive, real-time, direct, on-site measurements of a wide range of both inorganic and organic analytes in gaseous, liquid and solid samples. Some of them do not require the use of reagents and do not produce any analytical waste. All these features contribute to the greenness of field portable techniques. Several stationary analytical instruments have their portable versions. The most popular ones include: gas chromatographs with different detectors (mass spectrometer (MS), flame ionization detector, photoionization detector),more » ultraviolet–visible and near-infrared spectrophotometers, X-ray fluorescence spectrometers, ion mobility spectrometers, electronic noses and electronic tongues. The use of portable instruments in environmental sample analysis gives a possibility of on-site screening and a subsequent selection of samples for routine laboratory analyses. They are also very useful in situations that require an emergency response and for process monitoring applications. However, quantification of results is still problematic in many cases. The other disadvantages include: higher detection limits and lower sensitivity than these obtained in laboratory conditions, a strong influence of environmental factors on the instrument performance and a high possibility of sample contamination in the field. This paper reviews recent applications of field portable instruments in environmental sample analysis and discusses their analytical capabilities. - Highlights: • Field portable instruments are widely used in environmental sample analysis. • Field portable instruments are indispensable for analysis in emergency response. • Miniaturization of field portable instruments reduces resource consumption. • In situ analysis is in agreement with green analytical chemistry principles. • Performance requirements in field analysis stimulate technological progress.« less
Besis, Athanasios; Tsolakidou, Alexandra; Balla, Dimitra; Samara, Constantini; Voutsa, Dimitra; Pantazaki, Anastasia; Choli-Papadopoulou, Theodora; Lialiaris, Theodore S
2017-11-01
Toxic organic substances and polar organic marker compounds, i.e. polychlorinated biphenyls (PCBs), organochlorine pesticides (OCPs), polybrominated diphenyl ethers (PBDEs), polycyclic aromatic hydrocarbons (PAHs) and their nitro-derivatives (N-PAHs), as well as dicarboxylic acids (DCAs) and sugars/sugar anhydrites (S/SAs) were analyzed in size-segregated PM samples (<0.49, 0.49-0.97, 0.97-3 and >3 μm) collected at two urban sites (urban traffic and urban background) during the cold and the warm season. The potential associations between the organic PM determinants and the adverse cellular effects (i.e. cytotoxicity, genotoxicity, DNA damage, oxidative DNA adduct formation, and inflammatory response) induced by the extractable organic matter (EOM) of PM, previously measured in Velali et al. (2016b), were investigated by bivariate correlations and Principal Component Analysis (PCA). Partial Least Square regression analysis (PLS) was also employed in order to identify the chemical classes mainly involved in the EOM-induced toxicological endpoints in the various particle size fractions. Results indicated that particle size range <0.49 μm was the major carrier of PM mass and organic compounds at both sites. All toxic organic compounds exhibited higher concentrations at the urban traffic site, except PCBs and OCPs that did not exhibit intra-urban variations. Conversely, wintertime levels of levoglucosan were significantly higher at the urban background site as a result of residential biomass burning. The PLS regression analysis allowed quite good prediction of the EOM-induced cytotoxicity and genotoxicity based on the determined organic chemical classes, particularly for the finest size fraction of PM. Nevertheless, it is expected that other chemical constituents, not determined here, also contribute to the measured toxicological responses. Copyright © 2017. Published by Elsevier Ltd.
Analysis of free online physician advice services.
Cohen, Raphael; Elhadad, Michael; Birk, Ohad
2013-01-01
Online Consumer Health websites are a major source of information for patients worldwide. We focus on another modality, online physician advice. We aim to evaluate and compare the freely available online expert physicians' advice in different countries, its scope and the type of content provided. Using automated methods for information retrieval and analysis, we compared consumer health portals from the US, Canada, the UK and Israel (WebMD,NetDoctor,AskTheDoctor and BeOK). The evaluated content was generated between 2002 and 2011. We analyzed the different sites, looking at the distribution of questions in the various health topics, answer lengths and content type. Answers could be categorized into longer broad-educational answers versus shorter patient-specific ones, with different physicians having personal preferences as to answer type. The Israeli website BeOK, providing 10 times the number of answers than in the other three health portals, supplied answers that are shorter on average than in the other websites. Response times in these sites may be rapid with 32% of the WebMD answers and 64% of the BeOK answers provided in less than 24 hours. The voluntary contribution model used by BeOK and WebMD enables generation of large numbers of physician expert answers at low cost, providing 50,000 and 3,500 answers per year, respectively. Unlike health information in online databases or advice and support in patient-forums, online physician advice provides qualified specialists' responses directly relevant to the questions asked. Our analysis showed that high numbers of expert answers could be generated in a timely fashion using a voluntary model. The length of answers varied significantly between the internet sites. Longer answers were associated with educational content while short answers were associated with patient-specific content. Standard site-specific guidelines for expert answers will allow for more desirable content (educational content) or better throughput (patient-specific content).
Franceschini, M.D.; Custer, Christine M.; Custer, T.W.; Reed, J.M.; Romero, L.M.
2008-01-01
We assayed baseline and stress-induced corticosterone concentrations from adult female and nestling tree swallows, Tachycineta bicolor, from New England, USA, sites with different levels of contamination with polychlorinated biphenyls (PCBs) and 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Corticosterone was compared over 2 years from a highly contaminated PCB site along the Housatonic River (Berkshire County, MA, USA), a midrange contaminated site upstream, and a reference site. Adult females (n = 29), sampled only in 2003, showed an inverted-U association with PCBs, with higher stress-induced corticosterone with midrange contamination than at the high-contamination site. In nestlings, stress-induced corticosterone was highest for the highly contaminated site compared with the other sites in 2003 (n = 53, 29 nests), with no difference among sites in 2004 (n = 93, 27 nests). In 2004, we began testing mechanisms underlying these changes in nestlings at the high- and low-PCB sites. Corticosterone response to dexamethasone injection (used to test negative feedback) was not different between sites, but stress-induced corticosterone was reduced at the contaminated site after adrenocorticotropin hormone injection (used to test adrenal responsiveness), suggesting an inhibited ability to mount a stress response. We also compared nestlings from a stretch of the Woonasquatucket River, Rhode Island, USA, heavily contaminated with TCDD (n = 80, 43 nests) with nestlings from an upstream site that had lower levels of TCDD and the Berkshire County reference site. Although there were no stress-induced differences, baseline corticosterone was lower at the higher TCDD site than at the reference site. Altogether these findings suggest that tree swallows chronically exposed to high PCB and TCDD levels exhibit altered baseline and stress-induced corticosterone responses, but the patterns of alteration might not be predictable. ?? 2008 SETAC.
Lentz, E.E.; Hapke, C.J.
2011-01-01
Antecedent geology plays a crucial role in determining the inner-shelf, nearshore, and onshore geomorphology observed in coastal systems. However, the influence of the geologic framework on a system is difficult to extract when evaluating responses to changes due to storms and anthropogenic modifications, and few studies have quantified the potential for these influences in dune/beach environments. This study evaluates topographic change to the dune/beach system at Fire Island, New York over a ten year period (1998-2008) at two sites representing eastern and western reaches of the island where morphology has been shown to vary. The sites are situated along swaths of coast eroding differentially and where the inner shelf geologic framework differs substantially. Fewer large storms occurred in the first half of the study period, compared with the later part of the study period which includes several severe and prolonged extratropical storms. Additionally, a major beach replenishment project was conducted at one of the study sites. Topographic data from LiDAR and RTK GPS surveys are used to construct high-resolution 3D surfaces, which are used to determine volumetric change and to extract 2D alongshore features and profiles for analysis. The study sites help to further characterize morphologic differences between eastern and western reaches of the island. The western site displays higher sand volumes, lower dunes, and a lower gradient profile slope when compared with the eastern site. In addition to these fundamental morphologic differences, the two sites also differ significantly in their response to coastal storms and in the fact that their replenishment histories are different. The replenished areas show reduced vulnerability to storms through minimal volume loss and shoreline accretion that should be considered when evaluating the response of replenished areas to episodic events. We propose that site-specific differences evident throughout the study period can be linked to alongshore variations in the framework geology of the system. Anthropogenic modifications may have intensified differences already inherent in the system. ?? 2010 Elsevier B.V.
WormBase ParaSite - a comprehensive resource for helminth genomics.
Howe, Kevin L; Bolt, Bruce J; Shafie, Myriam; Kersey, Paul; Berriman, Matthew
2017-07-01
The number of publicly available parasitic worm genome sequences has increased dramatically in the past three years, and research interest in helminth functional genomics is now quickly gathering pace in response to the foundation that has been laid by these collective efforts. A systematic approach to the organisation, curation, analysis and presentation of these data is clearly vital for maximising the utility of these data to researchers. We have developed a portal called WormBase ParaSite (http://parasite.wormbase.org) for interrogating helminth genomes on a large scale. Data from over 100 nematode and platyhelminth species are integrated, adding value by way of systematic and consistent functional annotation (e.g. protein domains and Gene Ontology terms), gene expression analysis (e.g. alignment of life-stage specific transcriptome data sets), and comparative analysis (e.g. orthologues and paralogues). We provide several ways of exploring the data, including genome browsers, genome and gene summary pages, text search, sequence search, a query wizard, bulk downloads, and programmatic interfaces. In this review, we provide an overview of the back-end infrastructure and analysis behind WormBase ParaSite, and the displays and tools available to users for interrogating helminth genomic data. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Valencia, A.; Ladah, L. B.
2016-02-01
The objective of this study was to quantify and compare the daily settlement rate of barnacle larvae of Chthamalus spp. at small spatial scales ( 1 km) at three sites with unique geomorphology. Simultaneously, water-column temperature, currents, and coastal winds were measured to detect potential physical transport mechanisms responsible for supply of planktonic larvae to the coast. Autocorrelation artifacts in the environmental and settlement time series were removed with the Autoregressive Integrated Moving Average (ARIMA) and their residuals were used to perform a Principal Component Analysis (PCA). This analysis was carried out to determine the independent modes of variability in the environmental forcing mechanisms that may explain the settlement patterns. We found synchronous settlement pulses occurring throughout the study. Settlement at the wave exposed site was only associated to the wind-forcing mode and not to internal waves, which had not been detected previously and was surprising, considering the strong semidiurnal internal tide at this site. Settlement at both the reef-bounded site and the inside-bay site associated to vertical isotherm displacements, thereby suggesting the importance of internal waves for supply-side ecology at these more southern sites. Our results suggest that a complex suite of factors may interact to result in larval supply at the same site, and that larval supply at nearby sites may be forced by different factors due to differences in geomorphology and/or bathymetry, explaining spatial heterogeneity often detected in larval supply and settlement.
2009-01-01
Background Bacillus anthracis, the etiologic agent of anthrax, has recently been used as an agent of bioterrorism. The innate immune system initially appears to contain the pathogen at the site of entry. Because the human alveolar macrophage (HAM) plays a key role in lung innate immune responses, studying the HAM response to B. anthracis is important in understanding the pathogenesis of the pulmonary form of this disease. Methods In this paper, the transcriptional profile of B. anthracis spore-treated HAM was compared with that of mock-infected cells, and differentially expressed genes were identified by Affymetrix microarray analysis. A portion of the results were verified by Luminex protein analysis. Results The majority of genes modulated by spores were upregulated, and a lesser number were downregulated. The differentially expressed genes were subjected to Ingenuity Pathway analysis, the Database for Annotation, Visualization and Integrated Discovery (DAVID) analysis, the Promoter Analysis and Interaction Network Toolset (PAINT) and Oncomine analysis. Among the upregulated genes, we identified a group of chemokine ligand, apoptosis, and, interestingly, keratin filament genes. Central hubs regulating the activated genes were TNF-α, NF-κB and their ligands/receptors. In addition to TNF-α, a broad range of cytokines was induced, and this was confirmed at the level of translation by Luminex multiplex protein analysis. PAINT analysis revealed that many of the genes affected by spores contain the binding site for c-Rel, a member of the NF-κB family of transcription factors. Other transcription regulatory elements contained in many of the upregulated genes were c-Myb, CP2, Barbie Box, E2F and CRE-BP1. However, many of the genes are poorly annotated, indicating that they represent novel functions. Four of the genes most highly regulated by spores have only previously been associated with head and neck and lung carcinomas. Conclusion The results demonstrate not only that TNF-α and NF-κb are key components of the innate immune response to the pathogen, but also that a large part of the mechanisms by which the alveolar macrophage responds to B. anthracis are still unknown as many of the genes involved are poorly annotated. PMID:19744333
Vukmir, Rade B
2004-03-01
There are many variables that can have an effect on survival in cardiopulmonary arrest. This study examined the effect of urban, suburban, or rural location on the outcome of prehospital cardiac arrest as a secondary end point in a study evaluating the effect of bicarbonate on survival. The proportion of survivors within a type of EMS provider system as well as response times were compared. This prospective, randomized, double-blind clinical intervention trial enrolled 874 prehospital cardiopulmonary arrest patients encountered by prehospital urban, suburban, and rural regional EMS area. Population density (patients per square mile) calculation allowed classification into urban (>2000/mi2), suburban (>400/mi2), and rural (0-399/mi2) systems. This group underwent standard advanced cardiac life support (ACLS) intervention with or without early empiric administration of bicarbonate in a 1-mEq/kg dose. A group of demographic, diagnostic, and therapeutic variables were analyzed for their effect on survival. Times were measured from collapse until onset of medical intervention and survival measured as the presence of ED vital signs on arrival. Data analysis used chi-squared with Pearson correlation for survivorship and Student t test comparisons for response times. The overall survival rate was approximately 13.9% (110 of 793), ranging from 9% rural, 14% for suburban, and 23% for urban sites for 372 patients (P=.007). Survival differences were associated with classification of arrest locale in this sample-best for urban, suburban, followed by rural sites. There was no difference in time to bystander cardiopulmonary resuscitation, but medical response time (basic life support) was decreased for suburban or urban sites, and intervention (ACLS) and transport times were decreased for suburban sites alone. Although response times were differentiated by location, they were not necessarily predictive of survival. Factors other than response time such as patient population or resuscitation skill could influence survival from cardiac arrest occurring in diverse prehospital service areas.
Genetic Basis for Variation in Wheat Grain Yield in Response to Varying Nitrogen Application
Mahjourimajd, Saba; Taylor, Julian; Sznajder, Beata; Timmins, Andy; Shahinnia, Fahimeh; Rengel, Zed; Khabaz-Saberi, Hossein; Kuchel, Haydn; Okamoto, Mamoru
2016-01-01
Nitrogen (N) is a major nutrient needed to attain optimal grain yield (GY) in all environments. Nitrogen fertilisers represent a significant production cost, in both monetary and environmental terms. Developing genotypes capable of taking up N early during development while limiting biomass production after establishment and showing high N-use efficiency (NUE) would be economically beneficial. Genetic variation in NUE has been shown previously. Here we describe the genetic characterisation of NUE and identify genetic loci underlying N response under different N fertiliser regimes in a bread wheat population of doubled-haploid lines derived from a cross between two Australian genotypes (RAC875 × Kukri) bred for a similar production environment. NUE field trials were carried out at four sites in South Australia and two in Western Australia across three seasons. There was genotype-by-environment-by-treatment interaction across the sites and also good transgressive segregation for yield under different N supply in the population. We detected some significant Quantitative Trait Loci (QTL) associated with NUE and N response at different rates of N application across the sites and years. It was also possible to identify lines showing positive N response based on the rankings of their Best Linear Unbiased Predictions (BLUPs) within a trial. Dissecting the complexity of the N effect on yield through QTL analysis is a key step towards elucidating the molecular and physiological basis of NUE in wheat. PMID:27459317
A site-directed mutagenesis analysis of tNOX functional domains
NASA Technical Reports Server (NTRS)
Chueh, Pin-Ju; Morre, Dorothy M.; Morre, D. James
2002-01-01
Constitutive NADH oxidase proteins of the mammalian cell surface exhibit two different activities, oxidation of hydroquinones (or NADH) and protein disulfide-thiol interchange which alternate to yield oscillatory patterns with period lengths of 24 min. A drug-responsive tNOX (tumor-associated NADH oxidase) has a period length of about 22 min. The tNOX cDNA has been cloned and expressed. These two proteins are representative of cycling oxidase proteins of the plant and animal cell surface. In this report, we describe a series of eight amino acid replacements in tNOX which, when expressed in Escherichia coli, were analyzed for enzymatic activity, drug response and period length. Replacement sites selected include six cysteines that lie within the processed plasma membrane (34 kDa) form of the protein, and amino acids located in putative drug and adenine nucleotide (NADH) binding domains. The latter, plus two of the cysteine replacements, resulted in a loss of enzymatic activity. The recombinant tNOX with the modified drug binding site retained activity but the activity was no longer drug-responsive. The four remaining cysteine replacements were of interest in that both activity and drug response were retained but the period length for both NADH oxidation and protein disulfide-thiol interchange was increased from 22 min to 36 or 42 min. The findings confirm the correctness of the drug and adenine nucleotide binding motifs within the tNOX protein and imply a potential critical role of cysteine residues in determining the period length.
Characterization and functional analysis of the Paralichthys olivaceus prdm1 gene promoter.
Li, Peizhen; Wang, Bo; Cao, Dandan; Liu, Yuezhong; Zhang, Quanqi; Wang, Xubo
2017-10-01
PR domain containing protein 1 (Prdm1) is a transcriptional repressor identified in various species and plays multiple important roles in immune response and embryonic development. However, little is known about the transcriptional regulation of the prdm1 gene. This study aims to characterize the promoter of Paralichthys olivaceus prdm1 (Po-prdm1) gene and determine the regulatory mechanism of Po-prdm1 expression. A 2000bp-long 5'-flanking region (translation initiation site designated as +1) of the Po-prdm1 gene was isolated and characterized. The regulatory elements in this fragment were then investigated and many putative transcription factor (TF) binding sites involved in immunity and multiple tissue development were identified. A 5'-deletion analysis was then conducted, and the ability of the deletion mutants to promote luciferase and green fluorescent protein (GFP) expression in a flounder gill cell line was examined. The results revealed that the minimal promoter is located in the region between -446 and -13bp, and the region between -1415 and -13bp enhanced the promoter activity. Site-directed mutation analysis was subsequently performed on the putative regulatory elements sites, and the results indicated that FOXP1, MSX and BCL6 binding sites play negative functional roles in the regulation of the Po-prdm1 expression in FG cells. In vivo analysis demonstrated that a GFP reporter gene containing 1.4kb-long promoter fragment (-1415/-13) was expressed in the head and trunk muscle fibres of transient transgenic zebrafish embryos. Our study provided the basic information for the exploration of Po-prdm1 regulation and expression. Copyright © 2017 Elsevier Inc. All rights reserved.
Harris, Peter R; Sillence, Elizabeth; Briggs, Pam
2011-07-27
How do people decide which sites to use when seeking health advice online? We can assume, from related work in e-commerce, that general design factors known to affect trust in the site are important, but in this paper we also address the impact of factors specific to the health domain. The current study aimed to (1) assess the factorial structure of a general measure of Web trust, (2) model how the resultant factors predicted trust in, and readiness to act on, the advice found on health-related websites, and (3) test whether adding variables from social cognition models to capture elements of the response to threatening, online health-risk information enhanced the prediction of these outcomes. Participants were asked to recall a site they had used to search for health-related information and to think of that site when answering an online questionnaire. The questionnaire consisted of a general Web trust questionnaire plus items assessing appraisals of the site, including threat appraisals, information checking, and corroboration. It was promoted on the hungersite.com website. The URL was distributed via Yahoo and local print media. We assessed the factorial structure of the measures using principal components analysis and modeled how well they predicted the outcome measures using structural equation modeling (SEM) with EQS software. We report an analysis of the responses of participants who searched for health advice for themselves (N = 561). Analysis of the general Web trust questionnaire revealed 4 factors: information quality, personalization, impartiality, and credible design. In the final SEM model, information quality and impartiality were direct predictors of trust. However, variables specific to eHealth (perceived threat, coping, and corroboration) added substantially to the ability of the model to predict variance in trust and readiness to act on advice on the site. The final model achieved a satisfactory fit: χ(2) (5) = 10.8 (P = .21), comparative fit index = .99, root mean square error of approximation = .052. The model accounted for 66% of the variance in trust and 49% of the variance in readiness to act on the advice. Adding variables specific to eHealth enhanced the ability of a model of trust to predict trust and readiness to act on advice.
Harris, Peter R; Briggs, Pam
2011-01-01
Background How do people decide which sites to use when seeking health advice online? We can assume, from related work in e-commerce, that general design factors known to affect trust in the site are important, but in this paper we also address the impact of factors specific to the health domain. Objective The current study aimed to (1) assess the factorial structure of a general measure of Web trust, (2) model how the resultant factors predicted trust in, and readiness to act on, the advice found on health-related websites, and (3) test whether adding variables from social cognition models to capture elements of the response to threatening, online health-risk information enhanced the prediction of these outcomes. Methods Participants were asked to recall a site they had used to search for health-related information and to think of that site when answering an online questionnaire. The questionnaire consisted of a general Web trust questionnaire plus items assessing appraisals of the site, including threat appraisals, information checking, and corroboration. It was promoted on the hungersite.com website. The URL was distributed via Yahoo and local print media. We assessed the factorial structure of the measures using principal components analysis and modeled how well they predicted the outcome measures using structural equation modeling (SEM) with EQS software. Results We report an analysis of the responses of participants who searched for health advice for themselves (N = 561). Analysis of the general Web trust questionnaire revealed 4 factors: information quality, personalization, impartiality, and credible design. In the final SEM model, information quality and impartiality were direct predictors of trust. However, variables specific to eHealth (perceived threat, coping, and corroboration) added substantially to the ability of the model to predict variance in trust and readiness to act on advice on the site. The final model achieved a satisfactory fit: χ2 5 = 10.8 (P = .21), comparative fit index = .99, root mean square error of approximation = .052. The model accounted for 66% of the variance in trust and 49% of the variance in readiness to act on the advice. Conclusions Adding variables specific to eHealth enhanced the ability of a model of trust to predict trust and readiness to act on advice. PMID:21795237
Federal Register 2010, 2011, 2012, 2013, 2014
2012-05-25
... Environmental Response, Compensation, and Liability Act for the Wabash Environmental Technologies Site AGENCY...)(1) agreement with 21 parties for the Wabash Environmental Technologies Superfund Site. SUMMARY: In... concerning the Wabash Environmental Technologies hazardous waste site in Terre Haute, Indiana (the ``Site...
Channel response to sediment release: insights from a paired analysis of dam removal
Collins, Mathias J.; Snyder, Noah P.; Boardman, Graham; Banks, William S.; Andrews, Mary; Baker, Matthew E.; Conlon, Maricate; Gellis, Allen; McClain, Serena; Miller, Andrew; Wilcock, Peter
2017-01-01
Dam removals with unmanaged sediment releases are good opportunities to learn about channel response to abruptly increased bed material supply. Understanding these events is important because they affect aquatic habitats and human uses of floodplains. A longstanding paradigm in geomorphology holds that response rates to landscape disturbance exponentially decay through time. However, a previous study of the Merrimack Village Dam (MVD) removal on the Souhegan River in New Hampshire, USA, showed that an exponential function poorly described the early geomorphic response. Erosion of impounded sediments there was two-phased. We had an opportunity to quantitatively test the two-phase response model proposed for MVD by extending the record there and comparing it with data from the Simkins Dam removal on the Patapsco River in Maryland, USA. The watershed sizes are the same order of magnitude (102 km2), and at both sites low-head dams were removed (~3–4 m) and ~65 000 m3 of sand-sized sediments were discharged to low-gradient reaches. Analyzing four years of repeat morphometry and sediment surveys at the Simkins site, as well as continuous discharge and turbidity data, we observed the two-phase erosion response described for MVD. In the early phase, approximately 50% of the impounded sediment at Simkins was eroded rapidly during modest flows. After incision to base level and widening, a second phase began when further erosion depended on floods large enough to go over bank and access impounded sediments more distant from the newly-formed channel. Fitting functional forms to the data for both sites, we found that two-phase exponential models with changing decay constants fit the erosion data better than single-phase models. Valley width influences the two-phase erosion responses upstream, but downstream responses appear more closely related to local gradient, sediment re-supply from the upstream impoundments, and base flows.
Effects of Barometric Fluctuations on Well Water-Level Measurements and Aquifer Test Data
DOE Office of Scientific and Technical Information (OSTI.GOV)
Spane, Frank A.
1999-12-16
This report examines the effects of barometric fluctuations on well water-level measurements and evaluates adjustment and removal methods for determining areal aquifer head conditions and aquifer test analysis. Two examples of Hanford Site unconfined aquifer tests are examined that demonstrate baro-metric response analysis and illustrate the predictive/removal capabilities of various methods for well water-level and aquifer total head values. Good predictive/removal characteristics were demonstrated with best corrective results provided by multiple-regression deconvolution methods.
Landscape of the PARKIN-dependent ubiquitylome in response to mitochondrial depolarization.
Sarraf, Shireen A; Raman, Malavika; Guarani-Pereira, Virginia; Sowa, Mathew E; Huttlin, Edward L; Gygi, Steven P; Harper, J Wade
2013-04-18
The PARKIN ubiquitin ligase (also known as PARK2) and its regulatory kinase PINK1 (also known as PARK6), often mutated in familial early-onset Parkinson's disease, have central roles in mitochondrial homeostasis and mitophagy. Whereas PARKIN is recruited to the mitochondrial outer membrane (MOM) upon depolarization via PINK1 action and can ubiquitylate porin, mitofusin and Miro proteins on the MOM, the full repertoire of PARKIN substrates--the PARKIN-dependent ubiquitylome--remains poorly defined. Here we use quantitative diGly capture proteomics (diGly) to elucidate the ubiquitylation site specificity and topology of PARKIN-dependent target modification in response to mitochondrial depolarization. Hundreds of dynamically regulated ubiquitylation sites in dozens of proteins were identified, with strong enrichment for MOM proteins, indicating that PARKIN dramatically alters the ubiquitylation status of the mitochondrial proteome. Using complementary interaction proteomics, we found depolarization-dependent PARKIN association with numerous MOM targets, autophagy receptors, and the proteasome. Mutation of the PARKIN active site residue C431, which has been found mutated in Parkinson's disease patients, largely disrupts these associations. Structural and topological analysis revealed extensive conservation of PARKIN-dependent ubiquitylation sites on cytoplasmic domains in vertebrate and Drosophila melanogaster MOM proteins. These studies provide a resource for understanding how the PINK1-PARKIN pathway re-sculpts the proteome to support mitochondrial homeostasis.
Surface horizontal logging for uranium and its decay products at a Superfund site
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gadeken, L.L.; Madigan, W.P.
1995-12-31
The United States Department of Energy (DOE) is now responsible for the environmental restoration and management of a number of sites where nuclear activities occurred during the Cold War. The DOE sponsored an Expedited Site Characterization performed by Ames Laboratory at the St. Louis (Missouri) Airport Site (SLAPS) during August--September, 1994. Uranium processing occurred at SLAPS during the Cold War and there is now significant residual radioactive contamination. Surveys associated the highest radioactivity levels at SLAPS with the ``barium cake`` (AJ-4) waste areas. This paper reports on continuous gamma ray spectroscopy measurements to identify the emitting, isotopes and to quantifymore » the amount of radioactivity present for each. An oilfield wireline gamma ray spectrometry sonde (the Compensated Spectral Natural Gamma instrument) was adapted to perform horizontal measurements with the detector section 3 ft above the soil surface. The CSNG detector is a 2-in.-diameter by 12-in.-long sodium iodide crystal. The spectrometry data are processed by a weighted-least-squares algorithm that incorporates whole spectrum responses for the radioisotopes of interest. The radioactivities are reported in pCi/g units for each isotope, and a depth-of-emission estimate is found by Compton-downscattering spectral shape analysis.« less
Impediments to predicting site response: Seismic property estimation and modeling simplifications
Thompson, E.M.; Baise, L.G.; Kayen, R.E.; Guzina, B.B.
2009-01-01
We compare estimates of the empirical transfer function (ETF) to the plane SH-wave theoretical transfer function (TTF) within a laterally constant medium for invasive and noninvasive estimates of the seismic shear-wave slownesses at 13 Kiban-Kyoshin network stations throughout Japan. The difference between the ETF and either of the TTFs is substantially larger than the difference between the two TTFs computed from different estimates of the seismic properties. We show that the plane SH-wave TTF through a laterally homogeneous medium at vertical incidence inadequately models observed amplifications at most sites for both slowness estimates, obtained via downhole measurements and the spectral analysis of surface waves. Strategies to improve the predictions can be separated into two broad categories: improving the measurement of soil properties and improving the theory that maps the 1D soil profile onto spectral amplification. Using an example site where the 1D plane SH-wave formulation poorly predicts the ETF, we find a more satisfactory fit to the ETF by modeling the full wavefield and incorporating spatially correlated variability of the seismic properties. We conclude that our ability to model the observed site response transfer function is limited largely by the assumptions of the theoretical formulation rather than the uncertainty of the soil property estimates.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Prendez, M.; Ortiz, J.L.; Cortes, E.
In Chile, the State Public Health Office (Ministerio de Salud Publica) is responsible for pollution control and for air quality. This office has been monitoring only toxic gases and total suspended particulate matter. The present work is the first study in Chile designed to determine trace elements and their concentrations in particulate matter in the air. By use of enrichment factors, 25 trace elements were classified according to natural or anthropogenic origin. There were two sampling periods: July (winter) and September (spring) 1976. Four sites were studied, located about 6 km north, south, west and east of downtown Santiago. Themore » south, north and west sites are urban and 55 m above sea level. The east site is suburban and approximately 270 m higher than the others. Twenty-four-hour samples were collected on Whatman-41 cellulose filter paper, in a modified stainless steel Buchner funnel. Approximately 10 m/sup 3/ were used at the urban sites and 200 m/sup 3/ at the suburban site. Instrumental neutron activation analysis (INAA) was used as the analytical technique.« less
Izhar, Lior; Adamson, Britt; Ciccia, Alberto; Lewis, Jedd; Pontano-Vaites, Laura; Leng, Yumei; Liang, Anthony C.; Westbrook, Thomas F.; Harper, J. Wade; Elledge, Stephen J.
2015-01-01
Localization to sites of DNA damage is a hallmark of DNA damage response (DDR) proteins. To identify new DDR factors, we screened epitope-tagged proteins for localization to sites of chromatin damaged by UV laser microirradiation and found >120 proteins that localize to damaged chromatin. These include the BAF tumor suppressor complex and the ALS candidate protein TAF15. TAF15 contains multiple domains that bind damaged chromatin in a PARP-dependent manner, suggesting a possible role as glue that tethers multiple PAR chains together. Many positives were transcription factors and >70% of randomly tested transcription factors localized to sites of DNA damage and approximately 90% were PARP-dependent for localization. Mutational analyses showed that localization to damaged chromatin is DNA-binding domain-dependent. By examining Hoechst staining patterns at damage sites, we see evidence of chromatin decompaction that is PARP-dependent. We propose that PARP-regulated chromatin remodeling at sites of damage allows transient accessibility of DNA-binding proteins. PMID:26004182
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hunsberger, R.; Mosey, G.
2014-04-01
The U.S. Environmental Protection Agency (EPA) Office of Solid Waste and Emergency Response, in accordance with the RE-Powering America's Lands initiative, engaged the U.S. Department of Energy's (DOE) National Renewable Energy Laboratory (NREL) to conduct feasibility studies to assess the viability of developing renewable energy generating facilities on contaminated sites. This site, in Limestone, Maine -- formerly the location of the Loring Air Force Base but now owned by the Aroostook Band of Micmac -- was selected for the potential to produce heating pellets from woody feedstock. Biomass was chosen as the renewable energy resource to evaluate based on abundantmore » woody-biomass resources available in the area. NREL also evaluates potential savings from converting existing Micmac property from oil-fired heating to pellet heating.« less
Integrating Building Information Modeling and Health and Safety for Onsite Construction
Ganah, Abdulkadir; John, Godfaurd A.
2014-01-01
Background Health and safety (H&S) on a construction site can either make or break a contractor, if not properly managed. The usage of Building Information Modeling (BIM) for H&S on construction execution has the potential to augment practitioner understanding of their sites, and by so doing reduce the probability of accidents. This research explores BIM usage within the construction industry in relation to H&S communication. Methods In addition to an extensive literature review, a questionnaire survey was conducted to gather information on the embedment of H&S planning with the BIM environment for site practitioners. Results The analysis of responses indicated that BIM will enhance the current approach of H&S planning for construction site personnel. Conclusion From the survey, toolbox talk will have to be integrated with the BIM environment, because it is the predominantly used procedure for enhancing H&S issues within construction sites. The advantage is that personnel can visually understand H&S issues as work progresses during the toolbox talk onsite. PMID:25830069
Hydraulic properties of three types of glacial deposits in Ohio
Strobel, M.L.
1993-01-01
The effects of thickness, grain size, fractures, weathering, and atmosphericconditions on vertical ground-water flow in glacial deposits were studied at three sites that represent ground moraine, end moraine, and lacustrine depositional environments. Vertical hydraulic conductivities computed from pumped-well tests were 3.24 x 10-1 to 6.47 x 10-1 ft/d (feet per day) at the site representing end moraine and 1.17 ft/d at the site representing lacustrine deposits. Analysis of test data for the ground moraine site did not yield estimates of hydraulic conductivities, but did indicate that ground water flows through the total thickness of deposits in response to discharge from a lower gravel unit. Vertical hydraulic conductivities computed from pumped-well tests of nested wells and data from drill-core analyses indicate that fractures affect the migration of ground water downward through the glacial deposits at these sites. Flow through glacial deposits is complex; it is controlled by fractures, gram-size distribution, clay content, thickness, and degree of weathering, and atmospheric conditions.
Site characterization and site response in Port-au-Prince, Haiti
Hough, Susan E.; Yong, Alan K.; Altidor, Jean Robert; Anglade, Dieuseul; Given, Douglas D.; Mildor, Saint-Louis
2011-01-01
Waveform analysis of aftershocks of the Mw7.0 Haiti earthquake of 12 January 2010 reveals amplification of ground motions at sites within the Cul de Sac valley in which Port-au-Prince is situated. Relative to ground motions recorded at a hard-rock reference site, peak acceleration values are amplified by a factor of approximately 1.8 at sites on low-lying Mio-Pliocene deposits in central Port-au-Prince and by a factor of approximately 2.5–3 on a steep foothill ridge in the southern Port-au-Prince metropolitan region. The observed amplitude, predominant periods, variability, and polarization of amplification are consistent with predicted topographic amplification by a steep, narrow ridge. A swath of unusually high damage in this region corresponds with the extent of the ridge where high weak-motion amplifications are observed. We use ASTER (Advanced Spaceborne Thermal Emission and Reflection Radiometer) imagery to map local geomorphology, including characterization of both near-surface and of small-scale topographic structures that correspond to zones of inferred amplification.
Kayen, Robert E.; Barnhardt, Walter A.; Ashford, Scott; Rollins, Kyle
2000-01-01
A ground penetrating radar (GPR) experiment at the Treasure Island Test Site [TILT] was performed to non-destructively image the soil column for changes in density prior to, and following, a liquefaction event. The intervening liquefaction was achieved by controlled blasting. A geotechnical borehole radar technique was used to acquire high-resolution 2-D radar velocity data. This method of non-destructive site characterization uses radar trans-illumination surveys through the soil column and tomographic data manipulation techniques to construct radar velocity tomograms, from which averaged void ratios can be derived at 0.25 - 0.5m pixel footprints. Tomograms of void ratio were constructed through the relation between soil porosity and dielectric constant. Both pre- and post-blast tomograms were collected and indicate that liquefaction related densification occurred at the site. Volumetric strains estimated from the tomograms correlate well with the observed settlement at the site. The 2-D imagery of void ratio can serve as high-resolution data layers for numerical site response analysis.
Integrating building information modeling and health and safety for onsite construction.
Ganah, Abdulkadir; John, Godfaurd A
2015-03-01
Health and safety (H&S) on a construction site can either make or break a contractor, if not properly managed. The usage of Building Information Modeling (BIM) for H&S on construction execution has the potential to augment practitioner understanding of their sites, and by so doing reduce the probability of accidents. This research explores BIM usage within the construction industry in relation to H&S communication. In addition to an extensive literature review, a questionnaire survey was conducted to gather information on the embedment of H&S planning with the BIM environment for site practitioners. The analysis of responses indicated that BIM will enhance the current approach of H&S planning for construction site personnel. From the survey, toolbox talk will have to be integrated with the BIM environment, because it is the predominantly used procedure for enhancing H&S issues within construction sites. The advantage is that personnel can visually understand H&S issues as work progresses during the toolbox talk onsite.
Emotions and beliefs after a disaster: a comparative analysis of Haiti and Indonesia.
O'Connell, Erin; Abbott, Roger P; White, Robert S
2017-10-01
A number of studies have examined emotional and belief responses following a disaster, yet there has been limited comparative analysis of responses to disasters in different places. This paper reviews the results of 366 questionnaires that evaluated key emotional and belief concepts in Haiti after the earthquake on 12 January 2010 (n=212) and in Indonesia after the earthquake in Yogyakarta on 27 May 2006 (n=154). The results indicate significant differences between the responses in the two settings, particularly in relation to feelings of impunity, self-blame for the disaster, regret about pre-earthquake behaviour, and a sense of justice in the world. Furthermore, the impacts of age, education, and gender on responses also were different in the two case study sites. Overall, the results suggest that understanding the cultural, religious, and social contexts of different disaster locales is important in comprehending the emotions and beliefs that manifest themselves in the wake of a major disaster. © 2017 The Author(s). Disasters © Overseas Development Institute, 2017.
Tretto, P H W; Fabris, V; Cericato, G O; Sarkis-Onofre, R; Bacchi, A
2018-04-24
This systematic review evaluates the influence of the instrument used for the implant site preparation on the bone-implant interface. Any type of clinical or animal study were searched for in MEDLINE/PubMed, ISI Web of Science, and SciVerse Scopus. Two independent reviewers screened titles/abstracts of articles and the full-text of potentially eligible studies. Comparisons of bone to implant contact and crestal bone loss were estimated using pairwise meta-analysis. Twenty-nine studies met the inclusion criteria. The instruments identified in the articles were conventional drills (CDs), osteotome (OT), piezoelectric device (PD), Er:YAG LASER (LS) and osseodensification drills (ODs). The meta-analysis on bone to implant contact suggested no difference between CDs and other techniques and the meta-analysis on crestal bone loss suggested no difference between CDs and PD. The survival of implants in sites prepared with CDs vs. OT or PD presented no significant differences. The use of PD provided lower inflammatory response and earlier bone formation when compared to CDs. ODs provided significant biomechanical improvement in comparison to CDs. LS did not provide any relevant improvement in comparison to CDs or PD. The influence of the instrument used for implant site preparation depended on the property evaluated. Copyright © 2018 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.
Mesoscale barrier estuary behaviour in response to sea-level rise, storms and sediment supply.
NASA Astrophysics Data System (ADS)
Hamilton, Christine; Kirby, Jason; Plater, Andrew; Lane, Timothy
2017-04-01
Future vulnerability and resilience of coastal landscapes, and their associated communities, infrastructure and nature conservation interests, is of increasing concern due to the combined effects of climate change and sea-level rise. The Suffolk coast, UK, characterised by gravel barrier beaches and a spit feature of international geomorphological interest, has changed dramatically. However, existing Holocene research in this respect is limited. Sediments preserved within the enclosed valleys and back-barrier wetlands of Suffolk provide an opportunity to improve understanding of the complex mesoscale (years-decades-centuries) behaviour of coastlines and their geomorphological response to changes in natural forcing. This research aims to reconstruct Holocene changes in coastline behaviour to develop reconstructions of coastal evolution relating to changes in relative sea level, sediment supply and storm incidence. Litho- and bio-stratigraphic analysis (sedimentology, particle size, and diatom analysis) has been undertaken on three marsh and wetland sites in a 5 km section between Walberswick and Dunwich. Though intra-site sediment variability is high, a consistent pattern of interbedded intertidal and freshwater units separated by transitional marsh deposits is seen at all sites. Diatom analysis from two sites (Westwood Marsh and Oldtown Marsh) indicates increased marine and brackish conditions across the organic-minerogenic transitions. The diatom assemblage from Great Dingle Hill, a more seaward site, is dominated by brackish species, with an increase in marine conditions across the main organic-minerogenic stratigraphic transition. Freshwater and salt tolerant species are minimal in this assemblage, indicating a constant saltwater input. The onset of peat deposition has been dated to 6950-6790 cal. BP at the base of the Westwood Marsh sequence. These results contrast with existing research from the Blyth estuary (5 km north) where peat deposition was dated to 7714-7479 cal. BP. Submitted radiocarbon analysis will provide further chronological constraint for the timing of the major coastal behavioural changes identified from the analysis. Combined, these results indicate that this section of the Suffolk coast has been subject to periodic opening and closing during the Holocene. Though currently unresolved, longshore sediment supply, high magnitude-low frequency storm events, sea-level change, and the position of offshore banks are likely causal mechanisms for these changes. These results will improve understanding of the long term (Holocene) natural signal of coastal change and are significant given that the regional Shoreline Management Plan has recommended managed realignment for this section of the Suffolk coast.
40 CFR 300.410 - Removal site evaluation.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 40 Protection of Environment 27 2010-07-01 2010-07-01 false Removal site evaluation. 300.410... PLAN Hazardous Substance Response § 300.410 Removal site evaluation. (a) A removal site evaluation... evaluation of a release identified for possible CERCLA response pursuant to § 300.415 shall, as appropriate...
NASA Astrophysics Data System (ADS)
Chapman, Martin Colby
1998-12-01
The design earthquake selection problem is fundamentally probabilistic. Disaggregation of a probabilistic model of the seismic hazard offers a rational and objective approach that can identify the most likely earthquake scenario(s) contributing to hazard. An ensemble of time series can be selected on the basis of the modal earthquakes derived from the disaggregation. This gives a useful time-domain realization of the seismic hazard, to the extent that a single motion parameter captures the important time-domain characteristics. A possible limitation to this approach arises because most currently available motion prediction models for peak ground motion or oscillator response are essentially independent of duration, and modal events derived using the peak motions for the analysis may not represent the optimal characterization of the hazard. The elastic input energy spectrum is an alternative to the elastic response spectrum for these types of analyses. The input energy combines the elements of amplitude and duration into a single parameter description of the ground motion that can be readily incorporated into standard probabilistic seismic hazard analysis methodology. This use of the elastic input energy spectrum is examined. Regression analysis is performed using strong motion data from Western North America and consistent data processing procedures for both the absolute input energy equivalent velocity, (Vsbea), and the elastic pseudo-relative velocity response (PSV) in the frequency range 0.5 to 10 Hz. The results show that the two parameters can be successfully fit with identical functional forms. The dependence of Vsbea and PSV upon (NEHRP) site classification is virtually identical. The variance of Vsbea is uniformly less than that of PSV, indicating that Vsbea can be predicted with slightly less uncertainty as a function of magnitude, distance and site classification. The effects of site class are important at frequencies less than a few Hertz. The regression modeling does not resolve significant effects due to site class at frequencies greater than approximately 5 Hz. Disaggregation of general seismic hazard models using Vsbea indicates that the modal magnitudes for the higher frequency oscillators tend to be larger, and vary less with oscillator frequency, than those derived using PSV. Insofar as the elastic input energy may be a better parameter for quantifying the damage potential of ground motion, its use in probabilistic seismic hazard analysis could provide an improved means for selecting earthquake scenarios and establishing design earthquakes for many types of engineering analyses.
Collins, Brian D.; Bedford, David; Corbett, Skye C.; Fairley, Helen C.; Cronkite-Ratcliff, Collin
2016-01-01
Process dynamics in fluvial-based dryland environments are highly complex with fluvial, aeolian, and alluvial processes all contributing to landscape change. When anthropogenic activities such as dam-building affect fluvial processes, the complexity in local response can be further increased by flood- and sediment-limiting flows. Understanding these complexities is key to predicting landscape behavior in drylands and has important scientific and management implications, including for studies related to paleoclimatology, landscape ecology evolution, and archaeological site context and preservation. Here we use multi-temporal LiDAR surveys, local weather data, and geomorphological observations to identify trends in site change throughout the 446-km-long semi-arid Colorado River corridor in Grand Canyon, Arizona, USA, where archaeological site degradation related to the effects of upstream dam operation is a concern. Using several site case studies, we show the range of landscape responses that might be expected from concomitant occurrence of dam-controlled fluvial sand bar deposition, aeolian sand transport, and rainfall-induced erosion. Empirical rainfall-erosion threshold analyses coupled with a numerical rainfall–runoff–soil erosion model indicate that infiltration-excess overland flow and gullying govern large-scale (centimeter- to decimeter-scale) landscape changes, but that aeolian deposition can in some cases mitigate gully erosion. Whereas threshold analyses identify the normalized rainfall intensity (defined as the ratio of rainfall intensity to hydraulic conductivity) as the primary factor governing hydrologic-driven erosion, assessment of false positives and false negatives in the dataset highlight topographic slope as the next most important parameter governing site response. Analysis of 4+ years of high resolution (four-minute) weather data and 75+ years of low resolution (daily) climate records indicates that dryland erosion is dependent on short-term, storm-driven rainfall intensity rather than cumulative rainfall, and that erosion can occur outside of wet seasons and even wet years. These results can apply to other similar semi-arid landscapes where process complexity may not be fully understood.
The Binomial Model in Fluctuation Analysis of Quantal Neurotransmitter Release
Quastel, D. M. J.
1997-01-01
The mathematics of the binomial model for quantal neurotransmitter release is considered in general terms, to explore what information might be extractable from statistical aspects of data. For an array of N statistically independent release sites, each with a release probability p, the compound binomial always pertains, with , p′ ≡ 1 - var(m)/ (1 + cvp2) and n′ ≡ 2. Unless n′ is invariant with ambient conditions or stimulation paradigms, the simple binomial (cvp = 0) is untenable and n′ is neither N nor the number of “active” sites or sites with a quantum available. At each site p = popA, where po is the output probability if a site is “eligible” or “filled” despite previous quantal discharge, and pA (eligibility probability) depends at least on the replenishment rate, po, and interstimulus time. Assuming stochastic replenishment, a simple algorithm allows calculation of the full statistical composition of outputs for any hypothetical combinations of po's and refill rates, for any stimulation paradigm and spontaneous release. A rise in n′ (reduced cvp) tends to occur whenever po varies widely between sites, with a raised stimulation frequency or factors tending to increase po's. Unlike
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, Todd H.
Partial oxidation studies were conducted over a series of Ni-substituted lanthanum hexaaluminate catalysts, La 0.9Ni yAl 11.95-yO 19-δ (y = 1.0, 0.8, 0.4 and 0.2) to evaluate the effect of higher alkane, sulfur and polycyclic aromatic hydrocarbons using tetradecane (n-C 14), dibenzothiophene (DBT) and 1-methylnapthalene (1-MN) as model reaction compounds. XRD showed the Ni-substituted lanthanum hexaaluminate catalysts to have magnetoplumbite structure. Lattice parameters along the a,b-axis are shown to increase systematically with increasing Ni substitution. The unit cell is also shown to increase systematically with Ni substitution providing clear evidence of Ni 2+ substitution for Al 3+ in the lanthanummore » hexaaluminate lattice. Catalytic activity and product yields were evaluated by temperature programmed surface reaction (TPSR) using n-C 14 partial oxidation as a probe reaction. Between 750 and 900°C, H 2 and CO yields are shown to increase with increasing Ni surface sites while aromatic and olefin yields are shown to decrease. Step response experiments were performed to show the effect of 0.1 wt% 1-MN addition on catalytic activity and performance. As expected, at lower Ni substitution, thermal chemistry predominates suggesting fewer available active Ni sites. At the conditions tested, the site blocking effect is shown to be reversible at all levels of Ni substitution. Similar catalytic behaviors are observed with step response experiments to 50 ppm w/w dibenzothiophene (DBT) where site blocking is shown to produce a concomitantly greater effect on catalytic performance and active site occlusion with catalysts that have less active sites. The step response to DBT is also observed to be reversible. Post analysis of the used catalysts shows that coke deposition is greater on the catalysts with lower Ni substitution.« less
Gardner, Todd H.
2018-02-07
Partial oxidation studies were conducted over a series of Ni-substituted lanthanum hexaaluminate catalysts, La 0.9Ni yAl 11.95-yO 19-δ (y = 1.0, 0.8, 0.4 and 0.2) to evaluate the effect of higher alkane, sulfur and polycyclic aromatic hydrocarbons using tetradecane (n-C 14), dibenzothiophene (DBT) and 1-methylnapthalene (1-MN) as model reaction compounds. XRD showed the Ni-substituted lanthanum hexaaluminate catalysts to have magnetoplumbite structure. Lattice parameters along the a,b-axis are shown to increase systematically with increasing Ni substitution. The unit cell is also shown to increase systematically with Ni substitution providing clear evidence of Ni 2+ substitution for Al 3+ in the lanthanummore » hexaaluminate lattice. Catalytic activity and product yields were evaluated by temperature programmed surface reaction (TPSR) using n-C 14 partial oxidation as a probe reaction. Between 750 and 900°C, H 2 and CO yields are shown to increase with increasing Ni surface sites while aromatic and olefin yields are shown to decrease. Step response experiments were performed to show the effect of 0.1 wt% 1-MN addition on catalytic activity and performance. As expected, at lower Ni substitution, thermal chemistry predominates suggesting fewer available active Ni sites. At the conditions tested, the site blocking effect is shown to be reversible at all levels of Ni substitution. Similar catalytic behaviors are observed with step response experiments to 50 ppm w/w dibenzothiophene (DBT) where site blocking is shown to produce a concomitantly greater effect on catalytic performance and active site occlusion with catalysts that have less active sites. The step response to DBT is also observed to be reversible. Post analysis of the used catalysts shows that coke deposition is greater on the catalysts with lower Ni substitution.« less
Understanding student complaints in the service learning pedagogy.
Rosing, Howard; Reed, Susan; Ferrari, Joseph R; Bothne, Nancy J
2010-12-01
This study draws upon student evaluations across 3 years of service learning (SL) courses at a large, urban, faith-based university identifying issues of greatest concern to students. Analysis of qualitative responses revealed perspectives on the limits, pitfalls, and barriers to successful SL student work in the community replicated over the 3 year timeframe. Over 2,200 written responses were coded and tested for reliability for each of 3 years. The top three comments SL students were most likely to express included: (1) concern about their placement in the community, for example, that sites were not prepared or that further goal-setting, communication and training by the university was necessary; (2) that the university's choice of sites may have been ill considered; and, (3) that there were problems with time and scheduling. Ongoing assessment of students' perspectives on their placement experience identifies practices that can enhance their learning and contributions toward building stronger communities.
Ness, Genevieve Lynn; Sheehan, Amy Heck; Snyder, Margie E
2014-01-01
OBJECTIVE To characterize students' views and opinions of professionalism on popular social media sites and compare responses about social media behavior among students in different groups. DESIGN Cross-sectional survey. SETTING Four colleges of pharmacy in midwestern United States. PARTICIPANTS 516 graduating student pharmacists. INTERVENTIONS Online survey with open-ended questions. MAIN OUTCOME MEASURES Qualitative analysis of responses and themes. RESULTS A total of 212 student pharmacists completed surveys (41% response rate). Mean (± SD) age was 25.2 ± 4.6 years, and 72% of respondents were women. Major overarching themes identified in the qualitative analysis were separation of personal and professional lives, how accountability for actions should vary by severity, and the extent of representation of the students' character on social media. CONCLUSION Identified themes provided important insights into the ways in which student pharmacists view social media and use this widely accessible means of personal communication.
NASA Astrophysics Data System (ADS)
Chen, X.; Abercrombie, R. E.; Pennington, C.
2017-12-01
Recorded seismic waveforms include contributions from earthquake source properties and propagation effects, leading to long-standing trade-off problems between site/path effects and source effects. With near-field recordings, the path effect is relatively small, so the trade-off problem can be simplified to between source and site effects (commonly referred as "kappa value"). This problem is especially significant for small earthquakes where the corner frequencies are within similar ranges of kappa values, so direct spectrum fitting often leads to systematic biases due to corner frequency and magnitude. In response to the significantly increased seismicity rate in Oklahoma, several local networks have been deployed following major earthquakes: the Prague, Pawnee and Fairview earthquakes. Each network provides dense observations within 20 km surrounding the fault zone, recording tens of thousands of aftershocks between M1 to M3. Using near-field recordings in the Prague area, we apply a stacking approach to separate path/site and source effects. The resulting source parameters are consistent with parameters derived from ground motion and spectral ratio methods from other studies; they exhibit spatial coherence within the fault zone for different fault patches. We apply these source parameter constraints in an analysis of kappa values for stations within 20 km of the fault zone. The resulting kappa values show significantly reduced variability compared to those from direct spectral fitting without constraints on the source spectrum; they are not biased by earthquake magnitudes. With these improvements, we plan to apply the stacking analysis to other local arrays to analyze source properties and site characteristics. For selected individual earthquakes, we will also use individual-pair empirical Green's function (EGF) analysis to validate the source parameter estimations.
On the use of haplotype phylogeny to detect disease susceptibility loci
Bardel, Claire; Danjean, Vincent; Hugot, Jean-Pierre; Darlu, Pierre; Génin, Emmanuelle
2005-01-01
Background The cladistic approach proposed by Templeton has been presented as promising for the study of the genetic factors involved in common diseases. This approach allows the joint study of multiple markers within a gene by considering haplotypes and grouping them in nested clades. The idea is to search for clades with an excess of cases as compared to the whole sample and to identify the mutations defining these clades as potential candidate disease susceptibility sites. However, the performance of this approach for the study of the genetic factors involved in complex diseases has never been studied. Results In this paper, we propose a new method to perform such a cladistic analysis and we estimate its power through simulations. We show that under models where the susceptibility to the disease is caused by a single genetic variant, the cladistic test is neither really more powerful to detect an association nor really more efficient to localize the susceptibility site than an individual SNP testing. However, when two interacting sites are responsible for the disease, the cladistic analysis greatly improves the probability to find the two susceptibility sites. The impact of the linkage disequilibrium and of the tree characteristics on the efficiency of the cladistic analysis are also discussed. An application on a real data set concerning the CARD15 gene and Crohn disease shows that the method can successfully identify the three variant sites that are involved in the disease susceptibility. Conclusion The use of phylogenies to group haplotypes is especially interesting to pinpoint the sites that are likely to be involved in disease susceptibility among the different markers identified within a gene. PMID:15904492
Fish Assemblage Response to a Small Dam Removal in the Eightmile River System, Connecticut, USA
NASA Astrophysics Data System (ADS)
Poulos, Helen M.; Miller, Kate E.; Kraczkowski, Michelle L.; Welchel, Adam W.; Heineman, Ross; Chernoff, Barry
2014-11-01
We examined the effects of the Zemko Dam removal on the Eightmile River system in Salem, Connecticut, USA. The objective of this research was to quantify spatiotemporal variation in fish community composition in response to small dam removal. We sampled fish abundance over a 6-year period (2005-2010) to quantify changes in fish assemblages prior to dam removal, during drawdown, and for three years following dam removal. Fish population dynamics were examined above the dam, below the dam, and at two reference sites by indicator species analysis, mixed models, non-metric multidimensional scaling, and analysis of similarity. We observed significant shifts in fish relative abundance over time in response to dam removal. Changes in fish species composition were variable, and they occurred within 1 year of drawdown. A complete shift from lentic to lotic fishes failed to occur within 3 years after the dam was removed. However, we did observe increases in fluvial and transition (i.e., pool head, pool tail, or run) specialist fishes both upstream and downstream from the former dam site. Our results demonstrate the importance of dam removal for restoring river connectivity for fish movement. While the long-term effects of dam removal remain uncertain, we conclude that dam removals can have positive benefits on fish assemblages by enhancing river connectivity and fluvial habitat availability.
Fish assemblage response to a small dam removal in the Eightmile River system, Connecticut, USA.
Poulos, Helen M; Miller, Kate E; Kraczkowski, Michelle L; Welchel, Adam W; Heineman, Ross; Chernoff, Barry
2014-11-01
We examined the effects of the Zemko Dam removal on the Eightmile River system in Salem, Connecticut, USA. The objective of this research was to quantify spatiotemporal variation in fish community composition in response to small dam removal. We sampled fish abundance over a 6-year period (2005-2010) to quantify changes in fish assemblages prior to dam removal, during drawdown, and for three years following dam removal. Fish population dynamics were examined above the dam, below the dam, and at two reference sites by indicator species analysis, mixed models, non-metric multidimensional scaling, and analysis of similarity. We observed significant shifts in fish relative abundance over time in response to dam removal. Changes in fish species composition were variable, and they occurred within 1 year of drawdown. A complete shift from lentic to lotic fishes failed to occur within 3 years after the dam was removed. However, we did observe increases in fluvial and transition (i.e., pool head, pool tail, or run) specialist fishes both upstream and downstream from the former dam site. Our results demonstrate the importance of dam removal for restoring river connectivity for fish movement. While the long-term effects of dam removal remain uncertain, we conclude that dam removals can have positive benefits on fish assemblages by enhancing river connectivity and fluvial habitat availability.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-11-29
... (FEHB) Open Season Express Interactive Voice Response (IVR) System and Open Season Web site AGENCY: U.S... Benefits (FEHB) Open Season Express Interactive Voice Response (IVR) System and the Open Season Web site... Season Express Interactive Voice Response (IVR) System, and the Open Season Web site, Open Season Online...
Effects of urbanization on benthic macroinvertebrate communities in streams, Anchorage, Alaska
Ourso, Robert T.
2001-01-01
The effect of urbanization on stream macroinvertebrate communities was examined by using data gathered during a 1999 reconnaissance of 14 sites in the Municipality of Anchorage, Alaska. Data collected included macroinvertebrate abundance, water chemistry, and trace elements in bed sediments. Macroinvertebrate relative-abundance data were edited and used in metric and index calculations. Population density was used as a surrogate for urbanization. Cluster analysis (unweighted-paired-grouping method) using arithmetic means of macroinvertebrate presence-absence data showed a well-defined separation between urbanized and nonurbanized sites as well as extracted sites that did not cleanly fall into either category. Water quality in Anchorage generally declined with increasing urbanization (population density). Of 59 variables examined, 31 correlated with urbanization. Local regression analysis extracted 11 variables that showed a significant impairment threshold response and 6 that showed a significant linear response. Significant biological variables for determining the impairment threshold in this study were the Margalef diversity index, Ephemeroptera-Plecoptera-Trichoptera taxa richness, and total taxa richness. Significant thresholds were observed in the water-chemistry variables conductivity, dissolved organic carbon, potassium, and total dissolved solids. Significant thresholds in trace elements in bed sediments included arsenic, iron, manganese, and lead. Results suggest that sites in Anchorage that have ratios of population density to road density greater than 70, storm-drain densities greater than 0.45 miles per square mile, road densities greater than 4 miles per square mile, or population densities greater than 125-150 persons per square mile may require further monitoring to determine if the stream has become impaired. This population density is far less than the 1,000 persons per square mile used by the U.S. Census Bureau to define an urban area.
Effects of industrial and investigator disturbance on Arctic-nesting geese
Meixell, Brandt W.; Flint, Paul L.
2017-01-01
Oil and gas development on the Arctic Coastal Plain (ACP) of Alaska, USA may have effects on Arctic-nesting birds. To estimate effects of industrial activity and investigator disturbance on avian productivity, we monitored nests of greater white-fronted geese (Anser albifrons) with digital cameras and periodic nest visits during 2013–2014 at 2 sites on the ACP. A disturbed site was adjacent to human-made infrastructure and industrial clean-up activities initiated at the onset of the study and a control site was >2 km from sources of industrial disturbance. We assessed variation in estimates of incubation constancy, nest survival, and predator behavior relative to site, year, and distance from industrial activity using nest photographs obtained at 1-minute intervals. We compared analysis of hourly nest survival informed by intensive monitoring with cameras to analysis of daily nest survival informed by traditional nest visit data obtained at intervals of 5–7 days to assess how method and time scale of sampling affect ecological inference. Geese in both sites exhibited high levels of nest attendance and initiated incubation breaks less than once per day. Observer-caused incubation breaks associated with nest visits ( = 37.8 min) were longer than other types of incubation breaks ( = 8.7 min), demonstrating a differential response by nesting geese to direct human encroachment versus indirect vehicular and aircraft traffic. During both years, geese were absent from nests more frequently in the disturbed ( = 0.9 breaks/day) than control ( = 0.6 breaks/day) site, and this break frequency was slightly higher for nests closer to industrial activity. In the year with high rates of depredation, nest survival was positively related to distance from industrial activity and abandoned infrastructure, consistent with predictions of industry-caused effects. This relationship, however, was not evident in the year with reduced predation pressure, likely because of annual variation in arctic fox (Vulpes lagopus) behavior. Analysis of nest survival probability informed by camera data allowed for detection of detailed patterns of variation that were not supported when using only visit data for the same nests. Observer visits were responsible for reductions of 7–35% in nest survival probability, highlighting the importance of minimizing, and controlling for, observer effects in studies of avian productivity. Indirect vehicular and aircraft disturbance posed less risk to nest survival than direct encroachment by observers at nest sites. Therefore, effects of industrial activities on avian productivity in the Arctic can be minimized through practices that limit direct encounters with nests.
NASA Astrophysics Data System (ADS)
Farrugia, Daniela; Galea, Pauline; D'Amico, Sebastiano; Paolucci, Enrico
2016-04-01
It is well known that earthquake damage at a particular site depends on the source, the path that the waves travel through and the local geology. The latter is capable of amplifying and changing the frequency content of the incoming seismic waves. In regions of sparse or no strong ground motion records, like Malta (Central Mediterranean), ground motion simulations are used to obtain parameters for purposes of seismic design and analysis. As an input to ground motion simulations, amplification functions related to the shallow subsurface are required. Shear-wave velocity profiles of several sites on the Maltese islands were obtained using the Horizontal-to-Vertical Spectral Ratio (H/V), the Extended Spatial Auto-Correlation (ESAC) technique and the Genetic Algorithm. The sites chosen were all characterised by a layer of Blue Clay, which can be up to 75 m thick, underlying the Upper Coralline Limestone, a fossiliferous coarse grained limestone. This situation gives rise to a velocity inversion. Available borehole data generally extends down till the top of the Blue Clay layer therefore the only way to check the validity of the modelled shear-wave velocity profile is through the thickness of the topmost layer. Surface wave methods are characterised by uncertainties related to the measurements and the model used for interpretation. Moreover the inversion procedure is also highly non-unique. Such uncertainties are not commonly included in site response analysis. Yet, the propagation of uncertainties from the extracted dispersion curves to inversion solutions can lead to significant differences in the simulations (Boaga et al., 2011). In this study, a series of sensitivity analyses will be presented with the aim of better identifying those stratigraphic properties which can perturb the ground motion simulation results. The stochastic one-dimensional site response analysis algorithm, Extended Source Simulation (EXSIM; Motazedian and Atkinson, 2005), was used to perform these analyses. The amplification functions were extracted using the programme SITE_AMP (Boore, 2003), which computes amplifications based on the square root of the effective seismic impedance. Sensitivity indices were obtained by changing two parameters (thickness and shear-wave velocity) of the different layers while keeping the others constant. Additional analyses were carried out by producing various profiles within specified boundaries which are able to fit the experimental data. The analyses also show the important role that the shear-wave velocity profiles play in ground motion simulations. The results obtained highlight the importance of the correct knowledge of both the properties of the Upper Coralline Limestone and the Blue Clay, especially the Blue Clay thickness.
Marrus, Natasha; Faughn, Carley; Shuman, Jeremy; Petersen, Steve E; Constantino, John N; Povinelli, Daniel J; Pruett, John R
2011-05-01
Comparative studies of social responsiveness, an ability that is impaired in autism spectrum disorders, can inform our understanding of both autism and the cognitive architecture of social behavior. Because there is no existing quantitative measure of social responsiveness in chimpanzees, we generated a quantitative, cross-species (human-chimpanzee) social responsiveness measure. We translated the Social Responsiveness Scale (SRS), an instrument that quantifies human social responsiveness, into an analogous instrument for chimpanzees. We then retranslated this "Chimpanzee SRS" into a human "Cross-Species SRS" (XSRS). We evaluated three groups of chimpanzees (n = 29) with the Chimpanzee SRS and typical and human children with autism spectrum disorder (ASD; n = 20) with the XSRS. The Chimpanzee SRS demonstrated strong interrater reliability at the three sites (ranges for individual ICCs: 0.534 to 0.866; mean ICCs: 0.851 to 0.970). As has been observed in human beings, exploratory principal components analysis of Chimpanzee SRS scores supports a single factor underlying chimpanzee social responsiveness. Human subjects' XSRS scores were fully concordant with their SRS scores (r = 0.976, p = .001) and distinguished appropriately between typical and ASD subjects. One chimpanzee known for inappropriate social behavior displayed a significantly higher score than all other chimpanzees at its site, demonstrating the scale's ability to detect impaired social responsiveness in chimpanzees. Our initial cross-species social responsiveness scale proved reliable and discriminated differences in social responsiveness across (in a relative sense) and within (in a more objectively quantifiable manner) human beings and chimpanzees. Copyright © 2011 American Academy of Child and Adolescent Psychiatry. Published by Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Finsinger, Walter; Dos Santos, Thibaut; McKey, Doyle
2013-07-01
Variation of stomatal frequency (stomatal density and stomatal index) includes genetically-based, potentially-adaptive variation, and variation due to phenotypic plasticity, the degree of which may be fundamental to the ability to maintain high water-use efficiency and thus to deal with environmental change. We analysed stomatal frequency and morphology (pore length, pore width) in leaves from several individuals from nine populations of four sub-species of the Leonardoxa africana complex. The dataset represents a hierarchical sampling wherein factors are nested within each level (leaves in individuals, individuals in sites, etc.), allowing estimation of the contribution of different levels to overall variation, using variance-component analysis. SI showed significant variation among sites ("site" is largely confounded with "sub-species"), being highest in the sub-species localized in the highest-elevation site. However, most of the observed variance was accounted for at intra-site and intra-individual levels. This variance could reflect great phenotypic plasticity, presumably in response to highly local variation in micro-environmental conditions.
Gao, Lei; Hailu, Atakelty
2018-02-01
We develop and use an empirically based model, which integrates fishing behaviour and a coral reef system, to evaluate outcomes from site closure strategies to manage the effects of recreational fishing. The model is designed to estimate management effects in complex settings with two-way feedback effects (between fishing and ecosystem dynamics) as well as spillover effects where the closure of a site (or sites) leads to the redistribution of fishing effort. An iconic coral reef system is used as a case study. The results demonstrate that some site closure strategies provide little incremental benefits over less stringent approaches. They also show that some strategies targeting more sites are actually inferior to more limited strategies, demonstrating that, in the analysis of complex problems involving feedback effects and substitutions, there is little substitute for the use of empirically based and sound modelling as the basis for informed conservation decision making and stakeholder consultation. These findings have direct relevance not only for policies aimed at improving recreational fishing management but also for securing the supply of marine ecosystem services. Copyright © 2017 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Xu, M.; Hoffman, F. M.
2016-12-01
The El Niño Southern Oscillation (ENSO) is an important interannual climate variability and has significant consequences and impacts on the global biosphere. The responses of vegetation to ENSO are highly heterogeneous and generally depend on the biophysical and biochemical characteristics associated with model plant functional types (PFTs). The modeled biogeochemical variables from Earth System Models (ESMs) are generally grid averages consisting of several PFTs within a gridcell, which will lead to difficulties in directly comparing them with site observations and large uncertainties in studying their responses to large scale climate variability. In this study, we conducted a transient ENSO simulation for the previoustwo decades from 1995 to 2020 using the DOE ACME v0.3 model. It has a comprehensive terrestrial biogeochemistry model that is fully coupled with a sophisticated atmospheric model with an advanced spectral element dynamical core. The model was driven by the NOAA optimum interpolation sea surface temperature (SST) for contemporary years and CFS v2 nine-month seasonal predicted and reconstructed SST for future years till to 2020. We saved the key biogeochemical variables in the subgrid PFT patches and compared them with site observations directly. Furthermore, we studied the biogeochemical responses of terrestrial vegetation to two largest ENSO events (1997-1998 and 2015-2016) for different PFTs. Our results show that it is useful and meaningful to compare and analyze model simulations in subgrid patches. The comparison and analysis not only gave us the details of responses of terrestrial ecosystem to global climate variability under changing climate, but also the insightful view on the model performance on the PFT level.
Mazzoni, C; Santori, F; Saliola, M; Falcone, C
2000-01-01
KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p.
Launch Vehicle Control Center Architectures
NASA Technical Reports Server (NTRS)
Watson, Michael D.; Epps, Amy; Woodruff, Van; Vachon, Michael Jacob; Monreal, Julio; Williams, Randall; McLaughlin, Tom
2014-01-01
This analysis is a survey of control center architectures of the NASA Space Launch System (SLS), United Launch Alliance (ULA) Atlas V and Delta IV, and the European Space Agency (ESA) Ariane 5. Each of these control center architectures have similarities in basic structure, and differences in functional distribution of responsibilities for the phases of operations: (a) Launch vehicles in the international community vary greatly in configuration and process; (b) Each launch site has a unique processing flow based on the specific configurations; (c) Launch and flight operations are managed through a set of control centers associated with each launch site, however the flight operations may be a different control center than the launch center; and (d) The engineering support centers are primarily located at the design center with a small engineering support team at the launch site.
Poli, Daniele; DeMarse, Thomas B; Wheeler, Bruce C; Brewer, Gregory J
2017-07-01
CA3 and dentate gyrus (DG) neurons are cultured in two-chamber devices on multi-electrode arrays (MEAs) and connected via micro-tunnels. In order to evoke time-locked activity, paired-pulse stimulation is applied to 22 different sites and repeated 25 times in each well in 5 MEA co-cultures and results compared to CA3-CA3 and DG-DG networks homologous controls. In these hippocampal sub-regions, we focus on the mechanisms underpinning a network's ability to decode the identity of site specific stimulation from analysis of evoked network responses using a support vector machine classifier. Our results indicate that a pool of CA3 neurons is able to reliably decode the identity of DG stimulation site information.
Formation of RNA oligomers on montmorillonite: site of catalysis
NASA Technical Reports Server (NTRS)
Ertem, G.; Ferris, J. P.
1998-01-01
Certain montmorillonites catalyze the self condensation of the 5'-phosphorimidazolide of nucleosides in pH 8 aqueous electrolyte solutions at ambient temperatures leading to formation of RNA oligomers. In order to establish the nature of the sites on montmorillonite responsible for this catalytic activity, oligomerization reactions were run with montmorillonites which had been selectively modified (I) at the edges by (a) fluoride treatment, (b) silylation, (c) metaphosphate treatment of the anion exchange sites (II) in the interlayer by (a) saturation with quaternary alkylammonium ions of increasing size, (b) aluminum polyoxo cations. High pressure liquid chromatography, HPLC, analysis of condensation products for their chain lengths and yields indicated that modification at the edges did not affect the catalytic activity to a significant extent, while blocking the interlayer strongly inhibited product formation.
NASA Astrophysics Data System (ADS)
Soltani, Mohsen; Mauder, Matthias; Laux, Patrick; Kunstmann, Harald
2017-07-01
The temporal multiscale variability of the surface heat fluxes is assessed by the analysis of the turbulent heat and moisture fluxes using the eddy covariance (EC) technique at the TERrestrial ENvironmental Observatories (TERENO) prealpine region. The fast and slow response variables from three EC sites located at Fendt, Rottenbuch, and Graswang are gathered for the period of 2013 to 2014. Here, the main goals are to characterize the multiscale variations and drivers of the turbulent fluxes, as well as to quantify the energy balance closure (EBC) and analyze the possible reasons for the lack of EBC at the EC sites. To achieve these goals, we conducted a principal component analysis (PCA) and a climatological turbulent flux footprint analysis. The results show significant differences in the mean diurnal variations of the sensible heat (H) and latent heat (LE) fluxes, because of variations in the solar radiation, precipitation patterns, soil moisture, and the vegetation fraction throughout the year. LE was the main consumer of net radiation. Based on the first principal component (PC1), the radiation and temperature components with a total mean contribution of 29.5 and 41.3%, respectively, were found to be the main drivers of the turbulent fluxes at the study EC sites. A general lack of EBC is observed, where the energy imbalance values amount 35, 44, and 35% at the Fendt, Rottenbuch, and Graswang sites, respectively. An average energy balance ratio (EBR) of 0.65 is obtained in the region. The best closure occurred in the afternoon peaking shortly before sunset with a different pattern and intensity between the study sites. The size and shape of the annual mean half-hourly turbulent flux footprint climatology was analyzed. On average, 80% of the flux footprint was emitted from a radius of approximately 250 m around the EC stations. Moreover, the overall shape of the flux footprints was in good agreement with the prevailing wind direction for all three TERENO EC sites.
Accredited hand surgery fellowship Web sites: analysis of content and accessibility.
Trehan, Samir K; Morrell, Nathan T; Akelman, Edward
2015-04-01
To assess the accessibility and content of accredited hand surgery fellowship Web sites. A list of all accredited hand surgery fellowships was obtained from the online database of the American Society for Surgery of the Hand (ASSH). Fellowship program information on the ASSH Web site was recorded. All fellowship program Web sites were located via Google search. Fellowship program Web sites were analyzed for accessibility and content in 3 domains: program overview, application information/recruitment, and education. At the time of this study, there were 81 accredited hand surgery fellowships with 169 available positions. Thirty of 81 programs (37%) had a functional link on the ASSH online hand surgery fellowship directory; however, Google search identified 78 Web sites. Three programs did not have a Web site. Analysis of content revealed that most Web sites contained contact information, whereas information regarding the anticipated clinical, research, and educational experiences during fellowship was less often present. Furthermore, information regarding past and present fellows, salary, application process/requirements, call responsibilities, and case volume was frequently lacking. Overall, 52 of 81 programs (64%) had the minimal online information required for residents to independently complete the fellowship application process. Hand fellowship program Web sites could be accessed either via the ASSH online directory or Google search, except for 3 programs that did not have Web sites. Although most fellowship program Web sites contained contact information, other content such as application information/recruitment and education, was less frequently present. This study provides comparative data regarding the clinical and educational experiences outlined on hand fellowship program Web sites that are of relevance to residents, fellows, and academic hand surgeons. This study also draws attention to various ways in which the hand surgery fellowship application process can be made more user-friendly and efficient. Copyright © 2015 American Society for Surgery of the Hand. Published by Elsevier Inc. All rights reserved.
Mirus, Benjamin B.; Nimmo, J.R.
2013-01-01
The impact of preferential flow on recharge and contaminant transport poses a considerable challenge to water-resources management. Typical hydrologic models require extensive site characterization, but can underestimate fluxes when preferential flow is significant. A recently developed source-responsive model incorporates film-flow theory with conservation of mass to estimate unsaturated-zone preferential fluxes with readily available data. The term source-responsive describes the sensitivity of preferential flow in response to water availability at the source of input. We present the first rigorous tests of a parsimonious formulation for simulating water table fluctuations using two case studies, both in arid regions with thick unsaturated zones of fractured volcanic rock. Diffuse flow theory cannot adequately capture the observed water table responses at both sites; the source-responsive model is a viable alternative. We treat the active area fraction of preferential flow paths as a scaled function of water inputs at the land surface then calibrate the macropore density to fit observed water table rises. Unlike previous applications, we allow the characteristic film-flow velocity to vary, reflecting the lag time between source and deep water table responses. Analysis of model performance and parameter sensitivity for the two case studies underscores the importance of identifying thresholds for initiation of film flow in unsaturated rocks, and suggests that this parsimonious approach is potentially of great practical value.
Hypoxia induces mucin expression and secretion in human bronchial epithelial cells.
Zhou, Xiangdong; Tu, Jing; Li, Qi; Kolosov, Victor P; Perelman, Juliy M
2012-12-01
The study objective was to investigate the role of hypoxia-inducible factor 1 (HIF-1) in the transcriptional activation of MUC5AC in human bronchial epithelial (HBE) 16 cells under hypoxia conditions and the effect of hypoxia on expression and secretion of MUC5AC. Cells were incubated in hypoxia medium. Serial deletions or mutations of the MUC5AC promoter were cloned in the reporter pGL3-basic plasmid (Promega Biotech Co, Ltd, Beijing, China). These reporter plasmids were cotransfected with HIF-1α small interfering RNA. Hypoxia markedly increased the level of MUC5AC secretion and the transcriptional activity of MUC5AC promoters. Western blot analysis showed that HIF-1α and MUC5AC proteins were strongly increased after HBE16 cells were exposed to hypoxic conditions. Treatment of HBE16 cells with HIF-1α inhibitor (YC-1) or HIF-1α small interfering RNA significantly inhibited the expression of HIF-1α and MUC5AC, and the secretion of MUC5AC. Depletion of the promoter sequence did not reduce the MUC5AC promoter activity to hypoxia. Luciferase assay indicated that HRE in the MUC5AC promoter was in the region from -120 to +54. Promoter sequence analysis showed that 1 HRE site at -65 plays an important role in hypoxia activation of the MUC5AC. The inactivation of the HRE site using site-directed mutagenesis led to the complete loss of induction by hypoxia, which further confirmed the key role of the HRE site. MUC5AC expression and secretion are upregulated in response to hypoxia. The HRE site at -65 in the MUC5AC promoter and the HIF-1α are the major regulators for the cellular response against hypoxia in human bronchial epithelial cells. Copyright © 2012 Mosby, Inc. All rights reserved.
Activation of Ftz-F1-Responsive Genes through Ftz/Ftz-F1 Dependent Enhancers
Field, Amanda; Xiang, Jie; Anderson, W. Ray; Graham, Patricia; Pick, Leslie
2016-01-01
The orphan nuclear receptor Ftz-F1 is expressed in all somatic nuclei in Drosophila embryos, but mutations result in a pair-rule phenotype. This was explained by the interaction of Ftz-F1 with the homeodomain protein Ftz that is expressed in stripes in the primordia of segments missing in either ftz-f1 or ftz mutants. Ftz-F1 and Ftz were shown to physically interact and coordinately activate the expression of ftz itself and engrailed by synergistic binding to composite Ftz-F1/Ftz binding sites. However, attempts to identify additional target genes on the basis of Ftz-F1/ Ftz binding alone has met with only limited success. To discern rules for Ftz-F1 target site selection in vivo and to identify additional target genes, a microarray analysis was performed comparing wildtype and ftz-f1 mutant embryos. Ftz-F1-responsive genes most highly regulated included engrailed and nine additional genes expressed in patterns dependent on both ftz and ftz-f1. Candidate enhancers for these genes were identified by combining BDTNP Ftz ChIP-chip data with a computational search for Ftz-F1 binding sites. Of eight enhancer reporter genes tested in transgenic embryos, six generated expression patterns similar to the corresponding endogenous gene and expression was lost in ftz mutants. These studies identified a new set of Ftz-F1 targets, all of which are co-regulated by Ftz. Comparative analysis of enhancers containing Ftz/Ftz-F1 binding sites that were or were not bona fide targets in vivo suggested that GAF negatively regulates enhancers that contain Ftz/Ftz-F1 binding sites but are not actually utilized. These targets include other regulatory factors as well as genes involved directly in morphogenesis, providing insight into how pair-rule genes establish the body pattern. PMID:27723822
Meter scale variation in shrub dominance and soil moisture structure Arctic arthropod communities
Hansen, Oskar Liset Pryds; Bowden, Joseph J.; Treier, Urs A.; Normand, Signe; Høye, Toke
2016-01-01
The Arctic is warming at twice the rate of the rest of the world. This impacts Arctic species both directly, through increased temperatures, and indirectly, through structural changes in their habitats. Species are expected to exhibit idiosyncratic responses to structural change, which calls for detailed investigations at the species and community level. Here, we investigate how arthropod assemblages of spiders and beetles respond to variation in habitat structure at small spatial scales. We sampled transitions in shrub dominance and soil moisture between three different habitats (fen, dwarf shrub heath, and tall shrub tundra) at three different sites along a fjord gradient in southwest Greenland, using yellow pitfall cups. We identified 2,547 individuals belonging to 47 species. We used species richness estimation, indicator species analysis and latent variable modeling to examine differences in arthropod community structure in response to habitat variation at local (within site) and regional scales (between sites). We estimated species responses to the environment by fitting species-specific generalized linear models with environmental covariates. Species assemblages were segregated at the habitat and site level. Each habitat hosted significant indicator species, and species richness and diversity were significantly lower in fen habitats. Assemblage patterns were significantly linked to changes in soil moisture and vegetation height, as well as geographic location. We show that meter-scale variation among habitats affects arthropod community structure, supporting the notion that the Arctic tundra is a heterogeneous environment. To gain sufficient insight into temporal biodiversity change, we require studies of species distributions detailing species habitat preferences. PMID:27478709
NASA Astrophysics Data System (ADS)
Bora, Sanjay; Scherbaum, Frank; Kuehn, Nicolas; Stafford, Peter; Edwards, Benjamin
2016-04-01
The current practice of deriving empirical ground motion prediction equations (GMPEs) involves using ground motions recorded at multiple sites. However, in applications like site-specific (e.g., critical facility) hazard ground motions obtained from the GMPEs are need to be adjusted/corrected to a particular site/site-condition under investigation. This study presents a complete framework for developing a response spectral GMPE, within which the issue of adjustment of ground motions is addressed in a manner consistent with the linear system framework. The present approach is a two-step process in which the first step consists of deriving two separate empirical models, one for Fourier amplitude spectra (FAS) and the other for a random vibration theory (RVT) optimized duration (Drvto) of ground motion. In the second step the two models are combined within the RVT framework to obtain full response spectral amplitudes. Additionally, the framework also involves a stochastic model based extrapolation of individual Fourier spectra to extend the useable frequency limit of the empirically derived FAS model. The stochastic model parameters were determined by inverting the Fourier spectral data using an approach similar to the one as described in Edwards and Faeh (2013). Comparison of median predicted response spectra from present approach with those from other regional GMPEs indicates that the present approach can also be used as a stand-alone model. The dataset used for the presented analysis is a subset of the recently compiled database RESORCE-2012 across Europe, the Middle East and the Mediterranean region.
The Human Skin Microbiome Associates with the Outcome of and Is Influenced by Bacterial Infection
van Rensburg, Julia J.; Lin, Huaiying; Gao, Xiang; Toh, Evelyn; Fortney, Kate R.; Ellinger, Sheila; Zwickl, Beth; Janowicz, Diane M.; Katz, Barry P.; Nelson, David E.; Dong, Qunfeng
2015-01-01
ABSTRACT The influence of the skin microbiota on host susceptibility to infectious agents is largely unexplored. The skin harbors diverse bacterial species that may promote or antagonize the growth of an invading pathogen. We developed a human infection model for Haemophilus ducreyi in which human volunteers are inoculated on the upper arm. After inoculation, papules form and either spontaneously resolve or progress to pustules. To examine the role of the skin microbiota in the outcome of H. ducreyi infection, we analyzed the microbiomes of four dose-matched pairs of “resolvers” and “pustule formers” whose inoculation sites were swabbed at multiple time points. Bacteria present on the skin were identified by amplification and pyrosequencing of 16S rRNA genes. Nonmetric multidimensional scaling (NMDS) using Bray-Curtis dissimilarity between the preinfection microbiomes of infected sites showed that sites from the same volunteer clustered together and that pustule formers segregated from resolvers (P = 0.001, permutational multivariate analysis of variance [PERMANOVA]), suggesting that the preinfection microbiomes were associated with outcome. NMDS using Bray-Curtis dissimilarity of the endpoint samples showed that the pustule sites clustered together and were significantly different than the resolved sites (P = 0.001, PERMANOVA), suggesting that the microbiomes at the endpoint differed between the two groups. In addition to H. ducreyi, pustule-forming sites had a greater abundance of Proteobacteria, Bacteroidetes, Micrococcus, Corynebacterium, Paracoccus, and Staphylococcus species, whereas resolved sites had higher levels of Actinobacteria and Propionibacterium species. These results suggest that at baseline, resolvers and pustule formers have distinct skin bacterial communities which change in response to infection and the resultant immune response. PMID:26374122
Almog, Orna; González, Ana; Godin, Noa; de Leeuw, Marina; Mekel, Marlene J; Klein, Daniela; Braun, Sergei; Shoham, Gil; Walter, Richard L
2009-02-01
We determine and compare the crystal structure of two proteases belonging to the subtilisin superfamily: S41, a cold-adapted serine protease produced by Antarctic bacilli, at 1.4 A resolution and Sph, a mesophilic serine protease produced by Bacillus sphaericus, at 0.8 A resolution. The purpose of this comparison was to find out whether multiple calcium ion binding is a molecular factor responsible for the adaptation of S41 to extreme low temperatures. We find that these two subtilisins have the same subtilisin fold with a root mean square between the two structures of 0.54 A. The final models for S41 and Sph include a calcium-loaded state of five ions bound to each of these two subtilisin molecules. None of these calcium-binding sites correlate with the high affinity known binding site (site A) found for other subtilisins. Structural analysis of the five calcium-binding sites found in these two crystal structures indicate that three of the binding sites have two side chains of an acidic residue coordinating the calcium ion, whereas the other two binding sites have either a main-chain carbonyl, or only one acidic residue side chain coordinating the calcium ion. Thus, we conclude that three of the sites are of high affinity toward calcium ions, whereas the other two are of low affinity. Because Sph is a mesophilic subtilisin and S41 is a psychrophilic subtilisin, but both crystal structures were found to bind five calcium ions, we suggest that multiple calcium ion binding is not responsible for the adaptation of S41 to low temperatures. Copyright 2008 Wiley-Liss, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Johnson, Gary E.; Diefenderfer, Heida L.; Borde, Amy B.
The goal of this multi-year study (2004-2010) is to develop a methodology to evaluate the cumulative effects of multiple habitat restoration projects intended to benefit ecosystems supporting juvenile salmonids in the lower Columbia River and estuary. Literature review in 2004 revealed no existing methods for such an evaluation and suggested that cumulative effects could be additive or synergistic. Field research in 2005, 2006, and 2007 involved intensive, comparative studies paired by habitat type (tidal swamp vs. marsh), trajectory (restoration vs. reference site), and restoration action (tide gate vs. culvert vs. dike breach). The field work established two kinds of monitoringmore » indicators for eventual cumulative effects analysis: core and higher-order indicators. Management implications of limitations and applications of site-specific effectiveness monitoring and cumulative effects analysis were identified.« less
Monteiro, Rose A; Souza, Emanuel M; Geoffrey Yates, M; Steffens, M Berenice R; Pedrosa, Fábio O; Chubatsu, Leda S
2003-02-01
The Herbaspirillum seropedicae NifA protein is responsible for nif gene expression. The C-terminal domain of the H. seropedicae NifA protein, fused to a His-Tag sequence (His-Tag-C-terminal), was over-expressed and purified by metal-affinity chromatography to yield a highly purified and active protein. Band-shift assays showed that the NifA His-Tag-C-terminal bound specifically to the H. seropedicae nifB promoter region in vitro. In vivo analysis showed that this protein inhibited the Central + C-terminal domains of NifA protein from activating the nifH promoter of K. pneumoniae in Escherichia coli, indicating that the protein must be bound to the NifA-binding site (UAS site) at the nifH promoter region to activate transcription. Copyright 2002 Elsevier Science (USA)
Van Horn, David J.; Okie, Jordan G.; Buelow, Heather N.; Gooseff, Michael N.; Barrett, John E.
2014-01-01
Microbial communities in extreme environments often have low diversity and specialized physiologies suggesting a limited resistance to change. The McMurdo Dry Valleys (MDV) are a microbially dominated, extreme ecosystem currently undergoing climate change-induced disturbances, including the melting of massive buried ice, cutting through of permafrost by streams, and warming events. These processes are increasing moisture across the landscape, altering conditions for soil communities by mobilizing nutrients and salts and stimulating autotrophic carbon inputs to soils. The goal of this study was to determine the effects of resource addition (water/organic matter) on the composition and function of microbial communities in the MDV along a natural salinity gradient representing an additional gradient of stress in an already extreme environment. Soil respiration and the activity of carbon-acquiring extracellular enzymes increased significantly (P < 0.05) with the addition of resources at the low- and moderate-salinity sites but not the high-salinity site. The bacterial community composition was altered, with an increase in Proteobacteria and Firmicutes with water and organic matter additions at the low- and moderate-salinity sites and a near dominance of Firmicutes at the high-salinity site. Principal coordinate analyses of all samples using a phylogenetically informed distance matrix (UniFrac) demonstrated discrete clustering among sites (analysis of similarity [ANOSIM], P < 0.05 and R > 0.40) and among most treatments within sites. The results from this experimental work suggest that microbial communities in this environment will undergo rapid change in response to the altered resources resulting from climate change impacts occurring in this region. PMID:24610850
Van Horn, David J; Okie, Jordan G; Buelow, Heather N; Gooseff, Michael N; Barrett, John E; Takacs-Vesbach, Cristina D
2014-05-01
Microbial communities in extreme environments often have low diversity and specialized physiologies suggesting a limited resistance to change. The McMurdo Dry Valleys (MDV) are a microbially dominated, extreme ecosystem currently undergoing climate change-induced disturbances, including the melting of massive buried ice, cutting through of permafrost by streams, and warming events. These processes are increasing moisture across the landscape, altering conditions for soil communities by mobilizing nutrients and salts and stimulating autotrophic carbon inputs to soils. The goal of this study was to determine the effects of resource addition (water/organic matter) on the composition and function of microbial communities in the MDV along a natural salinity gradient representing an additional gradient of stress in an already extreme environment. Soil respiration and the activity of carbon-acquiring extracellular enzymes increased significantly (P < 0.05) with the addition of resources at the low- and moderate-salinity sites but not the high-salinity site. The bacterial community composition was altered, with an increase in Proteobacteria and Firmicutes with water and organic matter additions at the low- and moderate-salinity sites and a near dominance of Firmicutes at the high-salinity site. Principal coordinate analyses of all samples using a phylogenetically informed distance matrix (UniFrac) demonstrated discrete clustering among sites (analysis of similarity [ANOSIM], P < 0.05 and R > 0.40) and among most treatments within sites. The results from this experimental work suggest that microbial communities in this environment will undergo rapid change in response to the altered resources resulting from climate change impacts occurring in this region.
Federal Register 2010, 2011, 2012, 2013, 2014
2013-01-11
... responsible for making sure that your comment does not include any sensitive health information, like medical records or other individually identifiable health information. In addition, do not include any ``[t]rade... overnight service. Visit the Commission Web site at http://www.ftc.gov to read this Notice and the news...
ERIC Educational Resources Information Center
Walsh, Wendy A.; Cross, Theodore P.; Jones, Lisa M.; Simone, Monique; Kolko, David J.
2007-01-01
Objective: This study examines the impact of Children's Advocacy Centers (CAC) and other factors, such as the child's age, alleged penetration, and injury on the use of forensic medical examinations as part of the response to reported child sexual abuse. Methods: This analysis is part of a quasi-experimental study, the Multi-Site Evaluation of…
Phytoremediation is currently being explored for its potential to clean-up of the large number of military sites that have been contaminated by explosives such as 2,4,6-trinitrotoluene (TNT) and hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX). Although some of the enzymes responsi...
SIR-B measurements and modeling of vegetation
NASA Technical Reports Server (NTRS)
Ulaby, Fawwaz T.; Dobson, M. Craig
1986-01-01
A summary is presented of the results derived from analysis of six SIR-B data takes over an agricultural test site in west central Illinois. The first part describes the procedure used to calibrate the SIR-B imagery, the second part pertains to the observed radar response to soil moisture content, and the last part examines the information derivable from multiangle observations.
The World Trade Center attack. Observations from New York's Bellevue Hospital.
Roccaforte, J D
2001-12-01
This report describes selected aspects of the response by Bellevue Hospital Center to the World Trade Center attack of 11 September 2001. The hospital is 2.5 miles (4 km) from the site of the attack. These first-hand observations and this analysis may aid in future preparations. Key issues described relate to communication, organization, injuries treated, staffing, and logistics.
Surveyor V: Discussion of chemical analysis
Gault, D.E.; Adams, J.B.; Collins, R.J.; Green, J.; Kuiper, G.P.; Mazursky, H.; O'Keefe, J. A.; Phinney, R.A.; Shoemaker, E.M.
1967-01-01
Material of basaltic composition at the Surveyor V landing site implies that differentiation has occurred in the moon, probably due to internal sources of heat. The results are consistent with the hypothesis that extensive volcanic flows have been responsible for flooding and filling the mare basins. The processes and products of lunar magmatic activity are apparently similar to those of the earth.
Surveyor v: discussion of chemical analysis.
Gault, D E; Adams, J B; Collins, R J; Green, J; Kuiper, G P; Mazursky, H; O'keefe, J A; Phinney, R A; Shoemaker, E M
1967-11-03
Material of basaltic composition at the Surveyor V landing site implies that differentiation has occurred in the moon, probably due to internal sources of heat. The results are consistent with the hypothesis that extensive volcanic flows have been responsible for flooding and filling the mare basins. The processes and products of lunar magmatic activity are apparently similar to those of the earth.
ERIC Educational Resources Information Center
Zula, Ken; Yarrish, Karen K.; Pawelzik, Walter
2011-01-01
Social networking sites such as Facebook, LinkedIn, and Twitter are widely regarded as an exciting opportunity to communicate with friends, especially for college students. The overall response to social networking tends to be one of trust regarding a generation that, supposedly has many friends but little sense of privacy. Employers use social…
Chapter 27. Seed testing requirements and regulatory laws
Richard Stevens; Kent R. Jorgensen
2004-01-01
Federal and State seed laws require that seed used on range and wildland sites be officially tested and appropriately labeled or tagged. It is the responsibility of the seed distributor (who may be the producer, collector, or broker) toward the end user to properly tag each container of seed to comply with these laws. An analysis tag is always required. If seed has...
The Use Of Double Pulsed Holography For On-Site Vibration Analysis
NASA Astrophysics Data System (ADS)
Tyrer, John R.
1985-06-01
A description is given of a laser system used to produce interferograms of a large centrifugal compressor, powered by an industrial gas turbine engine with a dominant system response at 168Hz. The results demonstrate a travelling wave generated within the feed pipe to the compressor. Finally the description of a potential real time double pulse systeu is presented.
Geotechnical Site Investigation Using S-waves with Implications for Ground Motion Analysis
NASA Astrophysics Data System (ADS)
Hassan, Bilal; Butt, Stephen D.; Hurich, Charles A.
2017-12-01
Evaluation results of shear wave attenuation-based ground motion restricted by fracture orientation and rheology, from among those of an extended experimental study, are presented herein. The issues of competence of fractured bedrock dynamically disturbed multilaterally are assessed. Disturbance is primarily modelled by Sh and Sv stimulation, given fracture orientation, while subjected to direct fracture stress regime conditions varying in time. Hence, directionalities of polarisation and stress are taken into consideration simultaneously following simple site-specific non-erodetic approach. Comparison of spectral curves and spectral ratio curves of attenuation with respect to variations of direction and stress emphasise the amplification of the `seismic response' in one direction compared to the other, i.e. vertical vs. horizontal, in terms of weighing possibilities of or predicting structural integrity against failure. The composite analyses of multiple spectral curves not only enable determination of the orientation of the fracture set/s in space but also allow inferring the nature of more amplified response perpendicular to the crack surface compared to that of a response parallel to the crack surface.
Development of a Deltoid Shoulder Muscle Model for Rhesus Monkey Spaceflight Studies
NASA Technical Reports Server (NTRS)
Riley, Danny A.; Macias, Melissa Y.; Anders, Scott; Slocum, Glenn R.
1995-01-01
The acromiodeltoid shoulder muscle was demonstrated to be a suitable model for spaceflight studies. The muscle contains a mixture of fast and slow fibers, permitting analysis of muscle fiber type specific changes. Two biopsy sites per muscle were identified that provided samples not degraded by the biopsy procedure. Both sites contained sufficient numbers fibers for determining changes in fiber type percentages and size. There was adequate bilateral symmetry regarding fiber type composition in the left and right muscles such that a total of four times points can be compared. The ESOP cage did not cause atrophy of deltoid muscle fibers; this means that microgravity-induced atrophy should be detectable. As expected, muscle excision stimulated muscle IgM and IgG muscle autoantibody production. Nonrestrained control animals suppressed this response whereas restrained monkeys showed an abnormally pronounced response indicative a compromised immune system. The presence of ESOP cage-induced changes in the immune response may mask spaceflight-induced effects. The ESOP cage modified the dominant hand operation of the PTS. These results demonstrate the importance of high fidelity ground based controls.
Place, Sean P.; Menge, Bruce A.; Hofmann, Gretchen E.
2011-01-01
Summary The marine intertidal zone is characterized by large variation in temperature, pH, dissolved oxygen and the supply of nutrients and food on seasonal and daily time scales. These oceanic fluctuations drive of ecological processes such as recruitment, competition and consumer-prey interactions largely via physiological mehcanisms. Thus, to understand coastal ecosystem dynamics and responses to climate change, it is crucial to understand these mechanisms. Here we utilize transcriptome analysis of the physiological response of the mussel Mytilus californianus at different spatial scales to gain insight into these mechanisms. We used mussels inhabiting different vertical locations within Strawberry Hill on Cape Perpetua, OR and Boiler Bay on Cape Foulweather, OR to study inter- and intra-site variation of gene expression. The results highlight two distinct gene expression signatures related to the cycling of metabolic activity and perturbations to cellular homeostasis. Intermediate spatial scales show a strong influence of oceanographic differences in food and stress environments between sites separated by ~65 km. Together, these new insights into environmental control of gene expression may allow understanding of important physiological drivers within and across populations. PMID:22563136
Methodological issues in using data from social networking sites.
Leng, Ho Keat
2013-09-01
Social networking sites (SNS) have become increasingly popular in recent years. With the amount of data available on SNS, the potential exists for researchers to use these data for their research. However, like any research method, there are limitations in using data from SNS. First, as members of SNS are not representative of the population, there is the limitation in generalizing the findings to the population. Second, in SNS with a low level of activity, there is also the issue of whether the data are sufficient for analysis. Third, the validity of the postings by members of SNS should be considered, as members of SNS may not be truthful in their responses. In addition, as the environment for SNS favors a quick emotive response as opposed to a cognitive response, the review suggests that the researcher will need to be aware of possibly different behavior when members of a SNS are faced with a high involvement decision. This article concludes that while there is potential in analyzing data from SNS, researchers should be aware of the limitations in using these data.
NASA Astrophysics Data System (ADS)
Pischiutta, Marta; Cianfarra, Paola; Salvini, Francesco; Cara, Fabrizio; Vannoli, Paola
2018-03-01
Directional site effects observed at seismological stations on pronounced relief are analyzed. We investigate the ground motion properties calculating horizontal-to-vertical spectral ratios and horizontal polarization of both ambient vibrations and earthquake records using broadband seismograms of the Italian Seismic Network. We find that a subset of 47 stations with pronounced relief, results in a significant (>2) directional amplification of the horizontal component, with a well defined, site-specific direction of motion. However, the horizontal spectral response of sites is not uniform, varying from an isolated (resonant) frequency peak to a broadband amplification, interesting frequency bands as large as 1-10 Hz in many cases. Using the 47 selected stations, we have tried to establish a relation between directional amplification and topography geometry in a 2D-vision, when applicable, through a morphological analysis of the Digital Elevation Model using Geographic Information Systems. The procedure computes the parameters that characterize the geometry of topographic irregularities (size and slope), in combination with a principal component analysis that automatically yields the orientation of the elongated ridges. In seeking a relation between directional amplification and the surface morphology, we have found that it is impossible to fit the variety of observations with a resonant topography model as well as to identify common features in the ground motion behavior for stations with similar topography typologies. We conclude that, rather than the shape of the topography, local structural complexities and details of the near-surface structure must play a predominant role in controlling ground motion properties at sites with pronounced relief.
NASA Astrophysics Data System (ADS)
Pischiutta, Marta; Cianfarra, Paola; Salvini, Francesco; Cara, Fabrizio; Vannoli, Paola
2018-07-01
Directional site effects observed at seismological stations on pronounced relief are analysed. We investigate the ground motion properties calculating horizontal-to-vertical spectral ratios and horizontal polarization of both ambient vibrations and earthquake records using broad-band seismograms of the Italian seismic network. We find that a subset of 47 stations with pronounced relief results in a significant (>2) directional amplification of the horizontal component, with a well-defined, site-specific direction of motion. However, the horizontal spectral response of sites is not uniform, varying from an isolated (resonant) frequency peak to a broad-band amplification, interesting frequency bands as large as 1-10 Hz in many cases. Using 47 selected stations, we have tried to establish a relation between directional amplification and topography geometry in a 2-D vision, when applicable, through a morphological analysis of the digital elevation model using geographic information systems. The procedure computes the parameters that characterize the geometry of topographic irregularities (size and slope), in combination with a principal component analysis that automatically yields the orientation of the elongated ridges. In seeking a relation between directional amplification and the surface morphology, we have found that it is impossible to fit the variety of observations with a resonant topography model as well as to identify common features in the ground motion behaviour for stations with similar topography typologies. We conclude that, rather than the shape of the topography, local structural complexities and details of the near-surface structure must play a predominant role in controlling ground motion properties at sites with pronounced relief.
Prospective analysis of the quality of Spanish health information web sites after 3 years.
Conesa-Fuentes, Maria C; Hernandez-Morante, Juan J
2016-12-01
Although the Internet has become an essential source of health information, our study conducted 3 years ago provided evidence of the low quality of Spanish health web sites. The objective of the present study was to evaluate the quality of Spanish health information web sites now, and to compare these results with those obtained 3 years ago. For the original study, the most visited health information web sites were selected through the PageRank® (Google®) system. The present study evaluated the quality of the same web sites from February to May 2013, using the method developed by Bermúdez-Tamayo et al. and HONCode® criteria. The mean quality of the selected web sites was low and has deteriorated since the previous evaluation, especially in regional health services and institutions' web sites. The quality of private web sites remained broadly similar. Compliance with privacy and update criteria also improved in the intervening period. The results indicate that, even in the case of health web sites, design or appearance is more relevant to developers than quality of information. It is recommended that responsible institutions should increase their efforts to eliminate low-quality health information that may further contribute to health problems.
Mora, Cordula V; Walker, Michael M
2009-09-22
How homing pigeons (Columba livia) return to their loft from distant, unfamiliar sites has long been a mystery. At many release sites, untreated birds consistently vanish from view in a direction different from the home direction, a phenomenon called the release-site bias. These deviations in flight direction have been implicated in the position determination (or map) step of navigation because they may reflect local distortions in information about location that the birds obtain from the geophysical environment at the release site. Here, we performed a post hoc analysis of the relationship between vanishing bearings and local variations in magnetic intensity using previously published datasets for pigeons homing to lofts in Germany. Vanishing bearings of both experienced and naïve birds were strongly associated with magnetic intensity variations at release sites, with 90 per cent of bearings lying within +/-29 degrees of the magnetic intensity slope or contour direction. Our results (i) demonstrate that pigeons respond in an orderly manner to the local structure of the magnetic field at release sites, (ii) provide a mechanism for the occurrence of release-site biases and (iii) suggest that pigeons may derive spatial information from the magnetic field at the release site that could be used to estimate their current position relative to their loft.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miller, Julianne; Etyemezian, Vicken; Shillito, Rose
The increase in wildfires in arid and semi-arid parts of Nevada and elsewhere in the southwestern United States has implications for post-closure management and long-term stewardship for Soil Corrective Action Units (CAUs) on the Nevada National Security Site (NNSS) for which the Nevada Field Office of the United States Department of Energy, National Nuclear Security Administration has responsibility. For many CAUs and Corrective Action Sites, where closure-in-place alternatives are now being implemented or considered, there is a chance that these sites could burn over at some time while they still pose a risk to the environment or human health, givenmore » the long half lives of some of the radionuclide contaminants. This study was initiated to examine the effects and duration of wildfire on wind and water erodibility on sites analogous to those that exist on the NNSS. The data analyzed herein were gathered at the prescribed Gleason Fire site near Ely, Nevada, a site comparable to the northern portion of the NNSS. Quantification of wind erosion was conducted with a Portable In-Situ Wind ERosion Lab (PI-SWERL) on unburned soils, and on interspace and plant understory soils within the burned area. The PI-SWERL was used to estimate emissions of suspendible particles (particulate matter with aerodynamic diameters less than or equal to 10 micrometers) at different wind speeds. Filter samples, collected from the exhaust of the PI-SWERL during measurements, were analyzed for chemical composition. Based on nearly three years of data, the Gleason Fire site does not appear to have returned to pre burn wind erosion levels. Chemical composition data of suspendible particles are variable and show a trend toward pre-burn levels, but provide little insight into how the composition has been changing over time since the fire. Soil, runoff, and sediment data were collected from the Gleason Fire site to monitor the water erosion potential over the nearly three-year period. Soil hydrophobicity (water repellency) was noted on burned understory soils up to 12 months after the fire, as was the presence of ash on the soil surface. Soil deteriorated from a strong, definable pre-fire structure to a weakly cohesive mass (unstructured soil) immediately after the fire. Surface soil structure was evident 34 months after the fire at both burned and unburned sites, but was rare and weaker at burned sites. The amount of runoff and sediment was highly variable, but runoff occurred more frequently at burned interspace sites compared to burned understory and unburned interspace sites up to 34 months after the burn. No discernible pattern was evident on the amount of sediment transported, but the size of sediment from burned understory sites was almost double that of burned and unburned interspace soils after the fire, and decreased over the monitoring period. Curve numbers, a measure of the runoff potential, did not indicate any obvious runoff response to the fire. However, slight seasonal changes in curve numbers and runoff potential and, therefore, post-fire runoff response may be a function of fire impacts as well as the time of year that precipitation occurs. Site (interspace or understory) differences in soil properties and runoff persisted even after the fire. Vegetation data showed the presence of invasive grasses after the fire. Results from analysis of wind and water coupled with the spatial analysis of vegetation suggest that wind erosion may continue to occur due to the additional exposed soil surface (burned understory sites) until vegetation becomes re-established, and runoff may occur more frequently in interspace sites. The potential for fire-related wind erosion and water erosion may persist beyond three years in this system.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lord, Anna C.
The U.S. Strategic Petroleum Reserve (SPR) is a stockpile of emergency crude oil to be tapped into if a disruption in the nation's oil supply occurs. The SPR is comprised of four salt dome sites. Subsidence surveys have been conducted either annually or biennially at all four sites over the life of the program. Monitoring of surface behavior is a first line defense to detecting possible subsurface cavern integrity issues. Over the life of the Bryan Mound site, subsidence rates over abandoned Cavern 3 have continuously been the highest at the site. In an effort to try and understand themore » subsurface dynamics, specifically over Bryan Mound Cavern 3, historic interferometric synthetic aperture radar (InSAR) data was acquired and processed by TRE Altamira. InSAR involves the processing of multiple satellite synthetic aperture radar scenes acquired across the same location of the Earth's surface at different times to map surface deformation. The analysis of the data has the ability to detect millimeters of motion spanning days, months, year and decades, across specific sites. The intent in regards to the Bryan Mound site was (1) to confirm the higher subsidence rates recorded over abandoned Cavern 3 indicated by land survey and (2) understand the regional surface behavior. This report describes the InSAR analysis results, how those results compare to the historical collection of land survey data, and what additional information the data has provided towards understanding the response recorded at the surface.« less
2011-01-01
Background Populations of Atlantic killifish (Fundulus heteroclitus) have evolved resistance to the embryotoxic effects of polychlorinated biphenyls (PCBs) and other halogenated and nonhalogenated aromatic hydrocarbons that act through an aryl hydrocarbon receptor (AHR)-dependent signaling pathway. The resistance is accompanied by reduced sensitivity to induction of cytochrome P450 1A (CYP1A), a widely used biomarker of aromatic hydrocarbon exposure and effect, but whether the reduced sensitivity is specific to CYP1A or reflects a genome-wide reduction in responsiveness to all AHR-mediated changes in gene expression is unknown. We compared gene expression profiles and the response to 3,3',4,4',5-pentachlorobiphenyl (PCB-126) exposure in embryos (5 and 10 dpf) and larvae (15 dpf) from F. heteroclitus populations inhabiting the New Bedford Harbor, Massachusetts (NBH) Superfund site (PCB-resistant) and a reference site, Scorton Creek, Massachusetts (SC; PCB-sensitive). Results Analysis using a 7,000-gene cDNA array revealed striking differences in responsiveness to PCB-126 between the populations; the differences occur at all three stages examined. There was a sizeable set of PCB-responsive genes in the sensitive SC population, a much smaller set of PCB-responsive genes in NBH fish, and few similarities in PCB-responsive genes between the two populations. Most of the array results were confirmed, and additional PCB-regulated genes identified, by RNA-Seq (deep pyrosequencing). Conclusions The results suggest that NBH fish possess a gene regulatory defect that is not specific to one target gene such as CYP1A but rather lies in a regulatory pathway that controls the transcriptional response of multiple genes to PCB exposure. The results are consistent with genome-wide disruption of AHR-dependent signaling in NBH fish. PMID:21609454
The aluminum ordering in aluminosilicates: a dipolar 27Al NMR spectroscopy study.
Gee, Becky A
2004-01-01
The spatial ordering of aluminum atoms in CsAl(SiO3)2 and 3Al2O3.2SiO2 was probed by 27Al dipolar solid-state NMR spectroscopy. The 27Al response to a Hahn spin-echo pulse sequence in a series of aluminum-containing model crystalline compounds demonstrates that quantitative 27Al homonuclear dipolar second moments can be obtained to within +/-20% of the theoretical values, if evaluation of the spin-echo response curve is limited to short evolution periods (2t1 < or = 0.10 ms). Additionally, selective excitation of the central transition m = 1/2 --> -1/2 is necessary in order to ensure quantitative results. Restriction of spin exchange affecting the dephasing of the magnetization may decelerate the spin-echo decay at longer evolution periods. Considering these restraints, the method was used to probe the spatial distribution of aluminum atoms among the tetrahedral sites in two aluminosilicate materials. Experimental 27Al spin-echo response data for the aluminosilicates CsAl(SiO3)2 (synthetic pollucite) and 3Al2O3.2SiO2 (mullite) are compared with theoretical data based on (I) various degrees of aluminum-oxygen-aluminum bond formation among tetrahedrally coordinated aluminum atoms (Al(T(d) )-O-Al(T(d) )) and (II) the maximum avoidance of Al(T(d) )-O-Al(T(d) ) bonding. Analysis of the second moment values and resulting echo decay responses suggests that partial suppression of spin exchange among aluminum atoms in crystallographically distinct sites may contribute to the 27Al spin echo decay in 3Al2O3.2SiO2, thus complicating quantitative analysis of the data. Silicon-29 and aluminum-27 magic angle spinning (MAS) NMR spectra of 3Al2O3.2SiO2 are consistent with those previously reported. The experimental 27Al spin-echo response behavior of CsAl(SiO3)2 differs from the theoretical response behavior based on the maximum avoidance of Al-O-Al bonding between tetrahedral aluminum sites in CsAl(SiO3)2. A single unresolved resonance is observed in both the silicon-29 and aluminum-27 MAS spectra of CsAl(SiO3)2. Copyright 2003 John Wiley & Sons, Ltd.
Regulation of CYBB Gene Expression in Human Phagocytes by a Distant Upstream NF-κB Binding Site.
Frazão, Josias B; Thain, Alison; Zhu, Zhiqing; Luengo, Marcos; Condino-Neto, Antonio; Newburger, Peter E
2015-09-01
The human CYBB gene encodes the gp91-phox component of the phagocyte oxidase enzyme complex, which is responsible for generating superoxide and other downstream reactive oxygen species essential to microbial killing. In the present study, we have identified by sequence analysis a putative NF-κB binding site in a DNase I hypersensitive site, termed HS-II, located in the distant 5' flanking region of the CYBB gene. Electrophoretic mobility assays showed binding of the sequence element by recombinant NF-κB protein p50 and by proteins in nuclear extract from the HL-60 myeloid leukemia cell line corresponding to p50 and to p50/p65 heterodimers. Chromatin immunoprecipitation demonstrated NF-κB binding to the site in intact HL-60 cells. Chromosome conformation capture (3C) assays demonstrated physical interaction between the NF-κB binding site and the CYBB promoter region. Inhibition of NF-κB activity by salicylate reduced CYBB expression in peripheral blood neutrophils and differentiated U937 monocytic leukemia cells. U937 cells transfected with a mutant inhibitor of κB "super-repressor" showed markedly diminished CYBB expression. Luciferase reporter analysis of the NF-κB site linked to the CYBB 5' flanking promoter region revealed enhanced expression, augmented by treatment with interferon-γ. These studies indicate a role for this distant, 15 kb upstream, binding site in NF-κB regulation of the CYBB gene, an essential component of phagocyte-mediated host defense. © 2015 Wiley Periodicals, Inc.
NASA Astrophysics Data System (ADS)
Stretch, V.; Gedalof, Z.; Berg, A. A.
2010-12-01
Increased atmospheric CO2 could increase photosynthetic rates and cause trees to use water more efficiently, thereby increasing overall growth rates relative to climatic limiting factors. CO2 fertilization has been found across a range of forest types; however results have been inconsistent and based on short-term studies. Long-term studies based on tree-rings have generally been restricted to a few sites and have produced conflicting results. An initial global analysis of tree-ring widths for evidence of increasing growth relative to drought suggested a small but highly significant proportion of trees exhibit increasing growth over the past 130 years. These growth increases could not be attributed to increasing water use efficiency, elevation effects, nitrogen deposition, or divergence. These results suggest that CO2 fertilization is occurring at some locations and may influence future forest dynamics but this does not appear to occur at all locations. The processes causing differential responses are the focus of this study. Here we illustrate response differences between Douglas-fir (Pseudotsuga menziesii) and ponderosa pine (Pinus ponderosa). Using multiple site chronologies from these species over western North America, we demonstrate several site-specific explanations for differential responses to CO2 fertilization, such as forest composition, density, slope, aspect, soil type, and position relative to range limits.
NASA Astrophysics Data System (ADS)
Zhang, Ying; Lantz, Nicholas; Guindon, Bert; Jiao, Xianfen
2017-01-01
Accurate and frequent monitoring of land surface changes arising from oil and gas exploration and extraction is a key requirement for the responsible and sustainable development of these resources. Petroleum deposits typically extend over large geographic regions but much of the infrastructure required for oil and gas recovery takes the form of numerous small-scale features (e.g., well sites, access roads, etc.) scattered over the landscape. Increasing exploitation of oil and gas deposits will increase the presence of these disturbances in heavily populated regions. An object-based approach is proposed to utilize RapidEye satellite imagery to delineate well sites and related access roads in diverse complex landscapes, where land surface changes also arise from other human activities, such as forest logging and agriculture. A simplified object-based change vector approach, adaptable to operational use, is introduced to identify the disturbances on land based on red-green spectral response and spatial attributes of candidate object size and proximity to roads. Testing of the techniques has been undertaken with RapidEye multitemporal imagery in two test sites located at Alberta, Canada: one was a predominant natural forest landscape and the other landscape dominated by intensive agricultural activities. Accuracies of 84% and 73%, respectively, have been achieved for the identification of well site and access road infrastructure of the two sites based on fully automated processing. Limited manual relabeling of selected image segments can improve these accuracies to 95%.
DSOD Procedures for Seismic Hazard Analysis
NASA Astrophysics Data System (ADS)
Howard, J. K.; Fraser, W. A.
2005-12-01
DSOD, which has jurisdiction over more than 1200 dams in California, routinely evaluates their dynamic stability using seismic shaking input ranging from simple pseudostatic coefficients to spectrally matched earthquake time histories. Our seismic hazard assessments assume maximum earthquake scenarios of nearest active and conditionally active seismic sources. Multiple earthquake scenarios may be evaluated depending on sensitivity of the design analysis (e.g., to certain spectral amplitudes, duration of shaking). Active sources are defined as those with evidence of movement within the last 35,000 years. Conditionally active sources are those with reasonable expectation of activity, which are treated as active until demonstrated otherwise. The Division's Geology Branch develops seismic hazard estimates using spectral attenuation formulas applicable to California. The formulas were selected, in part, to achieve a site response model similar to the 2000 IBC's for rock, soft rock, and stiff soil sites. The level of dynamic loading used in the stability analysis (50th, 67th, or 84th percentile ground shaking estimates) is determined using a matrix that considers consequence of dam failure and fault slip rate. We account for near-source directivity amplification along such faults by adjusting target response spectra and developing appropriate design earthquakes for analysis of structures sensitive to long-period motion. Based on in-house studies, the orientation of the dam analysis section relative to the fault-normal direction is considered for strike-slip earthquakes, but directivity amplification is assumed in any orientation for dip-slip earthquakes. We do not have probabilistic standards, but we evaluate the probability of our ground shaking estimates using hazard curves constructed from the USGS Interactive De-Aggregation website. Typically, return periods for our design loads exceed 1000 years. Excessive return periods may warrant a lower design load. Minimum shaking levels are provided for sites far from active faulting. Our procedures and standards are presented at the DSOD website http://damsafety.water.ca.gov/. We review our methods and tools periodically under the guidance of our Consulting Board for Earthquake Analysis (and expect to make changes pending NGA completion), mindful that frequent procedural changes can interrupt design evaluations.
EPA Region 2 SEMS_CERCLIS Sites All [R2] and SEMS_CERCLIS Sites NPL [R2] GIS Layers
The Region 2 SEMS_CERCLIS Sites All [R2] GIS layer contains unique Superfund Enterprise Management System (SEMS) site records. These records have the following NPL_STATUS designations: CURRENTLY ON FINAL NPL, DELETED FROM FINAL NPL, NOT ON NPL, PROPOSED FOR NPL, REMOVED FROM PROPOSED NPL, and SITE IS PART OF NPL SITE. The Region 2 SEMS_CERCLIS NPL Sites [R2] GIS layer only has SEMS records with the following NPL_STATUS designations: 'CURRENTLY ON FINAL NPL', 'DELETED FROM FINAL NPL', 'PROPOSED FOR NPL'.The Superfund Enterprise Management System (SEMS) is EPA's official record for tracking hazardous waste sites, potentially hazardous waste sites, and remedial activities performed in support of the Superfund Program across the nation. This includes sites that are on the National Priorities List (NPL) or are being considered for the NPL. SEMS represents a joint development and ongoing collaboration between Superfund's Remedial, Removal, Federal Facilities, Enforcement, and Emergency Response programs. It provides its wide audience base with a means of ongoing analysis of Superfund Program activities and informational needs at the site, regional management, and national management levels. The customers of SEMS or SEMS data are five EPA Headquarters offices and regional staff, citizens, the regulated community, other Federal agencies, States, Tribes, local agencies, and industry. SEMS stakeholders are States, Congress, other Federal agencies, industry groups, and cit
Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.
Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G
2016-11-01
Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.
Test and Analysis of a Buckling-Critical Large-Scale Sandwich Composite Cylinder
NASA Technical Reports Server (NTRS)
Schultz, Marc R.; Sleight, David W.; Gardner, Nathaniel W.; Rudd, Michelle T.; Hilburger, Mark W.; Palm, Tod E.; Oldfield, Nathan J.
2018-01-01
Structural stability is an important design consideration for launch-vehicle shell structures and it is well known that the buckling response of such shell structures can be very sensitive to small geometric imperfections. As part of an effort to develop new buckling design guidelines for sandwich composite cylindrical shells, an 8-ft-diameter honeycomb-core sandwich composite cylinder was tested under pure axial compression to failure. The results from this test are compared with finite-element-analysis predictions and overall agreement was very good. In particular, the predicted buckling load was within 1% of the test and the character of the response matched well. However, it was found that the agreement could be improved by including composite material nonlinearity in the analysis, and that the predicted buckling initiation site was sensitive to the addition of small bending loads to the primary axial load in analyses.
Characterization of the SOS meta-regulon in the human gut microbiome.
Cornish, Joseph P; Sanchez-Alberola, Neus; O'Neill, Patrick K; O'Keefe, Ronald; Gheba, Jameel; Erill, Ivan
2014-05-01
Data from metagenomics projects remain largely untapped for the analysis of transcriptional regulatory networks. Here, we provide proof-of-concept that metagenomic data can be effectively leveraged to analyze regulatory networks by characterizing the SOS meta-regulon in the human gut microbiome. We combine well-established in silico and in vitro techniques to mine the human gut microbiome data and determine the relative composition of the SOS network in a natural setting. Our analysis highlights the importance of translesion synthesis as a primary function of the SOS response. We predict the association of this network with three novel protein clusters involved in cell wall biogenesis, chromosome partitioning and restriction modification, and we confirm binding of the SOS response transcriptional repressor to sites in the promoter of a cell wall biogenesis enzyme, a phage integrase and a death-on-curing protein. We discuss the implications of these findings and the potential for this approach for metagenome analysis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chavez, Juan; Chung, Woon-Gye; Miranda, Cristobal L.
2010-01-18
The protein targets and sites of modification by 4-hydroxy-2(E)-nonenal (HNE) in human monocytic THP-1 cells after exogenous exposure to HNE were examined using a multipronged proteomic approach involving electrophoretic, immunoblotting, and mass spectrometric methods. Immunoblot analysis using monoclonal anti-HNE antibodies showed several proteins as targets of HNE adduction. Pretreatment of THP-1 cells with ascorbic acid resulted in reduced levels of HNE-protein adducts. Biotinylation of Michael-type HNE adducts using an aldehyde-reactive hydroxylamine-functionalized probe (aldehyde-reactive probe, ARP) and subsequent enrichment facilitated the identification and site-specific assignment of the modifications by LC-MS/MS analysis. Sixteen proteins were unequivocally identified as targets of HNE adduction,more » and eighteen sites of HNE modification at Cys and His residues were assigned. HNE exposure of THP-1 cells resulted in the modification of proteins involved in cytoskeleton organization and regulation, proteins associated with stress responses, and enzymes of the glycolytic and other metabolic pathways. Finally, this study yielded the first evidence of site-specific adduction of HNE to Cys-295 in tubulin α-1B chain, Cys-351 and Cys-499 in α-actinin-4, Cys-328 in vimentin, Cys-369 in d-3-phosphoglycerate dehydrogenase, and His-246 in aldolase A.« less
Surfing on the morning after: analysis of an emergency contraception website.
Gainer, Erin; Sollet, Christian; Ulmann, Marion; Lévy, Delphine; Ulmann, André
2003-03-01
The introduction of widespread nonprescription delivery of hormonal emergency contraception (EC) calls for development of innovative tools to provide information to and gather feedback from EC users. Individuals seeking confidential information on sexual health and contraception are increasingly turning to the Internet as the resource of choice. This study employed analytical software and manual content analysis to examine the use of a website dedicated to an EC product (www.norlevo.com) over the course of 2 years. Frequency of visits to and pageviews of the site increased consistently over the 2-year time period, and the bulk of the visitors to the site were EC users seeking responses to frequently asked questions. The most common concern raised by users was the occurrence of spotting and menstrual bleeding following EC use. This analysis reveals that within the context of nonprescription access to hormonal EC, a website can constitute a potent educational tool for health professionals and EC users and provide a valuable source of post-marketing feedback on product use.
Paillet, Frederick L.; Singhroy, V.H.; Hansen, D.T.; Pierce, R.R.; Johnson, A.I.
2002-01-01
Integration of geophysical data obtained at various scales can bridge the gap between localized data from boreholes and site-wide data from regional survey profiles. Specific approaches to such analysis include: 1) comparing geophysical measurements in boreholes with the same measurement made from the surface; 2) regressing geophysical data obtained in boreholes with water-sample data from screened intervals; 3) using multiple, physically independent measurements in boreholes to develop multivariate response models for surface geophysical surveys; 4) defining subsurface cell geometry for most effective survey inversion methods; and 5) making geophysical measurements in boreholes to serve as independent verification of geophysical interpretations. Integrated analysis of surface electromagnetic surveys and borehole geophysical logs at a study site in south Florida indicates that salinity of water in the surficial aquifers is controlled by a simple wedge of seawater intrusion along the coast and by a complex pattern of upward brine seepage from deeper aquifers throughout the study area. This interpretation was verified by drilling three additional test boreholes in carefully selected locations.
Global Proteome Analysis Links Lysine Acetylation to Diverse Functions in Oryza Sativa.
Xue, Chao; Liu, Shuai; Chen, Chen; Zhu, Jun; Yang, Xibin; Zhou, Yong; Guo, Rui; Liu, Xiaoyu; Gong, Zhiyun
2018-01-01
Lysine acetylation (Kac) is an important protein post-translational modification in both eukaryotes and prokaryotes. Herein, we report the results of a global proteome analysis of Kac and its diverse functions in rice (Oryza sativa). We identified 1353 Kac sites in 866 proteins in rice seedlings. A total of 11 Kac motifs are conserved, and 45% of the identified proteins are localized to the chloroplast. Among all acetylated proteins, 38 Kac sites are combined in core histones. Bioinformatics analysis revealed that Kac occurs on a diverse range of proteins involved in a wide variety of biological processes, especially photosynthesis. Protein-protein interaction networks of the identified proteins provided further evidence that Kac contributes to a wide range of regulatory functions. Furthermore, we demonstrated that the acetylation level of histone H3 (lysine 27 and 36) is increased in response to cold stress. In summary, our approach comprehensively profiles the regulatory roles of Kac in the growth and development of rice. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Nagai, Takashi; Horio, Takeshi; Yokoyama, Atsushi; Kamiya, Takashi; Takano, Hiroyuki; Makino, Tomoyuki
2012-06-01
On-site soil washing with iron(III) chloride reduces Cd levels in soil, and thus the human health risks caused by Cd in food. However, it may threaten aquatic organisms when soil washing effluent is discharged to open aquatic systems. Therefore, we conducted trial-scale on-site soil washing and ecological risk assessment in Nagano and Niigata prefectures, Japan. The ecological effect of effluent water was investigated by two methods. The first was bioassay using standard aquatic test organisms. Twice-diluted effluent water from the Nagano site and the original effluent water from the Niigata site had no significant effects on green algae, water flea, caddisfly, and fish. The safe dilution rates were estimated as 20 times and 10 times for the Nagano and Niigata sites, respectively, considering an assessment factor of 10. The second method was probabilistic effect analysis using chemical analysis and the species sensitivity distribution concept. The mixture effects of CaCl(2), Al, Zn, and Mn were considered by applying a response additive model. The safe dilution rates, assessed for a potentially affected fraction of species of 5%, were 7.1 times and 23.6 times for the Nagano and Niigata sites, respectively. The actual dilution rates of effluent water by river water at the Nagano and Niigata sites were 2200-67,000 times and 1300-110,000 times, respectively. These are much larger than the safe dilution rates derived from the two approaches. Consequently, the ecological risk to aquatic organisms of soil washing is evaluated as being below the concern level. Copyright © 2012 Elsevier Inc. All rights reserved.
Reif, Andrew G.
2002-01-01
IntroductionIn 1970, the Chester County Water Resources Authority (Pennsylvania) and the U.S. Geological Survey (USGS) established a long-term water-quality network with the goal of assessing the quality of streams in the county and understanding stream changes in response to urbanization using benthic-macroinvertebrate data. This database represents one of the longest continuous water-quality data sets in the country. Benthic macroinvertebrates are aquatic insects, such as mayflies, caddisflies, riffle beetles, and midges, and other invertebrates that live on the stream bottom. Benthic macroinvertebrates are useful in evaluating stream quality because their habitat preferences and low motility cause them to be affected directly by substances that enter the aquatic system. By evaluating the diversity and community structure of benthic-macroinvertebrate populations, a determination of stream quality can be made.Between 1981 and 1997, the network consisted of 43 sites in 5 major basins in Chester County—Delaware, Schuylkill, Brandywine, Big Elk and Octoraro, and Red and White Clay. Benthic-macroinvertebrate, water-chemistry, and habitat data were collected each year in October or November during base-flow conditions. Using these data, Reif evaluated the overall water-quality condition of Chester County streams. This Fact Sheet summarizes the key findings from Reif for streams in the Schuylkill River Basin. These streams include Pigeon Creek (site 10), Stony Run (site 6), French Creek (sites 12-16), Pickering Creek (sites 1-5), Little Valley Creek (site 49), and Valley Creek (site 50). This summary includes an analysis of stream conditions based on benthic-macroinvertebrate samples and an analysis of trends in stream conditions for the 17-year study period.
Oropeza-Aburto, Araceli; Cruz-Ramírez, Alfredo; Acevedo-Hernández, Gustavo J.; Pérez-Torres, Claudia-Anahí; Caballero-Pérez, Juan; Herrera-Estrella, Luis
2012-01-01
Plants have evolved a plethora of responses to cope with phosphate (Pi) deficiency, including the transcriptional activation of a large set of genes. Among Pi-responsive genes, the expression of the Arabidopsis phospholipase DZ2 (PLDZ2) is activated to participate in the degradation of phospholipids in roots in order to release Pi to support other cellular activities. A deletion analysis was performed to identify the regions determining the strength, tissue-specific expression, and Pi responsiveness of this regulatory region. This study also reports the identification and characterization of a transcriptional enhancer element that is present in the PLDZ2 promoter and able to confer Pi responsiveness to a minimal, inactive 35S promoter. This enhancer also shares the cytokinin and sucrose responsive properties observed for the intact PLDZ2 promoter. The EZ2 element contains two P1BS motifs, each of which is the DNA binding site of transcription factor PHR1. Mutation analysis showed that the P1BS motifs present in EZ2 are necessary but not sufficient for the enhancer function, revealing the importance of adjacent sequences. The structural organization of EZ2 is conserved in the orthologous genes of at least eight families of rosids, suggesting that architectural features such as the distance between the two P1BS motifs are also important for the regulatory properties of this enhancer element. PMID:22210906
Gregory, M. Brian; Calhoun, Daniel L.
2007-01-01
As part of the U.S. Geological Survey National Water-Quality Assessment Program?s effort to assess the physical, chemical, and biological responses of streams to urbanization, 30 wadable streams were sampled near Atlanta, Ga., during 2002?2003. Watersheds were selected to minimize natural factors such as geology, altitude, and climate while representing a range of urban development. A multimetric urban intensity index was calculated using watershed land use, land cover, infrastructure, and socioeconomic variables that are highly correlated with population density. The index was used to select sites along a gradient from low to high urban intensity. Response variables measured include stream hydrology and water temperature, instream habitat, field properties (pH, conductivity, dissolved oxygen, turbidity), nutrients, pesticides, suspended sediment, sulfate, chloride, Escherichia coli (E. coli) concentrations, and characterization of algal, invertebrate and fish communities. In addition, semipermeablemembrane devices (SPMDs)?passive samplers that concentrate hydrophobic organic contaminants such as polycyclicaromatic hydrocarbons (PAHs)?were used to evaluate water-quality conditions during the 4 weeks prior to biological sampling. Changes in physical, chemical, and biological conditions were evaluated using both nonparametric correlation analysis and nonmetric multidimensional scaling (MDS) ordinations and associated comparisons of dataset similarity matrices. Many of the commonly reported effects of watershed urbanization on streams were observed in this study, such as altered hydrology and increases in some chemical constituent levels. Analysis of water-chemistry data showed that specific conductance, chloride, sulfate, and pesticides increased as urbanization increased. Nutrient concentrations were not directly correlated to increases in development, but were inversely correlated to percent forest in the watershed. Analyses of SPMD-derived data showed that bioassays and certain chemical constituents such as pyrene and benzophenanthrene, both PAHs found in coal tar, were strongly correlated with measures of watershed urbanization. Hydrologic variability metrics indicated that as urban development increased, streams became flashier, with characteristic high flows having shorter duration. The hydrologic effects associated with urbanization were greatest during the fall and least apparent during the winter. No correlations were observed between increasing urbanization and stream temperature or changes in stream habitat. Algal, invertebrate, and fish communities exhibited statistically significant changes as watersheds became increasingly urban, with the strongest responses observed in the invertebrate community followed by fishes, then algal diatom communities. Invertebrate communities were the most responsive to increasing urbanization with Ephemeroptera, Plecoptera, and Tricoptera taxa, especially Plecoptera (stoneflies) responding negatively and most strongly to increasing urbanization. Invertebrate communities were influenced more significantly by water quality, although significant responses to altered hydrology also were noted. In terms of the fish community, the percentage of cyprinids present in the stream was the only Index of Biotic Integrity metric that responded negatively to increases in watershed urbanization. Fish community response to urbanization was intermediate relative to algae and invertebrates with respect to significant metric responses as well as the overall community response to increasing urbanization. Measures of hydrologic variability were the most influential environmental variables affecting the algal community. Although sites were originally chosen to represent a gradient of increasing urbanization, a cluster analysis performed on the component metrics of the urban index categorized sites into four distinct groups. Multivariate analysis based on nonmetric MDS and related analyses of data ma
Kawano, Noriyuki; Ohtaki, Megu
2006-02-01
The main objective of this paper is to identify salient experiences of those who were exposed to radiation by the nuclear tests at the Semipalatinsk Nuclear Tests Site (SNTS). In 2002, our research team of the Research Institute for Radiation Biology and Medicine, Hiroshima University, started to conduct some field research by means of a questionnaire survey. Through this, we expected to examine the health condition of the residents near the SNTS, identify their experiences from the nuclear tests, and understand the exposure path. This attempt at clarifying the reality of radiation exposure at Semipalatinsk through the use of a survey research method is the first of its kind. Among the responses to our survey, the present paper focuses mainly upon responses to the questions concerning the experiences of the nuclear tests. It deals mainly with direct experiences of nuclear tests of the residents characteristic to Semipalatinsk, including some new experiences hitherto unnoticed. The present paper touches upon their concrete direct experiences of flash, bomb blast, heat, rain and dust. We also discuss distinct experiences in Semipalatinsk such as evacuation, through the additional use of their testimonies. The data have been compared with the results obtained in a similar survey made in Hiroshima and Nagasaki. For the data analysis, a statistical method called logistic multiple linear regression analysis has been used.