From screen to structure with a harvestable microfluidic device.

PubMed

Stojanoff, Vivian; Jakoncic, Jean; Oren, Deena A; Nagarajan, V; Poulsen, Jens-Christian Navarro; Adams-Cioaba, Melanie A; Bergfors, Terese; Sommer, Morten O A

2011-08-01

Advances in automation have facilitated the widespread adoption of high-throughput vapour-diffusion methods for initial crystallization screening. However, for many proteins, screening thousands of crystallization conditions fails to yield crystals of sufficient quality for structural characterization. Here, the rates of crystal identification for thaumatin, catalase and myoglobin using microfluidic Crystal Former devices and sitting-drop vapour-diffusion plates are compared. It is shown that the Crystal Former results in a greater number of identified initial crystallization conditions compared with vapour diffusion. Furthermore, crystals of thaumatin and lysozyme obtained in the Crystal Former were used directly for structure determination both in situ and upon harvesting and cryocooling. On the basis of these results, a crystallization strategy is proposed that uses multiple methods with distinct kinetic trajectories through the protein phase diagram to increase the output of crystallization pipelines.

Laser scattering in a hanging drop vapor diffusion apparatus for protein crystal growth in a microgravity environment

NASA Technical Reports Server (NTRS)

Casay, G. A.; Wilson, W. W.

1992-01-01

One type of hardware used to grow protein crystals in the microgravity environment aboard the U.S. Space Shuttle is a hanging drop vapor diffusion apparatus (HDVDA). In order to optimize crystal growth conditions, dynamic control of the HDVDA is desirable. A critical component in the dynamically controlled system is a detector for protein nucleation. We have constructed a laser scattering detector for the HDVDA capable of detecting the nucleation stage. The detector was successfully tested for several scatterers differing in size using dynamic light scattering techniques. In addition, the ability to detect protein nucleation using the HDVDA was demonstrated for lysozyme.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baig, M.; Brown, A.; Eswaramoorthy, S.

Klebsiella pneumoniae, a gram-negative enteric bacterium, is found in nosocomial infections which are acquired during hospital stays for about 10% of hospital patients in the United States. The crystal structure of a putative oxidoreductase from K. pneumoniae has been determined. The structural information of this K. pneumoniae protein was used to understand its function. Crystals of the putative oxidoreductase enzyme were obtained by the sitting drop vapor diffusion method using Polyethylene glycol (PEG) 3350, Bis-Tris buffer, pH 5.5 as precipitant. These crystals were used to collect X-ray data at beam line X12C of the National Synchrotron Light Source (NSLS) atmore » Brookhaven National Laboratory (BNL). The crystal structure was determined using the SHELX program and refi ned with CNS 1.1. This protein, which is involved in the catalysis of an oxidation-reduction (redox) reaction, has an alpha/beta structure. It utilizes nicotinamide adenine dinucleotide phosphate (NADP) or nicotine adenine dinucleotide (NAD) to perform its function. This structure could be used to determine the active and co-factor binding sites of the protein, information that could help pharmaceutical companies in drug design and in determining the protein’s relationship to disease treatment such as that for pneumonia and other related pathologies.« less

Expression, crystallization and phasing of vacuolar H(+)-ATPase subunit C (Vma5p) of Saccharomyces cerevisiae.

PubMed

Drory, Omri; Mor, Adi; Frolow, Felix; Nelson, Nathan

2004-10-01

The expression, crystallization and phasing of subunit C (Vma5p) of the yeast (Saccharomyces cerevisiae) vacuolar proton-translocating ATPase (V-ATPase) is described. The expressed protein consists of 412 residues: 392 from the reading frame of Vma5p and 20 N-terminal residues originating from the plasmid. Diffraction-quality crystals were obtained using the hanging-drop and sitting-drop vapour-diffusion methods assisted by streak-seeding, with PEG 3350 as precipitant. The crystals formed in hanging drops diffracted to 1.80 A and belong to space group P4(3)2(1)2(1), with unit-cell parameters a = b = 62.54, c = 327.37 A, alpha = beta = gamma = 90 degrees. The structure was solved using SIRAS with a Lu(O2C2H3)2 heavy-atom derivative.

Crystallization and X-ray analysis of the salmon-egg lectin SEL24K

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murata, Kenji; Fisher, Andrew J.; Hedrick, Jerry L., E-mail: jlhedrick@ucdavis.edu

2007-05-01

The 24 kDa egg lectin of Chinook salmon (Oncorhynchus tshawytscha) was purified by affinity chromatography from salmon eggs and crystallized by the hanging-drop vapor-diffusion method using 15/4 EO/OH (pentaerythritol ethoxylate) as a precipitant. The 24 kDa egg lectin of Chinook salmon (Oncorhynchus tshawytscha) is released from the egg during the cortical reaction. The lectin functions in blocking polyspermy during the fertilization process. The egg lectin was purified by affinity chromatography from salmon eggs and crystallized by the hanging-drop vapor-diffusion method using 15/4 EO/OH (pentaerythritol ethoxylate) as a precipitant. The crystal diffracted synchrotron-radiation X-rays to 1.63 Å resolution. The crystal belongsmore » to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 93.0, b = 73.6, c = 113.6 Å, α = 90, β = 92.82, γ = 90°. The crystal is likely to contain eight molecules in the asymmetric unit (V{sub M} = 2.3 Å{sup 3} Da{sup −1}), corresponding to a solvent content of 45.5%. A self-rotation function suggests an arrangement with 222 point symmetry within the asymmetric unit.« less

Dropwise condensation

PubMed Central

Leach, R. N.; Stevens, F.; Langford, S. C.; Dickinson, J. T.

2008-01-01

Dropwise condensation of water vapor from a naturally cooling, hot water reservoir onto a hydrophobic polymer film and a silanized glass slide was studied by direct observation and simulations. The observed drop growth kinetics suggest that smallest drops grow principally by the diffusion of water adsorbed on the substrate to the drop perimeter, while drops larger than 50 μm in diameter grow principally by direct deposition from the vapor onto the drop surface. Drop coalescence plays a critical role in determining the drop size distribution, and stimulates the nucleation of new, small drops on the substrates. Simulations of drop growth incorporating these growth mechanisms provide a good description of the observed drop size distribution. Because of the large role played by coalescence, details of individual drop growth make little difference to the final drop size distribution. The rate of condensation per unit substrate area is especially high for the smallest drops, and may help account for the high heat transfer rates associated with dropwise condensation relative to filmwise condensation in heat exchange applications. PMID:17014129

Prediction of orthostatic hypotension in multiple system atrophy and Parkinson disease

PubMed Central

Sun, Zhanfang; Jia, Dandan; Shi, Yuting; Hou, Xuan; Yang, Xiaosu; Guo, Jifeng; Li, Nan; Wang, Junling; Sun, Qiying; Zhang, Hainan; Lei, Lifang; Shen, Lu; Yan, Xinxiang; Xia, Kun; Jiang, Hong; Tang, Beisha

2016-01-01

Orthostatic hypotension (OH) is common in multiple system atrophy (MSA) and Parkinson disease (PD), generally assessed through a lying-to-standing orthostatic test. However, standing blood pressure may not be available due to orthostatic intolerance or immobilization for such patients. Systolic blood pressure (SBP) and diastolic blood pressure (DBP) were successively measured in supine, sitting, and standing positions in patients with MSA and PD. Receiver operating characteristic analysis was used to evaluate diagnostic performance of the drops of sitting SBP or DBP. OH and severe OH were respectively regarded as “gold standard”. The drops of SBP in standing position were associated with increased disease severity for MSA and correlated with age for PD. In MSA group, drops in sitting SBP ≥ 14 mmHg or DBP ≥ 6 mmHg had highest validity for prediction of OH, and drops in sitting SBP ≥ 18 mmHg or DBP ≥ 8 mmHg for severe OH. In PD group, drops in sitting SBP ≥ 10 mmHg or DBP ≥ 6 mmHg had highest validity for prediction of OH. The lying-to-sitting orthostatic test is an alternative method for detection of OH in MSA and PD, especially when standing BP could not be validly measured due to various reasons. PMID:26867507

Atomistic modeling of dropwise condensation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sikarwar, B. S., E-mail: bssikarwar@amity.edu; Singh, P. L.; Muralidhar, K.

The basic aim of the atomistic modeling of condensation of water is to determine the size of the stable cluster and connect phenomena occurring at atomic scale to the macroscale. In this paper, a population balance model is described in terms of the rate equations to obtain the number density distribution of the resulting clusters. The residence time is taken to be large enough so that sufficient time is available for all the adatoms existing in vapor-phase to loose their latent heat and get condensed. The simulation assumes clusters of a given size to be formed from clusters of smallermore » sizes, but not by the disintegration of the larger clusters. The largest stable cluster size in the number density distribution is taken to be representative of the minimum drop radius formed in a dropwise condensation process. A numerical confirmation of this result against predictions based on a thermodynamic model has been obtained. Results show that the number density distribution is sensitive to the surface diffusion coefficient and the rate of vapor flux impinging on the substrate. The minimum drop radius increases with the diffusion coefficient and the impinging vapor flux; however, the dependence is weak. The minimum drop radius predicted from thermodynamic considerations matches the prediction of the cluster model, though the former does not take into account the effect of the surface properties on the nucleation phenomena. For a chemically passive surface, the diffusion coefficient and the residence time are dependent on the surface texture via the coefficient of friction. Thus, physical texturing provides a means of changing, within limits, the minimum drop radius. The study reveals that surface texturing at the scale of the minimum drop radius does not provide controllability of the macro-scale dropwise condensation at large timescales when a dynamic steady-state is reached.« less

Film boiling of mercury droplets

NASA Technical Reports Server (NTRS)

Baumeister, K. J.; Schoessow, G. J.; Chmielewski, C. E.

1975-01-01

Vaporization times of mercury droplets in Leidenfrost film boiling on a flat horizontal plate are measured in an air atmosphere. Extreme care was used to prevent large amplitude droplet vibrations and surface wetting; therefore, these data can be compared to film boiling theory. Diffusion from the upper surface of the drop appears as a dominant mode of mass transfer from the drop. A closed-form analytical film boiling theory is developed to account for the diffusive evaporation. Reasonable agreement between data and theory is seen.

Purification, crystallization and preliminary X-ray crystallographic studies of Rv3705c from Mycobacterium tuberculosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Feifei; Gao, Feng; Li, Honglin

The cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of Rv3705c from M. tuberculosis are described. The conserved protein Rv3705c from Mycobacterium tuberculosis has been cloned, expressed, purified and crystallized by the sitting-drop vapour-diffusion method using PEG 3350 as a precipitant. The Rv3705c crystals exhibited space group P6{sub 1}22 or P6{sub 5}22, with unit-cell parameters a = b = 198.0, c = 364.1 Å, α = β = 90, γ = 120°, and diffracted to a resolution of 3.3 Å.

Crystal structure of human dual specificity phosphatase, JNK stimulatory phosphatase-1, at 1.5 A resolution.

PubMed

Yokota, Takehiro; Nara, Yukinori; Kashima, Akiko; Matsubara, Keiko; Misawa, Satoru; Kato, Ryohei; Sugio, Shigetoshi

2007-02-01

Human JNK stimulatory phosphatase-1 (JSP-1) is a novel member of dual specificity phosphatases. A C-terminus truncated JSP-1 was expressed in Escherichia coli and was crystallized using the sitting-drop vapor diffusion method. Thin-plate crystals obtained at 278 K belong to a monoclinic space group, C2, with unit-cell parameters a = 84.0 A, b = 49.3 A, c = 47.3 A, and beta = 119.5 degrees , and diffract up to 1.5 A resolution at 100 K. The structure of JSP-1 has a single compact (alpha/beta) domain, which consists of six alpha-helices and five beta-strands, and shows a conserved structural scaffold in regard to both DSPs and PTPs. A cleft formed by a PTP-loop at the active site is very shallow, and is occupied by one sulfonate compound, MES, at the bottom. In the binary complex structure of JSP-1 with MES, the conformations of three important segments in regard to the catalytic mechanism are not similar to those in PTP1B. JSP-1 has no loop corresponding to the Lys120-loop of PTP1B, and tryptophan residue corresponding to the substrate-stacking in PTP1B is substituted by alanine residue in JSP-1. Copyright 2006 Wiley-Liss, Inc.

Purification, characterization, and crystallization of Crocodylus siamensis hemoglobin.

PubMed

Jandaruang, Jinda; Siritapetawee, Jaruwan; Songsiriritthigul, Chomphunuch; Preecharram, Sutthidech; Azuma, Taoka; Dhiravisit, Apisak; Fukumori, Yoshihiro; Thammasirirak, Sompong

2014-08-01

Crocodylus siamensis hemoglobin was purified by a size exclusion chromatography, Sephacryl S-100 with buffer containing dithiothreitol. The purified Hb was dissociated to be two forms (α chain and β chain) which observed by SDS-PAGE, indicated that the C. siamensis Hb was an unpolymerized form. The unpolymerized Hb (composed of two α chains and two β chains) showed high oxygen affinity at 3.13 mmHg (P(50)) and 1.96 (n value), and a small Bohr effect (δH(+) = -0.29) at a pH of 6.9-8.4. Adenosine triphosphate did not affect the oxygenation properties, whereas bicarbonate ions strongly depressed oxygen affinity. Crude C. siamensis Hb solutions were showed high O(2) affinity at P(50) of 2.5 mmHg which may assure efficient utilization of the lung O(2) reserve during breath holding and diving. The purified Hbs were changed to cyanmethemoglobin forms prior crystallization. Rod- and plate-shaped crystals were obtained by the sitting-drop vapor-diffusion method at 5 °C using equal volumes of protein solution (37 mg/ml) and reservoir [10-13 % (w/v) PEG 4000, with 0.1 M Tris buffer in present of 0.2 M MgCl(2)·6H(2)O] solution at a pH of 7.0-8.5.

Evaporation of a sessile water drop and a drop of aqueous salt solution.

PubMed

Misyura, S Y

2017-11-07

The influence of various factors on the evaporation of drops of water and aqueous salt solution has been experimentally studied. Typically, in the studies of drop evaporation, only the diffusive vapor transfer, radiation and the molecular heat conduction are taken into account. However, vapor-gas convection plays an important role at droplet evaporation. In the absence of droplet boiling, the influence of gas convection turns out to be the prevailing factor. At nucleate boiling, a prevailing role is played by bubbles generation and vapor jet discharge at a bubble collapse. The gas convection behavior for water and aqueous salt solution is substantially different. With a growth of salt concentration over time, the influence of the convective component first increases, reaches an extremum and then significantly decreases. At nucleate boiling in a salt solution it is incorrect to simulate the droplet evaporation and the heat transfer in quasi-stationary approximation. The evaporation at nucleate boiling in a liquid drop is divided into several characteristic time intervals. Each of these intervals is characterized by a noticeable change in both the evaporation rate and the convection role.

Crystallization and preliminary X-ray diffraction of the DEAD-box protein Mss116p complexed with an RNA oligonucleotide and AMP-PNP

DOE Office of Scientific and Technical Information (OSTI.GOV)

Del Campo, Mark; Lambowitz, Alan M.; Texas)

2009-09-02

The Saccharomyces cerevisiae DEAD-box protein Mss116p is a general RNA chaperone which functions in mitochondrial group I and group II intron splicing, translation and RNA-end processing. For crystallization trials, full-length Mss116p and a C-terminally truncated protein (Mss116p/{Delta}598-664) were overproduced in Escherichia coli and purified to homogeneity. Mss116p exhibited low solubility in standard solutions ({le}1 mg ml{sup -1}), but its solubility could be increased by adding 50 mM L-arginine plus 50 mM L-glutamate and 50% glycerol to achieve concentrations of {approx}10 mg ml{sup -1}. Initial crystals were obtained by the microbatch method in the presence of a U{sub 10} RNA oligonucleotidemore » and the ATP analog AMP-PNP and were then improved by using seeding and sitting-drop vapor diffusion. A cryocooled crystal of Mss116p/{Delta}598-664 in complex with AMP-PNP and U{sub 10} belonged to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 88.54, b = 126.52, c = 55.52 {angstrom}, and diffracted X-rays to beyond 1.9 {angstrom} resolution using synchrotron radiation from sector 21 at the Advanced Photon Source.« less

High-throughput method for optimum solubility screening for homogeneity and crystallization of proteins

DOEpatents

Kim, Sung-Hou [Moraga, CA; Kim, Rosalind [Moraga, CA; Jancarik, Jamila [Walnut Creek, CA

2012-01-31

An optimum solubility screen in which a panel of buffers and many additives are provided in order to obtain the most homogeneous and monodisperse protein condition for protein crystallization. The present methods are useful for proteins that aggregate and cannot be concentrated prior to setting up crystallization screens. A high-throughput method using the hanging-drop method and vapor diffusion equilibrium and a panel of twenty-four buffers is further provided. Using the present methods, 14 poorly behaving proteins have been screened, resulting in 11 of the proteins having highly improved dynamic light scattering results allowing concentration of the proteins, and 9 were crystallized.

Crystallization and X-ray diffraction analysis of 6-­aminohexanoate-dimer hydrolase from Arthrobacter sp. KI72

PubMed Central

Ohki, Taku; Mizuno, Nobuhiro; Shibata, Naoki; Takeo, Masahiro; Negoro, Seiji; Higuchi, Yoshiki

2005-01-01

To investigate the structure–function relationship between 6-aminohexanoate-dimer hydrolase (EII) from Arthrobacter sp. and a cryptic protein (EII′) which shows 88% sequence identity to EII, a hybrid protein (named Hyb-24) of EII and EII′ was overexpressed, purified and crystallized using the sitting-drop vapour-diffusion method with ammonium sulfate as a precipitant in MES buffer pH 6.5. The crystal belongs to space group P3121 or P3221, with unit-cell parameters a = b = 96.37, c = 113.09 Å. Diffraction data were collected from native and methylmercuric chloride derivative crystals to resolutions of 1.75 and 1.80 Å, respectively. PMID:16511198

Purification, crystallization and preliminary X-ray diffraction studies of N-acetylglucosamine-phosphate mutase from Candida albicans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishitani, Yuichi; Maruyama, Daisuke; Nonaka, Tsuyoshi

2006-04-01

Preliminary X-ray diffraction studies on N-acetylglucosamine-phosphate mutase from C. albicans are reported. N-acetylglucosamine-phosphate mutase (AGM1) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine (UDP-GlcNAc) in eukaryotes and belongs to the α-d-phosphohexomutase superfamily. AGM1 from Candida albicans (CaAGM1) was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals obtained belong to the primitive monoclinic space group P2{sub 1}, with unit-cell parameters a = 60.2, b = 130.2, c = 78.0 Å, β = 106.7°. The crystals diffract X-rays to beyond 1.8 Å resolution using synchrotron radiation.

A Fiber Optic Probe for Monitoring Protein Aggregation, Nucleation, and Crystallization

NASA Technical Reports Server (NTRS)

Ansari, Rafat R.; Suh, Kwang I.; Arabshahi, Alireza; Wilson, William W.; Bray, Terry L.; DeLucas, Lawrence J.

1996-01-01

Protein crystals are experimentally grown in hanging drops in microgravity experiments on-board the Space Shuttle orbiter. The technique of dynamic light scattering (DLS) can be used to monitor crystal growth process in hanging droplets (approx. 30 (L)) in microgravity experiments, but elaborate instrumentation and optical alignment problems have made in-situ applications difficult. In this paper we demonstrate that such experiments are now feasible. We apply a newly developed fiber optic probe to various earth and space (micro- gravity) bound protein crystallization system configurations to test its capability. These include conventional batch (cuvette or capillary) systems, hanging drop method in a six-pack hanging drop vapor diffusion apparatus (HDVDA), a modified HDVDA for temperature- induced nucleation and aggregation studies, and a newly envisioned dynamically controlled vapor diffusion system (DCVDS) configuration. Our compact system exploits the principles of DLS and offers a fast (within a few seconds) means of quantitatively and non-invasively monitoring the various growth stages of protein crystallization. In addition to DLS capability, the probe can also be used for performing single-angle static light scattering measurements. It utilizes extremely low levels of laser power (approx. few (W)) without a need of having any optical alignment and vibration isolation. The compact probe is also equipped with a miniaturized microscope for visualization of macroscopic protein crystals. This new optical diagnostic system opens up enormous opportunity for exploring new ways to grow good quality crystals suitable for x-ray crystallographic analysis and may help develop a concrete scientific basis for understanding the process of crystallization.

Protein crystal growth in space

NASA Technical Reports Server (NTRS)

Bugg, C. E.; Clifford, D. W.

1987-01-01

The advantages of protein crystallization in space, and the applications of protein crystallography to drug design, protein engineering, and the design of synthetic vaccines are examined. The steps involved in using protein crystallography to determine the three-dimensional structure of a protein are discussed. The growth chamber design and the hand-held apparatus developed for protein crystal growth by vapor diffusion techniques (hanging-drop method) are described; the experimental data from the four Shuttle missions are utilized to develop hardware for protein crystal growth in space and to evaluate the effects of gravity on protein crystal growth.

Crystallization and crystallographic studies of kallistatin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Fang; Zhou, Aiwu; Wei, Zhenquan, E-mail: weizhq@gmail.com

2015-08-25

The crystallization of human kallistatin in the relaxed conformation is reported. Kallistatin is a serine protease inhibitor (serpin) which specifically inhibits human tissue kallikrein; however, its inhibitory activity is inhibited by heparin. In order to elucidate the underlying mechanism, recombinant human kallistatin was prepared in Escherichia coli and the protein was crystallized by the sitting-drop vapour-diffusion method. X-ray diffraction data were collected to 1.9 Å resolution. The crystals were found to belong to space group P6{sub 1}, with unit-cell parameters a = 113.51, b = 113.51, c = 76.17 Å. Initial analysis indicated that the crystallized kallistatin was in amore » relaxed conformation, with its reactive-centre loop inserted in the central β-sheet.« less

Expression, purification, crystallization and preliminary X-ray diffraction analysis of Bifidobacterium adolescentis xylose isomerase

PubMed Central

dos Reis, Caio Vinicius; Bernardes, Amanda; Polikarpov, Igor

2013-01-01

Xylose isomerase (EC 5.3.1.5) is a key enzyme in xylose metabolism which is industrially important for the transformation of glucose and xylose into fructose and xylulose, respectively. The Bifidobacterium adolescentis xylA gene (NC_008618.1) encoding xylose isomerase (XI) was cloned and the enzyme was overexpressed in Escherichia coli. Purified recombinant XI was crystallized using the sitting-drop vapour-diffusion method with polyethylene glycol 3350 as the precipitating agent. A complete native data set was collected to 1.7 Å resolution using a synchrotron-radiation source. The crystals belonged to the orthorhombic space group P21212, with unit-cell parameters a = 88.78, b = 123.98, c = 78.63 Å. PMID:23695585

Crystallization and preliminary X-ray analysis of PH1566, a putative ribosomal RNA-processing factor from the hyperthermophilic archaeon Pyrococcus horikoshii OT3

PubMed Central

Jia, Min Ze; Ohtsuka, Jun; Lee, Woo Cheol; Nagata, Koji; Tanokura, Masaru

2006-01-01

A putative ribosomal RNA-processing factor consisting of two KH domains from Pyrococcus horikoshii OT3 (PH1566; 25 kDa) was crystallized by the sitting-drop vapour-diffusion method using PEG 3000 as the precipitant. The crystals diffracted X-rays to beyond 2.0 Å resolution using a synchrotron-radiation source. The space group of the crystals was determined as primitive orthorhombic P212121, with unit-cell parameters a = 45.9, b = 47.4, c = 95.7 Å. The crystals contain one molecule in the asymmetric unit (V M = 2.5 Å3 Da−1) and have a solvent content of 50%. PMID:16511260

Drop deployment system for crystal growth apparatus

NASA Technical Reports Server (NTRS)

Rhodes, Percy H. (Inventor); Snyder, Robert S. (Inventor); Pusey, Marc L. (Inventor)

1992-01-01

This invention relates to a crystal growth apparatus (10) generally used for growing protein crystals wherein a vapor diffusion method is used for growing the crystals. In this apparatus, a precipitating solution and a solution containing dissolved crystalline material are stored in separate vials (12, 14), each having a resilient diaphragm (28) across one end and an opening (24) with a puncturable septum (26) thereacross at an opposite end. The vials are placed in receptacles (30) having a manifold (41) with a manifold diaphragm (42) in contact with the vial diaphragm at one end of the receptacle and a hollow needle (36) for puncturing the septum at the other end of the manifold. The needles of each vial communicate with a ball mixer (40) that mixes the precipitate and protein solutions and directs the mixed solution to a drop support (64) disposed in a crystal growth chamber (16), the drop support being a tube with an inner bevelled surface (66) that provides more support for the drop (68) than the tubes of the prior art. A sealable storage region (70) intermediate the drop support and mixer provides storage of the drop (68) and the grown crystals.

METHOD OF MAKING TUNGSTEN FILAMENTS

DOEpatents

Frazer, J.W.

1962-12-18

A method of making tungsten filaments is described in which the tungsten is completely free of isotope impurities in the range of masses 234 to 245 for use in mass spectrometers. The filament comprises a tantalum core generally less than 1 mil in diameter having a coating of potassium-free tantalum-diffused tungsten molecularly bonded thereto. In the preferred process of manufacture a short, thin tantalum filament is first mounted between terminal posts mounted in insulated relation through a backing plate. The tungsten is most conveniently vapor plated onto the tantalum by a tungsten carbonyl vapor decomposition method having a critical step because of the tendency of the tantalum to volatilize at the temperature of operntion of the filament. The preferred recipe comprises volatilizing tantalum by resistance henting until the current drops by about 40%, cutting the voltage back to build up the tungsten, and then gradually building the temperature back up to balance the rate of tungsten deposition with the rate of tantalum volatilization. (AEC)

An evaporation model of multicomponent solution drops

NASA Astrophysics Data System (ADS)

Sartori, Silvana; Liñán, Amable; Lasheras, Juan C.

2010-11-01

Solutions of polymers are widely used in the pharmaceutical industry as tablets coatings. These allow controlling the rate at which the drug is delivered, taste or appearance. The coating is performed by spraying and drying the tablets at moderate temperatures. The wetting of the coating solution on the pill's surface depends on the droplet Webber and Re numbers, angle of impact and on the rheological properties of the droplet. We present a model for the evaporation of multicomponent solutions droplets in a hot air environment with temperatures substantially lower than the boiling temperature of the solvent. As the liquid vaporizes from the surface the fluid in the drop increases in concentration, until reaching its saturation point. After saturation, precipitation occurs uniformly within the drop. As the surface regresses, a compacting front formed by the precipitate at its maximum packing density advances into the drop, while the solute continues precipitating uniformly. This porous shell grows fast due to the double effect of surface regression and precipitation. The evaporation rate is determined by the rates at which heat is transported to the droplet surface and at which liquid vapor diffuses away from it. When the drop is fully compacted, the evaporation is drastically reduced.

Crystallization and preliminary X-ray diffraction analysis of red clover necrotic mosaic virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martin, Stanton L.; Guenther, Richard H.; Sit, Tim L.

2010-11-12

Red clover necrotic mosaic virus (RCNMV) is a species that belongs to the Tombusviridae family of plant viruses with a T = 3 icosahedral capsid. RCNMV virions were purified and were crystallized for X-ray analysis using the hanging-drop vapor-diffusion method. Self-rotation functions and systematic absences identified the space group as I23, with two virions in the unit cell. The crystals diffracted to better than 4 {angstrom} resolution but were very radiation-sensitive, causing rapid decay of the high-resolution reflections. The data were processed to 6 {angstrom} in the analysis presented here.

Preliminary investigations of protein crystal growth using the Space Shuttle

NASA Technical Reports Server (NTRS)

Delucas, L. J.; Suddath, F. L.; Snyder, R.; Naumann, R.; Broom, M. B.; Pusey, M.; Yost, V.; Herren, B .; Carter, D.

1986-01-01

Four preliminary Shuttle experiments are described which have been used to develop prototype hardware for a more advanced system that will evaluate effects of gravity on protein crystal growth. The first phase of these experiments has centered on the development of micromethods for protein crystal growth by vapor-diffusion techniques (using a space version of the hanging-drop method) and on dialysis using microdialysis cells. Results suggest that the elimination of density-driven sedimentation can effect crystal morphology. In the dialysis experiment, space-grown crystals of concanavalin B were three times longer and 1/3 the thickness of earth-grown crystals.

Crystallization and diffraction analysis of [beta]-N-acetylhexosaminidase from Aspergillus oryzae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vanek, Ondrej; Brynd, Jirí; Hofbauerová, Katerina

2012-05-08

Fungal {beta}-N-acetylhexosaminidases are enzymes that are used in the chemoenzymatic synthesis of biologically interesting oligosaccharides. The enzyme from Aspergillus oryzae was produced and purified from its natural source and crystallized using the hanging-drop vapor-diffusion method. Diffraction data from two crystal forms (primitive monoclinic and primitive tetragonal) were collected to resolutions of 3.2 and 2.4 {angstrom}, respectively. Electrophoretic and quantitative N-terminal protein-sequencing analyses confirmed that the crystals are formed by a complete biologically active enzyme consisting of a glycosylated catalytic unit and a noncovalently attached propeptide.

Determination of 1-octanol-air partition coefficient using gaseous diffusion in the air boundary layer.

PubMed

Ha, Yeonjeong; Kwon, Jung-Hwan

2010-04-15

Exact determination of the partition coefficient between 1-octanol and air (K(OA)) is very important because it is a key descriptor for describing the thermodynamic partitioning between the air and organic phases. In spite of its importance, the number and quality of experimental K(OA) values for hydrophobic organic chemicals are limited because of experimental difficulties. Thus, to measure K(OA) values, a high-throughput method was developed that used liquid-phase extraction with 1-octanol drop at the tip of a microsyringe needle. The concentration in the headspace surrounding the 1 muL octanol drop was equilibrated with liquid octanol containing polycyclic aromatic hydrocarbons (PAHs). The change in concentrations of PAHs in the octanol drop was measured to obtain mass transfer rate constants, and these rate constants were then converted into K(OA) values using a film diffusion model. Thirteen polycyclic aromatic hydrocarbons with log K(OA) between 5 and 12 were chosen for the proof of the principle. Experimental determination of log K(OA) was accomplished in 30 h for PAHs with their log K(OA) less than 11. The measured log K(OA) values were very close to those obtained by various experimental and estimation methods in the literature, suggesting that this new method can provide a fast and easy determination of log K(OA) values for many chemicals of environmental interests. In addition, the applicability of the method can be extended to determine Henry's law constant for compounds with low vapor pressure and to estimate gaseous transfer rate of semivolatile compounds for environmental fate modeling.

Smoothed particle hydrodynamics method for evaporating multiphase flows.

PubMed

Yang, Xiufeng; Kong, Song-Charng

2017-09-01

The smoothed particle hydrodynamics (SPH) method has been increasingly used for simulating fluid flows; however, its ability to simulate evaporating flow requires significant improvements. This paper proposes an SPH method for evaporating multiphase flows. The present SPH method can simulate the heat and mass transfers across the liquid-gas interfaces. The conservation equations of mass, momentum, and energy were reformulated based on SPH, then were used to govern the fluid flow and heat transfer in both the liquid and gas phases. The continuity equation of the vapor species was employed to simulate the vapor mass fraction in the gas phase. The vapor mass fraction at the interface was predicted by the Clausius-Clapeyron correlation. An evaporation rate was derived to predict the mass transfer from the liquid phase to the gas phase at the interface. Because of the mass transfer across the liquid-gas interface, the mass of an SPH particle was allowed to change. Alternative particle splitting and merging techniques were developed to avoid large mass difference between SPH particles of the same phase. The proposed method was tested by simulating three problems, including the Stefan problem, evaporation of a static drop, and evaporation of a drop impacting a hot surface. For the Stefan problem, the SPH results of the evaporation rate at the interface agreed well with the analytical solution. For drop evaporation, the SPH result was compared with the result predicted by a level-set method from the literature. In the case of drop impact on a hot surface, the evolution of the shape of the drop, temperature, and vapor mass fraction were predicted.

Purification, crystallization and preliminary X-ray diffraction of the C-terminal bromodomain from human BRD2

PubMed Central

Umehara, Takashi; Wakamori, Masatoshi; Tanaka, Akiko; Padmanabhan, Balasundaram; Yokoyama, Shigeyuki

2007-01-01

BRD2 is a bromodomain-containing BET-family protein that associates with acetylated histones throughout the cell cycle. Although the tertiary structures of the bromodomains involved in histone acetyl transfer are already known, the structures of the BET-type bromodomains, which are required for tight association with acetylated chromatin, are poorly understood. Here, the expression, purification and crystallization of the C-terminal bromodomain of human BRD2 are reported. The protein was crystallized by the sitting-drop vapour-diffusion method in the orthorhombic space group P21212, with unit-cell parameters a = 71.78, b = 52.60, c = 32.06 Å and one molecule per asymmetric unit. The crystal diffracted beyond 1.80 Å resolution using synchrotron radiation. PMID:17620725

Purification, crystallization and preliminary X-ray analysis of the IgV domain of human nectin-4.

PubMed

Xu, Xiang; Zhang, Xiaoai; Lu, Guangwen; Cai, Yongping

2012-08-01

Nectin-4 belongs to a family of immunoglobulin-like cell adhesion molecules and is highly expressed in cancer cells. Recently, nectin-4 was found to be a receptor of measles virus and the IgV domain sustains strong binding to measles virus H protein. In this study, the successful expression and purification of human nectin-4 V domain (nectin-4v) is reported. The purified protein was crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.8 Å resolution and belonged to space group P2(1), with unit-cell parameters a = 33.1, b = 51.7, c = 56.9 Å, β = 94.7°. Preliminary analysis of the diffraction data was also performed.

Purification, crystallization and preliminary X-ray analysis of the IgV domain of human nectin-4

PubMed Central

Xu, Xiang; Zhang, Xiaoai; Lu, Guangwen; Cai, Yongping

2012-01-01

Nectin-4 belongs to a family of immunoglobulin-like cell adhesion molecules and is highly expressed in cancer cells. Recently, nectin-4 was found to be a receptor of measles virus and the IgV domain sustains strong binding to measles virus H protein. In this study, the successful expression and purification of human nectin-4 V domain (nectin-4v) is reported. The purified protein was crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.8 Å resolution and belonged to space group P21, with unit-cell parameters a = 33.1, b = 51.7, c = 56.9 Å, β = 94.7°. Preliminary analysis of the diffraction data was also performed. PMID:22869128

Preliminary X-ray diffraction analysis of a thermophilic β-1,3-1,4-glucanase from Clostridium thermocellum.

PubMed

Zhang, Lilan; Zhao, Puya; Chen, Chun-Chi; Huang, Chun-Hsiang; Ko, Tzu-Ping; Zheng, Yingying; Guo, Rey-Ting

2014-07-01

β-1,3-1,4-Glucanases catalyze the specific hydrolysis of internal β-1,4-glycosidic bonds adjacent to the 3-O-substituted glucose residues in mixed-linked β-glucans. The thermophilic glycoside hydrolase CtGlu16A from Clostridium thermocellum exhibits superior thermal profiles, high specific activity and broad pH adaptability. Here, the catalytic domain of CtGlu16A was expressed in Escherichia coli, purified and crystallized in the trigonal space group P3121, with unit-cell parameters a=b=74.5, c=182.9 Å, by the sitting-drop vapour-diffusion method and diffracted to 1.95 Å resolution. The crystal contains two protein molecules in an asymmetric unit. Further structural determination and refinement are in progress.

Crystallization and preliminary crystallographic analysis of human common-type acylphosphatase

PubMed Central

Yeung, Rachel C. Y.; Lam, Sonia Y.; Wong, Kam-Bo

2006-01-01

Human acylphosphatase, an 11 kDa enzyme that catalyzes the hydrolysis of carboxyl phosphate bonds, has been studied extensively as a model system for amyloid-fibril formation. However, the structure is still not known of any isoform of human acylphosphatase. Here, the crystallization and preliminary X-­ray diffraction data analysis of human common-type acylphosphatase are reported. Crystals of human common-type acylphosphatase have been grown by the sitting-drop vapour-diffusion method at 289 K using polyethylene glycol 4000 as precipitant. Diffraction data were collected to 1.45 Å resolution at 100 K. The crystals belong to space group P212121, with unit-cell parameters a = 42.58, b = 47.23, c = 57.26 Å. PMID:16511269

Purification, crystallization and preliminary X-ray diffraction analysis of the Escherichia coli common pilus chaperone EcpB

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garnett, James A.; Diallo, Mamou; Matthews, Steve J., E-mail: s.j.matthews@imperial.ac.uk

In Escherichia coli, the common pilus (Ecp) belongs to an alternative chaperone–usher pathway that plays a major role in both early biofilm formation and host-cell adhesion. Initial attempts at crystallizing the chaperone EcpB using natively purified protein from the bacterial periplasm were not successful; however, after the isolation of EcpB under denaturing conditions and subsequent refolding, crystals were obtained at pH 8.0 using the sitting-drop method of vapour diffusion. This is the first time that this refolding strategy has been used to purify CU chaperones. Pili are key cell-surface components that allow the attachment of bacteria to both biological andmore » abiotic solid surfaces, whilst also mediating interactions between themselves. In Escherichia coli, the common pilus (Ecp) belongs to an alternative chaperone–usher (CU) pathway that plays a major role in both early biofilm formation and host-cell adhesion. The chaperone EcpB is involved in the biogenesis of the filament, which is composed of EcpA and EcpD. Initial attempts at crystallizing EcpB using natively purified protein from the bacterial periplasm were not successful; however, after the isolation of EcpB under denaturing conditions and subsequent refolding, crystals were obtained at pH 8.0 using the sitting-drop method of vapour diffusion. Diffraction data have been processed to 2.4 Å resolution. These crystals belonged to the trigonal space group P3{sub 1}21 or P3{sub 2}21, with unit-cell parameters a = b = 62.65, c = 121.14 Å and one monomer in the asymmetric unit. Molecular replacement was unsuccessful, but selenomethionine-substituted protein and heavy-atom derivatives are being prepared for phasing. The three-dimensional structure of EcpB will provide invaluable information on the subtle mechanistic differences in biogenesis between the alternative and classical CU pathways. Furthermore, this is the first time that this refolding strategy has been used to purify CU chaperones, and it could be implemented in similar systems where it has not been possible to obtain highly ordered crystals.« less

Methods for characterizing subsurface volatile contaminants using in-situ sensors

DOEpatents

Ho, Clifford K [Albuquerque, NM

2006-02-21

An inverse analysis method for characterizing diffusion of vapor from an underground source of volatile contaminant using data taken by an in-situ sensor. The method uses one-dimensional solutions to the diffusion equation in Cartesian, cylindrical, or spherical coordinates for isotropic and homogenous media. If the effective vapor diffusion coefficient is known, then the distance from the source to the in-situ sensor can be estimated by comparing the shape of the predicted time-dependent vapor concentration response curve to the measured response curve. Alternatively, if the source distance is known, then the effective vapor diffusion coefficient can be estimated using the same inverse analysis method. A triangulation technique can be used with multiple sensors to locate the source in two or three dimensions. The in-situ sensor can contain one or more chemiresistor elements housed in a waterproof enclosure with a gas permeable membrane.

Reconciling Isotopic Partitioning Estimates of Moisture Fluxes in Semi-arid Landscapes Through a New Modeling Approach for Evaporation

NASA Astrophysics Data System (ADS)

Kaushik, A.; Berkelhammer, M. B.; O'Neill, M.; Noone, D.

2017-12-01

The partitioning of land surface latent heat flux into evaporation and transpiration remains a challenging problem despite a basic understanding of the underlying mechanisms. Water isotopes are useful tracers for separating evaporation and transpiration contributions because E and T have distinct isotopic ratios. Here we use the isotope-based partitioning method at a semi-arid grassland tall-tower site in Colorado. Our results suggest that under certain conditions evaporation cannot be isotopically distinguished from transpiration without modification of existing partitioning techniques. Over a 4-year period, we measured profiles of stable oxygen and hydrogen isotope ratios of water vapor from the surface to 300 m and soil water down to 1 m along with standard meteorological fluxes. Using these data, we evaluated the contributions of rainfall, equilibration, surface water vapor exchange and sub-surface vapor diffusion to the isotopic composition of evapotranspiration (ET). Applying the standard isotopic approach to find the transpiration portion of ET (i.e., T/ET), we see a significant discrepancy compared with a method to constrain T/ET based on gross primary productivity (GPP). By evaluating the kinetic fractionation associated with soil evaporation and vapor diffusion we find that a significant proportion (58-84%) of evaporation following precipitation is non-fractionating. This is possible when water from isolated soil layers is being nearly completely evaporated. Non-fractionating evaporation looks isotopically like transpiration and therefore leads to an overestimation of T/ET. Including non-fractionating evaporation reconciles the isotope-based partitioning estimates of T/ET with the GPP method, and may explain the overestimation of T/ET from isotopes compared to other methods. Finally, we examine the application of non-fractionating evaporation to other boundary layer moisture flux processes such as rain evaporation, where complete evaporation of smaller drop pools may produce a similarly weaker kinetic effect.

Protein crystal growth results from shuttle flight 51-F

NASA Technical Reports Server (NTRS)

Bugg, C. E.

1985-01-01

The protein crystal growth (PCG) experiments run on 51-F were analyzed. It was found that: (1) sample stability is increased over that observed during the experiments on flight 51-D; (2) the dialysis experiments produced lysozyme crystals that were significantly larger than those obtained in our identical ground-based studies; (3) temperature fluctuations apparently caused problems during the crystallization experiments on 51-F; (4) it is indicated that teflon tape stabilizes droplets on the syringe tips; (5) samples survived during the reentry and landing in glass tips that were not stoppered with plungers; (6) from the ground-based studies, it was expected that equilibration should be complete within 2 to 4 days for all of these vapor-diffusion experiments, thus it appears that the vapor diffusion rates are somewhat slower under microgravity conditions; (7) drop tethering was highly successful, all four of the tethered drops were stable, even though they contained MPD solutions; (8) the PCG experiments on 51-F were done to assess the hardware and experimental procedures that are developed for future flights, when temperature control will be available. Lysozyme crystals obtained by microdialysis are considerably larger than those obtained on the ground, using the identical apparatus and procedures.

Purification, crystallization and preliminary X-ray diffraction analysis of GatD, a glutamine amidotransferase-like protein from Staphylococcus aureus peptidoglycan

PubMed Central

Vieira, Diana; Figueiredo, Teresa A.; Verma, Anil; Sobral, Rita G.; Ludovice, Ana M.; de Lencastre, Hermínia; Trincao, Jose

2014-01-01

Amidation of peptidoglycan is an essential feature in Staphylococcus aureus that is necessary for resistance to β-lactams and lysozyme. GatD, a 27 kDa type I glutamine amidotransferase-like protein, together with MurT ligase, catalyses the amidation reaction of the glutamic acid residues of the peptidoglycan of S. aureus. The native and the selenomethionine-derivative proteins were crystallized using the sitting-drop vapour-diffusion method with polyethylene glycol, sodium acetate and calcium acetate. The crystals obtained diffracted beyond 1.85 and 2.25 Å, respectively, and belonged to space group P212121. X-ray diffraction data sets were collected at Diamond Light Source (on beamlines I02 and I04) and were used to obtain initial phases. PMID:24817726

Crystallization and preliminary X-ray diffraction analysis of the peripheral light-harvesting complex LH2 from Marichromatium purpuratum.

PubMed

Cranston, Laura J; Roszak, Aleksander W; Cogdell, Richard J

2014-06-01

LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment-protein complex that is involved in harvesting light energy and transferring it to the LH1-RC `core' complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a=b=109.36, c=80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer.

Crystallization and preliminary X-ray diffraction analysis of the peripheral light-harvesting complex LH2 from Marichromatium purpuratum

PubMed Central

Cranston, Laura J.; Roszak, Aleksander W.; Cogdell, Richard J.

2014-01-01

LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment–protein complex that is involved in harvesting light energy and transferring it to the LH1–RC ‘core’ complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a = b = 109.36, c = 80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer. PMID:24915099

Expression, purification, crystallization and preliminary X-ray analysis of tannase from Lactobacillus plantarum.

PubMed

Wu, Mingbo; Peng, Xiaohong; Wen, Hua; Wang, Qin; Chen, Qianming; McKinstry, William J; Ren, Bin

2013-04-01

Tannase catalyses the hydrolysis of the galloyl ester bond of tannins to release gallic acid. It belongs to the serine esterases and has wide applications in the food, feed, beverage, pharmaceutical and chemical industries. The tannase from Lactobacillus plantarum was cloned, expressed and purified. The protein was crystallized by the sitting-drop vapour-diffusion method with microseeding. The crystals belonged to space group P1, with unit-cell parameters a = 46.5, b = 62.8, c = 83.8 Å, α = 70.4, β = 86.0, γ = 79.4°. Although the enzyme exists mainly as a monomer in solution, it forms a dimer in the asymmetric unit of the crystal. The crystals diffracted to beyond 1.60 Å resolution using synchrotron radiation and a complete data set was collected to 1.65 Å resolution.

A variational approach to the study of capillary phenomena

NASA Technical Reports Server (NTRS)

Emmer, M.; Gonzalez, E.; Tamanini, I.

1982-01-01

The problem of determining the free surface of a liquid in a capillary tube, and of a liquid drop, sitting first on a horizontal plane and then on more general surfaces is considered. With some modifications, the method applies to the study of pendent drops and of rotating drops as well. The standard capillary problem, i.e. the determination of the free surface of a liquid in a thin tube of general cross section, which resuls from the simultaneous action of surface tension, boundary adhesion and gravity is discussed. It turns out that in this case the existence of the solution surface depends heavily on the validity of a simple geometric condition about the mean curvature of the boundary curve of the cross section of the capillary tube. Some particular examples of physical interest are also be discussed. Liquid drops sitting on or hanging from a fixed horizontal plane are discussed. The symmetry of the solutions (which can actually be proved, as consequence of a general symmetrization argument) now plays the chief role in deriving both the existence and the regularity of energy-minimizing configurations. When symmetry fails (this is the case, for example, when the contact angle between the drop and the plate is not constant, or when the supporting surface is not itself symmetric), then more sophisticated methods must be used. Extensions in this direction are outlined.

Assessment of water droplet evaporation mechanisms on hydrophobic and superhydrophobic substrates.

PubMed

Pan, Zhenhai; Dash, Susmita; Weibel, Justin A; Garimella, Suresh V

2013-12-23

Evaporation rates are predicted and important transport mechanisms identified for evaporation of water droplets on hydrophobic (contact angle ~110°) and superhydrophobic (contact angle ~160°) substrates. Analytical models for droplet evaporation in the literature are usually simplified to include only vapor diffusion in the gas domain, and the system is assumed to be isothermal. In the comprehensive model developed in this study, evaporative cooling of the interface is accounted for, and vapor concentration is coupled to local temperature at the interface. Conjugate heat and mass transfer are solved in the solid substrate, liquid droplet, and surrounding gas. Buoyancy-driven convective flows in the droplet and vapor domains are also simulated. The influences of evaporative cooling and convection on the evaporation characteristics are determined quantitatively. The liquid-vapor interface temperature drop induced by evaporative cooling suppresses evaporation, while gas-phase natural convection acts to enhance evaporation. While the effects of these competing transport mechanisms are observed to counterbalance for evaporation on a hydrophobic surface, the stronger influence of evaporative cooling on a superhydrophobic surface accounts for an overprediction of experimental evaporation rates by ~20% with vapor diffusion-based models. The local evaporation fluxes along the liquid-vapor interface for both hydrophobic and superhydrophobic substrates are investigated. The highest local evaporation flux occurs at the three-phase contact line region due to proximity to the higher temperature substrate, rather than at the relatively colder droplet top; vapor diffusion-based models predict the opposite. The numerically calculated evaporation rates agree with experimental results to within 2% for superhydrophobic substrates and 3% for hydrophobic substrates. The large deviations between past analytical models and the experimental data are therefore reconciled with the comprehensive model developed here.

Exposure assessment of ETBE in gas station workers and gasoline tanker truck drivers.

PubMed

Eitaki, Yoko; Kawai, Toshio; Omae, Kazuyuki

2011-01-01

In order to measure occupational exposure concentrations of ethyl tertiary-butyl ether (ETBE), we developed a diffusive sampling method for monitoring ETBE and performed an ETBE exposure assessment. The applicability of diffusive samplers was examined by exposing the samplers to ETBE vapor in test chambers. The personal exposure levels of workers and airborne concentrations were measured at 4 gas stations. The ETBE sampling rate for the diffusive samplers (VOC-SD, Sigma-Aldrich Japan) was 25.04 ml/min (25°C). Compared with the active sampling method, the diffusive samplers could be used for short-term measurements and in environments containing a mixture of organic solvents. The geometric mean (GM) of TWA-8h ETBE was 0.08 ppm (0.02-0.28 ppm) in 28 gas station workers and 0.04 ppm (0.01-0.21 ppm) in 2 gasoline tanker truck drivers. With regard to ETBE airborne concentrations, the GM was 4.12 ppm (0.93-8.71 ppm) at the handles of hanging pumps but dropped to less than 0.01 ppm (less than 0.01-0.01 ppm) at the side of a public road. The diffusive sampling method can be used for the measurement of occupational ETBE exposure. The threshold limit of TLV-TWA 5 ppm recommended by the ACGIH was not exceeded in any of the workers in this study.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marana, S. R.; Cançado, F. C.; Valério, A. A.

The digestive lysozymes 1 and 2 from M. domestica were crystallized by vapour diffusion. The crystallographic data were processed to a maximum resolution of 1.9 Å in both cases. Lysozymes are mostly known for their defensive role against bacteria, but in several animals lysozymes have a digestive function. Here, the initial crystallographic characterization of two digestive lysozymes from Musca domestica are presented. The proteins were crystallized using the sitting-drop vapour-diffusion method in the presence of ammonium sulfate or PEG/2-propanol as the precipitant. X-ray diffraction data were collected to a maximum resolution of 1.9 Å using synchrotron radiation. The lysozyme 1more » and 2 crystals belong to the monoclinic space group P2{sub 1} (unit-cell parameters a = 36.52, b = 79.44, c = 45.20 Å, β = 102.97°) and the orthorhombic space group P2{sub 1}2{sub 1}2 (unit-cell parameters a = 73.90, b = 96.40, c = 33.27 Å), respectively. The crystal structures were solved by molecular replacement and structure refinement is in progress.« less

Crystallization and preliminary diffraction analysis of a DsbA homologue from Wolbachia pipientis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kurz, M.; Iturbe-Ormaetxe, I.; Jarrott, R.

2008-02-01

The first crystallization of a W. pipientis protein, α-DsbA1, was achieved using hanging-drop and sitting-drop vapour diffusion. α-DsbA1 is one of two DsbA homologues encoded by the Gram-negative α-proteobacterium Wolbachia pipientis, an endosymbiont that can behave as a reproductive parasite in insects and as a mutualist in medically important filarial nematodes. The α-DsbA1 protein is thought to be important for the folding and secretion of Wolbachia proteins involved in the induction of reproductive distortions. Crystals of native and SeMet α-DsbA1 were grown by vapour diffusion and belong to the monoclinic space group C2, with unit-cell parameters a = 71.4, bmore » = 49.5, c = 69.3 Å, β = 107.0° and one molecule in the asymmetric unit (44% solvent content). X-ray data were recorded from native crystals to a resolution of 2.01 Å using a copper anode and data from SeMet α-DsbA1 crystals were recorded to 2.45 Å resolution using a chromium anode.« less

Crystallization and preliminary X-ray diffraction analysis of the lectin from Dioclea rostrata Benth seeds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Delatorre, Plínio; Departamento de Ciências Biológicas, Universidade Regional do Cariri, Crato, CE 63195-000; Nascimento, Kyria Santiago

2006-02-01

D. rostrata lectin was crystallized by hanging-drop vapor diffusion. The crystal belongs to the orthorhombic space group I222 and diffracted to 1.87 Å resolution. Lectins from the Diocleinae subtribe (Leguminosae) are highly similar proteins that promote various biological activities with distinctly differing potencies. The structural basis for this experimental data is not yet fully understood. Dioclea rostrata lectin was purified and crystallized by hanging-drop vapour diffusion at 293 K. The crystal belongs to the orthorhombic space group I222, with unit-cell parameters a = 61.51, b = 88.22, c = 87.76 Å. Assuming the presence of one monomer per asymmetric unit,more » the solvent content was estimated to be about 47.9%. A complete data set was collected at 1.87 Å resolution.« less

Development of an automated large-scale protein-crystallization and monitoring system for high-throughput protein-structure analyses.

PubMed

Hiraki, Masahiko; Kato, Ryuichi; Nagai, Minoru; Satoh, Tadashi; Hirano, Satoshi; Ihara, Kentaro; Kudo, Norio; Nagae, Masamichi; Kobayashi, Masanori; Inoue, Michio; Uejima, Tamami; Oda, Shunichiro; Chavas, Leonard M G; Akutsu, Masato; Yamada, Yusuke; Kawasaki, Masato; Matsugaki, Naohiro; Igarashi, Noriyuki; Suzuki, Mamoru; Wakatsuki, Soichi

2006-09-01

Protein crystallization remains one of the bottlenecks in crystallographic analysis of macromolecules. An automated large-scale protein-crystallization system named PXS has been developed consisting of the following subsystems, which proceed in parallel under unified control software: dispensing precipitants and protein solutions, sealing crystallization plates, carrying robot, incubators, observation system and image-storage server. A sitting-drop crystallization plate specialized for PXS has also been designed and developed. PXS can set up 7680 drops for vapour diffusion per hour, which includes time for replenishing supplies such as disposable tips and crystallization plates. Images of the crystallization drops are automatically recorded according to a preprogrammed schedule and can be viewed by users remotely using web-based browser software. A number of protein crystals were successfully produced and several protein structures could be determined directly from crystals grown by PXS. In other cases, X-ray quality crystals were obtained by further optimization by manual screening based on the conditions found by PXS.

Gas-evaporation in low-gravity field (cogelation mechanism of metal vapors) (M-14)

NASA Technical Reports Server (NTRS)

Wada, N.

1993-01-01

When metal and alloy compounds are heated and vaporized in a rare gas such as helium, argon, or xenon, the vaporized substances diffused in the rare gas are supersaturated resulting in a smoke of fine particles of the material congealing as snow or fog. The gas vaporizing method is a fine particle generation method. Though the method has a variety of applications, the material vapor flow is disturbed by gravitational convection on Earth. The inability to elucidate the fine particle generation mechanism results in an obstruction to improving the method to mass production levels. As no convection occurs in microgravity in space, the fine particle generation mechanism influenced only by diffusion can be investigated. Investigators expect that excellent particles with homogeneous diameter distribution can be obtained. Experiment data and facts will assist in improving efficiency, quality, and scale or production processes including element processes such as vaporization, diffusion, and condensation. The objective of this experiment is to obtain important information related to the mechanism of particle formation in the gas atmosphere (smoke particles) and the production of submicron powders of extremely uniform size.

Impact of Moisture Content and Grain Size on Hydrocarbon Diffusion in Porous Media

NASA Astrophysics Data System (ADS)

McLain, A. A.; Ho, C. K.

2001-12-01

Diffusion of hydrocarbon vapors in porous media can play an important role in our ability to characterize subsurface contaminants such as trichloroethylene (TCE). For example, traditional monitoring methods often rely on direct sampling of contaminated soils or vapor. These samples may be influenced by the diffusion of vapors away from the contaminant source term, such as non-aqueous-phase TCE liquid. In addition, diffusion of hydrocarbon vapors can also impact the migration and dispersion of the contaminant in the subsurface. Therefore, understanding the diffusion rates and vapor transport processes of hydrocarbons in variably-saturated, heterogeneous porous media will assist in the characterization and detection of these subsurface contaminants. The purpose of this study was to investigate the impact of soil heterogeneity and water-moisture content on the diffusion processes for TCE. A one-dimensional column experiment was used to monitor the rates of vapor diffusion through sand. Experiments were performed with different average water-moisture contents and different grain sizes. On one end of the column, a reservoir cap is used to encase the TCE, providing a constant vapor boundary condition while sealing the end. The other end of the column contains a novel microchemical sensor. The sensor employs a polymer-absorption resistor (chemiresistor) that reversibly swells and increases in resistance when exposed to hydrocarbons. Once calibrated, the chemiresistors can be used to passively monitor vapor concentrations. This unique method allows the detection of in-situ vapor concentrations without disturbing the local environment. Results are presented in the form of vapor-concentration breakthrough curves as detected by the sensor. The shape of the breakthrough curve is dependent on several key parameters, including the length of the column and parameters (e.g., water-moisture content and grain-size) that affect the effective diffusion coefficient of TCE in air. Comparisons are made between theoretical and observed breakthrough curves to evaluate the diffusion of TCE and other relevant physical processes (e.g., air-water partitioning of TCE). The relative impact of water-moisture content and grain size on the diffusion of TCE vapor in porous media is also addressed. The authors thank Bob Hughes, who developed the chemiresistor sensors, and Chad Davis, who assisted with the calibrations. Sandia is a multiprogram laboratory operated by Sandia Corporation, a Lockheed Martin Company, for the United States Department of Energy under Contract DE-AC04-94AL85000.

Crystallization and preliminary X-ray analysis of the NAD+-reducing [NiFe] hydrogenase from Hydrogenophilus thermoluteolus TH-1

PubMed Central

Taketa, Midori; Nakagawa, Hanae; Habukawa, Mao; Osuka, Hisao; Kihira, Kiyohito; Komori, Hirofumi; Shibata, Naoki; Ishii, Masaharu; Igarashi, Yasuo; Nishihara, Hirofumi; Yoon, Ki-Seok; Ogo, Seiji; Shomura, Yasuhito; Higuchi, Yoshiki

2015-01-01

NAD+-reducing [NiFe] hydrogenases catalyze the oxidoreduction of dihydrogen concomitant with the interconversion of NAD+ and NADH. Here, the isolation, purification and crystallization of the NAD+-reducing [NiFe] hydrogenase from Hydrogenophilus thermoluteolus TH-1 are reported. Crystals of the NAD+-reducing [NiFe] hydrogenase were obtained within one week from a solution containing polyethylene glycol using the sitting-drop vapour-diffusion method and micro-seeding. The crystal diffracted to 2.58 Å resolution and belonged to space group C2, with unit-cell parameters a = 131.43, b = 189.71, c = 124.59 Å, β = 109.42°. Assuming the presence of two NAD+-reducing [NiFe] hydrogenase molecules in the asymmetric unit, V M was calculated to be 2.2 Å3  Da−1, which corresponds to a solvent content of 43%. Initial phases were determined by the single-wavelength anomalous dispersion method using the anomalous signal from the Fe atoms. PMID:25615977

Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708

PubMed Central

Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

2009-01-01

Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 Å resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P212121, with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 Å. The Matthews coefficient (V M = 1.76 Å3 Da−1) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit. PMID:19923737

Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708.

PubMed

Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

2009-11-01

Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 angstrom resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P2(1)2(1)2(1), with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 angstrom. The Matthews coefficient (V(M) = 1.76 angstrom(3) Da(-1)) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit.

Crystallization and preliminary X-ray diffraction analysis of P30, the transmembrane domain of pertactin, an autotransporter from Bordetella pertussis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhu, Yanshi; Black, Isobel; Roszak, Aleksander W.

2007-07-01

P30, the transmembrane C-terminal domain of pertactin from B. pertussis has been crystallized after refolding in vitro. Preliminary X-ray crystallographic data are reported. P30, the 32 kDa transmembrane C-terminal domain of pertactin from Bordetella pertussis, is supposed to form a β-barrel inserted into the outer membrane for the translocation of the passenger domain. P30 was cloned and expressed in inclusion bodies in Escherichia coli. After refolding and purification, the protein was crystallized using the sitting-drop vapour-diffusion method at 292 K. The crystals diffract to a resolution limit of 3.5 Å using synchrotron radiation and belong to the hexagonal space groupmore » P6{sub 1}22, with unit-cell parameters a = b = 123.27, c = 134.43 Å.« less

Purification, crystallization and preliminary X-ray diffraction study of human ribosomal protein L10 core domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishimura, Mitsuhiro; Protein Research Group, RIKEN Yokohama Institute, RIKEN Genomic Sciences Center, 1-7-22 Suehiro-cho, Tsurumi, Yokohama 230-0045; Kaminishi, Tatsuya

2007-11-01

A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to spacemore » group P3{sub 1}21 or P3{sub 2}21.« less

Crystallization and preliminary X-ray analysis of the stress-response PPM phosphatase RsbX from Bacillus subtilis

PubMed Central

Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi

2009-01-01

RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase σ factor SigB. In order to elucidate the structural–functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 Å resolution with an R merge of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 Å, α = 98.8, β = 90.0, γ = 108.4°. PMID:19923733

Crystallization and preliminary X-ray analysis of the stress-response PPM phosphatase RsbX from Bacillus subtilis.

PubMed

Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi

2009-11-01

RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase sigma factor SigB. In order to elucidate the structural-functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 angstrom resolution with an R(merge) of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 angstrom , alpha = 98.8, beta = 90.0, gamma = 108.4 degrees.

Purification, crystallization and preliminary X-ray diffraction studies of UDP-N-acetylglucosamine pyrophosphorylase from Candida albicans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maruyama, Daisuke; Nishitani, Yuichi; Nonaka, Tsuyoshi

2006-12-01

UDP-N-acetylglucosamine pyrophosphorylase was purified and crystallized and X-ray diffraction data were collected to 2.3 Å resolution. UDP-N-acetylglucosamine pyrophosphorylase (UAP) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine. UAP from Candida albicans was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals of the substrate and product complexes both diffract X-rays to beyond 2.3 Å resolution using synchrotron radiation. The crystals of the substrate complex belong to the triclinic space group P1, with unit-cell parameters a = 47.77, b = 62.89, c = 90.60 Å, α = 90.01, β = 97.72, γ = 92.88°, whereas those of the productmore » complex belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 61.95, b = 90.87, c = 94.88 Å.« less

Recombinant expression, purification, crystallization and preliminary X-ray diffraction analysis of the C-terminal DUF490(963-1138) domain of TamB from Escherichia coli.

PubMed

Josts, Inokentijs; Grinter, Rhys; Kelly, Sharon M; Mosbahi, Khedidja; Roszak, Aleksander; Cogdell, Richard; Smith, Brian O; Byron, Olwyn; Walker, Daniel

2014-09-01

TamB is a recently described inner membrane protein that, together with its partner protein TamA, is required for the efficient secretion of a subset of autotransporter proteins in Gram-negative bacteria. In this study, the C-terminal DUF490963-1138 domain of TamB was overexpressed in Escherichia coli K-12, purified and crystallized using the sitting-drop vapour-diffusion method. The crystals belonged to the primitive trigonal space group P3121, with unit-cell parameters a = b = 57.34, c = 220.74 Å, and diffracted to 2.1 Å resolution. Preliminary secondary-structure and X-ray diffraction analyses are reported. Two molecules are predicted to be present in the asymmetric unit. Experimental phasing using selenomethionine-labelled protein will be undertaken in the future.

Expression, purification, crystallization and preliminary X-ray analysis of tannase from Lactobacillus plantarum

PubMed Central

Wu, Mingbo; Peng, Xiaohong; Wen, Hua; Wang, Qin; Chen, Qianming; McKinstry, William J.; Ren, Bin

2013-01-01

Tannase catalyses the hydrolysis of the galloyl ester bond of tannins to release gallic acid. It belongs to the serine esterases and has wide applications in the food, feed, beverage, pharmaceutical and chemical industries. The tannase from Lactobacillus plantarum was cloned, expressed and purified. The protein was crystallized by the sitting-drop vapour-diffusion method with microseeding. The crystals belonged to space group P1, with unit-cell paramters a = 46.5, b = 62.8, c = 83.8 Å, α = 70.4, β = 86.0, γ = 79.4°. Although the enzyme exists mainly as a monomer in solution, it forms a dimer in the asymmetric unit of the crystal. The crystals diffracted to beyond 1.60 Å resolution using synchrotron radiation and a complete data set was collected to 1.65 Å resolution. PMID:23545659

Crystallization and preliminary X-ray diffraction analysis of the P3 RNA domain of yeast ribonuclease MRP in a complex with RNase P/MRP protein components Pop6 and Pop7.

PubMed

Perederina, Anna; Esakova, Olga; Quan, Chao; Khanova, Elena; Krasilnikov, Andrey S

2010-01-01

Eukaryotic ribonucleases P and MRP are closely related RNA-based enzymes which contain a catalytic RNA component and several protein subunits. The roles of the protein subunits in the structure and function of eukaryotic ribonucleases P and MRP are not clear. Crystals of a complex that included a circularly permuted 46-nucleotide-long P3 domain of the RNA component of Saccharomyces cerevisiae ribonuclease MRP and selenomethionine derivatives of the shared ribonuclease P/MRP protein components Pop6 (18.2 kDa) and Pop7 (15.8 kDa) were obtained using the sitting-drop vapour-diffusion method. The crystals belonged to space group P4(2)22 (unit-cell parameters a = b = 127.2, c = 76.8 A, alpha = beta = gamma = 90 degrees ) and diffracted to 3.25 A resolution.

Purification, crystallization and preliminary crystallographic analysis of Streptococcus pyogenes laminin-binding protein Lbp

DOE Office of Scientific and Technical Information (OSTI.GOV)

Linke, Christian, E-mail: clin180@ec.auckland.ac.nz; Caradoc-Davies, Tom T.; Australian Synchrotron, Clayton, Victoria 3168

2008-02-01

The S. pyogenes laminin-binding protein Lbp, which is essential for adhesion to human laminin, has been expressed, purified and crystallized. The laminin-binding protein Lbp (Spy2007) from Streptococcus pyogenes (a group A streptococcus) mediates adhesion to the human basal lamina glycoprotein laminin. Accordingly, Lbp is essential in in vitro models of cell adhesion and invasion. However, the molecular and structural basis of laminin binding by bacteria remains unknown. Therefore, the lbp gene has been cloned for recombinant expression in Escherichia coli. Lbp has been purified and crystallized from 30%(w/v) PEG 1500 by the sitting-drop vapour-diffusion method. The crystals belonged to themore » monoclinic space group P2{sub 1}, with unit-cell parameters a = 42.62, b = 92.16, c = 70.61 Å, β = 106.27°, and diffracted to 2.5 Å resolution.« less

Crystallization and preliminary X-ray analysis of CTP:phosphoethanolamine cytidylyltransferase (ECT) from Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ohtsuka, Jun; Nagata, Koji; Lee, Woo Cheol

2006-10-01

CTP:phosphoethanolamine cytidylyltransferase from S. cerevisiae has been expressed, purified and crystallized. CTP:phosphoethanolamine cytidylyltransferase (ECT) is the enzyme that catalyzes the conversion of phosphoethanolamine to CDP-ethanolamine in the phosphatidylethanolamine-biosynthetic pathway (Kennedy pathway). ECT from Saccharomyces cerevisiae was crystallized by the sitting-drop vapour-diffusion method using PEG 4000 as precipitant. The crystals diffracted X-rays from a synchrotron-radiation source to 1.88 Å resolution. The space group was assigned as primitive tetragonal, P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 66.3, c = 150.8 Å. The crystals contain one ECT molecule in the asymmetric unit (V{sub M} = 2.2more » Å{sup 3} Da{sup −1}), with a solvent content of 43%.« less

Crystallization and preliminary X-ray analysis of the NADPH-dependent 3-quinuclidinone reductase from Rhodotorula rubra

PubMed Central

Takeshita, Daijiro; Kataoka, Michihiko; Miyakawa, Takuya; Miyazono, Ken-ichi; Uzura, Atsuko; Nagata, Koji; Shimizu, Sakayu; Tanokura, Masaru

2009-01-01

(R)-3-Quinuclidinol is a useful compound that is applicable to the synthesis of various pharmaceuticals. The NADPH-dependent carbonyl reductase 3-­quinuclidinone reductase from Rhodotorula rubra catalyzes the stereospecific reduction of 3-quinuclidinone to (R)-3-quinuclidinol and is expected to be utilized in industrial production of this alcohol. 3-Quinuclidinone reductase from R. rubra was expressed in Escherichia coli and purified using Ni-affinity and ion-exchange column chromatography. Crystals of the protein were obtained by the sitting-drop vapour-diffusion method using PEG 8000 as the precipitant. The crystals belonged to space group P41212, with unit-cell parameters a = b = 91.3, c = 265.4 Å, and diffracted X-rays to 2.2 Å resolution. The asymmetric unit contained four molecules of the protein and the solvent content was 48.4%. PMID:19478454

Etiology and use of the "hanging drop" technique: a review.

PubMed

Todorov, Ludmil; VadeBoncouer, Timothy

2014-01-01

Background. The hanging drop (HD) technique presumably relies on the presence of subatmospheric epidural pressure. It is not clear whether this negative pressure is intrinsic or an artifact and how it is affected by body position. There are few data to indicate how often HD is currently being used. Methods. We identified studies that measured subatmospheric pressures and looked at the effect of the sitting position. We also looked at the technique used for cervical and thoracic epidural anesthesia in the last 10 years. Results. Intrinsic subatmospheric pressures were measured in the thoracic and cervical spine. Three trials studied the effect of body position, indicating a higher incidence of subatmospheric pressures when sitting. The results show lower epidural pressure (-10.7 mmHg) with the sitting position. 28.8% of trials of cervical and thoracic epidural anesthesia that documented the technique used, utilized the HD technique. When adjusting for possible bias, the rate of HD use can be as low as 11.7%. Conclusions. Intrinsic negative pressure might be present in the cervical and thoracic epidural space. This effect is more pronounced when sitting. This position might be preferable when using HD. Future studies are needed to compare it with the loss of resistance technique.

Molecular dynamics study of the vaporization of an ionic drop.

PubMed

Galamba, N

2010-09-28

The melting of a microcrystal in vacuum and subsequent vaporization of a drop of NaCl were studied through molecular dynamics simulations with the Born-Mayer-Huggins-Tosi-Fumi rigid-ion effective potential. The vaporization was studied for a single isochor at increasing temperatures until the drop completely vaporized, and gaseous NaCl formed. Examination of the vapor composition shows that the vapor of the ionic drop and gaseous NaCl are composed of neutral species, the most abundant of which, ranging from simple NaCl monomers (ion pairs) to nonlinear polymers, (Na(n)Cl(n))(n=2-4). The enthalpies of sublimation, vaporization, and dissociation of the different vapor species are found to be in reasonable agreement with available experimental data. The decrease of the enthalpy of vaporization of the vapor species, with the radius of the drop decrease, accounts for a larger fraction of trimers and tetramers than that inferred from experiments. Further, the rhombic dimer is significantly more abundant than its linear isomer although the latter increases with the temperature. The present results suggest that both trimers and linear dimers may be important to explain the vapor pressure of molten NaCl at temperatures above 1500 K.

Computation of shear-induced collective-diffusivity in emulsions

NASA Astrophysics Data System (ADS)

Malipeddi, Abhilash Reddy; Sarkar, Kausik

2017-11-01

The shear-induced collective-diffusivity of drops in an emulsion is calculated through simulation. A front-tracking finite difference method is used to integrate the Navier-Stokes equations. When a cloud of drops is subjected to shear flow, after a certain time, the width of the cloud increases with the 1/3 power of time. This scaling of drop-cloud-width with time is characteristic of (sub-)diffusion that arises from irreversible two-drop interactions. The collective diffusivity is calculated from this relationship. A feature of the procedure adopted here is the modest computational requirement, wherein, a few drops ( 70) in shear for short time ( 70 strain) is found to be sufficient to get a good estimate. As far as we know, collective-diffusivity has not been calculated for drops through simulation till now. The computed values match with experimental measurements reported in the literature. The diffusivity in emulsions is calculated for a range of Capillary (Ca) and Reynolds (Re) numbers. It is found to be a unimodal function of Ca , similar to self-diffusivity. A sub-linear increase of the diffusivity with Re is seen for Re < 5 . This work has been limited to a viscosity matched case.

A morphological screening of protein crystals for interferon delivery by metal ion-chelate technology.

PubMed

Jiang, Yanbo; Shi, Kai; Wang, Shuo; Li, Xuefeng; Cui, Fude

2010-12-01

This study presents a preliminary exploration on extending the half-life of therapeutic proteins by crystallization strategy without new molecular entities generation. Recombinant human interferon (rhIFN) α-2b, a model protein drug in this case, was crystallized using a hanging-drop vapor diffusion method. A novel chelating technique with metal ions was employed to promote crystals formation. The effects of key factors such as seeding protein concentration, pH of the hanging drop, ionic strength of the equilibration solution, and precipitants were investigated. Size-exclusion liquid chromatography, antiviral activity determination, and enzyme-linked immunosorbent assay indicated that both the molecular integrity and biological potency of rhIFN were not significantly affected by crystallization process. In addition, the in vitro release behavior of rhIFN from crystal lattice was characterized by an initial fast release, followed by a sustained release up to 48 hour. The work described here suggested an exciting possibility of therapeutic protein crystals as a long-acting formulation.

Model for determining vapor equilibrium rates in the hanging drop method for protein crystal growth

NASA Technical Reports Server (NTRS)

Baird, James K.; Frieden, Richard W.; Meehan, E. J., Jr.; Twigg, Pamela J.; Howard, Sandra B.; Fowlis, William A.

1987-01-01

An engineering analysis of the rate of evaporation of solvent in the hanging drop method of protein crystal growth is presented. Results are applied to 18 drop and well arrangements commonly encountered in the laboratory. The chemical nature of the salt, drop size and shape, drop concentration, well size, well concentration, and temperature are taken into account. The rate of evaporation increases with temperature, drop size, and the salt concentration difference between the drop and the well. The evaporation in this model possesses no unique half-life. Once the salt in the drop achieves 80 percent of its final concentration, further evaporation suffers from the law of diminishing returns.

Behavior of fluids in a weightless environment

NASA Technical Reports Server (NTRS)

Fester, D. A.; Eberhardt, R. N.; Tegart, J. R.

1977-01-01

Fluid behavior in a low-g environment is controlled primarily by surface tension forces. Certain fluid and system characteristics determine the magnitude of these forces for both a free liquid surface and liquid in contact with a solid. These characteristics, including surface tension, wettability or contact angle, system geometry, and the relationships governing their interaction, are discussed. Various aspects of fluid behavior in a low-g environment are then presented. This includes the formation of static interface shapes, oscillation and rotation of drops, coalescence, the formation of foams, tendency for cavitation, and diffusion in liquids which were observed during the Skylab fluid mechanics science demonstrations. Liquid reorientation and capillary pumping to establish equilibrium configurations for various system geometries, observed during various free-fall (drop-tower) low-g tests, are also presented. Several passive low-g fluid storage and transfer systems are discussed. These systems use surface tension forces to control the liquid/vapor interface and provide gas-free liquid transfer and liquid-free vapor venting.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kish, Kevin; McDonnell, Patricia A.; Goldfarb, Valentina

Protein tyrosine phosphatase {gamma} is a membrane-bound receptor and is designated RPTP{gamma}. RPTP{gamma} and two mutants, RPTP{gamma}(V948I, S970T) and RPTP{gamma}(C858S, S970T), were recombinantly expressed and purified for X-ray crystallographic studies. The purified enzymes were crystallized using the hanging-drop vapor-diffusion method. Crystallographic data were obtained from several different crystal forms in the absence and the presence of inhibitor. In this paper, a description is given of how three different crystal forms were obtained that were used with various ligands. An orthorhombic crystal form and a trigonal crystal form were obtained both with and without ligand, and a monoclinic crystal form wasmore » only obtained in the presence of a particularly elaborated inhibitor.« less

Evaporation Flux Distribution of Drops on a Hydrophilic or Hydrophobic Flat Surface by Molecular Simulations.

PubMed

Xie, Chiyu; Liu, Guangzhi; Wang, Moran

2016-08-16

The evaporation flux distribution of sessile drops is investigated by molecular dynamic simulations. Three evaporating modes are classified, including the diffusion dominant mode, the substrate heating mode, and the environment heating mode. Both hydrophilic and hydrophobic drop-substrate interactions are considered. To count the evaporation flux distribution, which is position dependent, we proposed an azimuthal-angle-based division method under the assumption of spherical crown shape of drops. The modeling results show that the edge evaporation, i.e., near the contact line, is enhanced for hydrophilic drops in all the three modes. The surface diffusion of liquid molecular absorbed on solid substrate for hydrophilic cases plays an important role as well as the space diffusion on the enhanced evaporation rate at the edge. For hydrophobic drops, the edge evaporation flux is higher for the substrate heating mode, but lower than elsewhere of the drop for the diffusion dominant mode; however, a nearly uniform distribution is found for the environment heating mode. The evidence shows that the temperature distribution inside drops plays a key role in the position-dependent evaporation flux.

Molecular Dynamic Simulation of Water Vapor and Determination of Diffusion Characteristics in the Pore

NASA Astrophysics Data System (ADS)

Nikonov, Eduard G.; Pavluš, Miron; Popovičová, Mária

2018-02-01

One of the varieties of pores, often found in natural or artificial building materials, are the so-called blind pores of dead-end or saccate type. Three-dimensional model of such kind of pore has been developed in this work. This model has been used for simulation of water vapor interaction with individual pore by molecular dynamics in combination with the diffusion equation method. Special investigations have been done to find dependencies between thermostats implementations and conservation of thermodynamic and statistical values of water vapor - pore system. The two types of evolution of water - pore system have been investigated: drying and wetting of the pore. Full research of diffusion coefficient, diffusion velocity and other diffusion parameters has been made.

Combustion Characteristics of Sprays

DTIC Science & Technology

1989-08-01

Lin. T. H.. and Sohrab. S. H. (1987). On the transition oi’diffusion to premixed I’lames in consers.ed ssstem Cornhusio. Flume 68. 73. Mlizutani. Y ...and Nakauima. A. (1973a). Combustion of fuel vapor-drop-air systems: Part 1-Open burner flames. Combust. F/ante 21.14. Mizutani. Y .. and Nakajima. A...AFOSR LES Final Report. AFRPL. Sohrab. S. H.. Ye. Z. Y .. and Law~k C. K. (1984). An experimenial investication on ilame interaction ano the

LCP crystallization and X-ray diffraction analysis of VcmN, a MATE transporter from Vibrio cholerae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kusakizako, Tsukasa; Tanaka, Yoshiki; Hipolito, Christopher J.

A V. cholerae MATE transporter was crystallized using the lipidic cubic phase (LCP) method. X-ray diffraction data sets were collected from single crystals obtained in a sandwich plate and a sitting-drop plate to resolutions of 2.5 and 2.2 Å, respectively. Multidrug and toxic compound extrusion (MATE) transporters, one of the multidrug exporter families, efflux xenobiotics towards the extracellular side of the membrane. Since MATE transporters expressed in bacterial pathogens contribute to multidrug resistance, they are important therapeutic targets. Here, a MATE-transporter homologue from Vibrio cholerae, VcmN, was overexpressed in Escherichia coli, purified and crystallized in lipidic cubic phase (LCP). X-raymore » diffraction data were collected to 2.5 Å resolution from a single crystal obtained in a sandwich plate. The crystal belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 52.3, b = 93.7, c = 100.2 Å. As a result of further LCP crystallization trials, crystals of larger size were obtained using sitting-drop plates. X-ray diffraction data were collected to 2.2 Å resolution from a single crystal obtained in a sitting-drop plate. The crystal belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 61.9, b = 91.8, c = 100.9 Å. The present work provides valuable insights into the atomic resolution structure determination of membrane transporters.« less

Method and means for producing solid evacuated microspheres of hydrogen

DOEpatents

Turnbull, Robert J.; Foster, Christopher A.; Hendricks, Charles D.

1976-01-01

A method is provided for producing solid, evacuated microspheres comprised of hydrogen. The spheres are produced by forming a jet of liquid hydrogen and exciting mechanical waves on the jet of appropriate frequency so that the jet breaks up into drops with a bubble formed in each drop by cavitation. The drops are exposed to a pressure less than the vapor pressure of the liquid hydrogen so that the bubble which is formed within each drop expands. The drops which contain bubbles are exposed to an environment having a pressure just below the triple point of liquid hydrogen and they thereby freeze giving solid, evacuated spheres of hydrogen.

Dynamics of gas bubble growth in a supersaturated solution with Sievert's solubility law.

PubMed

Gor, G Yu; Kuchma, A E

2009-07-21

This paper presents a theoretical description of diffusion growth of a gas bubble after its nucleation in supersaturated liquid solution. We study systems where gas molecules completely dissociate in the solvent into two parts, thus making Sievert's solubility law valid. We show that the difference between Henry's and Sievert's laws for chemical equilibrium conditions causes the difference in bubble growth dynamics. Assuming that diffusion flux is steady we obtain a differential equation on bubble radius. Bubble dynamics equation is solved analytically for the case of homogeneous nucleation of a bubble, which takes place at a significant pressure drop. We also obtain conditions of diffusion flux steadiness. The fulfillment of these conditions is studied for the case of nucleation of water vapor bubbles in magmatic melts.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

Systematic Improvement of Protein Crystals by Determining the Supersolubility Curves of Phase Diagrams

PubMed Central

Saridakis, Emmanuel; Chayen, Naomi E.

2003-01-01

A systematic approach for improving protein crystals by growing them in the metastable zone using the vapor diffusion technique is described. This is a simple technique for optimization of crystallization conditions. Screening around known conditions is performed to establish a working phase diagram for the crystallization of the protein. Dilutions of the crystallization drops across the supersolubility curve into the metastable zone are then carried out as follows: the coverslips holding the hanging drops are transferred, after being incubated for some time at conditions normally giving many small crystals, over reservoirs at concentrations which normally yield clear drops. Fewer, much larger crystals are obtained when the incubation times are optimized, compared with conventional crystallization at similar conditions. This systematic approach has led to the structure determination of the light-harvesting protein C-phycocyanin to the highest-ever resolution of 1.45 Å. PMID:12547801

Measurement and Modeling of Water-Vapor Diffusion in Elastomers with Impact in Humidity and Vacuum Measurements

NASA Astrophysics Data System (ADS)

Šetina, Janez; Sefa, Makfir; Erjavec, Bojan; Hudoklin, Domen

2013-03-01

The dynamics of water-vapor dissolution in Viton O-rings is measured with a gravimetric method using a precise mass comparator. A sample gasket was degassed in high vacuum for a sufficiently long period to remove more than 99 % of the dissolved water vapor. After that, it was exposed to the ambient atmosphere with a controlled temperature, and relative humidity and water-vapor uptake curves were measured gravimetrically with a precise balance. The dynamics of a water-vapor release into vacuum from another sample that was previously saturated with water vapor at room temperature was determined. The sample was placed in a vacuum outgassing rate measurement apparatus. The time dependence of the evolved water vapor was calculated by integrating the measured outgassing rate. The physical process of water absorption can be described by the diffusion equation. The geometry of the samples required solving the diffusion equation in cylindrical coordinates. This was done numerically using a finite-difference method. As a result of the modeling, room temperature values of the diffusion constant D, the solubility s, and the permeability K = D× s of water vapor in the sample material (Viton A-401C) were obtained. For sample 1, we obtained D = 8.0 × 10 ^{-8} cm2 {\\cdot } s^{-1} and s = 6.5 × 10^{-7} g {\\cdot } cm^-3 Pa^{-1}, while for sample 2, D = 3.0 × 10^{-7} cm2 s^{-1} and s = 3.5 × 10^{-7} g {\\cdot } cm^{-3} {\\cdot } Pa^{-1}.

Crystallization and initial crystallographic characterization of the Corynebacterium glutamicum nitrilotriacetate monooxygenase component A

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Kyung-Jin, E-mail: kkj@postech.ac.kr; Kim, Sujin; Lee, Sujin

2006-11-01

The Corynebacterium glutamicum NTA monooxygenase component A protein, which plays the central role in NTA biodegradation, was crystallized. The initial X-ray crystallographic characterization is reported. Safety and environmental concerns have recently dictated the proper disposal of nitrilotriacetate (NTA). Biodegradation of NTA is initiated by NTA monooxygenase, which is composed of two proteins: component A and component B. The NTA monooxygenase component A protein from Corynebacterium glutamicum was crystallized using the sitting-drop vapour-diffusion method in the presence of ammonium sulfate as the precipitant. X-ray diffraction data were collected to a maximum resolution of 2.5 Å on a synchrotron beamline. The crystalmore » belongs to the monoclinic space group C2, with unit-cell parameters a = 111.04, b = 98.51, c = 171.61 Å, β = 101.94°. The asymmetric unit consists of four molecules, corresponding to a packing density of 2.3 Å{sup 3} Da{sup −1}. The structure was solved by molecular replacement. Structure refinement is in progress.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Saijo, Shinya; Sato, Takao; Kumasaka, Takashi

The reaction center–light-harvesting 1 core complex from R. viridis was crystallized and X-ray diffraction data were collected to 8.0 Å resolution. The reaction center–light-harvesting 1 (RC–LH1) core complex is the photosynthetic apparatus in the membrane of the purple photosynthetic bacterium Rhodopseudomonas viridis. The RC is surrounded by an LH1 complex that is constituted of oligomers of three types of apoproteins (α, β and γ chains) with associated bacteriochlorophyll bs and carotenoid. It has been crystallized by the sitting-drop vapour-diffusion method. A promising crystal diffracted to beyond 8.0 Å resolution. It belonged to space group P1, with unit-cell parameters a =more » 141.4, b = 136.9, c = 185.3 Å, α = 104.6, β = 94.0, γ = 110.7°. A Patterson function calculated using data between 15.0 and 8.0 Å resolution suggested that the LH1 complex is distributed with quasi-16-fold rotational symmetry around the RC.« less

Cloning, purification, crystallization and preliminary X-ray studies of a carbohydrate-binding module (CBM_E1) derived from sugarcane soil metagenome.

PubMed

Campos, Bruna Medeia; Alvarez, Thabata Maria; Liberato, Marcelo Vizona; Polikarpov, Igor; Gilbert, Harry J; Zeri, Ana Carolina de Mattos; Squina, Fabio Marcio

2014-09-01

In recent years, owing to the growing global demand for energy, dependence on fossil fuels, limited natural resources and environmental pollution, biofuels have attracted great interest as a source of renewable energy. However, the production of biofuels from plant biomass is still considered to be an expensive technology. In this context, the study of carbohydrate-binding modules (CBMs), which are involved in guiding the catalytic domains of glycoside hydrolases for polysaccharide degradation, is attracting growing attention. Aiming at the identification of new CBMs, a sugarcane soil metagenomic library was analyzed and an uncharacterized CBM (CBM_E1) was identified. In this study, CBM_E1 was expressed, purified and crystallized. X-ray diffraction data were collected to 1.95 Å resolution. The crystals, which were obtained by the sitting-drop vapour-diffusion method, belonged to space group I23, with unit-cell parameters a = b = c = 88.07 Å.

Expression, purification, crystallization and preliminary X-ray diffraction analysis of the pectin methylesterase from the sugar cane weevil Sphenophorus levis.

PubMed

Evangelista, Danilo Elton; Schutzer de Godoy, Andre; Fonseca Pereira de Paula, Fernando; Henrique-Silva, Flavio; Polikarpov, Igor

2014-03-01

Pectin methylesterase removes the methyl groups from the main chain of pectin, the major component of the middle lamella of the plant cell wall. The enzyme is involved in plant cell-wall development, is part of the enzymatic arsenal used by microorganisms to attack plants and also has a wide range of applications in the industrial sector. Therefore, there is a considerable interest in studies of the structure and function of this enzyme. In this work, the pectin methylesterase from Sphenophorus levis was produced in Pichia pastoris and purified. Crystals belonging to the monoclinic space group C2, with unit-cell parameters a = 122.181, b = 82.213, c = 41.176 Å, β = 97.48°, were obtained by the sitting-drop vapour-diffusion method and an X-ray diffraction data set was collected to 2.1 Å resolution. Structure refinement and model building are in progress.

Crystallization and preliminary crystallographic analysis of maganese(II)-dependent 2,3-dihydroxybiphenyl 1,2-dioxygenase from Bacillus sp. JF8

PubMed Central

Senda, Miki; Hatta, Takashi; Kimbara, Kazuhide; Senda, Toshiya

2010-01-01

A thermostable manganese(II)-dependent 2,3-dihydroxybiphenyl-1,2-dioxygenase derived from Bacillus sp. JF8 was crystallized. The initial screening for crystallization was performed by the sitting-drop vapour-diffusion method using a crystallization robot, resulting in the growth of two crystal forms. The first crystal belonged to space group P1, with unit-cell parameters a = 62.7, b = 71.4, c = 93.6 Å, α = 71.2, β = 81.0, γ = 64.0°, and diffracted to 1.3 Å resolution. The second crystal belonged to space group I222, with unit-cell parameters a = 74.2, b = 90.8, c = 104.3 Å, and diffracted to 1.3 Å resolution. Molecular-replacement trials using homoprotocatechuate 2,3-dioxygenase from Arthrobacter globiformis (28% amino-acid sequence identity) as a search model provided a satisfactory solution for both crystal forms. PMID:20208161

Three dimensional modeling of cirrus during the 1991 FIRE IFO 2: Detailed process study

NASA Technical Reports Server (NTRS)

Jensen, Eric J.; Toon, Owen B.; Westphal, Douglas L.

1993-01-01

A three-dimensional model of cirrus cloud formation and evolution, including microphysical, dynamical, and radiative processes, was used to simulate cirrus observed in the FIRE Phase 2 Cirrus field program (13 Nov. - 7 Dec. 1991). Sulfate aerosols, solution drops, ice crystals, and water vapor are all treated as interactive elements in the model. Ice crystal size distributions are fully resolved based on calculations of homogeneous freezing of solution drops, growth by water vapor deposition, evaporation, aggregation, and vertical transport. Visible and infrared radiative fluxes, and radiative heating rates are calculated using the two-stream algorithm described by Toon et al. Wind velocities, diffusion coefficients, and temperatures were taken from the MAPS analyses and the MM4 mesoscale model simulations. Within the model, moisture is transported and converted to liquid or vapor by the microphysical processes. The simulated cloud bulk and microphysical properties are shown in detail for the Nov. 26 and Dec. 5 case studies. Comparisons with lidar, radar, and in situ data are used to determine how well the simulations reproduced the observed cirrus. The roles played by various processes in the model are described in detail. The potential modes of nucleation are evaluated, and the importance of small-scale variations in temperature and humidity are discussed. The importance of competing ice crystal growth mechanisms (water vapor deposition and aggregation) are evaluated based on model simulations. Finally, the importance of ice crystal shape for crystal growth and vertical transport of ice are discussed.

Propelling a water drop with the vapor-mediated Marangoni effect

NASA Astrophysics Data System (ADS)

Kim, Seungho; Kim, Ho-Young

2013-11-01

We show that a water drop on solid surfaces can be propelled just by placing a volatile alcohol drop nearby. It is found to be because the water-air interface near the alcohol drop mixes with alcohol vapor, thereby locally lowering the surface tension. The surface-tension-gradient induces the motion of the water drop, enabling the trajectory control of water drops through the motion of remote alcohol drops. This vapor-mediated Marangoni effect also gives rise to other interesting interfacial flow phenomena, such as nucleation of holes on a water film and ballooning of a water drop hanging from a syringe needle with the approach of an alcohol drop. We visualize such interfacial dynamics with a high-speed camera and rationalize their salient features by scaling analysis. This work was supported by the National Research Foundation of Korea (grant no. 2012-008023).

Protein crystal growth in a microgravity environment

NASA Technical Reports Server (NTRS)

Bugg, Charles E.

1988-01-01

Protein crystal growth is a major experimental problem and is the bottleneck in widespread applications of protein crystallography. Research efforts now being pursued and sponsored by NASA are making fundamental contributions to the understanding of the science of protein crystal growth. Microgravity environments offer the possibility of performing new types of experiments that may produce a better understanding of protein crystal growth processes and may permit growth environments that are more favorable for obtaining high quality protein crystals. A series of protein crystal growth experiments using the space shuttle was initiated. The first phase of these experiments was focused on the development of micro-methods for protein crystal growth by vapor diffusion techniques, using a space version of the hanging drop method. The preliminary space experiments were used to evolve prototype hardware that will form the basis for a more advanced system that can be used to evaluate effects of gravity on protein crystal growth.

Star-shaped oscillations of Leidenfrost drops

NASA Astrophysics Data System (ADS)

Ma, Xiaolei; Liétor-Santos, Juan-José; Burton, Justin C.

2017-03-01

We experimentally investigate the self-sustained, star-shaped oscillations of Leidenfrost drops. The drops levitate on a cushion of evaporated vapor over a heated, curved surface. We observe modes with n =2 -13 lobes around the drop periphery. We find that the wavelength of the oscillations depends only on the capillary length of the liquid and is independent of the drop radius and substrate temperature. However, the number of observed modes depends sensitively on the liquid viscosity. The dominant frequency of pressure variations in the vapor layer is approximately twice the drop oscillation frequency, consistent with a parametric forcing mechanism. Our results show that the star-shaped oscillations are driven by capillary waves of a characteristic wavelength beneath the drop and that the waves are generated by a large shear stress at the liquid-vapor interface.

Controlling Vapor Pressure In Hanging-Drop Crystallization

NASA Technical Reports Server (NTRS)

Carter, Daniel C.; Smith, Robbie

1988-01-01

Rate of evaporation adjusted to produce larger crystals. Device helps to control vapor pressure of water and other solvents in vicinity of hanging drop of solution containing dissolved enzyme protein. Well of porous frit (sintered glass) holds solution in proximity to drop of solution containing protein or enzyme. Vapor from solution in frit controls evaporation of solvent from drop to control precipitation of protein or enzyme. With device, rate of nucleation limited to decrease number and increase size (and perhaps quality) of crystals - large crystals of higher quality needed for x-ray diffraction studies of macromolecules.

Heat Pipe Vapor Dynamics. Ph.D. Thesis

NASA Technical Reports Server (NTRS)

Issacci, Farrokh

1990-01-01

The dynamic behavior of the vapor flow in heat pipes is investigated at startup and during operational transients. The vapor is modeled as two-dimensional, compressible viscous flow in an enclosure with inflow and outflow boundary conditions. For steady-state and operating transients, the SIMPLER method is used. In this method a control volume approach is employed on a staggered grid which makes the scheme very stable. It is shown that for relatively low input heat fluxes the compressibility of the vapor flow is low and the SIMPLER scheme is suitable for the study of transient vapor dynamics. When the input heat flux is high or the process under a startup operation starts at very low pressures and temperatures, the vapor is highly compressible and a shock wave is created in the evaporator. It is shown that for a wide range of input heat fluxes, the standard methods, including the SIMPLER scheme, are not suitable. A nonlinear filtering technique, along with the centered difference scheme, are then used for shock capturing as well as for the solution of the cell Reynolds-number problem. For high heat flux, the startup transient phase involves multiple shock reflections in the evaporator region. Each shock reflection causes a significant increase in the local pressure and a large pressure drop along the heat pipe. Furthermore, shock reflections cause flow reversal in the evaporation region and flow circulations in the adiabatic region. The maximum and maximum-averaged pressure drops in different sections of the heat pipe oscillate periodically with time because of multiple shock reflections. The pressure drop converges to a constant value at steady state. However, it is significantly higher than its steady-state value at the initiation of the startup transient. The time for the vapor core to reach steady-state condition depends on the input heat flux, the heat pipe geometry, the working fluid, and the condenser conditions. However, the vapor transient time, for an Na-filled heat pipe is on the order of seconds. Depending on the time constant for the overall system, the vapor transient time may be very short. Therefore, the vapor core may be assumed to be quasi-steady in the transient analysis of a heat pipe operation.

Effects of Evaporation/Condensation on Spreading and Contact Angle of a Volatile Liquid Drop

NASA Technical Reports Server (NTRS)

Zhang, Nengli; Chao, David F.; Singh, Bhim S. (Technical Monitor)

2000-01-01

Effects of evaporation/condensation on spreading and contact angle were experimentally studied. A sessile drop of R-113 was tested at different vapor environments to determine the effects of evaporation/condensation on the evolution of contact diameter and contact angle of the drop. Condensation on the drop surface occurs at both the saturated and a nonsaturated vapor environments and promotes the spreading. When the drop is placed in the saturated vapor environment it tends to completely wetting and spreads rapidly. In a nonsaturated vapor environment, the evolution of the sessile drop is divided three stages: condensation-spreading stage, evaporation-retracting stage and rapid contracting stage. In the first stage the drop behaves as in the saturated environment. In the evaporation -retracting stage, the competition between spreading and evaporation of the drop determines the evolution characteristics of the contact diameter and the contact angle. A lower evaporation rate struggles against the spreading power to turn the drop from spreading to retracting with a continuous increase of the contact angle. The drop placed in open air has a much higher evaporation rate. The strong evaporation suppresses the spreading and accelerates the retraction of the drop with a linear decrease of the contact diameter. The contraction of the evaporating drops is gradually accelerated when the contact diameter decreases to 3 min and less till drying up, though the evaporation rate is gradually slowing down.

Computer simulations of nematic drops: Coupling between drop shape and nematic order

NASA Astrophysics Data System (ADS)

Rull, L. F.; Romero-Enrique, J. M.; Fernandez-Nieves, A.

2012-07-01

We perform Monte Carlo computer simulations of nematic drops in equilibrium with their vapor using a Gay-Berne interaction between the rod-like molecules. To generate the drops, we initially perform NPT simulations close to the nematic-vapor coexistence region, allow the system to equilibrate and subsequently induce a sudden volume expansion, followed with NVT simulations. The resultant drops coexist with their vapor and are generally not spherical but elongated, have the rod-like particles tangentially aligned at the surface and an overall nematic orientation along the main axis of the drop. We find that the drop eccentricity increases with increasing molecular elongation, κ. For small κ the nematic texture in the drop is bipolar with two surface defects, or boojums, maximizing their distance along this same axis. For sufficiently high κ, the shape of the drop becomes singular in the vicinity of the defects, and there is a crossover to an almost homogeneous texture; this reflects a transition from a spheroidal to a spindle-like drop.

Diffuse sunlight based calibration of the water vapor channel in the upc raman lidar

NASA Astrophysics Data System (ADS)

Muñoz-Porcar, Constantino; Comeron, Adolfo; Sicard, Michaël; Barragan, Ruben; Garcia-Vizcaino, David; Rodríguez-Gómez, Alejandro; Rocadenbosch, Francesc

2018-04-01

A method for determining the calibration factor of the water vapor channel of a Raman lidar, based on zenith measurements of diffuse sunlight and on assumptions regarding some system parameters and Raman scattering models, has been applied to the lidar system of Universitat Politècnica de Catalunya (UPC; Technical University of Catalonia, Spain). Results will be analyzed in terms of stability and comparison with typical methods relying on simultaneous radiosonde measurements.

Lanthanide-activated scheelite nanocrystal phosphors prepared by the low-temperature vapor diffusion sol-gel method

DOE PAGES

Culver, Sean P.; Brutchey, Richard L.

2016-10-25

A series of Eu 3+-, Tb 3+-, and Tm 3+-doped CaWO 4 phosphor nanocrystals have been synthesized under benign conditions using the vapor diffusion sol–gel method. Here the high degree of synthetic flexibility inherent to this approach has enabled the synthesis of a CaWO 4:(Eu,Tb) dual-sensitized white light emitting nanocrystal phosphor upon commercial UV excitation at 366 nm with a long lifetime exceeding 1 ms.

Method and apparatus for determining minority carrier diffusion length in semiconductors

DOEpatents

Moore, Arnold R.

1984-01-01

Method and apparatus are provided for determining the diffusion length of minority carriers in semiconductor material, particularly amorphous silicon which has a significantly small minority carrier diffusion length using the constant magnitude surface-photovoltage (SPV) method. Steady or modulated illumination at several wavelengths provides the light excitation on the surface of the material to generate the SPV. A manually controlled or automatic servo system maintains a constant predetermined value of the SPV for each wavelength. A drop of a transparent electrolyte solution containing redox couples (preferably quinhydrone) having an oxidation-reduction potential (E) in the order of +0.6 to -1.65 volts couples the SPV to a measurement system. The drop of redox couple solution functions to create a liquid Schottky barrier at the surface of the material. Illumination light is passed through a transparent rod supported over the surface and through the drop of transparent electrolyte. The drop is held in the gap between the rod and the surface. Steady red light is also used as an optical bias to reduce deleterious space-charge effects that occur in amorphous silicon.

Gas Suppression via Copper Interlayers in Magnetron Sputtered Al-Cu2O Multilayers.

PubMed

Kinsey, Alex H; Slusarski, Kyle; Sosa, Steven; Weihs, Timothy P

2017-07-05

The use of thin-foil, self-propagating thermite reactions to bond components successfully depends on the ability to suppress gas generation and avoid pore formation during the exothermic production of brazes. To study the mechanisms of vapor production in diluted thermites, thin film multilayer Al-Cu-Cu 2 O-Cu foils are produced via magnetron sputtering, where the Cu layer thickness is systematically increased from 0 to 100 nm in 25 nm increments. The excess Cu layers act as diffusion barriers, limiting the transport of oxygen from the oxide to the Al fuel, as determined by slow heating differential scanning calorimetry experiments. Furthermore, by adding excess Cu to the system, the temperature of the self-propagating thermite reactions drops below the boiling point of Cu, eliminating the metal vapor production. It is determined that Cu vapor production can be eliminated by increasing the Cu interlayer thickness above 50 nm. However, the porous nature of the final products suggests that only metal vapor production is suppressed via dilution. Gas generation via oxygen release is still capable of producing a porous reaction product.

Some mechanisms for the formation of octopus-shaped iron micro-particles

NASA Astrophysics Data System (ADS)

Bica, Ioan

2004-08-01

Fluid spheres (micro-spheres or/and drops) are formed out of the metallic solid (the carbon steel semi-finished product) in the argon plasma of the transferred electric arc. For short intervals of time, the spheres are at rest with relation to vapors. The movement of the vapors around the spheres is in the same plane. It consists of a movement around a circle combined with the movement produced by a definitely located whirl. The molar concentration of the vapors is small in comparison with the molar density of the mixture formed of vapors and gas. At the intersection of the sphere and the plane of movement of the vapors, distinct stagnation point is formed. They constitute points of the beginning/and end of the current lines. Each current line is a carrier of a vapor cylinder. In time, the cylinder-gas interface reaches points of temperature equal to that of the "dew point" for iron. On this occasion a liquid membrane is formed. It delimits the vapor-gas mixture from the rest of the gas. Subsequent to the process of diffusion in non-stationary condition, the membrane becomes thicker and no vapors exist inside the tube. Needle-shaped micro-tubes are formed, in liquid phase, around the fluid sphere. By solidification, micro-particles occur, consisting of a central nucleus around which ligaments branch out.

Performance of some nucleation theories with a nonsharp droplet-vapor interface.

PubMed

Napari, Ismo; Julin, Jan; Vehkamäki, Hanna

2010-10-21

Nucleation theories involving the concept of nonsharp boundary between the droplet and vapor are compared to recent molecular dynamics (MD) simulation data of Lennard-Jones vapors at temperatures above the triple point. The theories are diffuse interface theory (DIT), extended modified liquid drop-dynamical nucleation theory (EMLD-DNT), square gradient theory (SGT), and density functional theory (DFT). Particular attention is paid to thermodynamic consistency in the comparison: the applied theories either use or, with a proper parameter adjustment, result in the same values of equilibrium vapor pressure, bulk liquid density, and surface tension as the MD simulations. Realistic pressure-density correlations are also used. The best agreement between the simulated nucleation rates and calculations is obtained from DFT, SGT, and EMLD-DNT, all of which, in the studied temperature range, show deviations of less than one order of magnitude in the nucleation rate. DIT underestimates the nucleation rate by up to two orders of magnitude. DFT and SGT give the best estimate of the molecular content of the critical nuclei. Overall, at the vapor conditions of this study, all the investigated theories perform better than classical nucleation theory in predicting nucleation rates.

Crystallization and preliminary X-ray analysis of the atrial natriuretic peptide (ANP) receptor extracellular domain complex with ANP: use of ammonium sulfate as the cryosalt.

PubMed

Ogawa, Haruo; Zhang, Xiaolun; Qiu, Yue; Ogata, Craig M; Misono, Kunio S

2003-10-01

Atrial natriuretic peptide (ANP) plays a major role in blood pressure and volume regulation owing to its natriuretic and vasodilatory activities. The ANP receptor is a single-span transmembrane receptor coupled to its intrinsic guanylyl cyclase activity. The extracellular hormone-binding domain of rat ANP receptor (ANPR) was overexpressed by permanent transfection in CHO cells and purified. ANPR complexed with ANP was crystallized at 301 K by the hanging-drop vapor-diffusion method. The crystals were frozen in 3.4 M ammonium sulfate used as a cryoprotectant. The crystals diffracted to 3.1 A resolution using synchrotron radiation and belonged to the hexagonal space group P6(1), with unit-cell parameters a = b = 100.3, c = 258.6 A.

Crystallization and Preliminary X-ray Diffraction Analysis of Hemextin A: A Unique Anticoagulant Protein from Hemachatus haemachatus Venom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee,Y.; Kumar, S.; Jobichen, C.

2007-01-01

Hemextin A was isolated and purified from African Ringhals cobra (Hemachatus haemachatus). It is a three-finger toxin that specifically inhibits blood coagulation factor VIIa and clot formation and that also interacts with hemextin B to form a unique anticoagulant complex. Hemextin A was crystallized by the hanging-drop vapor-diffusion method by equilibration against 0.2 M ammonium acetate, 0.1 M sodium acetate trihydrate pH 4.6 and 30% PEG 4000 as the precipitating agent. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 {angstrom} and two molecules in the asymmetricmore » unit. They diffracted to 1.5 {angstrom} resolution at beamline X25 at BNL.« less

9. BUILDING NO. 620B, FRICTION PENDULUM BUILDING. 29FOOT DROP TOWER ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

9. BUILDING NO. 620-B, FRICTION PENDULUM BUILDING. 29-FOOT DROP TOWER SITS BEHIND BLAST SHIELD IN FRONT OF BUILDING. - Picatinny Arsenal, 600 Area, Test Areas District, State Route 15 near I-80, Dover, Morris County, NJ

Co-crystal structures of PTK6: With Dasatinib at 2.24 Å, with novel imidazo[1,2-a]pyrazin-8-amine derivative inhibitor at 1.70 Å resolution.

PubMed

Thakur, Manish Kumar; Birudukota, Swarnakumari; Swaminathan, Srinivasan; Battula, Sivarama Krishna; Vadivelu, Sarvanan; Tyagi, Rajiv; Gosu, Ramachandraiah

2017-01-22

Human Protein tyrosine kinase 6 (PTK6)(EC:2.7.10.2), also known as the breast tumor kinase (BRK), is an intracellular non-receptor Src-related tyrosine kinase expressed five-fold or more in human breast tumors and breast cancer cell lines but its expression being low or completely absent from normal mammary gland. There is a recent interest in targeting PTK6-positive breast cancer by developing small molecule inhibitor against PTK6. Novel imidazo[1,2-a]pyrazin-8-amines (IPA) derivative compounds and FDA approved drug, Dasatinib are reported to inhibit PTK6 kinase activity with IC 50 in nM range. To understand binding mode of these compounds and key interactions that drive the potency against PTK6, one of the IPA compounds and Dasatinib were chosen to study through X-ray crystallography. The recombinant PTK6 kinase domain was purified and co-crystallized at room temperature by the sitting-drop vapor diffusion method, collected X-ray diffraction data at in-house and resolved co-crystal structure of PTK6-KD with Dasatinib at 2.24 Å and with IPA compound at 1.70 Å resolution. Both these structures are in DFG-in & αC-helix-out conformation with unambiguous electron density for Dasatinib or IPA compound bound at the ATP-binding pocket. Relative difference in potency between Dasatinib and IPA compound is delineated through the additional interactions derived from the occupation of additional pocket by Dasatinib at gatekeeper area. Refined crystallographic coordinates for the kinase domain of PTK6 in complex with IPA compound and Dasatinib have been submitted to Protein Data Bank under the accession number 5DA3 and 5H2U respectively. Copyright © 2016 Elsevier Inc. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zipper, Lauren E.; Aristide, Xavier; Bishop, Dylan P.

A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fitting the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under differentmore » conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63–82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. Ultimately, the results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations.« less

A simple technique to reduce evaporation of crystallization droplets by using plate lids with apertures for adding liquids.

PubMed

Zipper, Lauren E; Aristide, Xavier; Bishop, Dylan P; Joshi, Ishita; Kharzeev, Julia; Patel, Krishna B; Santiago, Brianna M; Joshi, Karan; Dorsinvil, Kahille; Sweet, Robert M; Soares, Alexei S

2014-12-01

A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fitting the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under different conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63-82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. The results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations.

Sulfur Doping of InAs

DTIC Science & Technology

2015-06-04

dopant in III-V molecular beam epitaxial (MBE) growth, due to the high vapor pressure. This is a significant concern as high vapor pressure species...results were also observed with co-implantation of gallium with selenium, which sits on the group-V site [10]. Consequently, the sulfur dose was

Macroscopic modeling of heat and water vapor transfer with phase change in dry snow based on an upscaling method: Influence of air convection

NASA Astrophysics Data System (ADS)

Calonne, N.; Geindreau, C.; Flin, F.

2015-12-01

At the microscopic scale, i.e., pore scale, dry snow metamorphism is mainly driven by the heat and water vapor transfer and the sublimation-deposition process at the ice-air interface. Up to now, the description of these phenomena at the macroscopic scale, i.e., snow layer scale, in the snowpack models has been proposed in a phenomenological way. Here we used an upscaling method, namely, the homogenization of multiple-scale expansions, to derive theoretically the macroscopic equivalent modeling of heat and vapor transfer through a snow layer from the physics at the pore scale. The physical phenomena under consideration are steady state air flow, heat transfer by conduction and convection, water vapor transfer by diffusion and convection, and phase change (sublimation and deposition). We derived three different macroscopic models depending on the intensity of the air flow considered at the pore scale, i.e., on the order of magnitude of the pore Reynolds number and the Péclet numbers: (A) pure diffusion, (B) diffusion and moderate convection (Darcy's law), and (C) strong convection (nonlinear flow). The formulation of the models includes the exact expression of the macroscopic properties (effective thermal conductivity, effective vapor diffusion coefficient, and intrinsic permeability) and of the macroscopic source terms of heat and vapor arising from the phase change at the pore scale. Such definitions can be used to compute macroscopic snow properties from 3-D descriptions of snow microstructures. Finally, we illustrated the precision and the robustness of the proposed macroscopic models through 2-D numerical simulations.

Microfabricated diffusion source

DOEpatents

Oborny, Michael C [Albuquerque, NM; Frye-Mason, Gregory C [Cedar Crest, NM; Manginell, Ronald P [Albuquerque, NM

2008-07-15

A microfabricated diffusion source to provide for a controlled diffusion rate of a vapor comprises a porous reservoir formed in a substrate that can be filled with a liquid, a headspace cavity for evaporation of the vapor therein, a diffusion channel to provide a controlled diffusion of the vapor, and an outlet to release the vapor into a gas stream. The microfabricated diffusion source can provide a calibration standard for a microanalytical system. The microanalytical system with an integral diffusion source can be fabricated with microelectromechanical systems technologies.

Thermal activation of superheated lipid-coated perfluorocarbon drops.

PubMed

Mountford, Paul A; Thomas, Alec N; Borden, Mark A

2015-04-28

This study explored the thermal conditions necessary for the vaporization of superheated perfluorocarbon nanodrops. Droplets C3F8 and C4F10 coated with a homologous series of saturated diacylphosphatidylcholines were formed by condensation of 4 μm diameter microbubbles. These drops were stable at room temperature and atmospheric pressure, but they vaporized back into microbubbles at higher temperatures. The vaporization transition was measured as a function of temperature by laser light extinction. We found that C3F8 and C4F10 drops experienced 90% vaporization at 40 and 75 °C, respectively, near the theoretical superheat limits (80-90% of the critical temperature). We therefore conclude that the metastabilty of these phase-change agents arises not from the droplet Laplace pressure altering the boiling point, as previously reported, but from the metastability of the pure superheated fluid to homogeneous nucleation. The rate of C4F10 drop vaporization was quantified at temperatures ranging from 55 to 75 °C, and an apparent activation energy barrier was calculated from an Arrhenius plot. Interestingly, the activation energy increased linearly with acyl chain length from C14 to C20, indicating that lipid interchain cohesion plays an important role in suppressing the vaporization rate. The vaporized drops (microbubbles) were found to be unstable to dissolution at high temperatures, particularly for C14 and C16. However, proper choice of the fluorocarbon and lipid species provided a nanoemulsion that could undergo at least ten reversible condensation/vaporization cycles. The vaporization properties presented in this study may facilitate the engineering of tunable phase-shift particles for diagnostic imaging, targeted drug delivery, tissue ablation, and other applications.

Studies on Aspirin Crystals Generated by a Modified Vapor Diffusion Method.

PubMed

Mittal, Amit; Malhotra, Deepak; Jain, Preeti; Kalia, Anupama; Shunmugaperumal, Tamilvanan

2016-08-01

The objectives of the current investigation were (1) to study the influence of selected two different non-solvents (diethylether and dichloromethane) on the drug crystal formation of a model drug, aspirin (ASP-I) by the modified vapor diffusion method and (2) to characterize and compare the generated crystals (ASP-II and ASP-III) using different analytical techniques with that of unprocessed ASP-I. When compared to the classical vapor diffusion method which consumes about 15 days to generate drug crystals, the modified method needs only 12 h to get the same. Fourier transform-infrared spectroscopy (FT-IR) reveals that the internal structures of ASP-II and ASP-III crystals were identical when compared with ASP-I. Although the drug crystals showed a close similarity in X-ray diffraction patterns, the difference in the relative intensities of some of the diffraction peaks (especially at 2θ values of around 7.7 and 15.5) could be attributed to the crystal habit or crystal size modification. Similarly, the differential scanning calorimetry (DSC) study speculates that only the crystal habit modifications might occur but without involving any change in internal structure of the generated drug polymorphic form I. This is further substantiated from the scanning electron microscopy (SEM) pictures that indicated the formation of platy shape for the ASP-II crystals and needle shape for the ASP-III crystals. In addition, the observed slow dissolution of ASP crystals should indicate polymorph form I formation. Thus, the modified vapor diffusion method could routinely be used to screen and legally secure all possible forms of other drug entities too.

The origin of star-shaped oscillations of Leidenfrost drops

NASA Astrophysics Data System (ADS)

Ma, Xiaolei; Burton, Justin C.

We experimentally investigate the oscillations of Leidenfrost drops of water, liquid nitrogen, ethanol, methanol, acetone and isopropyl alcohol. The drops levitate on a cushion of evaporated vapor over a hot, curved surface which keeps the drops stationary. We observe star-shaped modes along the periphery of the drop, with mode numbers n = 2 to 13. The number of observed modes is sensitive to the properties of the liquid. The pressure oscillation frequency in the vapor layer under the drop is approximately twice that of the drop frequency, which is consistent with a parametric forcing mechanism. However, the Rayleigh and thermal Marangoni numbers are of order 10,000, indicating that convection should play a dominating role as well. Surprisingly, we find that the wavelength and frequency of the oscillations only depend on the thickness of the liquid, which is twice the capillary length, and do not depend on the mode number, substrate temperature, or the substrate curvature. This robust behavior suggests that the wavelength for the oscillations is set by thermal convection inside the drop, and is less dependent on the flow in the vapor layer under the drop

Solid evacuated microspheres of hydrogen

DOEpatents

Turnbull, Robert J.; Foster, Christopher A.; Hendricks, Charles D.

1982-01-01

A method is provided for producing solid, evacuated microspheres comprised of hydrogen. The spheres are produced by forming a jet of liquid hydrogen and exciting mechanical waves on the jet of appropriate frequency so that the jet breaks up into drops with a bubble formed in each drop by cavitation. The drops are exposed to a pressure less than the vapor pressure of the liquid hydrogen so that the bubble which is formed within each drop expands. The drops which contain bubbles are exposed to an environment having a pressure just below the triple point of liquid hydrogen and they thereby freeze giving solid, evacuated spheres of hydrogen.

46 CFR 39.30-1 - Operational requirements-TB/ALL.

Code of Federal Regulations, 2010 CFR

2010-10-01

... oxygen content of each area of that tank formed by each partial bulkhead must be measured at a point one... the requirements of this part. (b) The pressure drop through the vapor collection system from the most... rate versus the pressure drop. (c) If a vessel carries vapor hoses, the pressure drop through the hoses...

Crystallization screening test for the whole-cell project on Thermus thermophilus HB8

PubMed Central

Iino, Hitoshi; Naitow, Hisashi; Nakamura, Yuki; Nakagawa, Noriko; Agari, Yoshihiro; Kanagawa, Mayumi; Ebihara, Akio; Shinkai, Akeo; Sugahara, Mitsuaki; Miyano, Masashi; Kamiya, Nobuo; Yokoyama, Shigeyuki; Hirotsu, Ken; Kuramitsu, Seiki

2008-01-01

It was essential for the structural genomics of Thermus thermophilus HB8 to efficiently crystallize a number of proteins. To this end, three conventional robots, an HTS-80 (sitting-drop vapour diffusion), a Crystal Finder (hanging-drop vapour diffusion) and a TERA (modified microbatch) robot, were subjected to a crystallization condition screening test involving 18 proteins from T. thermophilus HB8. In addition, a TOPAZ (microfluidic free-interface diffusion) designed specifically for initial screening was also briefly examined. The number of diffraction-quality crystals and the time of appearance of crystals increased in the order HTS-80, Crystal Finder, TERA. With the HTS-80 and Crystal Finder, the time of appearance was short and the rate of salt crystallization was low. With the TERA, the number of diffraction-quality crystals was high, while the time of appearance was long and the rate of salt crystallization was relatively high. For the protein samples exhibiting low crystallization success rates, there were few crystallization conditions that were common to the robots used. In some cases, the success rate depended greatly on the robot used. The TOPAZ showed the shortest time of appearance and the highest success rate, although the crystals obtained were too small for diffraction studies. These results showed that the combined use of different robots significantly increases the chance of obtaining crystals, especially for proteins exhibiting low crystallization success rates. The structures of 360 of 944 purified proteins have been successfully determined through the combined use of an HTS-80 and a TERA. PMID:18540056

Lithium-ions diffusion kinetic in LiFePO4/carbon nanoparticles synthesized by microwave plasma chemical vapor deposition for lithium-ion batteries

NASA Astrophysics Data System (ADS)

Gao, Chao; Zhou, Jian; Liu, Guizhen; Wang, Lin

2018-03-01

Olivine structure LiFePO4/carbon nanoparticles are synthesized successfully using a microwave plasma chemical vapor deposition (MPCVD) method. Microwave is an effective method to synthesize nanomaterials, the LiFePO4/carbon nanoparticles with high crystallinity can shorten diffusion routes for ionic transfer and electron tunneling. Meanwhile, a high quality, complete and homogenous carbon layer with appropriate thickness coating on the surface of LiFePO4 particles during in situ chemical vapor deposition process, which can ensure that electrons are able to transfer fast enough from all sides. Electrochemical impedance spectroscopy (EIS) is carried out to collect information about the kinetic behavior of lithium diffusion in LiFePO4/carbon nanoparticles during the charging and discharging processes. The chemical diffusion coefficients of lithium ions, DLi, are calculated in the range of 10-15-10-9 cm2s-1. Nanoscale LiFePO4/carbon particles show the longer regions of the faster solid-solution diffusion, and corresponding to the narrower region of the slower two-phase diffusion during the insertion/exaction of lithium ions. The CV and galvanostatic charge-discharge measurements show that the LiFePO4/carbon nanoparticles perform an excellent electrochemical performance, especially the high rate capacity and cycle life.

Bulk Growth of Wide Band Gap II-VI Compound Semiconductors by Physical Vapor Transport

NASA Technical Reports Server (NTRS)

Su, Ching-Hua

1997-01-01

The mechanism of physical vapor transport of II-VI semiconducting compounds was studied both theoretically, using a one-dimensional diffusion model, as well as experimentally. It was found that the vapor phase stoichiometry is critical in determining the vapor transport rate. The experimental heat treatment methods to control the vapor composition over the starting materials were investigated and the effectiveness of the heat treatments was confirmed by partial pressure measurements using an optical absorption technique. The effect of residual (foreign) gas on the transport rate was also studies theoretically by the diffusion model and confirmed experimentally by the measurements of total pressure and compositions of the residual gas. An in-situ dynamic technique for the transport rate measurements and a further extension of the technique that simultaneously measured the partial pressures and transport rates were performed and, for the first time, the experimentally determined mass fluxes were compared with those calculated, without any adjustable parameters, from the diffusion model. Using the information obtained from the experimental transport rate measurements as guideline high quality bulk crystal of wide band gap II-VI semiconductor were grown from the source materials which undergone the same heat treatment methods. The grown crystals were then extensively characterized with emphasis on the analysis of the crystalline structural defects.

Crystallization and preliminary X-ray analysis of ginkbilobin-2 from Ginkgo biloba seeds: a novel antifungal protein with homology to the extracellular domain of plant cysteine-rich receptor-like kinases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miyakawa, Takuya; Sawano, Yoriko; Miyazono, Ken-ichi

Purification and crystallization of ginkbilobin-2 and its selenomethionine derivative allowed the collection of complete data to 2.38 Å resolution and multiwavelength anomalous diffraction data sets, respectively. The antifungal protein ginkbilobin-2 (Gnk2) from Ginkgo biloba seeds does not show homology to other pathogenesis-related proteins, but does show homology to the extracellular domain of plant cysteine-rich receptor-like kinases. Native Gnk2 purified from ginkgo nuts and the selenomethionine derivative of recombinant Gnk2 (SeMet-rGnk2) were crystallized by the sitting-drop vapour-diffusion method using different precipitants. X-ray diffraction data were collected from Gnk2 at 2.38 Å resolution and from SeMet-rGnk2 at 2.79 Å resolution using amore » synchrotron-radiation source. The crystals of both proteins belonged to the primitive cubic space group P2{sub 1}3, with unit-cell parameters a = b = c = 143.2 Å.« less

Crystallization and preliminary X-ray diffraction analysis of an endo-1,4-β-D-glucanase from Aspergillus aculeatus F-50.

PubMed

Chen, Yun; Huang, Jian Wen; Chen, Chun Chi; Lai, Hui Lin; Jin, Jian; Guo, Rey Ting

2015-04-01

Cellulose is the most abundant renewable biomass on earth, and its decomposition has proven to be very useful in a wide variety of industries. Endo-1,4-β-D-glucanase (EC 3.2.1.4; endoglucanase), which can catalyze the random hydrolysis of β-1,4-glycosidic bonds to cleave cellulose into smaller fragments, is a key cellulolytic enzyme. An endoglucanase isolated from Aspergillus aculeatus F-50 (FI-CMCase) that was classified into glycoside hydrolase family 12 has been found to be effectively expressed in the industrial strain Pichia pastoris. Here, recombinant FI-CMCase was crystallized. Crystals belonging to the orthorhombic space group C222₁, with unit-cell parameters a = 74.2, b = 75.1, c = 188.4 Å, were obtained by the sitting-drop vapour-diffusion method and diffracted to 1.6 Å resolution. Initial phase determination by molecular replacement clearly shows that the crystal contains two protein molecules in the asymmetric unit. Further model building and structure refinement are in progress.

Crystallization and preliminary X-ray crystallographic analysis of hydroquinone dioxygenase from Sphingomonas sp. TTNP3

PubMed Central

Da Vela, Stefano; Ferraroni, Marta; Kolvenbach, Boris A.; Keller, Eva; Corvini, Philippe F. X.; Scozzafava, Andrea; Briganti, Fabrizio

2012-01-01

Hydroquinone dioxygenase (HQDO), a novel FeII ring-fission dioxygenase from Sphingomonas sp. strain TTNP3 which oxidizes a wide range of hydroquinones to the corresponding 4-hydroxymuconic semialdehydes, has been crystallized. The enzyme is an α2β2 heterotetramer constituted of two subunits of 19 and 38 kDa. Diffraction-quality crystals of HQDO were obtained using the sitting-drop vapour-diffusion method at 277 K from a solution consisting of 16% PEG 4000, 0.3 M MgCl2, 0.1 M Tris pH 8.5. The crystals belonged to the monoclinic space group P21, with unit-cell parameters a = 88.4, b = 125.4, c = 90.8 Å, β = 105.3°. The asymmetric unit contained two heterotetramers, i.e. four copies of each of the two different subunits related by noncrystallographic 222 symmetry. A complete data set extending to a maximum resolution of 2.5 Å was collected at 100 K using a wavelength of 0.980 Å. PMID:22691794

Crystallization and preliminary X-ray diffraction analysis of the TetR-family transcriptional repressor YhgD from Bacillus halodurans

PubMed Central

Yeo, Hyun Ku; Park, Young Woo; Kang, Jina; Lee, Jae Young

2013-01-01

YhgD is a member of the TetR-family transcription factors, which regulate genes encoding proteins involved in multidrug resistance, virulence, osmotic stress and pathogenicity. YhgD from the alkaliphilic bacterium Bacillus halodurans was cloned and overexpressed in Escherichia coli. YhgD (Bh2145) from B. halodurans is composed of 193 amino-acid residues with a molecular mass of 21 853 Da. YhgD was crystallized at 296 K using ethylene glycol as a precipitant by the sitting-drop vapour-diffusion method. The crystal diffracted to 1.9 Å resolution and belonged to the apparent triclinic space group P1, with unit-cell parameters a = 37.22, b = 47.85, c = 54.15 Å, α = 92.75, β = 107.9, γ = 90.27°. The asymmetric unit is likely to contain two molecules of monomeric YhgD, giving a crystal volume per mass (V M) of 2.05 Å3 Da−1 and a solvent content of 40.2%. PMID:23695570

Crystallization and preliminary X-ray diffraction analysis of the TetR-family transcriptional repressor YhgD from Bacillus halodurans.

PubMed

Yeo, Hyun Ku; Park, Young Woo; Kang, Jina; Lee, Jae Young

2013-05-01

YhgD is a member of the TetR-family transcription factors, which regulate genes encoding proteins involved in multidrug resistance, virulence, osmotic stress and pathogenicity. YhgD from the alkaliphilic bacterium Bacillus halodurans was cloned and overexpressed in Escherichia coli. YhgD (Bh2145) from B. halodurans is composed of 193 amino-acid residues with a molecular mass of 21 853 Da. YhgD was crystallized at 296 K using ethylene glycol as a precipitant by the sitting-drop vapour-diffusion method. The crystal diffracted to 1.9 Å resolution and belonged to the apparent triclinic space group P1, with unit-cell parameters a = 37.22, b = 47.85, c = 54.15 Å, α = 92.75, β = 107.9, γ = 90.27°. The asymmetric unit is likely to contain two molecules of monomeric YhgD, giving a crystal volume per mass (VM) of 2.05 Å(3) Da(-1) and a solvent content of 40.2%.

An approximate analysis of the diffusing flow in a self-controlled heat pipe.

NASA Technical Reports Server (NTRS)

Somogyi, D.; Yen, H. H.

1973-01-01

Constant-density two-dimensional axisymmetric equations are presented for the diffusing flow of a class of self-controlled heat pipes. The analysis is restricted to the vapor space. Condensation of the vapor is related to its mass fraction at the wall by the gas kinetic formula. The Karman-Pohlhausen integral method is applied to obtain approximate solutions. Solutions are presented for a water heat pipe with neon control gas.

Effects of water immersion to the neck on pulmonary circulation and tissue volume in man

NASA Technical Reports Server (NTRS)

Begin, R.; Epstein, M.; Sackner, M. A.; Levinson, R.; Dougherty, R.; Duncan, D.

1976-01-01

A rapid noninvasive breathing method is used to obtain serial measurements of the pulmonary capillary blood flow, diffusing capacity per unit of alveolar volume, combined pulmonary tissue plus capillary volume, functional residual capacity, and oxygen consumption in five normal subjects undergoing 6 h of sitting, 4 h of sitting while immersed to the neck in thermoneutral water, and 4 h of lying in thermoneutral water to the neck. The rebreathing method employed a test gas mixture containing 0.5% C2H2, 0.3% C(18)O, 10% He, 21% O2, and balance N2. It is shown that immersion to the neck in the seated posture results in significant increases in sodium excretion cardiac output, and diffusing capacity per unit of alveolar volume. The pulmonary tissue plus capillary volume did not change, demonstrating that the central vascular engorgement induced by water immersion is not accompanied by significant extravasation of fluid into the pulmonary interstitial space.

Quantitative Measurement of Oxygen in Microgravity Combustion

NASA Technical Reports Server (NTRS)

Silver, Joel A.

1997-01-01

A low-gravity environment, in space or in ground-based facilities such as drop towers, provides a unique setting for studying combustion mechanisms. Understanding the physical phenomena controlling the ignition and spread of flames in microgravity has importance for space safety as well as for better characterization of dynamical and chemical combustion processes which are normally masked by buoyancy and other gravity-related effects. Due to restrictions associated with performing measurements in reduced gravity, diagnostic methods which have been applied to microgravity combustion studies have generally been limited to capture of flame emissions on film or video, laser Schlieren imaging and (intrusive) temperature measurements using thermocouples. Given the development of detailed theoretical models, more sophisticated diagnostic methods are needed to provide the kind of quantitative data necessary to characterize the properties of microgravity combustion processes as well as provide accurate feedback to improve the predictive capabilities of the models. When the demands of space flight are considered, the need for improved diagnostic systems which are rugged, compact, reliable, and operate at low power becomes apparent. The objective of this research is twofold. First, we want to develop a better understanding of the relative roles of diffusion and reaction of oxygen in microgravity combustion. As the primary oxidizer species, oxygen plays a major role in controlling the observed properties of flames, including flame front speed (in solid or liquid flames), extinguishment characteristics, flame size and flame temperature. The second objective is to develop better diagnostics based on diode laser absorption which can be of real value in both microgravity combustion research and as a sensor on-board Spacelab as either an air quality monitor or as part of a fire detection system. In our prior microgravity work, an eight line-of-sight fiber optic system measured water vapor mole fractions in the NASA Lewis 2.2-sec Drop Tower. In that system, the laser and all electronics resided at the top of the drop tower and was connected via a fiber optic cable to the rig, on which a 'pitch and catch' set of fiber collimating lenses were used to transmit the laser beam across a jet diffusion flame. This system required eight independent detection/demodulation units and had poor spatial resolution. This research builds on this earlier work, resulting in an improved capability for quantitative, nonintrusive measurement of major combustion species. A vertical cavity surface-emitting diode laser (VCSEL) and a continuous spatial scanning method permit the measurement of temporal and spatial profiles of the concentrations and temperatures of molecular oxygen. High detection sensitivity is achieved with wavelength modulation spectroscopy (WMS). One-g experiments are performed using a slot diffusion flame. Microgravity measurements on a solid fuel (cellulose sheet) system are planned for the NASA Lewis 2.2-second Drop Tower Facility.

Improvements to water vapor transmission and capillary absorption measurements in porous materials

Treesearch

Samuel L. Zelinka; Samuel V. Glass; Charles R. Boardman

2016-01-01

The vapor permeability (or equivalently the vapor diffusion resistance factor) and the capillary absorption coefficient are frequently used as inputs to hygrothermal or heat, air, and moisture (HAM) models. However, it has been well documented that the methods used to determine these properties are sensitive to the operator, and wide variations in the properties have...

Three-dimensional structure of Erwinia carotovora L-asparaginase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kislitsyn, Yu. A.; Kravchenko, O. V.; Nikonov, S. V.

2006-10-15

Three-dimensional structure of Erwinia carotovora L-asparaginase, which has antitumor activity and is used for the treatment of acute lymphoblastic leukemia, was solved at 3 A resolution and refined to R{sub cryst} = 20% and R{sub free} = 28%. Crystals of recombinant Erwinia carotovora L-asparaginase were grown by the hanging-drop vapor-diffusion method from protein solutions in a HEPES buffer (pH 6.5) and PEG MME 5000 solutions in a cacodylate buffer (pH 6.5) as the precipitant. Three-dimensional X-ray diffraction data were collected up to 3 A resolution from one crystal at room temperature. The structure was solved by the molecular replacement methodmore » using the coordinates of Erwinia chrysanthemi L-asparaginase as the starting model. The coordinates refined with the use of the CNS program package were deposited in the Protein Data Bank (PDB code 1ZCF)« less

Crystallization and X-ray analysis of the salmon-egg lectin SEL24K.

PubMed

Murata, Kenji; Fisher, Andrew J; Hedrick, Jerry L

2007-05-01

The 24 kDa egg lectin of Chinook salmon (Oncorhynchus tshawytscha) is released from the egg during the cortical reaction. The lectin functions in blocking polyspermy during the fertilization process. The egg lectin was purified by affinity chromatography from salmon eggs and crystallized by the hanging-drop vapor-diffusion method using 15/4 EO/OH (pentaerythritol ethoxylate) as a precipitant. The crystal diffracted synchrotron-radiation X-rays to 1.63 A resolution. The crystal belongs to the monoclinic space group P2(1), with unit-cell parameters a = 93.0, b = 73.6, c = 113.6 A, alpha = 90, beta = 92.82, gamma = 90 degrees. The crystal is likely to contain eight molecules in the asymmetric unit (V(M) = 2.3 A3 Da(-1)), corresponding to a solvent content of 45.5%. A self-rotation function suggests an arrangement with 222 point symmetry within the asymmetric unit.

Purification and crystallization of Bacillus subtilis NrnA, a novel enzyme involved in nanoRNA degradation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nelersa, Claudiu M.; Schmier, Brad J.; Malhotra, Arun

2012-05-08

The final step in RNA degradation is the hydrolysis of RNA fragments five nucleotides or less in length (nanoRNA) to mononucleotides. In Escherichia coli this step is carried out by oligoribonuclease (Orn), a DEDD-family exoribonuclease that is conserved throughout eukaryotes. However, many bacteria lack Orn homologs, and an unrelated DHH-family phosphoesterase, NrnA, has recently been identified as one of the enzymes responsible for nanoRNA degradation in Bacillus subtilis. To understand its mechanism of action, B. subtilis NrnA was purified and crystallized at room temperature using the hanging-drop vapor-diffusion method with PEG 4000, PEG 3350 or PEG MME 2000 as precipitant.more » The crystals belonged to the primitive monoclinic space group P2{sub 1}, with unit-cell parameters a = 50.62, b = 121.3, c = 123.4 {angstrom}, {alpha} = 90, {beta} = 91.31, {gamma} = 90{sup o}.« less

Drop Impact on Hairy Surfaces

NASA Astrophysics Data System (ADS)

Nasto, Alice; Hosoi, Anette

2017-11-01

Using a combination of experiments and theory, we investigate the effect of a millimeter-scale hairy texture on impact of liquid drops. By varying the speed of the drop at impact and the spacing of the hairs, we observe a variety of behaviors. For dense hairs and low impact velocity, the liquid drop sits on top of the hair, similar to a Cassie-Baxter state. For higher impact velocity, and intermediate to high density of hairs, the drops penetrate through the surface, but the hairs resist their spreading. For low hair density and high impact velocity, the drops impact and splash.

Self-Diffusion of Drops in a Dilute Sheared Emulsion

NASA Technical Reports Server (NTRS)

Loewenberg, Michael; Hinch, E. J.

1996-01-01

Self-diffusion coefficients that describe cross-flow migration of non-Brownian drops in a dilute sheared emulsion were obtained by trajectory calculations. A boundary integral formulation was used to describe pairwise interactions between deformable drops; interactions between undeformed drops were described with mobility functions for spherical drops. The results indicate that drops have large anisotropic self-diffusivities which depend strongly on the drop viscosity and modestly on the shear-rate. Pairwise interactions between drops in shear-flow do not appreciably promote drop breakup.

Factors affecting the morphology of isocitrate lyase crystals

NASA Technical Reports Server (NTRS)

Demattei, Robert C.; Feigelson, Robert S.; Weber, Patricia C.

1992-01-01

Isocitrate lyase crystals have been grown by the hanging drop vapor equilibration method in both 1-g and microgravity and by vapor equilibrium in small capillaries. The crystal morphologies obtained have ranged from dendritic to 'octagonal' prisms. Theoretical evaporation models have been applied to these growth regimes. The results of these analyses along with other experimental results, indicate the factors which must be controlled to produce good growth morphologies.

Micro-explosion of compound drops

NASA Astrophysics Data System (ADS)

Chen, Chun-Kuei; Lin, Ta-Hui

2014-08-01

Introducing water into spray combustion systems, by either water-in-oil emulsification or supplementary water injection, is one of the major techniques for combustion improvement and NOx reduction. Plentiful researches are available on combustion of water-in-oil emulsion fuel drops. The emulsified liquid is a heterogeneous mixture of immiscible liquids. One component forms the continuous phase and the other component forms the discrete phase. The discrete phase consists of globules of the one fluid that are suspended in the continuous phase fluid. Water-in-oil emulsions are commonly considered for combustion applications because emulsions can result in micro-explosion, thereby reducing the average drop diameter to enhance liquid vaporization, and suppressing the formation of soot and NOx. However, the water addition generally does not exceed about 20% for smooth engine operations[!, 21. The combustion characteristics and micro-explosion of emulsion drop were studied by many researchers. The micro-explosion of water in fuel emulsion drops was caused by very fast growth of superheated water vapor bubbles, its superheat limits must be lower than the boiling point temperature of the fuel. These bubbles were primarily governed by the pressure difference between the superheated vapor and the liquid, and by the inertia imparted to the liquid by the motion of the bubble surface[3 6 In this study, we used a coaxial nozzle to generation the multi-component drop. The different type of water-in-oil fuel drops called the compound drops. Unlike an emulsion drop, a compound drop consists of a water core and a fuel shell, which can originate from the phase separation of emulsion[7, 81 or a water drop colliding with a fuel drop[9, 101 Burning and micro-explosion of compound drops have been found to be distinct from those of emulsion drops[9-111 Wang et al.[9 , 101 studied the combustion characteristics of collision merged alkane-water drops. The merged drops appeared in adhesive and inserted manners. The drop ignition delay time increased with increasing water content. The average burning rate of alkane-water drops decreased with increasing water content. In the burning process, hexadecane-water drops exhibited flash vaporization or flame extinction. Heterogeneous explosion was occasionally observed in drops with trapped air bubbles. The air bubbles were assumed to be the nucleation points of the heterogeneous explosions. Chen and Lin[11 studied the characteristics of water-in-dodecane compound drop with different water content, diameter of drop and environmental oxygen concentration. The vaporization rate increased with increasing environmental oxygen concentration. The compound drops micro-exploded during the burning process in a random way. The number of micro-explosions was majorly influenced by drop diameter, followed by environmental oxygen concentration. Water content had a weaker effect on micro-explosion. As available literature and research results of compound drop burning are scarce, their combustion and micro-explosion behaviors are still poorly understood. In this regard, we changed the drop nature as compound drops to study their combustion characteristics and micro-explosion phenomena.

Modeling contact angle hysteresis of a liquid droplet sitting on a cosine wave-like pattern surface.

PubMed

Promraksa, Arwut; Chen, Li-Jen

2012-10-15

A liquid droplet sitting on a hydrophobic surface with a cosine wave-like square-array pattern in the Wenzel state is simulated by using the Surface Evolver to determine the contact angle. For a fixed drop volume, multiple metastable states are obtained at two different surface roughnesses. Unusual and non-circular shape of the three-phase contact line of a liquid droplet sitting on the model surface is observed due to corrugation and distortion of the contact line by structure of the roughness. The contact angle varies along the contact line for each metastable state. The maximum and minimum contact angles among the multiple metastable states at a fixed viewing angle correspond to the advancing and the receding contact angles, respectively. It is interesting to observe that the advancing/receding contact angles (and contact angle hysteresis) are a function of viewing angle. In addition, the receding (or advancing) contact angles at different viewing angles are determined at different metastable states. The contact angle of minimum energy among the multiple metastable states is defined as the most stable (equilibrium) contact angle. The Wenzel model is not able to describe the contact angle along the three-phase contact line. The contact angle hysteresis at different drop volumes is determined. The number of the metastable states increases with increasing drop volume. Drop volume effect on the contact angles is also discussed. Crown Copyright © 2012. Published by Elsevier Inc. All rights reserved.

Portable vapor diffusion coefficient meter

DOEpatents

Ho, Clifford K [Albuquerque, NM

2007-06-12

An apparatus for measuring the effective vapor diffusion coefficient of a test vapor diffusing through a sample of porous media contained within a test chamber. A chemical sensor measures the time-varying concentration of vapor that has diffused a known distance through the porous media. A data processor contained within the apparatus compares the measured sensor data with analytical predictions of the response curve based on the transient diffusion equation using Fick's Law, iterating on the choice of an effective vapor diffusion coefficient until the difference between the predicted and measured curves is minimized. Optionally, a purge fluid can forced through the porous media, permitting the apparatus to also measure a gas-phase permeability. The apparatus can be made lightweight, self-powered, and portable for use in the field.

Transport of Colloids along Corners: Visualization of Evaporation-Induced Flows beyond the Axisymmetric Condition.

PubMed

Vélez-Cordero, J Rodrigo; Yáñez Soto, Bernardo; Arauz-Lara, José L

2016-08-16

Nonhomogeneous evaporation fluxes have been shown to promote the formation of internal currents in sessile droplets, explaining the patterns that suspended particles leave after the droplet has dried out. Although most evaporation experiments have been conducted using spherical-cap-shaped drops, which are essentially in an axisymmetric geometry, here we show an example of nonhomogeneous evaporation in asymmetric geometries, which is visualized by following the motion of colloidal particles along liquid fingers forming a meniscus at square corners. It is found that the particle's velocity increases with the diffusive evaporation factor [Formula: see text] for the three tested fluids: water, isopropyl alcohol (IPA), and ethanol (EtOH). Here, [Formula: see text] is the vapor diffusivity in air, RH is the relative amount of vapor in the atmosphere, and cs is the saturated vapor concentration. We observed that in IPA and EtOH the internal currents promote a 3D spiral motion, whereas in water the particle's trajectory is basically unidirectional. By adding 0.25 critical micelle concentration (CMC) of sodium dodecyl sulfate (SDS) surfactant in water, a velocity blast was observed in the whole circulation flow pattern, going from [Formula: see text] to nearly [Formula: see text] in the longitudinal velocity component. To assess the effect of breaking the axisymmetric condition on the evaporation flux profile, we numerically solved the diffusive equation in model geometries that preserve the value of the contact angle θ but introduce an additional angle ϕ that characterizes the solid substrate. By testing different combinations of θ and ϕ, we corroborated that the evaporation flux increases when the substrate and the gas-liquid curves meet at corners with increasing sharpness.

Dynamics and mass transport of solutal convection in a closed porous media system

NASA Astrophysics Data System (ADS)

Wen, Baole; Akhbari, Daria; Hesse, Marc

2016-11-01

Most of the recent studies of CO2 sequestration are performed in open systems where the constant partial pressure of CO2 in the vapor phase results in a time-invariant saturated concentration of CO2 in the brine (Cs). However, in some closed natural CO2 reservoirs, e.g., Bravo Dome in New Mexico, the continuous dissolution of CO2 leads to a pressure drop in the gas that is accompanied by a reduction of Cs and thereby affects the dynamics and mass transport of convection in the brine. In this talk, I discuss the characteristics of convective CO2 dissolution in a closed system. The gas is assumed to be ideal and its solubility given by Henry's law. An analytical solution shows that the diffusive base state is no longer self-similar and that diffusive mass transfer declines rapidly. Scaling analysis reveals that the volume ratio of brine and gas η determines the behavior of the system. DNS show that no constant flux regime exists for η > 0 nevertheless, the quantity F /Cs2 remains constant, where F is the dissolution flux. The onset time is only affected by η when the Rayleigh number Ra is small. In this case, the drop in Cs during the initial diffusive regime significantly reduces the effective Ra and therefore delays the onset.

A simple technique to reduce evaporation of crystallization droplets by using plate lids with apertures for adding liquids

PubMed Central

Zipper, Lauren E.; Aristide, Xavier; Bishop, Dylan P.; Joshi, Ishita; Kharzeev, Julia; Patel, Krishna B.; Santiago, Brianna M.; Joshi, Karan; Dorsinvil, Kahille; Sweet, Robert M.; Soares, Alexei S.

2014-01-01

A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fitting the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under different conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63–82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. The results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations. PMID:25484231

A simple technique to reduce evaporation of crystallization droplets by using plate lids with apertures for adding liquids

DOE PAGES

Zipper, Lauren E.; Aristide, Xavier; Bishop, Dylan P.; ...

2014-11-28

A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fitting the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under differentmore » conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63–82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. Ultimately, the results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations.« less

Surface temperature measurements of a levitated water drop during laser irradiation

NASA Astrophysics Data System (ADS)

Brownell, Cody; Tracey, Timothy

2016-11-01

Simulation of high energy laser propagation and scattering in the maritime environment is problematic, due to the high liklihood of turbulence, fog, and rain or sea spray within the beam path. Laser interactions with large water drops (diameters of approximately 1-mm), such as those found in a light rain, have received relatively less attention. In this regime a high energy laser will rapidly heat and vaporize a water drop as it traverses the beam path, but the exact heating / vaporization rate, its dependence on impurities, and ancillary effects on the drop or surroundings are unclear. In this work we present surface temperature measurements of a water drop obtained using a FLIR IR camera. The drop is acoustically levitated, and subject to a continuous wave laser with a wavelength of 1070-nm and a mean irradiance of approximately 500 W/cm2. These measurements show that the steady-state surface temperature of the drop is well below the saturation temperature, yet based on the time history of the drop volume vaporization begins almost immediately upon laser strike. Inferences on the turbulence characteristics within the drop are also made from measurements of the fluctuations in the surface temperature. Supported by ONR, HEL-JTO, and USNA Trident Scholar Program.

Incorporating C60 as Nucleation Sites Optimizing PbI2 Films To Achieve Perovskite Solar Cells Showing Excellent Efficiency and Stability via Vapor-Assisted Deposition Method.

PubMed

Chen, Hai-Bin; Ding, Xi-Hong; Pan, Xu; Hayat, Tasawar; Alsaedi, Ahmed; Ding, Yong; Dai, Song-Yuan

2018-01-24

To achieve high-quality perovskite solar cells (PSCs), the morphology and carrier transportation of perovskite films need to be optimized. Herein, C 60 is employed as nucleation sites in PbI 2 precursor solution to optimize the morphology of perovskite films via vapor-assisted deposition process. Accompanying the homogeneous nucleation of PbI 2 , the incorporation of C 60 as heterogeneous nucleation sites can lower the nucleation free energy of PbI 2 , which facilitates the diffusion and reaction between PbI 2 and organic source. Meanwhile, C 60 could enhance carrier transportation and reduce charge recombination in the perovskite layer due to its high electron mobility and conductivity. In addition, the grain sizes of perovskite get larger with C 60 optimizing, which can reduce the grain boundaries and voids in perovskite and prevent the corrosion because of moisture. As a result, we obtain PSCs with a power conversion efficiency (PCE) of 18.33% and excellent stability. The PCEs of unsealed devices drop less than 10% in a dehumidification cabinet after 100 days and remain at 75% of the initial PCE during exposure to ambient air (humidity > 60% RH, temperature > 30 °C) for 30 days.

Flame Structure and Scalar Properties in Microgravity Laminar Fires

NASA Technical Reports Server (NTRS)

Feikema, D. A.; Lim, J.; Sivathanu, Y.

2006-01-01

Recent results from microgravity combustion experiments conducted in the Zero Gravity Facility (ZGF) 5.18 second drop tower are reported. Emission mid-infrared spectroscopy measurements have been completed to quantitatively determine the flame temperature, water and carbon dioxide vapor concentrations, radiative emissive power, and soot concentrations in a microgravity laminar ethylene/air flame. The ethylene/air laminar flame conditions are similar to previously reported experiments including the Flight Project, Laminar Soot Processes (LSP). Soot concentrations and gas temperatures are in reasonable agreement with similar results available in the literature. However, soot concentrations and flame structure dramatically change in long duration microgravity laminar diffusion flames as demonstrated in this paper.

Effect of superficial velocity on vaporization pressure drop with propane in horizontal circular tube

NASA Astrophysics Data System (ADS)

Novianto, S.; Pamitran, A. S.; Nasruddin, Alhamid, M. I.

2016-06-01

Due to its friendly effect on the environment, natural refrigerants could be the best alternative refrigerant to replace conventional refrigerants. The present study was devoted to the effect of superficial velocity on vaporization pressure drop with propane in a horizontal circular tube with an inner diameter of 7.6 mm. The experiments were conditioned with 4 to 10 °C for saturation temperature, 9 to 20 kW/m2 for heat flux, and 250 to 380 kg/m2s for mass flux. It is shown here that increased heat flux may result in increasing vapor superficial velocity, and then increasing pressure drop. The present experimental results were evaluated with some existing correlations of pressure drop. The best prediction was evaluated by Lockhart-Martinelli (1949) with MARD 25.7%. In order to observe the experimental flow pattern, the present results were also mapped on the Wang flow pattern map.

Temperature gradient effects on vapor diffusion in partially-saturated porous media

DOE Office of Scientific and Technical Information (OSTI.GOV)

Webb, S.W.

1999-07-01

Vapor diffusion in porous media in the presence of its own liquid may be enhanced due to pore-scale processes, such as condensation and evaporation across isolated liquid islands. Webb and Ho (1997) developed one-and two-dimensional mechanistic pore-scale models of these processes in an ideal porous medium. For isothermal and isobaric boundary conditions with a concentration gradient, the vapor diffusion rate was significantly enhanced by these liquid island processes compared to a dry porous media. The influence of a temperature gradient on the enhanced vapor diffusion rate is considered in this paper. The two-dimensional pore network model which is used inmore » the present study is shown. For partially-saturated conditions, a liquid island is introduced into the top center pore. Boundary conditions on the left and right sides of the model are specified to give the desired concentration and temperature gradients. Vapor condenses on one side of the liquid island and evaporates off the other side due to local vapor pressure lowering caused by the interface curvature, even without a temperature gradient. Rather than acting as an impediment to vapor diffusion, the liquid island actually enhances the vapor diffusion rate. The enhancement of the vapor diffusion rate can be significant depending on the liquid saturation. Vapor diffusion is enhanced by up to 40% for this single liquid island compared to a dry porous medium; enhancement factors of up to an order of magnitude have been calculated for other conditions by Webb and Ho (1997). The dominant effect on the enhancement factor is the concentration gradient; the influence of the temperature gradient is smaller. The significance of these results, which need to be confirmed by experiments, is that the dominant model of enhanced vapor diffusion (EVD) by Philip and deVries (1957) predicts that temperature gradients must exist for EVD to occur. If there is no temperature gradient, there is no enhancement. The present results indicate that EVD is predominantly driven by concentration gradients; temperature gradients are less important. Therefore, the EVD model of Philip and deVries may need to be modified to reflect these results.« less

A highly accurate boundary integral equation method for surfactant-laden drops in 3D

NASA Astrophysics Data System (ADS)

Sorgentone, Chiara; Tornberg, Anna-Karin

2018-05-01

The presence of surfactants alters the dynamics of viscous drops immersed in an ambient viscous fluid. This is specifically true at small scales, such as in applications of droplet based microfluidics, where the interface dynamics become of increased importance. At such small scales, viscous forces dominate and inertial effects are often negligible. Considering Stokes flow, a numerical method based on a boundary integral formulation is presented for simulating 3D drops covered by an insoluble surfactant. The method is able to simulate drops with different viscosities and close interactions, automatically controlling the time step size and maintaining high accuracy also when substantial drop deformation appears. To achieve this, the drop surfaces as well as the surfactant concentration on each surface are represented by spherical harmonics expansions. A novel reparameterization method is introduced to ensure a high-quality representation of the drops also under deformation, specialized quadrature methods for singular and nearly singular integrals that appear in the formulation are evoked and the adaptive time stepping scheme for the coupled drop and surfactant evolution is designed with a preconditioned implicit treatment of the surfactant diffusion.

Preliminary endurance tests of water vaporizers for resistojet applications

NASA Technical Reports Server (NTRS)

Morren, W. Earl; Macrae, Gregory S.

1993-01-01

Three water vaporizers designed for resistojet applications were built and tested for periods up to 500 h and 250 thermal cycles. Two of the vaporizers were not sensitive to orientation with respect to gravity, an indication of likely compatibility with low-gravity environments. Some temperatures and pressures in the third were impacted by orientation, although operation was always stable. The pressure drop across the sand-filled version increased by 147 percent in 38 h and 19 thermal cycles. Bonding of the sand granules in the downstream end of the heat exchanger was the suspected cause of failure of this vaporizer. Pressure drops across the two sintered stainless steel-filled versions were more gradual. One, with a pore size of 60 microns, showed an 80 percent increase in 500 h and 250 thermal cycles and another, with a 10 microns poresize, showed a 29 percent increase in 350 h and 175 thermal cycles. Testing of the latter metal-filled vaporizer was ongoing as of this writing. Oxidation of the porous metal packing materials in these vaporizers, with subsequent deposition of oxide particles within the pores, was believed to have caused the observed increases in pressure drops.

Etiology and Use of the “Hanging Drop” Technique: A Review

PubMed Central

Todorov, Ludmil; VadeBoncouer, Timothy

2014-01-01

Background. The hanging drop (HD) technique presumably relies on the presence of subatmospheric epidural pressure. It is not clear whether this negative pressure is intrinsic or an artifact and how it is affected by body position. There are few data to indicate how often HD is currently being used. Methods. We identified studies that measured subatmospheric pressures and looked at the effect of the sitting position. We also looked at the technique used for cervical and thoracic epidural anesthesia in the last 10 years. Results. Intrinsic subatmospheric pressures were measured in the thoracic and cervical spine. Three trials studied the effect of body position, indicating a higher incidence of subatmospheric pressures when sitting. The results show lower epidural pressure (−10.7 mmHg) with the sitting position. 28.8% of trials of cervical and thoracic epidural anesthesia that documented the technique used, utilized the HD technique. When adjusting for possible bias, the rate of HD use can be as low as 11.7%. Conclusions. Intrinsic negative pressure might be present in the cervical and thoracic epidural space. This effect is more pronounced when sitting. This position might be preferable when using HD. Future studies are needed to compare it with the loss of resistance technique. PMID:24839558

First Protein Crystallization Experiments on The International Space Station: Sweet Success in Space With Thaumatin

NASA Technical Reports Server (NTRS)

Kundrot, Craig E.; Barnes, Cindy L.; Snell, Eddie H.; Achari, Aniruddha; Whitaker, Ann F. (Technical Monitor)

2001-01-01

We determined the room temperature 1.2 A structure of thaumatin using a crystal grown in the first protein crystallization experiment conducted aboard the International Space Station (ISS). The crystals were grown in the Enhanced Gaseous Nitrogen Dewar (EGN) developed by Alexander McPherson and co-workers. EGN transports frozen solutions contained in tygon tubing in a liquid nitrogen Dewar to ISS where the tubes then thaw. Batch, free interface diffusion (FID), or vapor diffusion crystallization occurs after thawing. EGN was flown to the ISS on STS-106 on September 8, 2000. This was a "risk mitigation" flight that tested EGN performance and the process of conducting experiments on ISS. We focused on how to map a hanging drop crystallization recipe to the EGN FID method. Thaumatin was chosen as the test system. Three series of crystallization recipes were set-up. Each series tested different volume ratios of protein-rich solution to precipitant-rich solution. The series differed from each other by fixing either the protein concentration or the amount of protein in the solutions. Upon return of the samples to Earth on October 24 by STS-92, bubbles that spanned the diameter of the tubing were observed in all tubes. Such bubbles interrupt liquid-liquid diffusion and force vapor diffusion equilibration to occur instead. Nonetheless, crystals grew in 9 of 30 tubes. Many large crystals were grown, the largest being 2.0 x 1.1 x 1.0 cubic mm. The largest crystal was used to collect data at room temperature on beamline 7-1 of the Stanford Synchrotron Radiation Source to a maximum resolution of 1.2 A. The structure was refined anisotropically using SHELX with a data to parameter ratio of 4.5 to give an R(sub factor) of 15.8% (R(sub free) = 18.2%) for ail reflections without generated hydrogens. This refinement is proceeding. Comparisons of this 1.2 A microgravity structure to previous reports of the thaumatin structure at 1.75 A and to ground control crystals will be presented.

[Expression, crystallization and crystallographic study of the 1st IgV domain of human CD96].

PubMed

Jiang, Wenjing; Zhang, Shuijun; Yan, Jinghua; Guo, Ning

2013-05-01

CD96 (Tactile) is an adhesion receptor expressed mainly on activated T cells, NK cells. As a family member of the immunoglobulin-like cell receptor, CD96 consists of three immunoglobulin-like domains (V1, V2/C and C) in the extracellular region. Recent studies have shown that the 1st IgV domain of CD96 (CD96V1) plays an essential role in cell adhesion and NK cell-mediated killing. In this study, the 1st IgV domain of human CD96 (hCD96V1) was cloned and expressed in Escherichia coli (BL21). The soluble protein was obtained by refolding of the hCD96V1 inclusion bodies. From analytical ultracentrifugation, we could predict that CD96 V1 maily exists as dimer with approximate molecular weight of 26.9 kDa. The protein was then successfully crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.9 angstrom resolution and belonged to space group P21, with unit-cell parameters a = 35.1, b = 69.5, c = 49.6A, alpha=gamma=90 degrees, beta=105.4 degrees.

Recombinant production, crystallization and X-ray crystallographic structure determination of the peptidyl-tRNA hydrolase of Pseudomonas aeruginosa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hughes, Ronny C.; McFeeters, Hana; Coates, Leighton

The peptidyl-tRNA hydrolase enzyme from the pathogenic bacterium Pseudomonas aeruginosa (Pth; EC 3.1.1.29) has been cloned, expressed in Escherichia coli and crystallized for X-ray structural analysis. Suitable crystals were grown using the sitting-drop vapour-diffusion method after one week of incubation against a reservoir solution consisting of 20% polyethylene glycol 4000, 100 mM Tris pH 7.5, 10%(v/v) isopropyl alcohol. The crystals were used to obtain the three-dimensional structure of the native protein at 1.77 Å resolution. The structure was determined by molecular replacement of the crystallographic data processed in space group P6122 with unit-cell parameters a = b = 63.62,c =more » 155.20 Å, α = β = 90, γ = 120°. The asymmetric unit of the crystallographic lattice was composed of a single copy of the enzyme molecule with a 43% solvent fraction, corresponding to a Matthews coefficient of 2.43 Å3 Da-1. The crystallographic structure reported here will serve as the foundation for future structure-guided efforts towards the development of novel small-molecule inhibitors specific to bacterial Pths.« less

Isolation, purification, crystallization, and preliminary X-ray diffraction study of the crystals of HU protein from M. gallisepticum

NASA Astrophysics Data System (ADS)

Nikolaeva, A. Yu.; Timofeev, V. I.; Boiko, K. M.; Korzhenevskii, D. A.; Rakitina, T. V.; Dorovatovskii, P. V.; Lipkin, A. V.

2015-11-01

HU proteins are involved in bacterial DNA and RNA repair. Since these proteins are absent in cells of higher organisms, inhibitors of HU proteins can be used as effective and safe antibiotics. The crystallization conditions for the M. gallisepticum HU protein were found and optimized by the vapor-diffusion method. The X-ray diffraction data set was collected to 2.91 Å resolution from the crystals grown by the vapor-diffusion method on a synchrotron source. The crystals of the HU protein belong to sp. gr. P41212 and have the following unit-cell parameters: a = b = 97.94 Å, c = 77.92 Å, α = β = γ = 90°.

Comparison of methods for the measurement of mist and vapor from light mineral oil-based metalworking fluids.

PubMed

Simpson, Andrew T

2003-11-01

The measurement of oil mist derived from metalworking fluids formulated with light mineral oils can be highly inaccurate when using traditional filter sampling. This is due to evaporation of oil from the filter. In this work the practicability of an alternative approach measuring total oil mist and vapor was investigated. Combinations of inhalable particle samplers with backup sorbent vapor traps and standard vapor sampling on pumped and diffusive sorbent tubes were evaluated with gravimetric, infrared spectroscopic, and gas chromatographic analytical methods against the performance requirements of European Standard EN 482. An artificial aerosol was used to compare the methods against a reference method of filter sampler in series with three impingers. Multi-orifice samplers were used with standard 8-mm diameter charcoal tubes at 2 L/min without any signs of channelling or significant breakthrough, as were conical inhalable samplers with XAD-2 tubes at 1 L/min. Most combinations of samplers had a bias of less than 3 percent, but solitary pumped charcoal tubes underestimated total oil by 13 percent. Diffusive sampling was affected by impaction of mist particles and condensation of oil vapor. Gravimetric analysis of filters revealed significant potential sample loss during storage, with 4 percent being lost after one day when stored at room temperature and 2 percent when refrigerated. Samples left overnight in the balance room to equilibrate lost 24 percent. Infrared spectroscopy gave more precise results for vapor than gas chromatography (p = 0.002). Gas chromatography was less susceptible to bias from contaminating solvent vapors than infrared spectroscopy, but was still vulnerable to petroleum distillates. Under the specific test conditions (one oil type and mist particle size), all combinations of methods examined complied with the requirements of European Standard EN 484. Total airborne oil can be measured accurately; however, care must be taken to avoid contamination by hydrocarbon solvent vapors during sampling.

Chemical vapor deposition of W-Si-N and W-B-N

DOEpatents

Fleming, James G.; Roherty-Osmun, Elizabeth Lynn; Smith, Paul M.; Custer, Jonathan S.; Jones, Ronald V.; Nicolet, Marc-A.; Madar, Roland; Bernard, Claude

1999-01-01

A method of depositing a ternary, refractory based thin film on a substrate by chemical vapor deposition employing precursor sources of tungsten comprising WF.sub.6, either silicon or boron, and nitrogen. The result is a W--Si--N or W--B--N thin film useful for diffusion barrier and micromachining applications.

Comparison of Sampling Methods to Determine the Impact of Aerobic Biodegradation on Benzene Concentrations at UST Sites

EPA Science Inventory

This material will be interesting to regulators and contractors who collect samples of soil gas to estimate the potential for vapor intrusion of buildings. In the absence of biodegradation, transport of vapors through the unsaturated zone is expected to be by diffusion, and t...

Reactive codoping of GaAlInP compound semiconductors

DOEpatents

Hanna, Mark Cooper [Boulder, CO; Reedy, Robert [Golden, CO

2008-02-12

A GaAlInP compound semiconductor and a method of producing a GaAlInP compound semiconductor are provided. The apparatus and method comprises a GaAs crystal substrate in a metal organic vapor deposition reactor. Al, Ga, In vapors are prepared by thermally decomposing organometallic compounds. P vapors are prepared by thermally decomposing phospine gas, group II vapors are prepared by thermally decomposing an organometallic group IIA or IIB compound. Group VIB vapors are prepared by thermally decomposing a gaseous compound of group VIB. The Al, Ga, In, P, group II, and group VIB vapors grow a GaAlInP crystal doped with group IIA or IIB and group VIB elements on the substrate wherein the group IIA or IIB and a group VIB vapors produced a codoped GaAlInP compound semiconductor with a group IIA or IIB element serving as a p-type dopant having low group II atomic diffusion.

Properties of water along the liquid-vapor coexistence curve via molecular dynamics simulations using the polarizable TIP4P-QDP-LJ water model

PubMed Central

Bauer, Brad A.; Patel, Sandeep

2009-01-01

We present an extension of the TIP4P-QDP model, TIP4P-QDP-LJ, that is designed to couple changes in repulsive and dispersive nonbond interactions to changes in polarizability. Polarizability is intimately related to the dispersion component of classical force field models of interactions, and we explore the effect of incorporating this connection explicitly on properties along the liquid-vapor coexistence curve of pure water. Parametrized to reproduce condensed-phase liquid water properties at 298 K, the TIP4P-QDP-LJ model predicts density, enthalpy of vaporization, self-diffusion constant, and the dielectric constant at ambient conditions to about the same accuracy as TIP4P-QDP but shows remarkable improvement in reproducing the liquid-vapor coexistence curve. TIP4P-QDP-LJ predicts critical constants of Tc=623 K, ρc=0.351 g∕cm3, and Pc=250.9 atm, which are in good agreement with experimental values of Tc=647.1 K, ρc=0.322 g∕cm3, and Pc=218 atm, respectively. Applying a scaling factor correction (obtained by fitting the experimental vapor-liquid equilibrium data to the law of rectilinear diameters using a three-term Wegner expansion) the model predicts critical constants (Tc=631 K and ρc=0.308 g∕cm3). Dependence of enthalpy of vaporization, self-diffusion constant, surface tension, and dielectric constant on temperature are shown to reproduce experimental trends. We also explore the interfacial potential drop across the liquid-vapor interface for the temperatures studied. The interfacial potential demonstrates little temperature dependence at lower temperatures (300–450 K) and significantly enhanced (exponential) dependence at elevated temperatures. Terms arising from the decomposition of the interfacial potential into dipole and quadrupole contributions are shown to monotonically approach zero as the temperature approaches the critical temperature. Results of this study suggest that self-consistently treating the coupling of phase-dependent polarizability with dispersion interactions in classical water force fields may be an important effect for the extension of polarizable water force fields to reproduce properties along the liquid-vapor coexistence envelope as well as near critical conditions. More importantly, the present study demonstrates the rather remarkable transferability of a water model parametrized to a single state point to other thermodynamic states. Further studies are recommended. PMID:19725623

Properties of water along the liquid-vapor coexistence curve via molecular dynamics simulations using the polarizable TIP4P-QDP-LJ water model.

PubMed

Bauer, Brad A; Patel, Sandeep

2009-08-28

We present an extension of the TIP4P-QDP model, TIP4P-QDP-LJ, that is designed to couple changes in repulsive and dispersive nonbond interactions to changes in polarizability. Polarizability is intimately related to the dispersion component of classical force field models of interactions, and we explore the effect of incorporating this connection explicitly on properties along the liquid-vapor coexistence curve of pure water. Parametrized to reproduce condensed-phase liquid water properties at 298 K, the TIP4P-QDP-LJ model predicts density, enthalpy of vaporization, self-diffusion constant, and the dielectric constant at ambient conditions to about the same accuracy as TIP4P-QDP but shows remarkable improvement in reproducing the liquid-vapor coexistence curve. TIP4P-QDP-LJ predicts critical constants of T(c)=623 K, rho(c)=0.351 g/cm(3), and P(c)=250.9 atm, which are in good agreement with experimental values of T(c)=647.1 K, rho(c)=0.322 g/cm(3), and P(c)=218 atm, respectively. Applying a scaling factor correction (obtained by fitting the experimental vapor-liquid equilibrium data to the law of rectilinear diameters using a three-term Wegner expansion) the model predicts critical constants (T(c)=631 K and rho(c)=0.308 g/cm(3)). Dependence of enthalpy of vaporization, self-diffusion constant, surface tension, and dielectric constant on temperature are shown to reproduce experimental trends. We also explore the interfacial potential drop across the liquid-vapor interface for the temperatures studied. The interfacial potential demonstrates little temperature dependence at lower temperatures (300-450 K) and significantly enhanced (exponential) dependence at elevated temperatures. Terms arising from the decomposition of the interfacial potential into dipole and quadrupole contributions are shown to monotonically approach zero as the temperature approaches the critical temperature. Results of this study suggest that self-consistently treating the coupling of phase-dependent polarizability with dispersion interactions in classical water force fields may be an important effect for the extension of polarizable water force fields to reproduce properties along the liquid-vapor coexistence envelope as well as near critical conditions. More importantly, the present study demonstrates the rather remarkable transferability of a water model parametrized to a single state point to other thermodynamic states. Further studies are recommended.

Fate of sulfur mustard on soil: Evaporation, degradation, and vapor emission.

PubMed

Jung, Hyunsook; Kah, Dongha; Chan Lim, Kyoung; Lee, Jin Young

2017-01-01

After application of sulfur mustard to the soil surface, its possible fate via evaporation, degradation following absorption, and vapor emission after decontamination was studied. We used a laboratory-sized wind tunnel, thermal desorber, gas chromatograph-mass spectrometry (GC-MS), and 13 C nuclear magnetic resonance ( 13 C NMR) for systematic analysis. When a drop of neat HD was deposited on the soil surface, it evaporated slowly while being absorbed immediately into the matrix. The initial evaporation or drying rates of the HD drop were found to be power-dependent on temperature and initial drop volume. Moreover, drops of neat HD, ranging in size from 1 to 6 μL, applied to soil, evaporated at different rates, with the smaller drops evaporating relatively quicker. HD absorbed into soil remained for a month, degrading eventually to nontoxic thiodiglycol via hydrolysis through the formation of sulfonium ions. Finally, a vapor emission test was performed for HD contaminant after a decontamination process, the results of which suggest potential risk from the release of trace chemical quantities of HD into the environment. Copyright © 2016 Elsevier Ltd. All rights reserved.

Biochemical analysis and the preliminary crystallographic characterization of D-tagatose 3-epimerase from Rhodobacter sphaeroides.

PubMed

Qi, Zhengliang; Zhu, Zhangliang; Wang, Jian-Wen; Li, Songtao; Guo, Qianqian; Xu, Panpan; Lu, Fuping; Qin, Hui-Min

2017-11-09

D-Tagatose 3-epimerase epimerizes D-fructose to yield D-psicose, which is a rare sugar that exists in small quantities in nature and is difficult to synthesize chemically. We aim to explore potential industrial biocatalysts for commercial-scale manufacture of this rare sugar. A D-tagatose 3-epimerase from Rhodobacter sphaeroides (RsDTE) has recently been identified as a D-tagatose 3-epimerase that can epimerize D-fructose to yield D-psicose with a high conversion rate. The purified RsDTE by Ni-affinity chromatography, ionic exchange chromatography and gel filtration forms a tetramer in solution. The maximal activity was in Tris-HCl buffer pH 8.5, and the optimal temperature was at 35 °C. The product, D-psicose, was confirmed using HPLC and NMR. Crystals of RsDTE were obtained using crystal kits and further refined under crystallization conditions such as 10% PEG 8000,0.1 M HEPES pH 7.5, and 8% ethylene glycol at 20 °C using the sitting-drop vapor diffusion method. The RsDTE homology model showed that it possessed the characteristic TIM-barrel fold. Four residues, Glu156, Asp189, Gln215 and Glu250, forms a hydrogen bond network with the active Mn(II) for the hydride transfer reaction. These residues may constitute the catalytic tetrad of RsDTE. The residues around O1, O2 and O3 of the substrates were conserved. However, the binding-site residues are different at O4, O5 and O6. Arg118 formed the unique hydrogen bond with O4 of D-fructose which indicates RsDTE's preference of D-fructose more than any other family enzymes. RsDTE possesses a different metal-binding site. Arg118, forming unique hydrogen bond with O4 of D-fructose, regulates the substrate recognition. The research on D-tagatose 3-epimerase or D-psicose 3-epimerase enzymes attracts enormous commercial interest and would be widely used for rare sugar production in the future.

Crystallization and preliminary X-ray analysis of an exotype alginate lyase Atu3025 from Agrobacterium tumefaciens strain C58, a member of polysaccharide lyase family 15

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ochiai, Akihito; Yamasaki, Masayuki; Mikami, Bunzo

2006-05-01

The crystallization and preliminary X-ray characterization of a family PL-15 exotype alginate lyase are presented. Almost all alginate lyases depolymerize alginate in an endolytical fashion via a β-elimination reaction. The alginate lyase Atu3025 from Agrobacterium tumefaciens strain C58, consisting of 776 amino-acid residues, is a novel exotype alginate lyase classified into polysaccharide lyase family 15. The enzyme was crystallized at 293 K by sitting-drop vapour diffusion with polyethylene glycol 4000 as a precipitant. Preliminary X-ray analysis showed that the Atu3025 crystal belonged to space group P2{sub 1} and diffracted to 2.8 Å resolution, with unit-cell parameters a = 107.7, bmore » = 108.3, c = 149.5 Å, β = 91.5°.« less

Deer mouse hemoglobin exhibits a lowered oxygen affinity owing to mobility of the E helix.

PubMed

Inoguchi, Noriko; Oshlo, Jake R; Natarajan, Chandrasekhar; Weber, Roy E; Fago, Angela; Storz, Jay F; Moriyama, Hideaki

2013-04-01

The deer mouse, Peromyscus maniculatus, exhibits altitude-associated variation in hemoglobin oxygen affinity. To examine the structural basis of this functional variation, the structure of the hemoglobin was solved. Recombinant hemoglobin was expressed in Escherichia coli and was purified by ion-exchange chromatography. Recombinant hemoglobin was crystallized by the hanging-drop vapor-diffusion method using polyethylene glycol as a precipitant. The obtained orthorhombic crystal contained two subunits in the asymmetric unit. The refined structure was interpreted as the aquo-met form. Structural comparisons were performed among hemoglobins from deer mouse, house mouse and human. In contrast to human hemoglobin, deer mouse hemoglobin lacks the hydrogen bond between α1Trp14 in the A helix and α1Thr67 in the E helix owing to the Thr67Ala substitution. In addition, deer mouse hemoglobin has a unique hydrogen bond at the α1β1 interface between residues α1Cys34 and β1Ser128.

Deer mouse hemoglobin exhibits a lowered oxygen affinity owing to mobility of the E helix

PubMed Central

Inoguchi, Noriko; Oshlo, Jake R.; Natarajan, Chandrasekhar; Weber, Roy E.; Fago, Angela; Storz, Jay F.; Moriyama, Hideaki

2013-01-01

The deer mouse, Peromyscus maniculatus, exhibits altitude-associated variation in hemoglobin oxygen affinity. To examine the structural basis of this functional variation, the structure of the hemoglobin was solved. Recombinant hemoglobin was expressed in Escherichia coli and was purified by ion-exchange chromatography. Recombinant hemoglobin was crystallized by the hanging-drop vapor-diffusion method using polyethylene glycol as a precipitant. The obtained orthorhombic crystal contained two subunits in the asymmetric unit. The refined structure was interpreted as the aquo-met form. Structural comparisons were performed among hemoglobins from deer mouse, house mouse and human. In contrast to human hemoglobin, deer mouse hemoglobin lacks the hydrogen bond between α1Trp14 in the A helix and α1Thr67 in the E helix owing to the Thr67Ala substitution. In addition, deer mouse hemoglobin has a unique hydrogen bond at the α1β1 interface between residues α1Cys34 and β1Ser128. PMID:23545644

Modeling and Uncertainty Quantification of Vapor Sorption and Diffusion in Heterogeneous Polymers

DOE PAGES

Sun, Yunwei; Harley, Stephen J.; Glascoe, Elizabeth A.

2015-08-13

A high-fidelity model of kinetic and equilibrium sorption and diffusion is developed and exercised. The gas-diffusion model is coupled with a triple-sorption mechanism: Henry’s law absorption, Langmuir adsorption, and pooling or clustering of molecules at higher partial pressures. Sorption experiments are conducted and span a range of relative humidities (0-95%) and temperatures (30-60°C). Kinetic and equilibrium sorption properties and effective diffusivity are determined by minimizing the absolute difference between measured and modeled uptakes. Uncertainty quantification and sensitivity analysis methods are described and exercised herein to demonstrate the capability of this modeling approach. Water uptake in silica-filled and unfilled poly(dimethylsiloxane) networksmore » is investigated; however, the model is versatile enough to be used with a wide range of materials and vapors.« less

Inverse Leidenfrost effect: self-propelling drops on a bath

NASA Astrophysics Data System (ADS)

Gauthier, Anais; van der Meer, Devaraj; Lohse, Detlef; Physics of Fluids Team

2017-11-01

When deposited on very hot solid, volatile drops can levitate over a cushion of vapor, in the so-called Leidenfrost state. This phenomenon can also be observed on a hot bath and similarly to the solid case, drops are very mobile due to the absence of contact with the substrate that sustains them. We discuss here a situation of ``inverse Leidenfrost effect'' where room-temperature drops levitate on a liquid nitrogen pool - the vapor is generated here by the bath sustaining the relatively hot drop. We show that the drop's movement is not random: the liquid goes across the bath in straight lines, a pattern only disrupted by elastic bouncing on the edges. In addition, the drops are initially self-propelled; first at rest, they accelerate for a few seconds and reach velocities of the order of a few cm/s, before slowing down. We investigate experimentally the parameters that affect their successive acceleration and deceleration, such as the size and nature of the drops and we discuss the origin of this pattern.

Ignition process in Diesel engines

NASA Technical Reports Server (NTRS)

Wentzel, W

1936-01-01

This report analyzes the heating and vaporization process of fuel droplets in a compression-ignition engine on the basis of the theory of similitude - according to which, the period for heating and complete vaporization of the average size fuel drop is only a fraction of the actually observed ignition lag. The result is that ignition takes place in the fuel vapor air mixture rather than on the surface of the drop. The theoretical result is in accord with the experimental observations by Rothrock and Waldron. The combustion shock occurring at lower terminal compression temperature, especially in the combustion of coal-tar oil, is attributable to a simultaneous igniting of a larger fuel-vapor volume formed prior to ignition.

Flame Radiation, Structure, and Scalar Properties in Microgravity Laminar Fires

NASA Technical Reports Server (NTRS)

Feikema, Douglas; Lim, Jongmook; Sivathanu, Yudaya

2007-01-01

Results from microgravity combustion experiments conducted in the Zero Gravity Research Facility (ZGF) 5.18 second drop facility are reported. The results quantify flame radiation, structure, and scalar properties during the early phase of a microgravity fire. Emission mid-infrared spectroscopy measurements have been completed to quantitatively determine the flame temperature, water and carbon dioxide vapor concentrations, radiative emissive power, and soot concentrations in microgravity laminar methane/air, ethylene/nitrogen/air and ethylene/air jet flames. The measured peak mole fractions for water vapor and carbon dioxide are found to be in agreement with state relationship predictions for hydrocarbon/air combustion. The ethylene/air laminar flame conditions are similar to previously reported results including those from the flight project, Laminar Soot Processes (LSP). Soot concentrations and gas temperatures are in reasonable agreement with similar results available in the literature. However, soot concentrations and flame structure dramatically change in long-duration microgravity laminar diffusion flames as demonstrated in this report.

Chemical vapor deposition of W-Si-N and W-B-N

DOEpatents

Fleming, J.G.; Roherty-Osmun, E.L.; Smith, P.M.; Custer, J.S.; Jones, R.V.; Nicolet, M.; Madar, R.; Bernard, C.

1999-06-29

A method of depositing a ternary, refractory based thin film on a substrate by chemical vapor deposition employing precursor sources of tungsten comprising WF[sub 6], either silicon or boron, and nitrogen. The result is a W-Si-N or W-B-N thin film useful for diffusion barrier and micromachining applications. 10 figs.

Characteristics of Evaporator with a Lipuid-Vapor Separator

NASA Astrophysics Data System (ADS)

Ikeguchi, Masaki; Tanaka, Naoki; Yumikura, Tsuneo

Flow pattern of refrigerant in a heat exchanger tube changes depending on vapor quality, tube diameter, refrigerant flow rate and refrigerant properties. High flow rate causes mist flow where the quality is from 0.8 to 1.0. 1n this flow pattern, the liquid film detaches from the tube wall so that the heat flow is intervened. The heat transfer coefficient generally increases with the flow rate. But the pressure drop of refrigerant flow simultaneously increases and the region of the mist flow enlarges. In order to reduce the pressure drop and suppress the mist flow, we have developped a small liquid-vapor separator that removes the vapor from the evaporating refrigerant flow. This separator is equipped in the middle of the evaporator where the flow pattern is annular. The experiments to evaluate the effect of this separator were carried out and the following conclutions were obtained. (1) Average heat transfer coefficient increases by 30-60 %. (2) Pressure drop reduces by 20-30 %. (3) Cooling Capacity increases by 2-9 %.

Recent results and new hardware developments for protein crystal growth in microactivity

NASA Technical Reports Server (NTRS)

Delucas, L. J.; Long, M. M.; Moore, K. M.; Smith, C.; Carson, M.; Narayana, S. V. L.; Carter, D.; Clark, A. D., Jr.; Nanni, R. G.; Ding, J.

1993-01-01

Protein crystal growth experiments have been performed on 16 space shuttle missions since April, 1985. The initial experiments utilized vapor diffusion crystallization techniques similar to those used in laboratories for earth-based experiments. More recent experiments have utilized temperature induced crystallization as an alternative method for growing high quality protein crystals in microgravity. Results from both vapor diffusion and temperature induced crystallization experiments indicate that proteins grown in microgravity may be larger, display more uniform morphologies, and yield diffraction data to significantly higher resolutions than the best crystals of these proteins grown on earth.

Expression, purification and crystallization of a human protein SH3BGRL at atomic resolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yin, Lei; Zhu, De-Yu; Yang, Na

2005-04-01

The protein SH3BGRL, containing both SH3-binding and Homer EVH1-binding motifs, has been crystallized using the hanging-drop vapour-diffusion method. The protein SH3BGRL, containing both SH3-binding and Homer EVH1-binding motifs, has been crystallized using the hanging-drop vapour-diffusion method. The crystals diffract to 0.88 Å resolution and belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 28.8886, b = 34.9676, c = 98.0016 Å. Preliminary analysis indicates that the asymmetric unit contains one molecule and has a solvent content of about 34%.

Corner wetting during the vapor-liquid-solid growth of faceted nanowires

NASA Astrophysics Data System (ADS)

Spencer, Brian; Davis, Stephen

2016-11-01

We consider the corner wetting of liquid drops in the context of vapor-liquid-solid growth of nanowires. Specifically, we construct numerical solutions for the equilibrium shape of a liquid drop on top of a faceted nanowire by solving the Laplace-Young equation with a free boundary determined by mixed boundary conditions. A key result for nanowire growth is that for a range of contact angles there is no equilibrium drop shape that completely wets the corner of the faceted nanowire. Based on our numerical solutions we determine the scaling behavior for the singular surface behavior near corners of the nanowire in terms of the Young contact angle and drop volume.

Water vapor diffusion membranes, 2

NASA Technical Reports Server (NTRS)

Holland, F. F.; Klein, E.; Smith, J. K.; Eyer, C.

1976-01-01

Transport mechanisms were investigated for the three different types of water vapor diffusion membranes. Membranes representing porous wetting and porous nonwetting structures as well as dense diffusive membrane structures were investigated for water permeation rate as a function of: (1) temperature, (2) solids composition in solution, and (3) such hydrodynamic parameters as sweep gas flow rate, solution flow rate and cell geometry. These properties were measured using nitrogen sweep gas to collect the effluent. In addition, the chemical stability to chromic acid-stabilized urine was measured for several of each type of membrane. A technology based on the mechanism of vapor transport was developed, whereby the vapor diffusion rates and relative susceptibility of membranes to fouling and failure could be projected for long-term vapor recovery trials using natural chromic acid-stabilized urine.

Crystallization of Membrane Proteins by Vapor Diffusion

PubMed Central

Delmar, Jared A.; Bolla, Jani Reddy; Su, Chih-Chia; Yu, Edward W.

2016-01-01

X-ray crystallography remains the most robust method to determine protein structure at the atomic level. However, the bottlenecks of protein expression and purification often discourage further study. In this chapter, we address the most common problems encountered at these stages. Based on our experiences in expressing and purifying antimicrobial efflux proteins, we explain how a pure and homogenous protein sample can be successfully crystallized by the vapor diffusion method. We present our current protocols and methodologies for this technique. Case studies show step-by-step how we have overcome problems related to expression and diffraction, eventually producing high quality membrane protein crystals for structural determinations. It is our hope that a rational approach can be made of the often anecdotal process of membrane protein crystallization. PMID:25950974

Overexpression, purification, crystallization and preliminary X-ray studies of Vibrio cholerae EpsG

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jens, Jason; Raghunathan, Kannan; Vago, Frank

2010-01-12

EpsG is the major pseudopilin protein of the Vibrio cholerae type II secretion system. An expression plasmid that encodes an N-terminally truncated form of EpsG with a C-terminal noncleavable His tag was constructed. Recombinant EpsG was expressed in Escherichia coli; the truncated protein was purified and crystallized by hanging-drop vapor diffusion against a reservoir containing 6 mM zinc sulfate, 60 mM MES pH 6.5, 15% PEG MME 550. The crystals diffracted X-rays to a resolution of 2.26 {angstrom} and belonged to space group P2{sub 1}, with unit-cell parameters a = 88.61, b = 70.02, c = 131.54 {angstrom}.

Preparation for microgravity - The role of the Microgravity Material Science Laboratory

NASA Technical Reports Server (NTRS)

Johnston, J. Christopher; Rosenthal, Bruce N.; Meyer, Maryjo B.; Glasgow, Thomas K.

1988-01-01

Experiments at the NASA Lewis Research Center's Microgravity Material Science Laboratory using physical and mathematical models to delineate the effects of gravity on processes of scientific and commercial interest are discussed. Where possible, transparent model systems are used to visually track convection, settling, crystal growth, phase separation, agglomeration, vapor transport, diffusive flow, and polymer reactions. Materials studied include metals, alloys, salts, glasses, ceramics, and polymers. Specific technologies discussed include the General Purpose furnace used in the study of metals and crystal growth, the isothermal dendrite growth apparatus, the electromagnetic levitator/instrumented drop tube, the high temperature directional solidification furnace, the ceramics and polymer laboratories and the center's computing facilities.

Tritium Plume Dynamics in the Shallow Unsaturated Zone Adjacent to an Arid Waste Disposal Facility

NASA Astrophysics Data System (ADS)

Maples, S.; Andraski, B. J.; Stonestrom, D. A.; Cooper, C. A.; Michel, R. L.; Pohll, G. M.

2012-12-01

Previous studies at the U.S. Geological Survey's Amargosa Desert Research Site (ADRS) in southern Nevada have documented two plumes of tritiated water-vapor (3HHOg) adjacent to a closed, commercial low-level radioactive waste disposal facility. Wastes were disposed on-site from 1962-92. Tritium has moved long distances (> 400 m) through a shallow (1-2-m depth) dry gravelly layer—orders of magnitude further than anticipated by standard transport models. Geostatistical methods, spatial moment analyses and tritium flux calculations were applied to assess shallow plume dynamics. A grid-based plant-water sampling method was utilized to infer detailed, field-scale 3HHOg concentrations at 5-yr intervals during 2001-11. Results indicate that gravel-layer 3HHOg mass diminished faster than would be expected from radioactive decay (~70% in 10 yr). Both plumes exhibited center-of-mass stability, suggesting that bulk-plume movement is minimal during the period of study. Nonetheless, evidence of localized lateral advancement along some margins, combined with increases in the spatial covariance of concentration distribution, indicates intra-plume mass redistribution is ongoing. Previous studies have recognized that vertical movement of tritiated water from sub-root-zone gravel into the root-zone contributes to atmospheric release via evapotranspiration. Estimates of lateral and vertical tritium fluxes during the study period indicate (1) vertical tritiated water fluxes were dominated by diffusive-vapor fluxes (> 90%), and (2) vertical diffusive-vapor fluxes were roughly an order of magnitude greater than lateral diffusive-vapor fluxes. This behavior highlights the importance of the atmosphere as a tritium sink. Estimates of cumulative vertical diffusive-vapor flux and radioactive decay with time were comparable to observed declines in total shallow plume mass with time. This suggests observed changes in plume mass may (1) be attributed, in considerable part, to these removal mechanisms, and (2) appreciable input from the adjacent disposal facility is not occurring at this time.

The study of lead vapor ionization in discharge with a hot cathode and efficiency of its deposition on the substrates applied for plasma separation method

NASA Astrophysics Data System (ADS)

Antonov, N. N.; Samokhin, A. A.; Zhabin, S. N.; Gavrikov, A. V.; Smirnov, V. P.

2016-11-01

Spent nuclear fuel plasma separation method approbation implies the use of model substances. Thus it is necessary to solve the problem of material conversion into a cold plasma flow, as well as the problem of deposition on collectors. For this purpose, we carried out a kinetic and hydrodynamic simulation of the discharge with hot cathode in the lead vapor (lead vapor was injected into the interelectrode gap). Dependencies of the ionization efficiency, electrostatic potential distribution, density distribution of ions and electrons in the discharge gap on the discharge current density and the model substance vapor concentration were obtained. The simulation results show that at discharge current density of about 3.5 A/cm2 and the lead vapor concentration of 2 × 1012 cm-3, the ionization efficiency is close to 60%. Experimental research of the discharge with a hot cathode in the lead vapor was carried out. We also carried out the research of the Pb condensation coefficients on various substrates. For experimental data analysis the numerical model based on Monte Carlo method was used. The research results show that deposition coefficients at medium temperatures of substrates near 70 °C do not drop lower than 75%.

The numerical methods for the development of the mixture region in the vapor explosion simulations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Y.; Ohashi, H.; Akiyama, M.

An attempt to numerically simulate the process of the vapor explosion with a general multi-component and multi-dimension code is being challenged. Because of the rapid change of the flow field and extremely nonuniform distribution of the components in the system of the vapor explosion, the numerical divergence and diffusion are subject to occur easily. A dispersed component model and a multiregion scheme, by which these difficulties can be effectively overcome, were proposed. The simulations have been performed for the processes of the premixing and the fragmentation propagation in the vapor explosion.

Coalescence of a Drop inside another Drop

NASA Astrophysics Data System (ADS)

Mugundhan, Vivek; Jian, Zhen; Yang, Fan; Li, Erqiang; Thoroddsen, Sigurdur

2016-11-01

Coalescence dynamics of a pendent drop sitting inside another drop, has been studied experimentally and in numerical simulations. Using an in-house fabricated composite micro-nozzle, a smaller salt-water drop is introduced inside a larger oil drop which is pendent in a tank containing the same liquid as the inner drop. On touching the surface of outer drop, the inner drop coalesces with the surrounding liquid forming a vortex ring, which grows in time to form a mushroom-like structure. The initial dynamics at the first bridge opening up is quantified using Particle Image Velocimetry (PIV), while matching the refractive index of the two liquids. The phenomenon is also numerically simulated using the open-source code Gerris. The problem is fully governed by two non-dimensional parameters: the Ohnesorge number and the diameter ratios of the two drops. The validated numerical model is used to better understand the dynamics of the phenomenon. In some cases a coalescence cascade is observed with liquid draining intermittently and the inner drop reducing in size.

Cloning, overexpression, crystallization and preliminary X-ray crystallographic analysis of a slow-processing mutant of penicillin G acylase from Kluyvera citrophila.

PubMed

Varshney, Nishant Kumar; Ramasamy, Sureshkumar; Brannigan, James A; Wilkinson, Anthony J; Suresh, C G

2013-08-01

Kluyvera citrophila penicillin G acylase (KcPGA) has recently attracted increased attention relative to the well studied and commonly used Escherichia coli PGA (EcPGA) because KcPGA is more resilient to harsh conditions and is easier to immobilize for the industrial hydrolysis of natural penicillins to generate the 6-aminopenicillin (6-APA) nucleus, which is the starting material for semi-synthetic antibiotic production. Like other penicillin acylases, KcPGA is synthesized as a single-chain inactive pro-PGA, which upon autocatalytic processing becomes an active heterodimer of α and β chains. Here, the cloning of the pac gene encoding KcPGA and the preparation of a slow-processing mutant precursor are reported. The purification, crystallization and preliminary X-ray analysis of crystals of this precursor protein are described. The protein crystallized in two different space groups, P1, with unit-cell parameters a = 54.0, b = 124.6, c = 135.1 Å, α = 104.1, β = 101.4, γ = 96.5°, and C2, with unit-cell parameters a = 265.1, b = 54.0, c = 249.2 Å, β = 104.4°, using the sitting-drop vapour-diffusion method. Diffraction data were collected at 100 K and the phases were determined using the molecular-replacement method. The initial maps revealed electron density for the spacer peptide.

Numerical study of effect of the gas-coolant free surface on the droplet fragmentation behavior of coolants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, H.X.; Anh, B.V.; Dinh, T.N.

1999-07-01

This paper presents results of a numerical investigation on the behavior of melt drops falling in a gas (vapor) space and then penetrating into a liquid volume through the gas-liquid interface. The phenomenon studied here is, usually, observed when a liquid drop falls through air into a water pool and is, specially, of interest when a hypothetical severe reactor core meltdown accident is considered. The objective of this work is to study the effect of the gas-liquid interface on the dynamic evolution of the interaction area between the fragmenting melt drop and water. In the present study, the Navier-Stokes equationsmore » are solved for three phases (gas, liquid and melt-drop) using a higher-order, explicit, numerical method, called Cubic-Interpolated Pseudo-Particle (CIP) method, which is employed in combination with an advanced front-capturing scheme, named the Level Set Algorithm (LSA). By using this method, reasonable physical pictures of droplet deformation and fragmentation during movement in a stationary uniform water pool, and in a gas-liquid two-layer volume, is simulated. Effect of the gas-liquid interface on the drop deformation and fragmentation is analyzed by comparing the simulation results obtained for the two cases. Effects of the drop geometry, and of the flow conditions, on the behavior of the melt drop are also analyzed.« less

Sorption and modeling of mass transfer of toxic chemical vapors in activated-carbon fiber-cloth adsorbers

USGS Publications Warehouse

Lordgooei, M.; Sagen, J.; Rood, M.J.; Rostam-Abadi, M.

1998-01-01

A new activated-carbon fiber-cloth (ACFC) adsorber coupled with an electrothermal regenerator and a cryogenic condenser was designed and developed to efficiently capture and recover toxic chemical vapors (TCVs) from simulated industrial gas streams. The system was characterized for adsorption by ACFC, electrothermal desorption, and cryogenic condensation to separate acetone and methyl ethyl ketone from gas streams. Adsorption dynamics are numerically modeled to predict system characteristics during scale-up and optimization of the process in the future. The model requires diffusivities of TCVs into an activated-carbon fiber (ACF) as an input. Effective diffusivities of TCVs into ACFs were modeled as a function of temperature, concentration, and pore size distribution. Effective diffusivities for acetone at 65 ??C and 30-60 ppmv were measured using a chromatography method. The energy factor for surface diffusion was determined from comparison between the experimental and modeled effective diffusivities. The modeled effective diffusivities were used in a dispersive computational model to predict mass transfer zones of TCVs in fixed beds of ACFC under realistic conditions for industrial applications.

Effect of External Pressure Drop on Loop Heat Pipe Operating Temperature

NASA Technical Reports Server (NTRS)

Jentung, Ku; Ottenstein, Laura; Rogers, Paul; Cheung, Kwok; Obenschain, Arthur F. (Technical Monitor)

2002-01-01

This paper discusses the effect of the pressure drop on the operating temperature in a loop heat pipe (LHP). Because the evaporator and the compensation chamber (CC) both contain two-phase fluid, a thermodynamic constraint exists between the temperature difference and the pressure drop for these two components. As the pressure drop increases, so will the temperature difference. The temperature difference in turn causes an increase of the heat leak from the evaporator to the CC, resulting in a higher CC temperature. Furthermore, the heat leak strongly depends on the vapor void fraction inside the evaporator core. Tests were conducted by installing a valve on the vapor line so as to vary the pressure drop, and by charging the LHP with various amounts of fluid. Test results verify that the LHP operating temperature increases with an increasing differential pressure, and the temperature increase is a strong function of the fluid inventory in the loop.

Bubble formation during drop impact on a heated pool

NASA Astrophysics Data System (ADS)

Tian, Yuansi; Alhazmi, Muath; Kouraytem, Nadia; Thoroddsen, Sigurdur

2017-11-01

Ultra high-speed video imaging, at up to 200 kfps, is used to investigate a drop impinging onto a high temperature pool. The room-temperature perfluorohexane drop, which has a boiling temperature as low as 56 °C impacts on the soybean oil pool heated up to around 200 °C, which is overwhelmingly higher than the boiling temperature of the drop. The bottom of the drop is therefore covered by a layer of vapor which prevents contact between the two immiscible liquid surfaces, akin to the Leidenfrost effect However, as the pool temperature is reduced, one starts seeing contact and the dynamics transition into the vapor explosion regime. At the boundary of this regime we observe some entrapment of scattered or a toroidal ring of small bubbles. Experimental video data will be presented to show this novel phenomenon and explain how these bubbles are formed and evolve.

Method and apparatus for the production of metal oxide powder

DOEpatents

Harris, Michael T.; Scott, Timothy C.; Byers, Charles H.

1993-01-01

The present invention provides a method for preparing metal oxide powder. A first solution, which is substantially organic, is prepared. A second solution, which is an aqueous solution substantially immiscible in the first solution, is prepared and delivered as drops to the first solution. The drops of the second solution are atomized by a pulsed electric field forming micro-drops of the second solution. Reagents in the first solution diffuse into and react with reactants in the micro-drops of the second solution forming metal hydroxide or oxalate particles. The metal hydroxide or metal oxalate particles are then recovered and dried to produce the metal oxide powder. An apparatus for preparing a metal oxide powder is also disclosed.

Method and apparatus for the production of metal oxide powder

DOEpatents

Harris, Michael T.; Scott, Timothy C.; Byers, Charles H.

1992-01-01

The present invention provides a method for preparing metal oxide powder. A first solution, which is substantially organic, is prepared. A second solution, which is an aqueous solution substantially immiscible in the first solution, is prepared and delivered as drops to the first solution. The drops of the second solution are atomized by a pulsed electric field forming micro-drops of the second solution. Reagents in the first solution diffuse into and react with reactants in the micro-drops of the second solution forming metal hydroxide or oxalate particles. The metal hydroxide or metal oxalate particles are then recovered and dried to produce the metal oxide powder. An apparatus for preparing a metal oxide powder is also disclosed.

Method and apparatus for the production of metal oxide powder

DOEpatents

Harris, M.T.; Scott, T.C.; Byers, C.H.

1992-06-16

The present invention provides a method for preparing metal oxide powder. A first solution, which is substantially organic, is prepared. A second solution, which is an aqueous solution substantially immiscible in the first solution, is prepared and delivered as drops to the first solution. The drops of the second solution are atomized by a pulsed electric field forming micro-drops of the second solution. Reagents in the first solution diffuse into and react with reactants in the micro-drops of the second solution forming metal hydroxide or oxalate particles. The metal hydroxide or metal oxalate particles are then recovered and dried to produce the metal oxide powder. An apparatus for preparing a metal oxide powder is also disclosed. 2 figs.

Physics-based agent to simulant correlations for vapor phase mass transport.

PubMed

Willis, Matthew P; Varady, Mark J; Pearl, Thomas P; Fouse, Janet C; Riley, Patrick C; Mantooth, Brent A; Lalain, Teri A

2013-12-15

Chemical warfare agent simulants are often used as an agent surrogate to perform environmental testing, mitigating exposure hazards. This work specifically addresses the assessment of downwind agent vapor concentration resulting from an evaporating simulant droplet. A previously developed methodology was used to estimate the mass diffusivities of the chemical warfare agent simulants methyl salicylate, 2-chloroethyl ethyl sulfide, di-ethyl malonate, and chloroethyl phenyl sulfide. Along with the diffusivity of the chemical warfare agent bis(2-chloroethyl) sulfide, the simulant diffusivities were used in an advection-diffusion model to predict the vapor concentrations downwind from an evaporating droplet of each chemical at various wind velocities and temperatures. The results demonstrate that the simulant-to-agent concentration ratio and the corresponding vapor pressure ratio are equivalent under certain conditions. Specifically, the relationship is valid within ranges of measurement locations relative to the evaporating droplet and observation times. The valid ranges depend on the relative transport properties of the agent and simulant, and whether vapor transport is diffusion or advection dominant. Published by Elsevier B.V.

Phormidium phycoerythrin forms hexamers in crystals: a crystallographic study

PubMed Central

Sonani, Ravi Raghav; Sharma, Mahima; Gupta, Gagan Deep; Kumar, Vinay; Madamwar, Datta

2015-01-01

The crystallographic analysis of a marine cyanobacterium (Phormidium sp. A09DM) phycoerythrin (PE) that shows distinct sequence features compared with known PE structures from cyanobacteria and red algae is reported. Phormidium PE was crystallized using the sitting-drop vapour-diffusion method with ammonium sulfate as a precipitant. Diffraction data were collected on the protein crystallography beamline at the Indus-2 synchrotron. The crystals diffracted to about 2.1 Å resolution at 100 K. The crystals, with an apparent hexagonal morphology, belonged to space group P1, with unit-cell parameters a = 108.3, b = 108.4 Å, c = 116.6 Å, α = 78.94, β = 82.50, γ = 60.34°. The molecular-replacement solution confirmed the presence of 12 αβ monomers in the P1 cell. The Phormidium PE elutes as an (αβ)3 trimer of αβ monomers from a molecular-sieve column and exists as [(αβ)3]2 hexamers in the crystal lattice. Unlike red algal PE proteins, the hexamers of Phormidium PE do not form higher-order structures in the crystals. The existence of only one characteristic visual absorption band at 564 nm suggests the presence of phycoerythrobilin chromophores, and the absence of any other types of bilins, in the Phormidium PE assembly. PMID:26249689

Crystallization and X-ray diffraction analysis of the CH domain of the cotton kinesin GhKCH2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qin, Xinghua; The Fourth Military Medical University, No. 169 Changlexi Road, Xincheng District, Xi’an 710032, People’s Republic of; Chen, Ziwei

The cloning, expression, purification and crystallization of the CH domain of the plant-specific kinesin GhKCH2 is reported. GhKCH2 belongs to a group of plant-specific kinesins (KCHs) containing an actin-binding calponin homology (CH) domain in the N-terminus. Previous studies revealed that the GhKCH2 CH domain (GhKCH2-CH) had a higher affinity for F-actin (K{sub d} = 0.42 ± 0.02 µM) than most other CH-domain-containing proteins. To understand the underlying mechanism, prokaryotically expressed GhKCH2-CH (amino acids 30–166) was purified and crystallized. Crystals were grown by the sitting-drop vapour-diffusion method using 0.1 M Tris–HCl pH 7.0, 20%(w/v) PEG 8000 as a precipitant. The crystalsmore » diffracted to a resolution of 2.5 Å and belonged to space group P2{sub 1}, with unit-cell parameters a = 41.57, b = 81.92, c = 83.00 Å, α = 90.00, β = 97.31, γ = 90.00°. Four molecules were found in the asymmetric unit with a Matthews coefficient of 2.22 Å{sup 3} Da{sup −1}, corresponding to a solvent content of 44.8%.« less

Overexpression, purification, crystallization and preliminary X-ray studies of Vibrio cholerae EpsG

PubMed Central

Jens, Jason; Raghunathan, Kannan; Vago, Frank; Arvidson, Dennis

2009-01-01

EpsG is the major pseudopilin protein of the Vibrio cholerae type II secretion system. An expression plasmid that encodes an N-terminally truncated form of EpsG with a C-terminal noncleavable His tag was constructed. Recombinant EpsG was expressed in Escherichia coli; the truncated protein was purified and crystallized by hanging-drop vapor diffusion against a reservoir containing 6 mM zinc sulfate, 60 mM MES pH 6.5, 15% PEG MME 550. The crystals diffracted X-rays to a resolution of 2.26 Å and belonged to space group P21, with unit-cell parameters a = 88.61, b = 70.02, c = 131.54 Å. PMID:19478449

Comparison of precursor infiltration into polymer thin films via atomic layer deposition and sequential vapor infiltration using in-situ quartz crystal microgravimetry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Padbury, Richard P.; Jur, Jesse S., E-mail: jsjur@ncsu.edu

Previous research exploring inorganic materials nucleation behavior on polymers via atomic layer deposition indicates the formation of hybrid organic–inorganic materials that form within the subsurface of the polymer. This has inspired adaptations to the process, such as sequential vapor infiltration, which enhances the diffusion of organometallic precursors into the subsurface of the polymer to promote the formation of a hybrid organic–inorganic coating. This work highlights the fundamental difference in mass uptake behavior between atomic layer deposition and sequential vapor infiltration using in-situ methods. In particular, in-situ quartz crystal microgravimetry is used to compare the mass uptake behavior of trimethyl aluminummore » in poly(butylene terephthalate) and polyamide-6 polymer thin films. The importance of trimethyl aluminum diffusion into the polymer subsurface and the subsequent chemical reactions with polymer functional groups are discussed.« less

Insights into gold-catalyzed plasma-assisted CVD growth of silicon nanowires

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Wanghua, E-mail: wanghua.chen@polytechnique.edu; Roca i Cabarrocas, Pere

2016-07-25

Understanding and controlling effectively the behavior of metal catalyst droplets during the Vapor-Liquid-Solid growth of nanowires are crucial for their applications. In this work, silicon nanowires are produced by plasma-assisted Chemical Vapor Deposition using gold as a catalyst. The influence of hydrogen plasma on nanowire growth is investigated experimentally and theoretically. Interestingly, in contrast to conventional chemical vapor deposition, the growth rate of silicon nanowires shows a decrease as a function of their diameters, which is consistent with the incorporation of silicon via sidewall diffusion. We show that Ostwald ripening of catalyst droplets during nanowire growth is inhibited in themore » presence of a hydrogen plasma. However, when the plasma is off, the diffusion of Au atoms on the nanowire sidewall can take place. Based on this observation, we have developed a convenient method to grow silicon nanotrees.« less

The structure of evaporating and combusting sprays: Measurements and predictions

NASA Technical Reports Server (NTRS)

Shuen, J. S.; Solomon, A. S. P.; Faeth, G. M.

1984-01-01

An apparatus developed, to allow observations of monodisperse sprays, consists of a methane-fueled turbulent jet diffusion flame with monodisperse methanol drops injected at the burner exit. Mean and fluctuating-phase velocities, drop sizes, drop-mass fluxes and mean-gas temperatures were measured. Initial drop diameters of 100 and 180 microns are being considered in order to vary drop penetration in the flow and effects of turbulent dispersion. Baseline tests of the burner flame with no drops present were also conducted. Calibration tests, needed to establish methods for predicting drop transport, involve drops supported in the post-flame region of a flat-flame burner operated at various mixture ratios. Spray models which are being evaluated include: (1) locally homogeneous flow (LFH) analysis, (2) deterministic separated flow (DSF) analysis and (3) stochastic separated flow (SSF) analysis.

Macroscopic modeling for heat and water vapor transfer in dry snow by homogenization.

PubMed

Calonne, Neige; Geindreau, Christian; Flin, Frédéric

2014-11-26

Dry snow metamorphism, involved in several topics related to cryospheric sciences, is mainly linked to heat and water vapor transfers through snow including sublimation and deposition at the ice-pore interface. In this paper, the macroscopic equivalent modeling of heat and water vapor transfers through a snow layer was derived from the physics at the pore scale using the homogenization of multiple scale expansions. The microscopic phenomena under consideration are heat conduction, vapor diffusion, sublimation, and deposition. The obtained macroscopic equivalent model is described by two coupled transient diffusion equations including a source term arising from phase change at the pore scale. By dimensional analysis, it was shown that the influence of such source terms on the overall transfers can generally not be neglected, except typically under small temperature gradients. The precision and the robustness of the proposed macroscopic modeling were illustrated through 2D numerical simulations. Finally, the effective vapor diffusion tensor arising in the macroscopic modeling was computed on 3D images of snow. The self-consistent formula offers a good estimate of the effective diffusion coefficient with respect to the snow density, within an average relative error of 10%. Our results confirm recent work that the effective vapor diffusion is not enhanced in snow.

Crystallization and initial X-ray analysis of polyhydroxyalkanoate granule-associated protein from Aeromonas hydrophila

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Minglian; Li, Zhenguo; Zheng, Wei

The phasin PhaP{sub Ah} from A. hydrophila strain 4AK4 was crystallized using the hanging-drop vapour-diffusion method. Polyhydroxyalkanoate (PHA) granule-associated proteins (phasins) were discovered in PHA-accumulating bacteria. They play a crucial role as a structural protein during initial PHA-granule formation and granule growth and also serve as interfaces for granule stabilization in vivo. The phasin PhaP{sub Ah} from Aeromonas hydrophila strain 4AK4 was crystallized using the hanging-drop vapour-diffusion method. Single crystals were cryocooled for X-ray diffraction analysis. The phasin crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 80.8, b = 108.9, c = 134.4 Å.

Low temperature Zn diffusion for GaSb solar cell structures fabrication

NASA Technical Reports Server (NTRS)

Sulima, Oleg V.; Faleev, Nikolai N.; Kazantsev, Andrej B.; Mintairov, Alexander M.; Namazov, Ali

1995-01-01

Low temperature Zn diffusion in GaSb, where the minimum temperature was 450 C, was studied. The pseudo-closed box (PCB) method was used for Zn diffusion into GaAs, AlGaAs, InP, InGaAs and InGaAsP. The PCB method avoids the inconvenience of sealed ampoules and proved to be simple and reproducible. The special design of the boat for Zn diffusion ensured the uniformality of Zn vapor pressure across the wafer surface, and thus the uniformity of the p-GaSb layer depth. The p-GaSb layers were studied using Raman scattering spectroscopy and the x-ray rocking curve method. As for the postdiffusion processing, an anodic oxidation was used for a precise thinning of the diffused GaSb layers. The results show the applicability of the PCB method for the large-scale production of the GaSb structures for solar cells.

The rate of collisions due to Brownian or gravitational motion of small drops

NASA Technical Reports Server (NTRS)

Zhang, Xiaoguang; Davis, Robert H.

1991-01-01

Quantitative predictions of the collision rate of two spherical drops undergoing Brownian diffusion or gravitational sedimentation are presented. The diffusion equation for relative Brownian motion of two drops is derived, and the relative motion of pairs of drops in gravitational sedimentation is traced via a trajectory analysis in order to develop theoretical models to determine the collision efficiencies, both with and without interparticle forces applied between the drops. It is concluded that finite collision rates between nondeforming fluid drops are possible for Brownian diffusion or gravitational sedimentation in the absence of attractive forces, in stark contrast to the prediction that lubrication forces prevent rigid spheres from contacting each other unless an attractive force that becomes infinite as the separation approaches zero is applied. Collision rates are shown to increase as the viscosity of the drop-phase decreases. In general, hydrodynamic interactions reduce the collision rates more for gravitational collisions than for Brownian collisions.

24 CFR 3280.704 - Fuel supply systems.

Code of Federal Regulations, 2012 CFR

2012-04-01

... be ventilated at top and bottom to facilitate diffusion of vapors. The compartment shall be... to permit diffusion of vapors and shall be insulated from the structural members of the body. Tanks...

24 CFR 3280.704 - Fuel supply systems.

Code of Federal Regulations, 2014 CFR

2014-04-01

... be ventilated at top and bottom to facilitate diffusion of vapors. The compartment shall be... to permit diffusion of vapors and shall be insulated from the structural members of the body. Tanks...

24 CFR 3280.704 - Fuel supply systems.

Code of Federal Regulations, 2013 CFR

2013-04-01

... be ventilated at top and bottom to facilitate diffusion of vapors. The compartment shall be... to permit diffusion of vapors and shall be insulated from the structural members of the body. Tanks...

Formation of microbeads during vapor explosions of Field's metal in water

NASA Astrophysics Data System (ADS)

Kouraytem, N.; Li, E. Q.; Thoroddsen, S. T.

2016-06-01

We use high-speed video imaging to investigate vapor explosions during the impact of a molten Field's metal drop onto a pool of water. These explosions occur for temperatures above the Leidenfrost temperature and are observed to occur in up to three stages as the metal temperature is increased, with each explosion being more powerful that the preceding one. The Field's metal drop breaks up into numerous microbeads with an exponential size distribution, in contrast to tin droplets where the vapor explosion deforms the metal to form porous solid structures. We compare the characteristic bead size to the wavelength of the fastest growing mode of the Rayleigh-Taylor instability.

Vapor-phase interactions and diffusion of organic solvents in the unsaturated zone

USGS Publications Warehouse

Roy, W.R.; Griffin, R.A.

1990-01-01

This article presents an analysis of the interactions and static movement of 37 organic solvents as vapors through the unsaturated soil zone. The physicochemical interactions of the organic vapors with unsaturated soil materials were emphasized with focus on diffusive, and adsorptive interactions. Fick's Law and porous media diffusion coefficients for most of the solvent vapors were either compiled or estimated; coefficients were not available for some of the fluorinated solvents. The adsorption of some of the solvent vapors by silica was concluded to be due to hydrogen bond formation with surface silanol groups. Heats of adsorption data for different adsorbents were also compiled. There were very few data on the adsorption of these solvent vapors by soils, but it appears that the magnitude of adsorption of nonpolar solvents is reduced as the relative humidity of the vapor-solid system is increased. Consequently, the interaction of the vapors may then separated into two processes; (1) gas-water partitioning described by Henry's Law constants, and (2) solid-water adsorption coefficients which may be estimated from liquid-solid partition coefficients (Kd values). ?? 1990 Springer-Verlag New York Inc.

Analytical Model for Diffusive Evaporation of Sessile Droplets Coupled with Interfacial Cooling Effect.

PubMed

Nguyen, Tuan A H; Biggs, Simon R; Nguyen, Anh V

2018-05-30

Current analytical models for sessile droplet evaporation do not consider the nonuniform temperature field within the droplet and can overpredict the evaporation by 20%. This deviation can be attributed to a significant temperature drop due to the release of the latent heat of evaporation along the air-liquid interface. We report, for the first time, an analytical solution of the sessile droplet evaporation coupled with this interfacial cooling effect. The two-way coupling model of the quasi-steady thermal diffusion within the droplet and the quasi-steady diffusion-controlled droplet evaporation is conveniently solved in the toroidal coordinate system by applying the method of separation of variables. Our new analytical model for the coupled vapor concentration and temperature fields is in the closed form and is applicable for a full range of spherical-cap shape droplets of different contact angles and types of fluids. Our analytical results are uniquely quantified by a dimensionless evaporative cooling number E o whose magnitude is determined only by the thermophysical properties of the liquid and the atmosphere. Accordingly, the larger the magnitude of E o , the more significant the effect of the evaporative cooling, which results in stronger suppression on the evaporation rate. The classical isothermal model is recovered if the temperature gradient along the air-liquid interface is negligible ( E o = 0). For substrates with very high thermal conductivities (isothermal substrates), our analytical model predicts a reversal of temperature gradient along the droplet-free surface at a contact angle of 119°. Our findings pose interesting challenges but also guidance for experimental investigations.

Preparation, crystallization and preliminary crystallographic analysis of old yellow enzyme from Trypanosoma cruzi

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sugiyama, Shigeru; Tokuoka, Keiji; Uchiyama, Nahoko

2007-10-01

Old yellow enzyme from Trypanosoma cruzi, has been crystallized using the hanging-drop vapour-diffusion method. Old yellow enzyme (OYE) is an NADPH oxidoreductase that contains a flavin mononucleotide as a prosthetic group. The OYE from Trypanosoma cruzi, which produces prostaglandin F{sub 2α}, a potent mediator of various physiological and pathological processes, from prostaglandin H2. The protein was recombinantly expressed and purified from Escherichia coli and was crystallized using the hanging-drop vapour-diffusion method. The crystal belongs to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 56.3, b = 78.8, c = 78.8 Å, β = 93.4° and two moleculesmore » per asymmetric unit. The crystals were suitable for X-ray crystallographic studies and diffracted to 1.70 Å resolution. A Patterson search method is in progress using the structure of OYE from Pseudomonas putida as a starting model.« less

Structure of High-Speed Sprays.

DTIC Science & Technology

1985-02-01

red (Appendix B and Ref. 9) and computed (Appendix C and Ref. 10) the drop veloci lies in the farfield of non vaporizing Diesel-type sprays; measured...and Ref. 9) and computed (Appendix C and Ref. 10) the drop velocities in the farfield of non vaporizing Diesel-type sprays; measured (11) (and are...r) e and 41 - ,(r) e Solutions free from singularities on the axis r- O are found to be f, = C , Io(kr) and #I = C , rI,(.r), where C , and Ca are

Condensation of nano-refrigerant inside a horizontal tube

NASA Astrophysics Data System (ADS)

Darzi, Milad; Sadoughi, M. K.; Sheikholeslami, M.

2018-05-01

In this paper, condensing pressure drop of refrigerant-based nanofluid inside a tube is studied. Isobutene was selected as the base fluid while CuO nanoparticles were utilized to prepare nano-refrigerant. However, for the feasibility of nanoparticle dispersion into the refrigerant, Polyester oil (POE) was utilized as lubricant oil and added to the pure refrigerant by 1% mass fraction. Various values of mass flux, vapor quality, concentration of nanoparticle are investigated. Results indicate that adding nanoparticles leads to enhance frictional pressure drop. Nanoparticles caused larger pressure drop penalty at relatively lower vapor qualities which may be attributed to the existing condensation flow pattern such that annular flow is less influenced by nanoparticles compared to intermittent flow regime.

An intercomparison of methods for solving the stochastic collection equation with a focus on cloud radar Doppler spectra in drizzling stratocumulus

NASA Astrophysics Data System (ADS)

Lee, H.; Fridlind, A. M.; Ackerman, A. S.; Kollias, P.

2017-12-01

Cloud radar Doppler spectra provide rich information for evaluating the fidelity of particle size distributions from cloud models. The intrinsic simplifications of bulk microphysics schemes generally preclude the generation of plausible Doppler spectra, unlike bin microphysics schemes, which develop particle size distributions more organically at substantial computational expense. However, bin microphysics schemes face the difficulty of numerical diffusion leading to overly rapid large drop formation, particularly while solving the stochastic collection equation (SCE). Because such numerical diffusion can cause an even greater overestimation of radar reflectivity, an accurate method for solving the SCE is essential for bin microphysics schemes to accurately simulate Doppler spectra. While several methods have been proposed to solve the SCE, here we examine those of Berry and Reinhardt (1974, BR74), Jacobson et al. (1994, J94), and Bott (2000, B00). Using a simple box model to simulate drop size distribution evolution during precipitation formation with a realistic kernel, it is shown that each method yields a converged solution as the resolution of the drop size grid increases. However, the BR74 and B00 methods yield nearly identical size distributions in time, whereas the J94 method produces consistently larger drops throughout the simulation. In contrast to an earlier study, the performance of the B00 method is found to be satisfactory; it converges at relatively low resolution and long time steps, and its computational efficiency is the best among the three methods considered here. Finally, a series of idealized stratocumulus large-eddy simulations are performed using the J94 and B00 methods. The reflectivity size distributions and Doppler spectra obtained from the different SCE solution methods are presented and compared with observations.

Preliminary Crystallographic Study of Hemoglobin from Buffalo (Bubalus bubalis): A Low Oxygen Affinity Species.

PubMed

Balasubramanian, Moovarkumudalvan; Moorthy, Ponnuraj Sathya; Neelagandan, Kamariah; Ponnuswamy, Mondikalipudur Nanjappa Gounder

2009-01-01

Hemoglobin is a tetrameric, iron-containing metalloprotein, which plays a vital role in the transportation of oxygen from lungs to tissues and carbon dioxide back to lungs. Though good amount of work has already been done on hemoglobins, the scarcity of data on three dimensional structures pertaining to low oxygen affinity hemoglobins from mammalian species, motivated our group to work on this problem specifically. Herein, we report the preliminary crystallographic analysis of buffalo hemoglobin, which belongs to low oxygen affinity species. The buffalo blood was collected, purified by anion exchange chromatography and crystallized with PEG 3350 using 50mM phosphate buffer at pH 6.7 as a precipitant by hanging drop vapor diffusion method. Data collection was carried out using mar345dtb image plate detector system. Buffalo hemoglobin crystallizes in orthorhombic space group P2(1)2(1)2(1) with one whole biological molecule (alpha2beta2) in the asymmetric unit with cell dimensions a=63.064A, b=74.677A, c=110.224A.

Short-term effects of sports taping on navicular height, navicular drop and peak plantar pressure in healthy elite athletes: A within-subject comparison.

PubMed

Kim, Taegyu; Park, Jong-Chul

2017-11-01

Medial tibial stress syndrome (MTSS) is one of the most common exercise-induced leg pain. The navicular drop (ND) was identified as a risk factor for MTSS. This study aimed to evaluate the short-term effects of sports taping applied to the supporting lower leg during sitting, standing, walking, and jogging to restrict the ND in healthy elite athletes.Twenty-four healthy elite athletes without a history of exercise-induced pain or injuries in the lower limbs participated in this study (median age: 21.00 years; 1st--3rd quartiles; 19.25-22.00). The 4 taping conditions were used: rigid taping (RT), kinesiology taping (KT), placebo taping (PT), and non-taping (NT). The order of taping techniques was randomly assigned. Normalized navicular height (NH), ND, and normalized ND evaluated using 3-dimensional motion analysis, and normalized peak plantar pressure (PP) were compared in 4 taping conditions during sitting, standing, walking, and jogging.During sitting, the normalized NH of RT is higher than that of NT, KT, and PT (χ = 17.30, P = .001), while during jogging, the normalized NH of RT is higher than that of NT and PT (χ = 10.55, P = .014). The normalized peak PP of NT is higher than that of PT (χ = 8.871, P = .031) in the lateral midfoot region.This study showed the RT technique maintained NH during sitting and jogging, and the RT technique could be an effective preventive and treatment strategy for MTSS.

Lattice Boltzmann Simulation of Kinetic Isotope Effect During Snow Crystal Formation

NASA Astrophysics Data System (ADS)

Lu, G.; Depaolo, D. J.; Kang, Q.; Zhang, D.

2007-12-01

The isotopic composition of precipitation, especially that of snow, plays a special role in the global hydrological cycle and in reconstruction of past climates using polar ice cores. The fractionation of the major water isotope species (HHO, HDO, HHO-18) during ice crystal formation is critical to understanding the global distribution of isotopes in precipitation. Ice crystal growth in clouds is traditionally treated with a spherically-symmetric steady state diffusion model, with semi-empirical modifications added to account for ventilation and for complex crystal morphology. Although it is known that crystal growth rate, which depends largely on the degree of vapor over- saturation, determines crystal morphology, there are no quantitative models that relate morphology to the vapor saturation factor. Since kinetic (vapor phase diffusion-controlled) isotopic fractionation also depends on growth rate, there should be direct relationships between vapor saturation, crystal morphology, and crystal isotopic composition. We use a 2D lattice Boltzmann model to simulate diffusion-controlled ice crystal growth from vapor- oversaturated air. In the model, crystals grow solely according to the diffusive fluxes just above the crystal surfaces, and hence crystal morphology arises from the initial and boundary conditions in the model and does not need to be specified a priori. Crystal growth patterns can be varied between random growth and deterministic growth (along the maximum concentration gradient for example). The input parameters needed are the isotope- dependent vapor deposition rate constant (k) and the water vapor diffusivity in air (D). The values of both k and D can be computed from kinetic theory, and there are also experimentally determined values of D. The deduced values of k are uncertain to the extent that the condensation coefficient for ice is uncertain. The ratio D/k is a length (order 1 micron) that determines the minimum scale of dendritic growth features and allows us to scale the numerical calculations to atmospheric conditions. Our calculations confirm that the crystal/vapor isotopic fractionation approaches the equilibrium value, and the crystals are compact (circular in 2D) as the saturation factor approaches unity (S= 1.0). However, few natural crystals form under such conditions. At higher oversaturation (e.g. S = 1.2), dendritic crystals of millimeter size develop on timescales appropriate to cloud processes, and kinetic effects control isotopic fractionation. Fractionation factors for dendritic crystals are similar to those predicted by the spherical diffusion model, but the model also gives estimates of crystal heterogeneity. Dendritic crystals are constrained to be relatively large, with dimension much greater than about 20D/k. The most difficult aspect of the modeling is to account for the large density difference between air and ice, which requires us to use a fictitious higher density for the vapor-oversaturated air and scale the crystal growth time accordingly. An approach using a larger scale simulation and the domain decomposition method can provide a vapor flux for a nested smaller scale calculation. The results clarify the controls on crystal growth, and the relationships between saturation state, growth rate, crystal morphology and isotopic fractionation.

Spreading of a liquid film on a substrate by the evaporation-adsorption process

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wayner, P.C. Jr.; Schonberg, J.

1992-09-01

The importance of evaporation followed by multilayer adsorption in comparison to liquid flow at the leading edge of a volatile spreading film is analyzed. Presuming that both flows are functions of the same chemical potential gradient, a dimensionless group (N) which delineates the relative importance of vapor diffusion flow to viscous flow on the surface is obtained: N = [rho][sub i]D[nu]x/([minus][bar A][pi]). The relative importance of vapor flow increases with the vapor-pressure dependent partial density, [rho][sub i], and diffusivity, D, of the diffusing vapor, the kinematic viscosity of the liquid, [nu], and the distance downstream from the bulk liquid region,more » x, and decreases with the Hamaker constant, 6[pi][bar A]. Using physical properties the modifiers volatile'' and nonvolatile'' can thereby be put in perspective. Changes in the interfacial force field are a function of [bar A]. The spreading velocity due to the vapor diffusion process is obtained and is found to decrease with a decrease in the interfacial force field and the bulk vapor pressure. The infinite stress at the contact line can be easily relieved by evaporation-adsorption in many systems.« less

Use of Plastic Capillaries for Macromolecular Crystallization

NASA Technical Reports Server (NTRS)

Potter, Rachel R.; Hong, Young-Soo; Ciszak, Ewa M.

2003-01-01

Methods of crystallization of biomolecules in plastic capillaries (Nalgene 870 PFA tubing) are presented. These crystallization methods used batch, free-interface liquid- liquid diffusion alone, or a combination with vapor diffusion. Results demonstrated growth of crystals of test proteins such as thaumatin and glucose isomerase, as well as protein studied in our laboratory such dihydrolipoamide dehydrogenase. Once the solutions were loaded in capillaries, they were stored in the tubes in frozen state at cryogenic temperatures until the desired time of activation of crystallization experiments.

Analysis of Evaporative On-Board Diagnostic (OBD) Readiness and DTCs Using I/M Data

EPA Science Inventory

Gasoline vehicles are equipped with evaporative emissions control systems that control vapor from the fuel storage system while a vehicle is sitting or driving. When these systems or the vehicle’s gasoline delivery system malfunction, excessive evaporative emissions can be emitte...

Pinning-Depinning Mechanisms of the Contact Line during Evaporation of Microdroplets on Rough Surfaces: A Lattice Boltzmann Simulation.

PubMed

Yuan, Wu-Zhi; Zhang, Li-Zhi

2018-06-22

In this study, pinning and depinning of the contact line during droplet evaporation on the rough surfaces with randomly distributed structures is theoretically analyzed and numerically investigated. A fast Fourier transformation (FFT) method is used to generate the rough surfaces, whose skewness ( Sk), kurtosis ( K), and root-mean-square ( Rq) are obtained from real surfaces. A thermal multiphase LB model is proposed to simulate the isothermal pinning and depinning processes. The evaporation processes are recorded with the variations in contact angle, contact radius, and drop shape. It is found that the drops sitting on rough surfaces show different behavior from those on smoother surfaces. The former shows a pinned contact line during almost the whole lifetime. By contrast, the latter experiences a stick-slip-jump behavior until the drop disappears. At mesoscopic scale, the pinning of the contact line is actually a slow motion rather than a complete immobilization at the sharp edges. The dynamic equilibrium is achieved by the self-adjustment of the contact line according to each edge.

Diffusive-convective physical vapor transport of PbTe from a Te-rich solid source

NASA Technical Reports Server (NTRS)

Zoutendyk, J.; Akutagawa, W.

1982-01-01

Crystal growth of PbTe by physical vapor transport (sublimation) in a closed ampoule is governed by the vapor species in thermal equilibrium with the solid compound. Deviations from stoichiometry in the source material cause diffusion limitation of the transport rate, which can be modified by natural (gravity-driven) convection. Mass-transport experiments have been performed using Te-rich material wherein sublimation rates have been measured in order to study the effects of natural convection in diffusion-limited vapor transport. Linear velocities for both crystal growth and evaporation (back sublimation) have been measured for transport in the direction of gravity, horizontally, and opposite to gravity. The experimental results are discussed in terms of both the one-dimensional diffusive-advective model and current, more sophisticated theory which includes natural convection. There is some evidence that convection effects from radial temperature gradients and solutal density gradients have been observed.

Purification, identification and preliminary crystallographic studies of an allergenic protein from Lathyrus sativus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qureshi, Insaf A.; Sethi, Dhruv K.; Salunke, Dinakar M., E-mail: dinakar@nii.res.in

2006-09-01

A 24 kDa protein was purified from the seeds of L. sativus by ammonium sulfate fractionation and ion-exchange chromatography. Crystals were obtained by the hanging-drop vapour-diffusion method. A 24 kDa protein was purified from the seeds of Lathyrus sativus by ammonium sulfate fractionation and ion-exchange chromatography. The N-terminal amino-acid sequence showed significant homology with the 2S albumin class of seed storage proteins. The protein showed 85% sequence homology with the seed albumin of Pisum sativum within the 40 N-terminal residues. Crystals were obtained by the hanging-drop vapour-diffusion method. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cellmore » parameters a = 43.5, b = 82.7, c = 153.4 Å.« less

Distribution of selected volatile organic compounds determined with water-to-vapor diffusion samplers at the interface between ground water and surface water, Centredale Manor site, North Providence, Rhode Island, September 1999

USGS Publications Warehouse

Church, Peter E.; Lyford, Forest P.; Clifford, Scott

2000-01-01

Volatile organic compounds are present in soils and ground water at the Centredale Manor Superfund Site in North Providence, Rhode Island. In September 1999, water-to-vapor diffusion samplers were placed in the bottom sediments of waterways adjacent to the site to identify possible contaminated ground-water discharge areas. The approximate12-acre site is a narrow stretch of land between the eastern bank of the Woonasquatucket River, downstream from the U.S. Route 44 bridge and a former mill raceway. The samplers were placed along a 2,250-foot reach of the Woonasquatucket River, in the former mill raceway several hundred feet to the east and parallel to the river, and in a cross channel between the river and former mill raceway. Volatile organic compounds were detected in 84 of the 104 water-to-vapor diffusion samplers retrieved. Trichloroethylene and tetrachloro-ethylene were the principal volatile organic compounds detected. The highest vapor concentrations measured for these two chemicals were from diffusion samplers located along an approximate 100-foot reach of the Woonasquatucket River about 500 feet downstream of the bridge; here trichloroethylene and tetrachloroethylene vapor concentrations ranged from about 2,000 to 180,000 and 1,600 to 1,400,000 parts per billion by volume, respectively. Upstream and downstream from this reach and along the former mill raceway, trichloroethylene and tetrachloroethylene vapor concentrations from the diffusion samples were generally less than 100 parts per billion by volume. Along the lower reaches of the river and mill raceway, however, and in the cross channel, vapor concentrations of trichloroethylene exceeded 100 parts per billion by volume and tetrachloroethylene exceeded 1,000 parts per billion by volume in several diffusion samples. Although diffusion sample vapor concentrations are higher than water concentrations in surface waters and in ground water, and they should only be interpreted qualitatively as relative values, these values provide important information as to potential discharge areas of contaminants.

Investigation of cerebral hemodynamic changes during repeated sit-stand maneuver using functional near-infrared spectroscopy

NASA Astrophysics Data System (ADS)

Niu, Haijing; Li, Lin; Bhave, Gauri S.; Lin, Zi-jing; Tian, Fenghua; Khosrow, Behbehani; Zhang, Rong; Liu, Hanli

2011-03-01

The goal for this study is to examine cerebral autoregulation in response to a repeated sit-stand maneuver using both diffuse functional Near Infrared spectroscopy (fNIRS) and Transcranial Doppler sonography (TCD). While fNIRS can provide transient changes in hemodynamic response to such a physical action, TCD is a noninvasive transcranial method to detect the flow velocities in the basal or middle cerebral arteries (MCA). The initial phase of this study was to measure fNIRS signals from the forehead of subjects during the repeated sit-stand protocol and to understand the corresponding meaning of the detected signals. Also, we acquired preliminary data from simultaneous measurements of fNIRS and TCD during the sit-stand protocol so as to explore the technical difficulty of such an approach. Specifically, ten healthy adult subjects were enrolled to perform the planned protocol, and the fNIRS array probes with 4 sources and 10 detectors were placed on the subject's forehead to detect hemodynamic signal changes from the prefrontal cortex. The fNIRS results show that the oscillations of hemoglobin concentration were spatially global and temporally dynamic across the entire region of subject's forehead. The oscillation patterns in both hemoglobin concentrations and blood flow velocity seemed to follow one another; changes in oxy-hemoglobin concentration were much larger than those in deoxyhemoglobin concentration. These preliminary findings provide us with evidence that fNIRS is an appropriate means readily for studying cerebral hemodynamics and autoregulation during sit-stand maneuvers.

Cryogenic spray vaporization in high-velocity helium, argon and nitrogen gasflows

NASA Technical Reports Server (NTRS)

Ingebo, Robert D.

1993-01-01

Effects of gas properties on cryogenic liquid-jet atomization in high-velocity helium, nitrogen, and argon gas flows were investigated. Volume median diameter, D(sub v.5e), data were obtained with a scattered-light scanning instrument. By calculating the change in spray drop size, -Delta D(sub v.5)(exp 2), due to droplet vaporization, it was possible to calculate D(sub v.5C). D(sub v.5C) is the unvaporized characteristic drop size formed at the fuel-nozzle orifice. This drop size was normalized with respect to liquid-jet diameter, D(sub O). It was then correlated with several dimensionless groups to give an expression for the volume median diameter of cryogenic LN2 sprays. This expression correlates drop size D(sub v.5c) with aerodynamic and liquid-surface forces so that it can be readily determined in the design of multiphase-flow propellant injectors for rocket combustors.

Genital and Urinary Tract Defects

MedlinePlus

... wrong place. The clitoris is a female external sex organ. For boys and girls, bladder control problems Some babies need ... to sit down to urinate. And in some boys, the testicles don’t fully drop down ... problems with sex or urinating later in life. Hypospadias usually is ...

Measurement of hemodynamics during postural changes using a new wearable cephalic laser blood flowmeter.

PubMed

Fujikawa, Tetsuya; Tochikubo, Osamu; Kura, Naoki; Kiyokura, Takanori; Shimada, Junichi; Umemura, Satoshi

2009-10-01

Patients with orthostatic hypotension have pathologic hemodynamics related to changes in body posture. A new cephalic laser blood flowmeter that can be worn on the tragus to investigate the hemodynamics upon rising from a sitting or squatting posture was developed. The relationship between cephalic hemodynamics and cerebral ischemic symptoms in 63 subjects in a sitting, squatting, and standing positions using the new device was evaluated. Transient decrease in blood pressure within 15 s after rising to an erect position possibly causes dizziness, syncope, and fall. Subjects exhibiting dizziness upon standing showed a significant decrease in the cephalic blood flow (CBF) and indirect beat-to-beat systolic blood pressure, as monitored by the Finometer, and a significant correlation was observed between the drop ratio (drop value on rising/mean value in the squatting position) of CBF and that of systolic blood pressure. This new wearable CBF-meter is potentially useful for estimating cephalic hemodynamics and objectively diagnosing cerebral ischemic symptoms of subjects in a standing posture.

Alternate methods of applying diffusants to silicon solar cells. [screen printing of thick-film paste materials and vapor phase transport from solid sources

NASA Technical Reports Server (NTRS)

Brock, T. W.; Field, M. B.

1979-01-01

Low-melting phosphate and borate glasses were screen printed on silicon wafers and heated to form n and p junctions. Data on surface appearance, sheet resistance and junction depth are presented. Similar data are reported for vapor phase transport from sintered aluminum metaphosphate and boron-containing glass-ceramic solid sources. Simultaneous diffusion of an N(+) layer with screen-printed glass and a p(+) layer with screen-printed Al alloy paste was attempted. No p(+) back surface field formation was achieved. Some good cells were produced but the heating in an endless-belt furnace caused a large scatter in sheet resistance and junction depth for three separate lots of wafers.

Crystallization and preliminary X-ray analysis of gamma-glutamyltranspeptidase from Escherichia coli K-12.

PubMed

Kumagai, H; Nohara, S; Suzuki, H; Hashimoto, W; Yamamoto, K; Sakai, H; Sakabe, K; Fukuyama, K; Sakabe, N

1993-12-20

gamma-Glutamyltranspeptidase (EC 2.3.2.2) from Escherichia coli K-12 has been purified and crystallized by means of vapor diffusion in hanging drops. Two kinds of crystals on cell dimensions were found for X-ray diffraction analysis, one from ammonium sulfate and the other from polyethylene glycol 6000 as precipitants. The crystals of the orthorhombic form grown in the presence of 15% polyethylene glycol and 20 mM sodium acetate buffer were chosen for further analysis. The crystals belonged to space group P2(1)2(1)2(1), with cell dimensions of a = 128.1, b = 129.9 and c = 79.2 A, and two molecules constitute an asymmetric unit. These crystals diffracted to 2.0 A resolution and were suitable for X-ray crystallographic studies.

Size Distribution and Velocity of Ethanol Drops in a Rocket Combustor Burning Ethanol and Liquid Oxygen

NASA Technical Reports Server (NTRS)

Ingebo, Robert D.

1961-01-01

Single jets of ethanol were studied photomicrographically inside a rocket chamber as they broke up into sprays of drops which underwent simultaneous acceleration and vaporization with chemical reaction occurring in the surrounding combustion gas stream. In each rocket test-firing, liquid oxygen was used as the oxidant. Both drop velocity and drop size distribution data were obtained from photomicrographs of the ethanol drops taken with an ultra-high speed tracking camera developed at NASA, Lewis Research Center.

Productivity of transcriptionists using a treadmill desk.

PubMed

Thompson, Warren G; Levine, James A

2011-01-01

Time spent sitting increases all-cause mortality. Sedentary occupations are a major contributor to the obesity epidemic. A treadmill desk offers the potential to increase activity while working; however, it is important to make sure that productivity does not decline. The purpose of this study is to evaluate productivity while using a treadmill desk. Eleven experienced medical transcriptionists participated in the study. Transcriptionists were given 4 hours training in the use of a treadmill desk. They were asked to transcribe tapes for 8 hours both while sitting and while using the treadmill desk. Speed and accuracy of transcription were compared as were the average expended calories per hour. The accuracy of transcription did not differ between sitting and walking transcriptions. The speed of transcription was 16% slower while walking than while sitting (p < 0.001). The transcriptionists expended 100 calories per hour more when they transcribed while walking than when they transcribed while sitting (p < 0.001). The treadmill desk offers a way to reduce sedentariness in the workplace and has potential to reduce employee obesity and health care costs. However, more than 4 hours of training will be necessary to prevent a significant drop in employee productivity.

Quantification of natural vapor fluxes of trichloroethene in the unsaturated zone at Picatinny Arsenal, New Jersey

USGS Publications Warehouse

Smith, James A.; Tisdale, Amy K.; Cho, H. Jean

1996-01-01

The upward flux of trichloroethene (TCE) vapor through the unsaturated zone above a contaminated, water-table aquifer at Picatinny Arsenal, New Jersey, has been studied under natural conditions over a 12-month period. Vertical gas-phase diffusion fluxes were estimated indirectly by measuring the TCE vapor concentration gradient in the unsaturated zone and using Fick's law to calculate the flux. The total gas-phase flux (e.g., the sum of diffusion and advection fluxes) was measured directly with a vertical flux chamber (VFC). In many cases, the upward TCE vapor flux was several orders of magnitude greater than the upward TCE diffusion flux, suggesting that mechanisms other than steady-state vapor diffusion are contributing to the vertical transport of TCE vapors through the unsaturated zone. The measured total flux of TCE vapor from the subsurface to the atmosphere is approximately 50 kg/yr and is comparable in magnitude to the removal rate of TCE from the aquifer by an existing pump-and-treat system and by discharge into a nearby stream. The net upward flux of TCE is reduced significantly during a storm event, presumably due to the mass transfer of TCE from the soil gas to the infiltrating rainwater and its subsequent downward advection. Several potential problems associated with the measurement of total gas-phase fluxes are discussed.

Compact Water Vapor Exchanger for Regenerative Life Support Systems

NASA Technical Reports Server (NTRS)

Izenson, Michael G.; Chen, Weibo; Anderson, Molly; Hodgson, Edward

2012-01-01

Thermal and environmental control systems for future exploration spacecraft must meet challenging requirements for efficient operation and conservation of resources. Regenerative CO2 removal systems are attractive for these missions because they do not use consumable CO2 absorbers. However, these systems also absorb and vent water to space along with carbon dioxide. This paper describes an innovative device designed to minimize water lost from regenerative CO2 control systems. Design studies and proof-of-concept testing have shown the feasibility of a compact, efficient membrane water vapor exchanger (WVX) that will conserve water while meeting challenging requirements for operation on future spacecraft. Compared to conventional WVX designs, the innovative membrane WVX described here has the potential for high water recovery efficiency, compact size, and very low pressure losses. The key innovation is a method for maintaining highly uniform flow channels in a WVX core built from water-permeable membranes. The proof-of-concept WVX incorporates all the key design features of a prototypical unit, except that it is relatively small scale (1/23 relative to a unit sized for a crew of six) and some components were fabricated using non-prototypical methods. The proof-of-concept WVX achieved over 90% water recovery efficiency in a compact core in good agreement with analysis models. Furthermore the overall pressure drop is very small (less than 0.5 in. H2O, total for both flow streams) and meets requirements for service in environmental control and life support systems on future spacecraft. These results show that the WVX provides very uniform flow through flow channels for both the humid and dry streams. Measurements also show that CO2 diffusion through the water-permeable membranes will have negligible effect on the CO2 partial pressure in the spacecraft atmosphere.

DSMC simulations of vapor transport toward development of the lithium vapor box divertor concept

NASA Astrophysics Data System (ADS)

Jagoe, Christopher; Schwartz, Jacob; Goldston, Robert

2016-10-01

The lithium vapor divertor box concept attempts to achieve volumetric dissipation of the high heat efflux from a fusion power system. The vapor extracts the heat of the incoming plasma by ionization and radiation, while remaining localized in the vapor box due to differential pumping based on rapid condensation. Preliminary calculations with lithium vapor at densities appropriate for an NSTX-U-scale machine give Knudsen numbers between 0.01 and 1, outside both the range of continuum fluid dynamics and of collisionless Monte Carlo. The direct-simulation Monte Carlo (DSMC) method, however, can simulate rarefied gas flows in this regime. Using the solver contained in the OpenFOAM package, pressure-driven flows of water vapor will be analyzed. The use of water vapor in the relevant range of Knudsen number allows for a flexible similarity experiment to verify the reliability of the code before moving to tests with lithium. The simulation geometry consists of chains of boxes on a temperature gradient, connected by slots with widths that are a representative fraction of the dimensions of the box. We expect choked flow, sonic shocks, and order-of-magnitude pressure and density drops from box to box, but this expectation will be tested in the simulation and then experiment. This work is supported by the Princeton Environmental Institute.

The evaporation of a drop of mercury

NASA Astrophysics Data System (ADS)

Winter, Thomas G.

2003-08-01

The evaporative rates of two drops of mercury at room temperature are determined experimentally and theoretically. The resulting mercury vapor levels are estimated and measured, compared with the OSHA permissible exposure limit, and found to be small by comparison.

Experiments on Nitrogen Oxide Production of Droplet Arrays Burning under Microgravity Conditions

NASA Astrophysics Data System (ADS)

Moesl, Klaus; Sattelmayer, Thomas; Kikuchi, Masao; Yamamoto, Shin; Yoda, Shinichi

The optimization of the combustion process is top priority in current aero-engine and aircraft development, particularly from the perspectives of high efficiency, minimized fuel consumption, and a sustainable exhaust gas production. Aero-engines are exclusively liquid-fueled with a strong correlation between the combustion temperature and the emissions of nitric oxide (NOX ). Due to safety concerns, the progress in NOX reduction has been much slower than in stationary gas turbines. In the past, the mixing intensity in the primary zone of aero-engine combustors was improved and air staging implemented. An important question for future aero-engine combustors, consequently, is how partial vaporization influences the NOX emissions of spray flames? In order to address this question, the combustion of partially vaporized, linear droplet arrays was studied experimentally under microgravity conditions. The influence of fuel pre-vaporization on the NOX emissions was assessed in a wide range. The experiments were performed in a drop tower and a sounding rocket campaign. The microgravity environment provided ideal experiment conditions without the disturbing ef-fect of natural convection. This allowed the study of the interacting phenomena of multi-phase flow, thermodynamics, and chemical kinetics. This way the understanding of the physical and chemical processes related to droplet and spray combustion could be improved. The Bremen drop tower (ZARM) was utilized for the precursor campaign in July 2008, which was com-prised of 30 drops. The sounding rocket experiments, which totaled a microgravity duration of 6 minutes, were finally performed on the flight of TEXUS-46 in November 2009. On both campaigns the "Japanese Combustion Module" (JCM) was used. It is a cooperative experi-ment on droplet array combustion between the Japan Aerospace Exploration Agency (JAXA) and ESA's (European Space Agency) research team, working on the combustion properties of partially premixed sprays. One droplet array consisted of five droplets (for sounding rocket) and 9 -17 droplets (for drop tower) of the hydrocarbon n-decane (C10 H22 ). While keeping the pressure at 1.0 bar (+/-20 mbar), the combustion chamber temperature and the fuel vaporization time were varied in the range of 300 -500 K and 0.5 -18 s, respectively. Consequently, the total amount of fuel, the local equivalence ratio Φ along the droplet array, and the dimensionless droplet spacing S/d0 , with d0 being the initial droplet diameter, were adapted. Ignition was initiated by a hot-wire igniter from one end of the droplet array. Representative gas samples were collected from every single combustion sequence after flame extinction and stored in specially treated gas sampling cylinders for their succeeding analysis on ground. Visual observation of the combustion process, as well as temperature and pressure logging, supported the scientific interpretation of the gas analysis. With an increase of the preheating temperature, NOX emissions increase due to a higher effec-tive flame temperatures. However, with an increasing pre-vaporization, NOX emissions become lower due to the dropping number and the dropping size of burning droplets, acting as hot spots. A correction for the effect of the preheating temperature was developed. It reveals the effect of pre-vaporization and shows that the NOX emissions are almost independent of it for near-stoichiometric operation. At overall lean conditions the NOX emissions drop non-linearly with the degree of vaporization. Up to now, this leads to the conclusion that a high degree of vaporization is required in order to achieve substantial NOX abatement.

The Commercial Vapor Diffusion Apparatus (CVDA) STS-95

NASA Technical Reports Server (NTRS)

2004-01-01

The Commercial Vapor Diffusion Apparatus will be used to perform 128 individual crystal growth investigations for commercial and science research. These experiments will grow crystals of several different proteins, including HIV-1 Protease Inhibitor, Glycogen Phosphorylase A, and NAD Synthetase. The Commercial Vapor Diffusion Apparatus supports multiple commercial investigations within a controlled environment. The goal of the Commercial Protein Crystal Growth payload on STS-95 is to grow large, high-quality crystals of several different proteins of interest to industry, and to continue to refine the technology and procedures used in microgravity for this important commercial research.

Improved Assessment Strategies for Vapor Intrusion Passive Samplers and Building Pressure Control

DTIC Science & Technology

2013-09-01

pressure control. Matrix Analyte Method Container Holding Time (Days) Vapor Radon McHugh , Hammond, Nickels , and Hartman, 2008 Tedlar ® bag 14...2: Diffusive Sampling,” ISO 16017-2:2003. McHugh T. E., D. E. Hammond, T. Nickels , and B. Hartman. 2008. “Use of Radon Measurements for Evaluation...Control I. D. Rivera-Duarte D. B. Chadwick SSC Pacific T. McAlary H. Groenevelt T. Creamer D. Bertrand Geosyntec Consultants, Inc. T. McHugh

In situ growth of ceramic quantum dots in polyaniline host via water vapor flow diffusion as potential electrode materials for energy applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mombrú, Dominique; Romero, Mariano, E-mail: mromero@fq.edu.uy; Faccio, Ricardo, E-mail: rfaccio@fq.edu.uy

In situ preparation of polyaniline-ceramic nanocomposites has recently demonstrated that the electrical properties are highly improved with respect to the typical ex situ preparations. In this report, we present for the first time, to the best of our knowledge, the in situ growth of titanium oxide quantum dots in polyaniline host via water vapor flow diffusion as an easily adaptable route to prepare other ceramic-polymer nanocomposites. The main relevance of this method is the possibility to prepare ceramic quantum dots from alkoxide precursors using water vapor flow into any hydrophobic polymer host and to achieve good homogeneity and size-control. Inmore » addition, we perform full characterization by means of high-resolution transmission electron microscopy, X-ray powder diffraction, small angle X-ray scattering, thermogravimetric and calorimetric analyses, confocal Raman microscopy and impedance spectroscopy analyses. The presence of the polymer host and interparticle Coulomb repulsive interactions was evaluated as an influence for the formation of ~3–8 nm equally-sized quantum dots independently of the concentration. The polyaniline polaron population showed an increase for the quantum dots diluted regime and the suppression at the concentrated regime, ascribed to the formation of chemical bonds at the interface, which was confirmed by theoretical simulations. In agreement with the previous observation, the in situ growth of ceramic quantum dots in polyaniline host via water vapor flow diffusion could be very useful as a novel approach to prepare electrode materials for energy conversion and storage applications. - Highlights: • In situ growth of titanium oxide quantum dots in polyaniline host via water vapor flow diffusion. • Polyaniline charge carriers at the interface and charge interactions between quantum dots. • Easy extrapolation to sol-gel derived quantum dots into polymer host as potential electrode materials.« less

A simple technique to reduce evaporation of crystallization droplets by using plate lids with apertures for adding liquids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zipper, Lauren E.; Binghamton University, 4400 Vestal Parkway East, Vestal, NY 13902; Aristide, Xavier

This article describes the use of evaporation control lids that are fitted to crystallization plates to improve the reproducibility of trials using as little as 5 nl. The plate lids contain apertures which are large enough for the transfer of protein containing droplets, but small enough to greatly reduce the rate of evaporation during the time needed to prepare the plate. A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fittingmore » the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under different conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63–82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. The results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations.« less

Heat and mass transfer in flames

NASA Technical Reports Server (NTRS)

Faeth, G. M.

1986-01-01

Heat- and mass-transfer processes in turbulent diffusion flames are discussed, considering turbulent mixing and the structure of single-phase flames, drop processes in spray flames, and nonluminous and luminous flame radiation. Interactions between turbulence and other phenomena are emphasized, concentrating on past work of the author and his associates. The conserved-scalar formalism, along with the laminar-flamelet approximation, is shown to provide reasonable estimates of the structure of gas flames, with modest levels of empiricism. Extending this approach to spray flames has highlighted the importance of drop/turbulence interactions; e.g., turbulent dispersion of drops, modification of turbulence by drops, etc. Stochastic methods being developed to treat these phenomena are yielding encouraging results.

Medium-range predictability of early summer sea ice thickness distribution in the East Siberian Sea based on the TOPAZ4 ice-ocean data assimilation system

NASA Astrophysics Data System (ADS)

Nakanowatari, Takuya; Inoue, Jun; Sato, Kazutoshi; Bertino, Laurent; Xie, Jiping; Matsueda, Mio; Yamagami, Akio; Sugimura, Takeshi; Yabuki, Hironori; Otsuka, Natsuhiko

2018-06-01

Accelerated retreat of Arctic Ocean summertime sea ice has focused attention on the potential use of the Northern Sea Route (NSR), for which sea ice thickness (SIT) information is crucial for safe maritime navigation. This study evaluated the medium-range (lead time below 10 days) forecast of SIT distribution in the East Siberian Sea (ESS) in early summer (June-July) based on the TOPAZ4 ice-ocean data assimilation system. A comparison of the operational model SIT data with reliable SIT estimates (hindcast, satellite and in situ data) showed that the TOPAZ4 reanalysis qualitatively reproduces the tongue-like distribution of SIT in ESS in early summer and the seasonal variations. Pattern correlation analysis of the SIT forecast data over 3 years (2014-2016) reveals that the early summer SIT distribution is accurately predicted for a lead time of up to 3 days, but that the prediction accuracy drops abruptly after the fourth day, which is related to a dynamical process controlled by synoptic-scale atmospheric fluctuations. For longer lead times ( > 4 days), the thermodynamic melting process takes over, which contributes to most of the remaining prediction accuracy. In July 2014, during which an ice-blocking incident occurred, relatively thick SIT ( ˜ 150 cm) was simulated over the ESS, which is consistent with the reduction in vessel speed. These results suggest that TOPAZ4 sea ice information has great potential for practical applications in summertime maritime navigation via the NSR.

Microfabricated valveless devices for thermal bioreactions based on diffusion-limited evaporation.

PubMed

Wang, Fang; Yang, Ming; Burns, Mark A

2008-01-01

Microfluidic devices that reduce evaporative loss during thermal bioreactions such as PCR without microvalves have been developed by relying on the principle of diffusion-limited evaporation. Both theoretical and experimental results demonstrate that the sample evaporative loss can be reduced by more than 20 times using long narrow diffusion channels on both sides of the reaction region. In order to further suppress the evaporation, the driving force for liquid evaporation is reduced by two additional techniques: decreasing the interfacial temperature using thermal isolation and reducing the vapor concentration gradient by replenishing water vapor in the diffusion channels. Both thermal isolation and vapor replenishment techniques can limit the sample evaporative loss to approximately 1% of the reaction content.

Tritium plume dynamics in the shallow unsaturated zone in an arid environment

USGS Publications Warehouse

Maples, S.R.; Andraski, Brian J.; Stonestrom, David A.; Cooper, C.A.; Pohll, G.; Michel, R.L.

2014-01-01

The spatiotemporal variability of a tritium plume in the shallow unsaturated zone and the mechanisms controlling its transport were evaluated during a 10-yr study. Plume movement was minimal and its mass declined by 68%. Upward-directed diffusive-vapor tritium fluxes and radioactive decay accounted for most of the observed plume-mass declines.Effective isolation of tritium (3H) and other contaminants at waste-burial facilities requires improved understanding of transport processes and pathways. Previous studies documented an anomalously widespread (i.e., theoretically unexpected) distribution of 3H (>400 m from burial trenches) in a dry, sub-root-zone gravelly layer (1–2-m depth) adjacent to a low-level radioactive waste (LLRW) burial facility in the Amargosa Desert, Nevada, that closed in 1992. The objectives of this study were to: (i) characterize long-term, spatiotemporal variability of 3H plumes; and (ii) quantify the processes controlling 3H behavior in the sub-root-zone gravelly layer beneath native vegetation adjacent to the facility. Geostatistical methods, spatial moment analyses, and mass flux calculations were applied to a spatiotemporally comprehensive, 10-yr data set (2001–2011). Results showed minimal bulk-plume advancement during the study period and limited Fickian spreading of mass. Observed spreading rates were generally consistent with theoretical vapor-phase dispersion. The plume mass diminished more rapidly than would be expected from radioactive decay alone, indicating net efflux from the plume. Estimates of upward 3H efflux via diffusive-vapor movement were >10× greater than by dispersive-vapor or total-liquid movement. Total vertical fluxes were >20× greater than lateral diffusive-vapor fluxes, highlighting the importance of upward migration toward the land surface. Mass-balance calculations showed that radioactive decay and upward diffusive-vapor fluxes contributed the majority of plume loss. Results indicate that plume losses substantially exceeded any continuing 3H contribution to the plume from the LLRW facility during 2001 to 2011 and suggest that the widespread 3H distribution resulted from transport before 2001.

Method of making an electrode

DOEpatents

Isenberg, Arnold O.

1986-01-01

Disclosed is a method of coating an electrode on a solid oxygen conductive oxide layer. A coating of particles of an electronic conductor is formed on one surface of the oxide layer and a source of oxygen is applied to the opposite surface of the oxide layer. A metal halide vapor is applied over the electronic conductor and the oxide layer is heated to a temperature sufficient to induce oxygen to diffuse through the oxide layer and react with the metal halide vapor. This results in the growing of a metal oxide coating on the particles of electronic conductor, thereby binding them to the oxide layer.

Direct numerical simulations of two-phase laminar jet flows with different cross-section injection geometries

NASA Astrophysics Data System (ADS)

Abdel-Hameed, H.; Bellan, J.

2002-10-01

Direct numerical simulations are performed of spatial, three-dimensional, laminar jets of different inlet geometric configurations for the purpose of quantifying the characteristics of the flows; both single-phase (SP) and two-phase (TP) free jets are considered. The TP jets consist of gas laden with liquid drops randomly injected at the inlet. Drop evaporation ensues both due to the gaseous flow being initially unvitiated by the vapor species corresponding to the liquid drops, and to drop heating as the initial drop temperature is lower than that of the carrier gas. The conservation equations for the TP flow include complete couplings of mass, momentum, and energy based on thermodynamically self-consistent specification of the vapor enthalpy, internal energy, and latent heat of vaporization. Inlet geometries investigated are circular, elliptic, rectangular, square, and triangular. The results focus both on the different spreading achieved according to the inlet geometry, as well as on the considerable change in the flow field due to the presence of the drops. The most important consequence of the drop interaction with the flow is the production of streamwise vorticity that alters entrainment and species mixing according to the inlet geometry. Similar to their SP equivalent, TP jets are shown to reach steady-state entrainment; examination of the flows at this time station shows that the potential cores of TP jets are shorter by an order of magnitude than their SP counterpart. Moreover, whereas the TP circular jet exhibits a symmetric entrainment pattern well past the streamwise location of the potential core, noncircular jets display at the same location strong departures from symmetry. Furthermore, the SP-jet phenomenon of axis switching is no longer present in TP jets. The distributions of drop-number density, liquid mass, and evaporated species are compared for different inlet cross sections and recommendations are made regarding the optimal choice for different applications.

Noncircular Cross Sections Could Enhance Mixing in Sprays

NASA Technical Reports Server (NTRS)

Bellan, Josette; Abdel-Hameed, Hesham

2003-01-01

A computational study has shown that by injecting drops in jets of gas having square, elliptical, triangular, or other noncircular injection cross sections, it should be possible to increase (relative to comparable situations having circular cross section) the entrainment and dispersion of liquid drops. This finding has practical significance for a variety of applications in which it is desirable to increase dispersion of drops. For example, in chemical-process sprays, increased dispersion leads to increases in chemical- reaction rates; in diesel engines, increasing the dispersion of drops of sprayed fuel reduces the production of soot; and in household and paint sprays, increasing the dispersion of drops makes it possible to cover larger surfaces. It has been known for some years that single-phase fluid jets that enter flow fields through noncircular inlets entrain more fluid than do comparable jets entering through circular inlets. The computational study reported here was directed in part toward determining whether and how this superior mixing characteristic of noncircular single phase jets translates to a similar benefit in cases of two-phase jets (that is, sprays). The study involved direct numerical simulations of single- and two-phase free jets with circular, elliptical, rectangular, square, and triangular inlet cross sections. The two-phase jets consisted of gas laden with liquid drops randomly injected at the inlets. To address the more interesting case of evaporating drops, the carrier gas in the jets was specified to be initially unvitiated by the vapor of the liquid chemical species and the initial temperature of the drops was chosen to be smaller than that of the gas. The mathematical model used in the study was constructed from the conservation equations for the two-phase flow and included complete couplings of mass, momentum, and energy based on thermodynamically self-consistent specification of the enthalpy, internal energy, and latent heat of vaporization of the vapor.

Device For Controlling Crystallization Of Protein

NASA Technical Reports Server (NTRS)

Noever, David A.

1993-01-01

Variable sandwich spacer enables optimization of evaporative driving force that governs crystallization of protein from solution. Mechanically more rigid than hanging-drop and sitting-drop devices. Large oscillations and dislodgment of drop of solution in response to vibrations suppressed by glass plates. Other advantages include: suitable for automated delivery, stable handling, and programmable evaporation of protein solution; controlled configuration enables simple and accurate determination of volume of solution without disrupting crystallization; pH and concentration of precipitant controlled dynamically because pH and concentration coupled to rate of evaporation, controllable via adjustment of gap between plates; and enables variation of ratio between surface area and volume of protein solution. Alternative version, plates oriented vertically instead of horizontally.

Effects of body position on the carbon monoxide diffusing capacity in patients with chronic heart failure: relation to hemodynamic changes.

PubMed

Faggiano, P; D'Aloia, A; Simoni, P; Gualeni, A; Foglio, K; Ambrosino, N; Giordano, A

1998-01-01

Pulmonary diffusion has been found to be reduced in patients with congestive heart failure. The effects of postural changes on the diffusing capacity had been evaluated in healthy subjects, but not in patients with heart failure. The aim of this study was to evaluate the posture-induced changes in diffusing capacity in patients with chronic heart failure and their relation to the hemodynamic profile. The pulmonary carbon monoxide diffusing capacity (DLCO) was measured in the supine position, with 20 degrees passive head elevation, and in the sitting position, both postures maintained for 10 min, in a group of 32 male patients with mild to moderate chronic heart failure due to left ventricular systolic dysfunction (ejection fraction <35%). On a separate day, in the absence of any changes in clinical status and therapy, the hemodynamic parameters were measured by right-heart catheterization. The sequence of postures was assigned randomly. The mean values of DLCO were slightly reduced and did not differ in the two positions (20.3 +/- 5.7 vs. 19.4 +/- 5.6 ml/min/mm Hg, 77 +/- 23 vs. 75 +/- 20% of predicted, respectively). The patients were then subdivided according to changes in DLCO from the supine to the sitting position: DLCO increased (+23%) in 9 patients (28%, group 1), decreased (-17.5%) in 17 patients (53%, group 2), and remained within the coefficient of reproducibility ( +/- 5 %) in 6 patients (group 3). As compared with group 2, group 1 patients showed a significant increase in mean pulmonary artery pressure (+7 vs. -15%, p < 0.01) and pulmonary capillary wedge pressure (+8 vs. -22%, p < 0.005) from the supine to the sitting position, while the cardiac index showed a smaller - but not significant - decrease in group 1 (-5 vs. -12%). The percent changes in DLCO significantly correlated with changes in pulmonary capillary wedge (r = 0.54, p < 0.0005) and mean pulmonary artery (r = 0.47, p < 0.005) pressures. In chronic heart failure postural changes may induce different responses in diffusing capacity. To a greater extent than in healthy subjects, the most common response is a decrease in DLCO in the sitting as compared with the supine position. The DLCO changes correlate with variations in pulmonary circulation pressure, probably due to changes in pulmonary vascular recruitment and pulmonary capillary blood volume.

Influence of Computational Drop Representation in LES of a Droplet-Laden Mixing Layer

NASA Technical Reports Server (NTRS)

Bellan, Josette; Radhakrishnan, Senthilkumaran

2013-01-01

Multiphase turbulent flows are encountered in many practical applications including turbine engines or natural phenomena involving particle dispersion. Numerical computations of multiphase turbulent flows are important because they provide a cheaper alternative to performing experiments during an engine design process or because they can provide predictions of pollutant dispersion, etc. Two-phase flows contain millions and sometimes billions of particles. For flows with volumetrically dilute particle loading, the most accurate method of numerically simulating the flow is based on direct numerical simulation (DNS) of the governing equations in which all scales of the flow including the small scales that are responsible for the overwhelming amount of dissipation are resolved. DNS, however, requires high computational cost and cannot be used in engineering design applications where iterations among several design conditions are necessary. Because of high computational cost, numerical simulations of such flows cannot track all these drops. The objective of this work is to quantify the influence of the number of computational drops and grid spacing on the accuracy of predicted flow statistics, and to possibly identify the minimum number, or, if not possible, the optimal number of computational drops that provide minimal error in flow prediction. For this purpose, several Large Eddy Simulation (LES) of a mixing layer with evaporating drops have been performed by using coarse, medium, and fine grid spacings and computational drops, rather than physical drops. To define computational drops, an integer NR is introduced that represents the ratio of the number of existing physical drops to the desired number of computational drops; for example, if NR=8, this means that a computational drop represents 8 physical drops in the flow field. The desired number of computational drops is determined by the available computational resources; the larger NR is, the less computationally intensive is the simulation. A set of first order and second order flow statistics, and of drop statistics are extracted from LES predictions and are compared to results obtained by filtering a DNS database. First order statistics such as Favre averaged stream-wise velocity, Favre averaged vapor mass fraction, and the drop stream-wise velocity, are predicted accurately independent of the number of computational drops and grid spacing. Second order flow statistics depend both on the number of computational drops and on grid spacing. The scalar variance and turbulent vapor flux are predicted accurately by the fine mesh LES only when NR is less than 32, and by the coarse mesh LES reasonably accurately for all NR values. This is attributed to the fact that when the grid spacing is coarsened, the number of drops in a computational cell must not be significantly lower than that in the DNS.

Can Hail and Rain Nucleate Cloud Droplets?

NASA Astrophysics Data System (ADS)

Weiss, S.; Prabhakaran, P.; Krekhov, A.; Pumir, A.; Bodenschatz, E.

2017-12-01

We present results from a laboratory scale moist convection experiment composed of a mixture of pressurized sulphur hexafluoride (SF6 - liquid and vapor phase) and helium (He - gas phase) to mimic the wet (saturated water vapor) and dry components (nitrogen, oxygen etc.) of the earth's atmosphere. We operate the experiments close to critical conditions to allow for homogeneous nucleation of sulphur hexafluoride droplets. The liquid SF6 pool is heated from below and the warm SF6 vapor from the liquid-vapor interface rise and condense underneath the cold top plate. We observe the nucleation of microdroplets in the wake of cold drops falling through the SF6-He atmosphere. Using classical nucleation theory, we show that the nucleation is caused by isobaric cooling of SF6 vapor in the wake of the cold drop. Furthermore, we argue that in an atmospheric cloud, falling hail and large cold raindrops may induce heterogeneous nucleation of microdroplets in their wake. We also observe that under appropriate conditions these microdroplets form a stable horizontal layer, thus separating regions of super and sub-critical saturation.

Can hail and rain nucleate cloud droplets?

NASA Astrophysics Data System (ADS)

Prabhakaran, Prasanth; Weiss, Stephan; Krekhov, Alexei; Pumir, Alain; Bodenschatz, Eberhard

2017-11-01

We present results from a laboratory scale moist convection experiment composed of a mixture of pressurized sulphur hexafluoride (SF6 - liquid and vapor phase) and helium (He - gas phase) to mimic the wet (saturated water vapor) and dry components (nitrogen, oxygen etc.) of the earth's atmosphere. We operate the experiments close to critical conditions to allow for homogeneous nucleation of sulphur hexafluoride droplets. The liquid SF6 pool is heated from below and the warm SF6 vapor from the liquid-vapor interface rise and condense underneath the cold top plate. We observe the nucleation of microdroplets in the wake of cold drops falling through the SF6-He atmosphere. Using classical nucleation theory, we show that the nucleation is caused by isobaric cooling of SF6 vapor in the wake of the cold drop. Furthermore, we argue that in an atmospheric cloud, falling hail and large cold raindrops may induce heterogeneous nucleation of microdroplets in their wake. We also observe that under appropriate conditions these microdroplets form a stable horizontal layer, thus separating regions of super and sub-critical saturation.

Crystallization and preliminary crystallographic analysis of recombinant immunoglobulin G-binding protein from Streptococcus suis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khan, Abdul Hamid; Chu, Fuliang; Feng, Youjun

2008-08-01

Crystallization of recombinant IgG-binding protein expressed in Escherichia coli using the hanging-drop vapour-diffusion method is described. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 38.98, b = 43.94, c = 78.17 Å. Streptococcus suis, an important zoonotic pathogen, expresses immunoglobulin G-binding protein, which is thought to be helpful to the organism in eluding the host defence system. Recombinant IgG-binding protein expressed in Escherichia coli has been crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 38.98, b = 43.94, c =more » 78.17 Å and one molecule in the asymmetric unit. Diffraction data were collected to 2.60 Å resolution.« less

Influence of surface wettability on transport mechanisms governing water droplet evaporation.

PubMed

Pan, Zhenhai; Weibel, Justin A; Garimella, Suresh V

2014-08-19

Prediction and manipulation of the evaporation of small droplets is a fundamental problem with importance in a variety of microfluidic, microfabrication, and biomedical applications. A vapor-diffusion-based model has been widely employed to predict the interfacial evaporation rate; however, its scope of applicability is limited due to incorporation of a number of simplifying assumptions of the physical behavior. Two key transport mechanisms besides vapor diffusion-evaporative cooling and natural convection in the surrounding gas-are investigated here as a function of the substrate wettability using an augmented droplet evaporation model. Three regimes are distinguished by the instantaneous contact angle (CA). In Regime I (CA ≲ 60°), the flat droplet shape results in a small thermal resistance between the liquid-vapor interface and substrate, which mitigates the effect of evaporative cooling; upward gas-phase natural convection enhances evaporation. In Regime II (60 ≲ CA ≲ 90°), evaporative cooling at the interface suppresses evaporation with increasing contact angle and counterbalances the gas-phase convection enhancement. Because effects of the evaporative cooling and gas-phase convection mechanisms largely neutralize each other, the vapor-diffusion-based model can predict the overall evaporation rates in this regime. In Regime III (CA ≳ 90°), evaporative cooling suppresses the evaporation rate significantly and reverses entirely the direction of natural convection induced by vapor concentration gradients in the gas phase. Delineation of these counteracting mechanisms reconciles previous debate (founded on single-surface experiments or models that consider only a subset of the governing transport mechanisms) regarding the applicability of the classic vapor-diffusion model. The vapor diffusion-based model cannot predict the local evaporation flux along the interface for high contact angle (CA ≥ 90°) when evaporative cooling is strong and the temperature gradient along the interface determines the peak local evaporation flux.

Electrochemical measurements on a droplet using gold microelectrodes

NASA Astrophysics Data System (ADS)

Jenabi, Amin; Souri, Asma; Rastkhadiv, Ali

2016-03-01

Facile methods of ion recognition are important for the fabrication of electronic tongue systems. In this work, we demonstrate performing pulsed conductometry on microliter electrolyte droplets dropped on gold microelectrodes vapor deposited on soda lime glass slides. A droplet is dropped between two microelectrodes when a voltage waveform from a preprogramed power supply is applied on them. The temporal variation of the electric current passing through the droplet is recorded, digitized and stored. The obtained data are compared with the database formed out of the previous experiences for the classification of the sample electrolytes. It is shown that the shape of the voltage waveform is the important parameter of the process. We devised a method for the optimization of the voltage waveform profile for obtaining the maximum of discriminating information from the recorded current variations.

Two-phase heat transfer and pressure drop of LNG during saturated flow boiling in a horizontal tube

NASA Astrophysics Data System (ADS)

Chen, Dongsheng; Shi, Yumei

2013-12-01

Two-phase heat transfer and pressure drop of LNG (liquefied natural gas) have been measured in a horizontal smooth tube with an inner diameter of 8 mm. The experiments were conducted at inlet pressures from 0.3 to 0.7 MPa with a heat flux of 8-36 kW m-2, and mass flux of 49.2-201.8 kg m-2 s-1. The effect of vapor quality, inlet pressure, heat flux and mass flux on the heat transfer characteristic are discussed. The comparisons of the experimental data with the predicted value by existing correlations are analyzed. Zou et al. (2010) correlation shows the best accuracy with 24.1% RMS deviation among them. Moreover four frictional pressure drop methods are also chosen to compare with the experimental database.

HYDROCARBON VAPOR DIFFUSION IN INTACT CORE SLEEVES

EPA Science Inventory

The diffusion of 2,2,4-trimethylpentane (TMP) and 2,2,5-trimethylhexane (TMH) vapors put of residually contaminated sandy soil from the U.S. Environmental Protection Agency (EPA) field research site at Traverse City, Michigan, was measured and modeled. The headspace of an intact ...

Fabrication of p(+)-n junction GaAs solar cells by a novel method

NASA Technical Reports Server (NTRS)

Ghandhi, S. K.; Mathur, G.; Rode, H.; Borrego, J. M.

1984-01-01

A novel method for making p(+)-n diffused junction GaAs solar cells, with the formation of a diffusion source, an anti-reflective coating, and a protective cover glass in a single chemical-vapor deposition operation is discussed. Consideration is given to device fabrication and to solar-cell characteristics. The advantages of the technique are that the number of process steps is kept to an absolute minimum, the fabrication procedure is low-cost, and the GaAs surface is protected during the entire operation.

Self-diffusion Coefficient and Structure of Binary n-Alkane Mixtures at the Liquid-Vapor Interfaces.

PubMed

Chilukoti, Hari Krishna; Kikugawa, Gota; Ohara, Taku

2015-10-15

The self-diffusion coefficient and molecular-scale structure of several binary n-alkane liquid mixtures in the liquid-vapor interface regions have been examined using molecular dynamics simulations. It was observed that in hexane-tetracosane mixture hexane molecules are accumulated in the liquid-vapor interface region and the accumulation intensity decreases with increase in a molar fraction of hexane in the examined range. Molecular alignment and configuration in the interface region of the liquid mixture change with a molar fraction of hexane. The self-diffusion coefficient in the direction parallel to the interface of both tetracosane and hexane in their binary mixture increases in the interface region. It was found that the self-diffusion coefficient of both tetracosane and hexane in their binary mixture is considerably higher in the vapor side of the interface region as the molar fraction of hexane goes lower, which is mostly due to the increase in local free volume caused by the local structure of the liquid in the interface region.

Behavior of sulfur mustard in sand, concrete, and asphalt matrices: Evaporation, degradation, and decontamination.

PubMed

Jung, Hyunsook; Choi, Seungki

2017-10-15

The evaporation, degradation, and decontamination of sulfur mustard on environmental matrices including sand, concrete, and asphalt are described. A specially designed wind tunnel and thermal desorber in combination with gas chromatograph (GC) produced profiles of vapor concentration obtained from samples of the chemical agent deposited as a drop on the surfaces of the matrices. The matrices were exposed to the chemical agent at room temperature, and the degradation reactions were monitored and characterized. A vapor emission test was also performed after a decontamination process. The results showed that on sand, the drop of agent spread laterally while evaporating. On concrete, the drop of the agent was absorbed immediately into the matrix while spreading and evaporating. However, the asphalt surface conserved the agent and slowly released parts of the agent over an extended period of time. The degradation reactions of the agent followed pseudo first order behavior on the matrices. Trace amounts of the residual agent present at the surface were also released as vapor after decontamination, posing a threat to the exposed individual and environment.

In vitro comparison of antimicrobial activity of aqueous decoction of Coriandrum sativum, and Dentol Drop with chlorhexidine on Streptococcus mutans

PubMed Central

Moradian, Hamid; Bazargani, Abdollah; Rafiee, Azade; Nazarialam, Ali

2013-01-01

Background and objectives Dental caries is still remained as a major health problem. This problem has created a new interest to search for new antimicrobial agents from various sources including medicinal plants. Since limited data is available so far regarding the antibacterial effect of Coriandrum sativum seed and Dentol Drop against Streptococcus mutans, this study aims to assess this activity. Materials and Methods This experimental study was conducted in Shiraz University of Medical Sciences. In vitro comparison of antimicrobial activity of aqueous decoction of Coriandrum sativum seed and Dentol drop with chlorhexidine against Streptococcus mutans was evaluated using disk diffusion and broth microdilution assays. Positive and negative controls were considered. The data was statistically analyzed by applying Kruskal-Wallis and Tukey post-hoc test to compare the groups using SPSS software (version 17). Results Dentol drop showed a remarkable antibacterial activity, in comparison with chlorhexidine, against S. mutans in the disk diffusion (p value = 0.005), and broth microdilution assays (p value = 0.0001). Based on the results of this study, Coriandrum sativum seed did not posses any antibacterial property. Conclusion Coriandrum sativum seed showed no anti-Streptococcus mutans activity. Dentol drop exhibited a remarkable antibacterial activity against S. mutans when tested in vitro. Dentol drop can be further studied as a preventive measure for dental caries. PMID:24475330

Crystallization and preliminary X-ray crystallographic analysis of the small subunit of the heterodimeric laccase POXA3b from Pleurotus ostreatus

PubMed Central

Ferraroni, Marta; Scozzafava, Andrea; Ullah, Sana; Tron, Thierry; Piscitelli, Alessandra; Sannia, Giovanni

2014-01-01

Laccases are multicopper oxidases of great biotechnological potential. While laccases are generally monomeric glycoproteins, the white-rot fungus Pleurotus ostreatus produces two closely related heterodimeric isoenzymes composed of a large subunit, homologous to the other fungal laccases, and a small subunit. The sequence of the small subunit does not show significant homology to any other protein or domain of known function and consequently its function is unknown. The highest similarity to proteins of known structure is to a putative enoyl-CoA hydratase/isomerase from Acinetobacter baumannii, which shows an identity of 27.8%. Diffraction-quality crystals of the small subunit of the heterodimeric laccase POXA3b (sPOXA3b) from P. ostreatus were obtained using the sitting-drop vapour-diffusion method at 294 K from a solution consisting of 1.8 M sodium formate, 0.1 M Tris–HCl pH 8.5. The crystals belonged to the tetragonal space group P41212 or P43212, with unit-cell parameters a = 126.6, c = 53.9 Å. The asymmetric unit contains two molecules related by a noncrystallographic twofold axis. A complete data set extending to a maximum resolution of 2.5 Å was collected at 100 K using a wavelength of 1.140 Å. PMID:24419623

Crystallization of Spätzle, a cystine-knot protein involved in embryonic development and innate immunity in Drosophila melanogaster

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoffmann, Anita; Neumann, Piotr; Schierhorn, Angelika

2008-08-01

Crystallization of the cystine-knot protein Spätzle occurred following serendipitous limited degradation of the pro-Spätzle propeptide during the crystallization experiment. The Spätzle protein is involved in both the definition of the dorsal–ventral axis during embryonic development and in the adult innate immune response. The disulfide-linked dimeric cystine-knot protein has been expressed as a proprotein in inclusion bodies in Escherichia coli and refolded in vitro by rapid dilution. Initial orthorhombic crystals that diffracted to 7 Å resolution were obtained after three months by the sitting-drop vapour-diffusion method. Optimization of the crystallization conditions resulted in orthorhombic crystals (space group P2{sub 1}2{sub 1}2{sub 1},more » with unit-cell parameters a = 53.0, b = 59.2, c = 62.5 Å) that diffracted to 2.8 Å resolution in-house. The small volume of the asymmetric unit indicated that it was not possible for the crystals to contain the complete pro-Spätzle dimer. Mass spectrometry, N-terminal sequencing and Western-blot analysis revealed that the crystals contained the C-terminal disulfide-linked cystine-knot dimer. Comparison of various crystallization experiments indicated that degradation of the N-terminal prodomain was dependent on the buffer conditions.« less

Diffusion mechanisms in chemical vapor-deposited iridium coated on chemical vapor-deposited rhenium

NASA Technical Reports Server (NTRS)

Hamilton, J. C.; Yang, N. Y. C.; Clift, W. M.; Boehme, D. R.; Mccarty, K. F.; Franklin, J. E.

1992-01-01

Radiation-cooled rocket thruster chambers have been developed which use CVD Re coated with CVD Ir on the interior surface that is exposed to hot combustion gases. The Ir serves as an oxidation barrier which protects the structural integrity-maintaining Re at elevated temperatures. The diffusion kinetics of CVD materials at elevated temperatures is presently studied with a view to the prediction and extension of these thrusters' performance limits. Line scans for Ir and Re were fit on the basis of a diffusion model, in order to extract relevant diffusion constants; the fastest diffusion process is grain-boundary diffusion, where Re diffuses down grain boundaries in the Ir overlayer.

Effect of Marangoni Convection on Surfactant Transfer Between the Drop Connected to the Reservoir and Surrounding Liquid

NASA Astrophysics Data System (ADS)

Kostarev, K.; Denisova, M.; Shmyrov, A.

2018-03-01

The paper presents the results of comparative investigation of the interaction between the capillary and buoyant mechanisms of motion in a problem of surfactant mass transfer between an insoluble drop and surrounding fluid under different gravity conditions. The research was performed for the drop that is coupled with the reservoir filled with a source mixture through a long thin tube (needle). Visualization of the flow patterns and concentration fields has shown that surfactant diffusion from the needle at normal gravity leads to the onset of the oscillatory mode of the capillary convection in the drop. It has been found that the frequency of the Marangoni convection outbursts, the lifetime of the oscillatory flow modes and the amount of the source mixture involved in the process of mass transfer depend on the drop size and initial concentration of the surfactant. The obtained results are compared with the cases of surfactant diffusion from the isolated drop under terrestrial conditions and from the drop coupled with reservoir in microgravity. Additionally, a series of experiments were performed to investigate diffusion of a surfactant from the surrounding solution into a drop.

Vapor Bubbles

NASA Astrophysics Data System (ADS)

Prosperetti, Andrea

2017-01-01

This article reviews the fundamental physics of vapor bubbles in liquids. Work on bubble growth and condensation for stationary and translating bubbles is summarized and the differences with bubbles containing a permanent gas stressed. In particular, it is shown that the natural frequency of a vapor bubble is proportional not to the inverse radius, as for a gas bubble, but to the inverse radius raised to the power 2/3. Permanent gas dissolved in the liquid diffuses into the bubble with strong effects on its dynamics. The effects of the diffusion of heat and mass on the propagation of pressure waves in a vaporous bubbly liquid are discussed. Other topics briefly touched on include thermocapillary flow, plasmonic nanobubbles, and vapor bubbles in an immiscible liquid.

Water vapor diffusion membranes

NASA Technical Reports Server (NTRS)

Holland, F. F., Jr.; Smith, J. K.

1974-01-01

The program is reported, which was designed to define the membrane technology of the vapor diffusion water recovery process and to test this technology using commercially available or experimental membranes. One membrane was selected, on the basis of the defined technology, and was subjected to a 30-day demonstration trial.

Combustion of liquid-fuel droplets in supercritical conditions

NASA Technical Reports Server (NTRS)

Shuen, J. S.; Yang, Vigor; Hsaio, C. C.

1992-01-01

A comprehensive analysis of liquid-fuel droplet combustion in both subcritical and supercritical environments has been conducted. The formulation is based on the complete conservation equations for both gas and liquid phases, and accommodates variable thermophysical properties, finite-rate chemical kinetics, and a full treatment of liquid-vapor phase equilibrium at the drop surface. The governing equations and associated interfacial boundary conditions are solved numerically using a fully coupled, implicit scheme with the dual time-stepping integration technique. The model is capable of treating the entire droplet history, including the transition from the subcritical to supercritical state. As a specific example, the combustion of n-pentane fuel droplets in air is studied for pressures in the range of 5-140 atm. Results indicate that the ambient gas pressure exerts significant control of droplet gasification and burning processes through its influence on fluid transport, gas-liquid interfacial thermodynamics, and chemical reactions. The droplet gasification rate increases progressively with pressure. However, the data for the overall burnout time exhibit a considerable change in the combustion mechanism at the critical pressure, mainly as a result of reduced mass diffusivity and latent heat of vaporization with increased pressure.

An evaporation model of colloidal suspension droplets

NASA Astrophysics Data System (ADS)

Sartori, Silvana; Li\\ Nán, Amable; Lasheras, Juan C.

2009-11-01

Colloidal suspensions of polymers in water or other solvents are widely used in the pharmaceutical industry to coat tablets with different agents. These allow controlling the rate at which the drug is delivered, taste or physical appearance. The coating is performed by simultaneously spraying and drying the tablets with the colloidal suspension at moderately high temperatures. The spreading of the coating on the pills surface depends on the droplet Webber and Reynolds numbers, angle of impact, but more importantly on the rheological properties of the drop. We present a model for the evaporation of a colloidal suspension droplet in a hot air environment with temperatures substantially lower than the boiling temperature of the carrier fluid. As the liquid vaporizes from the surface, a compacting front advances into the droplet faster than the liquid surface regresses, forming a shell of a porous medium where the particles reach their maximum packing density. While the surface regresses, the evaporation rate is determined by both the rate at which heat is transported to the droplet surface and the rate at which liquid vapor is diffused away from it. This regime continues until the compacting front reaches the center of the droplet, at which point the evaporation rate is drastically reduced.

Droplet Vaporization In A Levitating Acoustic Field

NASA Technical Reports Server (NTRS)

Ruff, G. A.; Liu, S.; Ciobanescu, I.

2003-01-01

Combustion experiments using arrays of droplets seek to provide a link between single droplet combustion phenomena and the behavior of complex spray combustion systems. Both single droplet and droplet array studies have been conducted in microgravity to better isolate the droplet interaction phenomena and eliminate or reduce the effects of buoyancy-induced convection. In most experiments involving droplet arrays, the droplets are supported on fibers to keep them stationary and close together before the combustion event. The presence of the fiber, however, disturbs the combustion process by introducing a source of heat transfer and asymmetry into the configuration. As the number of drops in a droplet array increases, supporting the drops on fibers becomes less practical because of the cumulative effect of the fibers on the combustion process. To eliminate the effect of the fiber, several researchers have conducted microgravity experiments using unsupported droplets. Jackson and Avedisian investigated single, unsupported drops while Nomura et al. studied droplet clouds formed by a condensation technique. The overall objective of this research is to extend the study of unsupported drops by investigating the combustion of well-characterized drop clusters in a microgravity environment. Direct experimental observations and measurements of the combustion of droplet clusters would provide unique experimental data for the verification and improvement of spray combustion models. In this work, the formation of drop clusters is precisely controlled using an acoustic levitation system so that dilute, as well as dense clusters can be created and stabilized before combustion in microgravity is begun. While the low-gravity test facility is being completed, tests have been conducted in 1-g to characterize the effect of the acoustic field on the vaporization of single and multiple droplets. This is important because in the combustion experiment, the droplets will be formed and levitated prior to ignition. Therefore, the droplets will begin to vaporize in the acoustic field thus forming the "initial conditions" for the combustion process. Understanding droplet vaporization in the acoustic field of this levitator is a necessary step that will help to interpret the experimental results obtained in low-gravity.

Development of speckle-free channel-cut crystal optics using plasma chemical vaporization machining for coherent x-ray applications.

PubMed

Hirano, Takashi; Osaka, Taito; Sano, Yasuhisa; Inubushi, Yuichi; Matsuyama, Satoshi; Tono, Kensuke; Ishikawa, Tetsuya; Yabashi, Makina; Yamauchi, Kazuto

2016-06-01

We have developed a method of fabricating speckle-free channel-cut crystal optics with plasma chemical vaporization machining, an etching method using atmospheric-pressure plasma, for coherent X-ray applications. We investigated the etching characteristics to silicon crystals and achieved a small surface roughness of less than 1 nm rms at a removal depth of >10 μm, which satisfies the requirements for eliminating subsurface damage while suppressing diffuse scattering from rough surfaces. We applied this method for fabricating channel-cut Si(220) crystals for a hard X-ray split-and-delay optical system and confirmed that the crystals provided speckle-free reflection profiles under coherent X-ray illumination.

Method to produce large, uniform hollow spherical shells

DOEpatents

Hendricks, C.D.

1983-09-26

The invention is a method to produce large uniform hollow spherical shells by (1) forming uniform size drops of heat decomposable or vaporizable material, (2) evaporating the drops to form dried particles, (3) coating the dried particles with a layer of shell forming material and (4) heating the composite particles to melt the outer layer and to decompose or vaporize the inner particle to form an expanding inner gas bubble. The expanding gas bubble forms the molten outer layer into a shell of relatively large diameter. By cycling the temperature and pressure on the molten shell, nonuniformities in wall thickness can be reduced. The method of the invention is utilized to produce large uniform spherical shells, in the millimeter to centimeter diameter size range, from a variety of materials and of high quality, including sphericity, concentricity and surface smoothness, for use as laser fusion or other inertial confinement fusion targets as well as other applications.

Method and apparatus for monitoring two-phase flow. [PWR

DOEpatents

Sheppard, J.D.; Tong, L.S.

1975-12-19

A method and apparatus for monitoring two-phase flow is provided that is particularly related to the monitoring of transient two-phase (liquid-vapor) flow rates such as may occur during a pressurized water reactor core blow-down. The present invention essentially comprises the use of flanged wire screens or similar devices, such as perforated plates, to produce certain desirable effects in the flow regime for monitoring purposes. One desirable effect is a measurable and reproducible pressure drop across the screen. The pressure drop can be characterized for various known flow rates and then used to monitor nonhomogeneous flow regimes. Another useful effect of the use of screens or plates in nonhomogeneous flow is that such apparatus tends to create a uniformly dispersed flow regime in the immediate downstream vicinity. This is a desirable effect because it usually increases the accuracy of flow rate measurements determined by conventional methods.

Terraced spreading of simple liquids on solid surfaces

NASA Technical Reports Server (NTRS)

Yang, Ju-Xing; Koplik, Joel; Banavar, Jayanth R.

1992-01-01

We have studied the spreading of liquid drops on a solid surface by molecular-dynamics simulations of coexisting three-phase Lennard-Jones systems of liquid, vapor, and solid. We consider both spherically symmetric atoms and diatomic molecules, and a range of interaction strengths. As the attraction between liquid and solid increases we observe a smooth transition in spreading regimes, from partial to complete to terraced wetting. In the terraced case, where distinct monomolecular layers spread with different velocities, the layers are ordered but not solid, with substantial molecular diffusion both within and between layers. The quantitative behavior resembles recent experimental findings, but the detailed dynamics differ. In particular, the layers exhibit an unusual spreading law, where their radii vary in time as R-squared approximately equal to log10t, which disagrees with experiments on polymeric liquids as well as recent calculations.

Numerical Simulation of Hydrodynamics of a Heavy Liquid Drop Covered by Vapor Film in a Water Pool

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ma, W.M.; Yang, Z.L.; Giri, A.

2002-07-01

A numerical study on the hydrodynamics of a droplet covered by vapor film in water pool is carried out. Two level set functions are used as to implicitly capture the interfaces among three immiscible fluids (melt-drop, vapor and coolant). This approach leaves only one set of conservation equations for the three phases. A high-order Navier-Stokes solver, called Cubic-Interpolated Pseudo-Particle (CIP) algorithm, is employed in combination with level set approach, which allows large density ratios (up to 1000), surface tension and jump in viscosity. By this calculation, the hydrodynamic behavior of a melt droplet falling into a volatile coolant is simulated,more » which is of great significance to reveal the mechanism of steam explosion during a hypothetical severe reactor accident. (authors)« less

Controlled In Meso Phase Crystallization – A Method for the Structural Investigation of Membrane Proteins

PubMed Central

Kubicek, Jan; Schlesinger, Ramona; Baeken, Christian; Büldt, Georg; Schäfer, Frank; Labahn, Jörg

2012-01-01

We investigated in meso crystallization of membrane proteins to develop a fast screening technology which combines features of the well established classical vapor diffusion experiment with the batch meso phase crystallization, but without premixing of protein and monoolein. It inherits the advantages of both methods, namely (i) the stabilization of membrane proteins in the meso phase, (ii) the control of hydration level and additive concentration by vapor diffusion. The new technology (iii) significantly simplifies in meso crystallization experiments and allows the use of standard liquid handling robots suitable for 96 well formats. CIMP crystallization furthermore allows (iv) direct monitoring of phase transformation and crystallization events. Bacteriorhodopsin (BR) crystals of high quality and diffraction up to 1.3 Å resolution have been obtained in this approach. CIMP and the developed consumables and protocols have been successfully applied to obtain crystals of sensory rhodopsin II (SRII) from Halobacterium salinarum for the first time. PMID:22536388

Pressure Profiles in a Loop Heat Pipe Under Gravity Influence

NASA Technical Reports Server (NTRS)

Ku, Jentung

2015-01-01

During the operation of a loop heat pipe (LHP), the viscous flow induces pressure drops in various elements of the loop. The total pressure drop is equal to the sum of pressure drops in vapor grooves, vapor line, condenser, liquid line and primary wick, and is sustained by menisci at liquid and vapor interfaces on the outer surface of the primary wick in the evaporator. The menisci will curve naturally so that the resulting capillary pressure matches the total pressure drop. In ground testing, an additional gravitational pressure head may be present and must be included in the total pressure drop when LHP components are placed in a non-planar configuration. Under gravity-neutral and anti-gravity conditions, the fluid circulation in the LHP is driven solely by the capillary force. With gravity assist, however, the flow circulation can be driven by the combination of capillary and gravitational forces, or by the gravitational force alone. For a gravity-assist LHP at a given elevation between the horizontal condenser and evaporator, there exists a threshold heat load below which the LHP operation is gravity driven and above which the LHP operation is capillary force and gravity co-driven. The gravitational pressure head can have profound effects on the LHP operation, and such effects depend on the elevation, evaporator heat load, and condenser sink temperature. This paper presents a theoretical study on LHP operations under gravity neutral, anti-gravity, and gravity-assist modes using pressure diagrams to help understand the underlying physical processes. Effects of the condenser configuration on the gravitational pressure head and LHP operation are also discussed.

Pressure Profiles in a Loop Heat Pipe under Gravity Influence

NASA Technical Reports Server (NTRS)

Ku, Jentung

2015-01-01

During the operation of a loop heat pipe (LHP), the viscous flow induces pressure drops in various elements of the loop. The total pressure drop is equal to the sum of pressure drops in vapor grooves, vapor line, condenser, liquid line and primary wick, and is sustained by menisci at liquid and vapor interfaces on the outer surface of the primary wick in the evaporator. The menisci will curve naturally so that the resulting capillary pressure matches the total pressure drop. In ground testing, an additional gravitational pressure head may be present and must be included in the total pressure drop when LHP components are placed in a non-planar configuration. Under gravity-neutral and anti-gravity conditions, the fluid circulation in the LHP is driven solely by the capillary force. With gravity assist, however, the flow circulation can be driven by the combination of capillary and gravitational forces, or by the gravitational force alone. For a gravity-assist LHP at a given elevation between the horizontal condenser and evaporator, there exists a threshold heat load below which the LHP operation is gravity driven and above which the LHP operation is capillary force and gravity co-driven. The gravitational pressure head can have profound effects on the LHP operation, and such effects depend on the elevation, evaporator heat load, and condenser sink temperature. This paper presents a theoretical study on LHP operations under gravity-neutral, anti-gravity, and gravity-assist modes using pressure diagrams to help understand the underlying physical processes. Effects of the condenser configuration on the gravitational pressure head and LHP operation are also discussed.

Properties of liquid Ti alloys from electrostatic levitation experiments and simulation

NASA Astrophysics Data System (ADS)

Novak, Brian; Raush, Jonathan; Zhang, Xiaoman; Moldovan, Dorel; Meng, Wenjin; Guo, Shengmin

Accurate thermophysical property data for liquid metals and alloys are important for the development of realistic simulations of laser-based 3D printing processes. We are using the container-less electrostatic levitation (ESL) method, molecular simulation, and CALPHAD calculations to obtain such data for Ti alloys. We performed vacuum ESL measurements of viscosity and surface tension with an oscillating drop technique at NASA MSFC on molten elemental Ti, Ti-xAl binaries (x = 0-10 wt%), Ti-6Al-4V, and Ti-6Al-4V-10Mo which showed improved mechanical properties compared with traditional β Ti alloys. We also used classical molecular simulations to obtain viscosities and surface tensions for Ti-xAl. Pair distribution functions, diffusivities, and vapor pressures were also obtained from simulations. The simulated viscosities and surface tensions for pure Ti agree well with the ESL data while the Ti-xAl viscosities have the same trends as the ESL data, but not quantitative agreement. Chemical activity and Gibbs free energy of Ti-10Al were generated using the CALPHAD technique and compared to experimental values. Supported by the National Science Foundation through cooperative agreement OIA-1541079 and the Louisiana Board of Regents.

Purification, crystallization and preliminary X-ray diffraction studies on goat (Capra hircus) hemoglobin - a low oxygen affinity species.

PubMed

Moorthy, Ponnuraj Sathya; Neelagandan, Kamariah; Balasubramanian, Moovarkumudalvan; Ponnuswamy, Mondikalipudur Nanjappa Gounder

2009-01-01

Hemoglobin is a vital protein present in almost all higher species. It is a transport protein involved in carrying oxygen from lungs to tissues and carbon dioxide back to lungs by an intrinsically coordinated manner. Even though a good amount of work has been carried out in this direction there exists scarcity of structural insight on low oxygen affinity species. Attempts are being made to unravel the structural insight of this low oxygen affinity species. Goat blood plasma was collected, treated with EDTA to avoid blood clotting and purification was accomplished using DEAE-anion chromatographic column. The goat hemoglobin was crystallized using 50mM of phosphate buffer at pH 6.7 with 1M NaCl and PEG 3350 as precipitant by hanging drop vapor diffusion method. Crystals obtained are screened and suitable crystals are taken for data collection using mar345dtb as image plate detector system. Goat hemoglobin crystal diffracted up to 2.61 A resolution. Goat hemoglobin crystallizes in orthorhombic space group P212(1)2(1) as a whole biological molecule in the asymmetric unit with cell dimensions a=53.568A, b=67.365A, c=154.183A.

Simulation of the early startup period of high-temperature heat pipes from the frozen state by a rarefied vapor self-diffusion model

NASA Technical Reports Server (NTRS)

Cao, Y.; Faghri, A.

1993-01-01

The heat pipe startup process is described physically and is divided into five periods for convenience of analysis. The literature survey revealed that none of the previous attempts to simulate the heat pipe startup process numerically were successful, since the rarefied vapor flow in the heat pipe was not considered. Therefore, a rarefied vapor self-diffusion model is proposed, and the early startup periods, in which the rarefied vapor flow is dominant within the heat pipe, are first simulated numerically. The numerical results show that large vapor density gradients existed along the heat pipe length, and the vapor flow reaches supersonic velocities when the density is extremely low. The numerical results are compared with the experimental data of the early startup period with good agreement.

Reduction of furnace temperature in ultra long carbon nanotube growth by plasmonic excitation of electron Fermi gas of catalytic nanocluster

DOE Office of Scientific and Technical Information (OSTI.GOV)

Saeidi, Mohammadreza, E-mail: Saeidi.mr@gmail.com, E-mail: m.saeidi@shahed.ac.ir

2016-06-15

In this paper, a novel physical method is presented to reduce the temperature of the furnace and prevent loss of thermal energy in ultra long carbon nanotube (CNT) growth process by catalytic chemical vapor deposition. This method is based on the plasmonic excitation of electron Fermi gas of catalytic nanocluster sitting at tip end of CNT by ultraviolet (UV) irradiation. Physical concepts of the method are explained in detail. The results of applying the presented method consequences to an appropriate tip-growth mechanism of the ultra long CNTs show that, in the presence of plasmonic excitation, the growth rate of themore » CNT is enhanced. Demonstration of temperature reduction and simultaneous increase in CNT length by UV irradiation with the proper frequency are the most important and practical result of the paper. All results are interpreted and discussed.« less

Water vapor diffusion membrane development

NASA Technical Reports Server (NTRS)

Tan, M. K.

1977-01-01

An application of the water vapor diffusion technique is examined whereby the permeated water vapor is vented to space vacuum to alleviate on-board waste storage and provide supplemental cooling. The work reported herein deals primarily with the vapor diffusion-heat rejection (VD-HR) as it applies to the Space Shuttle. A stack configuration was selected, designed and fabricated. An asymmetric cellulose acetate membrane, used in reverse osmosis application was selected and a special spacer was designed to enhance mixing and promote mass transfer. A skid-mount unit was assembled from components used in the bench unit although no attempt was made to render it flight-suitable. The operating conditions of the VD-HR were examined and defined and a 60-day continuous test was carried out. The membranes performed very well throughout the test; no membrane rupture and no unusual flux decay was observed. In addition, a tentative design for a flight-suitable VD-HR unit was made.

Condensation of wet vapors in turbines

NASA Technical Reports Server (NTRS)

Kothman, R. E.

1970-01-01

Computer program predicts condensation point in wet vapor turbines and analyzes subsequent nucleation and growth processes to determine both moisture content and drop size and number distribution as a function of position. Program includes effects of molecular association on condensation and flow processes and handles both subsonic and supersonic flows.

Energy, volatile production, and climatic effects of the Chicxulub Cretaceous/Tertiary impact

NASA Technical Reports Server (NTRS)

Pope, K. O.; Baines, K. H.; Ocampo, A. C.; Ivanov, B. A.

1997-01-01

A comprehensive analysis of volatiles in the Chicxulub impact strongly supports the hypothesis that impact-generated sulfate aerosols caused over a decade of global cooling, acid rain, and disruption of ocean circulation, which contributed to the mass extinction at the Cretaceous/Tertiary (K/T) boundary. The crater size, meteoritic content of the K/T boundary clay, and impact models indicate that the Chicxulub crater was formed by a short period comet or an asteroid impact that released 0.7-3.4 x 10(31) ergs of energy. Impact models and experiments combined with estimates of volatiles in the projectile and target rocks predict that over 200 gigatons (Gt) each of SO2 and water vapor, and over 500 Gt of CO2, were globally distributed in the stratosphere by the impact. Additional volatiles may have been produced on a global or regional scale that formed sulfate aerosols rapidly in cooler parts of the vapor plume, causing an early, intense pulse of sulfuric acid rain. Estimates of the conversion rate of stratospheric SO2 and water vapor to sulfate aerosol, based on volcanic production of sulfate aerosols, coupled with calculations of diffusion, coagulation, and sedimentation, demonstrate that the 200 Gt stratospheric SO2 and water vapor reservoir would produce sulfate aerosols for 12 years. These sulfate aerosols caused a second pulse of acid rain that was global. Radiative transfer modeling of the aerosol clouds demonstrates (1) that if the initial rapid pulse of sulfate aerosols was global, photosynthesis may have been shut down for 6 months and (2) that for the second prolonged aerosol cloud, solar transmission dropped 80% by the end of first year and remained 50% below normal for 9 years. As a result, global average surface temperatures probably dropped between 5 degrees and 31 degrees K, suggesting that global near-freezing conditions may have been reached. Impact-generated CO2 caused less than 1 degree K greenhouse warming and therefore was insignificant compare to the sulfate cooling. The magnitude of sulfate cooling depends largely upon the rate of ocean mixing as surface waters cool, sink, and are replaced by upwelling of deep ocean water. This upwelling apparently drastically altered ocean stratification and circulation, which may explain the global collapse of the delta 13C gradient between surface and deep ocean waters at the K/T boundary.

Approximation of effective moisture-diffusion coefficient to characterize performance of a barrier coating

NASA Astrophysics Data System (ADS)

Nagai, Shingo

2013-11-01

We report estimation of the effective diffusion coefficient of moisture through a barrier coating to develop an encapsulation technology for the thin-film electronics industry. This investigation targeted a silicon oxide (SiOx) film that was deposited on a plastic substrate by a large-process-area web coater. Using the finite difference method based on diffusion theory, our estimation of the effective diffusion coefficient of a SiOx film corresponded to that of bulk glass that was previously reported. This result suggested that the low diffusivities of barrier films can be obtained on a mass-production level in the factory. In this investigation, experimental observations and mathematical confirmation revealed the limit of the water vapor transmission rate on the single barrier coating.

Thermal-hydraulic behaviors of vapor-liquid interface due to arrival of a pressure wave

DOE Office of Scientific and Technical Information (OSTI.GOV)

Inoue, Akira; Fujii, Yoshifumi; Matsuzaki, Mitsuo

In the vapor explosion, a pressure wave (shock wave) plays a fundamental role for triggering, propagation and enhancement of the explosion. Energy of the explosion is related to the magnitude of heat transfer rate from hot liquid to cold volatile one. This is related to an increasing rate of interface area and to an amount of transient heat flux between the liquids. In this study, the characteristics of transient heat transfer and behaviors of vapor film both on the platinum tube and on the hot melt tin drop, under same boundary conditions have been investigated. It is considered that theremore » exists a fundamental mechanism of the explosion in the initial expansion process of the hot liquid drop immediately after arrival of pressure wave. The growth rate of the vapor film is much faster on the hot liquid than that on the solid surface. Two kinds of roughness were observed, one due to the Taylor instability, by rapid growth of the explosion bubble, and another, nucleation sites were observed at the vapor-liquid interface. Based on detailed observation of early stage interface behaviors after arrival of a pressure wave, the thermal fragmentation mechanism is proposed.« less

Laser diagnostics for microgravity droplet studies

NASA Technical Reports Server (NTRS)

Winter, Michael

1993-01-01

Rapid advances have recently been made in numerical simulation of droplet combustion under microgravity conditions, while experimental capabilities remain relatively primitive. Calculations can now provide detailed information on mass and energy transport, complex gas-phase chemistry, multi-component molecular diffusion, surface evaporation and heterogeneous reaction, which provides a clearer picture of both quasi-steady as well as dynamic behavior of droplet combustion. Experiments concerning these phenomena typically result in pictures of the burning droplets, and the data therefrom describe droplet surface regression along with flame and soot shell position. With much more precise, detailed, experimental diagnostics, significant gains could be made on the dynamics and flame structural changes which occur during droplet combustion. Since microgravity experiments become increasingly more expensive as they progress from drop towers and flights to spaceborne experiments, there is a great need to maximize the information content from these experiments. Sophisticated measurements using laser diagnostics on individual droplets and combustion phenomena are now possible. These include measuring flow patterns and temperature fields within droplets, vaporization rates and vaporization enhancement, radical species profiling in flames and gas-phase flow-tagging velocimetry. Although these measurements are sophisticated, they have undergone maturation to the degree where with some development, they are applicable to studies of microgravity droplet combustion. This program beginning in September of 1992, will include a series of measurements in the NASA Learjet, KC-135 and Drop Tower facilities for investigating the range of applicability of these diagnostics while generating and providing fundamental data to ongoing NASA research programs in this area. This program is being conducted in collaboration with other microgravity investigators and is aimed toward supplementing their experimental efforts.

Modeling studies of gas movement and moisture migration at Yucca Mountain, Nevada

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsang, Y.W.; Pruess, K.

1991-06-01

Modeling studies on moisture redistribution processes that are mediated by gas phase flow and diffusion have been carried out. The problem addressed is the effect of a lowered humidity of the soil gas at the land surface on moisture removal from Yucca Mountain, the potential site for a high-level nuclear waste repository. At the land surface, humid formation gas contacts much drier atmospheric air. Near this contact, the humidity of the soil gas may be considerably lower than at greater depth, where the authors expect equilibrium with the liquid phase and close to 100% humidity. The lower relative humidity ofmore » the soil gas may be modeled by imposing, at the land surface, an additional negative capillary suction corresponding to vapor pressure lowering according to Kelvin`s Equation, thus providing a driving force for the upward movement of moisture in both the vapor and liquid phases. Sensitivity studies show that moisture removal from Yucca Mountain arising from the lowered-relative-humidity boundary condition is controlled by vapor diffusion. There is much experimental evidence in the soil literature that diffusion of vapor is enhanced due to pore-level phase change effects by a few orders of magnitude. Modeling results presented here will account for this enhancement in vapor diffusion.« less

Direct molecular diffusion and micro-mixing for rapid dewatering of LiBr solution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bigham, S; Isfahani, RN; Moghaddam, S

2014-03-01

A slow molecular diffusion rate often limits the desorption process of an absorbate molecule from a liquid absorbent. To enhance the desorption rate, the absorbent is often boiled to increase the liquid vapor interfacial area. However, the growth of bubbles generated during the nucleate boiling process still remains mass-diffusion limited. Here, it is shown that a desorption rate higher than that of boiling can be achieved, if the vapor absorbent interface is continuously replenished with the absorbate-rich solution to limit the concentration boundary layer growth. The study is conducted in a LiBr-water-solution, in which the water molecules' diffusion rate ismore » quite slow. The manipulation of the vapor solution interface concentration distribution is enabled by the mechanical confinement of the solution flow within microchannels, using a hydrophobic vapor-venting membrane and the implementation of microstructures on the flow channel's bottom wall. The microstructures stretch and fold the laminar streamlines within the solution film and produce vortices. The vortices continuously replace the concentrated solution at the vapor solution interface with the water-rich solution brought from the bottom and middle of the flow channel. The physics of the process is described using a combination of experimental and numerical studies. Published by Elsevier Ltd.« less

Calculation of nanodrop profile from fluid density distribution.

PubMed

Berim, Gersh O; Ruckenstein, Eli

2016-05-01

Two approaches are examined, which can be used to determine the drop profile from the fluid density distributions (FDDs) obtained on the basis of microscopic theories. For simplicity, only two-dimensional (cylindrical, or axisymmetrical) distributions are examined and it is assumed that the fluid is either in contact with a smooth solid or separated from the smooth solid by a lubricating liquid film. The first approach is based on the sharp-kink interface approximation in which the density of the liquid inside and the density of the vapor outside the drop are constant with the exception of the surface layer of the drop where the density is different from the above ones. In this case, the drop profile was calculated by minimizing the total potential energy of the system. The second approach is based on a nonuniform FDD obtained either by the density functional theory or molecular dynamics simulations. To determine the drop profile from such an FDD, which does not contain sharp interfaces, three procedures can be used. In the first two procedures, P1 and P2, the one-dimensional FDDs along straight lines which are parallel to the surface of the solid are extracted from the two-dimensional FDD. Each of those one-dimensional FDDs has a vapor-liquid interface at which the fluid density changes from vapor-like to liquid-like values. Procedure P1 uses the locations of the equimolar dividing surfaces for the one-dimensional FDDs as points of the drop profile. Procedure P2 is based on the assumption that the fluid density is constant on the surface of the drop, that density being selected either arbitrarily or as a fluid density at the location of the equimolar dividing surface for one of the one-dimensional FDDs employed in procedure P1. In the third procedure, P3, which is suggested for the first time in this paper, the one-dimensional FDDs are taken along the straight lines passing through a selected point inside the drop (radial line). Then, the drop profile is calculated like in procedure P1. It is shown, that procedure P3 provides a drop profile which is more reasonable than the other ones. Relationship of the discussed procedures to those used in image analysis is briefly discussed. Copyright © 2016 Elsevier B.V. All rights reserved.

In situ growth of ceramic quantum dots in polyaniline host via water vapor flow diffusion as potential electrode materials for energy applications

NASA Astrophysics Data System (ADS)

Mombrú, Dominique; Romero, Mariano; Faccio, Ricardo; Castiglioni, Jorge; Mombrú, Alvaro W.

2017-06-01

In situ preparation of polyaniline-ceramic nanocomposites has recently demonstrated that the electrical properties are highly improved with respect to the typical ex situ preparations. In this report, we present for the first time, to the best of our knowledge, the in situ growth of titanium oxide quantum dots in polyaniline host via water vapor flow diffusion as an easily adaptable route to prepare other ceramic-polymer nanocomposites. The main relevance of this method is the possibility to prepare ceramic quantum dots from alkoxide precursors using water vapor flow into any hydrophobic polymer host and to achieve good homogeneity and size-control. In addition, we perform full characterization by means of high-resolution transmission electron microscopy, X-ray powder diffraction, small angle X-ray scattering, thermogravimetric and calorimetric analyses, confocal Raman microscopy and impedance spectroscopy analyses. The presence of the polymer host and interparticle Coulomb repulsive interactions was evaluated as an influence for the formation of 3-8 nm equally-sized quantum dots independently of the concentration. The polyaniline polaron population showed an increase for the quantum dots diluted regime and the suppression at the concentrated regime, ascribed to the formation of chemical bonds at the interface, which was confirmed by theoretical simulations. In agreement with the previous observation, the in situ growth of ceramic quantum dots in polyaniline host via water vapor flow diffusion could be very useful as a novel approach to prepare electrode materials for energy conversion and storage applications.

Vapor condensation onto a non-volatile liquid drop

DOE Office of Scientific and Technical Information (OSTI.GOV)

Inci, Levent; Bowles, Richard K., E-mail: richard.bowles@usask.ca

2013-12-07

Molecular dynamics simulations of miscible and partially miscible binary Lennard–Jones mixtures are used to study the dynamics and thermodynamics of vapor condensation onto a non-volatile liquid drop in the canonical ensemble. When the system volume is large, the driving force for condensation is low and only a submonolayer of the solvent is adsorbed onto the liquid drop. A small degree of mixing of the solvent phase into the core of the particles occurs for the miscible system. At smaller volumes, complete film formation is observed and the dynamics of film growth are dominated by cluster-cluster coalescence. Mixing into the coremore » of the droplet is also observed for partially miscible systems below an onset volume suggesting the presence of a solubility transition. We also develop a non-volatile liquid drop model, based on the capillarity approximations, that exhibits a solubility transition between small and large drops for partially miscible mixtures and has a hysteresis loop similar to the one observed in the deliquescence of small soluble salt particles. The properties of the model are compared to our simulation results and the model is used to study the formulation of classical nucleation theory for systems with low free energy barriers.« less

Dynamics of ions in a water drop using the AMOEBA polarizable force field

NASA Astrophysics Data System (ADS)

Thaunay, Florian; Ohanessian, Gilles; Clavaguéra, Carine

2017-03-01

Various ions carrying a charge from -2 to +3 were confined in a drop of 100 water molecules as a way to model coordination properties inside the cluster and at the interface. The behavior of the ions has been followed by molecular dynamics with the AMOEBA polarizable force field. Multiply charged ions and small singly charged ions are found to lie inside the droplet, while bigger monovalent ions sit near the surface. The results provide a coherent picture of average structural properties as well as residence times for which a general trend is proposed, especially for the anions.

Electrowetting on semiconductors

NASA Astrophysics Data System (ADS)

Palma, Cesar; Deegan, Robert

2015-01-01

Applying a voltage difference between a conductor and a sessile droplet sitting on a thin dielectric film separating it from the conductor will cause the drop to spread. When the conductor is a good metal, the change of the drop's contact angle due to the voltage is given by the Young-Lippmann (YL) equation. Here, we report experiments with lightly doped, single crystal silicon as the conductive electrode. We derive a modified YL equation that includes effects due to the semiconductor and contact line pinning. We show that light induces a non-reversible wetting transition, and that our model agrees well with our experimental results.

Growth Mechanism Studies of ZnO Nanowires: Experimental Observations and Short-Circuit Diffusion Analysis.

PubMed

Shih, Po-Hsun; Wu, Sheng Yun

2017-07-21

Plenty of studies have been performed to probe the diverse properties of ZnO nanowires, but only a few have focused on the physical properties of a single nanowire since analyzing the growth mechanism along a single nanowire is difficult. In this study, a single ZnO nanowire was synthesized using a Ti-assisted chemical vapor deposition (CVD) method to avoid the appearance of catalytic contamination. Two-dimensional energy dispersive spectroscopy (EDS) mapping with a diffusion model was used to obtain the diffusion length and the activation energy ratio. The ratio value is close to 0.3, revealing that the growth of ZnO nanowires was attributed to the short-circuit diffusion.

Phase diagram of nanoscale alloy particles used for vapor-liquid-solid growth of semiconductor nanowires.

PubMed

Sutter, Eli; Sutter, Peter

2008-02-01

We use transmission electron microscopy observations to establish the parts of the phase diagram of nanometer sized Au-Ge alloy drops at the tips of Ge nanowires (NWs) that determine their temperature-dependent equilibrium composition and, hence, their exchange of semiconductor material with the NWs. We find that the phase diagram of the nanoscale drop deviates significantly from that of the bulk alloy, which explains discrepancies between actual growth results and predictions on the basis of the bulk-phase equilibria. Our findings provide the basis for tailoring vapor-liquid-solid growth to achieve complex one-dimensional materials geometries.

A fault constitutive relation accounting for thermal pressurization of pore fluid

USGS Publications Warehouse

Andrews, D.J.

2002-01-01

The heat generated in a slip zone during an earthquake can raise fluid pressure and thereby reduce frictional resistance to slip. The amount of fluid pressure rise depends on the associated fluid flow. The heat generated at a given time produces fluid pressure that decreases inversely with the square root of hydraulic diffusivity times the elapsed time. If the slip velocity function is crack-like, there is a prompt fluid pressure rise at the onset of slip, followed by a slower increase. The stress drop associated with the prompt fluid pressure rise increases with rupture propagation distance. The threshold propagation distance at which thermally induced stress drop starts to dominate over frictionally induced stress drop is proportional to hydraulic diffusivity. If hydraulic diffusivity is 0.02 m2/s, estimated from borehole samples of fault zone material, the threshold propagation distance is 300 m. The stress wave in an earthquake will induce an unknown amount of dilatancy and will increase hydraulic diffusivity, both of which will lessen the fluid pressure effect. Nevertheless, if hydraulic diffusivity is no more than two orders of magnitude larger than the laboratory value, then stress drop is complete in large earthquakes.

The role of thermal vapor diffusion in the subsurface hydrologic evolution of Mars

NASA Technical Reports Server (NTRS)

Clifford, Stephen M.

1991-01-01

The hydrologic response of groundwater to the thermal evolution of the early martian crust is considered. When a temperature gradient is present in a moist porous medium, it gives rise to a vapor-pressure gradient that drives the diffusion of water vapor from regions of high to low temperature. By this process, a geothermal gradient as small as 15 K/km could drive the vertical transport of 1 km of water to the freezing front at the base of the martian crysophere every 10 exp 6-10 exp 7 years, or the equivalent of about 100-1000 km of water over the course of martian geologic history. Models of the thermal history of Mars suggest that this thermally-driven vapor flux may have been as much as 3-5 times greater in the past. The magnitude of this transport suggests that the process of geothermally-induced vapor diffusion may have played a critical role in the initial emplacement of ground ice and the subsequent geomorphic and geochemical evolution of the martian crust.

Field Testing of an Unvented Roof with Fibrous Insulation, Tiles, and Vapor Diffusion Venting

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ueno, K.; Lstiburek, J. W.

This research is a test implementation of an unvented tile roof assembly in a hot-humid climate (Orlando, FL; Zone 2A), insulated with air permeable insulation (netted and blown fiberglass). Given the localized moisture accumulation and failures seen in previous unvented roof field work, it was theorized that a 'diffusion vent' (water vapor open, but air barrier 'closed') at the highest points in the roof assembly might allow for the wintertime release of moisture, to safe levels. The 'diffusion vent' is an open slot at the ridge and hips, covered with a water-resistant but vapor open (500+ perm) air barrier membrane.more » As a control comparison, one portion of the roof was constructed as a typical unvented roof (self-adhered membrane at ridge). The data collected to date indicate that the diffusion vent roof shows greater moisture safety than the conventional, unvented roof design.« less

Relation between heat of vaporization, ion transport, molar volume, and cation-anion binding energy for ionic liquids.

PubMed

Borodin, Oleg

2009-09-10

A number of correlations between heat of vaporization (H(vap)), cation-anion binding energy (E(+/-)), molar volume (V(m)), self-diffusion coefficient (D), and ionic conductivity for 29 ionic liquids have been investigated using molecular dynamics (MD) simulations that employed accurate and validated many-body polarizable force fields. A significant correlation between D and H(vap) has been found, while the best correlation was found for -log(DV(m)) vs H(vap) + 0.28E(+/-). A combination of enthalpy of vaporization and a fraction of the cation-anion binding energy was suggested as a measure of the effective cohesive energy for ionic liquids. A deviation of some ILs from the reported master curve is explained based upon ion packing and proposed diffusion pathways. No general correlations were found between the ion diffusion coefficient and molecular volume or the diffusion coefficient and cation/anion binding energy.

Scaling of Two-Phase Flows to Partial-Earth Gravity

NASA Technical Reports Server (NTRS)

Hurlbert, Kathryn M.; Witte, Larry C.

2003-01-01

A report presents a method of scaling, to partial-Earth gravity, of parameters that describe pressure drops and other characteristics of two-phase (liquid/ vapor) flows. The development of the method was prompted by the need for a means of designing two-phase flow systems to operate on the Moon and on Mars, using fluid-properties and flow data from terrestrial two-phase-flow experiments, thus eliminating the need for partial-gravity testing. The report presents an explicit procedure for designing an Earth-based test bed that can provide hydrodynamic similarity with two-phase fluids flowing in partial-gravity systems. The procedure does not require prior knowledge of the flow regime (i.e., the spatial orientation of the phases). The method also provides for determination of pressure drops in two-phase partial-gravity flows by use of a generalization of the classical Moody chart (previously applicable to single-phase flow only). The report presents experimental data from Mars- and Moon-activity experiments that appear to demonstrate the validity of this method.

Effects of thermal vapor diffusion on seasonal dynamics of water in the unsaturated zone

USGS Publications Warehouse

Milly, Paul C.D.

1996-01-01

The response of water in the unsaturated zone to seasonal changes of temperature (T) is determined analytically using the theory of nonisothermal water transport in porous media, and the solutions are tested against field observations of moisture potential and bomb fallout isotopic (36Cl and 3H) concentrations. Seasonally varying land surface temperatures and the resulting subsurface temperature gradients induce thermal vapor diffusion. The annual mean vertical temperature gradient is close to zero; however, the annual mean thermal vapor flux is downward, because the temperature‐dependent vapor diffusion coefficient is larger, on average, during downward diffusion (occurring at high T) than during upward diffusion (low T). The annual mean thermal vapor flux is shown to decay exponentially with depth; the depth (about 1 m) at which it decays to e−1of its surface value is one half of the corresponding decay depth for the amplitude of seasonal temperature changes. This depth‐dependent annual mean flux is effectively a source of water, which must be balanced by a flux divergence associated with other transport processes. In a relatively humid environment the liquid fluxes greatly exceed the thermal vapor fluxes, so such a balance is readily achieved without measurable effect on the dynamics of water in the unsaturated zone. However, if the mean vertical water flux through the unsaturated zone is very small (<1 mm y−1), as it may be at many locations in a desert landscape, the thermal vapor flux must be balanced mostly by a matric‐potential‐induced upward flux of water. This return flux may include both vapor and liquid components. Below any near‐surface zone of weather‐related fluctuations of matric potential, maintenance of this upward flux requires an increase with depth in the annual mean matric potential; this theoretical prediction is supported by long‐term field measurements in the Chihuahuan Desert. The analysis also makes predictions, confirmed by the field observations, regarding the seasonal variations of matric potential at a given depth. The conceptual model of unsaturated zone water transport developed here implies the possibility of near‐surface trapping of any aqueous constituent introduced at the surface.

Equatorial ground ice on Mars: Steady-state stability

NASA Technical Reports Server (NTRS)

Mellon, Michael T.; Jakosky, Bruce M.; Postawko, Susan E.

1993-01-01

Current Martian equatorial surface temperatures are too warm for water ice to exist at the surface for any appreciable length of time before subliming into the atmosphere. Subsurface temperatures are generally warmer still and, despite the presence of a diffusive barrier of porous regolith material, it has been shown by Smoluchowski, Clifford and Hillel, and Fanale et al. that buried ground ice will also sublime and be lost to the atmosphere in a relatively short time. We investigate the behavior of this subliming subsurface ice and show that it is possible for ice to maintain at a steady-state depth, where sublimation and diffusive loss to the atmosphere is balanced by resupply from beneath by diffusion and recondensation of either a deeper buried ice deposits or ground water. We examine the behavior of equatorial ground ice with a numercial time-marching molecular diffusion model. In our model we allow for diffusion of water vapor through a porous regolith, variations in diffusivity and porosity with ice content, and recondensation of sublimed water vapor. A regolith containing considerable amounts of ice can still be very porous, allowing water vapor to diffuse up from deeper within the ice layer where temperatures are warmer due to the geothermal gradient. This vapor can then recondense nearer to the surface where ice had previously sublimed and been lost to the atmosphere. As a result we find that ice deposits migrate to find a steady-state depth, which represents a balance between diffusive loss to the atmosphere through the overlying porous regolith and diffusive resupply through a porous icy regolith below. This depth depends primarily on the long-term mean surface temperature and the nature of the geothermal gradient, and is independent of the ice-free porosity and the regolith diffusivity. Only the rate of loss of ground ice depends on diffusive properties.

Thermal diffusivity of alpha-mercuric iodide

NASA Astrophysics Data System (ADS)

Burger, A.; Morgan, S. H.; Henderson, D. O.; Silberman, E.; Nason, D.

1991-01-01

The thermal diffusivity and its anisotropy is measured along the principal axes of tetragonal alpha-HgI2 semiconductor single crystals grown from vapor. The experiments are carried out using the flash pulse method. The results show that alpha(100-line-type) = 0.00370 sq cm/s + or - 3 percent and alpha(001-line-type = 0.00103 sq cm/s + or - 10 percent. Necessary corrections are made for the experimental variables of heat losses and finite pulse duration in the data analysis.

Laser absorption spectroscopy of water vapor confined in nanoporous alumina: wall collision line broadening and gas diffusion dynamics.

PubMed

Svensson, Tomas; Lewander, Märta; Svanberg, Sune

2010-08-02

We demonstrate high-resolution tunable diode laser absorption spectroscopy (TDLAS) of water vapor confined in nanoporous alumina. Strong multiple light scattering results in long photon pathlengths (1 m through a 6 mm sample). We report on strong line broadening due to frequent wall collisions (gas-surface interactions). For the water vapor line at 935.685 nm, the HWHM of confined molecules are about 4.3 GHz as compared to 2.9 GHz for free molecules (atmospheric pressure). Gas diffusion is also investigated, and in contrast to molecular oxygen (that moves rapidly in and out of the alumina), the exchange of water vapor is found very slow.

Delineation of discharge areas of two contaminant plumes by use of diffusion samplers, Johns Pond, Cape Cod, Massachusetts, 1998

USGS Publications Warehouse

Savoie, Jennifer G.; LeBlanc, D.R.; Blackwood, D.S.; McCobb, T.D.; Rendigs, R. R.; Clifford, Scott

2000-01-01

Diffusion samplers were installed in the bottom of Johns Pond, Cape Cod, Massachusetts, to confirm that volatile organic compounds from the Storm Drain-5 (SD-5) plume emanating from the Massachusetts Military Reservation (MMR) were discharging into the pond. An array of 134 vapor-diffusion samplers was buried by divers about 0.5 feet below the pond bottom in the presumed discharge area of the SD-5 plume and left in place for about 2 weeks to equilibrate. Two areas of high concentrations of volatile organic compounds (VOCs) were identified. Samples from the first area contained trichloroethene (TCE) and tetrachloroethene with concentrations in vapor as high as 890 and 667 parts per billion by volume, respectively. This discharge area is about 1,000 feet wide, extends from 100 to 350 feet offshore, and is interpreted to be the discharge area of the SD-5 plume. Samples from the second area were located closer to shore than the discharge area of the SD-5 plume and contained unexpectedly high vapor concentrations of TCE (more than 40,000 parts per billion by volume). Ground-water samples collected with a drive-point sampler near the second area had aqueous TCE concentrations as high as 1,100 micrograms per liter. Subsequently, a more closely spaced array of 110 vapor-diffusion samplers was installed to map the area of elevated TCE concentrations . The discharge area detected with the samplers is about 75 feet wide and extends from about 25 to 200 feet offshore . TCE vapor concentrations in this area were as high as 42,800 parts per billion by volume. TCE concentrations in micrograms per liter in water-diffusion samples from 15 selected sites in the two discharge areas were about 35 times lower than the TCE concentrations in parts per billion by volume in corresponding vapor-diffusion samples. The difference in values is due to the volatile nature of TCE and the different units of measure. TCE was detected in diffusion samplers set in the pond water column above the plume discharge areas, but the TCE concentrations were 20 to 30 times lower than the corresponding levels in diffusion samplers buried in the pond bottom.

DNS of moderate-temperature gaseous mixing layers laden with multicomponent-fuel drops

NASA Technical Reports Server (NTRS)

Clercq, P. C. Le; Bellan, J.

2004-01-01

A formulation representing multicomponent-fuel (MC-fuel) composition as a Probability Distribution Function (PDF) depending on the molar weight is used to construct a model of a large number of MC-fuel drops evaporating in a gas flow, so as to assess the extent of fuel specificity on the vapor composition.

Heat Transfer and Observation of Droplet-Surface Interactions During Air-Mist Cooling at CSP Secondary System Temperatures

NASA Astrophysics Data System (ADS)

Huerta L., Mario E.; Mejía G., M. Esther; Castillejos E., A. Humberto

2016-04-01

Air-mists are key elements in the secondary cooling of modern thin steel slab continuous casters. The selection of water, W, and air, A, flow rates, and pressures in pneumatic nozzles open up a wide spectrum of cooling possibilities by their influence on droplet diameter, d, droplet velocity, v, and water impact flux, w. Nonetheless, due to the harsh environment resulting from the high temperatures and dense mists involved, there is very little information about the correlation between heat flux extracted, - q, and mist characteristics, and none about the dynamics of drop-wall interactions. For obtaining both kinds of information, this work combines a steady-state heat flux measuring method with a visualization technique based on a high-speed camera and a laser illumination system. For wall temperatures, T w, between ~723 K and ~1453 K (~450 °C and ~1180 °C), which correspond to film boiling regime, it was confirmed that - q increases with increase in v, w, and T w and with decrease in d. It should be noticed, however, that the increase in w generally decreases the spray cooling effectiveness because striking drops do not evaporate efficiently due to the interference by liquid remains from previous drops. Visualization of the events happening close to the surface also reveals that the contact time of the liquid with the surface is very brief and that rebounding, splashing, sliding, and levitation of drops lead to ineffective contact with the surface. At the center of the mist footprint, where drops impinge nearly normal to the surface those with enough momentum establish intimate contact with it before forming a vapor layer that pushes away the remaining liquid. Also, some drops are observed sliding upon the surface or levitating close to it; these are drops with low momentum which are influenced by the deflecting air stream. At footprint positions where oblique impingement occurs, frequently drops are spotted sliding or levitating and liquid films flowing in from inner positions are seen generating vapor cushions after having stayed in contact with the surface. Visualization of events taking place under high, ~500 kPa, and low, ~200 kPa, air nozzle pressure, p a, conditions suggests that the considerably larger heat extraction obtained under high p a is related to more frequent impingement of finer and faster drops that result in the formation of a dense fog of tiny secondary drops that moves tangentially close to the surface.

Convection effects in protein crystal growth

NASA Technical Reports Server (NTRS)

Roberts, Glyn O.

1988-01-01

Protein crystals for X-ray diffraction study are usually grown resting on the bottom of a hanging drop of a saturated protein solution, with slow evaporation to the air in a small enclosed cell. The evaporation rate is controlled by hanging the drop above a reservoir of water, with its saturation vapor pressure decreased by a low concentration of a passive solute. The drop has a lower solute concentration, and its volume shrinks by evaporation until the molecular concentrations match. Protein crystals can also be grown from a seed crystal suspended or supported in the interior of a supersaturated solution. The main analysis of this report concerns this case because it is less complicated than hanging-drop growth. Convection effects have been suggested as the reason for the apparent cessation of growth at a certain rather small crystal size. It seeems that as the crystal grows, the number of dislocations increases to a point where further growth is hindered. Growth in the microgravity environment of an orbiting space vehicle has been proposed as a method for obtaining larger crystals. Experimental observations of convection effects during the growth of protein crystals have been reported.

Studies of the Terrestrial Molecular Oxygen and Carbon Cycles in Sand Dune Gases and in Biosphere 2.

NASA Astrophysics Data System (ADS)

Severinghaus, Jeffrey Peck

Molecular oxygen in the atmosphere is coupled tightly to the terrestrial carbon cycle by the processes of photosynthesis, respiration, and burning. This dissertation examines different aspects of this coupling in four chapters. Chapter 1 explores the feasibility of using air from sand dunes to reconstruct atmospheric O_2 composition centuries ago. Such a record would reveal changes in the mass of the terrestrial biosphere, after correction for known fossil fuel combustion, and constrain the fate of anthropogenic CO_2. Test drilling in sand dunes shows that sand dunes do contain old air, as shown by the concentrations of chlorofluorocarbons and ^{85}Kr. Diffusion is shown to dominate mixing rather than advection. However, biological respiration in dunes corrupts the signal, and isotopic analysis of O_2 and N _2 shows that fractionation of the gases precludes use of sand dunes as archives. Chapter 2 further explores this fractionation, revealing a previously unknown "water vapor flux fractionation" process. A flux of water vapor out of the moist dune into the dry desert air sweeps out the other gases, forcing them to diffuse back into the dune. The heavy isotopes of N_2 and O_2 diffuse more slowly, creating a steady state depletion of heavy isotopes in the dune interior. Molecular diffusion theory and a laboratory simulation of the effect agree well with the observations. Additional fractionation of the dune air occurs via thermal diffusion and gravitational settling, and it is predicted that soil gases in general will enjoy all three effects. Chapter 3 examines the cause of a mysterious drop in O _2 concentrations in the closed ecosystem of Biosphere 2, located near Tucson, Arizona. The organic -rich soil manufactured for the experiment is shown to be the culprit, with CO_2 produced by bacterial respiration of the organic matter reacting with the extensive concrete surfaces inside. Chapter 4 examines the O_2:C stoichiometry of terrestrial soil respiration and photosynthesis, in the context of using atmospheric O_2 measurements to constrain the size of the "missing sink" of CO_2. Direct measurements of soil respiration and biomatter elemental abundance suggest a value of 1.1 +/- 0.05 oxygen molecules per CO_2 molecule.

Crystallization and preliminary X-ray analysis of Streptococcus mutans dextran glucosidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Saburi, Wataru; Hondoh, Hironori, E-mail: hondoh@abs.agr.hokudai.ac.jp; Unno, Hideaki

2007-09-01

Dextran glucosidase from S. mutans was crystallized using the hanging-drop vapour-diffusion method. The crystals diffracted to 2.2 Å resolution. Dextran glucosidase from Streptococcus mutans is an exo-hydrolase that acts on the nonreducing terminal α-1,6-glucosidic linkage of oligosaccharides and dextran with a high degree of transglucosylation. Based on amino-acid sequence similarity, this enzyme is classified into glycoside hydrolase family 13. Recombinant dextran glucosidase was purified and crystallized by the hanging-drop vapour-diffusion technique using polyethylene glycol 6000 as a precipitant. The crystals belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 72.72, b = 86.47, cmore » = 104.30 Å. A native data set was collected to 2.2 Å resolution from a single crystal.« less

Deep-level transient spectroscopy studies of Ni- and Zn-diffused vapor-phase-epitaxy n-GaAs

NASA Technical Reports Server (NTRS)

Partin, D. L.; Chen, J. W.; Milnes, A. G.; Vassamillet, L. F.

1979-01-01

The paper presents deep-level transient spectroscopy studies of Ni- and Zn-diffused vapor-phase epitaxy n-GaAs. Nickel diffused into VPE n-GaAs reduces the hole diffusion length L sub p from 4.3 to 1.1 microns. Deep-level transient spectroscopy was used to identify energy levels in Ni-diffused GaAs; the as-grown VPE GaAs contains traces of these levels and an electron trap. Ni diffusion reduces the concentration of this level by an amount that matches the increase in concentration of each of the two Ni-related levels. A technique for measuring minority-carrier capture cross sections was developed, which indicates that L sub p in Ni-diffused VPE n-GaAs is controlled by the E sub c - 0.39 eV defect level.

Advances in modeling sorption and diffusion of moisture in porous reactive materials.

PubMed

Harley, Stephen J; Glascoe, Elizabeth A; Lewicki, James P; Maxwell, Robert S

2014-06-23

Water-vapor-uptake experiments were performed on a silica-filled poly(dimethylsiloxane) (PDMS) network and modeled by using two different approaches. The data was modeled by using established methods and the model parameters were used to predict moisture uptake in a sample. The predictions are reasonably good, but not outstanding; many of the shortcomings of the modeling are discussed. A high-fidelity modeling approach is derived and used to improve the modeling of moisture uptake and diffusion. Our modeling approach captures the physics and kinetics of diffusion and adsorption/desorption, simultaneously. It predicts uptake better than the established method; more importantly, it is also able to predict outgassing. The material used for these studies is a filled-PDMS network; physical interpretations concerning the sorption and diffusion of moisture in this network are discussed. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Apparatus for monitoring two-phase flow

DOEpatents

Sheppard, John D.; Tong, Long S.

1977-03-01

A method and apparatus for monitoring two-phase flow is provided that is particularly related to the monitoring of transient two-phase (liquid-vapor) flow rates such as may occur during a pressurized water reactor core blow-down. The present invention essentially comprises the use of flanged wire screens or similar devices, such as perforated plates, to produce certain desirable effects in the flow regime for monitoring purposes. One desirable effect is a measurable and reproducible pressure drop across the screen. The pressure drop can be characterized for various known flow rates and then used to monitor nonhomogeneous flow regimes. Another useful effect of the use of screens or plates in nonhomogeneous flow is that such apparatus tends to create a uniformly dispersed flow regime in the immediate downstream vicinity. This is a desirable effect because it usually increases the accuracy of flow rate measurements determined by conventional methods.

Mechanism of anisotropic surface self-diffusivity at the prismatic ice-vapor interface.

PubMed

Gladich, Ivan; Oswald, Amrei; Bowens, Natalie; Naatz, Sam; Rowe, Penny; Roeselova, Martina; Neshyba, Steven

2015-09-21

Predictive theoretical models for mesoscopic roughening of ice require improved understanding of attachment kinetics occurring at the ice-vapor interface. Here, we use classical molecular dynamics to explore the generality and mechanics of a transition from anisotropic to isotropic self-diffusivity on exposed prismatic surfaces. We find that self-diffusion parallel to the crystallographic a-axis is favored over the c-axis at sub-melt temperatures below about -35 °C, for three different representations of the water-water intermolecular potential. In the low-temperature anisotropic regime, diffusion results from interstitial admolecules encountering entropically distinct barriers to diffusion in the two in-plane directions. At higher temperatures, isotropic self-diffusion occurring deeper within the quasi-liquid layer becomes the dominant mechanism, owing to its larger energy of activation.

Modeling of chemical vapor infiltration for ceramic composites reinforced with layered, woven fabrics

NASA Technical Reports Server (NTRS)

Chung, Gui-Yung; Mccoy, Benjamin J.

1991-01-01

A homogeneous model is developed for the chemical vapor infiltration by one-dimensional diffusion into a system of layered plies consisting of woven tows containing bundles of filaments. The model predictions of the amount of deposition and the porosity of the sample as a function of time are compared with the predictions of a recent nonhomogeneous model with aligned holes formed by the weave. The nonhomogeneous model allows for diffusion through the aligned holes, into the spaces between plies, and into the gaps around filaments; i.e., three diffusion equations apply. Relative to the nonhomogeneous results, the homogeneous model underestimates the amount of deposition, since the absence of holes and spaces allows earlier occlusion of gaps around filaments and restricts the vapor infiltration.

Crystallization and preliminary X-ray diffraction studies of the lipopolysaccharide core biosynthetic enzyme ADP-L-glycero-D-mannoheptose 6-epimerase from Escherichia coli K-12.

PubMed

Ding, L; Zhang, Y; Deacon, A M; Ealick, S E; Ni, Y; Sun, P; Coleman, W G

1999-03-01

ADP-L-glycero-D-mannoheptose 6-epimerase is a 240 kDa NAD-dependent nucleotide diphosphosugar epimerase from Escherichia coli K12 which catalyzes the interconversion of ADP-D-glycero-D-mannoheptose and ADP-L-glycero-D-mannoheptose. ADP-L-glycero-D-mannoheptose is a required intermediate for lipopolysaccharide inner-core and outer-membrane biosynthesis in several genera of pathogenic and non-pathogenic Gram-negative bacteria. ADP-L-glycero-D-mannoheptose 6-epimerase was overexpressed in E. coli and purified to apparent homogeneity by chromatographic methods. Three crystal forms of the epimerase were obtained by a hanging-drop vapor-diffusion method. A native data set for crystal form III was collected in-house on a Rigaku R-AXIS-IIC image plate at 3.0 A resolution. The form III crystals belong to the monoclinic space group P21. The unit-cell parameters are a = 98.94, b = 110.53, c = 180.68 A and beta = 90.94 degrees. Our recent results show that these crystals diffract to 2.0 A resolution at the Cornell High Energy Synchrotron Source. The crystal probably contains six 40 kDa monomers per asymmetric unit, with a corresponding volume per protein mass (Vm) of 4.11 A3 Da-1 and a solvent fraction of 70%.

A diffuse-interface method for two-phase flows with soluble surfactants

PubMed Central

Teigen, Knut Erik; Song, Peng; Lowengrub, John; Voigt, Axel

2010-01-01

A method is presented to solve two-phase problems involving soluble surfactants. The incompressible Navier–Stokes equations are solved along with equations for the bulk and interfacial surfactant concentrations. A non-linear equation of state is used to relate the surface tension to the interfacial surfactant concentration. The method is based on the use of a diffuse interface, which allows a simple implementation using standard finite difference or finite element techniques. Here, finite difference methods on a block-structured adaptive grid are used, and the resulting equations are solved using a non-linear multigrid method. Results are presented for a drop in shear flow in both 2D and 3D, and the effect of solubility is discussed. PMID:21218125

Purification, crystallization and characterization of the Pseudomonas outer membrane protein FapF, a functional amyloid transporter.

PubMed

Rouse, Sarah L; Hawthorne, Wlliam J; Lambert, Sebastian; Morgan, Marc L; Hare, Stephen A; Matthews, Stephen

2016-12-01

Bacteria often produce extracellular amyloid fibres via a multi-component secretion system. Aggregation-prone, unstructured subunits cross the periplasm and are secreted through the outer membrane, after which they self-assemble. Here, significant progress is presented towards solving the high-resolution crystal structure of the novel amyloid transporter FapF from Pseudomonas, which facilitates the secretion of the amyloid-forming polypeptide FapC across the bacterial outer membrane. This represents the first step towards obtaining structural insight into the products of the Pseudomonas fap operon. Initial attempts at crystallizing full-length and N-terminally truncated constructs by refolding techniques were not successful; however, after preparing FapF 106-430 from the membrane fraction, reproducible crystals were obtained using the sitting-drop method of vapour diffusion. Diffraction data have been processed to 2.5 Å resolution. These crystals belonged to the monoclinic space group C121, with unit-cell parameters a = 143.4, b = 124.6, c = 80.4 Å, α = γ = 90, β = 96.32° and three monomers in the asymmetric unit. It was found that the switch to complete detergent exchange into C8E4 was crucial for forming well diffracting crystals, and it is suggested that this combined with limited proteolysis is a potentially useful protocol for membrane β-barrel protein crystallography. The three-dimensional structure of FapF will provide invaluable information on the mechanistic differences of biogenesis between the curli and Fap functional amyloid systems.

Optimization of crystals from nanodrops: crystallization and preliminary crystallographic study of a pheromone-binding protein from the honeybee Apis mellifera L.

PubMed

Lartigue, Audrey; Gruez, Arnaud; Briand, Loïc; Pernollet, Jean-Claude; Spinelli, Silvia; Tegoni, Mariella; Cambillau, Christian

2003-05-01

Pheromone-binding proteins (PBPs) are small helical proteins ( approximately 13-17 kDa) present in various sensory organs from moths and other insect species. They are involved in the transport of pheromones from the sensillar lymph to the olfactory receptors. Here, crystals of a PBP (Amel-ASP1) originating from honeybee (Apis mellifera L.) antennae and expressed as recombinant protein using the yeast Pichia pastoris are reported. Crystals of Amel-ASP1 have been obtained by the sitting-drop vapour-diffusion method using a nanodrop-dispensing robot under the following conditions: 200 nl of 40 mg ml(-1) protein solution in 10 mM Tris, 25 mM NaCl pH 8.0 was mixed with 100 nl of well solution containing 0.15 M sodium citrate, 1.5 M ammonium sulfate pH 5.5. The protein crystallizes in space group C222(1), with unit-cell parameters a = 74.8, b = 85.8, c = 50.2 A. With one molecule in the asymmetric unit, V(M) is 3.05 A(3) Da(-1) and the solvent content is 60%. A complete data set has been collected at 1.6 A resolution on beamline ID14-2 (ESRF, Grenoble). The nanodrop crystallization technique used with a novel optimization procedure made it possible to consume small amounts of protein and to obtain a unique crystal per nanodrop, suitable directly for data collection in-house or at a synchrotron-radiation source.

Growth Mechanism Studies of ZnO Nanowires: Experimental Observations and Short-Circuit Diffusion Analysis

PubMed Central

Shih, Po-Hsun

2017-01-01

Plenty of studies have been performed to probe the diverse properties of ZnO nanowires, but only a few have focused on the physical properties of a single nanowire since analyzing the growth mechanism along a single nanowire is difficult. In this study, a single ZnO nanowire was synthesized using a Ti-assisted chemical vapor deposition (CVD) method to avoid the appearance of catalytic contamination. Two-dimensional energy dispersive spectroscopy (EDS) mapping with a diffusion model was used to obtain the diffusion length and the activation energy ratio. The ratio value is close to 0.3, revealing that the growth of ZnO nanowires was attributed to the short-circuit diffusion. PMID:28754030

Condenser-type diffusion denuders for the collection of sulfur dioxide in a cleanroom.

PubMed

Chang, In-Hyoung; Lee, Dong Soo; Ock, Soon-Ho

2003-02-01

High-efficiency condenser-type diffusion denuders of cylindrical and planar geometries are described. The film condensation of water vapor onto a cooled denuder surface can be used as a method for collecting water-soluble gases. By using SO(2) as the test gas, the planar design offers quantitative collection efficiency at air sampling rates up to 5 L min(-1). Coupled to ion chromatography, the limit of detection (LOD) for SO(2) is 0.014 ppbv with a 30-min successive analysis sequence. The method has been successfully applied to the analysis of temperature- and humidity-controlled cleanroom air.

High-Pressure Transport Properties Of Fluids: Theory And Data From Levitated Drops At Combustion-Relevant Temperatures

NASA Technical Reports Server (NTRS)

Bellan, Josette; Harstad, Kenneth; Ohsaka, Kenichi

2003-01-01

Although the high pressure multicomponent fluid conservation equations have already been derived and approximately validated for binary mixtures by this PI, the validation of the multicomponent theory is hampered by the lack of existing mixing rules for property calculations. Classical gas dynamics theory can provide property mixing-rules at low pressures exclusively. While thermal conductivity and viscosity high-pressure mixing rules have been documented in the literature, there is no such equivalent for the diffusion coefficients and the thermal diffusion factors. The primary goal of this investigation is to extend the low pressure mixing rule theory to high pressures and validate the new theory with experimental data from levitated single drops. The two properties that will be addressed are the diffusion coefficients and the thermal diffusion factors. To validate/determine the property calculations, ground-based experiments from levitated drops are being conducted.

Analysis of models for two solution crystal growth problems

NASA Technical Reports Server (NTRS)

Fehribach, Joseph D.; Rosenberger, Franz

1989-01-01

Two diffusive solution crystal growth models are considered which are characterized by two phases separated by an interface, a lack of convective mixing in either phase, and the presence of diffusion components differing widely in diffusivity. The first model describes precipitant-driven solution crystal growth and the second model describes a hanging drop evaporation problem. It is shown that for certain proteins sharp concentration gradients may develop in the drop during evaporation, while under the same conditions the concentrations of other proteins remain uniform.

Development of PIV for Microgravity Diffusion Flames

NASA Technical Reports Server (NTRS)

Greenberg, Paul S.; Wernet, Mark P.; Yanis, William; Urban, David L.; Sunderland, Peter B.

2003-01-01

Results are presented from the application of Particle Image Velocimetry(PIV) to the overfire region of a laminar gas jet diffusion flame in normal gravity. A methane flame burning in air at 0.98 bar was considered. The apparatus demonstrated here is packaged in a drop rig designed for use in the 2.2 second drop tower.

Simulation of chemical-vapor-deposited silicon carbide for a cold wall vertical reactor

NASA Astrophysics Data System (ADS)

Lee, Y. L.; Sanchez, J. M.

1997-07-01

The growth rate of silicon carbide obtained by low-pressure chemical vapor deposition from tetramethylsilane is numerically simulated for a cold wall vertical reactor. The transport equations for momentum, heat, and mass transfer are simultaneously solved by employing the finite volume method. A model for reaction rate is also proposed in order to predict the measured growth rates [A. Figueras, S. Garelik, J. Santiso, R. Rodroguez-Clemente, B. Armas, C. Combescure, R. Berjoan, J.M. Saurel and R. Caplain, Mater. Sci. Eng. B 11 (1992) 83]. Finally, the effects of thermal diffusion on the growth rate are investigated.

Condensation on Slippery Asymmetric Bumps

NASA Astrophysics Data System (ADS)

Park, Kyoo-Chul; Kim, Philseok; Aizenberg, Joanna

Controlling dropwise condensation by designing surfaces that enable droplets to grow rapidly and be shed as quickly as possible is fundamental to water harvesting systems, thermal power generation, distillation towers, etc. However, cutting-edge approaches based on micro/nanoscale textures suffer from intrinsic trade-offs that make it difficult to optimize both growth and transport at once. Here we present a conceptually different design approach based on principles derived from Namib desert beetles, cacti, and pitcher plants that synergistically couples both aspects of condensation and outperforms other synthetic surfaces. Inspired by an unconventional interpretation of the role of the beetle's bump geometry in promoting condensation, we show how to maximize vapor diffusion flux at the apex of convex millimetric bumps by optimizing curvature and shape. Integrating this apex geometry with a widening slope analogous to cactus spines couples rapid drop growth with fast directional transport, by creating a free energy profile that drives the drop down the slope. This coupling is further enhanced by a slippery, pitcher plant-inspired coating that facilitates feedback between coalescence-driven growth and capillary-driven motion. We further observe an unprecedented six-fold higher exponent in growth rate and much faster shedding time compared to other surfaces. We envision that our fundamental understanding and rational design strategy can be applied to a wide range of phase change applications.

Condensation on Slippery Asymmetric Bumps

NASA Astrophysics Data System (ADS)

Park, Kyoo-Chul; Kim, Philseok; Aizenberg, Joanna

2016-11-01

Controlling dropwise condensation by designing surfaces that enable droplets to grow rapidly and be shed as quickly as possible is fundamental to water harvesting systems, thermal power generation, distillation towers, etc. However, cutting-edge approaches based on micro/nanoscale textures suffer from intrinsic trade-offs that make it difficult to optimize both growth and transport at once. Here we present a conceptually different design approach based on principles derived from Namib desert beetles, cacti, and pitcher plants that synergistically couples both aspects of condensation and outperforms other synthetic surfaces. Inspired by an unconventional interpretation of the role of the beetle's bump geometry in promoting condensation, we show how to maximize vapor diffusion flux at the apex of convex millimetric bumps by optimizing curvature and shape. Integrating this apex geometry with a widening slope analogous to cactus spines couples rapid drop growth with fast directional transport, by creating a free energy profile that drives the drop down the slope. This coupling is further enhanced by a slippery, pitcher plant-inspired coating that facilitates feedback between coalescence-driven growth and capillary-driven motion. We further observe an unprecedented six-fold higher exponent in growth rate and much faster shedding time compared to other surfaces. We envision that our fundamental understanding and rational design strategy can be applied to a wide range of phase change applications.

Development of a Scale-up Tool for Pervaporation Processes

PubMed Central

Thiess, Holger; Strube, Jochen

2018-01-01

In this study, an engineering tool for the design and optimization of pervaporation processes is developed based on physico-chemical modelling coupled with laboratory/mini-plant experiments. The model incorporates the solution-diffusion-mechanism, polarization effects (concentration and temperature), axial dispersion, pressure drop and the temperature drop in the feed channel due to vaporization of the permeating components. The permeance, being the key model parameter, was determined via dehydration experiments on a mini-plant scale for the binary mixtures ethanol/water and ethyl acetate/water. A second set of experimental data was utilized for the validation of the model for two chemical systems. The industrially relevant ternary mixture, ethanol/ethyl acetate/water, was investigated close to its azeotropic point and compared to a simulation conducted with the determined binary permeance data. Experimental and simulation data proved to agree very well for the investigated process conditions. In order to test the scalability of the developed engineering tool, large-scale data from an industrial pervaporation plant used for the dehydration of ethanol was compared to a process simulation conducted with the validated physico-chemical model. Since the membranes employed in both mini-plant and industrial scale were of the same type, the permeance data could be transferred. The comparison of the measured and simulated data proved the scalability of the derived model. PMID:29342956

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barbante, Paolo; Frezzotti, Aldo; Gibelli, Livio

The unsteady evaporation of a thin planar liquid film is studied by molecular dynamics simulations of Lennard-Jones fluid. The obtained results are compared with the predictions of a diffuse interface model in which capillary Korteweg contributions are added to hydrodynamic equations, in order to obtain a unified description of the liquid bulk, liquid-vapor interface and vapor region. Particular care has been taken in constructing a diffuse interface model matching the thermodynamic and transport properties of the Lennard-Jones fluid. The comparison of diffuse interface model and molecular dynamics results shows that, although good agreement is obtained in equilibrium conditions, remarkable deviationsmore » of diffuse interface model predictions from the reference molecular dynamics results are observed in the simulation of liquid film evaporation. It is also observed that molecular dynamics results are in good agreement with preliminary results obtained from a composite model which describes the liquid film by a standard hydrodynamic model and the vapor by the Boltzmann equation. The two mathematical model models are connected by kinetic boundary conditions assuming unit evaporation coefficient.« less

Detection of Explosive Vapors: The Roles of Exciton and Molecular Diffusion in Real-Time Sensing.

PubMed

Ali, Mohammad A; Shoaee, Safa; Fan, Shengqiang; Burn, Paul L; Gentle, Ian R; Meredith, Paul; Shaw, Paul E

2016-11-04

Time-resolved quartz crystal microbalance with in situ fluorescence measurements are used to monitor the sorption of the nitroaromatic (explosive) vapor, 2,4-dinitrotoluene (DNT) into a porous pentiptycene-containing poly(phenyleneethynylene) sensing film. Correlation of the nitroaromatic mass uptake with fluorescence quenching shows that the analyte diffusion follows the Case-II transport model, a film-swelling-limited process, in which a sharp diffusional front propagates at a constant velocity through the film. At a low vapor pressure of DNT of ≈16 ppb, the analyte concentration in the front is sufficiently high to give an average fluorophore-analyte separation of ≈1.5 nm. Hence, a long exciton diffusion length is not required for real-time sensing in the solid state. Rather the diffusion behavior of the analyte and the strength of the binding interaction between the analyte and the polymer play first-order roles in the fluorescence quenching process. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Control of flow through a vapor generator

DOEpatents

Radcliff, Thomas D.

2005-11-08

In a Rankine cycle system wherein a vapor generator receives heat from exhaust gases, provision is made to avoid overheating of the refrigerant during ORC system shut down while at the same time preventing condensation of those gases within the vapor generator when its temperature drops below a threshold temperature by diverting the flow of hot gases to ambient and to thereby draw ambient air through the vapor generator in the process. In one embodiment, a bistable ejector is adjustable between one position, in which the hot gases flow through the vapor generator, to another position wherein the gases are diverted away from the vapor generator. Another embodiment provides for a fixed valve ejector with a bias towards discharging to ambient, but with a fan on the downstream side of said vapor generator for overcoming this bias.

Variation characteristics of water vapor distribution during 2000-2008 over Hefei (31.9°N, 117.2°E) observed by L625 lidar

NASA Astrophysics Data System (ADS)

Wang, Min; Fang, Xin; Hu, Shunxing; Hu, Huanling; Li, Tao; Dou, Xiankang

2015-10-01

Observations of monthly and seasonal nightly water vapor variations over Hefei utilizing L625 lidar water vapor data observed from 2000 to 2008 is the focus of this study. The experimental setup and main parameters of the L625 lidar for water vapor measurement are first presented, then the measurement principle of water vapor and data processing methods are introduced. The water vapor measurement precision of the lidar system was analyzed by comparison with radiosonde. Monthly and seasonal water vapor profiles were built by analyzing 2000-2008 lidar data. In the vertical direction, results show that water vapor content decreases gradually with height. The more the water vapor content in the low atmosphere, the faster the decay rate with altitude. As far as monthly variation, the water vapor content first increases and then decreases with month. The maximum content of water vapor appears in July, at mixing ratio of 15.6 g/kg at 1 km. The seasonal variability of water vapor content is rather obvious. In summer the water vapor mixing ratio reaches up to 15.0 g/kg at 1 km, and in winter it is only 3.9 g/kg at the same altitude. Interannual variation of water vapor content differs between seasons (as revealed in the standard deviation of data) where summer is least stable and autumn is the most stable. Precipitable water vapor is calculated from water vapor mean profiles at 1-4 km and the relationship between precipitable water vapor and precipitation is also investigated. A clear positive correlation is found with Pearson correlation coefficients (R) 0.933 between monthly precipitation and mean precipitable water vapor, as well a clear positive correlation between seasonal precipitation and seasonal mean precipitable water vapor (R = 0.988). Precipitation conversion efficiency (PCE) is calculated from precipitation and precipitable water vapor. The monthly PCE reaches its maximum in October at 25.8%, and drops to its minimum in January at 11.5%. Seasonal PCE's minimum is 15.2% in autumn and 23.7% in winter, at maximum.

METHOD FOR REMOVAL OF LIGHT ISOTOPE PRODUCT FROM LIQUID THERMAL DIFFUSION UNITS

DOEpatents

Hoffman, J.D.; Ballou, J.K.

1957-11-19

A method and apparatus are described for removing the lighter isotope of a gaseous-liquid product from a number of diffusion columns of a liquid thermal diffusion system in two stages by the use of freeze valves. The subject liquid flows from the diffusion columns into a heated sloping capsule where the liquid is vaporized by the action of steam in a heated jacket surrounding the capsule. When the capsule is filled the gas flows into a collector. Flow between the various stages is controlled by freeze valves which are opened and closed by the passage of gas and cool water respectively through coils surrounding portions of the pipes through which the process liquid is passed. The use of the dual stage remover-collector and the freeze valves is an improvement on the thermal diffusion separation process whereby the fraction containing the lighter isotope many be removed from the tops of the diffusion columns without intercolumn flow, or prior stage flow while the contents of the capsule is removed to the final receiver.

A study of pressure losses in residential air distribution systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abushakra, Bass; Walker, Iain S.; Sherman, Max H.

2002-07-01

An experimental study was conducted to evaluate the pressure drop characteristics of residential duct system components that are either not available or not thoroughly (sometimes incorrectly) described in existing duct design literature. The tests were designed to imitate cases normally found in typical residential and light commercial installations. The study included three different sizes of flexible ducts, under different compression configurations, splitter boxes, supply boots, and a fresh air intake hood. The experimental tests conformed to ASHRAE Standard 120P--''Methods of Testing to Determine Flow Resistance of HVAC Air Ducts and Fittings''. The flexible duct study covered compressibility and bending effectsmore » on the total pressure drop, and the results showed that the available published references tend to underestimate the effects of compression in flexible ducts that can increase pressure drops by up to a factor of nine. The supply boots were tested under different configurations including a setup where a flexible duct elbow connection was considered as an integral part of the supply boot. The supply boots results showed that diffusers can increase the pressure drop by up to a factor of two in exit fittings, and the installation configuration can increase the pressure drop by up to a factor of five. The results showed that it is crucial for designers and contractors to be aware of the compressibility effects of the flexible duct, and the installation of supply boots and diffusers.« less

Hot spot formation and stagnation properties in simulations of direct-drive NIF implosions

NASA Astrophysics Data System (ADS)

Schmitt, Andrew J.; Obenschain, Stephen P.

2016-05-01

We investigate different proposed methods of increasing the hot spot energy and radius in inertial confinement fusion implosions. In particular, shock mistiming (preferentially heating the inner edge of the target's fuel) and increasing the initial vapor gas density are investigated as possible control mechanisms. We find that only the latter is effective in substantially increasing the hot spot energy and dimensions while achieving ignition. In all cases an increase in the hot spot energy is accompanied by a decrease in the hot spot energy density (pressure) and both the yield and the gain of the target drop substantially. 2D simulations of increased vapor density targets predict an increase in the robustness of the target with respect to surface perturbations but are accompanied by significant yield degradation.

Semen of spinal cord injured men freezes reliably.

PubMed

Padron, O F; Brackett, N L; Weizman, M S; Lynne, C M

1994-01-01

The objectives of the present study were to: 1) determine the effect of cryopreservation on the percent and the grade of motility of sperm from spinal cord injured (SCI) men and 2) determine which method of freezing yields the best post-thaw motility in sperm from SCI men. Antegrade semen samples were obtained from 9 SCI subjects and 10 age-matched healthy control subjects. Motility in fresh samples was determined and cryopreservative medium was added to each sample. Aliquots of each sample were frozen according to three methods: 1) liquid nitrogen vapor only (V); 2) vapor for 12 minutes followed by submersion into liquid nitrogen (V+N2); and 3) direct submersion into liquid nitrogen (N2). Samples were frozen for 1 week, then thawed. The post-thaw percent and grade of motility was determined. The mean percent motility of fresh samples for SCI subjects (21.0%) was significantly lower than for control subjects (55.7%). After thawing, the mean percent drop in motility for V, V+N2, and N2 for controls was 65.2%, 73.5%, and 79.4%, respectively, and for SCI subjects, it was 64.7%, 74.5%, and 81.6%, respectively. There was no statistically significant difference between control and SCI subjects by method of freezing. Vapor only as a freezing method was superior to all other methods for retention of sperm motility in both control and SCI subjects. We conclude that the semen of SCI men may be frozen reliably and that their sperm retain motility similar to that of normal men. Vapor only, being the most gentle method used, gives the best recovery of sperm motility in either group.

Kinetics of heterogeneous chemical reactions: a theoretical model for the accumulation of pesticides in soil.

PubMed

Lin, S H; Sahai, R; Eyring, H

1971-04-01

A theoretical model for the accumulation of pesticides in soil has been proposed and discussed from the viewpoint of heterogeneous reaction kinetics with a basic aim to understand the complex nature of soil processes relating to the environmental pollution. In the bulk of soil, the pesticide disappears by diffusion and a chemical reaction; the rate processes considered on the surface of soil are diffusion, chemical reaction, vaporization, and regular pesticide application. The differential equations involved have been solved analytically by the Laplace-transform method.

Kinetics of Heterogeneous Chemical Reactions: A Theoretical Model for the Accumulation of Pesticides in Soil

PubMed Central

Lin, S. H.; Sahai, R.; Eyring, H.

1971-01-01

A theoretical model for the accumulation of pesticides in soil has been proposed and discussed from the viewpoint of heterogeneous reaction kinetics with a basic aim to understand the complex nature of soil processes relating to the environmental pollution. In the bulk of soil, the pesticide disappears by diffusion and a chemical reaction; the rate processes considered on the surface of soil are diffusion, chemical reaction, vaporization, and regular pesticide application. The differential equations involved have been solved analytically by the Laplace-transform method. PMID:5279519

Enhanced Condensation Heat Transfer On Patterned Surfaces

NASA Astrophysics Data System (ADS)

Alizadeh-Birjandi, Elaheh; Kavehpour, H. Pirouz

2017-11-01

Transition from film to drop wise condensation can improve the efficiency of thermal management applications and result in considerable savings in investments and operating costs by millions of dollars every year. The current methods available are either hydrophobic coating or nanostructured surfaces. The former has little adhesion to the structure which tends to detach easily under working conditions, the fabrication techniques of the latter are neither cost-effective nor scalable, and both are made with low thermal conductivity materials that would negate the heat transfer enhancement by drop wise condensation. Therefore, the existing technologies have limitations in enhancing vapor-to-liquid condensation. This work focuses on development of surfaces with wettability contrast to boost drop wise condensation, which its overall heat transfer efficiency is 2-3 times film wise condensation, while maintaining high conduction rate through the surface at low manufacturing costs. The variation in interfacial energy is achieved through crafting hydrophobic patterns to the surface of the metal via scalable fabrication techniques. The results of experimental and surface optimization studies are also presented.

Spill-Resistant Alkali-Metal-Vapor Dispenser

NASA Technical Reports Server (NTRS)

Klipstein, William

2005-01-01

A spill-resistant vessel has been developed for dispensing an alkali-metal vapor. Vapors of alkali metals (most commonly, cesium or rubidium, both of which melt at temperatures slightly above room temperature) are needed for atomic frequency standards, experiments in spectroscopy, and experiments in laser cooling. Although the present spill-resistant alkali-metal dispenser was originally intended for use in the low-gravity environment of outer space, it can also be used in normal Earth gravitation: indeed, its utility as a vapor source was confirmed by use of cesium in a ground apparatus. The vessel is made of copper. It consists of an assembly of cylinders and flanges, shown in the figure. The uppermost cylinder is a fill tube. Initially, the vessel is evacuated, the alkali metal charge is distilled into the bottom of the vessel, and then the fill tube is pinched closed to form a vacuum seal. The innermost cylinder serves as the outlet for the vapor, yet prevents spilling by protruding above the surface of the alkali metal, no matter which way or how far the vessel is tilted. In the event (unlikely in normal Earth gravitation) that any drops of molten alkali metal have been shaken loose by vibration and are floating freely, a mesh cap on top of the inner cylinder prevents the drops from drifting out with the vapor. Liquid containment of the equivalent of 1.2 grams of cesium was confirmed for all orientations with rubbing alcohol in one of the prototypes later used with cesium.

A method to simultaneously determine sorption isotherms and sorption enthalpies with a double twin microcalorimeter

NASA Astrophysics Data System (ADS)

Wadso, Lars; Markova, Natalia

2002-07-01

Sorption of vapors of water, ethanol, and other liquids on solids like pharmaceuticals, textiles and food stuffs are of both practical and theoretical importance. In this article we present a technique to simultaneously measure sorption isotherms and sorption enthalpies. The sample is contained in one end of a sorption vessel. In the other end a vaporizable liquid is introduced to start the measurement. Mass transfer from the liquid to the sample is by vapor diffusion and the rate of mass transfer is calculated from the measured thermal power of vaporization. Simultaneously, the thermal power of sorption is measured and from this one may calculate the differential enthalpy of sorption. The thermal power measurements are made by inserting the sorption vessel in an isothermal double twin microcalorimeter.

Volatile organic compounds detected in vapor-diffusion samplers placed in sediments along and near the shoreline at Allen Harbor Landfill and Calf Pasture Point, Davisville, Rhode Island, March-April 1998

USGS Publications Warehouse

Lyford, F.P.; Kliever, J.D.; Scott, Clifford

1999-01-01

Volatile organic compounds are present in ground water at the Allen Harbor Landfill and the Calf Pasture Point sites on the former Naval Construction Battalion Center in Davisville, R.I. Vapor-diffusion samplers were used at the two sites during March-April 1998 to identify possible discharge points for contaminants along the shore of Allen Harbor and in two wetland areas near the shore. Results from vapor-diffusion samplers will be used in conjunction with other site information to evaluate proposed ground-water monitoring programs. Volatile organic compounds were detected in 41 of 115 samplers placed along the shoreline at the Allen Harbor Landfill. Trichloroethylene was the principal volatile organic compound detected of eight target compounds. The highest vapor concentration measured exceeded 300,000 parts per billion by volume in an area where TCE was detected in groundwater from nearby monitoring wells. Other chemicals detected in vapor-diffusion samplers included tetrachloroethylene, toluene, and benzene. Concentrations of individual volatile organic compounds were less than 100 parts per billion by volume in most samplers. Volatile organic compounds, principally trichloroethylene, were detected in 7 of 30 samplers placed along the shoreline at Calf Pasture Point; the highest trichloroethylene concentration was 1,900 parts per billion by volume. A trace concentration of tetrachloroethylene was detected in one of the samplers. One of 24 samplers placed in two wetland areas near the shore (suspected discharge areas for ground-water containing volatile organic compounds) detected trichloroethylene at a vapor concentration of 14 parts per billion by volume.

Influence of mass diffusion on the stability of thermophoretic growth of a solid from the vapor phase

NASA Technical Reports Server (NTRS)

Castillo, J. L.; Garcia-Ybarra, P. L.; Rosner, D. E.

1991-01-01

The stability of solid planar growth from a binary vapor phase with a condensing species dilute in a carrier gas is examined when the ratio of depositing to carrier species molecular mass is large and the main diffusive transport mechanism is thermal diffusion. It is shown that a deformation of the solid-gas interface induces a deformation of the gas phase isotherms that increases the thermal gradients and thereby the local mass deposition rate at the crests and reduces them at the valleys. The initial surface deformation is enhanced by the modified deposition rates in the absence of appreciable Fick/Brownian diffusion and interfacial energy effects.

Role of boundary layer diffusion in vapor deposition growth of chalcogenide nanosheets: the case of GeS.

PubMed

Li, Chun; Huang, Liang; Snigdha, Gayatri Pongur; Yu, Yifei; Cao, Linyou

2012-10-23

We report a synthesis of single-crystalline two-dimensional GeS nanosheets using vapor deposition processes and show that the growth behavior of the nanosheet is substantially different from those of other nanomaterials and thin films grown by vapor depositions. The nanosheet growth is subject to strong influences of the diffusion of source materials through the boundary layer of gas flows. This boundary layer diffusion is found to be the rate-determining step of the growth under typical experimental conditions, evidenced by a substantial dependence of the nanosheet's size on diffusion fluxes. We also find that high-quality GeS nanosheets can grow only in the diffusion-limited regime, as the crystalline quality substantially deteriorates when the rate-determining step is changed away from the boundary layer diffusion. We establish a simple model to analyze the diffusion dynamics in experiments. Our analysis uncovers an intuitive correlation of diffusion flux with the partial pressure of source materials, the flow rate of carrier gas, and the total pressure in the synthetic setup. The observed significant role of boundary layer diffusions in the growth is unique for nanosheets. It may be correlated with the high growth rate of GeS nanosheets, ~3-5 μm/min, which is 1 order of magnitude higher than other nanomaterials (such as nanowires) and thin films. This fundamental understanding of the effect of boundary layer diffusions may generally apply to other chalcogenide nanosheets that can grow rapidly. It can provide useful guidance for the development of general paradigms to control the synthesis of nanosheets.

A simple apparatus for controlling nucleation and size in protein crystal growth

NASA Technical Reports Server (NTRS)

Gernert, Kim M.; Smith, Robert; Carter, Daniel C.

1988-01-01

A simple device is described for controlling vapor equilibrium in macromolecular crystallization as applied to the protein crystal growth technique commonly referred to as the 'hanging drop' method. Crystal growth experiments with hen egg white lysozyme have demonstrated control of the nucleation rate. Nucleation rate and final crystal size have been found to be highly dependent upon the rate at which critical supersaturation is approached. Slower approaches show a marked decrease in the nucleation rate and an increase in crystal size.

Compact Apparatus Grows Protein Crystals

NASA Technical Reports Server (NTRS)

Bugg, Charles E.; Delucas, Lawrence J.; Suddath, Fred L.; Snyder, Robert S.; Herren, Blair J.; Carter, Daniel C.; Yost, Vaughn H.

1989-01-01

Laboratory apparatus provides delicately balanced combination of materials and chemical conditions for growth of protein crystals. Apparatus and technique for growth based on hanging-drop method for crystallization of macromolecules. Includes pair of syringes with ganged plungers. One syringe contains protein solution; other contains precipitating-agent solution. Syringes intrude into cavity lined with porous reservoir material saturated with 1 mL or more of similar precipitating-agent solution. Prior to activation, ends of syringes plugged to prevent transport of water vapor among three solutions.

Permeability of cork for water and ethanol.

PubMed

Fonseca, Ana Luisa; Brazinha, Carla; Pereira, Helena; Crespo, Joao G; Teodoro, Orlando M N D

2013-10-09

Transport properties of natural (noncompressed) cork were evaluated for water and ethanol in both vapor and liquid phases. The permeability for these permeants has been measured, as well as the sorption and diffusion coefficients. This paper focuses on the differences between the transport of gases' relevant vapors and their liquids (water and ethanol) through cork. A transport mechanism of vapors and liquids is proposed. Experimental evidence shows that both vapors and liquids permeate not only through the small channels across the cells (plasmodesmata), as in the permeation of gases, but also through the walls of cork cells by sorption and diffusion as in dense membranes. The present study also shows that cork permeability for gases was irreversibly and drastically decreased after cork samples were exposed to ethanol or water in liquid phase.

Fundamental study of FC-72 pool boiling surface temperature fluctuations and bubble behavior

NASA Astrophysics Data System (ADS)

Griffin, Alison R.

A heater designed to monitor surface temperature fluctuations during pool boiling experiments while the bubbles were simultaneously being observed has been fabricated and tested. The heat source was a transparent indium tin oxide (ITO) layer commercially deposited on a fused quartz substrate. Four copper-nickel thin film thermocouples (TFTCs) on the heater surface measured the surface temperature, while a thin layer of sapphire or fused silica provided electrical insulation between the TFTCs and the ITO. The TFTCs were micro-fabricated using the liftoff process to deposit the nickel and copper metal films. The TFTC elements were 50 mum wide and overlapped to form a 25 mum by 25 mum junction. TFTC voltages were recorded by a DAQ at a sampling rate of 50 kHz. A high-speed CCD camera recorded bubble images from below the heater at 2000 frames/second. A trigger sent to the camera by the DAQ synchronized the bubble images and the surface temperature data. As the bubbles and their contact rings grew over the TFTC junction, correlations between bubble behavior and surface temperature changes were demonstrated. On the heaters with fused silica insulation layers, 1--2°C temperature drops on the order of 1 ms occurred as the contact ring moved over the TFTC junction during bubble growth and as the contact ring moved back over the TFTC junction during bubble departure. These temperature drops during bubble growth and departure were due to microlayer evaporation and liquid rewetting the heated surface, respectively. Microlayer evaporation was not distinguished as the primary method of heat removal from the surface. Heaters with sapphire insulation layers did not display the measurable temperature drops observed with the fused silica heaters. The large thermal diffusivity of the sapphire compared to the fused silica was determined as the reason for the absence of these temperature drops. These findings were confirmed by a comparison of temperature drops in a 2-D simulation of a bubble growing over the TFTC junction on both the sapphire and fused silica heater surfaces. When the fused silica heater produced a temperature drop of 1.4°C, the sapphire heater produced a drop of only 0.04°C under the same conditions. These results verified that the lack of temperature drops present in the sapphire data was due to the thermal properties of the sapphire layer. By observing the bubble departure frequency and site density on the heater, as well as the bubble departure diameter, the contribution of nucleate boiling to the overall heat removal from the surface could be calculated. These results showed that bubble vapor generation contributed to approximately 10% at 1 W/cm2, 23% at 1.75 W/cm2, and 35% at 2.9 W/cm 2 of the heat removed from a fused silica heater. Bubble growth and contact ring growth were observed and measured from images obtained with the high-speed camera. Bubble data recorded on a fused silica heater at 3 W/cm2, 4 W/cm2, and 5 W/cm 2 showed that bubble departure diameter and lifetime were negligibly affected by the increase in heat flux. Bubble and contact ring growth rates demonstrated significant differences when compared on the fused silica and sapphire heaters at 3 W/cm2. The bubble departure diameters were smaller, the bubble lifetimes were longer, and the bubble departure frequency was larger on the sapphire heater, while microlayer evaporation was faster on the fused silica heater. Additional considerations revealed that these differences may be due to surface conditions as well as differing thermal properties. Nucleate boiling curves were recorded on the fused silica and sapphire heaters by adjusting the heat flux input and monitoring the local surface temperature with the TFTCs. The resulting curves showed a temperature drop at the onset of nucleate boiling due to the increase in heat transfer coefficient associated with bubble nucleation. One of the TFTC locations on the sapphire heater frequently experienced a second temperature drop at a higher heat flux. When the heat flux was started from 1 W/cm2 instead of zero or returned to zero only momentarily, the temperature overshoot did not occur. In these cases sufficient vapor remained in the cavities to initiate boiling at a lower superheat.

Dropped head congenital muscular dystrophy caused by de novo mutations in LMNA.

PubMed

Karaoglu, Pakize; Quizon, Nicolas; Pergande, Matthias; Wang, Haicui; Polat, Ayşe Ipek; Ersen, Ayca; Özer, Erdener; Willkomm, Lena; Hiz Kurul, Semra; Heredia, Raúl; Yis, Uluç; Selcen, Duygu; Çirak, Sebahattin

2017-04-01

Dropped head syndrome is an easily recognizable clinical presentation of Lamin A/C-related congenital muscular dystrophy. Patients usually present in the first year of life with profound neck muscle weakness, dropped head, and elevated serum creatine kinase. Two patients exhibited head drop during infancy although they were able to sit independently. Later they developed progressive axial and limb-girdle weakness. Creatine kinase levels were elevated and muscle biopsies of both patients showed severe dystrophic changes. The distinctive clinical hallmark of the dropped head led us to the diagnosis of Lamin A/C-related congenital muscular dystrophy, with a pathogenic de novo mutation p.Glu31del in the head domain of the Lamin A/C gene in both patients. Remarkably, one patient also had a central involvement with white matter changes on brain magnetic resonance imaging. Lamin A/C-related dropped-head syndrome is a rapidly progressive congenital muscular dystrophy and may lead to loss of ambulation, respiratory insufficiency, and cardiac complications. Thus, the genetic diagnosis of dropped-head syndrome as L-CMD and the implicated clinical care protocols are of vital importance for these patients. This disease may be underdiagnosed, as only a few genetically confirmed cases have been reported. Copyright © 2016 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Experimental investigation of the physical properties of medium and heavy oils, their vaporization and use in explosion engines. Part III

NASA Technical Reports Server (NTRS)

Heinlein, Fritz

1926-01-01

The test equipment for studying the vaporization of heavy and medium oils is described as well as some of the experimental properties explored such as vaporization speed and diffusion coefficient. The experiemtal arrangement is also discussed.

Quantitative organic vapor-particle sampler

DOEpatents

Gundel, Lara; Daisey, Joan M.; Stevens, Robert K.

1998-01-01

A quantitative organic vapor-particle sampler for sampling semi-volatile organic gases and particulate components. A semi-volatile organic reversible gas sorbent macroreticular resin agglomerates of randomly packed microspheres with the continuous porous structure of particles ranging in size between 0.05-10 .mu.m for use in an integrated diffusion vapor-particle sampler.

Ideal square quantum wells achieved in AlGaN/GaN superlattices using ultrathin blocking-compensation pair

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Xiaohong; Xu, Hongmei; Xu, Fuchun

A technique for achieving square-shape quantum wells (QWs) against the intrinsic polar discontinuity and interfacial diffusion through self-compensated pair interlayers is reported. Ultrathin low-and-high % pair interlayers that have diffusion-blocking and self-compensation capacities is proposed to resist the elemental diffusion at nanointerfaces and to grow the theoretically described abrupt rectangular AlGaN/GaN superlattices by metal-organic chemical vapor deposition. Light emission efficiency in such nanostructures is effectively enhanced and the quantum-confined Stark effect could be partially suppressed. This concept could effectively improve the quality of ultrathin QWs in functional nanostructures with other semiconductors or through other growth methods.

Purification, crystallization and preliminary X-ray diffraction studies of D-tagatose 3-epimerase from Pseudomonas cichorii.

PubMed

Yoshida, Hiromi; Yamada, Mitsugu; Nishitani, Takeyori; Takada, Goro; Izumori, Ken; Kamitori, Shigehiro

2007-02-01

D-Tagatose 3-epimerase (D-TE) from Pseudomonas cichorii catalyzes the epimerization of various ketohexoses at the C3 position. The epimerization of D-psicose has not been reported with epimerases other than P. cichorii D-TE and D-psicose 3-epimerase from Agrobacterium tumefaciens. Recombinant P. cichorii D-TE has been purified and crystallized. Crystals of P. cichorii D-TE were obtained by the sitting-drop method at room temperature. The crystal belongs to the monoclinic space group P2(1), with unit-cell parameters a = 76.80, b = 94.92, c = 91.73 A, beta = 102.82 degrees . Diffraction data were collected to 2.5 A resolution. The asymmetric unit is expected to contain four molecules.

Purification, crystallization and preliminary X-ray characterization of prunin-1, a major component of the almond (Prunus dulcis) allergen amandin.

PubMed

Albillos, Silvia M; Jin, Tengchuan; Howard, Andrew; Zhang, Yuzhu; Kothary, Mahendra H; Fu, Tong-Jen

2008-07-09

The 11S globulins from plant seeds account for a number of major food allergens. Because of the interest in the structural basis underlying the allergenicity of food allergens, we sought to crystallize the main 11S seed storage protein from almond ( Prunus dulcis). Prunin-1 (Pru1) was purified from defatted almond flour by water extraction, cryoprecipitation, followed by sequential anion exchange, hydrophobic interaction, and size exclusion chromatography. Single crystals of Pru1 were obtained in a screening with a crystal screen kit, using the hanging-drop vapor diffusion method. Diffraction quality crystals were grown after optimization. The Pru1 crystals diffracted to at least 3.0 A and belong to the tetragonal space group P4(1)22, with unit cell parameters of a = b = 150.912 A, c = 165.248 A. Self-rotation functions and molecular replacement calculations showed that there are three molecules in the asymmetry unit with water content of 51.41%. The three Pru1 protomers are related by a noncrystallographic 3-fold axis and they form a doughnut-shaped trimer. Two prunin trimers form a homohexamer. Elucidation of prunin structure will allow further characterization of the allergenic features of the 11S protein allergens at the molecular level.

A microchip fabricated with a vapor-diffusion self-assembled-monolayer method to transport droplets across superhydrophobic to hydrophilic surfaces.

PubMed

Lai, Yu-Hsuan; Yang, Jing-Tang; Shieh, Dar-Bin

2010-02-21

A wettability gradient to transport a droplet across superhydrophobic to hydrophilic surfaces is fabricated on combining a structure gradient and a self-assembled-monolayer (SAM) gradient. The combination of these two gradients is realized with a simple but versatile SAM technique, in which the textured silicon wafer strip is placed vertically in a bottle that contains a decyltrichlorosilane solution to form concurrently a saturated SAM below the liquid surface and a wettability gradient above. The platform fabricated in this way has a water-contact angle from 151.2 degrees to 39.7 degrees; the self-transport distance is hence increased significantly to about 9 mm. A theoretical model that approximates the shape of a moving drop to a spheroidal cap is developed to predict the self-transport behavior. Satisfactory agreement is shown for most regions except where the hysteresis effect is unmeasurable and an unsymmetrical deformation occurs. A double-directional gradient surface to alter the direction of movement of a droplet is also realized. The platforms we developed serve not only to transport a fluid over a long distance but also for a broad spectrum of biomedical applications such as protein adsorption, cell adhesion and DNA-based biosensors.

Diffusion with chemical reaction: An attempt to explain number density anomalies in experiments involving alkali vapor

NASA Technical Reports Server (NTRS)

Snow, W. L.

1974-01-01

The mutual diffusion of two reacting gases is examined which takes place in a bath of inert gas atoms. Solutions are obtained between concentric spheres, each sphere acting as a source for one of the reactants. The calculational model is used to illustrate severe number density gradients observed in absorption experiments with alkali vapor. Severe gradients result when sq root k/D R is approximately 5 where k, D, and R are respectively the second order rate constant, the multicomponent diffusion constant, and the geometrical dimension of the experiment.

Stray Stars Scattered in Space Artist Concept

NASA Image and Video Library

2014-11-06

This artist concept shows a view of a number of galaxies sitting in huge halos of stars. The stars are too distant to be seen individually and instead are seen as a diffuse glow, colored yellow in this illustration.

Successful use of the Cryolock device for cryopreservation of scarce human ejaculate and testicular spermatozoa.

PubMed

Stein, A; Shufaro, Y; Hadar, S; Fisch, B; Pinkas, H

2015-03-01

The existing methods for cryopreservation of very low count sperm samples are complex and sub-optimal for individual spermatozoa. Our purpose is to establish an effective simple method for cryoprotecting individual spermatozoa. Samples from patients with OTA were mixed with TYB or HEPES-buffered salt solution with glycerol + glucose and placed on a Cryolock that was plunged directly into liquid nitrogen or exposed to its vapors. Thawing was performed by direct immersion into a drop of warmed medium. The favorable method was tested on diluted samples (10-50 cells) and leftover TESE specimens from patients with azoospermia. Cryopreservation was considered successful if >30 spermatozoa, (>3 motile), or >5 spermatozoa (>1 motile) in diluted and TESE samples, were detected post-thawing. A significantly higher survival rate of seminal spermatozoa was obtained when using the Cryolock with TYB and freezing with liquid nitrogen vapor, compared to HEPES glycerol-glucose (95 vs. 35% respectively). Plunging the Cryolock into liquid nitrogen was detrimental. Cryolock combined with TYB cryoprotection and liquid nitrogen vapor freezing was highly effective for cryopreservation of individual spermatozoa in diluted and TESE samples. The Cryolock may serve for freezing very low-count sperm samples and individual spermatozoa. This method offers simplicity, efficacy, use of available materials, without requiring micromanipulation equipment or skills. © 2015 American Society of Andrology and European Academy of Andrology.

Numerical modeling of physical vapor transport under microgravity conditions: Effect of thermal creep and stress

NASA Technical Reports Server (NTRS)

Mackowski, Daniel W.; Knight, Roy W.

1993-01-01

One of the most promising applications of microgravity (micro-g) environments is the manufacture of exotic and high-quality crystals in closed cylindrical ampoules using physical vapor transport (PVT) processes. The quality enhancements are believed to be due to the absence of buoyant convection in the weightless environment - resulting in diffusion-limited transport of the vapor. In a typical experiment, solid-phase sample material is initially contained at one end of the ampoule. The sample is made to sublime into the vapor phase and deposit onto the opposite end by maintaining the source at an elevated temperature with respect to the deposit. Identification of the physical factors governing both the rates and uniformity of crystal growth, and the optimization of the micro-g technology, will require an accurate modeling of the vapor transport within the ampoule. Previous micro-g modeling efforts have approached the problem from a 'classical' convective/diffusion formulation, in which convection is driven by the action of buoyancy on thermal and solutal density differences. The general conclusion of these works have been that in low gravity environments the effect of buoyancy on vapor transport is negligible, and vapor transport occurs in a diffusion-limited mode. However, it has been recently recognized than in the non-isothermal (and often low total pressure) conditions encountered in ampoules, the commonly-assumed no-slip boundary condition to the differential equations governing fluid motion can be grossly unrepresentative of the actual situation. Specifically, the temperature gradients can give rise to thermal creep flows at the ampoule side walls. In addition, temperature gradients in the vapor itself can, through the action of thermal stress, lead to bulk fluid convection.

Assessing the potential of quartz crystal microbalance to estimate water vapor transfer in micrometric size cellulose particles.

PubMed

Thoury-Monbrun, Valentin; Gaucel, Sébastien; Rouessac, Vincent; Guillard, Valérie; Angellier-Coussy, Hélène

2018-06-15

This study aims at assessing the use of a quartz crystal microbalance (QCM) coupled with an adsorption system to measure water vapor transfer properties in micrometric size cellulose particles. This apparatus allows measuring successfully water vapor sorption kinetics at successive relative humidity (RH) steps on a dispersion of individual micrometric size cellulose particles (1 μg) with a total acquisition duration of the order of one hour. Apparent diffusivity and water uptake at equilibrium were estimated at each step of RH by considering two different particle geometries in mass transfer modeling, i.e. sphere or finite cylinder, based on the results obtained from image analysis. Water vapor diffusivity values varied from 2.4 × 10 -14  m 2  s -1 to 4.2 × 10 -12  m 2  s -1 over the tested RH range (0-80%) whatever the model used. A finite cylinder or spherical geometry could be used equally for diffusivity identification for a particle size aspect ratio lower than 2. Copyright © 2018 Elsevier Ltd. All rights reserved.

Crystallization and preliminary crystallographic analysis of the catechol 2,3-dioxygenase PheB from Bacillus stearothermophilus BR219

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sugimoto, Keisuke; Matsufuzi, Kazuki; Ohnuma, Hiroaki

2006-02-01

PheB, an extradiol-cleaving catecholic dioxygenase, was crystallized by the hanging-drop vapour-diffusion method using PEG 4000 as a precipitant. The crystal belongs to the orthorhombic system, space group P2{sub 1}2{sub 1}2{sub 1}, and diffracts to 2.3 Å resolution. Class II extradiol-cleaving catecholic dioxygenase, a key enzyme of aromatic compound degradation in bacteria, cleaves the aromatic ring of catechol by adding two O atoms. PheB is one of the class II extradiol-cleaving catecholic dioxygenases and shows a high substrate specificity for catechol derivatives, which have one aromatic ring. In order to reveal the mechanism of the substrate specificity of PheB, PheB hasmore » been crystallized by the hanging-drop vapour-diffusion method using PEG 4000 as a precipitant. The space group of the obtained crystal was P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 65.5, b = 119.2, c = 158.7 Å. The crystal diffracted to 2.3 Å resolution.« less

Crystallization and preliminary X-ray diffraction studies of choline-binding protein F from Streptococcus pneumoniae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Molina, Rafael; González, Ana; Moscoso, Miriam

2007-09-01

The modular choline-binding protein F (CbpF) from S. pneumoniae has been crystallized by the hanging-drop vapour-diffusion method. A SAD data set from a gadolinium-complex derivative has been collected to 2.1 Å resolution. Choline-binding protein F (CbpF) is a modular protein that is bound to the pneumococcal cell wall through noncovalent interactions with choline moieties of the bacterial teichoic and lipoteichoic acids. Despite being one of the more abundant proteins on the surface, along with the murein hydrolases LytA, LytB, LytC and Pce, its function is still unknown. CbpF has been crystallized using the hanging-drop vapour-diffusion method at 291 K. Diffraction-qualitymore » orthorhombic crystals belong to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 49.13, b = 114.94, c = 75.69 Å. A SAD data set from a Gd-HPDO3A-derivatized CbpF crystal was collected to 2.1 Å resolution at the gadolinium L{sub III} absorption edge using synchrotron radiation.« less

On the equilibrium contact angle of sessile liquid drops from molecular dynamics simulations.

PubMed

Ravipati, Srikanth; Aymard, Benjamin; Kalliadasis, Serafim; Galindo, Amparo

2018-04-28

We present a new methodology to estimate the contact angles of sessile drops from molecular simulations by using the Gaussian convolution method of Willard and Chandler [J. Phys. Chem. B 114, 1954-1958 (2010)] to calculate the coarse-grained density from atomic coordinates. The iso-density contour with average coarse-grained density value equal to half of the bulk liquid density is identified as the average liquid-vapor (LV) interface. Angles between the unit normal vectors to the average LV interface and unit normal vector to the solid surface, as a function of the distance normal to the solid surface, are calculated. The cosines of these angles are extrapolated to the three-phase contact line to estimate the sessile drop contact angle. The proposed methodology, which is relatively easy to implement, is systematically applied to three systems: (i) a Lennard-Jones (LJ) drop on a featureless LJ 9-3 surface; (ii) an SPC/E water drop on a featureless LJ 9-3 surface; and (iii) an SPC/E water drop on a graphite surface. The sessile drop contact angles estimated with our methodology for the first two systems are shown to be in good agreement with the angles predicted from Young's equation. The interfacial tensions required for this equation are computed by employing the test-area perturbation method for the corresponding planar interfaces. Our findings suggest that the widely adopted spherical-cap approximation should be used with caution, as it could take a long time for a sessile drop to relax to a spherical shape, of the order of 100 ns, especially for water molecules initiated in a lattice configuration on a solid surface. But even though a water drop can take a long time to reach the spherical shape, we find that the contact angle is well established much faster and the drop evolves toward the spherical shape following a constant-contact-angle relaxation dynamics. Making use of this observation, our methodology allows a good estimation of the sessile drop contact angle values even for moderate system sizes (with, e.g., 4000 molecules), without the need for long simulation times to reach the spherical shape.

On the equilibrium contact angle of sessile liquid drops from molecular dynamics simulations

NASA Astrophysics Data System (ADS)

Ravipati, Srikanth; Aymard, Benjamin; Kalliadasis, Serafim; Galindo, Amparo

2018-04-01

We present a new methodology to estimate the contact angles of sessile drops from molecular simulations by using the Gaussian convolution method of Willard and Chandler [J. Phys. Chem. B 114, 1954-1958 (2010)] to calculate the coarse-grained density from atomic coordinates. The iso-density contour with average coarse-grained density value equal to half of the bulk liquid density is identified as the average liquid-vapor (LV) interface. Angles between the unit normal vectors to the average LV interface and unit normal vector to the solid surface, as a function of the distance normal to the solid surface, are calculated. The cosines of these angles are extrapolated to the three-phase contact line to estimate the sessile drop contact angle. The proposed methodology, which is relatively easy to implement, is systematically applied to three systems: (i) a Lennard-Jones (LJ) drop on a featureless LJ 9-3 surface; (ii) an SPC/E water drop on a featureless LJ 9-3 surface; and (iii) an SPC/E water drop on a graphite surface. The sessile drop contact angles estimated with our methodology for the first two systems are shown to be in good agreement with the angles predicted from Young's equation. The interfacial tensions required for this equation are computed by employing the test-area perturbation method for the corresponding planar interfaces. Our findings suggest that the widely adopted spherical-cap approximation should be used with caution, as it could take a long time for a sessile drop to relax to a spherical shape, of the order of 100 ns, especially for water molecules initiated in a lattice configuration on a solid surface. But even though a water drop can take a long time to reach the spherical shape, we find that the contact angle is well established much faster and the drop evolves toward the spherical shape following a constant-contact-angle relaxation dynamics. Making use of this observation, our methodology allows a good estimation of the sessile drop contact angle values even for moderate system sizes (with, e.g., 4000 molecules), without the need for long simulation times to reach the spherical shape.

Approach to high quality GaN lateral nanowires and planar cavities fabricated by focused ion beam and metal-organic vapor phase epitaxy.

PubMed

Pozina, Galia; Gubaydullin, Azat R; Mitrofanov, Maxim I; Kaliteevski, Mikhail A; Levitskii, Iaroslav V; Voznyuk, Gleb V; Tatarinov, Evgeniy E; Evtikhiev, Vadim P; Rodin, Sergey N; Kaliteevskiy, Vasily N; Chechurin, Leonid S

2018-05-08

We have developed a method to fabricate GaN planar nanowires and cavities by combination of Focused Ion Beam (FIB) patterning of the substrate followed by Metal Organic Vapor Phase Epitaxy (MOVPE). The method includes depositing a silicon nitride mask on a sapphire substrate, etching of the trenches in the mask by FIB with a diameter of 40 nm with subsequent MOVPE growth of GaN within trenches. It was observed that the growth rate of GaN is substantially increased due to enhanced bulk diffusion of the growth precursor therefore the model for analysis of the growth rate was developed. The GaN strips fabricated by this method demonstrate effective luminescence properties. The structures demonstrate enhancement of spontaneous emission via formation of Fabry-Perot modes.

Assessing Sitting across Contexts: Development of the Multicontext Sitting Time Questionnaire

ERIC Educational Resources Information Center

Whitfield, Geoffrey P.; Pettee Gabriel, Kelley K.; Kohl, Harold W., III.

2013-01-01

Purpose: To describe the development and preliminary evaluation of the Multicontext Sitting Time Questionnaire (MSTQ). Method: During development of the MSTQ, contexts and domains of sitting behavior were utilized as recall cues to improve the accuracy of sitting assessment. The terms "workday" and "nonworkday" were used to…

Theoretical studies in support of the 3M-vapor transport (PVTOS-) experiments

NASA Technical Reports Server (NTRS)

Rosner, Daniel E.; Keyes, David E.

1989-01-01

Results are reported for a preliminary theoretical study of the coupled mass-, momentum-, and heat-transfer conditions expected within small ampoules used to grow oriented organic solid (OS-) films, by physical vapor transport (PVT) in microgravity environments. It is show that previous studies made restrictive assumptions (e.g., smallness of delta T/T, equality of molecular diffusivities) not valid under PVTOS conditions, whereas the important phenomena of sidewall gas creep, Soret transport of the organic vapor, and large vapor phase supersaturations associated with the large prevailing temperature gradients were not previously considered. Rational estimates are made of the molecular transport properties relevant to copper-phthalocyanine monomeric vapor in a gas mixture containing H2(g) and Xe(g). Efficient numerical methods have been developed and are outlined/illustrated here to making steady axisymmetric gas flow calculations within such ampoules, allowing for realistic realistic delta T/T(sub)w-values, and even corrections to Navier-Stokes-Fourier 'closure' for the governing continuum differential equations. High priority follow-on studies are outlined based on these new results.

Effect of water vapor on evolution of a thick Pt-layer modified oxide on the NiCoCrAl alloy at high temperature

NASA Astrophysics Data System (ADS)

Song, Peng; He, Xuan; Xiong, Xiping; Ma, Hongqing; Song, Qunling; Lü, Jianguo; Lu, Jiansheng

2018-03-01

To investigate the effect of water vapor on the novel Pt-containing oxide growth behavior, Pt-addition within the oxide layer on the surface of NiCoCrAl coating and furnace cycle tests were carried out at 1050 °C in air and air plus water vapor. The thick Pt-containing oxide layer on NiCoCrAl exhibits a different oxidation growth behavior compared to the conventional Pt-diffusion metallic coatings. The Pt-containing oxide after oxidation in air plus water vapor showed a much thicker oxide layer compare to the ones without Pt addition, and also presented a much better coating adhesion. During the oxidation process in air, Pt promotes the spinel (NiCr2O4) formation. However, the Cr2O3 formed in air with water vapor and fixed Pt within the complex oxide layer. The water vapor promoted the Ni and Co outer-diffusion, and combined with Pt to form CoPt compounds on the surface of the NiCoCrAl coating system.

Electrochemistry in an acoustically levitated drop.

PubMed

Chainani, Edward T; Ngo, Khanh T; Scheeline, Alexander

2013-02-19

Levitated drops show potential as microreactors, especially when radicals are present as reactants or products. Solid/liquid interfaces are absent or minimized, avoiding adsorption and interfacial reaction of conventional microfluidics. We report amperometric detection in an acoustically levitated drop with simultaneous ballistic addition of reactant. A gold microelectrode sensor was fabricated with a lithographic process; active electrode area was defined by a photosensitive polyimide mask. The microdisk gold working electrode of radius 19 μm was characterized using ferrocenemethanol in aqueous buffer. Using cyclic voltammetry, the electrochemically active surface area was estimated by combining a recessed microdisk electrode model with the Randles-Sevcik equation. Computer-controlled ballistic introduction of reactant droplets into the levitated drop was developed. Chronoamperometric measurements of ferrocyanide added ballistically demonstrate electrochemical monitoring using the microfabricated electrode in a levitated drop. Although concentration increases with time due to drop evaporation, the extent of concentration is predictable with a linear evaporation model. Comparison of diffusion-limited currents in pendant and levitated drops show that convection arising from acoustic levitation causes an enhancement of diffusion-limited current on the order of 16%.

Semiempirical self-consistent polarization description of bulk water, the liquid-vapor interface, and cubic ice.

PubMed

Murdachaew, Garold; Mundy, Christopher J; Schenter, Gregory K; Laino, Teodoro; Hutter, Jürg

2011-06-16

We have applied an efficient electronic structure approach, the semiempirical self-consistent polarization neglect of diatomic differential overlap (SCP-NDDO) method, previously parametrized to reproduce properties of water clusters by Chang, Schenter, and Garrett [ J. Chem. Phys. 2008 , 128 , 164111 ] and now implemented in the CP2K package, to model ambient liquid water at 300 K (both the bulk and the liquid-vapor interface) and cubic ice at 15 and 250 K. The SCP-NDDO potential retains its transferability and good performance across the full range of conditions encountered in the clusters and the bulk phases of water. In particular, we obtain good results for the density, radial distribution functions, enthalpy of vaporization, self-diffusion coefficient, molecular dipole moment distribution, and hydrogen bond populations, in comparison to experimental measurements. © 2011 American Chemical Society

An incomplete assembly with thresholding algorithm for systems of reaction-diffusion equations in three space dimensions IAT for reaction-diffusion systems

NASA Astrophysics Data System (ADS)

Moore, Peter K.

2003-07-01

Solving systems of reaction-diffusion equations in three space dimensions can be prohibitively expensive both in terms of storage and CPU time. Herein, I present a new incomplete assembly procedure that is designed to reduce storage requirements. Incomplete assembly is analogous to incomplete factorization in that only a fixed number of nonzero entries are stored per row and a drop tolerance is used to discard small values. The algorithm is incorporated in a finite element method-of-lines code and tested on a set of reaction-diffusion systems. The effect of incomplete assembly on CPU time and storage and on the performance of the temporal integrator DASPK, algebraic solver GMRES and preconditioner ILUT is studied.

Hidden marker position estimation during sit-to-stand with walker.

PubMed

Yoon, Sang Ho; Jun, Hong Gul; Dan, Byung Ju; Jo, Byeong Rim; Min, Byung Hoon

2012-01-01

Motion capture analysis of sit-to-stand task with assistive device is hard to achieve due to obstruction on reflective makers. Previously developed robotic system, Smart Mobile Walker, is used as an assistive device to perform motion capture analysis in sit-to-stand task. All lower limb markers except hip markers are invisible through whole session. The link-segment and regression method is applied to estimate the marker position during sit-to-stand. Applying a new method, the lost marker positions are restored and the biomechanical evaluation of the sit-to-stand movement with a Smart Mobile Walker could be carried out. The accuracy of the marker position estimation is verified with normal sit-to-stand data from more than 30 clinical trials. Moreover, further research on improving the link segment and regression method is addressed.

Monitoring water phase dynamics in winter clouds

NASA Astrophysics Data System (ADS)

Campos, Edwin F.; Ware, Randolph; Joe, Paul; Hudak, David

2014-10-01

This work presents observations of water phase dynamics that demonstrate the theoretical Wegener-Bergeron-Findeisen concepts in mixed-phase winter storms. The work analyzes vertical profiles of air vapor pressure, and equilibrium vapor pressure over liquid water and ice. Based only on the magnitude ranking of these vapor pressures, we identified conditions where liquid droplets and ice particles grow or deplete simultaneously, as well as the conditions where droplets evaporate and ice particles grow by vapor diffusion. The method is applied to ground-based remote-sensing observations during two snowstorms, using two distinct microwave profiling radiometers operating in different climatic regions (North American Central High Plains and Great Lakes). The results are compared with independent microwave radiometer retrievals of vertically integrated liquid water, cloud-base estimates from a co-located ceilometer, reflectivity factor and Doppler velocity observations by nearby vertically pointing radars, and radiometer estimates of liquid water layers aloft. This work thus makes a positive contribution toward monitoring and nowcasting the evolution of supercooled droplets in winter clouds.

Monitoring water phase dynamics in winter clouds

DOE PAGES

Campos, Edwin F.; Ware, Randolph; Joe, Paul; ...

2014-10-01

This work presents observations of water phase dynamics that demonstrate the theoretical Wegener–Bergeron–Findeisen concepts in mixed-phase winter storms. The work analyzes vertical profiles of air vapor pressure, and equilibrium vapor pressure over liquid water and ice. Based only on the magnitude ranking of these vapor pressures, we identified conditions where liquid droplets and ice particles grow or deplete simultaneously, as well as the conditions where droplets evaporate and ice particles grow by vapor diffusion. The method is applied to ground-based remote-sensing observations during two snowstorms, using two distinct microwave profiling radiometers operating in different climatic regions (North American Central Highmore » Plains and Great Lakes). The results are compared with independent microwave radiometer retrievals of vertically integrated liquid water, cloud-base estimates from a co-located ceilometer, reflectivity factor and Doppler velocity observations by nearby vertically pointing radars, and radiometer estimates of liquid water layers aloft. This work thus makes a positive contribution toward monitoring and now casting the evolution of supercooled droplets in winter clouds.« less

In situ study of mass transfer in aqueous solutions under high pressures via Raman spectroscopy: A new method for the determination of diffusion coefficients of methane in water near hydrate formation conditions

USGS Publications Warehouse

Lu, W.J.; Chou, I.-Ming; Burruss, R.C.; Yang, M.Z.

2006-01-01

A new method was developed for in situ study of the diffusive transfer of methane in aqueous solution under high pressures near hydrate formation conditions within an optical capillary cell. Time-dependent Raman spectra of the solution at several different spots along the one-dimensional diffusion path were collected and thus the varying composition profile of the solution was monitored. Diffusion coefficients were estimated by the least squares method based on the variations in methane concentration data in space and time in the cell. The measured diffusion coefficients of methane in water at the liquid (L)-vapor (V) stable region and L-V metastable region are close to previously reported values determined at lower pressure and similar temperature. This in situ monitoring method was demonstrated to be suitable for the study of mass transfer in aqueous solution under high pressure and at various temperature conditions and will be applied to the study of nucleation and dissolution kinetics of methane hydrate in a hydrate-water system where the interaction of methane and water would be more complicated than that presented here for the L-V metastable condition. ?? 2006 Society for Applied Spectroscopy.

Diesel engine emissions and combustion predictions using advanced mixing models applicable to fuel sprays

NASA Astrophysics Data System (ADS)

Abani, Neerav; Reitz, Rolf D.

2010-09-01

An advanced mixing model was applied to study engine emissions and combustion with different injection strategies ranging from multiple injections, early injection and grouped-hole nozzle injection in light and heavy duty diesel engines. The model was implemented in the KIVA-CHEMKIN engine combustion code and simulations were conducted at different mesh resolutions. The model was compared with the standard KIVA spray model that uses the Lagrangian-Drop and Eulerian-Fluid (LDEF) approach, and a Gas Jet spray model that improves predictions of liquid sprays. A Vapor Particle Method (VPM) is introduced that accounts for sub-grid scale mixing of fuel vapor and more accurately and predicts the mixing of fuel-vapor over a range of mesh resolutions. The fuel vapor is transported as particles until a certain distance from nozzle is reached where the local jet half-width is adequately resolved by the local mesh scale. Within this distance the vapor particle is transported while releasing fuel vapor locally, as determined by a weighting factor. The VPM model more accurately predicts fuel-vapor penetrations for early cycle injections and flame lift-off lengths for late cycle injections. Engine combustion computations show that as compared to the standard KIVA and Gas Jet spray models, the VPM spray model improves predictions of in-cylinder pressure, heat released rate and engine emissions of NOx, CO and soot with coarse mesh resolutions. The VPM spray model is thus a good tool for efficiently investigating diesel engine combustion with practical mesh resolutions, thereby saving computer time.

Macrokinetics of carbon nanotubes synthesis by the chemical vapor deposition method

NASA Astrophysics Data System (ADS)

Rukhov, Artem; Dyachkova, Tatyana; Tugolukov, Evgeny; Besperstova, Galina

2017-11-01

A new approach to studying and developing basic processes which take place on the surface of a metal catalyst during the thermal decomposition of carbonaceous substances in the carbon nanotubes synthesis by the chemical vapor deposition method was proposed. In addition, an analysis was made of the interrelationships between these thermal, diffusion, hydrodynamic and other synthesis processes. A strong effect of the catalyst regeneration stage on the stage of nanotube formation has been shown. Based on the developed approach, a mathematical model was elaborated. Comparison of the calculation and the experiment carried out with the NiO-MgO catalyst at propane flow rate of 50 mL/min (standard conditions) and ethanol flow rate 0.3 mL/min (liq.) has revealed a discrepancy of less than 10%.

Synthesis of alloys with controlled phase structure

DOEpatents

Guthrie, Stephen Everett; Thomas, George John; Bauer, Walter; Yang, Nancy Yuan Chi

1999-04-20

A method for preparing controlled phase alloys useful for engineering and hydrogen storage applications. This novel method avoids melting the constituents by employing vapor transport, in a hydrogen atmosphere, of an active metal constituent, having a high vapor pressure at temperatures .apprxeq.300 C. and its subsequent condensation on and reaction with the other constituent (substrate) of an alloy thereby forming a controlled phase alloy and preferably a single phase alloy. It is preferred that the substrate material be a metal powder such that diffusion of the active metal constituent, preferably magnesium, and reaction therewith can be completed within a reasonable time and at temperatures .apprxeq.300 C. thereby avoiding undesirable effects such as sintering, local compositional inhomogeneities, segregation, and formation of unwanted second phases such as intermetallic compounds.

Synthesis of alloys with controlled phase structure

DOEpatents

Guthrie, S.E.; Thomas, G.J.; Bauer, W.; Yang, N.Y.C.

1999-04-20

A method is described for preparing controlled phase alloys useful for engineering and hydrogen storage applications. This novel method avoids melting the constituents by employing vapor transport, in a hydrogen atmosphere, of an active metal constituent, having a high vapor pressure at temperatures {approx_equal}300 C and its subsequent condensation on and reaction with the other constituent (substrate) of an alloy thereby forming a controlled phase alloy and preferably a single phase alloy. It is preferred that the substrate material be a metal powder such that diffusion of the active metal constituent, preferably magnesium, and reaction therewith can be completed within a reasonable time and at temperatures {approx_equal}300 C thereby avoiding undesirable effects such as sintering, local compositional inhomogeneities, segregation, and formation of unwanted second phases such as intermetallic compounds. 4 figs.

Evaluation of moisture ingress from the perimeter of photovoltaic modules: Evaluation of moisture ingress

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kempe, Michael D.; Dameron, Arrelaine A.; Reese, Matthew O.

2013-05-14

Many thin film photovoltaic (PV) technologies can be sensitive to corrosion induced by the presence of water vapor in the packaging materials. Typically impermeable front and backsheets are used in conjunction with an edge-seal around the perimeter to prevent water vapor ingress. These edge-seal materials are often made of a polyisobutylene resin filled with desiccant, which dramatically increases the time for moisture to reach sensitive module components. While edge-seals can prevent moisture ingress, even the lowest diffusivity transparent encapsulant materials are insufficient for the lifetime of a module. To evaluate the performance of edge-seal and encapsulant materials in a mannermore » that simulates their function in a PV module, an optical method was devised where ingress is detected by reaction of a Ca film with water. Using this method, we have exposed test samples to heat and humidity allowing quantitative comparison of different edge-seal and encapsulant materials. Next, we use measurements of polymer diffusivity and solubility to evaluate the ability to model this moisture ingress. Here, we find good agreement between these two methods highlighting the much greater ability of polyisobutylene materials to keep moisture out as compared with typical encapsulant materials used in the PV industry.« less

Finite Element Analysis Modeling of Chemical Vapor Deposition of Silicon Carbide

DTIC Science & Technology

2014-06-19

thesis primarily focuses on mass transport by gas -phase flow and diffusion , chemical reaction in gas phase and on solid surfaces, and thin film...chemical vapor deposition (CVD). This thesis primarily focuses on mass transport by gas -phase flow and diffusion , chemical reaction in gas phase and...9 Fluid Flow…………………………………………..…………………..…………….9 Thermodynamics………………………………………..………………….….…….11 Chemical Reaction and Diffusion

Comparison of numerical simulation and experimental data for steam-in-place sterilization

NASA Technical Reports Server (NTRS)

Young, Jack H.; Lasher, William C.

1993-01-01

A complex problem involving convective flow of a binary mixture containing a condensable vapor and noncondensable gas in a partially enclosed chamber was modelled and results compared to transient experimental values. The finite element model successfully predicted transport processes in dead-ended tubes with inside diameters of 0.4 to 1.0 cm. When buoyancy driven convective flow was dominant, temperature and mixture compositions agreed with experimental data. Data from 0.4 cm tubes indicate diffusion to be the primary air removal method in small diameter tubes and the diffusivity value in the model to be too large.

New explicit equations for the accurate calculation of the growth and evaporation of hydrometeors by the diffusion of water vapor

NASA Technical Reports Server (NTRS)

Srivastava, R. C.; Coen, J. L.

1992-01-01

The traditional explicit growth equation has been widely used to calculate the growth and evaporation of hydrometeors by the diffusion of water vapor. This paper reexamines the assumptions underlying the traditional equation and shows that large errors (10-30 percent in some cases) result if it is used carelessly. More accurate explicit equations are derived by approximating the saturation vapor-density difference as a quadratic rather than a linear function of the temperature difference between the particle and ambient air. These new equations, which reduce the error to less than a few percent, merit inclusion in a broad range of atmospheric models.

Science 101: What Is the Difference between Solids and Liquids?

ERIC Educational Resources Information Center

Robertson, Bill

2013-01-01

Figuring out the difference between liquids and solids seems like a silly question at first. After all, don't we know that liquids do not have a definite shape and therefore assume the shape of their container? Place a drop of water in a short glass. Does this water take the shape of the glass? Nope. It just sits there on the bottom of the…

Standing and sitting adlayers in atomic layer deposition of ZnO

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gao, Zhengning; Banerjee, Parag, E-mail: parag.banerjee@wustl.edu; Wu, Fei

The extent of reactivity of diethyl zinc (DEZ) with a hydroxylated surface during atomic layer deposition (ALD) of ZnO using DEZ and water is measured. Two adlayer configurations of DEZ are possible. The “standing” adlayer releases one ethyl group from DEZ. The “sitting” adlayer releases both ethyl groups, thus forming a Zn bridge between two O anions. Density functional theory calculations suggest the sitting configuration is more stable than the standing configuration by 790 meV. In situ quadrupole mass spectroscopy of by-product ethane generated in ALD half cycles indicate that ∼1.56 OH sites react with a DEZ molecule resulting in 71.6%more » of sitting sites. A simple simulation of a “ball-and-stick” DEZ molecule randomly collapsing on a neighboring site remarkably captures this adlayer behavior. It is concluded that DEZ fraction sitting is a competitive process of a standing DEZ molecule collapsing onto an available neighboring hydroxyl site, as sites vie for occupancy via adsorption and surface diffusion.« less

Theoretical Basis for Estimated Test Times and Conditions for Drop Tower and Space-Based Droplet Burning Experiments With Methanol and N-Heptane

NASA Technical Reports Server (NTRS)

Marchese, Anthony J.; Dryer, Fredrick L.; Choi, Mun Y.

1994-01-01

In order to develop an extensive envelope of test conditions for NASA's space-based Droplet Combustion Experiment (DCE) as well those droplet experiments which can be performed using a drop tower, the transient vaporization and combustion of methanol and n-heptane droplets were simulated using a recently developed fully time-dependent, spherically symmetric droplet combustion model. The transient vaporization of methanol and n-heptane was modeled to characterize the instantaneous gas phase composition surrounding the droplet prior to the introduction of an ignition source. The results for methanol/air showed that the entire gas phase surrounding a 2 mm methanol droplet deployed in zero-g .quickly falls outside the lean flammability limit. The gas phase surrounding an identically-sized n-heptane droplet, on the other hand, remains flammable. The combustion of methanol was then modeled considering a detailed gas phase chemical kinetic mechanism (168 steps, 26 species) and the effect of the dissolution of flame-generated water into the liquid droplet. These results were used to determine the critical ignition diameter required to achieve quasi-steady droplet combustion in a given oxidizing environment. For droplet diameters greater than the critical ignition diameter, the model predicted a finite diameter at which the flame would extinguish. These extinction diameters were found to vary significantly with initial droplet diameter. This phenomenon appears to be unique to the transient heat transfer, mass transfer and chemical kinetics of the system and thus has not been reported elsewhere to date. The extinction diameter was also shown to vary significantly with the liquid phase Lewis number since the amount of water present in the droplet at extinction is largely governed by the rate at which water is transported into the droplet via mass diffusion. Finally, the numerical results for n-heptane combustion were obtained using both 2 step and 96 step semi-emperical chemical kinetic mechanisms. Neither mechanism exhibited the variation of extinction diameter with initial diameter.

Water vapor distribution in protoplanetary disks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Du, Fujun; Bergin, Edwin A., E-mail: fdu@umich.edu

Water vapor has been detected in protoplanetary disks. In this work, we model the distribution of water vapor in protoplanetary disks with a thermo-chemical code. For a set of parameterized disk models, we calculate the distribution of dust temperature and radiation field of the disk with a Monte Carlo method, and then solve the gas temperature distribution and chemical composition. The radiative transfer includes detailed treatment of scattering by atomic hydrogen and absorption by water of Lyα photons, since the Lyα line dominates the UV spectrum of accreting young stars. In a fiducial model, we find that warm water vapormore » with temperature around 300 K is mainly distributed in a small and well-confined region in the inner disk. The inner boundary of the warm water region is where the shielding of UV field due to dust and water itself become significant. The outer boundary is where the dust temperature drops below the water condensation temperature. A more luminous central star leads to a more extended distribution of warm water vapor, while dust growth and settling tends to reduce the amount of warm water vapor. Based on typical assumptions regarding the elemental oxygen abundance and the water chemistry, the column density of warm water vapor can be as high as 10{sup 22} cm{sup –2}. A small amount of hot water vapor with temperature higher than ∼300 K exists in a more extended region in the upper atmosphere of the disk. Cold water vapor with temperature lower than 100 K is distributed over the entire disk, produced by photodesorption of the water ice.« less

Corrosion-Mitigating, Bondable, Fluorinated Barrier Coating for Anodized Magnesium

DTIC Science & Technology

2016-05-01

transport the precursor vapor throughout the study was set at 9,500 sccm. The setup also incorporated a 38- × 54- × 0.6-cm stainless steel moveable...evaporated and that silane crosslinking had occurred, samples were allowed to sit uncovered in a fume hood for 1 h prior to electrochemical...measurement, contact-angle measurement, or plasma treatment. Samples were stored in a fume hood for approximately 24 h before applying an epoxy topcoat

Elastomeric Materials for Acoustical Applications

DTIC Science & Technology

1989-09-15

pfa UAtuWt.1. for Ado.iuatal Applvaations 828, 28n. •uaring Outdo t ho014 )I"PonL 1notoHMora, 6 U, I, 1. o4ront. dJo fmourg A Oo., |mtbaomer hmiaogyD...34Permeation, Diffusion, and Sorption of Gases and Vapors," in Methods of Experimental Phycics, 10 R. A. Fava, ed. (Academic Press, New York, 1981

Numerical simulation of transient, incongruent vaporization induced by high power laser

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsai, C.H.

1981-01-01

A mathematical model and numerical calculations were developed to solve the heat and mass transfer problems specifically for uranum oxide subject to laser irradiation. It can easily be modified for other heat sources or/and other materials. In the uranium-oxygen system, oxygen is the preferentially vaporizing component, and as a result of the finite mobility of oxygen in the solid, an oxygen deficiency is set up near the surface. Because of the bivariant behavior of uranium oxide, the heat transfer problem and the oxygen diffusion problem are coupled and a numerical method of simultaneously solving the two boundary value problems ismore » studied. The temperature dependence of the thermal properties and oxygen diffusivity, as well as the highly ablative effect on the surface, leads to considerable non-linearities in both the governing differential equations and the boundary conditions. Based on the earlier work done in this laboratory by Olstad and Olander on Iron and on Zirconium hydride, the generality of the problem is expanded and the efficiency of the numerical scheme is improved. The finite difference method, along with some advanced numerical techniques, is found to be an efficient way to solve this problem.« less

Cooling by conversion of para to ortho-hydrogen

NASA Technical Reports Server (NTRS)

Sherman, A. (Inventor)

1983-01-01

The cooling capacity of a solid hydrogen cooling system is significantly increased by exposing vapor created during evaporation of a solid hydrogen mass to a catalyst and thereby accelerating the endothermic para-to-ortho transition of the vapor to equilibrium hydrogen. Catalyst such as nickel, copper, iron or metal hydride gels of films in a low pressure drop catalytic reactor are suitable for accelerating the endothermic para-to-ortho conversion.

Laboratory Evaluation of Drop-in Solvent Alternatives to n-Propyl Bromide for Vapor Degreasing

NASA Technical Reports Server (NTRS)

Mitchell, Mark A.; Lowrey, Nikki M.

2012-01-01

Based on this limited laboratory study, solvent blends of trans-1,2 dichloroethylene with HFEs, HFCs, or PFCs appear to be viable alternatives to n-propyl bromide for vapor degreasing. The lower boiling points of these blends may lead to greater solvent loss during use. Additional factors must be considered when selecting a solvent substitute, including stability over time, VOC, GWP, toxicity, and business considerations.

Metallic diffusion measured by a modified Knudsen technique

NASA Technical Reports Server (NTRS)

Fray, D. J.

1969-01-01

Diffusion coefficient of a metal in high temperature system is determined. From the measurement of the weight loss from a Knudsen cell, the vapor pressure of the escaping species can be calculated. If the only way this species can enter the Knudsen cell is by diffusion through a foil, the weight loss is diffusion flux.

Quantification of vapor intrusion pathways into a slab-on-ground building under varying environmental conditions.

PubMed

Patterson, Bradley M; Davis, Greg B

2009-02-01

Potential hydrocarbon-vapor intrusion pathways into a building through a concrete slab-on-ground were investigated and quantified under a variety of environmental conditions to elucidate the potential mechanisms for indoor air contamination. Vapor discharge from the uncovered open ground soil adjacent to the building and subsequent advection into the building was unlikely due to the low soil-gas concentrations at the edge of the building as a result of aerobic biodegradation of hydrocarbon vapors. When the building's interior was under ambient pressure, a flux of vapors into the building due to molecular diffusion of vapors through the building's concrete slab (cyclohexane 11 and methylcyclohexane 31 mg m(-2) concrete slab day(-1)) and short-term (up to 8 h) cyclical pressure-driven advection of vapors through an artificial crack (cyclohexane 4.2 x 10(3) and methylcyclohexane 1.2 x 10(4) mg m(-2) cracks day(-1)) was observed. The average subslab vapor concentration under the center of the building was 25,000 microg L(-1). Based on the measured building's interiorvapor concentrations and the building's air exchange rate of 0.66 h(-1), diffusion of vapors through the concrete slab was the dominantvapor intrusion pathway and cyclical pressure exchanges resulted in a near zero advective flux. When the building's interior was under a reduced pressure (-12 Pa), advective transport through cracks or gaps in the concrete slab (cyclohexane 340 and methylcyclohexane 1100 mg m(-2) cracks day(-1)) was the dominant vapor intrusion pathway.

Development of a primary diffusion source of organic vapors for gas analyzer calibration

NASA Astrophysics Data System (ADS)

Lecuna, M.; Demichelis, A.; Sassi, G.; Sassi, M. P.

2018-03-01

The generation of reference mixtures of volatile organic compounds (VOCs) at trace levels (10 ppt-10 ppb) is a challenge for both environmental and clinical measurements. The calibration of gas analyzers for trace VOC measurements requires a stable and accurate source of the compound of interest. The dynamic preparation of gas mixtures by diffusion is a suitable method for fulfilling these requirements. The estimation of the uncertainty of the molar fraction of the VOC in the mixture is a key step in the metrological characterization of a dynamic generator. The performance of a dynamic generator was monitored over a wide range of operating conditions. The generation system was simulated by a model developed with computational fluid dynamics and validated against experimental data. The vapor pressure of the VOC was found to be one of the main contributors to the uncertainty of the diffusion rate and its influence at 10-70 kPa was analyzed and discussed. The air buoyancy effect and perturbations due to the weighing duration were studied. The gas carrier flow rate and the amount of liquid in the vial were found to play a role in limiting the diffusion rate. The results of sensitivity analyses were reported through an uncertainty budget for the diffusion rate. The roles of each influence quantity were discussed. A set of criteria to minimize the uncertainty contribution to the primary diffusion source (25 µg min-1) were estimated: carrier gas flow rate higher than 37.7 sml min-1, a maximum VOC liquid mass decrease in the vial of 4.8 g, a minimum residual mass of 1 g and vial weighing times of 1-3 min. With this procedure a limit uncertainty of 0.5% in the diffusion rate can be obtained for VOC mixtures at trace levels (10 ppt-10 ppb), making the developed diffusion vials a primary diffusion source with potential to become a new reference material for trace VOC analysis.

Evaporation-triggered microdroplet nucleation and the four life phases of an evaporating Ouzo drop

NASA Astrophysics Data System (ADS)

Tan, Huanshu; Diddens, Christian; Lv, Pengyu; Kuerten, J. G. M.; Zhang, Xuehua; Lohse, Detlef

2016-11-01

Evaporating liquid droplets are omnipresent in nature and technology, such as in inkjet printing, coating, deposition of materials, medical diagnostics, agriculture, the food industry, cosmetics, or spills of liquids. Here we show that the evaporation of such ternary mixtures can trigger a phase transition and the nucleation of microdroplets of one of the components of the mixture. As a model system, we pick a sessile Ouzo droplet (as known from daily life) and reveal and theoretically explain its four life phases: In phase I, the spherical cap-shaped droplet remains transparent while the more volatile ethanol is evaporating, preferentially at the rim of the drop because of the singularity there. This leads to a local ethanol concentration reduction and correspondingly to oil droplet nucleation there. This is the beginning of phase II, in which oil microdroplets quickly nucleate in the whole drop, leading to its milky color that typifies the so-called "Ouzo effect." Once all ethanol has evaporated, the drop, which now has a characteristic nonspherical cap shape, has become clear again, with a water drop sitting on an oil ring (phase III), finalizing the phase inversion. Finally, in phase IV, all water has evaporated, leaving behind a tiny spherical cap-shaped oil drop.

TEMPERATURE DISTRIBUTION IN A DIFFUSION CLOUD CHAMBER

DOE Office of Scientific and Technical Information (OSTI.GOV)

Slavic, I.; Szymakowski, J.; Stachorska, D.

1961-03-01

A diffusion cloud chamber with working conditions within a pressure range from 10 mm Hg to 2 atmospheres and at variable boundary surface temperatures in a wide interval is described. A simple procedure is described for cooling and thermoregulating the bottom of the chamber by means of vapor flow of liquid air which makes possible the achievement of temperature up to -120 deg C with stability better that plus or minus 1 deg C. A method for the measurement of temperature distribution by means of a thermistor is described, and a number of curves of the observed temperature gradient, dependentmore » on the boundary surface temperature is given. Analysis of other factors influencing the stable work of the diffusion cloud chamber was made. (auth)« less

Method and apparatus for flash evaporation of liquids

DOEpatents

Bharathan, Desikan

1984-01-01

A vertical tube flash evaporator for introducing a superheated liquid into a flash evaporation chamber includes a vertical inlet tube with a flared diffuser portion at its upper outlet end. A plurality of annular screens are positioned in axially spaced-apart relation to each other around the periphery of the vertical tube and below the diffuser portion thereof. The screens are preferably curved upward in a cup-shaped configuration. These flash evaporators are shown in an ocean thermal energy conversion unit designed for generating electric power from differential temperature gradients in ocean water. The method of use of the flash evaporators of this invention includes flowing liquid upwardly through the vertical tube into the diffuser where initial expansion and boiling occurs quite violently and explosively. Unvaporized liquid sheets and drops collide with each other to enhance surface renewal and evaporation properties, and liquid flowing over the outlet end of the diffuser falls onto the curved screens for further surface renewal and evaporation.

Method and apparatus for flash evaporation of liquids

DOEpatents

Bharathan, D.

1984-01-01

A vertical tube flash evaporator for introducing a super-heated liquid into a flash evaporation chamber includes a vertical inlet tube with a flared diffuser portion at its upper outlet end. A plurality of annular screens are positioned in axially spaced-apart relation to each other around the periphery of the vertical tube and below the diffuser portion thereof. The screens are preferably curved upward in a cup-shaped configuration. These flash evaporators are shown in an ocean thermal energy conversion unit designed for generating electric power from differential temperature gradients in ocean water. The method of use of the flash evaporators of this invention includes flowing liquid upwardly through the vertical tube into the diffuser where initial expansion and boiling occurs quite violently and explosively. Unvaporized liquid sheets and drops collide with each other to enhance surface renewal and evaporation properties, and liquid flowing over the outlet end of the diffuser falls onto the curved screens for further surface renewal and evaporation.

Structure of Mesorhizobium loti arylamine N-acetyltransferase 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Holton, Simon J.; Dairou, Julien; Sandy, James

2005-01-01

The crystal structure of a M. loti arylamine N-acetyltransferase 1 has been determined at 2.0 Å resolution. The arylamine N-acetyltransferase (NAT) enzymes have been found in a broad range of both eukaryotic and prokaryotic organisms. The NAT enzymes catalyse the transfer of an acetyl group from acetyl Co-enzyme A onto the terminal nitrogen of a range of arylamine, hydrazine and arylhydrazine compounds. Recently, several NAT structures have been reported from different prokaryotic sources including Salmonella typhimurium, Mycobacterium smegmatis and Pseudomonas aeruginosa. Bioinformatics analysis of the Mesorhizobium loti genome revealed two NAT paralogues, the first example of multiple NAT isoenzymes inmore » a eubacterial organism. The M. loti NAT 1 enzyme was recombinantly expressed and purified for X-ray crystallographic studies. The purified enzyme was crystallized in 0.5 M Ca(OAc){sub 2}, 16% PEG 3350, 0.1 M Tris–HCl pH 8.5 using the sitting-drop vapour-diffusion method. A data set diffracting to 2.0 Å was collected from a single crystal at 100 K. The crystal belongs to the orthorhombic spacegroup P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 53.2, b = 97.3, c = 114.3 Å. The structure was refined to a final free-R factor of 24.8%. The structure reveals that despite low sequence homology, M. loti NAT1 shares the common fold as reported in previous NAT structures and exhibits the same catalytic triad of residues (Cys-His-Asp) in the active site.« less

Structure of the newly found green turtle egg-white ribonuclease.

PubMed

Katekaew, Somporn; Kuaprasert, Buabarn; Torikata, Takao; Kakuta, Yoshimitsu; Kimura, Makoto; Yoneda, Kazunari; Araki, Tomohiro

2010-07-01

Marine green turtle (Chelonia mydas) egg-white ribonuclease (GTRNase) was crystallized from 1.1 M ammonium sulfate pH 5.5 and 30% glycerol using the sitting-drop vapour-diffusion method. The structure of GTRNase has been solved at 1.60 A resolution by the molecular-replacement technique using a model based on the structure of RNase 5 (murine angiogenin) from Mus musculus (46% identity). The crystal belonged to the monoclinic space group C2, with unit-cell parameters a = 86.271, b = 34.174, c = 39.738 A, alpha = 90, beta = 102, gamma = 90 degrees . GTRNase consists of three helices and seven beta-strands and displays the alpha+beta folding topology typical of a member of the RNase A superfamily. Superposition of the C(alpha) coordinates of GTRNase and RNase A superfamily members indicates that the overall structure is highly similar to that of angiogenin or RNase 5 from M. musculus (PDB code 2bwl) and RNase A from Bos taurus (PDB code 2blz), with root-mean-square deviations of 3.9 and 2.0 A, respectively. The catalytic residues are conserved with respect to the RNase A superfamily. The three disulfide bridges observed in the reptilian enzymes are conserved in GTRNase, while one further disulfide bond is required for the structural stability of mammalian RNases. GTRNase is expressed in egg white and the fact that its sequence has the highest similarity to that of snapping turtle pancreatic RNase suggests that the GTRNase secreted from oviduct cells to form egg white is probably the product of the same gene as activated in pancreatic cells.

Byproduct-free mass production of compound semiconductor nanowires: zinc phosphide

NASA Astrophysics Data System (ADS)

Chen, Yixi; Polinnaya, Rakesh; Vaddiraju, Sreeram

2018-05-01

A method for the mass production of compound semiconductor nanowires that involves the direct reaction of component elements in a chemical vapor deposition chamber (CVD) is presented. This method results in nanowires, without the associated production of any other byproducts such as nanoparticles or three-dimensional (3D) bulk crystals. Furthermore, no unreacted reactants remain mixed with the nanowire product in this method. This byproduct-free nanowire production thus circumvents the need to tediously purify and collect nanowires from a mixture of products/reactants after their synthesis. Demonstration made using zinc phosphide (Zn3P2) material system as an example indicated that the direct reaction of zinc microparticles with phosphorus supplied via the vapor phase results in the production of gram quantities of nanowires. To enhance thermal transport and achieve the complete reaction of zinc microparticles, while simultaneously ensuring that the microparticles do not agglomerate into macroscale zinc particles and partly remain unreacted (owing to diffusion limitations), pellets composed of mixtures of zinc and a sacrificial salt, NH4Cl, were employed as the starting material. The sublimation by decomposition of NH4Cl in the early stages of the reaction leaves a highly porous pellet of zinc composed of only zinc microparticles, which allows for inward diffusion of phosphorus/outward diffusion of zinc and the complete conversion of zinc into Zn3P2 nanowires. NH4Cl also aids in removal of any native oxide layer present on the zinc microparticles that may prevent their reaction with phosphorus. This method may be used to mass produce many other nanowires in a byproduct-free manner, besides Zn3P2.

High-throughput liquid-absorption air-sampling apparatus and methods

DOEpatents

Zaromb, Solomon

2000-01-01

A portable high-throughput liquid-absorption air sampler [PHTLAAS] has an asymmetric air inlet through which air is drawn upward by a small and light-weight centrifugal fan driven by a direct current motor that can be powered by a battery. The air inlet is so configured as to impart both rotational and downward components of motion to the sampled air near said inlet. The PHTLAAS comprises a glass tube of relatively small size through which air passes at a high rate in a swirling, highly turbulent motion, which facilitates rapid transfer of vapors and particulates to a liquid film covering the inner walls of the tube. The pressure drop through the glass tube is <10 cm of water, usually <5 cm of water. The sampler's collection efficiency is usually >20% for vapors or airborne particulates in the 2-3.mu. range and >50% for particles larger than 4.mu.. In conjunction with various analyzers, the PHTLAAS can serve to monitor a variety of hazardous or illicit airborne substances, such as lead-containing particulates, tritiated water vapor, biological aerosols, or traces of concealed drugs or explosives.

Agreement between experimental and theoretical effects of nitrogen gas flowrate on liquid jet atomization

NASA Technical Reports Server (NTRS)

Ingebo, Robert D.

1987-01-01

Two-phase flows were investigated by using high velocity nitrogen gas streams to atomize small-diameter liquid jets. Tests were conducted primarily in the acceleration-wave regime for liquid jet atomization, where it was found that the loss of droplets due to vaporization had a marked effect on drop size measurements. In addition, four identically designed two-fluid atomizers were fabricated and tested for similarity of spray profiles. A scattered-light scanner was used to measure a characteristic drop diameter, which was correlated with nitrogen gas flowrate. The exponent of 1.33 for nitrogen gas flowrate is identical to that predicted by atomization theory for liquid jet breakup in the acceleration-wave regime. This is higher than the value of 1.2 which was previously obtained at a sampling distance of 4.4 cm downstream of the atomizer. The difference is attributed to the fact that drop-size measurements obtained at a 2.2 cm sampling distance are less effected by vaporization and dispersion of small droplets and therefore should give better agreement with atomization theory. Profiles of characteristic drop diameters were also obtained by making at least five line-of-sight measurements across the spray at several horizontal positions above and below the center line of the spray.

Agreement between experimental and theoretical effects of nitrogen gas flowrate on liquid jet atomization

NASA Technical Reports Server (NTRS)

Ingebo, Robert D.

1987-01-01

Two-phase flows were investigated by using high velocity nitrogen gas streams to atomize small-diameter liquid jets. Tests were conducted primarily in the acceleration-wave regime for liquid jet atomization, where it was found that the loss of droplets due to vaporization had a marked effect on drop-size measurements. In addition, four identically designed two-fluid atomizers were fabricated and tested for similarity of spray profiles. A scattered-light scanner was used to measure a characteristic drop diameter, which was correlated with nitrogen gas flowrate. The exponent of 1.33 for nitrogen gas flowrate is identical to that predicted by atomization theory for liquid jet breakup in the acceleration-wave regime. This is higher than the value of 1.2 which was previously obtained at a smapling distance of 4.4 cm downstream of the atomizer. The difference is attributed to the fact that drop-size measurements obtained at a 2.2 cm sampling distance are less affected by vaporization and dispersion of small droplets and therefore should give better agreement with atomization theory. Profiles of characteristic drop diameters were also obtained by making at least five line-of-sight measurements across the spray at several horizontal positions above and below the center line of the spray.

Investigation of Capillary Limit in a Loop Heat Pipe

NASA Technical Reports Server (NTRS)

Ku, Jentung; Ottenstein, Laura; Rogers, Paul; Cheung, Kwok; Obenschain, Arthur F. (Technical Monitor)

2001-01-01

This paper presets an experimental study on the capillary limit of a loop heat pipe (LHP) at low powers. The slow thermal response of the loop at low powers made it possible to observe interactions among various components after the capillary limit was exceeded. The capillary limit at low powers was achieved by imposing additional pressure drops on the vapor line through the use of a metering valve. A differential pressure transducer was also used to measure the pressure drop across the evaporator and the compensation chamber (CC). Test results show that when the capillary limit is exceeded, vapor will penetrate the primary wick, resulting in a partial dry-out of the evaporator and a rapid increase of the CC temperature. Because the evaporator can tolerate vapor bubbles, the LHP will continue to function and may reach a new steady state at the higher temperature. Thus, the LHP will exhibit a graceful degradation in performance rather than a complete failure. Moreover, the loop can recover from a partial dry-out by reducing the heat load without a re-start.

Diffusion Of Mass In Evaporating Multicomponent Drops

NASA Technical Reports Server (NTRS)

Bellan, Josette; Harstad, Kenneth G.

1992-01-01

Report summarizes study of diffusion of mass and related phenomena occurring in evaporation of dense and dilute clusters of drops of multicomponent liquids intended to represent fuels as oil, kerosene, and gasoline. Cluster represented by simplified mathematical model, including global conservation equations for entire cluster and conditions on boundary between cluster and ambient gas. Differential equations of model integrated numerically. One of series of reports by same authors discussing evaporation and combustion of sprayed liquid fuels.

Langmuir-Blodgett nanotemplates for protein crystallography.

PubMed

Pechkova, Eugenia; Nicolini, Claudio

2017-12-01

The new generation of synchrotrons and microfocused beamlines has enabled great progress in X-ray protein crystallography, resulting in new 3D atomic structures for proteins of high interest to the pharmaceutical industry and life sciences. It is, however, often still challenging to produce protein crystals of sufficient size and quality (order, intensity of diffraction, radiation stability). In this protocol, we provide instructions for performing the Langmuir-Blodgett (LB) nanotemplate method, a crystallization approach that can be used for any protein (including membrane proteins). We describe how to produce highly ordered 2D LB protein monolayers at the air-water interface and deposit them on glass slides. LB-film formation can be observed by surface-pressure measurements and Brewster angle microscopy (BAM), although its quality can be characterized by atomic force microscopy (AFM) and nanogravimetry. Such films are then used as a 2D template for triggering 3D protein crystal formation by hanging-drop vapor diffusion. The procedure for forming the 2D template takes a few minutes. Structural information about the protein reorganization in the LB film during the crystallization process on the nano level can be obtained using an in situ submicron GISAXS (grazing-incidence small-angle X-ray scattering) method. MicroGISAXS spectra, measured directly at the interface of the LB films and protein solution in real time, as described in this protocol, can be interpreted in terms of the buildup of layers, islands, or holes. In our experience, the obtained LB crystals take 1-10 d to prepare and they are more ordered and radiation stable as compared with those produced using other crystallization methods.

Startup analysis for a high temperature gas loaded heat pipe

NASA Technical Reports Server (NTRS)

Sockol, P. M.

1973-01-01

A model for the rapid startup of a high-temperature gas-loaded heat pipe is presented. A two-dimensional diffusion analysis is used to determine the rate of energy transport by the vapor between the hot and cold zones of the pipe. The vapor transport rate is then incorporated in a simple thermal model of the startup of a radiation-cooled heat pipe. Numerical results for an argon-lithium system show that radial diffusion to the cold wall can produce large vapor flow rates during a rapid startup. The results also show that startup is not initiated until the vapor pressure p sub v in the hot zone reaches a precise value proportional to the initial gas pressure p sub i. Through proper choice of p sub i, startup can be delayed until p sub v is large enough to support a heat-transfer rate sufficient to overcome a thermal load on the heat pipe.

Adsorptive Water Removal from Dichloromethane and Vapor-Phase Regeneration of a Molecular Sieve 3A Packed Bed

PubMed Central

2017-01-01

The drying of dichloromethane with a molecular sieve 3A packed bed process is modeled and experimentally verified. In the process, the dichloromethane is dried in the liquid phase and the adsorbent is regenerated by water desorption with dried dichloromethane product in the vapor phase. Adsorption equilibrium experiments show that dichloromethane does not compete with water adsorption, because of size exclusion; the pure water vapor isotherm from literature provides an accurate representation of the experiments. The breakthrough curves are adequately described by a mathematical model that includes external mass transfer, pore diffusion, and surface diffusion. During the desorption step, the main heat transfer mechanism is the condensation of the superheated dichloromethane vapor. The regeneration time is shortened significantly by external bed heating. Cyclic steady-state experiments demonstrate the feasibility of this novel, zero-emission drying process. PMID:28539701

Self-Reported Sitting Time in New York City Adults, The Physical Activity and Transit Survey, 2010–2011

PubMed Central

Bartley, Katherine F.; Firestone, Melanie J.; Lee, Karen K.; Eisenhower, Donna L.

2015-01-01

Introduction Recent studies have demonstrated the negative health consequences associated with extended sitting time, including metabolic disturbances and decreased life expectancy. The objectives of this study were to characterize sitting time in an urban adult population and assess the validity of a 2-question method of self-reported sitting time. Methods The New York City Health Department conducted the 2010–2011 Physical Activity and Transit Survey (N = 3,597); a subset of participants wore accelerometers for 1 week (n = 667). Self-reported sitting time was assessed from 2 questions on time spent sitting (daytime and evening hours). Sedentary time was defined as accelerometer minutes with less than 100 counts on valid days. Descriptive statistics were used to estimate the prevalence of sitting time by demographic characteristics. Validity of sitting time with accelerometer-measured sedentary time was assessed using Spearman’s correlation and Bland-Altman techniques. All data were weighted to be representative of the New York City adult population based on the 2006–2008 American Community Survey. Results Mean daily self-reported sitting time was 423 minutes; mean accelerometer-measured sedentary time was 490 minutes per day (r = 0.32, P < .001). The mean difference was 49 minutes per day (limits of agreement: −441 to 343). Sitting time was higher in respondents at lower poverty and higher education levels and lower in Hispanics and people who were foreign-born. Conclusion Participants of higher socioeconomic status, who are not typically the focus of health disparities–related research, had the highest sitting times; Hispanics had the lowest levels. Sitting time may be accurately assessed by self-report with the 2-question method for population surveillance but may be limited in accurately characterizing individual-level behavior. PMID:26020549

Water vapor diffusion membrane development

NASA Technical Reports Server (NTRS)

Tan, M. K.

1976-01-01

A total of 18 different membranes were procured, characterized, and tested in a modified bench-scale vapor diffusion water reclamation unit. Four membranes were selected for further studies involving membrane fouling. Emphasis was placed on the problem of flux decline due to membrane fouling. This is discussed in greater details under "Summary and Discussion on Membrane Fouling Studies" presented in pages 47-51. The system was also investigated for low temperature application on wash-water where the permeated water is not recovered but vented into space vacuum.

Single nanowire thermal conductivity measurements by Raman thermography.

PubMed

Doerk, Gregory S; Carraro, Carlo; Maboudian, Roya

2010-08-24

A facile, rapid, and nondestructive technique for determining the thermal conductivity of individual nanowires based on Raman temperature mapping has been demonstrated. Using calculated absorption efficiencies, the thermal conductivities of single cantilevered Si nanowires grown by the vapor-liquid-solid method are measured and the results agree well with values predicted by diffuse phonon boundary scattering. As a measurement performed on the wire, thermal contact effects are avoided and ambient air convection is found to be negligible for the range of diameters measured. The method's versatility is further exemplified in the reverse measurement of a single nanowire absorption efficiency assuming diffuse phonon boundary scattering. The results presented here outline the broad utility that Raman thermography may have for future thermoelectric and photovoltaic characterization of nanostructures.

The sitting position during neurosurgical procedures does not influence serum biomarkers of pulmonary parenchymal injury.

PubMed

Duda, Izabela; Grzybowska, Konstancja; Jędrzejowska-Szypułka, Halina; Lewin-Kowalik, Joanna

2012-12-05

The sitting position during neurosurgical operations predisposes to air penetration through veins and the movement of the air through the pulmonary circulation. Contact of an air bubble with the endothelium can lead to acute lung injury. The presence of specific pulmonary proteins in the plasma such as surfactant protein D (SP-D) and Clara cell protein (CC16) is a biomarker of damaging processes at the air-blood barrier. The aim of our study was to examine the hypothesis that the level of investigated pulmonary biomarkers in plasma is higher in patients operated on in the sitting position. The study included patients undergoing planned neurosurgical operations, who were divided into two groups: the sitting group (40 patients, operated on in the sitting position) and the supine group (24 patients, operated in the supine position). After the operation blood samples were drawn, centrifuged, frozen and stored until analyses were conducted. The determination of the SP-D and CC16 levels was performed using an ELISA test. Air embolism (VAE) was defined as a sudden drop in etCO2 of more than 2 mmHg and the presence of air bubbles in the aspirated blood from the central cannula. In all patients, the number of hospitalization days in the postoperative period was calculated. There were no differences in the average levels of SP-D between the groups (the mean in the sitting group was 95.56 ng/mL and the mean in the supine group was 101.21 ng/mL). The average levels of CC16 were similar in both groups as well (6.56 ng/mL in the sitting group and 6.79 ng/mL in the supine group). There was a statistically significant positive correlation between SP-D and CC16 values in both groups. VAE was diagnosed clinically in 12.5% of cases in the sitting group without a significant increase in SP-D and CC16 levels. On average, patients in both groups were discharged from the hospital within 9 days of surgery. The sitting position and intraoperative VAE during neurosurgical procedures do not affect the concentration of plasma biomarkers of pulmonary parenchymal injury such as SP-D and CC16.

Electrical breakdown and nanogap formation of indium oxide core/shell heterostructure nanowires.

PubMed

Jung, Minkyung; Song, Woon; Sung Lee, Joon; Kim, Nam; Kim, Jinhee; Park, Jeunghee; Lee, Hyoyoung; Hirakawa, Kazuhiko

2008-12-10

We report the electrical breakdown behavior and subsequent nanogap formation of In(2)O(3)/InO(x) core/shell heterostructure nanowires with substrate-supported and suspended structures. The radial heterostructure nanowires, composed of crystalline In(2)O(3) cores and amorphous In-rich shells, are grown by chemical vapor deposition. As the nanowires broke down, they exhibited two distinct current drops in the current-voltage characteristics. The tips of the broken nanowires were found to have a cone or a volcano shape depending on the width of the nanowire. The shape, the size, and the position of the nanogap depend strongly on the device structure and the nanowire dimensions. The substrate-supported and the suspended devices exhibit distinct breakdown behavior which can be explained by the diffusive thermal transport model. The breakdown temperature of the nanowire is estimated to be about 450 K, close to the melting temperature of indium. We demonstrated the usefulness of this technique by successful fabrication of working pentacene field-effect transistors.

Secondary ion mass spectrometric investigation on ruthenium oxide systems: a comparison between poly- and nanocrystalline deposits

PubMed

Barison; Barreca; Daolio; Fabrizio; Piccirillo

2000-01-01

The influence of different RuO(2) crystallite sizes was investigated by secondary ion mass spectrometry (SIMS) on the oxide deposited on various support materials (Ni, Ti, Al(2)O(3), oxidized Si(100)). In order to examine the effect of an oxidic environment on the film structure, RuO(2) 20%-TiO(2) 80% at. mixed oxide was deposited on Ti. The polycrystalline coatings were prepared by heating the Ru (and Ti)-containing solution dropped on the supports.1 RuO(2) nanocrystalline coatings were grown by chemical vapor deposition (CVD) from Ru(COD)(eta(3)-allyl)(2).2 The identification of mixed oxide clusters showed the higher reactivity of Ni and Al(2)O(3) over the other substrates. Diffusion and migration characteristics were observed to be influenced by the nature of the support. The results are complementary to those of a previous SIMS investigation.3 Copyright 2000 John Wiley & Sons, Ltd.

An internal affinity-tag for purification and crystallization of the siderophore receptor FhuA, integral outer membrane protein from Escherichia coli K-12.

PubMed

Ferguson, A D; Breed, J; Diederichs, K; Welte, W; Coulton, J W

1998-07-01

FhuA (Mr 78,992, 714 amino acids), siderophore receptor for ferrichrome-iron in the outer membrane of Escherichia coli, was affinity tagged, rapidly purified, and crystallized. To obtain FhuA in quantities sufficient for crystallization, a hexahistidine tag was genetically inserted into the fhuA gene after amino acid 405, which resides in a known surface-exposed loop. Recombinant FhuA405.H6 was overexpressed in an E. coli strain that is devoid of several major porins and using metal-chelate chromatography was purified in large amounts to homogeneity. FhuA crystals were grown using the hanging drop vapor diffusion technique and were suitable for X-ray diffraction analysis. On a rotating anode X-ray source, diffraction was observed to 3.0 A resolution. The crystals belong to space group P6(1) or P6(5) with unit cell dimensions of a=b=174 A, c=88 A (alpha=beta=90 degrees, gamma=120 degrees).

In situ study of the growth and degradation processes in tetragonal lysozyme crystals on a silicon substrate by high-resolution X-ray diffractometry

NASA Astrophysics Data System (ADS)

Kovalchuk, M. V.; Prosekov, P. A.; Marchenkova, M. A.; Blagov, A. E.; D'yakova, Yu. A.; Tereshchenko, E. Yu.; Pisarevskii, Yu. V.; Kondratev, O. A.

2014-09-01

The results of an in situ study of the growth of tetragonal lysozyme crystals by high-resolution X-ray diffractometry are considered. The crystals are grown by the sitting-drop method on crystalline silicon substrates of different types: both on smooth substrates and substrates with artificial surface-relief structures using graphoepitaxy. The crystals are grown in a special hermetically closed crystallization cell, which enables one to obtain images with an optical microscope and perform in situ X-ray diffraction studies in the course of crystal growth. Measurements for lysozyme crystals were carried out in different stages of the crystallization process, including crystal nucleation and growth, developed crystals, the degradation of the crystal structure, and complete destruction.

Purification, crystallization and preliminary X-ray diffraction studies of d-tagatose 3-epimerase from Pseudomonas cichorii

PubMed Central

Yoshida, Hiromi; Yamada, Mitsugu; Nishitani, Takeyori; Takada, Goro; Izumori, Ken; Kamitori, Shigehiro

2007-01-01

d-Tagatose 3-epimerase (D-TE) from Pseudomonas cichorii catalyzes the epimerization of various ketohexoses at the C3 position. The epimerization of d-­psicose has not been reported with epimerases other than P. cichorii D-­TE and d-psicose 3-epimerase from Agrobacterium tumefaciens. Recombinant P. cichorii D-TE has been purified and crystallized. Crystals of P. cichorii D-TE were obtained by the sitting-drop method at room temperature. The crystal belongs to the monoclinic space group P21, with unit-cell parameters a = 76.80, b = 94.92, c = 91.73 Å, β = 102.82°. Diffraction data were collected to 2.5 Å resolution. The asymmetric unit is expected to contain four molecules. PMID:17277456

Scavenging dissolved oxygen via acoustic droplet vaporization.

PubMed

Radhakrishnan, Kirthi; Holland, Christy K; Haworth, Kevin J

2016-07-01

Acoustic droplet vaporization (ADV) of perfluorocarbon emulsions has been explored for diagnostic and therapeutic applications. Previous studies have demonstrated that vaporization of a liquid droplet results in a gas microbubble with a diameter 5-6 times larger than the initial droplet diameter. The expansion factor can increase to a factor of 10 in gassy fluids as a result of air diffusing from the surrounding fluid into the microbubble. This study investigates the potential of this process to serve as an ultrasound-mediated gas scavenging technology. Perfluoropentane droplets diluted in phosphate-buffered saline (PBS) were insonified by a 2 MHz transducer at peak rarefactional pressures lower than and greater than the ADV pressure amplitude threshold in an in vitro flow phantom. The change in dissolved oxygen (DO) of the PBS before and after ADV was measured. A numerical model of gas scavenging, based on conservation of mass and equal partial pressures of gases at equilibrium, was developed. At insonation pressures exceeding the ADV threshold, the DO of air-saturated PBS decreased with increasing insonation pressures, dropping as low as 25% of air saturation within 20s. The decrease in DO of the PBS during ADV was dependent on the volumetric size distribution of the droplets and the fraction of droplets transitioned during ultrasound exposure. Numerically predicted changes in DO from the model agreed with the experimentally measured DO, indicating that concentration gradients can explain this phenomenon. Using computationally modified droplet size distributions that would be suitable for in vivo applications, the DO of the PBS was found to decrease with increasing concentrations. This study demonstrates that ADV can significantly decrease the DO in an aqueous fluid, which may have direct therapeutic applications and should be considered for ADV-based diagnostic or therapeutic applications. Copyright © 2016 Elsevier B.V. All rights reserved.

Scavenging dissolved oxygen via acoustic droplet vaporization

PubMed Central

Radhakrishnan, Kirthi; Holland, Christy K.; Haworth, Kevin J.

2016-01-01

Acoustic droplet vaporization (ADV) of perfluorocarbon emulsions has been explored for diagnostic and therapeutic applications. Previous studies have demonstrated that vaporization of a liquid droplet results in a gas microbubble with a diameter 5 to 6 times larger than the initial droplet diameter. The expansion factor can increase to a factor of 10 in gassy fluids as a result of air diffusing from the surrounding fluid into the microbubble. This study investigates the potential of this process to serve as an ultrasound-mediated gas scavenging technology. Perfluoropentane droplets diluted in phosphate-buffered saline (PBS) were insonified by a 2 MHz transducer at peak rarefactional pressures lower than and greater than the ADV pressure amplitude threshold in an in vitro flow phantom. The change in dissolved oxygen (DO) of the PBS before and after ADV was measured. A numerical model of gas scavenging, based on conservation of mass and equal partial pressures of gases at equilibrium, was developed. At insonation pressures exceeding the ADV threshold, the DO of air-saturated PBS decreased with increasing insonation pressures, dropping as low as 25% of air saturation within 20 s. The decrease in DO of the PBS during ADV was dependent on the volumetric size distribution of the droplets and the fraction of droplets transitioned during ultrasound exposure. Numerically predicted changes in DO from the model agreed with the experimentally measured DO, indicating that concentration gradients can explain this phenomenon. Using computationally modified droplet size distributions that would be suitable for in vivo applications, the DO of the PBS was found to decrease with increasing concentrations. This study demonstrates that ADV can significantly decrease the DO in an aqueous fluid, which may have direct therapeutic applications and should be considered for ADV-based diagnostic or therapeutic applications. PMID:26964964

Lattice Boltzmann Simulation of Water Isotope Fractionation During Growth of Ice Crystals in Clouds

NASA Astrophysics Data System (ADS)

Lu, G.; Depaolo, D.; Kang, Q.; Zhang, D.

2006-12-01

The isotopic composition of precipitation, especially that of snow, plays a special role in the global hydrological cycle and in reconstruction of past climates using polar ice cores. The fractionation of the major water isotope species (HHO, HDO, HHO-18) during ice crystal formation is critical to understanding the global distribution of isotopes in precipitation. Ice crystal growth in clouds is traditionally treated with a spherically- symmetric steady state diffusion model, with semi-empirical modifications added to account for ventilation and for complex crystal morphology. Although it is known that crystal growth rate, which depends largely on the degree of vapor over-saturation, determines crystal morphology, there are no existing quantitative models that directly relate morphology to the vapor saturation factor. Since kinetic (vapor phase diffusion-controlled) isotopic fractionation also depends on growth rate, there should be a direct relationship between vapor saturation, crystal morphology, and crystal isotopic composition. We use a 2D Lattice-Boltzmann model to simulate diffusion-controlled ice crystal growth from vapor- oversaturated air. In the model, crystals grow solely according to the diffusive fluxes just above the crystal surfaces, and hence crystal morphology arises from the initial and boundary conditions in the model and does not need to be specified a priori. The input parameters needed are the isotope-dependent vapor deposition rate constant (k) and the water vapor diffusivity in air (D). The values of both k and D can be computed from kinetic theory, and there are also experimentally determined values of D. The deduced values of k are uncertain to the extent that the sticking coefficient (or accommodation coefficient) for ice is uncertain. The ratio D/k is a length that determines the minimum scale of dendritic growth features and allows us to scale the numerical calculations to atmospheric conditions using a dimensionless Damkohler number: Da = kh/D, where h is the width of the 2D calculation domain. Varying the nondimensional Da in the model is equivalent to varying the scale (h) in the model. Our calculations confirm that the crystal/vapor isotopic fractionation approaches the equilibrium value, and the crystals are compact (circular in 2D) as the saturation factor approaches unity (S= 1.0). At higher oversaturation (e.g. S = 1.2), dendritic crystals of millimeter size develop on timescales appropriate to cloud processes, the isotopic fractionations are dominated by kinetic effects, and similar to those predicted by the spherical diffusion model. Dendritic crystals are constrained to be relatively large, with dimension much greater than D/k. The most difficult aspect of the modeling is to account for the large density difference between air and ice, which requires us to use a fictitious higher density for the vapor-oversaturated air and scale the crystal growth time accordingly. A different approach, using a larger scale simulation to derive boundary conditions for a nested smaller scale calculation is in progress. The results to date clarify the controls on dendritic crystal growth, the relationships between saturation state, growth rate, crystal morphology and isotopic fractionation, and provide limits on the value of the accommodation coefficient.

Theoretical and experimental emittance measurements for a thin liquid sheet flow

NASA Technical Reports Server (NTRS)

Englehart, Amy N.; Mcconley, Marc W.; Chubb, Donald L.

1995-01-01

Surface tension forces at the edges of a thin liquid (approximately 200 microns) sheet flow result in a triangularly shaped sheet. Such a geometry is ideal for an external flow radiator. Since the fluid must have very low vapor pressure, Dow Corning 705 silicone oil was used and the emittance of a flowing sheet of oil was determined by two methods. The emittance was derived as a function of the temperature drop between the top of the sheet and the coalescence point of the sheet, the sink temperature, the volumetric flow and the length of the sheet. the emittance for the oil was also calculated using an extinction coefficient determined from spectral transmittance data of the oil. The oil's emittance ranges from .67 to .87 depending on the sheet thickness and sheet temperature. The emittance derived from the temperature drop was slightly less than the emittance calculated from transmittance data. An investigation of temperature fluctuation upstream of the slit plate was also done. The fluctuations were determined to be negligible, not affecting the temperature drop which was due to radiation.

Structure and Dynamics of Interfaces: Drops and Films

NASA Technical Reports Server (NTRS)

Mann, J. Adin, Jr.; Mann, Elizabeth K.; Meyer, William V.; Neumann, A. Wilhelm; Tavana, Hossein

2015-01-01

We aim to acquire measurements of the structure and dynamics of certain liquid-fluid interfaces using an ensemble of techniques in collaboration: (1) Total internal reflection (TIR) Surface light scattering spectroscopy (SLSS), (2) Brewster angle microscopy (BAM), and (3) Drop-shape analysis. SLSS and BAM can be done on a shared interfacial footprint. Results using a 50-50 mixture of pentane-isohexane, which extends the range of NASA's Confined Vapor Bubble (CVB) experiment, yield surface tension results that differ from the expected Langmuir Fit. These results were confirmed using both the SLSS and drop-shape analysis approaches.

On the acceleration of charged particles at relativistic shock fronts

NASA Technical Reports Server (NTRS)

Kirk, J. G.; Schneider, P.

1987-01-01

The diffusive acceleration of highly relativistic particles at a shock is reconsidered. Using the same physical assumptions as Blandford and Ostriker (1978), but dropping the restriction to nonrelativistic shock velocities, the authors find approximate solutions of the particle kinetic equation by generalizing the diffusion approximation to higher order terms in the anisotropy of the particle distribution. The general solution of the transport equation on either side of the shock is constructed, which involves the solution of an eigenvalue problem. By matching the two solutions at the shock, the spectral index of the resulting power law is found by taking into account a sufficiently large number of eigenfunctions. Low-order truncation corresponds to the standard diffusion approximation and to a somewhat more general method described by Peacock (1981). In addition to the energy spectrum, the method yields the angular distribution of the particles and its spatial dependence.

Crystallization and preliminary X-ray crystallographic analysis of BxlE, a xylobiose transporter from Streptomyces thermoviolaceus OPC-520

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seike, Kiho; Sato, Junji; Tomoo, Koji, E-mail: tomoo@gly.oups.ac.jp

2007-07-01

To clarify the structural basis of sugar binding by BxlE at the atomic level, recombinant BxlE was crystallized using the hanging-drop vapour-diffusion method at 290 K. Together with the integral membrane proteins BxlF and BxlG, BxlE isolated from Streptomyces thermoviolaceus OPC-520 forms an ATP-binding cassette (ABC) transport system that mediates the uptake of xylan. To clarify the structural basis of sugar binding by BxlE at the atomic level, recombinant BxlE was crystallized using the hanging-drop vapour-diffusion method at 290 K. The crystals belonged to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 44.63, b = 63.27, cmore » = 66.40 Å, β = 103.05°, and contained one 48 kDa molecule per asymmetric unit (V{sub M} = 1.96 Å{sup 3} Da{sup −1}). Diffraction data collected to a resolution of 1.65 Å using a rotating-anode X-ray source gave a data set with an overall R{sub merge} of 2.6% and a completeness of 91.3%. A data set from a platinum derivative is being used for phasing by the SAD method.« less

A hybrid interface tracking - level set technique for multiphase flow with soluble surfactant

NASA Astrophysics Data System (ADS)

Shin, Seungwon; Chergui, Jalel; Juric, Damir; Kahouadji, Lyes; Matar, Omar K.; Craster, Richard V.

2018-04-01

A formulation for soluble surfactant transport in multiphase flows recently presented by Muradoglu and Tryggvason (JCP 274 (2014) 737-757) [17] is adapted to the context of the Level Contour Reconstruction Method, LCRM, (Shin et al. IJNMF 60 (2009) 753-778, [8]) which is a hybrid method that combines the advantages of the Front-tracking and Level Set methods. Particularly close attention is paid to the formulation and numerical implementation of the surface gradients of surfactant concentration and surface tension. Various benchmark tests are performed to demonstrate the accuracy of different elements of the algorithm. To verify surfactant mass conservation, values for surfactant diffusion along the interface are compared with the exact solution for the problem of uniform expansion of a sphere. The numerical implementation of the discontinuous boundary condition for the source term in the bulk concentration is compared with the approximate solution. Surface tension forces are tested for Marangoni drop translation. Our numerical results for drop deformation in simple shear are compared with experiments and results from previous simulations. All benchmarking tests compare well with existing data thus providing confidence that the adapted LCRM formulation for surfactant advection and diffusion is accurate and effective in three-dimensional multiphase flows with a structured mesh. We also demonstrate that this approach applies easily to massively parallel simulations.

PASSIVE/DIFFUSIVE SAMPLERS FOR PESTICIDES IN RESIDENTIAL INDOOR AIR

EPA Science Inventory

Pesticides applied indoors vaporize from treated surfaces (e.g., carpets and baseboards) resulting in elevated air concentrations that may persist for long periods after applications. Estimating long-term respiratory exposures to pesticide vapors in residential indoor environme...

Atomization and vaporization characteristics of airblast fuel injection inside a venturi tube

NASA Technical Reports Server (NTRS)

Sun, H.; Chue, T.-H.; Lai, M.-C.; Tacina, R. R.

1993-01-01

This paper describes the experimental and numerical characterization of the capillary fuel injection, atomization, dispersion, and vaporization of liquid fuel in a coflowing air stream inside a single venturi tube. The experimental techniques used are all laser-based. Phase Doppler analyzer was used to characterize the atomization and vaporization process. Planar laser-induced fluorescence visualizations give good qualitative picture of the fuel droplet and vapor distribution. Limited quantitative capabilities of the technique are also demonstrated. A modified version of the KIVA-II was used to simulate the entire spray process, including breakup and vaporization. The advantage of venturi nozzle is demonstrated in terms of better atomization, more uniform F/A distribution, and less pressure drop. Multidimensional spray calculations can be used as a design tool only if care is taken for the proper breakup model, and wall impingement process.

Transmitting and reflecting diffuser. [for ultraviolet light

NASA Technical Reports Server (NTRS)

Keafer, L. S., Jr.; Burcher, E. E.; Kopia, L. P. (Inventor)

1973-01-01

A near-Lambertian diffuser is described which transmits and reflects ultraviolet light. An ultraviolet grade fused silica substrate is coated with vaporized fuse silica. The coating thickness is controlled, one thickness causing ultraviolet light to diffuse and another thickness causing ultraviolet light to reflect a near Lambertian pattern.

Fluid transport in partially filled porous sol-gel silica glass

NASA Astrophysics Data System (ADS)

D'orazio, Franco; Bhattacharja, Sankar; Halperin, William P.; Gerhardt, Rosario

1990-10-01

Measurements of low-frequency ac electrical conductivity of a porous glass filled with different amounts of a saline solution are compared with the self-diffusion coefficient of water measured in the same sample, reported previously [F. D'Orazio et al., Phys. Rev. Lett. 63, 43 (1989)]. The two transport parameters are consistently related through the Einstein relation under saturation conditions. A more complex picture is revealed for the unsaturated sample, since the presence of a vapor phase enhances the self-diffusion coefficient. Conductivity experiments allow an independent assessment of the contribution to self-diffusion from the liquid phase. However, a comparison between the two experiments indicates that the role of the vapor phase is not well understood.

Analytical study of the liquid phase transient behavior of a high temperature heat pipe. M.S. Thesis

NASA Technical Reports Server (NTRS)

Roche, Gregory Lawrence

1988-01-01

The transient operation of the liquid phase of a high temperature heat pipe is studied. The study was conducted in support of advanced heat pipe applications that require reliable transport of high temperature drops and significant distances under a broad spectrum of operating conditions. The heat pipe configuration studied consists of a sealed cylindrical enclosure containing a capillary wick structure and sodium working fluid. The wick is an annular flow channel configuration formed between the enclosure interior wall and a concentric cylindrical tube of fine pore screen. The study approach is analytical through the solution of the governing equations. The energy equation is solved over the pipe wall and liquid region using the finite difference Peaceman-Rachford alternating direction implicit numerical method. The continuity and momentum equations are solved over the liquid region by the integral method. The energy equation and liquid dynamics equation are tightly coupled due to the phase change process at the liquid-vapor interface. A kinetic theory model is used to define the phase change process in terms of the temperature jump between the liquid-vapor surface and the bulk vapor. Extensive auxiliary relations, including sodium properties as functions of temperature, are used to close the analytical system. The solution procedure is implemented in a FORTRAN algorithm with some optimization features to take advantage of the IBM System/370 Model 3090 vectorization facility. The code was intended for coupling to a vapor phase algorithm so that the entire heat pipe problem could be solved. As a test of code capabilities, the vapor phase was approximated in a simple manner.

Development of Nb{sub 3}Sn Cavity Vapor Diffusion Deposition System

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eremeev, Grigory V.; Macha, Kurt M.; Clemens, William A.

2014-02-01

Nb{sub 3}Sn is a BCS superconductors with the superconducting critical temperature higher than that of niobium, so theoretically it surpasses the limitations of niobium in RF fields. The feasibility of technology has been demonstrated at 1.5 GHz with Nb{sub 3}Sn vapor deposition technique at Wuppertal University. The benefit at these frequencies is more pronounced at 4.2 K, where Nb{sub 3}Sn coated cavities show RF resistances an order of magnitude lower than that of niobium. At Jefferson Lab we started the development of Nb{sub 3}Sn vapor diffusion deposition system within an R\\&D development program towards compact light sources. Here we presentmore » the current progress of the system development.« less

A Mass Diffusion Model for Dry Snow Utilizing a Fabric Tensor to Characterize Anisotropy

NASA Astrophysics Data System (ADS)

Shertzer, Richard H.; Adams, Edward E.

2018-03-01

A homogenization algorithm for randomly distributed microstructures is applied to develop a mass diffusion model for dry snow. Homogenization is a multiscale approach linking constituent behavior at the microscopic level—among ice and air—to the macroscopic material—snow. Principles of continuum mechanics at the microscopic scale describe water vapor diffusion across an ice grain's surface to the air-filled pore space. Volume averaging and a localization assumption scale up and down, respectively, between microscopic and macroscopic scales. The model yields a mass diffusivity expression at the macroscopic scale that is, in general, a second-order tensor parameterized by both bulk and microstructural variables. The model predicts a mass diffusivity of water vapor through snow that is less than that through air. Mass diffusivity is expected to decrease linearly with ice volume fraction. Potential anisotropy in snow's mass diffusivity is captured due to the tensor representation. The tensor is built from directional data assigned to specific, idealized microstructural features. Such anisotropy has been observed in the field and laboratories in snow morphologies of interest such as weak layers of depth hoar and near-surface facets.

Chemical vapor deposition fluid flow simulation modelling tool

NASA Technical Reports Server (NTRS)

Bullister, Edward T.

1992-01-01

Accurate numerical simulation of chemical vapor deposition (CVD) processes requires a general purpose computational fluid dynamics package combined with specialized capabilities for high temperature chemistry. In this report, we describe the implementation of these specialized capabilities in the spectral element code NEKTON. The thermal expansion of the gases involved is shown to be accurately approximated by the low Mach number perturbation expansion of the incompressible Navier-Stokes equations. The radiative heat transfer between multiple interacting radiating surfaces is shown to be tractable using the method of Gebhart. The disparate rates of reaction and diffusion in CVD processes are calculated via a point-implicit time integration scheme. We demonstrate the use above capabilities on prototypical CVD applications.

Purification and crystallization of Kokobera virus helicase

DOE Office of Scientific and Technical Information (OSTI.GOV)

De Colibus, Luigi; Speroni, Silvia; Coutard, Bruno

2007-03-01

Kokobera virus is a mosquito-borne flavivirus belonging, like West Nile virus, to the Japanese encephalitis virus serocomplex. Crystals of the Kokobera virus helicase domain were obtained by the hanging-drop vapour-diffusion method and exhibit a diffraction limit of 2.3 Å. Kokobera virus is a mosquito-borne flavivirus belonging, like West Nile virus, to the Japanese encephalitis virus serocomplex. The flavivirus genus is characterized by a positive-sense single-stranded RNA genome. The unique open reading frame of the viral RNA is transcribed and translated as a single polyprotein which is post-translationally cleaved to yield three structural and seven nonstructural proteins, one of which ismore » the NS3 gene that encodes a C-terminal helicase domain consisting of 431 amino acids. Helicase inhibitors are potential antiviral drugs as the helicase is essential to viral replication. Crystals of the Kokobera virus helicase domain were obtained by the hanging-drop vapour-diffusion method. The crystals belong to space group P3{sub 1}21 (or P3{sub 2}21), with unit-cell parameters a = 88.6, c = 138.6 Å, and exhibit a diffraction limit of 2.3 Å.« less

Expression, purification, crystallization and preliminary X-ray analysis of the ligand-binding domain of metabotropic glutamate receptor 7

DOE Office of Scientific and Technical Information (OSTI.GOV)

Muto, Takanori; Tsuchiya, Daisuke; Morikawa, Kosuke, E-mail: morikako@protein.osaka-u.ac.jp

2007-07-01

The ligand-binding domain of metabotropic glutamate receptor 7 has been overexpressed, purified, and crystallized by the hanging-drop vapour-diffusion method. A complete data set has been collected to 3.30 Å. Glutamate is the major excitatory neurotransmitter and its metabotropic glutamate receptor (mGluR) plays an important role in the central nervous system. The ligand-binding domain (LBD) of mGluR subtype 7 (mGluR7) was produced using the baculovirus expression system and purified from the culture medium. The purified protein was characterized by gel-filtration chromatography, SDS–PAGE and a ligand-binding assay. Crystals of mGluR7 LBD were grown at 293 K by the hanging-drop vapour-diffusion method. Themore » crystals diffracted X-rays to 3.30 Å resolution using synchrotron radiation and belong to the trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 92.4, c = 114.3 Å. Assuming the presence of one protomer per crystallographic asymmetric unit, the Matthews coefficient V{sub M} was calculated to be 2.5 Å{sup 3} Da{sup −1} and the solvent content was 51%.« less

Investigation of aluminosilicate refractory for solid oxide fuel cell applications

NASA Astrophysics Data System (ADS)

Gentile, Paul Steven

Stationary solid oxide fuel cells (SOFCs) have been demonstrated to provide clean and reliable electricity through electro-chemical conversion of various fuel sources (CH4 and other light hydrocarbons). To become a competitive conversion technology the costs of SOFCs must be reduced to less than $400/kW. Aluminosilicate represents a potential low cost alternative to high purity alumina for SOFC refractory applications. The objectives of this investigation are to: (1) study changes of aluminosilicate chemistry and morphology under SOFC conditions, (2) identify volatile silicon species released by aluminosilicates, (3) identify the mechanisms of aluminosilicate vapor deposition on SOFC materials, and (4) determine the effects of aluminosilicate vapors on SOFC electrochemical performance. It is shown thermodynamically and empirically that low cost aluminosilicate refractory remains chemically and thermally unstable under SOFC operating conditions between 800°C and 1000°C. Energy dispersive spectroscopy (EDS) and X-ray photoelectron spectroscopy (XPS) of the aluminosilicate bulk and surface identified increased concentrations of silicon at the surface after exposure to SOFC gases at 1000°C for 100 hours. The presence of water vapor accelerated surface diffusion of silicon, creating a more uniform distribution. Thermodynamic equilibrium modeling showed aluminosilicate remains stable in dry air, but the introduction of water vapor indicative of actual SOFC gas streams creates low temperature (<1000°C) silicon instability due to the release of Si(OH)4 and SiO(OH) 2. Thermal gravimetric analysis and transpiration studies identified a discrete drop in the rate of silicon volatility before reaching steady state conditions after 100-200 hours. Electron microscopy observed the preferential deposition of vapors released from aluminosilicate on yttria stabilized zirconia (YSZ) over nickel. The adsorbent consisted of alumina rich clusters enclosed in an amorphous siliceous layer. Silicon penetrated the YSZ along grain boundaries, isolating grains in an insulating glassy phase. XPS did not detect spectra shifts or peak broadening associated with formation of new Si-Zr-Y-O phases. SOFC electrochemical performance testing at 800-1000°C attributed rapid degradation (0.1% per hour) of cells exposed to aluminosilicate vapors in the fuel stream predominately to ohmic polarization. EDS identified silicon concentrations above impurity levels at the electrolyte/active anode interface.

Hydrogen-water vapor mixtures: Control of hydrothermal atmospheres by hydrogen osmosis

USGS Publications Warehouse

Shaw, H.R.

1963-01-01

Experiments at 700??C and 800 bars total pressure demonstrate positive deviations from ideality for mixtures of hydrogen and H2O gases. The deviations are greater than predicted with Stockmayer's method. The composition of the mixture and the fugacity of hydrogen are controlled by diffusing hydrogen through metallic membranes. The results give the fugacities of both H 2O and oxygen.

Hanging drop crystal growth apparatus

NASA Technical Reports Server (NTRS)

Naumann, Robert J. (Inventor); Witherow, William K. (Inventor); Carter, Daniel C. (Inventor); Bugg, Charles E. (Inventor); Suddath, Fred L. (Inventor)

1990-01-01

This invention relates generally to control systems for controlling crystal growth, and more particularly to such a system which uses a beam of light refracted by the fluid in which crystals are growing to detect concentration of solutes in the liquid. In a hanging drop apparatus, a laser beam is directed onto drop which refracts the laser light into primary and secondary bows, respectively, which in turn fall upon linear diode detector arrays. As concentration of solutes in drop increases due to solvent removal, these bows move farther apart on the arrays, with the relative separation being detected by arrays and used by a computer to adjust solvent vapor transport from the drop. A forward scattering detector is used to detect crystal nucleation in drop, and a humidity detector is used, in one embodiment, to detect relative humidity in the enclosure wherein drop is suspended. The novelty of this invention lies in utilizing angular variance of light refracted from drop to infer, by a computer algorithm, concentration of solutes therein. Additional novelty is believed to lie in using a forward scattering detector to detect nucleating crystallites in drop.

Flow field investigation in a bulb turbine diffuser

NASA Astrophysics Data System (ADS)

Pereira, M.; Duquesne, P.; Aeschlimann, V.; Deschênes, C.

2017-04-01

An important drop in turbine performances has been measured in a bulb turbine model operated at overload. Previous investigations have correlated the performance drop with diffuser losses, and particularly to the flow separation zone at the diffuser wall. The flow has been investigated in the transition part of the diffuser using two LDV measurement sections. The transition part is a diffuser section that transforms from a circular to a rectangular section. The two measurement sections are at the inlet and outlet of the diffuser transition part. The turbine has been operated at three operating points, which are representative of different flow patterns at the diffuser exit at overload. In addition to the average velocity field, the analysis is conducted based on a backflow occurrence function and on the swirl level. Results reveal a counter-rotating zone in the diffuser, which intensifies with the guide vanes opening. The guide vanes opening induces a modification of the flow phenomena: from a central backflow recirculation zone at the lowest flowrate to a backflow zone induced by flow separation at the wall at the highest flowrate.

Optical Characterization of a Multipoint Lean Direct Injector for Gas Turbine Combustors: Velocity and Fuel Drop Size Measurements

NASA Technical Reports Server (NTRS)

Heath, Christopher M.; Anderson, Robert C.; Locke, Randy J.; Hicks, Yolanda R.

2010-01-01

Performance of a multipoint, lean direct injection (MP-LDI) strategy for low emission aero-propulsion systems has been tested in a Jet-A fueled, lean flame tube combustion rig. Operating conditions for the series of tests included inlet air temperatures between 672 and 828 K, pressures between 1034 and 1379 kPa and total equivalence ratios between 0.41 and 0.45, resulting in equilibrium flame temperatures approaching 1800 K. Ranges of operation were selected to represent the spectrum of subsonic and supersonic flight conditions projected for the next-generation of commercial aircraft. This document reports laser-based measurements of in situ fuel velocities and fuel drop sizes for the NASA 9-point LDI hardware arranged in a 3 3 square grid configuration. Data obtained represent a region of the flame tube combustor with optical access that extends 38.1-mm downstream of the fuel injection site. All data were obtained within reacting flows, without particle seeding. Two diagnostic methods were employed to evaluate the resulting flow path. Three-component velocity fields have been captured using phase Doppler interferometry (PDI), and two-component velocity distributions using planar particle image velocimetry (PIV). Data from these techniques have also offered insight into fuel drop size and distribution, fuel injector spray angle and pattern, turbulence intensity, degree of vaporization and extent of reaction. This research serves to characterize operation of the baseline NASA 9- point LDI strategy for potential use in future gas-turbine combustor applications. An additional motive is the compilation of a comprehensive database to facilitate understanding of combustor fuel injector aerodynamics and fuel vaporization processes, which in turn may be used to validate computational fluid dynamics codes, such as the National Combustor Code (NCC), among others.

Comprehensive analysis of earthquake source spectra and swarms in the Salton Trough, California

NASA Astrophysics Data System (ADS)

Chen, X.; Shearer, P. M.

2011-09-01

We study earthquakes within California's Salton Trough from 1981 to 2009 from a precisely relocated catalog. We process the seismic waveforms to isolate source spectra, station spectra and travel-time dependent spectra. The results suggest an average P wave Q of 340, agreeing with previous results indicating relatively high attenuation in the Salton Trough. Stress drops estimated from the source spectra using an empirical Green's function (EGF) method reveal large scatter among individual events but a low median stress drop of 0.56 MPa for the region. The distribution of stress drop after applying a spatial-median filter indicates lower stress drops near geothermal sites. We explore the relationships between seismicity, stress drops and geothermal injection activities. Seismicity within the Salton Trough shows strong spatial clustering, with 20 distinct earthquake swarms with at least 50 events. They can be separated into early-Mmax and late-Mmax groups based on the normalized occurrence time of their largest event. These swarms generally have a low skew value of moment release history, ranging from -9 to 3.0. The major temporal difference between the two groups is the excess of seismicity and an inverse power law increase of seismicity before the largest event for the late-Mmax group. All swarms exhibit spatial migration of seismicity at a statistical significance greater than 85%. A weighted L1-norm inversion of linear migration parameters yields migration velocities from 0.008 to 0.8 km/hour. To explore the influence of fluid injection in geothermal sites, we also model the migration behavior with the diffusion equation, and obtain a hydraulic diffusion coefficient of approximately 0.25 m2/s for the Salton Sea geothermal site, which is within the range of expected values for a typical geothermal reservoir. The swarms with migration velocities over 0.1 km/hour cannot be explained by the diffusion curve, rather, their velocity is consistent with the propagation velocity of creep and slow slip events. These variations in migration behavior allow us to distinguish among different driving processes.

Estimates of evapotranspiration in alkaline scrub and meadow communities of Owens Valley, California, using the Bowen-ratio, eddy-correlation, and Penman-combination methods

USGS Publications Warehouse

Duell, L. F. W.

1988-01-01

In Owens Valley, evapotranspiration (ET) is one of the largest components of outflow in the hydrologic budget and the least understood. ET estimates for December 1983 through October 1985 were made for seven representative locations selected on the basis of geohydrology and the characteristics of phreatophytic alkaline scrub and meadow communities. The Bowen-ratio, eddy-correlation, and Penman-combination methods were used to estimate ET. The results of the analyses appear satisfactory when compared to other estimates of ET. Results by the eddy-correlation method are for a direct and a residual latent-heat flux that is based on sensible-heat flux and energy budget measurements. Penman-combination potential ET estimates were determined to be unusable because they overestimated actual ET. Modification in the psychrometer constant of this method to account for differences between heat-diffusion resistance and vapor-diffusion resistance permitted actual ET to be estimated. The methods may be used for studies in similar semiarid and arid rangeland areas in the Western United States. Meteorological data for three field sites are included in the appendix. Simple linear regression analysis indicates that ET estimates are correlated to air temperature, vapor-density deficit, and net radiation. Estimates of annual ET range from 300 mm at a low-density scrub site to 1,100 mm at a high-density meadow site. The monthly percentage of annual ET was determined to be similar for all sites studied. (Author 's abstract)

From drop impact physics to spray cooling models: a critical review

NASA Astrophysics Data System (ADS)

Breitenbach, Jan; Roisman, Ilia V.; Tropea, Cameron

2018-03-01

Spray-wall interaction is an important process encountered in a large number of existing and emerging technologies and is the underlying phenomenon associated with spray cooling. Spray cooling is a very efficient technology, surpassing all other conventional cooling methods, especially those not involving phase change and not exploiting the latent heat of vaporization. However, the effectiveness of spray cooling is dependent on a large number of parameters, including spray characteristics like drop size, velocity and number density, the surface morphology, but also on the temperature range and thermal properties of the materials involved. Indeed, the temperature of the substrate can have significant influence on the hydrodynamics of drop and spray impact, an aspect which is seldom considered in model formulation. This process is extremely complex, thus most design rules to date are highly empirical in nature. On the other hand, significant theoretical progress has been made in recent years about the interaction of single drops with heated walls and improvements to the fundamentals of spray cooling can now be anticipated. The present review has the objective of summarizing some of these recent advances and to establish a framework for future development of more reliable and universal physics-based correlations to describe quantities involved in spray cooling.

Application of Machine Learning Approaches for Classifying Sitting Posture Based on Force and Acceleration Sensors.

PubMed

Zemp, Roland; Tanadini, Matteo; Plüss, Stefan; Schnüriger, Karin; Singh, Navrag B; Taylor, William R; Lorenzetti, Silvio

2016-01-01

Occupational musculoskeletal disorders, particularly chronic low back pain (LBP), are ubiquitous due to prolonged static sitting or nonergonomic sitting positions. Therefore, the aim of this study was to develop an instrumented chair with force and acceleration sensors to determine the accuracy of automatically identifying the user's sitting position by applying five different machine learning methods (Support Vector Machines, Multinomial Regression, Boosting, Neural Networks, and Random Forest). Forty-one subjects were requested to sit four times in seven different prescribed sitting positions (total 1148 samples). Sixteen force sensor values and the backrest angle were used as the explanatory variables (features) for the classification. The different classification methods were compared by means of a Leave-One-Out cross-validation approach. The best performance was achieved using the Random Forest classification algorithm, producing a mean classification accuracy of 90.9% for subjects with which the algorithm was not familiar. The classification accuracy varied between 81% and 98% for the seven different sitting positions. The present study showed the possibility of accurately classifying different sitting positions by means of the introduced instrumented office chair combined with machine learning analyses. The use of such novel approaches for the accurate assessment of chair usage could offer insights into the relationships between sitting position, sitting behaviour, and the occurrence of musculoskeletal disorders.

Baseline predictors of maintenance of intervention-induced changes in physical activity and sitting time among diabetic and pre-diabetic patients: a descriptive case series.

PubMed

Helmink, Judith H M; Gubbels, Jessica S; van Brussel-Visser, Femke N; de Vries, Nanne K; Kremers, Stef P J

2013-05-08

The aim of this study was to explore the predictive value of baseline characteristics in relation to changes in physical activity (PA) and sedentary behaviour among diabetic and pre-diabetic patients participating in a primary care based exercise intervention. We used a descriptive case series among diabetic and pre-diabetic patients (n = 119, 50.8% male, mean age 65.5 (SD = 7.8)). Measurements took place with questionnaires at baseline and two years after the start of the intervention. Predictor variables included demographic factors, Body Mass Index, baseline PA and sitting time, and baseline socio-cognitive profile. At follow-up, respondents spent more time being physically active than at baseline. For the total group, the average sitting time remained almost unchanged between the two measurements. Further exploration showed that respondents who had relatively high levels of PA at the start of the intervention, increased their total sitting time, while respondents with relatively low levels of PA at the start decreased their sitting time. The socio-cognitive profile did not predict behaviour change. The intervention appeared to be suitable for people with a low-education level, but the results should be interpreted in view of the limitations of the study such as the non-controlled design, self-reported outcomes and selective drop-out of participants. Interventions for this specific target group may need to put more emphasis on the prevention of increased sitting time. The finding that the socio-cognitive profile did not predict behaviour change may underline the proposition that decisions to initiate and maintain PA behaviour change are to a large extend non-linear events. Acknowledging the possible non-linearity of the relationship between socio-cognitive determinants and behaviour change will help our understanding of this complex and dynamic process.

Vapor Flow Patterns During a Start-Up Transient in Heat Pipes

NASA Technical Reports Server (NTRS)

Issacci, F.; Ghoniem, N, M.; Catton, I.

1996-01-01

The vapor flow patterns in heat pipes are examined during the start-up transient phase. The vapor core is modelled as a channel flow using a two dimensional compressible flow model. A nonlinear filtering technique is used as a post process to eliminate the non-physical oscillations of the flow variables. For high-input heat flux, multiple shock reflections are observed in the evaporation region. The reflections cause a reverse flow in the evaporation and circulations in the adiabatic region. Furthermore, each shock reflection causes a significant increase in the local pressure and a large pressure drop along the heat pipe.

Purification, Crystallization and Preliminary X-ray Characterization of Prunin-1, a Major Component of the Almond (Prunus dulcis) Allergen Amandin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Albillos, Silvia M.; Jin, Tengchuan; Howard, Andrew

2008-08-04

The 11S globulins from plant seeds account for a number of major food allergens. Because of the interest in the structural basis underlying the allergenicity of food allergens, we sought to crystallize the main 11S seed storage protein from almond (Prunus dulcis). Prunin-1 (Pru1) was purified from defatted almond flour by water extraction, cryoprecipitation, followed by sequential anion exchange, hydrophobic interaction, and size exclusion chromatography. Single crystals of Pru1 were obtained in a screening with a crystal screen kit, using the hanging-drop vapor diffusion method. Diffraction quality crystals were grown after optimization. The Pru1 crystals diffracted to at least 3.0more » {angstrom} and belong to the tetragonal space group P4{sub 1}22, with unit cell parameters of a = b = 150.912 {angstrom}, c = 165.248 {angstrom}. Self-rotation functions and molecular replacement calculations showed that there are three molecules in the asymmetry unit with water content of 51.41%. The three Pru1 protomers are related by a noncrystallographic 3-fold axis and they form a doughnut-shaped trimer. Two prunin trimers form a homohexamer. Elucidation of prunin structure will allow further characterization of the allergenic features of the 11S protein allergens at the molecular level.« less

Microgravity

NASA Image and Video Library

2004-04-15

The Commercial Vapor Diffusion Apparatus will be used to perform 128 individual crystal growth investigations for commercial and science research. These experiments will grow crystals of several different proteins, including HIV-1 Protease Inhibitor, Glycogen Phosphorylase A, and NAD Synthetase. The Commercial Vapor Diffusion Apparatus supports multiple commercial investigations within a controlled environment. The goal of the Commercial Protein Crystal Growth payload on STS-95 is to grow large, high-quality crystals of several different proteins of interest to industry, and to continue to refine the technology and procedures used in microgravity for this important commercial research.

Phosphate Reactions as Mechanisms of High-Temperature Lubrication

NASA Technical Reports Server (NTRS)

Nagarajan, Anitha; Garrido, Carolina; Gatica, Jorge E.; Morales, Wilfredo

2006-01-01

One of the major problems preventing the operation of advanced gas turbine engines at higher temperatures is the inability of currently used liquid lubricants to survive at these higher temperatures under friction and wear conditions. Current state-of-the-art organic liquid lubricants rapidly degrade at temperatures above 300 C; hence some other form of lubrication is necessary. Vapor-phase lubrication is a promising new technology for high-temperature lubrication. This lubrication method employs a liquid phosphate ester that is vaporized and delivered to bearings or gears; the vapor reacts with the metal surfaces, generating a solid lubricious film that has proven very stable at high temperatures. In this study, solid lubricious films were grown on cast-iron foils in order to obtain reaction and diffusion rate data to help characterize the growth mechanism. A phenomenological mathematical model of the film deposition process was derived incorporating transport and kinetic parameters that were coupled to the experimental data. This phenomenological model can now be reliably used as a predictive and scale-up tool for future vapor-phase lubrication studies.

Effect of water vapor on NH3-NO/NO2 SCR performance of fresh and aged MnOx-NbOx-CeO2 catalysts.

PubMed

Chen, Lei; Si, Zhichun; Wu, Xiaodong; Weng, Duan; Wu, Zhenwei

2015-05-01

A MnOx-NbOx-CeO2 catalyst for low temperature selective catalytic reduction (SCR) of NOx with NH3 was prepared by a sol-gel method, and characterized by NH3-NO/NO2 SCR catalytic activity, NO/NH3 oxidation activity, NOx/NH3 TPD, XRD, BET, H2-TPR and in-situ Diffuse Reflectance Infrared Fourier Transform Spectroscopy (DRIFTS). The results indicate that the MnOx-NbOx-CeO2 catalyst shows excellent low temperature NH3-SCR activity in the temperature range of 150-300°C. Water vapor inhibits the low temperature activity of the catalyst in standard SCR due to the inhibition of NOx adsorption. As the NO2 content increases in the feed, water vapor does not affect the activity in NO2 SCR. Meanwhile, water vapor significantly enhances the N2 selectivity of the fresh and the aged catalysts due to its inhibition of the decomposition of NH4NO3 into N2O. Copyright © 2015. Published by Elsevier B.V.

The role of mass transport in protein crystallization.

PubMed

García-Ruiz, Juan Manuel; Otálora, Fermín; García-Caballero, Alfonso

2016-02-01

Mass transport takes place within the mesoscopic to macroscopic scale range and plays a key role in crystal growth that may affect the result of the crystallization experiment. The influence of mass transport is different depending on the crystallization technique employed, essentially because each technique reaches supersaturation in its own unique way. In the case of batch experiments, there are some complex phenomena that take place at the interface between solutions upon mixing. These transport instabilities may drastically affect the reproducibility of crystallization experiments, and different outcomes may be obtained depending on whether or not the drop is homogenized. In diffusion experiments with aqueous solutions, evaporation leads to fascinating transport phenomena. When a drop starts to evaporate, there is an increase in concentration near the interface between the drop and the air until a nucleation event eventually takes place. Upon growth, the weight of the floating crystal overcomes the surface tension and the crystal falls to the bottom of the drop. The very growth of the crystal then triggers convective flow and inhomogeneities in supersaturation values in the drop owing to buoyancy of the lighter concentration-depleted solution surrounding the crystal. Finally, the counter-diffusion technique works if, and only if, diffusive mass transport is assured. The technique relies on the propagation of a supersaturation wave that moves across the elongated protein chamber and is the result of the coupling of reaction (crystallization) and diffusion. The goal of this review is to convince protein crystal growers that in spite of the small volume of the typical protein crystallization setup, transport plays a key role in the crystal quality, size and phase in both screening and optimization experiments.

Investigation Of Vapor Explosion Mechanisms Using High Speed Photography

NASA Astrophysics Data System (ADS)

Armstrong, Donn R.; Anderson, Richard P.

1983-03-01

The vapor explosion, a physical interaction between hot and cold liquids that causes the explosive vaporization of the cold liquid, is a hazard of concern in such diverse industries as metal smelting and casting, paper manufacture, and nuclear power generation. Intensive work on this problem worldwide, for the past 25 years has generated a number of theories and mechanisms proposed to explain vapor explosions. High speed photography has been the major instrument used to test the validity of the theories and to provide the observations that have lead to new theories. Examples are given of experimental techniques that have been used to investigate vapor explosions. Detailed studies of specific mechanisms have included microsecond flash photograph of contact boiling and high speed cinematography of shock driven breakup of liquid drops. Other studies looked at the explosivity of various liquid pairs using cinematography inside a pulsed nuclear reactor and x-ray cinematography of a thermite-sodium interaction.

Transport of Carbon Tetrachloride in a Fractured Vadose Zone due to Atmospheric Pressure Fluctuations, Diffusion, and Vapor Density

NASA Astrophysics Data System (ADS)

McCray, J. E.; Downs, W.; Falta, R. W.; Housley, T.

2005-12-01

DNAPL sources of carbon tetrachloride (CT) vapors are of interest at the Radioactive Waste Management Complex (RWMC) at the Idaho National Engineering and Environmental Laboratory (INEEL). The site is underlain by thick fractured basalt that includes sedimentary interbeds, each are a few meters thick. Daily atmospheric pressure fluctuations serve as driving forces for CT vapor transport in the subsurface. Other important transport processes for vapor movement include gas-phase diffusion and density-driven transport. The objective of this research is to investigate the influence and relative importance of these processes on gaseous transport of CT. Gas pressure and vapor concentration measurements were conducted at various depths in two wells. A numerical multiphase flow model (TOUGH2), calibrated to field pressure data, is used to conduct sensitivity analyses to elucidate the importance of the different transport mechanisms. Results show that the basalt is highly permeable to vertical air flow. The pressure dampening occurs mainly in the sedimentary interbeds. Model-calibrated permeability values for the interbeds are similar to those obtained in a study by the U.S. Geological Survey for shallow sediments, and an order of magnitude higher than column-scale values obtained by previous studies conducted by INEEL scientists. The transport simulations indicate that considering the effect of barometric pressure changes is critical to simulating transport of pollutants in the vadose zone above the DNAPL source. Predicted concentrations can be orders of magnitude smaller than actual concentrations if the effect is not considered. Below the DNAPL vapor source, accounting for density and diffusion alone would yield acceptable results provided that a 20% error in concentrations are acceptable, and that simulating concentrations trends (and not actual concentrations) is the primary goal.

Wetting and drying of liquid on crossed fibers

NASA Astrophysics Data System (ADS)

Sauret, Alban; Bick, Alison D.; Stone, Howard A.; Complex Fluids Group Team

2013-11-01

Fibrous media are common in various engineered systems such as filters, paper or the textile industry. Many of these materials can be described as a network of fibers in which a wetting liquid tends to accumulate at its nodes and changes the bulk properties. Here we study a drop of silicone oil sitting on the simplest element of the array: two rigid crossed fibers. In particular, we investigate experimentally how the structure of the material affects the wetting and drying dynamics of that liquid drop. We first show that the liquid can adopt different shapes from a long liquid column to a drop. The transition between these morphologies depends on the volume of liquid, the tilting angle between the fibers, as well as the fiber radius. The wetting length in the column state can be predicted analytically. Because of these different shapes, the liquid exhibits different drying kinetics, which effects the overall drying time. Our study suggests that shearing a wetted array of fibers, by tuning the liquid morphology, may enhance the drying rate.

Three-dimensional modeling of diesel engine intake flow, combustion and emissions

NASA Technical Reports Server (NTRS)

Reitz, R. D.; Rutland, C. J.

1992-01-01

A three-dimensional computer code (KIVA) is being modified to include state-of-the-art submodels for diesel engine flow and combustion: spray atomization, drop breakup/coalescence, multi-component fuel vaporization, spray/wall interaction, ignition and combustion, wall heat transfer, unburned HC and NOx formation, soot and radiation, and the intake flow process. Improved and/or new submodels which were completed are: wall heat transfer with unsteadiness and compressibility, laminar-turbulent characteristic time combustion with unburned HC and Zeldo'vich NOx, and spray/wall impingement with rebounding and sliding drops. Results to date show that adding the effects of unsteadiness and compressibility improves the accuracy of heat transfer predictions; spray drop rebound can occur from walls at low impingement velocities (e.g., in cold-starting); larger spray drops are formed at the nozzle due to the influence of vaporization on the atomization process; a laminar-and-turbulent characteristic time combustion model has the flexibility to match measured engine combustion data over a wide range of operating conditions; and finally, the characteristic time combustion model can also be extended to allow predictions of ignition. The accuracy of the predictions is being assessed by comparisons with available measurements. Additional supporting experiments are also described briefly. To date, comparisons with measured engine cylinder pressure and heat flux data were made for homogeneous charge, spark-ignited and compression-ignited engines. The model results are in good agreement with the experiments.

Apparatus for diffusion-gap thermal desalination

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lowenstein, Andrew

A thermal distillation apparatus including evaporation surfaces that are wetted with a solution, and from which at least some of the volatile solvent contained in the solution evaporates, condensers having an external surface in close proximity to, but not touching, a corresponding one of the one or more evaporation surfaces, and on which vapors of the solvent condense, releasing thermal energy that heats a flow of the solution moving upward within the condensers, spacers that prevent contact between the evaporating surfaces and the condensers, wherein spaces between the evaporating surfaces and the condensers are filled with a gaseous mixture composedmore » of solvent vapor and one or more non-condensable gases, and except for diffusion of the solvent vapor relative to the non-condensable gases, the gaseous mixture is stationary.« less

Kinetic Monte Carlo Simulations of Oxygen Diffusion in Environmental Barrier Coating Materials

NASA Technical Reports Server (NTRS)

Good, Brian S.

2017-01-01

Ceramic Matrix Composite (CMC) materials are of interest for use in next-generation turbine engine components, offering a number of significant advantages, including reduced weight and high operating temperatures. However, in the hot environment in which such components operate, the presence of water vapor can lead to corrosion and recession, limiting the useful life of the components. Such degradation can be reduced through the use of Environmental Barrier Coatings (EBCs) that limit the amount of oxygen and water vapor reaching the component. Candidate EBC materials include Yttrium and Ytterbium silicates. In this work we present results of kinetic Monte Carlo (kMC) simulations of oxygen diffusion, via the vacancy mechanism, in Yttrium and Ytterbium disilicates, along with a brief discussion of interstitial diffusion.

Direct methanol fuel cell and system

DOEpatents

Wilson, Mahlon S.

2004-10-26

A fuel cell having an anode and a cathode and a polymer electrolyte membrane located between anode and cathode gas diffusion backings uses a methanol vapor fuel supply. A permeable polymer electrolyte membrane having a permeability effective to sustain a carbon dioxide flux equivalent to at least 10 mA/cm.sup.2 provides for removal of carbon dioxide produced at the anode by reaction of methanol with water. Another aspect of the present invention includes a superabsorpent polymer material placed in proximity to the anode gas diffusion backing to hold liquid methanol or liquid methanol solution without wetting the anode gas diffusion backing so that methanol vapor from the liquid methanol or liquid methanol-water solution is supplied to the membrane.

A Fast Hyperspectral Vector Radiative Transfer Model in UV to IR spectral bands

NASA Astrophysics Data System (ADS)

Ding, J.; Yang, P.; Sun, B.; Kattawar, G. W.; Platnick, S. E.; Meyer, K.; Wang, C.

2016-12-01

We develop a fast hyperspectral vector radiative transfer model with a spectral range from UV to IR with 5 nm resolutions. This model can simulate top of the atmosphere (TOA) diffuse radiance and polarized reflectance by considering gas absorption, Rayleigh scattering, and aerosol and cloud scattering. The absorption component considers several major atmospheric absorbers such as water vapor, CO2, O3, and O2 including both line and continuum absorptions. A regression-based method is used to parameterize the layer effective optical thickness for each gas, which substantially increases the computation efficiency for absorption while maintaining high accuracy. This method is over 500 times faster than the existing line-by-line method. The scattering component uses the successive order of scattering (SOS) method. For Rayleigh scattering, convergence is fast due to the small optical thickness of atmospheric gases. For cloud and aerosol layers, a small-angle approximation method is used in SOS calculations. The scattering process is divided into two parts, a forward part and a diffuse part. The scattering in the small-angle range in the forward direction is approximated as forward scattering. A cloud or aerosol layer is divided into thin layers. As the ray propagates through each thin layer, a portion diverges as diffuse radiation, while the remainder continues propagating in forward direction. The computed diffuse radiance is the sum of all of the diffuse parts. The small-angle approximation makes the SOS calculation converge rapidly even in a thick cloud layer.

Expression, purification, crystallization and preliminary X-ray crystallographic analysis of fructose-1,6-bisphosphate aldolase from Escherichia coli.

PubMed

Zhang, Li; Guo, Zheng; Huang, Jing; Liu, Meiruo; Wang, Yuandong; Ji, Chaoneng

2014-10-01

Fructose-1,6-bisphosphate aldolase is one of the most important enzymes in the glycolytic pathway and catalyzes the reversible cleavage of fructose-1,6-bisphosphate to dihydroxyacetone phosphate and glyceraldehyde 3-phosphate. The full-length fbaB gene encoding fructose-1,6-bisphosphate aldolase class I (FBPA I) was cloned from Escherichia coli strain BL21. FBPA I was overexpressed in E. coli and purified. Biochemical analysis found that the optimum reaction temperature of FBPA I is 330.5 K and that the enzyme has a high temperature tolerance. Crystals of recombinant FBPA I were obtained by the sitting-drop vapour-diffusion technique in a condition consisting of 19 mg ml(-1) FBPA I in 0.1 M Tris pH 9.0, 10%(w/v) polyethylene glycol 8000 and diffracted to 2.0 Å resolution. The crystals belonged to the monoclinic space group C2, with unit-cell parameters a = 217.7, b = 114.9, c = 183.9 Å, β = 124.6°. The asymmetric unit of these crystals may contain ten molecules, giving a Matthews coefficient of 2.48 Å(3) Da(-1) and a solvent content of 50.5%.

Thickness limitations in carbon nanotube reinforced silicon nitride coatings synthesized by vapor infiltration

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eres, Gyula

Chemical vapor infiltration is a convenient method for synthesizing carbon nanotube (CNT)-reinforced ceramic coatings. The thickness over which infiltration is relatively uniform is limited by gas phase diffusion in the pore structure. These effects were investigated in two types of silicon nitride matrix composites. With CNTs that were distributed uniformly on the substrate surface dense coatings were limited to thicknesses of several microns. With dual structured CNT arrays produced by photolithography coatings up to 400 gm thick were obtained with minimal residual porosity. Gas transport into these dual structured materials was facilitated by creating micron sized channels between "CNT pillars"more » (i.e. each pillar consisted of a large number of individual CNTs). The experimental results are consistent with basic comparisons between the rates of gas diffusion and silicon nitride growth in porous structures. This analysis also provides a general insight into optimizing infiltration conditions during the fabrication of thick CNT-reinforced composite coatings. (C) 2012 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.« less

Recombination properties of dislocations in GaN

NASA Astrophysics Data System (ADS)

Yakimov, Eugene B.; Polyakov, Alexander Y.; Lee, In-Hwan; Pearton, Stephen J.

2018-04-01

The recombination activity of threading dislocations in n-GaN with different dislocation densities and different doping levels was studied using electron beam induced current (EBIC). The recombination velocity on a dislocation, also known as the dislocation recombination strength, was calculated. The results suggest that dislocations in n-GaN giving contrast in EBIC are charged and surrounded by a space charge region, as evidenced by the observed dependence of dislocation recombination strength on dopant concentration. For moderate (below ˜108 cm-2) dislocation densities, these defects do not primarily determine the average diffusion length of nonequilibrium charge carriers, although locally, dislocations are efficient recombination sites. In general, it is observed that the effect of the growth method [standard metalorganic chemical vapor deposition (MOCVD), epitaxial lateral overgrowth versions of MOCVD, and hydride vapor phase epitaxy] on the recombination activity of dislocations is not very pronounced, although the average diffusion lengths can widely differ for various samples. The glide of basal plane dislocations at room temperature promoted by low energy electron irradiation does not significantly change the recombination properties of dislocations.

Ultra-fast vapor generation by a graphene nano-ratchet: a theoretical and simulation study.

PubMed

Ding, Hongru; Peng, Guilong; Mo, Shenqiu; Ma, Dengke; Sharshir, Swellam Wafa; Yang, Nuo

2017-12-14

Vapor generation is of prime importance for a broad range of applications: domestic water heating, desalination and wastewater treatment, etc. However, slow and inefficient evaporation limits its development. In this study, a nano-ratchet, a multilayer graphene with cone-shaped nanopores (MGCN), to accelerate vapor generation has been proposed. By performing molecular dynamics simulation, we found that air molecules were spontaneously transported across MGCN and resulted in a remarkable pressure difference, 21 kPa, between the two sides of MGCN. We studied the dependence of the pressure difference on the ambient temperature and geometry of MGCN in detail. Through further analysis of the diffusive transport, we found that pressure difference depended on the competition between ratchet transport and Knudsen diffusion and it was further found that ratchet transport is dominant. The significant pressure difference could lead to a 15-fold or greater enhancement of vapor generation, which shows the wide applications of this nano-ratchet.

Effect of polyethyleneimine modified graphene on the mechanical and water vapor barrier properties of methyl cellulose composite films.

PubMed

Liu, Hongyu; Liu, Cuiyun; Peng, Shuge; Pan, Bingli; Lu, Chang

2018-02-15

A series of novel methyl cellulose (MC) composite films were prepared using polyethyleneimine reduced graphene oxide (PEI-RGO) as an effective filler for water vapor barrier application. The as-prepared PEI-RGO/MC composites were characterized by Fourier transform infrared spectroscopy, X-ray diffraction, thermogravimetric analysis, tensile test and scanning electron microscopy. The experimental and theoretical results exhibited that PEI-RGO was uniformly dispersed in the MC matrix without aggregation and formed an aligned dispersion. The addition of PEI-RGO resulted in an enhanced surface hydrophobicity and a tortuous diffusion pathway for water molecules. Water vapor permeability of PEI-RGO/MC with loading of 3.0% of surface modified graphene was as low as 5.98×10 -11 gmm -2 s -1 Pa -1 . The synergistic effects of enhanced surface hydrophobicity and tortuous diffusion pathway were accounted for the improved water vapor barrier performance of the PEI-RGO/MC composite films. Copyright © 2017 Elsevier Ltd. All rights reserved.

Differential water sorption studies on Kevlar 49 and As-polymerized poly(p-phenylene terephthalamide): determination of water transport properties.

PubMed

Mooney, Damian A; MacElroy, J M Don

2007-11-06

Water vapor sorption experiments have been conducted on Kevlar 49 at 30 degrees C over a range of water vapor pressures in 0-90% of saturation and on the as-polymerized form of the material at 30, 45, and 60 degrees C over a series of water vapor pressures of 0-60%, 0-25%, and 0-15%, respectively. For each of the differential steps in water vapor pressure, dynamic uptake curves were generated and analyzed according to a number of different mathematical models, including Fickian, Coaxial cylindrical, and intercalation models. The intercalation model was demonstrated to be the most successful model and considered two time-scales involved in the diffusion process, i.e., a penetrant-diffusive time-scale and a polymer-local-matrix-relaxation time-scale. The success of this model reinforces previously reported adsorption and desorption isotherms which suggested that water may penetrate into the surface layers of the polymer crystallite through a process known as intercalation.

The Story of a Dewdrop.

ERIC Educational Resources Information Center

Abrikosov, A. A.

1992-01-01

Looks at one phase of the water cycle; the formation of drops in cooling water vapor. Examines the influence of surface shape on the equilibrium of the liquid and gas phases. Discusses the mathematical formulas that model the phenomenon. (MDH)

A Validated All-Pressure Fluid Drop Model and Lewis Number Effects for a Binary Mixture

NASA Technical Reports Server (NTRS)

Harstad, K.; Bellan, J.

1999-01-01

The differences between subcritical liquid drop and supercritical fluid drop behavior are discussed. Under subcritical, evaporative high emission rate conditions, a film layer is present in the inner part of the drop surface which contributes to the unique determination of the boundary conditions; it is this film layer which contributes to the solution's convective-diffusive character. In contrast, under supercritical condition as the boundary conditions contain a degree of arbitrariness due to the absence of a surface, and the solution has then a purely diffusive character. Results from simulations of a free fluid drop under no-gravity conditions are compared to microgravity experimental data from suspended, large drop experiments at high, low and intermediary temperatures and in a range of pressures encompassing the sub-and supercritical regime. Despite the difference between the conditions of the simulations and experiments (suspension vs. free floating), the time rate of variation of the drop diameter square is remarkably well predicted in the linear curve regime. The drop diameter is determined in the simulations from the location of the maximum density gradient, and agrees well with the data. It is also shown that the classical calculation of the Lewis number gives qualitatively erroneous results at supercritical conditions, but that an effective Lewis number previously defined gives qualitatively correct estimates of the length scales for heat and mass transfer at all pressures.

Fabrication of Polymer Microspheres for Optical Resonator and Laser Applications.

PubMed

Yamamoto, Yohei; Okada, Daichi; Kushida, Soh; Ngara, Zakarias Seba; Oki, Osamu

2017-06-02

This paper describes three methods of preparing fluorescent microspheres comprising π-conjugated or non-conjugated polymers: vapor diffusion, interface precipitation, and mini-emulsion. In all methods, well-defined, micrometer-sized spheres are obtained from a self-assembling process in solution. The vapor diffusion method can result in spheres with the highest sphericity and surface smoothness, yet the types of the polymers able to form these spheres are limited. On the other hand, in the mini-emulsion method, microspheres can be made from various types of polymers, even from highly crystalline polymers with coplanar, π-conjugated backbones. The photoluminescent (PL) properties from single isolated microspheres are unusual: the PL is confined inside the spheres, propagates at the circumference of the spheres via the total internal reflection at the polymer/air interface, and self-interferes to show sharp and periodic resonant PL lines. These resonating modes are so-called "whispering gallery modes" (WGMs). This work demonstrates how to measure WGM PL from single isolated spheres using the micro-photoluminescence (µ-PL) technique. In this technique, a focused laser beam irradiates a single microsphere, and the luminescence is detected by a spectrometer. A micromanipulation technique is then used to connect the microspheres one by one and to demonstrate the intersphere PL propagation and color conversion from coupled microspheres upon excitation at the perimeter of one sphere and detection of PL from the other microsphere. These techniques, µ-PL and micromanipulation, are useful for experiments on micro-optic application using polymer materials.

Energy gap opening by crossing drop cast single-layer graphene nanoribbons.

PubMed

Yamada, Toyo Kazu; Fukuda, Hideto; Fujiwara, Taizo; Liu, Polin; Nakamura, Kohji; Kasai, Seiya; Vazquez de Parga, Amadeo L; Tanaka, Hirofumi

2018-08-03

Band gap opening of a single-layer graphene nanoribbon (sGNR) sitting on another sGNR, fabricated by drop casting GNR solution on Au(111) substrate in air, was studied by means of scanning tunneling microscopy and spectroscopy in an ultra-high vacuum at 78 K and 300 K. GNRs with a width of ∼45 nm were prepared by unzipping double-walled carbon nanotubes (diameter ∼15 nm) using the ultrasonic method. In contrast to atomically-flat GNRs fabricated via the bottom-up process, the drop cast sGNRs were buckled on Au(111), i.e., some local points of the sGNR are in contact with the substrate (d ∼ 0.5 nm), but other parts float (d ∼ 1-3 nm), where d denotes the measured distance between the sGNR and the substrate. In spite of the fact that the nanoribbons were buckled, dI/dV maps confirmed that each buckled sGNR had a metallic character (∼3.5 G o ) with considerable uniform local density of states, comparable to a flat sGNR. However, when two sGNRs crossed each other, the crossed areas showed a band gap between -50 and +200 meV around the Fermi energy, i.e., the only upper sGNR electronic property changed from metallic to p-type semiconducting, which was not due to the bending, but the electronic interactions between the up and down sGNRs.

Mutual diffusion of binary liquid mixtures containing methanol, ethanol, acetone, benzene, cyclohexane, toluene, and carbon tetrachloride

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guevara-Carrion, Gabriela; Janzen, Tatjana; Muñoz-Muñoz, Y. Mauricio

Mutual diffusion coefficients of all 20 binary liquid mixtures that can be formed out of methanol, ethanol, acetone, benzene, cyclohexane, toluene, and carbon tetrachloride without a miscibility gap are studied at ambient conditions of temperature and pressure in the entire composition range. The considered mixtures show a varying mixing behavior from almost ideal to strongly non-ideal. Predictive molecular dynamics simulations employing the Green-Kubo formalism are carried out. Radial distribution functions are analyzed to gain an understanding of the liquid structure influencing the diffusion processes. It is shown that cluster formation in mixtures containing one alcoholic component has a significant impactmore » on the diffusion process. The estimation of the thermodynamic factor from experimental vapor-liquid equilibrium data is investigated, considering three excess Gibbs energy models, i.e., Wilson, NRTL, and UNIQUAC. It is found that the Wilson model yields the thermodynamic factor that best suits the simulation results for the prediction of the Fick diffusion coefficient. Four semi-empirical methods for the prediction of the self-diffusion coefficients and nine predictive equations for the Fick diffusion coefficient are assessed and it is found that methods based on local composition models are more reliable. Finally, the shear viscosity and thermal conductivity are predicted and in most cases favorably compared with experimental literature values.« less

Effects of side lying on lung function in older individuals.

PubMed

Manning, F; Dean, E; Ross, J; Abboud, R T

1999-05-01

Body positioning exerts a strong effect on pulmonary function, but its effect on other components of the oxygen transport pathway are less well understood, especially the effects of side-lying positions. This study investigated the interrelationships between side-lying positions and indexes of lung function such as spirometry, alveolar diffusing capacity, and inhomogeneity of ventilation in older individuals. Nineteen nonsmoking subjects (mean age=62.8 years, SD=6.8, range=50-74) with no history of cardiac or pulmonary disease were tested over 2 sessions. The test positions were sitting and left side lying in one session and sitting and right side lying in the other session. In each of the positions, forced vital capacity (FVC), forced expiratory volume in 1 second (FEV1), single-breath pulmonary diffusing capacity (DLCO/VA), and the slope of phase III (DN2%/L) of the single-breath nitrogen washout test to determine inhomogeneity of ventilation were measured. Compared with measurements obtained in the sitting position, FVC and FEV1 were decreased equally in the side-lying positions, but no change was observed in DLCO/VA or DN2%/L. Side-lying positions resulted in decreases in FVC and FEV1, which is consistent with the well-documented effects of the supine position. These findings further support the need for prescriptive rather than routine body positioning of patients with risks of cardiopulmonary compromise and the need to use upright positions in which lung volumes and capacities are maximized.

On the autonomous motion of active drops or bubbles.

PubMed

Ryazantsev, Yuri S; Velarde, Manuel G; Guzman, Eduardo; Rubio, Ramón G; Ortega, Francisco; Montoya, Juan-Jose

2018-05-19

Thermo-capillary stresses on the surface of a drop can be the result of a non-isothermal surface chemical conversion of a reactant dissolved in the host fluid. The strength of heat production (with e.g. absorption) on the surface is ruled by the diffusion of the reactant and depends on the state of motion of the drop. Such thermo-capillary stresses can provoke the motion of the drop or its motionless state in the presence of an external body force. If in the balance of forces, including indeed viscous drag, the net resultant force vanishes there is the possibility of autonomous motion with constant velocity of the drop. Focusing on drops with radii in the millimeter range provided here is a quantitative study of the possibility of such autonomous motion when the drop, considered as active unit, is seat of endo- or exo-thermic reactive processes that dominate its motion. The framework is restricted to Stokes flows in the hydrodynamics, negligible heat Peclet number while the solute Peclet number is considered very high. A boundary layer approximation is used in the description of reactant diffusion. Those processes eventually end up in the action being expressed by surface tension gradients and the Marangoni effect. Explicit expressions of the force acting on the drop and the velocity fields inside and outside the drop are provided. Some significant particular cases are discussed to illustrate the usefulness of the theory. Copyright © 2018. Published by Elsevier Inc.

Methane biofiltration in the presence of ethanol vapor under steady and transient state conditions: an experimental study.

PubMed

Ferdowsi, Milad; Ramirez, Antonio Avalos; Jones, Joseph Peter; Heitz, Michèle

2017-09-01

Methane (CH 4 ) removal in the presence of ethanol vapors was performed by a stone-based bed and a hybrid packing biofilter in parallel. In the absence of ethanol, a methane removal efficiency of 55 ± 1% was obtained for both biofilters under similar CH 4 inlet load (IL) of 13 ± 0.5 g CH4  m -3  h -1 and an empty bed residence time (EBRT) of 6 min. The results proved the key role of the bottom section in both biofilters for simultaneous removal of CH 4 and ethanol. Ethanol vapor was completely eliminated in the bottom sections for an ethanol IL variation between 1 and 11 g ethanol  m -3  h -1 . Ethanol absorption and accumulation in the biofilm phase as well as ethanol conversion to CO 2 contributed to ethanol removal efficiency of 100%. In the presence of ethanol vapor, CO 2 productions in the bottom section increased almost fourfold in both biofilters. The ethanol concentration in the leachate of the biofilter exceeding 2200 g ethanol  m -3 leachate in both biofilters demonstrated the excess accumulation of ethanol in the biofilm phase. The biofilters responded quickly to an ethanol shock load followed by a starvation with 20% decrease of their performance. The return to normal operations in both biofilters after the transient conditions took less than 5 days. Unlike the hybrid packing biofilter, excess pressure drop (up to 1.9 cmH 2 O m -1 ) was an important concern for the stone bed biofilter. The biomass accumulation in the bottom section of the stone bed biofilter contributed to 80% of the total pressure drop. However, the 14-day starvation reduced the pressure drop to 0.25 cmH 2 O m -1 .

Structure and characteristics of heterogeneous detonation

NASA Astrophysics Data System (ADS)

Nicholls, J. A.; Sichel, M.; Kauffman, C. W.

1983-09-01

The emphasis of this research program centered around the structure of heterogeneous detonation waves, inasmuch as this had been found to be very important to the detonation characteristics of heterogeneous mixtures. On the experimental side, a vertical detonation tube was used wherein liquid fuel drops, all of one size, were generated at the top of the tube and allowed to fall vertically into the desired gaseous mixture. A strong blast wave was transmitted into the mixture through use of an auxiliary shock tube. The propagation of the resultant wave was monitored by pressure switches, pressure transducers, and photography. The low vapor pressure liquid fuel, decane (400 micrometer drop size) was used for most of the experiments. Attention was given to wave structure, wave velocity, and initiation energy. Three atmospheres (100% O2; 40% O2/60% N2; and air) and a number of equivalence ratios were investigated. Holographic pictures and streak photography were employed to study the drop shattering process and the structure of the front. Other experiments investigated the addition of the sensitizer, normal propyl nitrate (NPN), to the decane. The important aspect of vapor pressure was studied by heating the entire tube to various elevated temperatures and then noting the effect on detonability.

Anomalous electrical conductivity of a gold thin film percolation system

NASA Astrophysics Data System (ADS)

Tao, Xiang-Ming; Ye, Gao-Xiang; Ye, Quan-Lin; Jin, Jin-Sheng; Lao, Yan-Feng; Jiao, Zheng-Kuan

2002-09-01

A gold thin film percolation system, deposited on a glass surface by the vapor deposition method, has been fabricated. By using the expansive and mobile properties of the silicone oil drop, a characteristic wedge-shaped film system with a slope of ~10-5 naturally forms during deposition. The electrical conductivity of the bandlike film, i.e., the uniform part of the wedge-shaped film with a fixed thickness, is measured with the four-probe method. It is found that the hopping and tunneling effects of the films are stronger than those of the other films. The dependence between the dc sheet resistance R0 and temperature T shows that the samples exhibit a negative coefficient dR0/dT below the temperature T*. According to our experiment, it is suggested that all the anomalous behaviors of the system should be related to the characteristic microstructure of the samples, which results from the immediate quench processes by the oil drop during deposition. The experiment indicates that the relaxation period of the microstructure of the samples may be longer than 30 min.

Free-surface flow of liquid oxygen under non-uniform magnetic field

NASA Astrophysics Data System (ADS)

Bao, Shi-Ran; Zhang, Rui-Ping; Wang, Kai; Zhi, Xiao-Qin; Qiu, Li-Min

2017-01-01

The paramagnetic property of oxygen makes it possible to control the two-phase flow at cryogenic temperatures by non-uniform magnetic fields. The free-surface flow of vapor-liquid oxygen in a rectangular channel was numerically studied using the two-dimensional phase field method. The effects of magnetic flux density and inlet velocity on the interface deformation, flow pattern and pressure drop were systematically revealed. The liquid level near the high-magnetic channel center was lifted upward by the inhomogeneous magnetic field. The interface height difference increased almost linearly with the magnetic force. For all inlet velocities, pressure drop under 0.25 T was reduced by 7-9% due to the expanded local cross-sectional area, compared to that without magnetic field. This work demonstrates the effectiveness of employing non-uniform magnetic field to control the free-surface flow of liquid oxygen. This non-contact method may be used for promoting the interface renewal, reducing the flow resistance, and improving the flow uniformity in the cryogenic distillation column, which may provide a potential for enhancing the operating efficiency of cryogenic air separation.

"Pressure Blocking" Effect in the Growing Vapor Bubble in a Highly Superheated Liquid

NASA Astrophysics Data System (ADS)

Zudin, Yu. B.; Zenin, V. V.

2016-09-01

The problem on the growth of a vapor bubble in a liquid whose superheating enthalpy exceeds the phase transition heat has been considered. A physical model of the "pressure blocking" in the bubble is presented. The problem for the conditions of the experiment on the effervescence of a butane drop has been solved numerically. An algorithm for constructing an analytical solution of the problem on the bubble growth in a highly superheated liquid is proposed.

PREDICTION OF THE VAPOR PRESSURE, BOILING POINT, HEAT OF VAPORIZATION AND DIFFUSION COEFFICIENT OF ORGANIC COMPOUNDS

EPA Science Inventory

The prototype computer program SPARC has been under development for several years to estimate physical properties and chemical reactivity parameters of organic compounds strictly from molecular structure. SPARC solute-solute physical process models have been developed and tested...

Substrate-mediated diffusion-induced growth of single-crystal nanowires.

PubMed

Mohammad, S Noor

2009-11-28

Theoretical investigations of the growth and growth rates of single-crystal nanowires (NWs) by vapor phase mechanisms have been carried out. Substrate-induced processes are assumed to dominate this growth. The modeling for growth takes adsorption, desorption, surface scattering, and diffusion into account. It takes into consideration also the retarding electric field arising from the scattering of the NW vapor species by both the substrate and the NW sidewalls. Growth characteristics under the influence of the retarding electric field have been studied. Competitive roles of adatom diffusivity and the electric field in the NW growth are elucidated. Influence of the growing NW length and the adatom impingement rate on the NW growth rate has been described. The effect of adatom collection area around each NW has been examined. The NW tapering and kinking have been explained. The fundamentals of the substrate induction and details of the growth parameters have been analyzed. The influence of foreign element catalytic agents in the vapor-liquid-solid mechanism has been presented. All these have led to the understanding and resolution of problems, controversies, and contradictions involving substrate-induced NW growths.

Microgravity nucleation and particle coagulation experiments support

NASA Technical Reports Server (NTRS)

Lilleleht, L. U.; Lass, T. J.

1987-01-01

A hollow sphere model is developed to predict the range of supersaturation ratio values for refractory metal vapors in a proposed experimental nucleation apparatus. Since the experiments are to be carried out in a microgravity environment, the model neglects the effects of convection and assumes that the only transfer of vapors through an inert gas atmosphere is by conduction and molecular diffusion. A consistent set of physical properties data is assembled for the various candidate metals and inert ambient gases expected to be used in the nucleation experiments. Transient partial pressure profiles are computed for the diffusing refractory species for two possible temperature distributions. The supersaturation ratio values from both candidate temperature profiles are compared with previously obtained experimetnal data on a silver-hydrogen system. The model is used to simulate the diffusion of magnesium vapor through argon and other inert gas atmospheres over ranges of initial and boundary conditions. These results identify different combinations of design and operating parameters which are liekly to produce supersaturation ratio values high enough to induce homogeneous nucleation in the apparatus being designed for the microgravity nucleation experiments.