Expression, purification and crystallization of a human protein SH3BGRL at atomic resolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yin, Lei; Zhu, De-Yu; Yang, Na

2005-04-01

The protein SH3BGRL, containing both SH3-binding and Homer EVH1-binding motifs, has been crystallized using the hanging-drop vapour-diffusion method. The protein SH3BGRL, containing both SH3-binding and Homer EVH1-binding motifs, has been crystallized using the hanging-drop vapour-diffusion method. The crystals diffract to 0.88 Å resolution and belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 28.8886, b = 34.9676, c = 98.0016 Å. Preliminary analysis indicates that the asymmetric unit contains one molecule and has a solvent content of about 34%.

Purification, crystallization and preliminary X-ray diffraction analysis of the Escherichia coli common pilus chaperone EcpB

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garnett, James A.; Diallo, Mamou; Matthews, Steve J., E-mail: s.j.matthews@imperial.ac.uk

In Escherichia coli, the common pilus (Ecp) belongs to an alternative chaperone–usher pathway that plays a major role in both early biofilm formation and host-cell adhesion. Initial attempts at crystallizing the chaperone EcpB using natively purified protein from the bacterial periplasm were not successful; however, after the isolation of EcpB under denaturing conditions and subsequent refolding, crystals were obtained at pH 8.0 using the sitting-drop method of vapour diffusion. This is the first time that this refolding strategy has been used to purify CU chaperones. Pili are key cell-surface components that allow the attachment of bacteria to both biological andmore » abiotic solid surfaces, whilst also mediating interactions between themselves. In Escherichia coli, the common pilus (Ecp) belongs to an alternative chaperone–usher (CU) pathway that plays a major role in both early biofilm formation and host-cell adhesion. The chaperone EcpB is involved in the biogenesis of the filament, which is composed of EcpA and EcpD. Initial attempts at crystallizing EcpB using natively purified protein from the bacterial periplasm were not successful; however, after the isolation of EcpB under denaturing conditions and subsequent refolding, crystals were obtained at pH 8.0 using the sitting-drop method of vapour diffusion. Diffraction data have been processed to 2.4 Å resolution. These crystals belonged to the trigonal space group P3{sub 1}21 or P3{sub 2}21, with unit-cell parameters a = b = 62.65, c = 121.14 Å and one monomer in the asymmetric unit. Molecular replacement was unsuccessful, but selenomethionine-substituted protein and heavy-atom derivatives are being prepared for phasing. The three-dimensional structure of EcpB will provide invaluable information on the subtle mechanistic differences in biogenesis between the alternative and classical CU pathways. Furthermore, this is the first time that this refolding strategy has been used to purify CU chaperones, and it could be implemented in similar systems where it has not been possible to obtain highly ordered crystals.« less

Purification, crystallization and preliminary X-ray diffraction analysis of GatD, a glutamine amidotransferase-like protein from Staphylococcus aureus peptidoglycan

PubMed Central

Vieira, Diana; Figueiredo, Teresa A.; Verma, Anil; Sobral, Rita G.; Ludovice, Ana M.; de Lencastre, Hermínia; Trincao, Jose

2014-01-01

Amidation of peptidoglycan is an essential feature in Staphylococcus aureus that is necessary for resistance to β-lactams and lysozyme. GatD, a 27 kDa type I glutamine amidotransferase-like protein, together with MurT ligase, catalyses the amidation reaction of the glutamic acid residues of the peptidoglycan of S. aureus. The native and the selenomethionine-derivative proteins were crystallized using the sitting-drop vapour-diffusion method with polyethylene glycol, sodium acetate and calcium acetate. The crystals obtained diffracted beyond 1.85 and 2.25 Å, respectively, and belonged to space group P212121. X-ray diffraction data sets were collected at Diamond Light Source (on beamlines I02 and I04) and were used to obtain initial phases. PMID:24817726

Crystallization and preliminary X-ray diffraction analysis of the peripheral light-harvesting complex LH2 from Marichromatium purpuratum.

PubMed

Cranston, Laura J; Roszak, Aleksander W; Cogdell, Richard J

2014-06-01

LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment-protein complex that is involved in harvesting light energy and transferring it to the LH1-RC `core' complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a=b=109.36, c=80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer.

Crystallization and preliminary X-ray diffraction analysis of the peripheral light-harvesting complex LH2 from Marichromatium purpuratum

PubMed Central

Cranston, Laura J.; Roszak, Aleksander W.; Cogdell, Richard J.

2014-01-01

LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment–protein complex that is involved in harvesting light energy and transferring it to the LH1–RC ‘core’ complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a = b = 109.36, c = 80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer. PMID:24915099

Expression, purification, crystallization and preliminary X-ray analysis of tannase from Lactobacillus plantarum.

PubMed

Wu, Mingbo; Peng, Xiaohong; Wen, Hua; Wang, Qin; Chen, Qianming; McKinstry, William J; Ren, Bin

2013-04-01

Tannase catalyses the hydrolysis of the galloyl ester bond of tannins to release gallic acid. It belongs to the serine esterases and has wide applications in the food, feed, beverage, pharmaceutical and chemical industries. The tannase from Lactobacillus plantarum was cloned, expressed and purified. The protein was crystallized by the sitting-drop vapour-diffusion method with microseeding. The crystals belonged to space group P1, with unit-cell parameters a = 46.5, b = 62.8, c = 83.8 Å, α = 70.4, β = 86.0, γ = 79.4°. Although the enzyme exists mainly as a monomer in solution, it forms a dimer in the asymmetric unit of the crystal. The crystals diffracted to beyond 1.60 Å resolution using synchrotron radiation and a complete data set was collected to 1.65 Å resolution.

Crystallization and initial X-ray analysis of polyhydroxyalkanoate granule-associated protein from Aeromonas hydrophila

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Minglian; Li, Zhenguo; Zheng, Wei

The phasin PhaP{sub Ah} from A. hydrophila strain 4AK4 was crystallized using the hanging-drop vapour-diffusion method. Polyhydroxyalkanoate (PHA) granule-associated proteins (phasins) were discovered in PHA-accumulating bacteria. They play a crucial role as a structural protein during initial PHA-granule formation and granule growth and also serve as interfaces for granule stabilization in vivo. The phasin PhaP{sub Ah} from Aeromonas hydrophila strain 4AK4 was crystallized using the hanging-drop vapour-diffusion method. Single crystals were cryocooled for X-ray diffraction analysis. The phasin crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 80.8, b = 108.9, c = 134.4 Å.

Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708

PubMed Central

Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

2009-01-01

Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 Å resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P212121, with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 Å. The Matthews coefficient (V M = 1.76 Å3 Da−1) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit. PMID:19923737

Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708.

PubMed

Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

2009-11-01

Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 angstrom resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P2(1)2(1)2(1), with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 angstrom. The Matthews coefficient (V(M) = 1.76 angstrom(3) Da(-1)) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit.

Crystallization and preliminary X-ray diffraction analysis of P30, the transmembrane domain of pertactin, an autotransporter from Bordetella pertussis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhu, Yanshi; Black, Isobel; Roszak, Aleksander W.

2007-07-01

P30, the transmembrane C-terminal domain of pertactin from B. pertussis has been crystallized after refolding in vitro. Preliminary X-ray crystallographic data are reported. P30, the 32 kDa transmembrane C-terminal domain of pertactin from Bordetella pertussis, is supposed to form a β-barrel inserted into the outer membrane for the translocation of the passenger domain. P30 was cloned and expressed in inclusion bodies in Escherichia coli. After refolding and purification, the protein was crystallized using the sitting-drop vapour-diffusion method at 292 K. The crystals diffract to a resolution limit of 3.5 Å using synchrotron radiation and belong to the hexagonal space groupmore » P6{sub 1}22, with unit-cell parameters a = b = 123.27, c = 134.43 Å.« less

Purification, crystallization and preliminary X-ray diffraction study of human ribosomal protein L10 core domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishimura, Mitsuhiro; Protein Research Group, RIKEN Yokohama Institute, RIKEN Genomic Sciences Center, 1-7-22 Suehiro-cho, Tsurumi, Yokohama 230-0045; Kaminishi, Tatsuya

2007-11-01

A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to spacemore » group P3{sub 1}21 or P3{sub 2}21.« less

Crystallization and preliminary X-ray analysis of the stress-response PPM phosphatase RsbX from Bacillus subtilis

PubMed Central

Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi

2009-01-01

RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase σ factor SigB. In order to elucidate the structural–functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 Å resolution with an R merge of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 Å, α = 98.8, β = 90.0, γ = 108.4°. PMID:19923733

Crystallization and preliminary X-ray analysis of the stress-response PPM phosphatase RsbX from Bacillus subtilis.

PubMed

Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi

2009-11-01

RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase sigma factor SigB. In order to elucidate the structural-functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 angstrom resolution with an R(merge) of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 angstrom , alpha = 98.8, beta = 90.0, gamma = 108.4 degrees.

Purification, crystallization and preliminary X-ray diffraction studies of UDP-N-acetylglucosamine pyrophosphorylase from Candida albicans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maruyama, Daisuke; Nishitani, Yuichi; Nonaka, Tsuyoshi

2006-12-01

UDP-N-acetylglucosamine pyrophosphorylase was purified and crystallized and X-ray diffraction data were collected to 2.3 Å resolution. UDP-N-acetylglucosamine pyrophosphorylase (UAP) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine. UAP from Candida albicans was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals of the substrate and product complexes both diffract X-rays to beyond 2.3 Å resolution using synchrotron radiation. The crystals of the substrate complex belong to the triclinic space group P1, with unit-cell parameters a = 47.77, b = 62.89, c = 90.60 Å, α = 90.01, β = 97.72, γ = 92.88°, whereas those of the productmore » complex belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 61.95, b = 90.87, c = 94.88 Å.« less

Recombinant expression, purification, crystallization and preliminary X-ray diffraction analysis of the C-terminal DUF490(963-1138) domain of TamB from Escherichia coli.

PubMed

Josts, Inokentijs; Grinter, Rhys; Kelly, Sharon M; Mosbahi, Khedidja; Roszak, Aleksander; Cogdell, Richard; Smith, Brian O; Byron, Olwyn; Walker, Daniel

2014-09-01

TamB is a recently described inner membrane protein that, together with its partner protein TamA, is required for the efficient secretion of a subset of autotransporter proteins in Gram-negative bacteria. In this study, the C-terminal DUF490963-1138 domain of TamB was overexpressed in Escherichia coli K-12, purified and crystallized using the sitting-drop vapour-diffusion method. The crystals belonged to the primitive trigonal space group P3121, with unit-cell parameters a = b = 57.34, c = 220.74 Å, and diffracted to 2.1 Å resolution. Preliminary secondary-structure and X-ray diffraction analyses are reported. Two molecules are predicted to be present in the asymmetric unit. Experimental phasing using selenomethionine-labelled protein will be undertaken in the future.

Expression, purification, crystallization and preliminary X-ray analysis of tannase from Lactobacillus plantarum

PubMed Central

Wu, Mingbo; Peng, Xiaohong; Wen, Hua; Wang, Qin; Chen, Qianming; McKinstry, William J.; Ren, Bin

2013-01-01

Tannase catalyses the hydrolysis of the galloyl ester bond of tannins to release gallic acid. It belongs to the serine esterases and has wide applications in the food, feed, beverage, pharmaceutical and chemical industries. The tannase from Lactobacillus plantarum was cloned, expressed and purified. The protein was crystallized by the sitting-drop vapour-diffusion method with microseeding. The crystals belonged to space group P1, with unit-cell paramters a = 46.5, b = 62.8, c = 83.8 Å, α = 70.4, β = 86.0, γ = 79.4°. Although the enzyme exists mainly as a monomer in solution, it forms a dimer in the asymmetric unit of the crystal. The crystals diffracted to beyond 1.60 Å resolution using synchrotron radiation and a complete data set was collected to 1.65 Å resolution. PMID:23545659

Crystallization and preliminary X-ray diffraction analysis of the P3 RNA domain of yeast ribonuclease MRP in a complex with RNase P/MRP protein components Pop6 and Pop7.

PubMed

Perederina, Anna; Esakova, Olga; Quan, Chao; Khanova, Elena; Krasilnikov, Andrey S

2010-01-01

Eukaryotic ribonucleases P and MRP are closely related RNA-based enzymes which contain a catalytic RNA component and several protein subunits. The roles of the protein subunits in the structure and function of eukaryotic ribonucleases P and MRP are not clear. Crystals of a complex that included a circularly permuted 46-nucleotide-long P3 domain of the RNA component of Saccharomyces cerevisiae ribonuclease MRP and selenomethionine derivatives of the shared ribonuclease P/MRP protein components Pop6 (18.2 kDa) and Pop7 (15.8 kDa) were obtained using the sitting-drop vapour-diffusion method. The crystals belonged to space group P4(2)22 (unit-cell parameters a = b = 127.2, c = 76.8 A, alpha = beta = gamma = 90 degrees ) and diffracted to 3.25 A resolution.

Purification, crystallization and preliminary crystallographic analysis of Streptococcus pyogenes laminin-binding protein Lbp

DOE Office of Scientific and Technical Information (OSTI.GOV)

Linke, Christian, E-mail: clin180@ec.auckland.ac.nz; Caradoc-Davies, Tom T.; Australian Synchrotron, Clayton, Victoria 3168

2008-02-01

The S. pyogenes laminin-binding protein Lbp, which is essential for adhesion to human laminin, has been expressed, purified and crystallized. The laminin-binding protein Lbp (Spy2007) from Streptococcus pyogenes (a group A streptococcus) mediates adhesion to the human basal lamina glycoprotein laminin. Accordingly, Lbp is essential in in vitro models of cell adhesion and invasion. However, the molecular and structural basis of laminin binding by bacteria remains unknown. Therefore, the lbp gene has been cloned for recombinant expression in Escherichia coli. Lbp has been purified and crystallized from 30%(w/v) PEG 1500 by the sitting-drop vapour-diffusion method. The crystals belonged to themore » monoclinic space group P2{sub 1}, with unit-cell parameters a = 42.62, b = 92.16, c = 70.61 Å, β = 106.27°, and diffracted to 2.5 Å resolution.« less

Crystallization and preliminary X-ray analysis of CTP:phosphoethanolamine cytidylyltransferase (ECT) from Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ohtsuka, Jun; Nagata, Koji; Lee, Woo Cheol

2006-10-01

CTP:phosphoethanolamine cytidylyltransferase from S. cerevisiae has been expressed, purified and crystallized. CTP:phosphoethanolamine cytidylyltransferase (ECT) is the enzyme that catalyzes the conversion of phosphoethanolamine to CDP-ethanolamine in the phosphatidylethanolamine-biosynthetic pathway (Kennedy pathway). ECT from Saccharomyces cerevisiae was crystallized by the sitting-drop vapour-diffusion method using PEG 4000 as precipitant. The crystals diffracted X-rays from a synchrotron-radiation source to 1.88 Å resolution. The space group was assigned as primitive tetragonal, P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 66.3, c = 150.8 Å. The crystals contain one ECT molecule in the asymmetric unit (V{sub M} = 2.2more » Å{sup 3} Da{sup −1}), with a solvent content of 43%.« less

Crystallization and preliminary X-ray analysis of the NADPH-dependent 3-quinuclidinone reductase from Rhodotorula rubra

PubMed Central

Takeshita, Daijiro; Kataoka, Michihiko; Miyakawa, Takuya; Miyazono, Ken-ichi; Uzura, Atsuko; Nagata, Koji; Shimizu, Sakayu; Tanokura, Masaru

2009-01-01

(R)-3-Quinuclidinol is a useful compound that is applicable to the synthesis of various pharmaceuticals. The NADPH-dependent carbonyl reductase 3-­quinuclidinone reductase from Rhodotorula rubra catalyzes the stereospecific reduction of 3-quinuclidinone to (R)-3-quinuclidinol and is expected to be utilized in industrial production of this alcohol. 3-Quinuclidinone reductase from R. rubra was expressed in Escherichia coli and purified using Ni-affinity and ion-exchange column chromatography. Crystals of the protein were obtained by the sitting-drop vapour-diffusion method using PEG 8000 as the precipitant. The crystals belonged to space group P41212, with unit-cell parameters a = b = 91.3, c = 265.4 Å, and diffracted X-rays to 2.2 Å resolution. The asymmetric unit contained four molecules of the protein and the solvent content was 48.4%. PMID:19478454

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

Preparation, crystallization and preliminary crystallographic analysis of old yellow enzyme from Trypanosoma cruzi

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sugiyama, Shigeru; Tokuoka, Keiji; Uchiyama, Nahoko

2007-10-01

Old yellow enzyme from Trypanosoma cruzi, has been crystallized using the hanging-drop vapour-diffusion method. Old yellow enzyme (OYE) is an NADPH oxidoreductase that contains a flavin mononucleotide as a prosthetic group. The OYE from Trypanosoma cruzi, which produces prostaglandin F{sub 2α}, a potent mediator of various physiological and pathological processes, from prostaglandin H2. The protein was recombinantly expressed and purified from Escherichia coli and was crystallized using the hanging-drop vapour-diffusion method. The crystal belongs to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 56.3, b = 78.8, c = 78.8 Å, β = 93.4° and two moleculesmore » per asymmetric unit. The crystals were suitable for X-ray crystallographic studies and diffracted to 1.70 Å resolution. A Patterson search method is in progress using the structure of OYE from Pseudomonas putida as a starting model.« less

Purification, identification and preliminary crystallographic studies of an allergenic protein from Lathyrus sativus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qureshi, Insaf A.; Sethi, Dhruv K.; Salunke, Dinakar M., E-mail: dinakar@nii.res.in

2006-09-01

A 24 kDa protein was purified from the seeds of L. sativus by ammonium sulfate fractionation and ion-exchange chromatography. Crystals were obtained by the hanging-drop vapour-diffusion method. A 24 kDa protein was purified from the seeds of Lathyrus sativus by ammonium sulfate fractionation and ion-exchange chromatography. The N-terminal amino-acid sequence showed significant homology with the 2S albumin class of seed storage proteins. The protein showed 85% sequence homology with the seed albumin of Pisum sativum within the 40 N-terminal residues. Crystals were obtained by the hanging-drop vapour-diffusion method. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cellmore » parameters a = 43.5, b = 82.7, c = 153.4 Å.« less

Development of an automated large-scale protein-crystallization and monitoring system for high-throughput protein-structure analyses.

PubMed

Hiraki, Masahiko; Kato, Ryuichi; Nagai, Minoru; Satoh, Tadashi; Hirano, Satoshi; Ihara, Kentaro; Kudo, Norio; Nagae, Masamichi; Kobayashi, Masanori; Inoue, Michio; Uejima, Tamami; Oda, Shunichiro; Chavas, Leonard M G; Akutsu, Masato; Yamada, Yusuke; Kawasaki, Masato; Matsugaki, Naohiro; Igarashi, Noriyuki; Suzuki, Mamoru; Wakatsuki, Soichi

2006-09-01

Protein crystallization remains one of the bottlenecks in crystallographic analysis of macromolecules. An automated large-scale protein-crystallization system named PXS has been developed consisting of the following subsystems, which proceed in parallel under unified control software: dispensing precipitants and protein solutions, sealing crystallization plates, carrying robot, incubators, observation system and image-storage server. A sitting-drop crystallization plate specialized for PXS has also been designed and developed. PXS can set up 7680 drops for vapour diffusion per hour, which includes time for replenishing supplies such as disposable tips and crystallization plates. Images of the crystallization drops are automatically recorded according to a preprogrammed schedule and can be viewed by users remotely using web-based browser software. A number of protein crystals were successfully produced and several protein structures could be determined directly from crystals grown by PXS. In other cases, X-ray quality crystals were obtained by further optimization by manual screening based on the conditions found by PXS.

Crystallization screening test for the whole-cell project on Thermus thermophilus HB8

PubMed Central

Iino, Hitoshi; Naitow, Hisashi; Nakamura, Yuki; Nakagawa, Noriko; Agari, Yoshihiro; Kanagawa, Mayumi; Ebihara, Akio; Shinkai, Akeo; Sugahara, Mitsuaki; Miyano, Masashi; Kamiya, Nobuo; Yokoyama, Shigeyuki; Hirotsu, Ken; Kuramitsu, Seiki

2008-01-01

It was essential for the structural genomics of Thermus thermophilus HB8 to efficiently crystallize a number of proteins. To this end, three conventional robots, an HTS-80 (sitting-drop vapour diffusion), a Crystal Finder (hanging-drop vapour diffusion) and a TERA (modified microbatch) robot, were subjected to a crystallization condition screening test involving 18 proteins from T. thermophilus HB8. In addition, a TOPAZ (microfluidic free-interface diffusion) designed specifically for initial screening was also briefly examined. The number of diffraction-quality crystals and the time of appearance of crystals increased in the order HTS-80, Crystal Finder, TERA. With the HTS-80 and Crystal Finder, the time of appearance was short and the rate of salt crystallization was low. With the TERA, the number of diffraction-quality crystals was high, while the time of appearance was long and the rate of salt crystallization was relatively high. For the protein samples exhibiting low crystallization success rates, there were few crystallization conditions that were common to the robots used. In some cases, the success rate depended greatly on the robot used. The TOPAZ showed the shortest time of appearance and the highest success rate, although the crystals obtained were too small for diffraction studies. These results showed that the combined use of different robots significantly increases the chance of obtaining crystals, especially for proteins exhibiting low crystallization success rates. The structures of 360 of 944 purified proteins have been successfully determined through the combined use of an HTS-80 and a TERA. PMID:18540056

Crystallization and preliminary X-ray analysis of the NAD+-reducing [NiFe] hydrogenase from Hydrogenophilus thermoluteolus TH-1

PubMed Central

Taketa, Midori; Nakagawa, Hanae; Habukawa, Mao; Osuka, Hisao; Kihira, Kiyohito; Komori, Hirofumi; Shibata, Naoki; Ishii, Masaharu; Igarashi, Yasuo; Nishihara, Hirofumi; Yoon, Ki-Seok; Ogo, Seiji; Shomura, Yasuhito; Higuchi, Yoshiki

2015-01-01

NAD+-reducing [NiFe] hydrogenases catalyze the oxidoreduction of dihydrogen concomitant with the interconversion of NAD+ and NADH. Here, the isolation, purification and crystallization of the NAD+-reducing [NiFe] hydrogenase from Hydrogenophilus thermoluteolus TH-1 are reported. Crystals of the NAD+-reducing [NiFe] hydrogenase were obtained within one week from a solution containing polyethylene glycol using the sitting-drop vapour-diffusion method and micro-seeding. The crystal diffracted to 2.58 Å resolution and belonged to space group C2, with unit-cell parameters a = 131.43, b = 189.71, c = 124.59 Å, β = 109.42°. Assuming the presence of two NAD+-reducing [NiFe] hydrogenase molecules in the asymmetric unit, V M was calculated to be 2.2 Å3  Da−1, which corresponds to a solvent content of 43%. Initial phases were determined by the single-wavelength anomalous dispersion method using the anomalous signal from the Fe atoms. PMID:25615977

Crystallization and preliminary crystallographic analysis of recombinant immunoglobulin G-binding protein from Streptococcus suis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khan, Abdul Hamid; Chu, Fuliang; Feng, Youjun

2008-08-01

Crystallization of recombinant IgG-binding protein expressed in Escherichia coli using the hanging-drop vapour-diffusion method is described. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 38.98, b = 43.94, c = 78.17 Å. Streptococcus suis, an important zoonotic pathogen, expresses immunoglobulin G-binding protein, which is thought to be helpful to the organism in eluding the host defence system. Recombinant IgG-binding protein expressed in Escherichia coli has been crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 38.98, b = 43.94, c =more » 78.17 Å and one molecule in the asymmetric unit. Diffraction data were collected to 2.60 Å resolution.« less

Crystallization and preliminary X-ray analysis of Streptococcus mutans dextran glucosidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Saburi, Wataru; Hondoh, Hironori, E-mail: hondoh@abs.agr.hokudai.ac.jp; Unno, Hideaki

2007-09-01

Dextran glucosidase from S. mutans was crystallized using the hanging-drop vapour-diffusion method. The crystals diffracted to 2.2 Å resolution. Dextran glucosidase from Streptococcus mutans is an exo-hydrolase that acts on the nonreducing terminal α-1,6-glucosidic linkage of oligosaccharides and dextran with a high degree of transglucosylation. Based on amino-acid sequence similarity, this enzyme is classified into glycoside hydrolase family 13. Recombinant dextran glucosidase was purified and crystallized by the hanging-drop vapour-diffusion technique using polyethylene glycol 6000 as a precipitant. The crystals belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 72.72, b = 86.47, cmore » = 104.30 Å. A native data set was collected to 2.2 Å resolution from a single crystal.« less

Crystallization and initial crystallographic characterization of the Corynebacterium glutamicum nitrilotriacetate monooxygenase component A

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Kyung-Jin, E-mail: kkj@postech.ac.kr; Kim, Sujin; Lee, Sujin

2006-11-01

The Corynebacterium glutamicum NTA monooxygenase component A protein, which plays the central role in NTA biodegradation, was crystallized. The initial X-ray crystallographic characterization is reported. Safety and environmental concerns have recently dictated the proper disposal of nitrilotriacetate (NTA). Biodegradation of NTA is initiated by NTA monooxygenase, which is composed of two proteins: component A and component B. The NTA monooxygenase component A protein from Corynebacterium glutamicum was crystallized using the sitting-drop vapour-diffusion method in the presence of ammonium sulfate as the precipitant. X-ray diffraction data were collected to a maximum resolution of 2.5 Å on a synchrotron beamline. The crystalmore » belongs to the monoclinic space group C2, with unit-cell parameters a = 111.04, b = 98.51, c = 171.61 Å, β = 101.94°. The asymmetric unit consists of four molecules, corresponding to a packing density of 2.3 Å{sup 3} Da{sup −1}. The structure was solved by molecular replacement. Structure refinement is in progress.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Saijo, Shinya; Sato, Takao; Kumasaka, Takashi

The reaction center–light-harvesting 1 core complex from R. viridis was crystallized and X-ray diffraction data were collected to 8.0 Å resolution. The reaction center–light-harvesting 1 (RC–LH1) core complex is the photosynthetic apparatus in the membrane of the purple photosynthetic bacterium Rhodopseudomonas viridis. The RC is surrounded by an LH1 complex that is constituted of oligomers of three types of apoproteins (α, β and γ chains) with associated bacteriochlorophyll bs and carotenoid. It has been crystallized by the sitting-drop vapour-diffusion method. A promising crystal diffracted to beyond 8.0 Å resolution. It belonged to space group P1, with unit-cell parameters a =more » 141.4, b = 136.9, c = 185.3 Å, α = 104.6, β = 94.0, γ = 110.7°. A Patterson function calculated using data between 15.0 and 8.0 Å resolution suggested that the LH1 complex is distributed with quasi-16-fold rotational symmetry around the RC.« less

Cloning, purification, crystallization and preliminary X-ray studies of a carbohydrate-binding module (CBM_E1) derived from sugarcane soil metagenome.

PubMed

Campos, Bruna Medeia; Alvarez, Thabata Maria; Liberato, Marcelo Vizona; Polikarpov, Igor; Gilbert, Harry J; Zeri, Ana Carolina de Mattos; Squina, Fabio Marcio

2014-09-01

In recent years, owing to the growing global demand for energy, dependence on fossil fuels, limited natural resources and environmental pollution, biofuels have attracted great interest as a source of renewable energy. However, the production of biofuels from plant biomass is still considered to be an expensive technology. In this context, the study of carbohydrate-binding modules (CBMs), which are involved in guiding the catalytic domains of glycoside hydrolases for polysaccharide degradation, is attracting growing attention. Aiming at the identification of new CBMs, a sugarcane soil metagenomic library was analyzed and an uncharacterized CBM (CBM_E1) was identified. In this study, CBM_E1 was expressed, purified and crystallized. X-ray diffraction data were collected to 1.95 Å resolution. The crystals, which were obtained by the sitting-drop vapour-diffusion method, belonged to space group I23, with unit-cell parameters a = b = c = 88.07 Å.

Expression, purification, crystallization and preliminary X-ray diffraction analysis of the pectin methylesterase from the sugar cane weevil Sphenophorus levis.

PubMed

Evangelista, Danilo Elton; Schutzer de Godoy, Andre; Fonseca Pereira de Paula, Fernando; Henrique-Silva, Flavio; Polikarpov, Igor

2014-03-01

Pectin methylesterase removes the methyl groups from the main chain of pectin, the major component of the middle lamella of the plant cell wall. The enzyme is involved in plant cell-wall development, is part of the enzymatic arsenal used by microorganisms to attack plants and also has a wide range of applications in the industrial sector. Therefore, there is a considerable interest in studies of the structure and function of this enzyme. In this work, the pectin methylesterase from Sphenophorus levis was produced in Pichia pastoris and purified. Crystals belonging to the monoclinic space group C2, with unit-cell parameters a = 122.181, b = 82.213, c = 41.176 Å, β = 97.48°, were obtained by the sitting-drop vapour-diffusion method and an X-ray diffraction data set was collected to 2.1 Å resolution. Structure refinement and model building are in progress.

Crystallization and preliminary crystallographic analysis of maganese(II)-dependent 2,3-dihydroxybiphenyl 1,2-dioxygenase from Bacillus sp. JF8

PubMed Central

Senda, Miki; Hatta, Takashi; Kimbara, Kazuhide; Senda, Toshiya

2010-01-01

A thermostable manganese(II)-dependent 2,3-dihydroxybiphenyl-1,2-dioxygenase derived from Bacillus sp. JF8 was crystallized. The initial screening for crystallization was performed by the sitting-drop vapour-diffusion method using a crystallization robot, resulting in the growth of two crystal forms. The first crystal belonged to space group P1, with unit-cell parameters a = 62.7, b = 71.4, c = 93.6 Å, α = 71.2, β = 81.0, γ = 64.0°, and diffracted to 1.3 Å resolution. The second crystal belonged to space group I222, with unit-cell parameters a = 74.2, b = 90.8, c = 104.3 Å, and diffracted to 1.3 Å resolution. Molecular-replacement trials using homoprotocatechuate 2,3-dioxygenase from Arthrobacter globiformis (28% amino-acid sequence identity) as a search model provided a satisfactory solution for both crystal forms. PMID:20208161

Crystallization and preliminary crystallographic analysis of the catechol 2,3-dioxygenase PheB from Bacillus stearothermophilus BR219

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sugimoto, Keisuke; Matsufuzi, Kazuki; Ohnuma, Hiroaki

2006-02-01

PheB, an extradiol-cleaving catecholic dioxygenase, was crystallized by the hanging-drop vapour-diffusion method using PEG 4000 as a precipitant. The crystal belongs to the orthorhombic system, space group P2{sub 1}2{sub 1}2{sub 1}, and diffracts to 2.3 Å resolution. Class II extradiol-cleaving catecholic dioxygenase, a key enzyme of aromatic compound degradation in bacteria, cleaves the aromatic ring of catechol by adding two O atoms. PheB is one of the class II extradiol-cleaving catecholic dioxygenases and shows a high substrate specificity for catechol derivatives, which have one aromatic ring. In order to reveal the mechanism of the substrate specificity of PheB, PheB hasmore » been crystallized by the hanging-drop vapour-diffusion method using PEG 4000 as a precipitant. The space group of the obtained crystal was P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 65.5, b = 119.2, c = 158.7 Å. The crystal diffracted to 2.3 Å resolution.« less

Crystallization and preliminary X-ray diffraction studies of choline-binding protein F from Streptococcus pneumoniae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Molina, Rafael; González, Ana; Moscoso, Miriam

2007-09-01

The modular choline-binding protein F (CbpF) from S. pneumoniae has been crystallized by the hanging-drop vapour-diffusion method. A SAD data set from a gadolinium-complex derivative has been collected to 2.1 Å resolution. Choline-binding protein F (CbpF) is a modular protein that is bound to the pneumococcal cell wall through noncovalent interactions with choline moieties of the bacterial teichoic and lipoteichoic acids. Despite being one of the more abundant proteins on the surface, along with the murein hydrolases LytA, LytB, LytC and Pce, its function is still unknown. CbpF has been crystallized using the hanging-drop vapour-diffusion method at 291 K. Diffraction-qualitymore » orthorhombic crystals belong to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 49.13, b = 114.94, c = 75.69 Å. A SAD data set from a Gd-HPDO3A-derivatized CbpF crystal was collected to 2.1 Å resolution at the gadolinium L{sub III} absorption edge using synchrotron radiation.« less

Crystallization and preliminary X-ray analysis of ginkbilobin-2 from Ginkgo biloba seeds: a novel antifungal protein with homology to the extracellular domain of plant cysteine-rich receptor-like kinases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miyakawa, Takuya; Sawano, Yoriko; Miyazono, Ken-ichi

Purification and crystallization of ginkbilobin-2 and its selenomethionine derivative allowed the collection of complete data to 2.38 Å resolution and multiwavelength anomalous diffraction data sets, respectively. The antifungal protein ginkbilobin-2 (Gnk2) from Ginkgo biloba seeds does not show homology to other pathogenesis-related proteins, but does show homology to the extracellular domain of plant cysteine-rich receptor-like kinases. Native Gnk2 purified from ginkgo nuts and the selenomethionine derivative of recombinant Gnk2 (SeMet-rGnk2) were crystallized by the sitting-drop vapour-diffusion method using different precipitants. X-ray diffraction data were collected from Gnk2 at 2.38 Å resolution and from SeMet-rGnk2 at 2.79 Å resolution using amore » synchrotron-radiation source. The crystals of both proteins belonged to the primitive cubic space group P2{sub 1}3, with unit-cell parameters a = b = c = 143.2 Å.« less

Crystallization and preliminary X-ray diffraction analysis of an endo-1,4-β-D-glucanase from Aspergillus aculeatus F-50.

PubMed

Chen, Yun; Huang, Jian Wen; Chen, Chun Chi; Lai, Hui Lin; Jin, Jian; Guo, Rey Ting

2015-04-01

Cellulose is the most abundant renewable biomass on earth, and its decomposition has proven to be very useful in a wide variety of industries. Endo-1,4-β-D-glucanase (EC 3.2.1.4; endoglucanase), which can catalyze the random hydrolysis of β-1,4-glycosidic bonds to cleave cellulose into smaller fragments, is a key cellulolytic enzyme. An endoglucanase isolated from Aspergillus aculeatus F-50 (FI-CMCase) that was classified into glycoside hydrolase family 12 has been found to be effectively expressed in the industrial strain Pichia pastoris. Here, recombinant FI-CMCase was crystallized. Crystals belonging to the orthorhombic space group C222₁, with unit-cell parameters a = 74.2, b = 75.1, c = 188.4 Å, were obtained by the sitting-drop vapour-diffusion method and diffracted to 1.6 Å resolution. Initial phase determination by molecular replacement clearly shows that the crystal contains two protein molecules in the asymmetric unit. Further model building and structure refinement are in progress.

Crystallization and preliminary X-ray crystallographic analysis of hydroquinone dioxygenase from Sphingomonas sp. TTNP3

PubMed Central

Da Vela, Stefano; Ferraroni, Marta; Kolvenbach, Boris A.; Keller, Eva; Corvini, Philippe F. X.; Scozzafava, Andrea; Briganti, Fabrizio

2012-01-01

Hydroquinone dioxygenase (HQDO), a novel FeII ring-fission dioxygenase from Sphingomonas sp. strain TTNP3 which oxidizes a wide range of hydroquinones to the corresponding 4-hydroxymuconic semialdehydes, has been crystallized. The enzyme is an α2β2 heterotetramer constituted of two subunits of 19 and 38 kDa. Diffraction-quality crystals of HQDO were obtained using the sitting-drop vapour-diffusion method at 277 K from a solution consisting of 16% PEG 4000, 0.3 M MgCl2, 0.1 M Tris pH 8.5. The crystals belonged to the monoclinic space group P21, with unit-cell parameters a = 88.4, b = 125.4, c = 90.8 Å, β = 105.3°. The asymmetric unit contained two heterotetramers, i.e. four copies of each of the two different subunits related by noncrystallographic 222 symmetry. A complete data set extending to a maximum resolution of 2.5 Å was collected at 100 K using a wavelength of 0.980 Å. PMID:22691794

Crystallization and preliminary X-ray diffraction analysis of the TetR-family transcriptional repressor YhgD from Bacillus halodurans

PubMed Central

Yeo, Hyun Ku; Park, Young Woo; Kang, Jina; Lee, Jae Young

2013-01-01

YhgD is a member of the TetR-family transcription factors, which regulate genes encoding proteins involved in multidrug resistance, virulence, osmotic stress and pathogenicity. YhgD from the alkaliphilic bacterium Bacillus halodurans was cloned and overexpressed in Escherichia coli. YhgD (Bh2145) from B. halodurans is composed of 193 amino-acid residues with a molecular mass of 21 853 Da. YhgD was crystallized at 296 K using ethylene glycol as a precipitant by the sitting-drop vapour-diffusion method. The crystal diffracted to 1.9 Å resolution and belonged to the apparent triclinic space group P1, with unit-cell parameters a = 37.22, b = 47.85, c = 54.15 Å, α = 92.75, β = 107.9, γ = 90.27°. The asymmetric unit is likely to contain two molecules of monomeric YhgD, giving a crystal volume per mass (V M) of 2.05 Å3 Da−1 and a solvent content of 40.2%. PMID:23695570

Crystallization and preliminary X-ray diffraction analysis of the TetR-family transcriptional repressor YhgD from Bacillus halodurans.

PubMed

Yeo, Hyun Ku; Park, Young Woo; Kang, Jina; Lee, Jae Young

2013-05-01

YhgD is a member of the TetR-family transcription factors, which regulate genes encoding proteins involved in multidrug resistance, virulence, osmotic stress and pathogenicity. YhgD from the alkaliphilic bacterium Bacillus halodurans was cloned and overexpressed in Escherichia coli. YhgD (Bh2145) from B. halodurans is composed of 193 amino-acid residues with a molecular mass of 21 853 Da. YhgD was crystallized at 296 K using ethylene glycol as a precipitant by the sitting-drop vapour-diffusion method. The crystal diffracted to 1.9 Å resolution and belonged to the apparent triclinic space group P1, with unit-cell parameters a = 37.22, b = 47.85, c = 54.15 Å, α = 92.75, β = 107.9, γ = 90.27°. The asymmetric unit is likely to contain two molecules of monomeric YhgD, giving a crystal volume per mass (VM) of 2.05 Å(3) Da(-1) and a solvent content of 40.2%.

Crystallization and preliminary X-ray analysis of an exotype alginate lyase Atu3025 from Agrobacterium tumefaciens strain C58, a member of polysaccharide lyase family 15

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ochiai, Akihito; Yamasaki, Masayuki; Mikami, Bunzo

2006-05-01

The crystallization and preliminary X-ray characterization of a family PL-15 exotype alginate lyase are presented. Almost all alginate lyases depolymerize alginate in an endolytical fashion via a β-elimination reaction. The alginate lyase Atu3025 from Agrobacterium tumefaciens strain C58, consisting of 776 amino-acid residues, is a novel exotype alginate lyase classified into polysaccharide lyase family 15. The enzyme was crystallized at 293 K by sitting-drop vapour diffusion with polyethylene glycol 4000 as a precipitant. Preliminary X-ray analysis showed that the Atu3025 crystal belonged to space group P2{sub 1} and diffracted to 2.8 Å resolution, with unit-cell parameters a = 107.7, bmore » = 108.3, c = 149.5 Å, β = 91.5°.« less

Purification and crystallization of Kokobera virus helicase

DOE Office of Scientific and Technical Information (OSTI.GOV)

De Colibus, Luigi; Speroni, Silvia; Coutard, Bruno

2007-03-01

Kokobera virus is a mosquito-borne flavivirus belonging, like West Nile virus, to the Japanese encephalitis virus serocomplex. Crystals of the Kokobera virus helicase domain were obtained by the hanging-drop vapour-diffusion method and exhibit a diffraction limit of 2.3 Å. Kokobera virus is a mosquito-borne flavivirus belonging, like West Nile virus, to the Japanese encephalitis virus serocomplex. The flavivirus genus is characterized by a positive-sense single-stranded RNA genome. The unique open reading frame of the viral RNA is transcribed and translated as a single polyprotein which is post-translationally cleaved to yield three structural and seven nonstructural proteins, one of which ismore » the NS3 gene that encodes a C-terminal helicase domain consisting of 431 amino acids. Helicase inhibitors are potential antiviral drugs as the helicase is essential to viral replication. Crystals of the Kokobera virus helicase domain were obtained by the hanging-drop vapour-diffusion method. The crystals belong to space group P3{sub 1}21 (or P3{sub 2}21), with unit-cell parameters a = 88.6, c = 138.6 Å, and exhibit a diffraction limit of 2.3 Å.« less

Expression, purification, crystallization and preliminary X-ray analysis of the ligand-binding domain of metabotropic glutamate receptor 7

DOE Office of Scientific and Technical Information (OSTI.GOV)

Muto, Takanori; Tsuchiya, Daisuke; Morikawa, Kosuke, E-mail: morikako@protein.osaka-u.ac.jp

2007-07-01

The ligand-binding domain of metabotropic glutamate receptor 7 has been overexpressed, purified, and crystallized by the hanging-drop vapour-diffusion method. A complete data set has been collected to 3.30 Å. Glutamate is the major excitatory neurotransmitter and its metabotropic glutamate receptor (mGluR) plays an important role in the central nervous system. The ligand-binding domain (LBD) of mGluR subtype 7 (mGluR7) was produced using the baculovirus expression system and purified from the culture medium. The purified protein was characterized by gel-filtration chromatography, SDS–PAGE and a ligand-binding assay. Crystals of mGluR7 LBD were grown at 293 K by the hanging-drop vapour-diffusion method. Themore » crystals diffracted X-rays to 3.30 Å resolution using synchrotron radiation and belong to the trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 92.4, c = 114.3 Å. Assuming the presence of one protomer per crystallographic asymmetric unit, the Matthews coefficient V{sub M} was calculated to be 2.5 Å{sup 3} Da{sup −1} and the solvent content was 51%.« less

Crystallization and preliminary X-ray crystallographic analysis of BxlE, a xylobiose transporter from Streptomyces thermoviolaceus OPC-520

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seike, Kiho; Sato, Junji; Tomoo, Koji, E-mail: tomoo@gly.oups.ac.jp

2007-07-01

To clarify the structural basis of sugar binding by BxlE at the atomic level, recombinant BxlE was crystallized using the hanging-drop vapour-diffusion method at 290 K. Together with the integral membrane proteins BxlF and BxlG, BxlE isolated from Streptomyces thermoviolaceus OPC-520 forms an ATP-binding cassette (ABC) transport system that mediates the uptake of xylan. To clarify the structural basis of sugar binding by BxlE at the atomic level, recombinant BxlE was crystallized using the hanging-drop vapour-diffusion method at 290 K. The crystals belonged to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 44.63, b = 63.27, cmore » = 66.40 Å, β = 103.05°, and contained one 48 kDa molecule per asymmetric unit (V{sub M} = 1.96 Å{sup 3} Da{sup −1}). Diffraction data collected to a resolution of 1.65 Å using a rotating-anode X-ray source gave a data set with an overall R{sub merge} of 2.6% and a completeness of 91.3%. A data set from a platinum derivative is being used for phasing by the SAD method.« less

[Expression, crystallization and crystallographic study of the 1st IgV domain of human CD96].

PubMed

Jiang, Wenjing; Zhang, Shuijun; Yan, Jinghua; Guo, Ning

2013-05-01

CD96 (Tactile) is an adhesion receptor expressed mainly on activated T cells, NK cells. As a family member of the immunoglobulin-like cell receptor, CD96 consists of three immunoglobulin-like domains (V1, V2/C and C) in the extracellular region. Recent studies have shown that the 1st IgV domain of CD96 (CD96V1) plays an essential role in cell adhesion and NK cell-mediated killing. In this study, the 1st IgV domain of human CD96 (hCD96V1) was cloned and expressed in Escherichia coli (BL21). The soluble protein was obtained by refolding of the hCD96V1 inclusion bodies. From analytical ultracentrifugation, we could predict that CD96 V1 maily exists as dimer with approximate molecular weight of 26.9 kDa. The protein was then successfully crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.9 angstrom resolution and belonged to space group P21, with unit-cell parameters a = 35.1, b = 69.5, c = 49.6A, alpha=gamma=90 degrees, beta=105.4 degrees.

Recombinant production, crystallization and X-ray crystallographic structure determination of the peptidyl-tRNA hydrolase of Pseudomonas aeruginosa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hughes, Ronny C.; McFeeters, Hana; Coates, Leighton

The peptidyl-tRNA hydrolase enzyme from the pathogenic bacterium Pseudomonas aeruginosa (Pth; EC 3.1.1.29) has been cloned, expressed in Escherichia coli and crystallized for X-ray structural analysis. Suitable crystals were grown using the sitting-drop vapour-diffusion method after one week of incubation against a reservoir solution consisting of 20% polyethylene glycol 4000, 100 mM Tris pH 7.5, 10%(v/v) isopropyl alcohol. The crystals were used to obtain the three-dimensional structure of the native protein at 1.77 Å resolution. The structure was determined by molecular replacement of the crystallographic data processed in space group P6122 with unit-cell parameters a = b = 63.62,c =more » 155.20 Å, α = β = 90, γ = 120°. The asymmetric unit of the crystallographic lattice was composed of a single copy of the enzyme molecule with a 43% solvent fraction, corresponding to a Matthews coefficient of 2.43 Å3 Da-1. The crystallographic structure reported here will serve as the foundation for future structure-guided efforts towards the development of novel small-molecule inhibitors specific to bacterial Pths.« less

Expression, purification, crystallization and initial crystallographic characterization of the p-hydroxybenzoate hydroxylase from Corynebacterium glutamicum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kwon, Soo-Young; Kang, Beom Sik; Kim, Ghyung-Hwa

2007-11-01

PHBH from Corynebacterium glutamicum was crystallized using the hanging-drop vapour-diffusion method in the presence of NaH{sub 2}PO{sub 4} and K{sub 2}HPO{sub 4} as precipitants. X-ray diffraction data were collected to a maximum resolution of 2.5 Å on a synchrotron beamline. p-Hydroxybenzoate hydroxylase (PHBH) is an FAD-dependent monooxygenase that catalyzes the hydroxylation of p-hydroxybenzoate (pOHB) to 3,4-dihydroxybenzoate in an NADPH-dependent reaction and plays an important role in the biodegradation of aromatic compounds. PHBH from Corynebacterium glutamicum was crystallized using the hanging-drop vapour-diffusion method in the presence of NaH{sub 2}PO{sub 4} and K{sub 2}HPO{sub 4} as precipitants. X-ray diffraction data were collectedmore » to a maximum resolution of 2.5 Å on a synchrotron beamline. The crystal belongs to the hexagonal space group P6{sub 3}22, with unit-cell parameters a = b = 94.72, c = 359.68 Å, γ = 120°. The asymmetric unit contains two molecules, corresponding to a packing density of 2.65 Å{sup 3} Da{sup −1}. The structure was solved by molecular replacement. Structure refinement is in progress.« less

Crystallization and preliminary X-ray diffraction studies of NP24-I, an isoform of a thaumatin-like protein from ripe tomato fruits

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ghosh, Raka; Chakrabarti, Chandana, E-mail: chandana.chakrabarti@saha.ac.in

2005-08-01

A thaumatin-like antifungal protein, NP24-I, has been isolated from ripe tomato fruits. It was crystallized by the vapour-diffusion method and data were collected to 2.45 Å. The structure was solved by molecular replacement. NP24 is a 24 kDa (207-amino-acid) antifungal thaumatin-like protein (TLP) found in tomato fruits. An isoform of the protein, NP24-I, is reported to play a possible role in ripening of the fruit in addition to its antifungal properties. The protein has been isolated and purified and crystallized by the hanging-drop vapour-diffusion method. The crystals belong to the tetragonal space group P4{sub 3}, with unit-cell parameters a =more » b = 61.01, c = 62.90 Å and one molecule per asymmetric unit. X-ray diffraction data were processed to a resolution of 2.45 Å and the structure was solved by molecular replacement.« less

Crystallization and preliminary X-ray diffraction analysis of central structure domains from mumps virus F protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Yueyong; Xu, Yanhui; Zhu, Jieqing

2005-09-01

Single crystals of the central structure domains from mumps virus F protein have been obtained by the hanging-drop vapour-diffusion method. A diffraction data set has been collected to 2.2 Å resolution. Fusion of members of the Paramyxoviridae family involves two glycoproteins: the attachment protein and the fusion protein. Changes in the fusion-protein conformation were caused by binding of the attachment protein to the cellular receptor. In the membrane-fusion process, two highly conserved heptad-repeat (HR) regions, HR1 and HR2, are believed to form a stable six-helix coiled-coil bundle. However, no crystal structure has yet been determined for this state in themore » mumps virus (MuV, a member of the Paramyxoviridae family). In this study, a single-chain protein consisting of two HR regions connected by a flexible amino-acid linker (named 2-Helix) was expressed, purified and crystallized by the hanging-drop vapour-diffusion method. A complete X-ray data set was obtained in-house to 2.2 Å resolution from a single crystal. The crystal belongs to space group C2, with unit-cell parameters a = 161.2, b = 60.8, c = 40.1 Å, β = 98.4°. The crystal structure will help in understanding the molecular mechanism of Paramyxoviridae family membrane fusion.« less

Crystallization and preliminary X-ray studies of dUTPase from Mason–Pfizer monkey retrovirus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barabás, Orsolya; Németh, Veronika; Vértessy, Beáta G., E-mail: vertessy@enzim.hu

2006-04-01

Deoxyuridine 5′-triphosphate nucleotidohydrolase from Mason–Pfizer monkey retrovirus (M-PMV dUTPase) is a betaretroviral member of the dUTPase enzyme family. The nucleocapsid-free dUTPase (48426 Da) was co-crystallized with a dUTP substrate analogue using the hanging-drop vapour-diffusion method. Deoxyuridine 5′-triphosphate nucleotidohydrolase from Mason–Pfizer monkey retrovirus (M-PMV dUTPase) is a betaretroviral member of the dUTPase enzyme family. In the mature M-PMV virion, this enzyme is present as the C-terminal domain of the fusion protein nucleocapsid-dUTPase. The homotrimeric organization characteristic of dUTPases is retained in this bifunctional fusion protein. The fusion protein supposedly plays a role in adequate localization of dUTPase activity in the vicinitymore » of nucleic acids during reverse transcription and integration. Here, the nucleocapsid-free dUTPase (48 426 Da) was cocrystallized with a dUTP substrate analogue using the hanging-drop vapour-diffusion method. The obtained crystals belong to the primitive hexagonal space group P6{sub 3}, with unit-cell parameters a = 60.6, b = 60.6, c = 63.6 Å, α = 90, β = 90, γ = 120°. Native and PtCl{sub 4}-derivative data sets were collected using synchrotron radiation to 1.75 and 2.3 Å, respectively. Phasing was successfully performed by isomorphous replacement combined with anomalous scattering.« less

Phormidium phycoerythrin forms hexamers in crystals: a crystallographic study

PubMed Central

Sonani, Ravi Raghav; Sharma, Mahima; Gupta, Gagan Deep; Kumar, Vinay; Madamwar, Datta

2015-01-01

The crystallographic analysis of a marine cyanobacterium (Phormidium sp. A09DM) phycoerythrin (PE) that shows distinct sequence features compared with known PE structures from cyanobacteria and red algae is reported. Phormidium PE was crystallized using the sitting-drop vapour-diffusion method with ammonium sulfate as a precipitant. Diffraction data were collected on the protein crystallography beamline at the Indus-2 synchrotron. The crystals diffracted to about 2.1 Å resolution at 100 K. The crystals, with an apparent hexagonal morphology, belonged to space group P1, with unit-cell parameters a = 108.3, b = 108.4 Å, c = 116.6 Å, α = 78.94, β = 82.50, γ = 60.34°. The molecular-replacement solution confirmed the presence of 12 αβ monomers in the P1 cell. The Phormidium PE elutes as an (αβ)3 trimer of αβ monomers from a molecular-sieve column and exists as [(αβ)3]2 hexamers in the crystal lattice. Unlike red algal PE proteins, the hexamers of Phormidium PE do not form higher-order structures in the crystals. The existence of only one characteristic visual absorption band at 564 nm suggests the presence of phycoerythrobilin chromophores, and the absence of any other types of bilins, in the Phormidium PE assembly. PMID:26249689

Crystallization and X-ray diffraction analysis of the CH domain of the cotton kinesin GhKCH2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qin, Xinghua; The Fourth Military Medical University, No. 169 Changlexi Road, Xincheng District, Xi’an 710032, People’s Republic of; Chen, Ziwei

The cloning, expression, purification and crystallization of the CH domain of the plant-specific kinesin GhKCH2 is reported. GhKCH2 belongs to a group of plant-specific kinesins (KCHs) containing an actin-binding calponin homology (CH) domain in the N-terminus. Previous studies revealed that the GhKCH2 CH domain (GhKCH2-CH) had a higher affinity for F-actin (K{sub d} = 0.42 ± 0.02 µM) than most other CH-domain-containing proteins. To understand the underlying mechanism, prokaryotically expressed GhKCH2-CH (amino acids 30–166) was purified and crystallized. Crystals were grown by the sitting-drop vapour-diffusion method using 0.1 M Tris–HCl pH 7.0, 20%(w/v) PEG 8000 as a precipitant. The crystalsmore » diffracted to a resolution of 2.5 Å and belonged to space group P2{sub 1}, with unit-cell parameters a = 41.57, b = 81.92, c = 83.00 Å, α = 90.00, β = 97.31, γ = 90.00°. Four molecules were found in the asymmetric unit with a Matthews coefficient of 2.22 Å{sup 3} Da{sup −1}, corresponding to a solvent content of 44.8%.« less

Cloning, overexpression, crystallization and preliminary X-ray crystallographic analysis of a slow-processing mutant of penicillin G acylase from Kluyvera citrophila.

PubMed

Varshney, Nishant Kumar; Ramasamy, Sureshkumar; Brannigan, James A; Wilkinson, Anthony J; Suresh, C G

2013-08-01

Kluyvera citrophila penicillin G acylase (KcPGA) has recently attracted increased attention relative to the well studied and commonly used Escherichia coli PGA (EcPGA) because KcPGA is more resilient to harsh conditions and is easier to immobilize for the industrial hydrolysis of natural penicillins to generate the 6-aminopenicillin (6-APA) nucleus, which is the starting material for semi-synthetic antibiotic production. Like other penicillin acylases, KcPGA is synthesized as a single-chain inactive pro-PGA, which upon autocatalytic processing becomes an active heterodimer of α and β chains. Here, the cloning of the pac gene encoding KcPGA and the preparation of a slow-processing mutant precursor are reported. The purification, crystallization and preliminary X-ray analysis of crystals of this precursor protein are described. The protein crystallized in two different space groups, P1, with unit-cell parameters a = 54.0, b = 124.6, c = 135.1 Å, α = 104.1, β = 101.4, γ = 96.5°, and C2, with unit-cell parameters a = 265.1, b = 54.0, c = 249.2 Å, β = 104.4°, using the sitting-drop vapour-diffusion method. Diffraction data were collected at 100 K and the phases were determined using the molecular-replacement method. The initial maps revealed electron density for the spacer peptide.

Purification, characterization and preliminary crystallographic studies of a PR-10 protein from Pachyrrhizus erosus seeds.

PubMed

Wu, Fang; Li, Yikun; Chang, Shaojie; Zhou, Zhaocai; Wang, Fang; Song, Xiaomin; Lin, Yujuan; Gong, Weimin

2002-12-01

A 16 kDa protein SPE16 was purified from the seeds of Pachyrrhizus erosus. Its N-terminal amino-acid sequence showed significant sequence homology to pathogenesis-related proteins from the PR-10 family. An activity assay indicated that SPE16 possesses ribonuclease activity as do some other PR-10 proteins. SPE16 crystals were obtained by the hanging-drop vapour-diffusion method. The space group is P2(1)2(1)2(1), with unit-cell parameters a = 53.36, b = 63.70, c = 72.96 A.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Imamura, Kayo; Matsuura, Takanori; Ye, Zhengmao

Disproportionating enzyme from potato was crystallized and preliminarily analyzed using X-ray diffraction. Disproportionating enzyme (D-enzyme; EC 2.4.1.25) is a 59 kDa protein that belongs to the α-amylase family. D-enzyme catalyses intramolecular and intermolecular transglycosylation reactions of α-1,4 glucan. A crystal of the D-enzyme from potato was obtained by the hanging-drop vapour-diffusion method. Preliminary X-ray data showed that the crystal diffracts to 2.0 Å resolution and belongs to space group C222{sub 1}, with unit-cell parameters a = 69.7, b = 120.3, c = 174.2 Å.

Expression, purification, crystallization and structure determination of the N terminal domain of Fhb, a factor H binding protein from Streptococcus suis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Chunmao; Yu, You; Yang, Maojun, E-mail: maojunyang@tsinghua.edu.cn

2015-10-23

Fhb is a surface virulence protein from Streptococcus suis, which could aid bacterial evasion of host innate immune defense by recruiting complement regulator factor H to inactivate C3b deposited on bacterial surface in blood. Here we successfully expressed and purified the N terminal domain of Fhb (N-Fhb) and obtained crystals of the N-Fhb by sitting-drop vapor diffusion method with a resolution of 1.50 Å. The crystals belong to space group C2 with unit cell parameters a = 127.1 Å, b = 77.3 Å, c = 131.6 Å, α = 90°, β = 115.9°, γ = 90°. The structure of N-Fhb was determined by SAD method and the core structure of N-Fhb is a β sandwich. Wemore » speculated that binding of Fhb to human factor H may be mainly mediated by surface amino acids with negative charges. - Highlights: • We expressed N-Fhb as the soluble protein in Escherichia coli. • Crystals of N-Fhb were grown by sitting drop vapor diffusion method. • Crystals of N-Fhb could diffracted to 1.5 Å. • The core structure of N-Fhb was a β sandwich. • A part of the surface of N-Fhb was rich with negative charges.« less

Crystallization and preliminary X-ray crystallographic analysis of the small subunit of the heterodimeric laccase POXA3b from Pleurotus ostreatus

PubMed Central

Ferraroni, Marta; Scozzafava, Andrea; Ullah, Sana; Tron, Thierry; Piscitelli, Alessandra; Sannia, Giovanni

2014-01-01

Laccases are multicopper oxidases of great biotechnological potential. While laccases are generally monomeric glycoproteins, the white-rot fungus Pleurotus ostreatus produces two closely related heterodimeric isoenzymes composed of a large subunit, homologous to the other fungal laccases, and a small subunit. The sequence of the small subunit does not show significant homology to any other protein or domain of known function and consequently its function is unknown. The highest similarity to proteins of known structure is to a putative enoyl-CoA hydratase/isomerase from Acinetobacter baumannii, which shows an identity of 27.8%. Diffraction-quality crystals of the small subunit of the heterodimeric laccase POXA3b (sPOXA3b) from P. ostreatus were obtained using the sitting-drop vapour-diffusion method at 294 K from a solution consisting of 1.8 M sodium formate, 0.1 M Tris–HCl pH 8.5. The crystals belonged to the tetragonal space group P41212 or P43212, with unit-cell parameters a = 126.6, c = 53.9 Å. The asymmetric unit contains two molecules related by a noncrystallographic twofold axis. A complete data set extending to a maximum resolution of 2.5 Å was collected at 100 K using a wavelength of 1.140 Å. PMID:24419623

Crystallization of Spätzle, a cystine-knot protein involved in embryonic development and innate immunity in Drosophila melanogaster

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoffmann, Anita; Neumann, Piotr; Schierhorn, Angelika

2008-08-01

Crystallization of the cystine-knot protein Spätzle occurred following serendipitous limited degradation of the pro-Spätzle propeptide during the crystallization experiment. The Spätzle protein is involved in both the definition of the dorsal–ventral axis during embryonic development and in the adult innate immune response. The disulfide-linked dimeric cystine-knot protein has been expressed as a proprotein in inclusion bodies in Escherichia coli and refolded in vitro by rapid dilution. Initial orthorhombic crystals that diffracted to 7 Å resolution were obtained after three months by the sitting-drop vapour-diffusion method. Optimization of the crystallization conditions resulted in orthorhombic crystals (space group P2{sub 1}2{sub 1}2{sub 1},more » with unit-cell parameters a = 53.0, b = 59.2, c = 62.5 Å) that diffracted to 2.8 Å resolution in-house. The small volume of the asymmetric unit indicated that it was not possible for the crystals to contain the complete pro-Spätzle dimer. Mass spectrometry, N-terminal sequencing and Western-blot analysis revealed that the crystals contained the C-terminal disulfide-linked cystine-knot dimer. Comparison of various crystallization experiments indicated that degradation of the N-terminal prodomain was dependent on the buffer conditions.« less

Purification, crystallization and preliminary crystallographic analysis of biotin protein ligase from Staphylococcus aureus.

PubMed

Pendini, Nicole R; Polyak, Steve W; Booker, Grant W; Wallace, John C; Wilce, Matthew C J

2008-06-01

Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 A resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P4(2)2(1)2, with unit-cell parameters a = b = 93.665, c = 131.95.

Crystallization and X-ray diffraction analysis of a catalytic domain of hyperthermophilic chitinase from Pyrococcus furiosus

PubMed Central

Mine, Shouhei; Nakamura, Tsutomu; Hirata, Kunio; Ishikawa, Kazuhiko; Hagihara, Yoshihisa; Uegaki, Koichi

2006-01-01

The crystallization and preliminary X-ray diffraction analysis of a catalytic domain of chitinase (PF1233 gene) from the hyperthermophilic archaeon Pyrococcus furiosus is reported. The recombinant protein, prepared using an Escherichia coli expression system, was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected at the undulator beamline BL44XU at SPring-8 to a resolution of 1.50 Å. The crystals belong to space group P212121, with unit-cell parameters a = 90.0, b = 92.8, c = 107.2 Å. PMID:16880559

The quaternary structure of the amidase from Geobacillus pallidus RAPc8 is revealed by its crystal packing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Agarkar, Vinod B.; Kimani, Serah W.; Cowan, Donald A.

2006-12-01

The amidase from G. pallidus RAPc8, a moderate thermophile, converts amides to the corresponding acids and ammonia and has application as an industrial catalyst. RAPc8 amidase has been cloned, expressed and purified, and then crystallized using the hanging-drop vapour-diffusion method. The amidase from Geobacillus pallidus RAPc8, a moderate thermophile, is a member of the nitrilase enzyme superfamily. It converts amides to the corresponding acids and ammonia and has application as an industrial catalyst. RAPc8 amidase has been cloned and functionally expressed in Escherichia coli and has been purified by heat treatment and a number of chromatographic steps. The enzyme wasmore » crystallized using the hanging-drop vapour-diffusion method. Crystals produced in the presence of 1.2 M sodium citrate, 400 mM NaCl, 100 mM sodium acetate pH 5.6 were selected for X-ray diffraction studies. A data set having acceptable statistics to 1.96 Å resolution was collected under cryoconditions using an in-house X-ray source. The space group was determined to be primitive cubic P4{sub 2}32, with unit-cell parameter a = 130.49 (±0.05) Å. The structure was solved by molecular replacement using the backbone of the hypothetical protein PH0642 from Pyrococcus horikoshii (PDB code 1j31) with all non-identical side chains substituted with alanine as a probe. There is one subunit per asymmetric unit. The subunits are packed as trimers of dimers with D3 point-group symmetry around the threefold axis in such a way that the dimer interface seen in the homologues is preserved.« less

Purification, crystallization and characterization of the Pseudomonas outer membrane protein FapF, a functional amyloid transporter.

PubMed

Rouse, Sarah L; Hawthorne, Wlliam J; Lambert, Sebastian; Morgan, Marc L; Hare, Stephen A; Matthews, Stephen

2016-12-01

Bacteria often produce extracellular amyloid fibres via a multi-component secretion system. Aggregation-prone, unstructured subunits cross the periplasm and are secreted through the outer membrane, after which they self-assemble. Here, significant progress is presented towards solving the high-resolution crystal structure of the novel amyloid transporter FapF from Pseudomonas, which facilitates the secretion of the amyloid-forming polypeptide FapC across the bacterial outer membrane. This represents the first step towards obtaining structural insight into the products of the Pseudomonas fap operon. Initial attempts at crystallizing full-length and N-terminally truncated constructs by refolding techniques were not successful; however, after preparing FapF 106-430 from the membrane fraction, reproducible crystals were obtained using the sitting-drop method of vapour diffusion. Diffraction data have been processed to 2.5 Å resolution. These crystals belonged to the monoclinic space group C121, with unit-cell parameters a = 143.4, b = 124.6, c = 80.4 Å, α = γ = 90, β = 96.32° and three monomers in the asymmetric unit. It was found that the switch to complete detergent exchange into C8E4 was crucial for forming well diffracting crystals, and it is suggested that this combined with limited proteolysis is a potentially useful protocol for membrane β-barrel protein crystallography. The three-dimensional structure of FapF will provide invaluable information on the mechanistic differences of biogenesis between the curli and Fap functional amyloid systems.

Optimization of crystals from nanodrops: crystallization and preliminary crystallographic study of a pheromone-binding protein from the honeybee Apis mellifera L.

PubMed

Lartigue, Audrey; Gruez, Arnaud; Briand, Loïc; Pernollet, Jean-Claude; Spinelli, Silvia; Tegoni, Mariella; Cambillau, Christian

2003-05-01

Pheromone-binding proteins (PBPs) are small helical proteins ( approximately 13-17 kDa) present in various sensory organs from moths and other insect species. They are involved in the transport of pheromones from the sensillar lymph to the olfactory receptors. Here, crystals of a PBP (Amel-ASP1) originating from honeybee (Apis mellifera L.) antennae and expressed as recombinant protein using the yeast Pichia pastoris are reported. Crystals of Amel-ASP1 have been obtained by the sitting-drop vapour-diffusion method using a nanodrop-dispensing robot under the following conditions: 200 nl of 40 mg ml(-1) protein solution in 10 mM Tris, 25 mM NaCl pH 8.0 was mixed with 100 nl of well solution containing 0.15 M sodium citrate, 1.5 M ammonium sulfate pH 5.5. The protein crystallizes in space group C222(1), with unit-cell parameters a = 74.8, b = 85.8, c = 50.2 A. With one molecule in the asymmetric unit, V(M) is 3.05 A(3) Da(-1) and the solvent content is 60%. A complete data set has been collected at 1.6 A resolution on beamline ID14-2 (ESRF, Grenoble). The nanodrop crystallization technique used with a novel optimization procedure made it possible to consume small amounts of protein and to obtain a unique crystal per nanodrop, suitable directly for data collection in-house or at a synchrotron-radiation source.

Prediction of orthostatic hypotension in multiple system atrophy and Parkinson disease

PubMed Central

Sun, Zhanfang; Jia, Dandan; Shi, Yuting; Hou, Xuan; Yang, Xiaosu; Guo, Jifeng; Li, Nan; Wang, Junling; Sun, Qiying; Zhang, Hainan; Lei, Lifang; Shen, Lu; Yan, Xinxiang; Xia, Kun; Jiang, Hong; Tang, Beisha

2016-01-01

Orthostatic hypotension (OH) is common in multiple system atrophy (MSA) and Parkinson disease (PD), generally assessed through a lying-to-standing orthostatic test. However, standing blood pressure may not be available due to orthostatic intolerance or immobilization for such patients. Systolic blood pressure (SBP) and diastolic blood pressure (DBP) were successively measured in supine, sitting, and standing positions in patients with MSA and PD. Receiver operating characteristic analysis was used to evaluate diagnostic performance of the drops of sitting SBP or DBP. OH and severe OH were respectively regarded as “gold standard”. The drops of SBP in standing position were associated with increased disease severity for MSA and correlated with age for PD. In MSA group, drops in sitting SBP ≥ 14 mmHg or DBP ≥ 6 mmHg had highest validity for prediction of OH, and drops in sitting SBP ≥ 18 mmHg or DBP ≥ 8 mmHg for severe OH. In PD group, drops in sitting SBP ≥ 10 mmHg or DBP ≥ 6 mmHg had highest validity for prediction of OH. The lying-to-sitting orthostatic test is an alternative method for detection of OH in MSA and PD, especially when standing BP could not be validly measured due to various reasons. PMID:26867507

Purification, Crystallization, and Preliminary Crystallographic Analysis of Deoxyuridine Triphosphate Nucleotidohydrolase from Arabidopsis Thaliana

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bajaj,M.; Moriyama, H.

2007-01-01

The deoxyuridine triphosphate nucleotidohydrolase gene from Arabidopsis thaliana was expressed and the gene product was purified. Crystallization was performed by the hanging-drop vapour-diffusion method at 298 K using 2 M ammonium sulfate as the precipitant. X-ray diffraction data were collected to 2.2 Angstroms resolution using Cu K{alpha} radiation. The crystal belongs to the orthorhombic space group P212121, with unit-cell parameters a = 69.90, b = 70.86 Angstroms, c = 75.55 Angstroms . Assuming the presence of a trimer in the asymmetric unit, the solvent content was 30%, with a VM of 1.8 Angstroms 3 Da-1.

Purification, crystallization and preliminary crystallographic analysis of biotin protein ligase from Staphylococcus aureus

PubMed Central

Pendini, Nicole R.; Polyak, Steve W.; Booker, Grant W.; Wallace, John C.; Wilce, Matthew C. J.

2008-01-01

Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 Å resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P42212, with unit-cell parameters a = b = 93.665, c = 131.95. PMID:18540065

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guo, Feng; Jin, Tengchuan; Howard, Andrew

The crystallization of the brazil nut allergen Ber e 2 is reported. Peanut and tree-nut allergies have attracted considerable attention because of their frequency and their lifelong persistence. Brazil-nut (Bertholletia excelsa) allergies have been well documented and the 11S legumin-like seed storage protein Ber e 2 (excelsin) is one of the two known brazil-nut allergens. In this study, Ber e 2 was extracted from brazil-nut kernels and purified to high purity by crystalline precipitation and gel-filtration chromatography. Well diffracting single crystals were obtained using the hanging-drop vapour-diffusion method. A molecular-replacement structural solution has been obtained. Refinement of the structure ismore » currently under way.« less

Automation of Vapor-Diffusion Growth of Protein Crystals

NASA Technical Reports Server (NTRS)

Hamrick, David T.; Bray, Terry L.

2005-01-01

Some improvements have been made in a system of laboratory equipment developed previously for studying the crystallization of proteins from solution by use of dynamically controlled flows of dry gas. The improvements involve mainly (1) automation of dispensing of liquids for starting experiments, (2) automatic control of drying of protein solutions during the experiments, and (3) provision for automated acquisition of video images for monitoring experiments in progress and for post-experiment analysis. The automation of dispensing of liquids was effected by adding an automated liquid-handling robot that can aspirate source solutions and dispense them in either a hanging-drop or a sitting-drop configuration, whichever is specified, in each of 48 experiment chambers. A video camera of approximately the size and shape of a lipstick dispenser was added to a mobile stage that is part of the robot, in order to enable automated acquisition of images in each experiment chamber. The experiment chambers were redesigned to enable the use of sitting drops, enable backlighting of each specimen, and facilitate automation.

Mixing of multiple metal vapours into an arc plasma in gas tungsten arc welding of stainless steel

NASA Astrophysics Data System (ADS)

Park, Hunkwan; Trautmann, Marcus; Tanaka, Keigo; Tanaka, Manabu; Murphy, Anthony B.

2017-11-01

A computational model of the mixing of multiple metal vapours, formed by vaporization of the surface of an alloy workpiece, into the thermal arc plasma in gas tungsten arc welding (GTAW) is presented. The model incorporates the combined diffusion coefficient method extended to allow treatment of three gases, and is applied to treat the transport of both chromium and iron vapour in the helium arc plasma. In contrast to previous models of GTAW, which predict that metal vapours are swept away to the edge of the arc by the plasma flow, it is found that the metal vapours penetrate strongly into the arc plasma, reaching the cathode region. The predicted results are consistent with published measurements of the intensity of atomic line radiation from the metal vapours. The concentration of chromium vapour is predicted to be higher than that of iron vapour due to its larger vaporization rate. An accumulation of chromium vapour is predicted to occur on the cathode at about 1.5 mm from the cathode tip, in agreement with published measurements. The arc temperature is predicted to be strongly reduced due to the strong radiative emission from the metal vapours. The driving forces causing the diffusion of metal vapours into the helium arc are examined, and it is found that diffusion due to the applied electric field (cataphoresis) is dominant. This is explained in terms of large ionization energies and the small mass of helium compared to those of the metal vapours.

Expression, purification, crystallization and preliminary X-ray crystallographic analysis of fructose-1,6-bisphosphate aldolase from Escherichia coli.

PubMed

Zhang, Li; Guo, Zheng; Huang, Jing; Liu, Meiruo; Wang, Yuandong; Ji, Chaoneng

2014-10-01

Fructose-1,6-bisphosphate aldolase is one of the most important enzymes in the glycolytic pathway and catalyzes the reversible cleavage of fructose-1,6-bisphosphate to dihydroxyacetone phosphate and glyceraldehyde 3-phosphate. The full-length fbaB gene encoding fructose-1,6-bisphosphate aldolase class I (FBPA I) was cloned from Escherichia coli strain BL21. FBPA I was overexpressed in E. coli and purified. Biochemical analysis found that the optimum reaction temperature of FBPA I is 330.5 K and that the enzyme has a high temperature tolerance. Crystals of recombinant FBPA I were obtained by the sitting-drop vapour-diffusion technique in a condition consisting of 19 mg ml(-1) FBPA I in 0.1 M Tris pH 9.0, 10%(w/v) polyethylene glycol 8000 and diffracted to 2.0 Å resolution. The crystals belonged to the monoclinic space group C2, with unit-cell parameters a = 217.7, b = 114.9, c = 183.9 Å, β = 124.6°. The asymmetric unit of these crystals may contain ten molecules, giving a Matthews coefficient of 2.48 Å(3) Da(-1) and a solvent content of 50.5%.

Crystallization and preliminary X-ray diffraction analysis of the lectin from Dioclea rostrata Benth seeds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Delatorre, Plínio; Departamento de Ciências Biológicas, Universidade Regional do Cariri, Crato, CE 63195-000; Nascimento, Kyria Santiago

2006-02-01

D. rostrata lectin was crystallized by hanging-drop vapor diffusion. The crystal belongs to the orthorhombic space group I222 and diffracted to 1.87 Å resolution. Lectins from the Diocleinae subtribe (Leguminosae) are highly similar proteins that promote various biological activities with distinctly differing potencies. The structural basis for this experimental data is not yet fully understood. Dioclea rostrata lectin was purified and crystallized by hanging-drop vapour diffusion at 293 K. The crystal belongs to the orthorhombic space group I222, with unit-cell parameters a = 61.51, b = 88.22, c = 87.76 Å. Assuming the presence of one monomer per asymmetric unit,more » the solvent content was estimated to be about 47.9%. A complete data set was collected at 1.87 Å resolution.« less

Expression, purification and preliminary crystallographic analysis of sucrose phosphate synthase (SPS) from Halothermothrix orenii

PubMed Central

Huynh, Frederick; Tan, Tien-Chye; Swaminathan, Kunchithapadam; Patel, Bharat K. C.

2005-01-01

This is the first report of the crystallization of a sucrose phosphate synthase (SPS; EC 2.4.1.14). It also constitutes the first study of a sucrose phosphate synthase from a non-photosynthetic thermohalophilic anaerobic bacterium, Halothermothrix orenii. The purified recombinant spsA protein has been crystallized in the monoclinic space group C2, with unit-cell parameters a = 154.2, b = 47.9, c = 72.3 Å, β = 103.16°, using the hanging-drop vapour-diffusion method. The crystal diffracts X-rays to a resolution limit of 3.01 Å. Heavy-metal and halide-soaking trials are currently in progress to solve the structure. PMID:16508108

Expression and X-Ray Structural Determination of the Nucleoprotein of Lassa Fever Virus.

PubMed

Qi, Xiaoxuan; Wang, Wenjian; Dong, Haohao; Liang, Yuying; Dong, Changjiang; Ly, Hinh

2018-01-01

We describe methods to express the nucleoprotein (NP) of Lassa fever virus (LASV) in E. coli, to purify and crystallize it using the sitting-drop vapor diffusion method. The crystals were screened using Rigaku micro-007 X-ray generator and a dataset was collected at a resolution of 2.36 Å. The crystals belong to space group P3, with the unit cell parameters a = b = 176.35 Å, c = 56.40 Å, α = β = 90°, and γ = 120°. Using the X-ray diffraction method, we constructed a three-dimensional structure of the LASV NP that should aid in the development of novel therapeutic strategies against this virus, for which vaccine and effective treatment modalities are currently unavailable.

Structure of Mesorhizobium loti arylamine N-acetyltransferase 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Holton, Simon J.; Dairou, Julien; Sandy, James

2005-01-01

The crystal structure of a M. loti arylamine N-acetyltransferase 1 has been determined at 2.0 Å resolution. The arylamine N-acetyltransferase (NAT) enzymes have been found in a broad range of both eukaryotic and prokaryotic organisms. The NAT enzymes catalyse the transfer of an acetyl group from acetyl Co-enzyme A onto the terminal nitrogen of a range of arylamine, hydrazine and arylhydrazine compounds. Recently, several NAT structures have been reported from different prokaryotic sources including Salmonella typhimurium, Mycobacterium smegmatis and Pseudomonas aeruginosa. Bioinformatics analysis of the Mesorhizobium loti genome revealed two NAT paralogues, the first example of multiple NAT isoenzymes inmore » a eubacterial organism. The M. loti NAT 1 enzyme was recombinantly expressed and purified for X-ray crystallographic studies. The purified enzyme was crystallized in 0.5 M Ca(OAc){sub 2}, 16% PEG 3350, 0.1 M Tris–HCl pH 8.5 using the sitting-drop vapour-diffusion method. A data set diffracting to 2.0 Å was collected from a single crystal at 100 K. The crystal belongs to the orthorhombic spacegroup P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 53.2, b = 97.3, c = 114.3 Å. The structure was refined to a final free-R factor of 24.8%. The structure reveals that despite low sequence homology, M. loti NAT1 shares the common fold as reported in previous NAT structures and exhibits the same catalytic triad of residues (Cys-His-Asp) in the active site.« less

Structure of the newly found green turtle egg-white ribonuclease.

PubMed

Katekaew, Somporn; Kuaprasert, Buabarn; Torikata, Takao; Kakuta, Yoshimitsu; Kimura, Makoto; Yoneda, Kazunari; Araki, Tomohiro

2010-07-01

Marine green turtle (Chelonia mydas) egg-white ribonuclease (GTRNase) was crystallized from 1.1 M ammonium sulfate pH 5.5 and 30% glycerol using the sitting-drop vapour-diffusion method. The structure of GTRNase has been solved at 1.60 A resolution by the molecular-replacement technique using a model based on the structure of RNase 5 (murine angiogenin) from Mus musculus (46% identity). The crystal belonged to the monoclinic space group C2, with unit-cell parameters a = 86.271, b = 34.174, c = 39.738 A, alpha = 90, beta = 102, gamma = 90 degrees . GTRNase consists of three helices and seven beta-strands and displays the alpha+beta folding topology typical of a member of the RNase A superfamily. Superposition of the C(alpha) coordinates of GTRNase and RNase A superfamily members indicates that the overall structure is highly similar to that of angiogenin or RNase 5 from M. musculus (PDB code 2bwl) and RNase A from Bos taurus (PDB code 2blz), with root-mean-square deviations of 3.9 and 2.0 A, respectively. The catalytic residues are conserved with respect to the RNase A superfamily. The three disulfide bridges observed in the reptilian enzymes are conserved in GTRNase, while one further disulfide bond is required for the structural stability of mammalian RNases. GTRNase is expressed in egg white and the fact that its sequence has the highest similarity to that of snapping turtle pancreatic RNase suggests that the GTRNase secreted from oviduct cells to form egg white is probably the product of the same gene as activated in pancreatic cells.

Crystallization and preliminary crystallographic analysis of a surface antigen glycoprotein, SAG19, from Eimeria tenella

PubMed Central

Ramly, Nur Zazarina; Rouzheinikov, Sergey N.; Sedelnikova, Svetlana E.; Baker, Patrick J.; Chow, Yock-Ping; Wan, Kiew-Lian; Nathan, Sheila; Rice, David W.

2013-01-01

Coccidiosis in chickens is caused by the apicomplexan parasite Eimeria tenella and is thought to involve a role for a superfamily of more than 20 cysteine-rich surface antigen glycoproteins (SAGs) in host–parasite interactions. A representative member of the family, SAG19, has been overexpressed in Escherichia coli, purified and crystallized by the hanging-drop method of vapour diffusion using ammonium sulfate as the precipitant. Crystals of SAG19 diffracted to beyond 1.50 Å resolution and belonged to space group I4, with unit-cell parameters a = b = 108.2, c = 37.5 Å. Calculation of possible values of V M suggests that there is a single molecule in the asymmetric unit. PMID:24316835

Crystallization and preliminary X-ray diffraction analysis of a cold-adapted catalase from Vibrio salmonicida

PubMed Central

Riise, Ellen Kristin; Lorentzen, Marit Sjo; Helland, Ronny; Willassen, Nils Peder

2006-01-01

Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P21, with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, β = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit. PMID:16511268

Expression, purification and crystallization of Trypanosoma cruzi dihydroorotate dehydrogenase complexed with orotate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Inaoka, Daniel Ken; Takashima, Eizo; Osanai, Arihiro

2005-10-01

The Trypanosoma cruzi dihydroorotate dehydrogenase, a key enzyme in pyrimidine de novo biosynthesis and redox homeostasis, was crystallized in complex with its first reaction product, orotate. Dihydroorotate dehydrogenase (DHOD) catalyzes the oxidation of dihydroorotate to orotate, the fourth step and the only redox reaction in the de novo biosynthesis of pyrimidine. DHOD from Trypanosoma cruzi (TcDHOD) has been expressed as a recombinant protein in Escherichia coli and purified to homogeneity. Crystals of the TcDHOD–orotate complex were grown at 277 K by the sitting-drop vapour-diffusion technique using polyethylene glycol 3350 as a precipitant. The crystals diffract to better than 1.8 Åmore » resolution using synchrotron radiation (λ = 0.900 Å). X-ray diffraction data were collected at 100 K and processed to 1.9 Å resolution with 98.2% completeness and an overall R{sub merge} of 7.8%. The TcDHOD crystals belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 67.87, b = 71.89, c = 123.27 Å. The presence of two molecules in the asymmetric unit (2 × 34 kDa) gives a crystal volume per protein weight (V{sub M}) of 2.2 Å{sup 3} Da{sup −1} and a solvent content of 44%.« less

Structure of the newly found green turtle egg-white ribonuclease

PubMed Central

Katekaew, Somporn; Kuaprasert, Buabarn; Torikata, Takao; Kakuta, Yoshimitsu; Kimura, Makoto; Yoneda, Kazunari; Araki, Tomohiro

2010-01-01

Marine green turtle (Chelonia mydas) egg-white ribonuclease (GTRNase) was crystallized from 1.1 M ammonium sulfate pH 5.5 and 30% glycerol using the sitting-drop vapour-diffusion method. The structure of GTRNase has been solved at 1.60 Å resolution by the molecular-replacement technique using a model based on the structure of RNase 5 (murine angiogenin) from Mus musculus (46% identity). The crystal belonged to the monoclinic space group C2, with unit-cell parameters a = 86.271, b = 34.174, c = 39.738 Å, α = 90, β = 102, γ = 90°. GTRNase consists of three helices and seven β-strands and displays the α+β folding topology typical of a member of the RNase A superfamily. Superposition of the Cα coordinates of GTRNase and RNase A superfamily members indicates that the overall structure is highly similar to that of angiogenin or RNase 5 from M. musculus (PDB code 2bwl) and RNase A from Bos taurus (PDB code 2blz), with root-mean-square deviations of 3.9 and 2.0 Å, respectively. The catalytic residues are conserved with respect to the RNase A superfamily. The three disulfide bridges observed in the reptilian enzymes are conserved in GTRNase, while one further disulfide bond is required for the structural stability of mammalian RNases. GTRNase is expressed in egg white and the fact that its sequence has the highest similarity to that of snapping turtle pancreatic RNase suggests that the GTRNase secreted from oviduct cells to form egg white is probably the product of the same gene as activated in pancreatic cells. PMID:20606267

Liquid-liquid diffusion crystallization improves the X-ray diffraction of EndoS, an endo-β-N-acetylglucosaminidase from Streptococcus pyogenes with activity on human IgG.

PubMed

Trastoy, Beatriz; Lomino, Joseph V; Wang, Lai Xi; Sundberg, Eric J

2013-12-01

Endoglycosidase S (EndoS) is an enzyme secreted by Streptococcus pyogenes that specifically hydrolyzes the β-1,4-di-N-acetylchitobiose core glycan on immunoglobulin G (IgG) antibodies. One of the most common human pathogens and the cause of group A streptococcal infections, S. pyogenes secretes EndoS in order to evade the host immune system by rendering IgG effector mechanisms dysfunctional. On account of its specificity for IgG, EndoS has also been used extensively for chemoenzymatic synthesis of homogeneous IgG glycoprotein preparations and is being developed as a novel therapeutic for a wide range of autoimmune diseases. The structural basis of its enzymatic activity and substrate specificity, however, remains unknown. Here, the purification and crystallization of EndoS are reported. Using traditional hanging-drop and sitting-drop vapor-diffusion crystallization, crystals of EndoS were grown that diffracted to a maximum of 3.5 Å resolution but suffered from severe anisotropy, the data from which could only be reasonably processed to 7.5 Å resolution. When EndoS was crystallized by liquid-liquid diffusion, it was possible to grow crystals with a different space group to those obtained by vapor diffusion. Crystals of wild-type endoglycosidase and glycosynthase constructs of EndoS grown by liquid-liquid diffusion diffracted to 2.6 and 1.9 Å resolution, respectively, with a greatly diminished anisotropy. Despite extensive efforts, the failure to reproduce these liquid-liquid diffusion-grown crystals by vapor diffusion suggests that these crystallization methods each sample a distinct crystallization space.

Crystallization and preliminary X-ray analysis of 2,3-diketo-5-methylthiopentyl-1-phosphate enolase from Bacillus subtilis

PubMed Central

Tamura, Haruka; Ashida, Hiroki; Koga, Shogo; Saito, Yohtaro; Yadani, Tomonori; Kai, Yasushi; Inoue, Tsuyoshi; Yokota, Akiho; Matsumura, Hiroyoshi

2009-01-01

2,3-Diketo-5-methylthiopentyl-1-phosphate enolase (DK-MTP-1P enolase) from Bacillus subtilis was crystallized using the hanging-drop vapour-diffusion method. Crystals grew using PEG 3350 as the precipitant at 293 K. The crystals diffracted to 2.3 Å resolution at 100 K using synchrotron radiation and were found to belong to the monoclinic space group P21, with unit-cell parameters a = 79.3, b = 91.5, c = 107.0 Å, β = 90.8°. The asymmetric unit contained four molecules of DK-MTP-1P enolase, with a V M value of 2.2 Å3 Da−1 and a solvent content of 43%. PMID:19194007

Expression, Purification And Preliminary X-Ray Analysis of the C-Terminal Domain of An Arginine Repressor Protein From Mycobacterium Tuberculosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, G.J.; Garen, C.R.; Cherney, M.M.

2009-06-03

The gene product of an open reading frame Rv1657 from Mycobacterium tuberculosis is a putative arginine repressor protein (ArgR), a transcriptional factor that regulates the expression of arginine-biosynthetic enzymes. Rv1657 was expressed and purified and a C-terminal domain was crystallized using the hanging-drop vapour-diffusion method. Diffraction data were collected and processed to a resolution of 2.15 {angstrom}. The crystals belong to space group P1 and the Matthews coefficient suggests that the crystals contain six C-terminal domain molecules per unit cell. Previous structural and biochemical studies on the arginine repressor proteins from other organisms have likewise shown the presence of sixmore » molecules per unit cell.« less

Purification, identification and preliminary crystallographic studies of Pru du amandin, an allergenic protein from Prunus dulcis.

PubMed

Gaur, Vineet; Sethi, Dhruv K; Salunke, Dinakar M

2008-01-01

Food allergies appear to be one of the foremost causes of hypersensitivity reactions. Nut allergies account for most food allergies and are often permanent. The 360 kDa hexameric protein Pru du amandin, a known allergen, was purified from almonds (Prunus dulcis) by ammonium sulfate fractionation and ion-exchange chromatography. The protein was identified by a BLAST homology search against the nonredundant sequence database. Pru du amandin belongs to the 11S legumin family of seed storage proteins characterized by the presence of a cupin motif. Crystals were obtained by the hanging-drop vapour-diffusion method. The crystals belong to space group P4(1) (or P4(3)), with unit-cell parameters a = b = 150.7, c = 164.9 A.

Purification, identification and preliminary crystallographic studies of Pru du amandin, an allergenic protein from Prunus dulcis

PubMed Central

Gaur, Vineet; Sethi, Dhruv K.; Salunke, Dinakar M.

2008-01-01

Food allergies appear to be one of the foremost causes of hypersensitivity reactions. Nut allergies account for most food allergies and are often permanent. The 360 kDa hexameric protein Pru du amandin, a known allergen, was purified from almonds (Prunus dulcis) by ammonium sulfate fractionation and ion-exchange chromatography. The protein was identified by a BLAST homology search against the nonredundant sequence database. Pru du amandin belongs to the 11S legumin family of seed storage proteins characterized by the presence of a cupin motif. Crystals were obtained by the hanging-drop vapour-diffusion method. The crystals belong to space group P41 (or P43), with unit-cell parameters a = b = 150.7, c = 164.9 Å. PMID:18097098

Purification, crystallization and preliminary crystallographic analysis of a 6-pyruvoyltetrahydropterin synthase homologue from Esherichia coli.

PubMed

Seo, Kyung Hye; Supangat; Kim, Hye Lim; Park, Young Shik; Jeon, Che Ok; Lee, Kon Ho

2008-02-01

6-Pyruvoyltetrahydropterin synthase from E. coli (ePTPS) has been crystallized using the hanging-drop vapour-diffusion method. Hexagonal- and rectangular-shaped crystals were obtained. Diffraction data were collected from the hexagonal and rectangular crystals to 3.0 and 2.3 A resolution, respectively. The hexagonal plate-shaped crystals belonged to space group P321, with unit-cell parameters a = b = 112.59, c = 68.82 A , and contained two molecules in the asymmetric unit. The rectangular crystals belonged to space group I222, with unit-cell parameters a = 112.76, b = 117.66, c = 153.57 A , and contained six molecules in the asymmetric unit. The structure of ePTPS in both crystal forms has been determined by molecular replacement.

Purification, crystallization and preliminary crystallographic analysis of a 6-pyruvoyltetrahydropterin synthase homologue from Esherichia coli

PubMed Central

Seo, Kyung Hye; Supangat; Kim, Hye Lim; Park, Young Shik; Jeon, Che Ok; Lee, Kon Ho

2008-01-01

6-Pyruvoyltetrahydropterin synthase from E. coli (ePTPS) has been crystallized using the hanging-drop vapour-diffusion method. Hexagonal- and rectangular-shaped crystals were obtained. Diffraction data were collected from the hexagonal and rectangular crystals to 3.0 and 2.3 Å resolution, respectively. The hexagonal plate-shaped crystals belonged to space group P321, with unit-cell parameters a = b = 112.59, c = 68.82 Å, and contained two molecules in the asymmetric unit. The rectangular crystals belonged to space group I222, with unit-cell parameters a = 112.76, b = 117.66, c = 153.57 Å, and contained six molecules in the asymmetric unit. The structure of ePTPS in both crystal forms has been determined by molecular replacement. PMID:18271114

Crystallization and preliminary X-ray diffraction analysis of a chitin-binding domain of hyperthermophilic chitinase from Pyrococcus furiosus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakamura, Tsutomu; Ishikawa, Kazuhiko; Hagihara, Yoshihisa

The expression, purification and preliminary X-ray diffraction studies of a chitin-binding domain of the chitinase from P. furiosus are reported. The crystallization and preliminary X-ray diffraction analysis of the chitin-binding domain of chitinase from a hyperthermophilic archaeon, Pyrococcus furiosus, are reported. The recombinant protein was prepared using an Escherichia coli overexpression system and was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected to 1.70 Å resolution. The crystal belonged to space group P4{sub 3}2{sub 1}2 or P4{sub 1}2{sub 1}2. The unit-cell parameters were determined to be a = b = 48.8, c = 85.0 Å.

Cloning, purification, crystallization and preliminary X-ray crystallographic analysis of SET/TAF-Iß δN from Homo sapiens.

PubMed

Xu, Zhen; Yang, Weili; Shi, Nuo; Gao, Yongxiang; Teng, Maikun; Niu, Liwen

2010-08-01

The histone chaperone SET encoded by the SET gene, which is also known as template-activating factor Iß (TAF-Iß), is a multifunctional molecule that is involved in many biological phenomena such as histone binding, nucleosome assembly, chromatin remodelling, replication, transcription and apoptosis. A truncated SET/TAF-Iß ΔN protein that lacked the first 22 residues of the N-terminus but contained the C-terminal acidic domain and an additional His6 tag at the C-terminus was overexpressed in Escherichia coli and crystallized by the hanging-drop vapour-diffusion method using sodium acetate as precipitant at 283 K. The crystals diffracted to 2.7 A resolution and belonged to space group P4(3)2(1)2.

Crystallization and preliminary X-ray diffraction studies of a novel ferredoxin involved in the dioxygenation of carbazole by Novosphingobium sp. KA1

PubMed Central

Umeda, Takashi; Katsuki, Junichi; Usami, Yusuke; Inoue, Kengo; Noguchi, Haruko; Fujimoto, Zui; Ashikawa, Yuji; Yamane, Hisakazu; Nojiri, Hideaki

2008-01-01

Novosphingobium sp. KA1 uses carbazole 1,9a-dioxygenase (CARDO) as the first dioxygenase in its carbazole-degradation pathway. The CARDO of KA1 contains a terminal oxygenase component and two electron-transfer components: ferredoxin and ferredoxin reductase. In contrast to the CARDO systems of other species, the ferredoxin component of KA1 is a putidaredoxin-type protein. This novel ferredoxin was crystallized at 293 K by the hanging-drop vapour-diffusion method using PEG MME 550 as the precipitant under anaerobic conditions. The crystals belong to space group C2221 and diffraction data were collected to a resolution of 1.9 Å (the diffraction limit was 1.6 Å). PMID:18607094

The millennium water vapour drop in chemistry-climate model simulations

NASA Astrophysics Data System (ADS)

Brinkop, Sabine; Dameris, Martin; Jöckel, Patrick; Garny, Hella; Lossow, Stefan; Stiller, Gabriele

2016-07-01

This study investigates the abrupt and severe water vapour decline in the stratosphere beginning in the year 2000 (the "millennium water vapour drop") and other similarly strong stratospheric water vapour reductions by means of various simulations with the state-of-the-art Chemistry-Climate Model (CCM) EMAC (ECHAM/MESSy Atmospheric Chemistry Model). The model simulations differ with respect to the prescribed sea surface temperatures (SSTs) and whether nudging is applied or not. The CCM EMAC is able to most closely reproduce the signature and pattern of the water vapour drop in agreement with those derived from satellite observations if the model is nudged. Model results confirm that this extraordinary water vapour decline is particularly obvious in the tropical lower stratosphere and is related to a large decrease in cold point temperature. The drop signal propagates under dilution to the higher stratosphere and to the poles via the Brewer-Dobson circulation (BDC). We found that the driving forces for this significant decline in water vapour mixing ratios are tropical sea surface temperature (SST) changes due to a coincidence with a preceding strong El Niño-Southern Oscillation event (1997/1998) followed by a strong La Niña event (1999/2000) and supported by the change of the westerly to the easterly phase of the equatorial stratospheric quasi-biennial oscillation (QBO) in 2000. Correct (observed) SSTs are important for triggering the strong decline in water vapour. There are indications that, at least partly, SSTs contribute to the long period of low water vapour values from 2001 to 2006. For this period, the specific dynamical state of the atmosphere (overall atmospheric large-scale wind and temperature distribution) is important as well, as it causes the observed persistent low cold point temperatures. These are induced by a period of increased upwelling, which, however, has no corresponding pronounced signature in SSTs anomalies in the tropics. Our free-running simulations do not capture the drop as observed, because a) the cold point temperature has a low bias and thus the water vapour variability is reduced and b) because they do not simulate the appropriate dynamical state. Large negative water vapour declines are also found in other years and seem to be a feature which can be found after strong combined El Niño/La Niña events if the QBO west phase during La Niña changes to the east phase.

Heat transfer and pressure drop of condensation of hydrocarbons in tubes

NASA Astrophysics Data System (ADS)

Fries, Simon; Skusa, Severin; Luke, Andrea

2018-03-01

The heat transfer coefficient and pressure drop are investigated for propane. Two different mild steel plain tubes and saturation pressures are considered for varying mass flux and vapour quality. The pressure drop is compared to the Friedel-Correlation with two different approaches to determine the friction factor. The first is calculation as proposed by Friedel and the second is through single phase pressure drop investigations. For lower vapour qualities the experimental results are in better agreement with the approach of the calculated friction factor. For higher vapour qualities the experimental friction factor is more precise. The pressure drop increases for a decreasing tube diameter and saturation pressure. The circumferential temperature profile and heat transfer coefficients are shown for a constant vapour quality at varying mass fluxes. The subcooling is highest for the bottom of the tube and lowest for the top. The average subcooling as well as the circumferential deviation decreases for rising mass fluxes. The averaged heat transfer coefficients are compared to the model proposed by Thome and Cavallini. The experimental results are in good agreement with both correlations, however the trend is better described with the correlation from Thome. The experimental heat transfer coefficients are under predicted by Thome and over predicted by Cavallini.

Expression, purification, crystallization and preliminary X-ray analysis of the Met244Ala variant of catalase–peroxidase (KatG) from the haloarchaeon Haloarcula marismortui

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ten-i, Tomomi; Kumasaka, Takashi; Higuchi, Wataru

2007-11-01

The Met244Ala variant of the H. marismortui KatG enzyme was expressed in haloarchaeal host cells and purified to homogeneity. The variant was crystallized using the hanging-drop vapour-diffusion method with ammonium sulfate and NaCl as precipitants. The reddish-brown rod-shaped crystals obtained belong to the monoclinic space group C2, with unit-cell parameters a = 315.24, b = 81.04, c = 74.77 Å, β = 99.81°. The covalent modification of the side chains of Trp95, Tyr218 and Met244 within the active site of Haloarcula marismortui catalase–peroxidase (KatG) appears to be common to all KatGs and has been demonstrated to be particularly significant formore » its bifunctionality [Smulevich et al. (2006 ▶), J. Inorg. Biochem.100, 568–585; Jakopitsch, Kolarich et al. (2003 ▶), FEBS Lett.552, 135–140; Jakopitsch, Auer et al. (2003 ▶), J. Biol. Chem.278, 20185–20191; Jakopitsch et al. (2004 ▶), J. Biol. Chem.279, 46082–46095; Regelsberger et al. (2001 ▶), Biochem. Soc. Trans.29, 99–105; Ghiladi, Knudsen et al. (2005 ▶), J. Biol. Chem.280, 22651–22663; Ghiladi, Medzihradzky et al. (2005 ▶), Biochemistry, 44, 15093–15105]. The Met244Ala variant of the H. marismortui KatG enzyme was expressed in haloarchaeal host cells and purified to homogeneity. The variant showed a complete loss of catalase activity, whereas the peroxidase activity of this mutant was highly enhanced owing to an increase in its affinity for the peroxidatic substrate. The variant was crystallized using the hanging-drop vapour-diffusion method with ammonium sulfate and NaCl as precipitants. The reddish-brown rod-shaped crystals obtained belong to the monoclinic space group C2, with unit-cell parameters a = 315.24, b = 81.04, c = 74.77 Å, β = 99.81°. A crystal frozen using lithium sulfate as the cryoprotectant diffracted to beyond 2.0 Å resolution. Preliminary X-ray analysis suggests the presence of a dimer in the asymmetric unit.« less

Open-tube diffusion techniques for InP/LnGaAs heterojunctior bipolar transistors

NASA Astrophysics Data System (ADS)

Schuitemaker, P.; Houston, P. A.

1986-11-01

Open-tube diffusion techniques used between 450 and 600° C are described which involve the supply of diffusant from a vapour source (via a solution) and a solid evaporated metal source. Investigations of Zn into InP and InGaAs(P) have been undertaken using both sources. SIMS profile analyses show that in the case of the vapour source the profiles indicate a concentration-dependent diffusion coefficient while the solid source diffusions can be well described by a Gaussian-type profile. The usefulness of the vapour source method has been demonstrated in the fabrication of bipolar transistors which exhibit good d.c. characteristics. The solid source method is limited by the slow diffusion velocity and more gradual profile. The InGaAs(P)/InP materials system has important applications in optical communications and future high speed microwave and switching devices. Useful technologies allied to the introduction of impurities into Si by diffusion, have gradually been emerging for use in the III-V semiconductor family. Closed tube systems1 have been used in order to contain the volatile group V species and prevent surface erosion. In addition, simpler open tube systems2,3 have been developed that maintain a sufficient overpressure of the group V element. Zn and Cd p-dopants have been studied extensively because of the volatility and relatively large diffusion rates in III-V semiconductors. Opentube diffusion into both InP and InGaAs2-6 has been studied but little detail has appeared concerning InGaAs and InGaAsP. In this paper we describe a comprehensive study of the diffusion of Zn into InP and InGaAs(P) using both open-tube vapour source and a Au/Zn/Au evaporated solid source with SiNx acting both as a mask and also an encapsulant to prevent loss of Zn and decomposition of the substrate material. The techniques have been successfully applied to the fabrication of InP/lnGaAs heterojunction bipolar transistors which show good dc characteristics. Reference to InGaAs in the text implies the InP lattice-matched composition In0.53Ga0.47As.

A sensor of alcohol vapours based on thin polyaniline base film and quartz crystal microbalance.

PubMed

Ayad, Mohamad M; El-Hefnawey, Gad; Torad, Nagy L

2009-08-30

Thin films of polyaniline base, emeraldine base (EB), coating on the quartz crystal microbalance (QCM) electrode were used as a sensitive layer for the detection of a number of primary aliphatic alcohols such as ethanol, methanol, 2-propanol and 1-propanol vapours. The frequency shifts (Deltaf) of the QCM were increased due to the vapour adsorption into the EB film. Deltaf were found to be linearly correlated with the concentrations of alcohols vapour in part per million (ppm). The sensitivity of the sensor was found to be governed by the chemical structure of the alcohol. The sensor shows a good reproducibility and reversibility. The diffusions of different alcohols vapour were studied and the diffusion coefficients (D) were calculated. It is concluded that the diffusion of the vapours into the EB film follows Fickian kinetics.

Crystallization and preliminary X-ray study of a (2R,3R)-2,3-butanediol dehydrogenase from Bacillus coagulans 2-6

PubMed Central

Miao, Xiangzhi; Huang, Xianhui; Zhang, Guofang; Zhao, Xiufang; Zhu, Xianming; Dong, Hui

2013-01-01

(2R,3R)-2,3-Butanediol dehydrogenase (R,R-BDH) from Bacillus coagulans 2-6 is a zinc-dependent medium-chain alcohol dehydrogenase. Recombinant R,R-BDH with a His6 tag at the C-terminus was expressed in Escherichia coli BL21 (DE3) cells and purified by Ni2+-chelating affinity and size-exclusion chromatography. Crystals were grown by the hanging-drop vapour-diffusion method at 289 K. The crystallization condition consisted of 8%(v/v) Tacsimate pH 4.6, 18%(w/v) polyethylene glycol 3350. The crystal diffracted to 2.8 Å resolution in the orthorhombic space group P212121, with unit-cell parameters a = 88.35, b = 128.73, c = 131.03 Å. PMID:24100567

Purification, crystallization and preliminary crystallographic study of low oxygen-affinity haemoglobin from cat (Felis silvestris catus) in two different crystal forms.

PubMed

Balasubramanian, M; Moorthy, Pon Sathya; Neelagandan, K; Ponnuswamy, M N

2009-03-01

Haemoglobin is a metalloprotein which plays a major role in the transportation of oxygen from the lungs to tissues and of carbon dioxide back to the lungs. The present work reports the preliminary crystallographic study of low oxygen-affinity haemoglobin from cat in different crystal forms. Cat blood was collected, purified by anion-exchange chromatography and crystallized in two different conditions by the hanging-drop vapour-diffusion method under unbuffered low-salt and buffered high-salt concentrations using PEG 3350 as a precipitant. Intensity data were collected using MAR345 and MAR345dtb image-plate detector systems. Cat haemoglobin crystallizes in monoclinic and orthorhombic crystal forms with one and two whole biological molecules (alpha(2)beta(2)), respectively, in the asymmetric unit.

Crystallization and preliminary crystallographic analysis of hygromycin B phosphotransferase from Escherichia coli.

PubMed

Iino, Daisuke; Takakura, Yasuaki; Kuroiwa, Mika; Kawakami, Ryouta; Sasaki, Yasuyuki; Hoshino, Takayuki; Ohsawa, Kanju; Nakamura, Akira; Yajima, Shunsuke

2007-08-01

Aminoglycoside antibiotics, such as hygromycin, kanamycin, neomycin, spectinomycin and streptomycin, inhibit protein synthesis by acting on bacterial and eukaryotic ribosomes. Hygromycin B phosphotransferase (Hph; EC 2.7.1.119) converts hygromycin B to 7''-O-phosphohygromycin using a phosphate moiety from ATP, resulting in the loss of its cell-killing activity. The Hph protein has been crystallized for the first time using a thermostable mutant and the hanging-drop vapour-diffusion method. The crystal provided diffraction data to a resolution of 2.1 A and belongs to space group P3(2)21, with unit-cell parameters a = b = 71.0, c = 125.0 A. Crystals of complexes of Hph with hygromycin B and AMP-PNP or ADP have also been obtained in the same crystal form as that of the apoprotein.

Crystallization and preliminary crystallographic analysis of hygromycin B phosphotransferase from Escherichia coli

PubMed Central

Iino, Daisuke; Takakura, Yasuaki; Kuroiwa, Mika; Kawakami, Ryouta; Sasaki, Yasuyuki; Hoshino, Takayuki; Ohsawa, Kanju; Nakamura, Akira; Yajima, Shunsuke

2007-01-01

Aminoglycoside antibiotics, such as hygromycin, kanamycin, neomycin, spectinomycin and streptomycin, inhibit protein synthesis by acting on bacterial and eukaryotic ribosomes. Hygromycin B phosphotransferase (Hph; EC 2.7.1.119) converts hygromycin B to 7′′-O-phosphohygromycin using a phosphate moiety from ATP, resulting in the loss of its cell-killing activity. The Hph protein has been crystallized for the first time using a thermostable mutant and the hanging-drop vapour-diffusion method. The crystal provided diffraction data to a resolution of 2.1 Å and belongs to space group P3221, with unit-cell parameters a = b = 71.0, c = 125.0 Å. Crystals of complexes of Hph with hygromycin B and AMP-PNP or ADP have also been obtained in the same crystal form as that of the apoprotein. PMID:17671368

Crystallization and preliminary X-ray study of a (2R,3R)-2,3-butanediol dehydrogenase from Bacillus coagulans 2-6.

PubMed

Miao, Xiangzhi; Huang, Xianhui; Zhang, Guofang; Zhao, Xiufang; Zhu, Xianming; Dong, Hui

2013-10-01

(2R,3R)-2,3-Butanediol dehydrogenase (R,R-BDH) from Bacillus coagulans 2-6 is a zinc-dependent medium-chain alcohol dehydrogenase. Recombinant R,R-BDH with a His6 tag at the C-terminus was expressed in Escherichia coli BL21 (DE3) cells and purified by Ni2+-chelating affinity and size-exclusion chromatography. Crystals were grown by the hanging-drop vapour-diffusion method at 289 K. The crystallization condition consisted of 8%(v/v) Tacsimate pH 4.6, 18%(w/v) polyethylene glycol 3350. The crystal diffracted to 2.8 Å resolution in the orthorhombic space group P2₁2₁2₁, with unit-cell parameters a=88.35, b=128.73, c=131.03 Å.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aoki, Ken-ichi; Tanaka, Nobutada, E-mail: ntanaka@pharm.showa-u.ac.jp; Ishikura, Shuhei

Pig heart carbonyl reductase has been crystallized in the presence of NADPH. Diffraction data have been collected using synchrotron radiation. Pig heart carbonyl reductase (PHCR), which belongs to the short-chain dehydrogenase/reductase (SDR) family, has been crystallized by the hanging-drop vapour-diffusion method. Two crystal forms (I and II) have been obtained in the presence of NADPH. Form I crystals belong to the tetragonal space group P4{sub 2}, with unit-cell parameters a = b = 109.61, c = 94.31 Å, and diffract to 1.5 Å resolution. Form II crystals belong to the tetragonal space group P4{sub 1}2{sub 1}2, with unit-cell parameters amore » = b = 120.10, c = 147.00 Å, and diffract to 2.2 Å resolution. Both crystal forms are suitable for X-ray structure analysis at high resolution.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Niemi, Merja, E-mail: merja.niemi@joensuu.fi; Jänis, Janne; Jylhä, Sirpa

The high-resolution mass-spectrometric characterization, crystallization and X-ray diffraction studies of a recombinant IgE Fab fragment in complex with bovine β-lactoglobulin are reported. A D1 Fab fragment containing the allergen-binding variable domains of the IgE antibody was characterized by ESI FT–ICR mass spectrometry and crystallized with bovine β-lactoglobulin (BLG) using the hanging-drop vapour-diffusion method at 293 K. X-ray data suitable for structure determination were collected to 2.8 Å resolution using synchrotron radiation. The crystal belonged to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 67.0, b = 100.6, c = 168.1 Å. The three-dimensional structure ofmore » the D1 Fab fragment–BLG complex will provide the first insight into IgE antibody–allergen interactions at the molecular level.« less

Application of hanging drop technique to optimize human IgG formulations.

PubMed

Li, Guohua; Kasha, Purna C; Late, Sameer; Banga, Ajay K

2010-01-01

The purpose of this work is to assess the hanging drop technique in screening excipients to develop optimal formulations for human immunoglobulin G (IgG). A microdrop of human IgG and test solution hanging from a cover slide and undergoing vapour diffusion was monitored by a stereomicroscope. Aqueous solutions of IgG in the presence of different pH, salt concentrations and excipients were prepared and characterized. Low concentration of either sodium/potassium phosphate or McIlvaine buffer favoured the solubility of IgG. Addition of sucrose favoured the stability of this antibody while addition of NaCl caused more aggregation. Antimicrobial preservatives were also screened and a complex effect at different buffer conditions was observed. Dynamic light scattering, differential scanning calorimetry and size exclusion chromatography studies were performed to further validate the results. In conclusion, hanging drop is a very easy and effective approach to screen protein formulations in the early stage of formulation development.

Crystallization and preliminary X-ray diffraction studies of the glutaminyl cyclase from Carica papaya latex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Azarkan, Mohamed; Clantin, Bernard; Bompard, Coralie

2005-01-01

The glutaminyl cyclase isolated from C. papaya latex has been crystallized using the hanging-drop method. Diffraction data have been collected at ESRF beamline BM14 and processed to 1.7 Å resolution. In living systems, the intramolecular cyclization of N-terminal glutamine residues is accomplished by glutaminyl cyclase enzymes (EC 2.3.2.5). While in mammals these enzymes are involved in the synthesis of hormonal and neurotransmitter peptides, the physiological role played by the corresponding plant enzymes still remains to be unravelled. Papaya glutaminyl cyclase (PQC), a 33 kDa enzyme found in the latex of the tropical tree Carica papaya, displays an exceptional resistance tomore » chemical and thermal denaturation as well as to proteolysis. In order to elucidate its enzymatic mechanism and to gain insights into the structural determinants underlying its remarkable stability, PQC was isolated from papaya latex, purified and crystallized by the hanging-drop vapour-diffusion method. The crystals belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 62.82, b = 81.23, c = 108.17 Å and two molecules per asymmetric unit. Diffraction data have been collected at ESRF beamline BM14 and processed to a resolution of 1.7 Å.« less

Preparation, crystallization and preliminary X-ray analysis of the methionine synthase (MetE) from Streptococcus mutans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fu, Tian-Min; Zhang, Xiao-Yan; Li, Lan-Fen

2006-10-01

Methionine synthase (MetE) from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.2 Å resolution. The Streptococcus mutans metE gene encodes methionine synthase (MetE), which catalyzes the direct transfer of a methyl group from methyltetrahydrofolate to homocysteine in the last step of methionine synthesis. metE was cloned into pET28a and the gene product was expressed at high levels in the Escherichia coli strain BL21 (DE3). MetE was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.2 Å resolution.more » The crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 52.85, b = 99.48, c = 77.88 Å, β = 94.55°.« less

Protein preparation and preliminary X-ray crystallographic analysis of a putative glucosamine 6-phosphate deaminase from Streptococcus mutants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, Guan-Jing; Li, Lan-Fen; Li, Dan

2007-09-01

A glucosamine 6-phosphate deaminase homologue from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.4 Å resolution. The SMU.636 protein from Streptococcus mutans is a putative glucosamine 6-phosphate deaminase with 233 residues. The smu.636 gene was PCR-amplified from S. mutans genomic DNA and cloned into the expression vector pET-28a(+). The resultant His-tagged fusion protein was expressed in Escherichia coli and purified to homogeneity in two steps. Crystals of the fusion protein were obtained by the hanging-drop vapour-diffusion method. The crystals diffracted to 2.4 Å resolution and belong to space group P2{sub 1}2{sub 1}2{sub 1}, withmore » unit-cell parameters a = 53.83, b = 82.13, c = 134.70 Å.« less

Preliminary X-ray crystallographic analysis of SMU.573, a putative sugar kinase from Streptococcus mutans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Yan-Feng; Li, Lan-Fen; Yang, Cheng

2008-01-01

SMU.573 from S. mutans was expressed in E. coli and crystallized. The crystals belong to space group I4 and 2.5 Å resolution diffraction data were collected at an in-house chromium radiation source. SMU.573 from Streptococcus mutans is a structurally and functionally uncharacterized protein that was selected for structural biology studies. Native and SeMet-labelled proteins were expressed with an N-His tag in Escherichia coli BL21 (DE3) and purified by Ni{sup 2+}-chelating and size-exclusion chromatography. Crystals of the SeMet-labelled protein were obtained by the hanging-drop vapour-diffusion method and a 2.5 Å resolution diffraction data set was collected using an in-house chromium radiationmore » source. The crystals belong to space group I4, with unit-cell parameters a = b = 96.53, c = 56.26 Å, α = β = γ = 90°.« less

Purification, crystallization and preliminary X-ray crystallographic analysis of rice Bowman–Birk inhibitor from Oryza sativa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Yi-Hung; Li, Hsin-Tai; Institute of Bioinformatics and Structural Biology, National Tsing-Hua University, Hsinchu 30013,Taiwan

2006-06-01

Rice Bowman–Birk inhibitor was expressed and crystallized. Bowman–Birk inhibitors (BBIs) are cysteine-rich proteins with inhibitory activity against proteases that are widely distributed in monocot and dicot species. The expression of rice BBI from Oryza sativa is up-regulated and induced by pathogens or insects during germination of rice seeds. The rice BBI (RBTI) of molecular weight 15 kDa has been crystallized using the hanging-drop vapour-diffusion method. According to the diffraction of rice BBI crystals at a resolution of 2.07 Å, the unit cell belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 74.37, b = 96.69, cmore » = 100.36 Å. Preliminary analysis indicates four BBI molecules in an asymmetric unit, with a solvent content of 58.29%.« less

Purification, identification and preliminary crystallographic studies of Pru du amandin, an allergenic protein from Prunus dulcis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gaur, Vineet; Sethi, Dhruv K.; Salunke, Dinakar M., E-mail: dinakar@nii.res.in

The purification, identification, crystallization and preliminary crystallographic studies of an allergy-related protein, Pru du amandin, from P. dulcis nuts are reported. Food allergies appear to be one of the foremost causes of hypersensitivity reactions. Nut allergies account for most food allergies and are often permanent. The 360 kDa hexameric protein Pru du amandin, a known allergen, was purified from almonds (Prunus dulcis) by ammonium sulfate fractionation and ion-exchange chromatography. The protein was identified by a BLAST homology search against the nonredundant sequence database. Pru du amandin belongs to the 11S legumin family of seed storage proteins characterized by the presencemore » of a cupin motif. Crystals were obtained by the hanging-drop vapour-diffusion method. The crystals belong to space group P4{sub 1} (or P4{sub 3}), with unit-cell parameters a = b = 150.7, c = 164.9 Å.« less

Purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies of great cormorant (Phalacrocorax carbo) haemoglobin.

PubMed

Jagadeesan, G; Malathy, P; Gunasekaran, K; Harikrishna Etti, S; Aravindhan, S

2014-11-01

Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to the trigonal system P3₁21, with unit-cell parameters a=b=55.64, c=153.38 Å, β=120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aravind, Penmatsa; Rajini, Bheemreddy; Sharma, Yogendra

The crystallization and preliminary X-ray diffraction analysis of AIM1g1, a βγ-crystallin domain of absent in melanoma (AIM1) protein from H. sapiens, is reported. AIM1g1 is a single βγ-crystallin domain from the protein absent in melanoma 1 (AIM1), which appears to play a role in the suppression of melanomas. This domain is known to bind calcium and its structure would help in identifying calcium-coordinating sites in vertebrate crystallins, which have hitherto been believed to have lost this ability during evolution. Crystallization of this domain was performed by the hanging-drop vapour-diffusion method. Crystals diffracted to a maximum resolution of 1.86 Å andmore » were found to belong to space group P6{sub 1} or P6{sub 5}, with unit-cell parameters a = b = 54.98, c = 59.73 Å. Solvent-content analysis indicated the presence of one monomer per asymmetric unit.« less

Crystallization and preliminary crystallographic analysis of an acridone-producing novel multifunctional type III polyketide synthase from Huperzia serrata

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morita, Hiroyuki; Kondo, Shin; Kato, Ryohei

2007-07-01

An acridone-producing novel type III polyketide synthase from H. serrata has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.0 Å. Polyketide synthase 1 (PKS1) from Huperzia serrata is a plant-specific type III polyketide synthase that shows an unusually versatile catalytic potential, producing various aromatic tetraketides, including chalcones, benzophenones, phlorogulucinols and acridones. Recombinant H. serrata PKS1 expressed in Escherichia coli was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 73.3, b = 85.0, c = 137.7 Å, α =more » β = γ = 90.0°. Diffraction data were collected to 2.0 Å resolution using synchrotron radiation at BL24XU of SPring-8.« less

Crystallization and preliminary X-ray diffraction analysis of a cold-adapted catalase from Vibrio salmonicida

DOE Office of Scientific and Technical Information (OSTI.GOV)

Riise, Ellen Kristin; Lorentzen, Marit Sjo; Helland, Ronny

2006-01-01

Monoclinic (P2{sub 1}) crystals of a His-tagged form of V. salmonicida catalase without cofactor diffract X-rays to 1.96 Å. Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, βmore » = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit.« less

Crystallization and preliminary X-ray data analysis of β-alanine synthase from Drosophila melanogaster

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lundgren, Stina; Andersen, Birgit; Piškur, Jure

2007-10-01

β-Alanine synthase catalyzes the last step in the reductive degradation pathway for uracil and thymine. Crystals of the recombinant enzyme from D. melanogaster belong to space group C2. Diffraction data to 3.3 Å resolution were collected and analyzed. β-Alanine synthase catalyzes the last step in the reductive degradation pathway for uracil and thymine, which represents the main clearance route for the widely used anticancer drug 5-fluorouracil. Crystals of the recombinant enzyme from Drosophila melanogaster, which is closely related to the human enzyme, were obtained by the hanging-drop vapour-diffusion method. They diffracted to 3.3 Å at a synchrotron-radiation source, belong tomore » space group C2 (unit-cell parameters a = 278.9, b = 95.0, c = 199.3 Å, β = 125.8°) and contain 8–10 molecules per asymmetric unit.« less

Crystallization and preliminary X-ray diffraction studies of the ubiquitin-like (UbL) domain of the human homologue A of Rad23 (hHR23A) protein.

PubMed

Chen, Yu Wai; Tajima, Toshitaka; Rees, Martin; Garcia-Maya, Mitla

2009-09-01

Human homologue A of Rad23 (hHR23A) plays dual roles in DNA repair as well as serving as a shuttle vehicle targeting polyubiquitinated proteins for degradation. Its N-terminal ubiquitin-like (UbL) domain interacts with the 19S proteasomal cap and provides the docking mechanism for protein delivery. Pyramidal crystals of the UbL domain of hHR23A were obtained by the hanging-drop vapour-diffusion method with ammonium sulfate as the crystallizing agent. The crystals diffracted to beyond 2 A resolution and belonged to the hexagonal space group P6(5)22, with unit-cell parameters a = b = 78.48, c = 63.57 A. The structure was solved by molecular replacement using the UbL domain of yeast Dsk2 as the search model.

Crystallization and preliminary X-ray diffraction studies of hyperthermophilic archaeal Rieske-type ferredoxin (ARF) from Sulfolobus solfataricus P1

PubMed Central

Kounosu, Asako; Hasegawa, Kazuya; Iwasaki, Toshio; Kumasaka, Takashi

2010-01-01

The hyperthermophilic archaeal Rieske-type [2Fe–2S] ferredoxin (ARF) from Sulfolobus solfataricus P1 contains a low-potential Rieske-type [2Fe–2S] cluster that has served as a tractable model for ligand-substitution studies on this protein family. Recombinant ARF harbouring a pET30a vector-derived N-­terminal extension region plus a hexahistidine tag has been heterologously overproduced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method using 0.05 M sodium acetate, 0.05 M HEPES, 2 M ammonium sulfate pH 5.5. The crystals diffracted to 1.85 Å resolution and belonged to the tetragonal space group P43212, with unit-cell parameters a = 60.72, c = 83.31 Å. The asymmetric unit contains one protein molecule. PMID:20606288

Crystallization and preliminary X-ray diffraction studies of hyperthermophilic archaeal Rieske-type ferredoxin (ARF) from Sulfolobus solfataricus P1.

PubMed

Kounosu, Asako; Hasegawa, Kazuya; Iwasaki, Toshio; Kumasaka, Takashi

2010-07-01

The hyperthermophilic archaeal Rieske-type [2Fe-2S] ferredoxin (ARF) from Sulfolobus solfataricus P1 contains a low-potential Rieske-type [2Fe-2S] cluster that has served as a tractable model for ligand-substitution studies on this protein family. Recombinant ARF harbouring a pET30a vector-derived N-terminal extension region plus a hexahistidine tag has been heterologously overproduced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method using 0.05 M sodium acetate, 0.05 M HEPES, 2 M ammonium sulfate pH 5.5. The crystals diffracted to 1.85 A resolution and belonged to the tetragonal space group P4(3)2(1)2, with unit-cell parameters a = 60.72, c = 83.31 A. The asymmetric unit contains one protein molecule.

Purification, characterization and preliminary crystallographic studies of a cysteine protease from Pachyrrhizus erosus seeds.

PubMed

Chang, Shaojie; Song, Xiaomin; Yan, Ming; Zhou, Zhaocai; Wu, Fang; Gong, Weimin

2004-01-01

The proteins Spe31 and Spe32, named after their respective molecular weights of about 31 and 32 kDa, were purified simultaneously from the seeds of Pachyrrhizus erosus. They cannot be separated from each other by column chromatography. N-terminal sequence analysis indicated that they belonged to the papain family of cysteine proteases. An in-gel activity assay revealed that Spe31 possesses proteolytic activity while Spe32 only displays very weak activity for protein degradation. Both of them are glycoproteins as detected by the periodic acid and Schiff's reagent method. Crystals were obtained from the protein mixture by the hanging-drop vapour-diffusion method; they diffracted to a resolution of 2.61 A on an in-house X-ray source. The crystals belong to space group P4(1(3))2(1)2, with unit-cell parameters a = b = 61.96, c = 145.61 A. Gel electrophoresis under non-denaturing conditions showed that the protein crystallized was Spe31.

Expression, purification, crystallization and preliminary X-ray studies of Lactobacillus jensenii enolase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harris, Paul T.; Raghunathan, Kannan; Spurbeck, Rachel R.

2010-09-02

Recombinant Lactobacillus jensenii enolase fused to a C-terminal noncleavable His tag was expressed in Escherichia coli, purified and crystallized by sitting-drop vapor diffusion. A complete data set was collected to 3.25 {angstrom} resolution. The crystals belonged to space group I4, with unit-cell parameters a = b = 145.31, c = 99.79 {angstrom}. There were two protein subunits in the asymmetric unit, which gave a Matthews coefficient V{sub M} of 2.8 {angstrom}{sup 3} Da{sup -1}, corresponding to 55.2% solvent content.

Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O -demethylase crystals by the microseeding method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harada, Ayaka; Sato, Yukari; Kamimura, Naofumi

2016-11-30

A tetrahydrofolate-dependentO-demethylase, LigM, fromSphingobiumsp. SYK-6 was crystallized by the hanging-drop vapour-diffusion method. However, the obtainedP3 121 orP3 221 crystals, which diffracted to 2.5–3.3 Å resolution, were hemihedrally twinned. To overcome the twinning problem, microseeding usingP3 121/P3 221 crystals as microseeds was performed with optimization of the reservoir conditions. As a result, another crystal form was obtained. The newly obtained crystal diffracted to 2.5–3.0 Å resolution and belonged to space groupP2 12 12, with unit-cell parametersa= 102.0,b= 117.3,c= 128.1 Å. TheP2 12 12 crystals diffracted to better than 2.0 Å resolution after optimizing the cryoconditions. Phasing using the single anomalous diffractionmore » method was successful at 3.0 Å resolution with a Pt-derivative crystal. This experience suggested that microseeding is an effective method to overcome the twinning problem, even when twinned crystals are utilized as microseeds.« less

Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O -demethylase crystals by the microseeding method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harada, Ayaka; Sato, Yukari; Kamimura, Naofumi

2016-11-30

A tetrahydrofolate-dependentO-demethylase, LigM, from Sphingobiumsp. SYK-6 was crystallized by the hanging-drop vapour-diffusion method. However, the obtained P3 121 orP3 221 crystals, which diffracted to 2.5–3.3 Å resolution, were hemihedrally twinned. To overcome the twinning problem, microseeding using P3 121/P3 2 21 crystals as microseeds was performed with optimization of the reservoir conditions. As a result, another crystal form was obtained. The newly obtained crystal diffracted to 2.5–3.0 Å resolution and belonged to space group P2 12 12, with unit-cell parametersa= 102.0,b= 117.3,c = 128.1 Å. The P2 12 12 crystals diffracted to better than 2.0 Å resolution after optimizing themore » cryoconditions. Phasing using the single anomalous diffraction method was successful at 3.0 Å resolution with a Pt-derivative crystal. This experience suggested that microseeding is an effective method to overcome the twinning problem, even when twinned crystals are utilized as microseeds.« less

Crystallization and preliminary X-ray diffraction studies of the ferredoxin reductase component in the Rieske nonhaem iron oxygenase system carbazole 1,9a-dioxygenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ashikawa, Yuji; Uchimura, Hiromasa; Fujimoto, Zui

2007-06-01

The NAD(P)H:ferredoxin oxidoreductase in carbazole 1,9a-dioxygenase from Janthinobacterium sp. J3 was crystallized and diffraction data were collected to 2.60 Å resolution. Carbazole 1,9a-dioxygenase (CARDO), which consists of an oxygenase component (CARDO-O) and the electron-transport components ferredoxin (CARDO-F) and ferredoxin reductase (CARDO-R), catalyzes dihydroxylation at the C1 and C9a positions of carbazole. CARDO-R was crystallized at 277 K using the hanging-drop vapour-diffusion method with the precipitant PEG 8000. Two crystal types (types I and II) were obtained. The type I crystal diffracted to a maximum resolution of 2.80 Å and belonged to space group P4{sub 2}2{sub 1}2, with unit-cell parameters amore » = b = 158.7, c = 81.4 Å. The type II crystal was obtained in drops from which type I crystals had been removed; it diffracted to 2.60 Å resolution and belonged to the same space group, with unit-cell parameters a = b = 161.8, c = 79.5 Å.« less

Real-time fluorescence quenching-based detection of nitro-containing explosive vapours: what are the key processes?

PubMed

Shaw, P E; Burn, P L

2017-11-15

The detection of explosives continues to be a pressing global challenge with many potential technologies being pursued by the scientific research community. Luminescence-based detection of explosive vapours with an organic semiconductor has attracted much interest because of its potential for detectors that have high sensitivity, compact form factor, simple operation and low-cost. Despite the abundance of literature on novel sensor materials systems there are relatively few mechanistic studies targeted towards vapour-based sensing. In this Perspective, we will review the progress that has been made in understanding the processes that control the real-time luminescence quenching of thin films by analyte vapours. These are the non-radiative quenching process by which the sensor exciton decays, the analyte-sensor intermolecular binding interaction, and the diffusion process for the analyte vapours in the film. We comment on the contributions of each of these processes towards the sensing response and, in particular, the relative roles of analyte diffusion and exciton diffusion. While the latter has been historically judged to be one of, if not the primary, causes for the high sensitivity of many conjugated polymers to nitrated vapours, recent evidence suggests that long exciton diffusion lengths are unnecessary. The implications of these results on the development of sensor materials for real-time detection are discussed.

Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria.

PubMed

Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G

1987-11-01

Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.

Heterologous expression, purification, crystallization and preliminary X-ray analysis of raucaffricine glucosidase, a plant enzyme specifically involved in Rauvolfia alkaloid biosynthesis.

PubMed

Ruppert, Martin; Panjikar, Santosh; Barleben, Leif; Stöckigt, Joachim

2006-03-01

Raucaffricine glucosidase (RG) is an enzyme that is specifically involved in the biosynthesis of indole alkaloids from the plant Rauvolfia serpentina. After heterologous expression in Escherichia coli cells, crystals of RG were obtained by the hanging-drop vapour-diffusion technique at 293 K with 0.3 M ammonium sulfate, 0.1 M sodium acetate pH 4.6 buffer and 11% PEG 4000 as precipitant. Crystals belong to space group I222 and diffract to 2.30 A, with unit-cell parameters a = 102.8, b = 127.3, c = 215.8 A.

Structure of fructose bisphosphate aldolase from Encephalitozoon cuniculi

PubMed Central

Gardberg, Anna; Sankaran, Banumathi; Davies, Doug; Bhandari, Janhavi; Staker, Bart; Stewart, Lance

2011-01-01

Fructose bisphosphate aldolose (FBPA) enzymes have been found in a broad range of eukaryotic and prokaryotic organisms. FBPA catalyses the cleavage of fructose 1,6-bisphosphate into glyceraldehyde 3-phosphate and dihydroxy­acetone phosphate. The SSGCID has reported several FBPA structures from pathogenic sources. Bioinformatic analysis of the genome of the eukaryotic microsporidian parasite Encephalitozoon cuniculi revealed an FBPA homolog. The structures of this enzyme in the presence of the native substrate FBP and also with the partial substrate analog phosphate are reported. The purified enzyme crystallized in 90 mM Bis-Tris propane pH 6.5, 18% PEG 3350, 18 mM NaKHPO4, 10 mM urea for the phosphate-bound form and 100 mM Bis-Tris propane pH 6.5, 20% PEG 3350, 20 mM fructose 1,6-­bisphosphate for the FBP-bound form. In both cases protein was present at 25 mg ml−1 and the sitting-drop vapour-diffusion method was used. For the FBP-bound form, a data set to 2.37 Å resolution was collected from a single crystal at 100 K. The crystal belonged to the orthorhombic space group C2221, with unit-cell parameters a = 121.46, b = 135.82, c = 61.54 Å. The structure was refined to a final free R factor of 20.8%. For the phosphate-bound form, a data set was collected to 2.00 Å resolution. The space group was also C2221 and the unit-cell parameters were a = 121.96, b = 137.61, c = 62.23 Å. The structure shares the typical barrel tertiary structure reported for previous FBPA structures and exhibits the same Schiff base in the active site. The quaternary structure is dimeric. This work provides a direct experimental result for the substrate-binding conformation of the product state of E. cuniculi FBPA. PMID:21904050

Structure of fructose bisphosphate aldolase from Encephalitozoon cuniculi.

PubMed

Gardberg, Anna; Sankaran, Banumathi; Davies, Doug; Bhandari, Janhavi; Staker, Bart; Stewart, Lance

2011-09-01

Fructose bisphosphate aldolose (FBPA) enzymes have been found in a broad range of eukaryotic and prokaryotic organisms. FBPA catalyses the cleavage of fructose 1,6-bisphosphate into glyceraldehyde 3-phosphate and dihydroxyacetone phosphate. The SSGCID has reported several FBPA structures from pathogenic sources. Bioinformatic analysis of the genome of the eukaryotic microsporidian parasite Encephalitozoon cuniculi revealed an FBPA homolog. The structures of this enzyme in the presence of the native substrate FBP and also with the partial substrate analog phosphate are reported. The purified enzyme crystallized in 90 mM Bis-Tris propane pH 6.5, 18% PEG 3350, 18 mM NaKHPO(4), 10 mM urea for the phosphate-bound form and 100 mM Bis-Tris propane pH 6.5, 20% PEG 3350, 20 mM fructose 1,6-bisphosphate for the FBP-bound form. In both cases protein was present at 25 mg ml(-1) and the sitting-drop vapour-diffusion method was used. For the FBP-bound form, a data set to 2.37 Å resolution was collected from a single crystal at 100 K. The crystal belonged to the orthorhombic space group C222(1), with unit-cell parameters a=121.46, b=135.82, c=61.54 Å. The structure was refined to a final free R factor of 20.8%. For the phosphate-bound form, a data set was collected to 2.00 Å resolution. The space group was also C222(1) and the unit-cell parameters were a=121.96, b=137.61, c=62.23 Å. The structure shares the typical barrel tertiary structure reported for previous FBPA structures and exhibits the same Schiff base in the active site. The quaternary structure is dimeric. This work provides a direct experimental result for the substrate-binding conformation of the product state of E. cuniculi FBPA.

Preliminary crystallographic analysis of salicylate 1,2-dioxygenase from Pseudaminobacter salicylatoxidans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matera, I.; Ferraroni, M.; Bürger, S.

2006-06-01

Salicylate 1,2-dioxygenase, a new ring-fission dioxygenase from the naphthalenesulfonate-degrading strain P. salicylatoxidans, which oxidizes salicylate to 2-oxohepta-3,5-dienedioic acid by a novel ring-fission mechanism, has been crystallized. The crystals obtained give diffraction data to 2.9 Å resolution which could assist in the elucidation of the catalytic mechanism of this peculiar dioxygenase. Salicylate 1,2-dioxygenase, a new ring-fission dioxygenase from the naphthalenesulfonate-degrading strain Pseudaminobacter salicylatoxidans which oxidizes salicylate to 2-oxohepta-3,5-dienedioic acid by a novel ring-fission mechanism, has been crystallized. Diffraction-quality crystals of salicylate 1,2-dioxygenase were obtained using the sitting-drop vapour-diffusion method at 277 K from a solution containing 10%(w/v) ethanol, 6%(w/v) PEG 400,more » 0.1 M sodium acetate pH 4.6. Crystals belong to the primitive tetragonal space group P4{sub 3}2{sub 1}2 or P4{sub 1}2{sub 1}2, with unit-cell parameters a = 133.3, c = 191.51 Å. A complete data set at 100 K extending to a maximum resolution of 2.9 Å was collected at a wavelength of 0.8423 Å. Molecular replacement using the coordinates of known extradiol dioxygenases structures as a model has so far failed to provide a solution for salicylate 1,2-dioxygenase. Attempts are currently being made to solve the structure of the enzyme by MAD experiments using the anomalous signal of the catalytic Fe{sup II} ions. The salicylate 1,2-dioxygenase structural model will assist in the elucidation of the catalytic mechanism of this ring-fission dioxygenase from P. salicylatoxidans, which differs markedly from the known gentisate 1,2-dioxygenases or 1-hydroxy-2-naphthoate dioxygenases because of its unique ability to oxidatively cleave salicylate, gentisate and 1-hydroxy-2-naphthoate with high catalytic efficiency.« less

A variational approach to the study of capillary phenomena

NASA Technical Reports Server (NTRS)

Emmer, M.; Gonzalez, E.; Tamanini, I.

1982-01-01

The problem of determining the free surface of a liquid in a capillary tube, and of a liquid drop, sitting first on a horizontal plane and then on more general surfaces is considered. With some modifications, the method applies to the study of pendent drops and of rotating drops as well. The standard capillary problem, i.e. the determination of the free surface of a liquid in a thin tube of general cross section, which resuls from the simultaneous action of surface tension, boundary adhesion and gravity is discussed. It turns out that in this case the existence of the solution surface depends heavily on the validity of a simple geometric condition about the mean curvature of the boundary curve of the cross section of the capillary tube. Some particular examples of physical interest are also be discussed. Liquid drops sitting on or hanging from a fixed horizontal plane are discussed. The symmetry of the solutions (which can actually be proved, as consequence of a general symmetrization argument) now plays the chief role in deriving both the existence and the regularity of energy-minimizing configurations. When symmetry fails (this is the case, for example, when the contact angle between the drop and the plate is not constant, or when the supporting surface is not itself symmetric), then more sophisticated methods must be used. Extensions in this direction are outlined.

Structural analysis of bacteriophage-encoded peptidoglycan hydrolase domain KMV36C: crystallization and preliminary X-ray diffraction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Van Hecke, Kristof, E-mail: kristof.vanhecke@chem.kuleuven.be; Briers, Yves; Derua, Rita

2008-04-01

Crystallization and X-ray data collection of the C-terminus of gp36 from bacteriophage ϕKMV (KMV36C) are reported. The C-terminus of gp36 of bacteriophage ϕKMV (KMV36C) functions as a particle-associated muramidase, presumably as part of the injection needle of the ϕKMV genome during infection. Crystals of KMV36C were obtained by hanging-drop vapour diffusion and diffracted to a resolution of 1.6 Å. The crystals belong to the cubic space group P432, with unit-cell parameters a = b = c = 102.52 Å. KMV36C shows 30% sequence identity to T4 lysozyme (PDB code)

Heterologous expression, purification, crystallization and preliminary X-ray analysis of raucaffricine glucosidase, a plant enzyme specifically involved in Rauvolfia alkaloid biosynthesis

PubMed Central

Ruppert, Martin; Panjikar, Santosh; Barleben, Leif; Stöckigt, Joachim

2006-01-01

Raucaffricine glucosidase (RG) is an enzyme that is specifically involved in the biosynthesis of indole alkaloids from the plant Rauvolfia serpentina. After heterologous expression in Escherichia coli cells, crystals of RG were obtained by the hanging-drop vapour-diffusion technique at 293 K with 0.3 M ammonium sulfate, 0.1 M sodium acetate pH 4.6 buffer and 11% PEG 4000 as precipitant. Crystals belong to space group I222 and diffract to 2.30 Å, with unit-cell parameters a = 102.8, b = 127.3, c = 215.8 Å. PMID:16511316

Etiology and use of the "hanging drop" technique: a review.

PubMed

Todorov, Ludmil; VadeBoncouer, Timothy

2014-01-01

Background. The hanging drop (HD) technique presumably relies on the presence of subatmospheric epidural pressure. It is not clear whether this negative pressure is intrinsic or an artifact and how it is affected by body position. There are few data to indicate how often HD is currently being used. Methods. We identified studies that measured subatmospheric pressures and looked at the effect of the sitting position. We also looked at the technique used for cervical and thoracic epidural anesthesia in the last 10 years. Results. Intrinsic subatmospheric pressures were measured in the thoracic and cervical spine. Three trials studied the effect of body position, indicating a higher incidence of subatmospheric pressures when sitting. The results show lower epidural pressure (-10.7 mmHg) with the sitting position. 28.8% of trials of cervical and thoracic epidural anesthesia that documented the technique used, utilized the HD technique. When adjusting for possible bias, the rate of HD use can be as low as 11.7%. Conclusions. Intrinsic negative pressure might be present in the cervical and thoracic epidural space. This effect is more pronounced when sitting. This position might be preferable when using HD. Future studies are needed to compare it with the loss of resistance technique.

Purification, crystallization and preliminary X-ray diffraction analysis of a novel keto-deoxy-d-galactarate (KDG) dehydratase from Agrobacterium tumefaciens

PubMed Central

Taberman, Helena; Andberg, Martina; Parkkinen, Tarja; Richard, Peter; Hakulinen, Nina; Koivula, Anu; Rouvinen, Juha

2014-01-01

d-Galacturonic acid is the main component of pectin. It could be used to produce affordable renewable fuels, chemicals and materials through biotechnical conversion. Keto-deoxy-d-galactarate (KDG) dehydratase is an enzyme in the oxidative pathway of d-galacturonic acid in Agrobacterium tumefaciens (At). It converts 3-deoxy-2-keto-l-threo-hexarate to α-ketoglutaric semialdehyde. At KDG dehydratase was crystallized by the hanging-drop vapour-diffusion method. The crystals belonged to the monoclinic space group C2, with unit-cell parameters a = 169.1, b = 117.8, c = 74.3 Å, β = 112.4° and an asymmetric unit of four monomers. X-ray diffraction data were collected to 1.9 Å resolution using synchrotron radiation. The three-dimensional structure of At KDG dehydratase will provide valuable information on the function of the enzyme and will allow it to be engineered for biorefinery-based applications. PMID:24419616

Purification, crystallization and preliminary X-ray analysis of the glucosamine-6-phosphate N-acetyltransferase from human liver

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Juan; Zhou, Yan-Feng; Li, Lan-Fen

2006-11-01

Glucosamine-6-phosphate N-acetyltransferase from human liver was expressed, purified and crystallized. Diffraction data have been collected to 2.6 Å resolution. Glucosamine-6-phosphate N-acetyltransferase from human liver, which catalyzes the transfer of an acetyl group from acetyl coenzyme A (AcCoA) to the primary amine of d-glucosamine 6-phosphate to form N-acetyl-d-glucosamine 6-phosphate, was expressed in a soluble form from Escherichia coli strain BL21 (DE3). The protein was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.6 Å resolution. The crystals belonged to space group P4{sub 1}2{sub 1}2more » or P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 50.08, c = 142.88 Å.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gao, Xiong-Zhuo; National Laboratory of Protein Engineering and Plant Genetic Engineering, College of Life Sciences, Peking University, Beijing 100871; Li, Lan-Fen

The SMU.961 protein from S. mutans was crystallized and preliminary characterization of the crystals, which diffracted to 2.9 Å resolution, shows them to belong to space group C2. The smu.961 gene encodes a putative protein of 183 residues in Streptococcus mutans, a major pathogen in human dental caries. The gene was cloned into expression vector pET28a and expressed in a substantial quantity in Escherichia coli strain BL21 (DE3) with a His tag at its N-terminus. The recombinant protein SMU.961 was purified to homogeneity in a two-step procedure consisting of Ni{sup 2+}-chelating and size-exclusion chromatography. Crystals suitable for X-ray diffraction weremore » obtained by the hanging-drop vapour-diffusion method and diffracted to 2.9 Å resolution at beamline I911-3, MAX-II-lab, Sweden. The crystal belonged to space group C2, with unit-cell parameters a = 98.62, b = 73.73, c = 184.73 Å, β = 98.82°.« less

Extracellular overproduction and preliminary crystallographic analysis of a family I.3 lipase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Angkawidjaja, Clement; You, Dong-Ju; Matsumura, Hiroyoshi

2007-03-01

A family I.3 lipase from Pseudomonas sp. MIS38 was secreted from Escherichia coli cells to the external medium, purified and crystallized and preliminary crystallographic studies were performed. A family I.3 lipase from Pseudomonas sp. MIS38 was secreted from Escherichia coli cells to the external medium, purified and crystallized and preliminary crystallographic studies were performed. The crystal was grown at 277 K by the hanging-drop vapour-diffusion method. Native X-ray diffraction data were collected to 1.7 Å resolution using synchrotron radiation at station BL38B1, SPring-8. The crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 48.79, b = 84.06,more » c = 87.04 Å. Assuming the presence of one molecule per asymmetric unit, the Matthews coefficient V{sub M} was calculated to be 2.73 Å{sup 3} Da{sup −1} and the solvent content was 55%.« less

Purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies of great cormorant (Phalacrocorax carbo) haemoglobin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jagadeesan, G.; Malathy, P.; Gunasekaran, K.

2014-10-25

The great cormorant hemoglobin has been isolated, purified and crystallized and the three dimensional structure is solved using molecular replacement technique. Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to themore » trigonal system P3{sub 1}21, with unit-cell parameters a = b = 55.64, c = 153.38 Å, β = 120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.« less

Purification, crystallization and preliminary crystallographic studies of haemoglobin from mongoose (Helogale parvula) in two different crystal forms induced by pH variation.

PubMed

Mohamed Abubakkar, M; Saraboji, K; Ponnuswamy, M N

2013-02-01

Haemoglobin (Hb) is a respiratory pigment; it is a tetrameric protein that ferries oxygen from the lungs to tissues and transports carbon dioxide on the return journey. The oxygen affinity of haemoglobin is regulated by the concentration of oxygen surrounding it and several efforts have revealed the shapes of Hb in different states and with different functions. However, study of the molecular basis of Hbs from low-oxygen-affinity species is critically needed in order to increase the understanding of the mechanism behind oxygen adaptation. The present study reports the preliminary crystallographic study of low-oxygen-affinity haemoglobin from mongoose, a burrowing mammal. Haemoglobin from mongoose was purified by anion-exchange chromatography, crystallized using the hanging-drop vapour-diffusion method and diffraction data sets were collected from monoclinic (2.3 Å resolution) and orthorhombic (2.9 Å resolution) crystal forms obtained by pH variation. The monoclinic and orthorhombic asymmetric units contained half and a whole biological molecule, respectively.

Expression, purification and preliminary X-ray analysis of the C-terminal domain of an arginine repressor protein from Mycobacterium tuberculosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, George J.; Garen, Craig R.; Cherney, Maia M.

2007-11-01

The C-terminal portion of the arginine repressor protein from M. tuberculosis H37Rv has been crystallized. The complete transcriptional factor regulates arginine biosynthesis by binding operator DNA when arginine is bound at the C-terminal domain. The gene product of an open reading frame Rv1657 from Mycobacterium tuberculosis is a putative arginine repressor protein (ArgR), a transcriptional factor that regulates the expression of arginine-biosynthetic enzymes. Rv1657 was expressed and purified and a C-terminal domain was crystallized using the hanging-drop vapour-diffusion method. Diffraction data were collected and processed to a resolution of 2.15 Å. The crystals belong to space group P1 and themore » Matthews coefficient suggests that the crystals contain six C-terminal domain molecules per unit cell. Previous structural and biochemical studies on the arginine repressor proteins from other organisms have likewise shown the presence of six molecules per unit cell.« less

Crystallization and preliminary crystallographic study of the yeast Malassezia sympodialis allergen Mala s 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vilhelmsson, Monica, E-mail: monica.vilhelmsson@medks.ki.se; Center for Infectious Medicine, Department of Medicine, Karolinska University Hospital, Huddinge, Stockholm; Hallberg, B. Martin

2006-02-01

Crystals of the M. sympodialis allergen Mala s 1 have been obtained using the hanging-drop vapour-diffusion method. A diffraction data set has been collected from native crystals to 1.35 Å resolution. The opportunistic yeast Malassezia sympodialis can act as an allergen and elicit specific IgE- and T-cell reactivity in patients with atopic eczema. The first identified major allergen from M. sympodialis, Mala s 1, is present on the cell surface of the yeast. Recombinant Mala s 1 was expressed in Escherichia coli, purified and refolded in a soluble form. Crystals of Mala s 1 were obtained in 25% PEG 8K,more » 0.2 M (NH{sub 4}){sub 2}SO{sub 4}. Crystals belong to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 44.4, b = 163.7, c = 50.6 Å, and diffract to 1.35 Å resolution.« less

Purification, crystallization and preliminary X-ray diffraction analysis of royal palm tree (Roystonea regia) peroxidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watanabe, Leandra; Nascimento, Alessandro S.; Zamorano, Laura S.

2007-09-01

The purification, crystallization, X-ray diffraction data acquisition and molecular-replacement results of royal palm tree (R. regia) peroxidase are described. Royal palm tree peroxidase (RPTP), which was isolated from Roystonea regia leaves, has an unusually high stability that makes it a promising candidate for diverse applications in industry and analytical chemistry [Caramyshev et al. (2005 ▶), Biomacromolecules, 6, 1360–1366]. Here, the purification and crystallization of this plant peroxidase and its X-ray diffraction data collection are described. RPTP crystals were obtained by the hanging-drop vapour-diffusion method and diffraction data were collected to a resolution of 2.8 Å. The crystals belong to themore » trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 116.83, c = 92.24 Å, and contain one protein molecule per asymmetric unit. The V{sub M} value and solvent content are 4.07 Å{sup 3} Da{sup −1} and 69.8%, respectively.« less

Crystallization and preliminary crystallographic analysis of hygromycin B phosphotransferase from Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Iino, Daisuke; Takakura, Yasuaki; Kuroiwa, Mika

2007-08-01

The crystallization and preliminary X-ray studies of the aminoglycoside antibiotic-modifying enzyme hygromycin B phosphotransferase from E. coli are reported. Aminoglycoside antibiotics, such as hygromycin, kanamycin, neomycin, spectinomycin and streptomycin, inhibit protein synthesis by acting on bacterial and eukaryotic ribosomes. Hygromycin B phosphotransferase (Hph; EC 2.7.1.119) converts hygromycin B to 7′′-O-phosphohygromycin using a phosphate moiety from ATP, resulting in the loss of its cell-killing activity. The Hph protein has been crystallized for the first time using a thermostable mutant and the hanging-drop vapour-diffusion method. The crystal provided diffraction data to a resolution of 2.1 Å and belongs to space group P3{submore » 2}21, with unit-cell parameters a = b = 71.0, c = 125.0 Å. Crystals of complexes of Hph with hygromycin B and AMP-PNP or ADP have also been obtained in the same crystal form as that of the apoprotein.« less

Crystallization and preliminary X-ray crystallographic analysis of BxlA, an intracellular beta-D-xylosidase from Streptomyces thermoviolaceus OPC-520.

PubMed

Morioka, Hideaki; Miki, Yasuhiro; Saito, Kei; Tomoo, Koji; Ishida, Toshimasa; Hasegawa, Tomokazu; Yamano, Akihito; Takada, Chiaki; Miyamoto, Katsushiro; Tsujibo, Hiroshi

2010-07-01

BxlA from Streptomyces thermoviolaceus OPC-520, together with the extracellular BxlE and the integral membrane proteins BxlF and BxlG, constitutes a xylanolytic system that participates in the intracellular transport of xylan-degradation products and the production of xylose. To elucidate the mechanism of the hydrolytic degradation of xylooligosaccharides to xylose at the atomic level, X-ray structural analysis of BxlA was attempted. The recombinant BxlA protein (molecular weight 82 kDa) was crystallized by the hanging-drop vapour-diffusion method at 289 K. The crystals belonged to the monoclinic space group C2, with unit-cell parameters a = 142.2, b = 129.5, c = 101.4 A, beta = 119.8 degrees , and contained two molecules per asymmetric unit (V(M) = 2.47 A(3) Da(-1)). Diffraction data were collected to a resolution to 2.50 A and provided a data set with an overall R(merge) of 8.3%.

Crystallization and preliminary X-ray crystallographic analysis of the GluR0 ligand-binding core from Nostoc punctiforme

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Jun Hyuck; Park, Soo Jeong; Rho, Seong-Hwan

2005-11-01

The GluR0 ligand-binding core from N. punctiforme was expressed, purified and crystallized in the presence of l-glutamate. A diffraction data set was collected to a resolution of 2.1 Å. GluR0 from Nostoc punctiforme (NpGluR0) is a bacterial homologue of the ionotropic glutamate receptor. The ligand-binding core of NpGluR0 was crystallized at 294 K using the hanging-drop vapour-diffusion method. The l-glutamate-complexed crystal belongs to space group C222{sub 1}, with unit-cell parameters a = 78.0, b = 145.1, c = 132.1 Å. The crystals contain three subunits in the asymmetric unit, with a V{sub M} value of 2.49 Å{sup 3} Da{sup −1}.more » The diffraction limit of the l-glutamate complex data set was 2.1 Å using synchrotron X-ray radiation at beamline BL-4A of the Pohang Accelerator Laboratory (Pohang, Korea)« less

Purification, identification and preliminary crystallographic studies of a 2S albumin seed protein from Lens culinaris

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gupta, Pankaj; Gaur, Vineet; Salunke, Dinakar M., E-mail: dinakar@nii.res.in

2008-08-01

A 2S albumin from L. culinaris was purified and crystallized and preliminary crystallographic studies were carried out. Lens culinaris (lentil) is a widely consumed high-protein-content leguminous crop. A 2S albumin protein (26.5 kDa) has been identified using NH{sub 2}-terminal sequencing from a 90% ammonium sulfate saturation fraction of total L. culinaris seed protein extract. The NH{sub 2}-terminal sequence shows very high homology to PA2, an allergy-related protein from Pisum sativum. The 2S albumin protein was purified using a combination of size-exclusion and ion-exchange chromatography. Crystals of the 2S seed albumin obtained using the hanging-drop vapour-diffusion method diffracted to 2.5 Åmore » resolution and were indexed in space group P4{sub 1} (or P4{sub 3}), with unit-cell parameters a = b = 78.6, c = 135.2 Å.« less

Cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from Thalictrum flavum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pasquo, Alessandra; Bonamore, Alessandra; Franceschini, Stefano

The cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from T. flavum, a protein which catalyzes the first committed step in the biosynthesis of benzylisoquinoline alkaloids, are reported. Norcoclaurine synthase (NCS) catalyzes the condensation of 3,4-dihydroxyphenylethylamine (dopamine) and 4-hydroxyphenylacetaldehyde (4-HPAA) as the first committed step in the biosynthesis of benzylisoquinoline alkaloids in plants. The protein was cloned, expressed and purified. Crystals were obtained at 294 K by the hanging-drop vapour-diffusion method using ammonium sulfate and sodium chloride as precipitant agents and diffract to better than 3.0 Å resolution using a synchrotron-radiation source. The crystals belong to themore » trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 86.31, c = 118.36 Å. A selenomethionine derivative was overexpressed, purified and crystallized in the same space group. A complete MAD data set was collected at 2.7 Å resolution. The model is under construction.« less

Computation of shear-induced collective-diffusivity in emulsions

NASA Astrophysics Data System (ADS)

Malipeddi, Abhilash Reddy; Sarkar, Kausik

2017-11-01

The shear-induced collective-diffusivity of drops in an emulsion is calculated through simulation. A front-tracking finite difference method is used to integrate the Navier-Stokes equations. When a cloud of drops is subjected to shear flow, after a certain time, the width of the cloud increases with the 1/3 power of time. This scaling of drop-cloud-width with time is characteristic of (sub-)diffusion that arises from irreversible two-drop interactions. The collective diffusivity is calculated from this relationship. A feature of the procedure adopted here is the modest computational requirement, wherein, a few drops ( 70) in shear for short time ( 70 strain) is found to be sufficient to get a good estimate. As far as we know, collective-diffusivity has not been calculated for drops through simulation till now. The computed values match with experimental measurements reported in the literature. The diffusivity in emulsions is calculated for a range of Capillary (Ca) and Reynolds (Re) numbers. It is found to be a unimodal function of Ca , similar to self-diffusivity. A sub-linear increase of the diffusivity with Re is seen for Re < 5 . This work has been limited to a viscosity matched case.

Alcohol vapours sensor based on thin polyaniline salt film and quartz crystal microbalance.

PubMed

Ayad, Mohamad M; Torad, Nagy L

2009-06-15

A sensor based on the quartz crystal microbalance (QCM) technique was developed for detection of a number of primary aliphatic alcohols such as ethanol, methanol, 1-propanol, and 2-propanol vapours. Detection was based on a sensitive and a thin film of polyaniline, emeraldine salt (ES), coated the QCM electrode. The frequency shifts (Delta f) of the QCM were increased due to the vapour absorption into the ES film. The values of Delta f were found to be linearly correlated with the concentrations of alcohols vapour in mg L(-1). The changes in frequency are due to the hydrophilic character of the ES and the electrostatic interaction as well as the type of the alcohol. The sensor shows a good reproducibility and reversibility. The diffusion and diffusion coefficient (D) of different alcohols vapour were determined. It was found that the sensor follows Fickian kinetics.

The frequency-dependent response of single aerosol particles to vapour phase oscillations and its application in measuring diffusion coefficients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Preston, Thomas C.; Davies, James F.; Wilson, Kevin R.

A new method for measuring diffusion in the condensed phase of single aerosol particles is proposed and demonstrated. The technique is based on the frequency-dependent response of a binary particle to oscillations in the vapour phase of one of its chemical components. Here, we discuss how this physical situation allows for what would typically be a non-linear boundary value problem to be approximately reduced to a linear boundary value problem. For the case of aqueous aerosol particles, we investigate the accuracy of the closed-form analytical solution to this linear problem through a comparison with the numerical solution of the fullmore » problem. Then, using experimentally measured whispering gallery modes to track the frequency-dependent response of aqueous particles to relative humidity oscillations, we determine diffusion coefficients as a function of water activity. The measured diffusion coefficients are compared to previously reported values found using the two common experiments: (i) the analysis of the sorption/desorption of water from a particle after a step-wise change to the surrounding relative humidity and (ii) the isotopic exchange of water between a particle and the vapour phase. The technique presented here has two main strengths: first, when compared to the sorption/desorption experiment, it does not require the numerical evaluation of a boundary value problem during the fitting process as a closed-form expression is available. Second, when compared to the isotope exchange experiment, it does not require the use of labeled molecules. Therefore, the frequency-dependent experiment retains the advantages of these two commonly used methods but does not suffer from their drawbacks.« less

The frequency-dependent response of single aerosol particles to vapour phase oscillations and its application in measuring diffusion coefficients

DOE PAGES

Preston, Thomas C.; Davies, James F.; Wilson, Kevin R.

2017-01-13

A new method for measuring diffusion in the condensed phase of single aerosol particles is proposed and demonstrated. The technique is based on the frequency-dependent response of a binary particle to oscillations in the vapour phase of one of its chemical components. Here, we discuss how this physical situation allows for what would typically be a non-linear boundary value problem to be approximately reduced to a linear boundary value problem. For the case of aqueous aerosol particles, we investigate the accuracy of the closed-form analytical solution to this linear problem through a comparison with the numerical solution of the fullmore » problem. Then, using experimentally measured whispering gallery modes to track the frequency-dependent response of aqueous particles to relative humidity oscillations, we determine diffusion coefficients as a function of water activity. The measured diffusion coefficients are compared to previously reported values found using the two common experiments: (i) the analysis of the sorption/desorption of water from a particle after a step-wise change to the surrounding relative humidity and (ii) the isotopic exchange of water between a particle and the vapour phase. The technique presented here has two main strengths: first, when compared to the sorption/desorption experiment, it does not require the numerical evaluation of a boundary value problem during the fitting process as a closed-form expression is available. Second, when compared to the isotope exchange experiment, it does not require the use of labeled molecules. Therefore, the frequency-dependent experiment retains the advantages of these two commonly used methods but does not suffer from their drawbacks.« less

Evaporation Flux Distribution of Drops on a Hydrophilic or Hydrophobic Flat Surface by Molecular Simulations.

PubMed

Xie, Chiyu; Liu, Guangzhi; Wang, Moran

2016-08-16

The evaporation flux distribution of sessile drops is investigated by molecular dynamic simulations. Three evaporating modes are classified, including the diffusion dominant mode, the substrate heating mode, and the environment heating mode. Both hydrophilic and hydrophobic drop-substrate interactions are considered. To count the evaporation flux distribution, which is position dependent, we proposed an azimuthal-angle-based division method under the assumption of spherical crown shape of drops. The modeling results show that the edge evaporation, i.e., near the contact line, is enhanced for hydrophilic drops in all the three modes. The surface diffusion of liquid molecular absorbed on solid substrate for hydrophilic cases plays an important role as well as the space diffusion on the enhanced evaporation rate at the edge. For hydrophobic drops, the edge evaporation flux is higher for the substrate heating mode, but lower than elsewhere of the drop for the diffusion dominant mode; however, a nearly uniform distribution is found for the environment heating mode. The evidence shows that the temperature distribution inside drops plays a key role in the position-dependent evaporation flux.

LCP crystallization and X-ray diffraction analysis of VcmN, a MATE transporter from Vibrio cholerae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kusakizako, Tsukasa; Tanaka, Yoshiki; Hipolito, Christopher J.

A V. cholerae MATE transporter was crystallized using the lipidic cubic phase (LCP) method. X-ray diffraction data sets were collected from single crystals obtained in a sandwich plate and a sitting-drop plate to resolutions of 2.5 and 2.2 Å, respectively. Multidrug and toxic compound extrusion (MATE) transporters, one of the multidrug exporter families, efflux xenobiotics towards the extracellular side of the membrane. Since MATE transporters expressed in bacterial pathogens contribute to multidrug resistance, they are important therapeutic targets. Here, a MATE-transporter homologue from Vibrio cholerae, VcmN, was overexpressed in Escherichia coli, purified and crystallized in lipidic cubic phase (LCP). X-raymore » diffraction data were collected to 2.5 Å resolution from a single crystal obtained in a sandwich plate. The crystal belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 52.3, b = 93.7, c = 100.2 Å. As a result of further LCP crystallization trials, crystals of larger size were obtained using sitting-drop plates. X-ray diffraction data were collected to 2.2 Å resolution from a single crystal obtained in a sitting-drop plate. The crystal belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 61.9, b = 91.8, c = 100.9 Å. The present work provides valuable insights into the atomic resolution structure determination of membrane transporters.« less

CO 2-fluxing collapses metal mobility in magmatic vapour

DOE PAGES

van Hinsberg, V. J.; Berlo, K.; Migdisov, A. A.; ...

2016-05-18

Magmatic systems host many types of ore deposits, including world-class deposits of copper and gold. Magmas are commonly an important source of metals and ore-forming fluids in these systems. In many magmatic-hydrothermal systems, low-density aqueous fluids, or vapours, are significant metal carriers. Such vapours are water-dominated shallowly, but fluxing of CO 2-rich vapour exsolved from deeper magma is now recognised as ubiquitous during open-system magma degassing. Furthermore, we show that such CO 2-fluxing leads to a sharp drop in element solubility, up to a factor of 10,000 for Cu, and thereby provides a highly efficient, but as yet unrecognised mechanismmore » for metal deposition.« less

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Cloning, purification, crystallization and preliminary structural studies of penicillin V acylase from Bacillus subtilis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rathinaswamy, Priya; Pundle, Archana V.; Prabhune, Asmita A.

An unannotated protein reported from B. subtilis has been expressed in E. coli and identified as possessing penicillin V acylase activity. The crystallization and preliminary crystallographic analysis of this penicillin V acylase is presented. Penicillin acylase proteins are amidohydrolase enzymes that cleave penicillins at the amide bond connecting the side chain to their β-lactam nucleus. An unannotated protein from Bacillus subtilis has been expressed in Escherichia coli, purified and confirmed to possess penicillin V acylase activity. The protein was crystallized using the hanging-drop vapour-diffusion method from a solution containing 4 M sodium formate in 100 mM Tris–HCl buffer pH 8.2.more » Diffraction data were collected under cryogenic conditions to a spacing of 2.5 Å. The crystals belonged to the orthorhombic space group C222{sub 1}, with unit-cell parameters a = 111.0, b = 308.0, c = 56.0 Å. The estimated Matthews coefficient was 3.23 Å{sup 3} Da{sup −1}, corresponding to 62% solvent content. The structure has been solved using molecular-replacement methods with B. sphaericus penicillin V acylase (PDB code 2pva) as the search model.« less

Transport phenomena in the crystallization of lysozyme by osmotic dewatering and liquid-liquid diffusion in low gravity

NASA Technical Reports Server (NTRS)

Todd, Paul; Sportiello, Michael G.; Gregory, Derek; Cassanto, John M.; Alvarado, Ulises A.; Ostroff, Robert; Korszun, Z. R.

1993-01-01

Two methods of protein crystallization, osmotic dewatering and liquid-liquid diffusion, like the vapor diffusion (hanging-drop and sessile-drop) methods allow a gradual approach to supersaturation conditions. The crystallization of hen egg-white lysozyme, an extensively characterized protein crystal, in the presence of sodium chloride was used as an experimental model with which to compare these two methods in low gravity and in the laboratory. Comparisons of crystal growth rates by the two methods under the two conditions have, to date, indicated that the rate of crystal growth by osmotic dewatering is nearly the same in low gravity and on the ground, while much faster crystal growth rates can be achieved by the liquid-liquid diffusion method in low gravity.

Purification, crystallization and preliminary crystallographic studies of haemoglobin from mongoose (Helogale parvula) in two different crystal forms induced by pH variation

PubMed Central

Mohamed Abubakkar, M.; Saraboji, K.; Ponnuswamy, M. N.

2013-01-01

Haemoglobin (Hb) is a respiratory pigment; it is a tetrameric protein that ferries oxygen from the lungs to tissues and transports carbon dioxide on the return journey. The oxygen affinity of haemoglobin is regulated by the concentration of oxygen surrounding it and several efforts have revealed the shapes of Hb in different states and with different functions. However, study of the molecular basis of Hbs from low-oxygen-affinity species is critically needed in order to increase the understanding of the mechanism behind oxygen adaptation. The present study reports the preliminary crystallographic study of low-oxygen-affinity haemoglobin from mongoose, a burrowing mammal. Haemoglobin from mongoose was purified by anion-exchange chromatography, crystallized using the hanging-drop vapour-diffusion method and diffraction data sets were collected from monoclinic (2.3 Å resolution) and orthorhombic (2.9 Å resolution) crystal forms obtained by pH variation. The monoclinic and orthorhombic asymmetric units contained half and a whole biological molecule, respectively. PMID:23385751

Crystallization and preliminary X-ray diffraction analysis of mouse 3(17)α-hydroxysteroid dehydrogenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

El-Kabbani, Ossama, E-mail: ossama.el-kabbani@vcp.monash.edu.au; Ishikura, Syuhei; Wagner, Armin

2005-07-01

Orthorhombic crystals of mouse 3(17)α-hydroxysteroid dehydrogenase were obtained from buffered polyethylene glycol solutions. The crystals diffracted to a resolution of 1.8 Å at the Swiss Light Source beamline X06SA. The 3(17)α-hydroxysteroid dehydrogenase from mouse is involved in the metabolism of oestrogens, androgens, neurosteroids and xenobiotic compounds. The enzyme was crystallized by the hanging-drop vapour-diffusion method in space group P222{sub 1}, with unit-cell parameters a = 84.91, b = 84.90, c = 95.83 Å. The Matthews coefficient (V{sub M}) and the solvent content were 2.21 Å{sup 3} Da{sup −1} and 44.6%, respectively, assuming the presence of two molecules in the asymmetricmore » unit. Diffraction data were collected to a resolution of 1.8 Å at the Swiss Light Source beamline X06SA using a MAR CCD area detector and gave a data set with an overall R{sub merge} of 6.8% and a completeness of 91.1%.« less

Purification, crystallization and preliminary X-ray analysis of native and selenomethionine class I tagatose-1,6-bisphosphate aldolase from Streptococcus pyogenes.

PubMed

Liotard, Brigitte; Sygusch, Jurgen

2004-03-01

Tagatose-1,6-bisphosphate aldolase (EC 4.1.2.40) is situated at the branching of the tagatose-6-phosphate and Embden-Meyerhof-Parnas (glycolysis) metabolic pathways, where it catalyzes the reversible cleavage of tagatose-1,6-bisphosphate to dihydroxyacetone phosphate and glyceraldehyde 3-phosphate. The recombinant protein from Streptococcus pyogenes was overexpressed in Escherichia coli in its native and selenomethionine-derivative forms and purified using ion-exchange and hydrophobic interaction chromatography. Orthorhombic crystals suitable for structural analysis were obtained by the hanging-drop vapour-diffusion method for both isoforms. The crystals belong to space group P2(1)2(1)2(1), with unit-cell parameters a = 63.7, b = 108.1, c = 238.7 A for the native form and a = 64.1, b = 108.3, c = 239.8 A for the selenomethionine derivative. The asymmetric unit contains four protomers, corresponding to a crystal volume per protein weight (V(M)) of 2.8 A(3) Da(-1) and a solvent content of 56% by volume.

Purification, partial characterization, crystallization and preliminary X-ray diffraction of a novel cardiotoxin-like basic protein from Naja naja atra (South Anhui) venom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rong, Hui; Li, Yan; Lou, Xiao-hua

2007-02-01

A novel cardiotoxin-like basic protein from Naja naja atra was crystallized and diffraction data were collected to 2.35 Å resolution. A novel cardiotoxin-like basic protein was isolated from the venom of the Chinese cobra (Naja naja atra) from the south of Anhui in China. The protein inhibits the expression of vascular endothelial growth factor and basic fibroblast growth factor in human lung cancer cell line H1299 and induces the haemolysis of rabbit erythrocytes under low-lecithin conditions. After a two-step chromatographic purification, the resultant 7 kDa protein was crystallized by the hanging-drop vapour-diffusion method at room temperature. A complete data setmore » was collected to 2.35 Å resolution using an in-house X-ray diffraction system. The crystal belongs to space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = b = 43.2, c = 147.9 Å. There are two molecules in the crystallographic asymmetric unit.« less

Crystallization and preliminary X-ray crystallographic analysis of a carbonyl reductase from Candida parapsilosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Rongzhen; Xu, Yan, E-mail: biosean@yahoo.com.cn; Sun, Ying

2008-04-01

A novel short-chain NADPH-dependent (S)-1-phenyl-1,2-ethanediol dehydrogenase (SCR) has been crystallized. A novel short-chain NADPH-dependent (S)-1-phenyl-1,2-ethanediol dehydrogenase (SCR) has been crystallized. Two distinct but related crystal forms of SCR were obtained using the hanging-drop vapour-diffusion method and a reservoir solution consisting of 18%(w/v) polyethylene glycol 2000 monomethyl ether and 8%(v/v) 2-propanol as the precipitant. The crystals were rhomboid in shape with average dimensions of 0.3 × 0.3 × 0.4 mm and diffracted to a resolution of 2.7–3.0 Å. The crystal forms both belong to space group P2{sub 1}2{sub 1}2{sub 1} and have unit-cell parameters a = 104.7, b = 142.8, cmore » = 151.8 Å and a = 101.1, b = 146.0, c = 159.8 Å. The calculated values of V{sub M}, rotation-function and translation-function solutions and consideration of potential crystal packing suggest that there are eight protein subunits per asymmetric unit.« less

Purification, crystallization and preliminary X-ray crystallographic analysis of a cysteine-rich secretory protein (CRISP) from Naja atra venom.

PubMed

Wang, Yu-Ling; Goh, King-Xiang; Wu, Wen-guey; Chen, Chun-Jung

2004-10-01

Cysteine-rich secretory proteins (CRISPs) play an important role in the innate immune system and are transcriptionally regulated by androgens in several tissues. The proteins are mostly found in the epididymis and granules of mammals, whilst a number of snake venoms also contain CRISP-family proteins. The natrin protein from the venom of Naja atra (Taiwan cobra), which belongs to a family of CRISPs and has a cysteine-rich C-terminal amino-acid sequence, has been purified using a three-stage chromatography procedure and crystals suitable for X-ray analysis have been obtained using the hanging-drop vapour-diffusion method. X-ray diffraction data were collected to 1.58 A resolution using synchrotron radiation; the crystals belong to space group C222(1), with unit-cell parameters a = 59.172, b = 65.038, c = 243.156 A. There are two protein molecules in the asymmetric unit and the Matthews coefficient is estimated to be 2.35 A3 Da(-1), corresponding to a solvent content of 47.60%.

Crystallization and preliminary X-ray analysis of pyruvate kinase from Bacillus stearothermophilus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Suzuki, Kenichiro; Ito, Sohei; Shimizu-Ibuka, Akiko

2005-08-01

This report describes the crystallization and X-ray diffraction data collection of three types (wild-type, W416F/V435W and C9S/C268S) of B. stearothermophilus. Crystals of C9S/C268S belonged to space group P6{sub 2}22 and diffracted to a resolution of 2.4 Å. Pyruvate kinase (PK) from a moderate thermophile, Bacillus stearothermophilus (BstPK), is an allosteric enzyme activated by AMP and ribose 5-phosphate but not by fructose 1,6-bisphosphate (FBP). However, almost all other PKs are activated by FBP. The wild-type and W416F/V435W mutant BstPKs were crystallized by the hanging-drop vapour-diffusion method. However, they were unsuitable for structural analysis because their data sets exhibited low completeness. Amore » crystal suitable for structural analysis was obtained using C9S/C268S enzyme. The crystal belonged to space group P6{sub 2}22, with unit-cell parameters a = b = 145.97, c = 118.03 Å.« less

Expression, purification and preliminary X-ray characterization of dl-2-haloacid dehalogenase from Methylobacterium sp. CPA1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Omi, Rie; Department of Chemistry, Graduate School of Science, Osaka City University, Sumiyoshi-ku, Osaka 558-8585; Jitsumori, Keiji

A recombinant form of dl-2-haloacid dehalogenase from Methylobacterium sp. CPA1 has been expressed in E. coli, purified and crystallized. The crystal belongs to space group P6{sub 3}. Diffraction data have been collected to 1.75 Å resolution. dl-2-Haloacid dehalogenase from Methylobacterium sp. CPA1 (dl-DEX Mb) is a unique enzyme that catalyzes the dehalogenation reaction without the formation of an ester intermediate. A recombinant form of dl-DEX Mb has been expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. The crystal belongs to the hexagonal space group P6{sub 3}, with unit-cell parameters a = b = 186.2, c =more » 114.4 Å. The crystals are likely to contain between four and eight monomers in the asymmetric unit, with a V{sub M} value of 4.20–2.10 Å{sup 3} Da{sup −1}. A self-rotation function revealed peaks on the χ = 180° section. X-ray data have been collected to 1.75 Å resolution.« less

Crystallization and preliminary X-ray analysis of a protease inhibitor from the latex of Carica papaya

DOE Office of Scientific and Technical Information (OSTI.GOV)

Azarkan, Mohamed; Garcia-Pino, Abel; Dibiani, Rachid

2006-12-01

The Kunitz-type trypsin/chymotrypsin inhibitor isolated from C. papaya latex has been crystallized using the hanging-drop vapour-diffusion method. Two different crystal forms are observed, diffracting to 2.6 and 1.7 Å. A Kunitz-type protease inhibitor purified from the latex of green papaya (Carica papaya) fruits was crystallized in the presence and absence of divalent metal ions. Crystal form I, which is devoid of divalent cations, diffracts to a resolution of 2.6 Å and belongs to space group P3{sub 1} or P3{sub 2}. This crystal form is a merohedral twin with two molecules in the asymmetric unit and unit-cell parameters a = bmore » = 74.70, c = 78.97 Å. Crystal form II, which was grown in the presence of Co{sup 2+}, diffracts to a resolution of 1.7 Å and belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 44.26, b = 81.99, c = 140.89 Å.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Che-Yen; Karolinska Institute Structural Virology, F68 Karolinska University Hospital, SE-14186 Stockholm; Institute of Public Health, National Yang-Ming University, 112 Taipei,Taiwan

A recombinant virus-like particle that is a potential oral hepatitis E vaccine was crystallized. Diffraction data were collected to 8.3 Å resolution and the X-ray structure was phased with the aid of a low-resolution density map determined using cryo-electron microscopy data. Hepatitis E virus (HEV) accounts for the majority of enterically transmitted hepatitis infections worldwide. Currently, there is no specific treatment for or vaccine against HEV. The major structural protein is derived from open reading frame (ORF) 2 of the viral genome. A potential oral vaccine is provided by the virus-like particles formed by a protein construct of partial ORF3more » protein (residue 70–123) fused to the N-terminus of the ORF2 protein (residues 112–608). Single crystals obtained by the hanging-drop vapour-diffusion method at 293 K diffract X-rays to 8.3 Å resolution. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 337, b = 343, c = 346 Å, α = β = γ = 90°, and contain one particle per asymmetric unit.« less

Crystallization and preliminary X-ray diffraction analyses of the redox-controlled complex of terminal oxygenase and ferredoxin components in the Rieske nonhaem iron oxygenase carbazole 1,9a-dioxygenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matsuzawa, Jun; Aikawa, Hiroki; Umeda, Takashi

2014-09-25

A crystal was obtained of the complex between reduced terminal oxygenase and oxidized ferredoxin components of carbazole 1,9a-dioxygenase. The crystal belonged to space group P2{sub 1} and diffracted to 2.25 Å resolution. The initial reaction in bacterial carbazole degradation is catalyzed by carbazole 1,9a-dioxygenase, which consists of terminal oxygenase (Oxy), ferredoxin (Fd) and ferredoxin reductase components. The electron-transfer complex between reduced Oxy and oxidized Fd was crystallized at 293 K using the hanging-drop vapour-diffusion method with PEG 3350 as the precipitant under anaerobic conditions. The crystal diffracted to a maximum resolution of 2.25 Å and belonged to space group P2{submore » 1}, with unit-cell parameters a = 97.3, b = 81.6, c = 116.2 Å, α = γ = 90, β = 100.1°. The V{sub M} value is 2.85 Å{sup 3} Da{sup −1}, indicating a solvent content of 56.8%.« less

Predictive model to describe water migration in cellular solid foods during storage.

PubMed

Voogt, Juliën A; Hirte, Anita; Meinders, Marcel B J

2011-11-01

Water migration in cellular solid foods during storage causes loss of crispness. To improve crispness retention, physical understanding of this process is needed. Mathematical models are suitable tools to gain this physical knowledge. Water migration in cellular solid foods involves migration through both the air cells and the solid matrix. For systems in which the water migration distance is large compared with the cell wall thickness of the solid matrix, the overall water flux through the system is dominated by the flux through the air. For these systems, water migration can be approximated well by a Fickian diffusion model. The effective diffusion coefficient can be expressed in terms of the material properties of the solid matrix (i.e. the density, sorption isotherm and diffusion coefficient of water in the solid matrix) and the morphological properties of the cellular structure (i.e. water vapour permeability and volume fraction of the solid matrix). The water vapour permeability is estimated from finite element method modelling using a simplified model for the cellular structure. It is shown that experimentally observed dynamical water profiles of bread rolls that differ in crust permeability are predicted well by the Fickian diffusion model. Copyright © 2011 Society of Chemical Industry.

Measurement of the densities of Cu and Ag vapours in a low-voltage switch using the hook method

NASA Astrophysics Data System (ADS)

Lins, Günter

2012-05-01

In a research model of a low-voltage circuit breaker with fixed contacts and windows for optical access, arcs powered by either a high-current transformer or a capacitor bank were initiated by the explosion of tungsten wires. Air at atmospheric pressure was the switching medium. The number densities of neutral silver and copper vapours from contacts and arc runners were measured simultaneously by the hook method using a Mach-Zehnder interferometer combined with a 1 m spectrograph and a gated intensified CCD camera. When an arc current was flowing, a substantial fraction of the metal vapour was ionized, and thus not amenable to a density measurement with the technique chosen. To nevertheless obtain approximate density values, the arc current was forced to zero within 8 to 10 µs at a preset time and measurements were carried out 100 µs after extinction of the arc. At that time the metal vapour was expected to have recombined to a large extent but not yet diffused to the walls in significant amounts. Depending on the current amplitude reached within the arc duration the arc remained anchored to the silver contacts or commutated to the copper arc runners. At a maximum current amplitude of 650 A Ag vapour densities of the order of 1022 m-3 were observed near the anode outweighing the Cu vapour density by a factor of 20. When at 1600 A the arc commutated to the arc runners a Cu vapour density of 8 × 1021 m-3 was reached while the Ag density remained limited to 2 × 1021 m-3.

Promoting protein crystallization using a plate with simple geometry.

PubMed

Chen, Rui-Qing; Yin, Da-Chuan; Liu, Yong-Ming; Lu, Qin-Qin; He, Jin; Liu, Yue

2014-03-01

Increasing the probability of obtaining protein crystals in crystallization screening is always an important goal for protein crystallography. In this paper, a new method called the cross-diffusion microbatch (CDM) method is presented, which aims to efficiently promote protein crystallization and increase the chance of obtaining protein crystals. In this method, a very simple crystallization plate was designed in which all crystallization droplets are in one sealed space, so that a variety of volatile components from one droplet can diffuse into any other droplet via vapour diffusion. Crystallization screening and reproducibility tests indicate that this method could be a potentially powerful technique in practical protein crystallization screening. It can help to obtain crystals with higher probability and at a lower cost, while using a simple and easy procedure.

Spectroscopic measurements of plasma plume induced during the laser deposition of the hydroxyapatite

NASA Astrophysics Data System (ADS)

Jedyński, M.; Szymański, Z.; Mróz, W.; Prokopiuk, A.; Jelinek, M.; Kocourek, T.

2004-03-01

Plasma plume induced by ArF exeimer laser ablation of a Ca10(PO4)6(OH)2 hydroxyapatite target during deposition process has been studied in different ambient conditions, i.e. in air or water vapour. ArF laser operated at the wavelength of 193 nm with the pulse energy of 300 mJ and 20 ns pulse duration. Spectroscopic measurements of the emission spectra of plasma plume have been made with the use of a fast gate, lens coupled micro-channel plate (MCP) image intensifier placed between a spectrograph and a 1254 silicon intensified target (SIT) detector connected to an optical multichannel analyser. The electron densities of 1022 ÷ 1023m-3 have been determined from the Stark broadening of Ca I lines as a function of the distance from the target. The expansion of the plasma plume has been studied using the time of flight method. The time-dependent radiation of the 422.673 nm Ca I and 393.366 nm Ca II lines has been, registered with the use of a monochromator and photomultiplier at various distances from the target. Velocities between 104 ÷ 103 m/s have been found. The velocity in air is several times higher than in the case with water vapour. The plasma plume dynamics is also different in both cases. In the presence of water vapour the spliting of the plasma plume appears.

Method and apparatus for determining minority carrier diffusion length in semiconductors

DOEpatents

Moore, Arnold R.

1984-01-01

Method and apparatus are provided for determining the diffusion length of minority carriers in semiconductor material, particularly amorphous silicon which has a significantly small minority carrier diffusion length using the constant magnitude surface-photovoltage (SPV) method. Steady or modulated illumination at several wavelengths provides the light excitation on the surface of the material to generate the SPV. A manually controlled or automatic servo system maintains a constant predetermined value of the SPV for each wavelength. A drop of a transparent electrolyte solution containing redox couples (preferably quinhydrone) having an oxidation-reduction potential (E) in the order of +0.6 to -1.65 volts couples the SPV to a measurement system. The drop of redox couple solution functions to create a liquid Schottky barrier at the surface of the material. Illumination light is passed through a transparent rod supported over the surface and through the drop of transparent electrolyte. The drop is held in the gap between the rod and the surface. Steady red light is also used as an optical bias to reduce deleterious space-charge effects that occur in amorphous silicon.

Batch crystallization of rhodopsin for structural dynamics using an X-ray free-electron laser

DOE PAGES

Wu, Wenting; Nogly, Przemyslaw; Rheinberger, Jan; ...

2015-06-27

Rhodopsin is a membrane protein from the G protein-coupled receptor family. Together with its ligand retinal, it forms the visual pigment responsible for night vision. In order to perform ultrafast dynamics studies, a time-resolved serial femtosecond crystallography method is required owing to the nonreversible activation of rhodopsin. In such an approach, microcrystals in suspension are delivered into the X-ray pulses of an X-ray free-electron laser (XFEL) after a precise photoactivation delay. Here in this study, a millilitre batch production of high-density microcrystals was developed by four methodical conversion steps starting from known vapour-diffusion crystallization protocols: (i) screening the low-salt crystallizationmore » conditions preferred for serial crystallography by vapour diffusion, (ii) optimization of batch crystallization, (iii) testing the crystal size and quality using second-harmonic generation (SHG) imaging and X-ray powder diffraction and (iv) production of millilitres of rhodopsin crystal suspension in batches for serial crystallography tests; these crystals diffracted at an XFEL at the Linac Coherent Light Source using a liquid-jet setup.« less

Unambiguous detection of nitrated explosive vapours by fluorescence quenching of dendrimer films

NASA Astrophysics Data System (ADS)

Geng, Yan; Ali, Mohammad A.; Clulow, Andrew J.; Fan, Shengqiang; Burn, Paul L.; Gentle, Ian R.; Meredith, Paul; Shaw, Paul E.

2015-09-01

Unambiguous and selective standoff (non-contact) infield detection of nitro-containing explosives and taggants is an important goal but difficult to achieve with standard analytical techniques. Oxidative fluorescence quenching is emerging as a high sensitivity method for detecting such materials but is prone to false positives--everyday items such as perfumes elicit similar responses. Here we report thin films of light-emitting dendrimers that detect vapours of explosives and taggants selectively--fluorescence quenching is not observed for a range of common interferents. Using a combination of neutron reflectometry, quartz crystal microbalance and photophysical measurements we show that the origin of the selectivity is primarily electronic and not the diffusion kinetics of the analyte or its distribution in the film. The results are a major advance in the development of sensing materials for the standoff detection of nitro-based explosive vapours, and deliver significant insights into the physical processes that govern the sensing efficacy.

Unambiguous detection of nitrated explosive vapours by fluorescence quenching of dendrimer films.

PubMed

Geng, Yan; Ali, Mohammad A; Clulow, Andrew J; Fan, Shengqiang; Burn, Paul L; Gentle, Ian R; Meredith, Paul; Shaw, Paul E

2015-09-15

Unambiguous and selective standoff (non-contact) infield detection of nitro-containing explosives and taggants is an important goal but difficult to achieve with standard analytical techniques. Oxidative fluorescence quenching is emerging as a high sensitivity method for detecting such materials but is prone to false positives—everyday items such as perfumes elicit similar responses. Here we report thin films of light-emitting dendrimers that detect vapours of explosives and taggants selectively—fluorescence quenching is not observed for a range of common interferents. Using a combination of neutron reflectometry, quartz crystal microbalance and photophysical measurements we show that the origin of the selectivity is primarily electronic and not the diffusion kinetics of the analyte or its distribution in the film. The results are a major advance in the development of sensing materials for the standoff detection of nitro-based explosive vapours, and deliver significant insights into the physical processes that govern the sensing efficacy.

Unambiguous detection of nitrated explosive vapours by fluorescence quenching of dendrimer films

PubMed Central

Geng, Yan; Ali, Mohammad A.; Clulow, Andrew J.; Fan, Shengqiang; Burn, Paul L.; Gentle, Ian R.; Meredith, Paul; Shaw, Paul E.

2015-01-01

Unambiguous and selective standoff (non-contact) infield detection of nitro-containing explosives and taggants is an important goal but difficult to achieve with standard analytical techniques. Oxidative fluorescence quenching is emerging as a high sensitivity method for detecting such materials but is prone to false positives—everyday items such as perfumes elicit similar responses. Here we report thin films of light-emitting dendrimers that detect vapours of explosives and taggants selectively—fluorescence quenching is not observed for a range of common interferents. Using a combination of neutron reflectometry, quartz crystal microbalance and photophysical measurements we show that the origin of the selectivity is primarily electronic and not the diffusion kinetics of the analyte or its distribution in the film. The results are a major advance in the development of sensing materials for the standoff detection of nitro-based explosive vapours, and deliver significant insights into the physical processes that govern the sensing efficacy. PMID:26370931

Expression, purification, crystallization and preliminary X-ray studies of Vibrio cholerae pseudopilin EpsH

DOE Office of Scientific and Technical Information (OSTI.GOV)

Raghunathan, Kannan; Vago, Frank S.; Ball, Terry

2010-01-12

EpsH is a minor pseudopilin protein of the Vibrio cholerae type II secretion system. A truncated form of EpsH with a C-terminal noncleavable His tag was constructed and expressed in Escherichia coli, purified and crystallized by sitting-drop vapor diffusion. A complete data set was collected to 1.71 {angstrom} resolution. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 53.39, b = 71.11, c = 84.64 {angstrom}. There were two protein molecules in the asymmetric unit, which gave a Matthews coefficient V{sub M} of 2.1 {angstrom}{sup 3} Da{sup -1}, corresponding to 41.5% solvent content.

Crystallization and preliminary crystallographic analysis of porcine acylaminoacyl peptidase.

PubMed

Wright, Helena; Kiss, András L; Szeltner, Zoltán; Polgár, László; Fülöp, Vilmos

2005-10-01

Acylaminoacyl peptidase (also known as acylamino-acid-releasing enzyme or acylpeptide hydrolase; EC 3.4.19.1) is an unusual member of the prolyl oligopeptidase family catalysing the hydrolysis of an N-acylated peptide to an acylamino acid and a peptide with a free N-terminus. Acylaminoacyl peptidase purified from porcine liver has been crystallized in mother liquor containing 0.1 M Tris-HCl pH 7.0, 10%(w/v) polyethylene glycol 8000, 50 mM MgCl2 and 1%(w/v) CHAPS using the hanging-drop vapour-diffusion technique. A full data set to 3.4 A resolution was collected at ESRF beamline ID14-4 and space group C222 was assigned, with unit-cell parameters a = 84.8, b = 421.1, c = 212.0 A and four molecules in the asymmetric unit.

9. BUILDING NO. 620B, FRICTION PENDULUM BUILDING. 29FOOT DROP TOWER ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

9. BUILDING NO. 620-B, FRICTION PENDULUM BUILDING. 29-FOOT DROP TOWER SITS BEHIND BLAST SHIELD IN FRONT OF BUILDING. - Picatinny Arsenal, 600 Area, Test Areas District, State Route 15 near I-80, Dover, Morris County, NJ

The use of inverse gas chromatography and gravimetric vapour sorption to study transitions in amorphous lactose.

PubMed

Ambarkhane, Ameet V; Pincott, Kim; Buckton, Graham

2005-04-27

The aim of this study was to measure the glass transition of amorphous lactose under well-controlled temperature and humidity, using inverse gas chromatography (IGC) and to relate these data to gravimetric vapour sorption experiments. Amorphous lactose (spray-dried) was exposed to a stepwise increment in the relative humidity (%RH) under isothermal conditions in an IGC. At the end of each conditioning step a decane injection was made, and the retention volumes were calculated using the maximum peak height (V(max)) method. The pressure drop across the column was recorded using the pressure transducers. These measurements were performed at various temperatures from 25 to 40 degrees C. The extent of water sorption at identical humidity (%RH) and temperature conditions was determined gravimetrically using dynamic vapour sorption (DVS). At each T, it was possible to determine: (1) a transition at low RH relating to the onset of mobility; (2) changes in retention volume relating to the point, where T(g) = T; (3) changes in pressure drop, which were related to the sample collapse. The rate and extent of water sorption was seen to alter at T(g) and also at a collapse point. Combinations of temperature and critical %RH (%cRH required to lower the dry glass transition temperature to the experimental temperature) obtained from IGC were comparable to those obtained from DVS. It was shown that at each T, the sample spontaneously crystallised, when T(g) was 32 degrees C below T. Inverse gas chromatograph can be used in this novel way to reveal the series of transitions that occur in amorphous materials.

Vaporization of a solid surface in an ambient gas

NASA Astrophysics Data System (ADS)

Benilov, M. S.; Jacobsson, S.; Kaddani, A.; Zahrai, S.

2001-07-01

The net flux of vapour from a solid surface in an ambient gas is analysed with the aim to estimate the effect of vaporization cooling on the energy balance of an arc cathode under conditions typical for a high-power current breaker. If the ratio of the equilibrium vapour pressure pv to the ambient pressure p∞ is smaller than unity, the removal of vapour from the surface is due to diffusion into the bulk of the gas. As a consequence, the net flux of the vapour from the surface is much smaller than the emitted flux. An estimate of the diffusion rate under conditions typical for a high-power current breaker indicates that vaporization cooling plays a minor role in the energy balance of the cathode in this case. If ratio pv/p∞ is above unity, the flow of the vapour from the surface appears and the net flux is comparable to the emitted flux. A simple analytical solution has been obtained for this case, which is in a good agreement with results of the Monte Carlo modelling of preceding authors. If pv/p∞ exceeds approximately 4.5, vaporization occurs as into vacuum and the net flux is about 0.82 of the emitted flux.

Growth of carbon nanotubes (CNTs) on metallic underlayers by diffusion plasma-enhanced chemical vapour deposition (DPECVD)

NASA Astrophysics Data System (ADS)

Kim, S. M.; Gangloff, L.

2009-10-01

Here, we demonstrate the low-temperature (480-612 °C) synthesis of carbon nanotubes (CNTs) on different metallic underlayers (i.e., NiV, Ir, Ag, Pt, W, and Ta) using diffusion (dc) plasma-enhanced (~20 W, -600 V) chemical vapour deposition (DPECVD). The catalyst used is bi-layered Fe/Al and the feedstock used is a mixture of C 2H 2 and NH 3 (1:4). The crucial component is the diffusion of radical ions and hydrogen generated such as H 2/H +/H 2+/NH 3+/CH 2+/C 2H 2+ (which are confirmed by in-situ mass spectroscopy) from the nozzle, where it is inserted for most effective plasma diffusion between a substrate and a gas distributor.

Monitoring of exposure to methylpentanes by diffusive sampling and urine analysis for alcoholic metabolites.

PubMed Central

Kawai, T; Mizunuma, K; Yasugi, T; Horiguchi, S; Iguchi, H; Mutti, A; Ghittori, S; Ikeda, M

1995-01-01

OBJECTIVES--To investigate the possibilities of personal ambient monitoring and biological monitoring for methylpentane isomers. METHODS--The performance of activated carbon cloth to absorb 2- and 3-methylpentane was studied by experimental vapour exposure followed by solvent extraction and gas chromatography (GC). Urine from workers and rats exposed to 2- and 3-methylpentane was analysed by GC with or without acid or enzymatic hydrolysis. RESULTS--Carbon cloth absorbed 2- and 3-methylpentane linearly to exposures up to eight hours and to 400 ppm, and was sensitive enough to detect a 15 minute peak of exposure. The two isomers were clearly separated from hexane on a DB-1 column. For analysis of the urine, enzymatic hydrolysis was superior to acid hydrolysis. Exposure of rats to methylpentane vapours showed that 2-methyl-2-pentanol and 3-methyl-2-pentanol were excreted in urine in proportion to the dose of 2-methylpentane and 3-methylpentane, respectively. 2-Methyl derivatives of 1-, 3-, and 4-propanol, 2-methylpentane-2,4-diol, and 3-methyl-2-pentanol were minor metabolites. Analysis of urine from the exposed workers showed that 2-methyl- and 3-methyl-2-pentanol are leading urinary metabolites after exposure to the corresponding methylpentane. CONCLUSIONS--Diffusive sampling is applicable to monitor 2- and 3-methylpentane vapours as is the case for hexane vapour. 2-Methyl-2-pentanol and 3-methyl-2-pentanol will be markers of occupational exposure to 2-methylpentane and 3-methylpentane, respectively. Also, 2-methylpentane-2,4-diol might be a marker of exposure to 2-methylpentane. PMID:8535496

Cloning, purification, crystallization and preliminary X-ray studies of a carbohydrate-binding module from family 64 (StX).

PubMed

Campos, Bruna Medeia; Liberato, Marcelo Vizona; Polikarpov, Igor; Zeri, Ana Carolina de Mattos; Squina, Fabio Marcio

2015-03-01

In recent years, biofuels have attracted great interest as a source of renewable energy owing to the growing global demand for energy, the dependence on fossil fuels, limited natural resources and environmental pollution. However, the cost-effective production of biofuels from plant biomass is still a challenge. In this context, the study of carbohydrate-binding modules (CBMs), which are involved in guiding the catalytic domains of glycoside hydrolases to polysaccharides, is crucial for enzyme development. Aiming at the structural and functional characterization of novel CBMs involved in plant polysaccharide deconstruction, an analysis of the CAZy database was performed and CBM family 64 was chosen owing to its capacity to bind with high specificity to microcrystalline cellulose and to the fact that is found in thermophilic microorganisms. In this communication, the CBM-encoding module named StX was expressed, purified and crystallized, and X-ray diffraction data were collected from native and derivatized crystals to 1.8 and 2.0 Å resolution, respectively. The crystals, which were obtained by the hanging-drop vapour-diffusion method, belonged to space group P3121, with unit-cell parameters a = b = 43.42, c = 100.96 Å for the native form. The phases were found using the single-wavelength anomalous diffraction method.

Purification, crystallization and preliminary crystallographic study of an IDS-epimerase from Agrobacterium tumefaciens BY6

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bäuerle, Bettina; Sandalova, Tatyana; Schneider, Gunter

2006-08-01

This is the first report of the crystallization of an IDS-epimerase from A. tumefaciens BY6 and its l-selenomethionine derivative. The initial degradation of all stereoisomers of the complexing agent iminodisuccinate (IDS) is enabled by an epimerase in the bacterial strain Agrobacterium tumefaciens BY6. This protein was produced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method. Crystals of IDS-epimerase were obtained under several conditions. The best diffracting crystals were grown in 22% PEG 3350, 0.2 M (NH{sub 4}){sub 2}SO{sub 4} and 0.1 M bis-Tris propane pH 7.2 at 293 K. These crystals belong to the monoclinic space groupmore » P2{sub 1}, with unit-cell parameters a = 55.4, b = 104.2, c = 78.6 Å, β = 103.3°, and diffracted to 1.7 Å resolution. They contain two protein molecules per asymmetric unit. In order to solve the structure using the MAD phasing method, crystals of the l-selenomethionine-substituted epimerase were grown in the presence of 20% PEG 3350, 0.2 M Na{sub 2}SO{sub 4} and 0.1 M bis-Tris propane pH 8.5.« less

The specific diffusion behaviour in paper and migration modelling from recycled board into dry foodstuffs.

PubMed

Hauder, J; Benz, H; Rüter, M; Piringer, O-G

2013-01-01

Recycled board plays an important role in food packaging, but the great variety of organic impurities must be considered as potential food contaminants. The diffusion behaviour of the impurities is significantly different from that in plastic materials. The two-layer concept for paper and board introduced recently is now treated in more detail. In the rate-determining surface region the diffusion coefficients of the n-alkanes in the homologous series with 15-35 carbon atoms decrease proportionally as their vapour pressures. This leads to a different equation of the diffusion coefficients in comparison with that for the core layer. Different polarities of the migrants have additional influences on the diffusion due to their interactions with the fibre matrix. A new analytical method for the quantification of aromatic impurities has previously been developed. Based on this method and on the described diffusion behaviour, a migration model for specific and global mass transfer of impurities from recycled board into dry food and food simulants is given.

Effects of water immersion to the neck on pulmonary circulation and tissue volume in man

NASA Technical Reports Server (NTRS)

Begin, R.; Epstein, M.; Sackner, M. A.; Levinson, R.; Dougherty, R.; Duncan, D.

1976-01-01

A rapid noninvasive breathing method is used to obtain serial measurements of the pulmonary capillary blood flow, diffusing capacity per unit of alveolar volume, combined pulmonary tissue plus capillary volume, functional residual capacity, and oxygen consumption in five normal subjects undergoing 6 h of sitting, 4 h of sitting while immersed to the neck in thermoneutral water, and 4 h of lying in thermoneutral water to the neck. The rebreathing method employed a test gas mixture containing 0.5% C2H2, 0.3% C(18)O, 10% He, 21% O2, and balance N2. It is shown that immersion to the neck in the seated posture results in significant increases in sodium excretion cardiac output, and diffusing capacity per unit of alveolar volume. The pulmonary tissue plus capillary volume did not change, demonstrating that the central vascular engorgement induced by water immersion is not accompanied by significant extravasation of fluid into the pulmonary interstitial space.

Purification, crystallization and preliminary crystallographic study of haemoglobin from camel (Camelus dromedarius): a high oxygen-affinity lowland species.

PubMed

Balasubramanian, M; Moorthy, Pon Sathya; Neelagandan, K; Ponnuswamy, M N

2009-08-01

Haemoglobin is a prototypical allosteric protein that is mainly involved in the transportation of oxygen from the lungs to tissues and of carbon dioxide back to the lungs in an intrinsically coordinated manner to maintain the viability of cells. Haemoglobin from Camelus dromedarius provides an interesting case study of adaptation to life in deserts at extremely high temperatures. An ambition to unravel the integrated structural and functional aspects of the casual survival of this animal at high temperatures led us to specifically work on this problem. The present work reports the preliminary crystallographic study of camel haemoglobin. Camel blood was collected and the haemoglobin was purified by anion-exchange chromatography and crystallized using the hanging-drop vapour-diffusion method under buffered high salt concentration using PEG 3350 as a precipitant. Intensity data were collected using a MAR 345 dtb image-plate detector system. Camel haemoglobin crystallized in the monoclinic space group P2(1), with one whole biological molecule (alpha(2)beta(2)) in the asymmetric unit and unit-cell parameters a = 52.759, b = 116.782, c = 52.807 A, beta = 120.07 degrees .

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Dongwen; Sun, Jianping; Zhao, Wei

The CRD domain of GRP from H. sapiens has been expressed, purified and crystallized and X-ray diffraction data have been collected to a resolution of 2.0 Å. Galectins are a family of animal lectins which share similar carbohydrate-recognition domains (CRDs) and an affinity for β-galactosides. A novel human galectin-related protein named GRP (galectin-related protein; previously known as HSPC159) comprises only one conserved CRD with 38 additional N-terminal residues. The C-terminal fragment of human GRP (GRP-C; residues 38–172) containing the CRD has been expressed and purified. The protein was crystallized using the hanging-drop vapour-diffusion method from a solution containing 2% PEGmore » 400 and 2M ammonium sulfate in 100 mM Tris–HCl buffer pH 7.5. Diffraction data were collected to a resolution limit of 2.0 Å at beamline 3W1A of Beijing Synchrotron Radiation Facility at 100 K. The crystals belong to the monoclinic space group C2, with unit-cell parameters a = 123.07, b = 96.67, c = 61.56 Å, β = 118.72°. The estimated Matthews coefficient was 2.6 Å{sup 3} Da{sup −1}, corresponding to 51.8% solvent content.« less

Crystallization and preliminary X-ray diffraction analysis of hemextin A: a unique anticoagulant protein from Hemachatus haemachatus venom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee, Yajnavalka; Kumar, Sundramurthy; Jobichen, Chacko

2007-08-01

Crystals of hemextin A, a three-finger toxin isolated and purified from African Ringhals cobra (H. haemachatus), are orthorhombic, space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 Å, and diffract to 1.5 Å resolution. Hemextin A was isolated and purified from African Ringhals cobra (Hemachatus haemachatus). It is a three-finger toxin that specifically inhibits blood coagulation factor VIIa and clot formation and that also interacts with hemextin B to form a unique anticoagulant complex. Hemextin A was crystallized by the hanging-drop vapour-diffusion method by equilibration against 0.2 M ammonium acetate, 0.1more » M sodium acetate trihydrate pH 4.6 and 30% PEG 4000 as the precipitating agent. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 Å and two molecules in the asymmetric unit. They diffracted to 1.5 Å resolution at beamline X25 at BNL.« less

Purification, crystallization and preliminary X-ray analysis of a thermostable glycoside hydrolase family 43 β-xylosidase from Geobacillus thermoleovorans IT-08

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rohman, Ali; Oosterwijk, Niels van; Kralj, Slavko

2007-11-01

The β-xylosidase was crystallized using PEG 6000 as precipitant. 5% PEG 6000 yielded bipyramid-shaped tetragonal crystals diffracting to 1.55 Å resolution, and 13% PEG 6000 gave rectangular monoclinic crystals diffracting to 1.80 Å resolution. The main enzymes involved in xylan-backbone hydrolysis are endo-1,4-β-xylanase and β-xylosidase. β-Xylosidase converts the xylo-oligosaccharides produced by endo-1,4-β-xylanase into xylose monomers. The β-xylosidase from the thermophilic Geobacillus thermoleovorans IT-08, a member of glycoside hydrolase family 43, was crystallized at room temperature using the hanging-drop vapour-diffusion method. Two crystal forms were observed. Bipyramid-shaped crystals belonging to space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = bmore » = 62.53, c = 277.4 Å diffracted to 1.55 Å resolution. The rectangular crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 57.94, b = 142.1, c = 153.9 Å, β = 90.5°, and diffracted to 1.80 Å resolution.« less

Crystallization and preliminary crystallographic analysis of l-asparaginase from Erwinia carotovora

PubMed Central

Wikman, Linnea E. K.; Krasotkina, Julya; Kuchumova, Anastasia; Sokolov, Nikolay N.; Papageorgiou, Anastassios C.

2005-01-01

Bacterial l-asparaginases have been used as therapeutic agents in the treatment of acute childhood lymphoblastic leukaemia for over 30 y. However, their use is limited owing to the glutaminase activity of the administered enzymes, which results in serious side effects. In contrast, l-asparaginase from Erwinia carotovora exhibits low glutaminase activity at physiological concentrations of l-asparagine and l-glutamine in the blood. Recombinant Er. carotovora l-­asparaginase was crystallized in the presence of l-glutamate by the hanging-drop vapour-diffusion method using 10 mg ml−1 purified enzyme, 16–18%(w/v) PEG 3350 and 0.2 M NaF. X-ray diffraction data were collected to 2.6 Å at 293 K using an in-house rotating-anode generator. The crystals belong to the monoclinic P21 space group, with unit-cell parameters a = 78.0, b = 112.3, c = 78.7 Å, β = 101.9° and a homotetramer in the crystallographic asymmetric unit. A molecular-replacement solution has been found and refinement is currently in progress. The crystal structure may provide leads towards protein-engineering efforts aimed at safer asparaginase administration in leukaemia treatment. PMID:16511054

Trypanothione reductase from Leishmania infantum: cloning, expression, purification, crystallization and preliminary X-ray data analysis.

PubMed

Baiocco, Paola; Franceschini, Stefano; Ilari, Andrea; Colotti, Gianni

2009-01-01

The most promising targets for Leishmania-specific drug design are two key enzymes involved in the unique thiol-based metabolism, common to all parasites of the Trypanosomatidae family: trypanothione synthetase (TryS) and trypanothione reductase (TR). Recently, new inhibitors of TR have been identified such as polyamines and tricyclic compounds. The knowledge of the three-dimensional structure of Leishmania TR will shed light on the mechanism of interaction of these inhibitors with TR and will be the starting point to design novel lead candidates to facilitate the development of new effective and affordable drugs. Trypanothione reductase from Leishmania infantum has been cloned, expressed in E. coli and purified. Crystals were obtained at 294 K by the hanging drop vapour diffusion method using ammonium sulfate as precipitant agent and diffract to better than 2.95 A resolution using a synchrotron radiation source. The crystals exhibit an unusually high solvent content of 74 %, belong to the tetragonal space group P41 with units cell parameters a=b=103.45 A, c=192.62 A and two molecules in the asymmetric unit. The protein X-ray structure has been solved by Molecular Replacement and the model is under construction.

Surface fractal dimension, water adsorption efficiency, and cloud nucleation activity of insoluble aerosol.

PubMed

Laaksonen, Ari; Malila, Jussi; Nenes, Athanasios; Hung, Hui-Ming; Chen, Jen-Ping

2016-05-03

Surface porosity affects the ability of a substance to adsorb gases. The surface fractal dimension D is a measure that indicates the amount that a surface fills a space, and can thereby be used to characterize the surface porosity. Here we propose a new method for determining D, based on measuring both the water vapour adsorption isotherm of a given substance, and its ability to act as a cloud condensation nucleus when introduced to humidified air in aerosol form. We show that our method agrees well with previous methods based on measurement of nitrogen adsorption. Besides proving the usefulness of the new method for general surface characterization of materials, our results show that the surface fractal dimension is an important determinant in cloud drop formation on water insoluble particles. We suggest that a closure can be obtained between experimental critical supersaturation for cloud drop activation and that calculated based on water adsorption data, if the latter is corrected using the surface fractal dimension of the insoluble cloud nucleus.

Surface fractal dimension, water adsorption efficiency, and cloud nucleation activity of insoluble aerosol

NASA Astrophysics Data System (ADS)

Laaksonen, Ari; Malila, Jussi; Nenes, Athanasios; Hung, Hui-Ming; Chen, Jen-Ping

2016-05-01

Surface porosity affects the ability of a substance to adsorb gases. The surface fractal dimension D is a measure that indicates the amount that a surface fills a space, and can thereby be used to characterize the surface porosity. Here we propose a new method for determining D, based on measuring both the water vapour adsorption isotherm of a given substance, and its ability to act as a cloud condensation nucleus when introduced to humidified air in aerosol form. We show that our method agrees well with previous methods based on measurement of nitrogen adsorption. Besides proving the usefulness of the new method for general surface characterization of materials, our results show that the surface fractal dimension is an important determinant in cloud drop formation on water insoluble particles. We suggest that a closure can be obtained between experimental critical supersaturation for cloud drop activation and that calculated based on water adsorption data, if the latter is corrected using the surface fractal dimension of the insoluble cloud nucleus.

Crystallization and X-ray diffraction analysis of an l-arabinonate dehydratase from Rhizobium leguminosarum bv. trifolii and a d-xylonate dehydratase from Caulobacter crescentus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rahman, Mohammad Mubinur; Andberg, Martina; Koivula, Anu

l-Arabinonate dehydratase and d-xylonate dehydratase from the IlvD/EDD family were crystallized by the vapour-diffusion method. Diffraction data sets were collected to resolutions of 2.40 and 2.66 Å from crystals of l-arabinonate dehydratase and d-xylonate dehydratase, respectively. l-Arabinonate dehydratase (EC 4.2.1.25) and d-xylonate dehydratase (EC 4.2.1.82) are two enzymes that are involved in a nonphosphorylative oxidation pathway of pentose sugars. l-Arabinonate dehydratase converts l-arabinonate into 2-dehydro-3-deoxy-l-arabinonate, and d-xylonate dehydratase catalyzes the dehydration of d-xylonate to 2-dehydro-3-deoxy-d-xylonate. l-Arabinonate and d-xylonate dehydratases belong to the IlvD/EDD family, together with 6-phosphogluconate dehydratases and dihydroxyacid dehydratases. No crystal structure of any l-arabinonate or d-xylonate dehydratasemore » is available in the PDB. In this study, recombinant l-arabinonate dehydratase from Rhizobium leguminosarum bv. trifolii (RlArDHT) and d-xylonate dehydratase from Caulobacter crescentus (CcXyDHT) were heterologously expressed in Escherichia coli and purified by the use of affinity chromatography followed by gel-filtration chromatography. The purified proteins were crystallized using the hanging-drop vapour-diffusion method at 293 K. Crystals of RlArDHT that diffracted to 2.40 Å resolution were obtained using sodium formate as a precipitating agent. They belonged to space group P2{sub 1}, with unit-cell parameters a = 106.07, b = 208.61, c = 147.09 Å, β = 90.43°. Eight RlArDHT molecules (two tetramers) in the asymmetric unit give a V{sub M} value of 3.2 Å{sup 3} Da{sup −1} and a solvent content of 62%. Crystals of CcXyDHT that diffracted to 2.66 Å resolution were obtained using sodium formate and polyethylene glycol 3350. They belonged to space group C2, with unit-cell parameters a = 270.42, b = 236.13, c = 65.17 Å, β = 97.38°. Four CcXyDHT molecules (a tetramer) in the asymmetric unit give a V{sub M} value of 4.0 Å{sup 3} Da{sup −1} and a solvent content of 69%.« less

Overexpression, purification, crystallization and preliminary structural studies of p-coumaric acid decarboxylase from Lactobacillus plantarum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rodríguez, Héctor; Rivas, Blanca de las; Muñoz, Rosario

2007-04-01

The enzyme p-coumaric acid decarboxylase (PDC) from L. plantarum has been recombinantly expressed, purified and crystallized. The structure has been solved at 2.04 Å resolution by the molecular-replacement method. The substrate-inducible p-coumaric acid decarboxylase (PDC) from Lactobacillus plantarum has been overexpressed in Escherichia coli, purified and confirmed to possess decarboxylase activity. The recombinant His{sub 6}-tagged enzyme was crystallized using the hanging-drop vapour-diffusion method from a solution containing 20%(w/v) PEG 4000, 12%(w/v) 2-propanol, 0.2 M sodium acetate, 0.1 M Tris–HCl pH 8.0 with 0.1 M barium chloride as an additive. Diffraction data were collected in-house to 2.04 Å resolution. Crystals belongedmore » to the tetragonal space group P4{sub 3}, with unit-cell parameters a = b = 43.15, c = 231.86 Å. The estimated Matthews coefficient was 2.36 Å{sup 3} Da{sup −1}, corresponding to 48% solvent content, which is consistent with the presence of two protein molecules in the asymmetric unit. The structure of PDC has been determined by the molecular-replacement method. Currently, the structure of PDC complexed with substrate analogues is in progress, with the aim of elucidating the structural basis of the catalytic mechanism.« less

Expression, purification, crystallization and preliminary X-ray analysis of a C-terminal fragment of the Epstein–Barr virus ZEBRA protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morand, Patrice; Laboratoire de Virologie Moléculaire et Structurale, EA 2939, Université Joseph Fourier, Grenoble; Budayova-Spano, Monika

A C-terminal fragment of the Epstein–Barr virus lytic switch protein ZEBRA has been crystallized in complex with DNA. A C-terminal fragment of the Epstein–Barr virus immediate-early transcription factor ZEBRA has been expressed as a recombinant protein in Escherichia coli and purified to homogeneity. The fragment behaves as a dimer in solution, consistent with the presence of a basic region leucine-zipper (bZIP) domain. Crystals of the fragment in complex with a DNA duplex were grown by the hanging-drop vapour-diffusion technique using polyethylene glycol 4000 and magnesium acetate as crystallization agents. Crystals diffract to better than 2.5 Å resolution using synchrotron radiationmore » (λ = 0.976 Å). Crystals belong to space group C2, with unit-cell parameters a = 94.2, b = 26.5, c = 98.1 Å, β = 103.9°.« less

Expression, purification, crystallization and preliminary X-ray analysis of perakine reductase, a new member of the aldo-keto reductase enzyme superfamily from higher plants

PubMed Central

Rosenthal, Cindy; Mueller, Uwe; Panjikar, Santosh; Sun, Lianli; Ruppert, Martin; Zhao, Yu; Stöckigt, Joachim

2006-01-01

Perakine reductase (PR) is a novel member of the aldo-keto reductase enzyme superfamily from higher plants. PR from the plant Rauvolfia serpentina is involved in the biosynthesis of monoterpenoid indole alkaloids by performing NADPH-dependent reduction of perakine, yielding raucaffrinoline. However, PR can also reduce cinnamic aldehyde and some of its derivatives. After heterologous expression of a triple mutant of PR in Escherichia coli, crystals of the purified and methylated enzyme were obtained by the hanging-drop vapour-diffusion technique at 293 K with 100 mM sodium citrate pH 5.6 and 27% PEG 4000 as precipitant. Crystals belong to space group C2221 and diffract to 2.0 Å, with unit-cell parameters a = 58.9, b = 93.0, c = 143.4 Å. PMID:17142919

R245fa Flow Boiling inside a 4.2 mm ID Microfin Tube

NASA Astrophysics Data System (ADS)

Longo, G. A.; Mancin, S.; Righetti, G.; Zilio, C.

2017-11-01

This paper presents the R245fa flow boiling heat transfer and pressure drop measurements inside a mini microfin tube with internal diameter at the fin tip of 4.2 mm, having 40 fins, 0.15 mm high with a helix angle of 18°. The tube was brazed inside a copper plate and electrically heated from the bottom. Sixteen T-type thermocouples are located in the copper plate to monitor the wall temperature. The experimental measurements were carried out at constant mean saturation temperature of 30 °C, by varying the refrigerant mass velocity between 100 kg m-2 s-1 and 300 kg m-2 s-1, the vapour quality from 0.15 to 0.95, at two different heat fluxes: 30 and 60 kW m-2. The experimental results are presented in terms of two-phase heat transfer coefficient, onset dryout vapour quality, and frictional pressure drop. Moreover, the experimental measurements are compared against the most updated models for boiling heat transfer coefficient and frictional pressure drop estimations available in the open literature for microfin tubes.

Drop Impact on Hairy Surfaces

NASA Astrophysics Data System (ADS)

Nasto, Alice; Hosoi, Anette

2017-11-01

Using a combination of experiments and theory, we investigate the effect of a millimeter-scale hairy texture on impact of liquid drops. By varying the speed of the drop at impact and the spacing of the hairs, we observe a variety of behaviors. For dense hairs and low impact velocity, the liquid drop sits on top of the hair, similar to a Cassie-Baxter state. For higher impact velocity, and intermediate to high density of hairs, the drops penetrate through the surface, but the hairs resist their spreading. For low hair density and high impact velocity, the drops impact and splash.

Self-Diffusion of Drops in a Dilute Sheared Emulsion

NASA Technical Reports Server (NTRS)

Loewenberg, Michael; Hinch, E. J.

1996-01-01

Self-diffusion coefficients that describe cross-flow migration of non-Brownian drops in a dilute sheared emulsion were obtained by trajectory calculations. A boundary integral formulation was used to describe pairwise interactions between deformable drops; interactions between undeformed drops were described with mobility functions for spherical drops. The results indicate that drops have large anisotropic self-diffusivities which depend strongly on the drop viscosity and modestly on the shear-rate. Pairwise interactions between drops in shear-flow do not appreciably promote drop breakup.

Modeling contact angle hysteresis of a liquid droplet sitting on a cosine wave-like pattern surface.

PubMed

Promraksa, Arwut; Chen, Li-Jen

2012-10-15

A liquid droplet sitting on a hydrophobic surface with a cosine wave-like square-array pattern in the Wenzel state is simulated by using the Surface Evolver to determine the contact angle. For a fixed drop volume, multiple metastable states are obtained at two different surface roughnesses. Unusual and non-circular shape of the three-phase contact line of a liquid droplet sitting on the model surface is observed due to corrugation and distortion of the contact line by structure of the roughness. The contact angle varies along the contact line for each metastable state. The maximum and minimum contact angles among the multiple metastable states at a fixed viewing angle correspond to the advancing and the receding contact angles, respectively. It is interesting to observe that the advancing/receding contact angles (and contact angle hysteresis) are a function of viewing angle. In addition, the receding (or advancing) contact angles at different viewing angles are determined at different metastable states. The contact angle of minimum energy among the multiple metastable states is defined as the most stable (equilibrium) contact angle. The Wenzel model is not able to describe the contact angle along the three-phase contact line. The contact angle hysteresis at different drop volumes is determined. The number of the metastable states increases with increasing drop volume. Drop volume effect on the contact angles is also discussed. Crown Copyright © 2012. Published by Elsevier Inc. All rights reserved.

Atomic origins of water-vapour-promoted alloy oxidation

NASA Astrophysics Data System (ADS)

Luo, Langli; Su, Mao; Yan, Pengfei; Zou, Lianfeng; Schreiber, Daniel K.; Baer, Donald R.; Zhu, Zihua; Zhou, Guangwen; Wang, Yanting; Bruemmer, Stephen M.; Xu, Zhijie; Wang, Chongmin

2018-06-01

The presence of water vapour, intentional or unavoidable, is crucial to many materials applications, such as in steam generators, turbine engines, fuel cells, catalysts and corrosion1-4. Phenomenologically, water vapour has been noted to accelerate oxidation of metals and alloys5,6. However, the atomistic mechanisms behind such oxidation remain elusive. Through direct in situ atomic-scale transmission electron microscopy observations and density functional theory calculations, we reveal that water-vapour-enhanced oxidation of a nickel-chromium alloy is associated with proton-dissolution-promoted formation, migration, and clustering of both cation and anion vacancies. Protons derived from water dissociation can occupy interstitial positions in the oxide lattice, consequently lowering vacancy formation energy and decreasing the diffusion barrier of both cations and anions, which leads to enhanced oxidation in moist environments at elevated temperatures. This work provides insights into water-vapour-enhanced alloy oxidation and has significant implications in other material and chemical processes involving water vapour, such as corrosion, heterogeneous catalysis and ionic conduction.

Atomic origins of water-vapour-promoted alloy oxidation.

PubMed

Luo, Langli; Su, Mao; Yan, Pengfei; Zou, Lianfeng; Schreiber, Daniel K; Baer, Donald R; Zhu, Zihua; Zhou, Guangwen; Wang, Yanting; Bruemmer, Stephen M; Xu, Zhijie; Wang, Chongmin

2018-06-01

The presence of water vapour, intentional or unavoidable, is crucial to many materials applications, such as in steam generators, turbine engines, fuel cells, catalysts and corrosion 1-4 . Phenomenologically, water vapour has been noted to accelerate oxidation of metals and alloys 5,6 . However, the atomistic mechanisms behind such oxidation remain elusive. Through direct in situ atomic-scale transmission electron microscopy observations and density functional theory calculations, we reveal that water-vapour-enhanced oxidation of a nickel-chromium alloy is associated with proton-dissolution-promoted formation, migration, and clustering of both cation and anion vacancies. Protons derived from water dissociation can occupy interstitial positions in the oxide lattice, consequently lowering vacancy formation energy and decreasing the diffusion barrier of both cations and anions, which leads to enhanced oxidation in moist environments at elevated temperatures. This work provides insights into water-vapour-enhanced alloy oxidation and has significant implications in other material and chemical processes involving water vapour, such as corrosion, heterogeneous catalysis and ionic conduction.

Studies on the Safety of DDVP for the Disinsection of Commercial Aircraft*

PubMed Central

Witter, Robert F.; Gaines, Thomas B.; Short, J. Gordon; Sedlak, V. A.; Maddock, D. R.

1961-01-01

There is a need for a more effective method for the disinsection of intercontinental aircraft. A study was made of the possible toxic hazard associated with a new method of disinsection using DDVP vapour (O,O-dimethyl-2,2-dichlorovinyl phosphate) as the insecticidal agent. In these experiments, men and monkeys were exposed four times over one- or two-hour periods for a total of 4-8 hours to DDVP vapour in a simulated aircraft cabin. The concentration of DDVP was higher and the exposure periods were longer than those planned for use in disinsection. Concentrations up to 0.7 μg per litre of air produced no effect on the cholinesterase of men or monkeys. It was found that a concentration of DDVP of 0.9-3.5 μg per litre of air caused a slight decrease in plasma cholinesterase of the men and the monkeys. At a DDVP concentration of 7.5-17.9 μg per litre, monkeys exhibited a marked drop in red cell and plasma cholinesterase and showed miosis, but no other signs of poisoning. PMID:13786106

Theoretical model of the Bergeron-Findeisen mechanism of ice crystal growth in clouds

NASA Astrophysics Data System (ADS)

Castellano, N. E.; Avila, E. E.; Saunders, C. P. R.

A numerical study of growth rate of ice particles in an array of water droplets (Bergeron-Findeisen mechanism) has used the method of electrostatic image charges to determine the vapour field in which a particle grows. Analysis of growth rate in various conditions of relevance to clouds has shown that it is proportional to liquid water content and to ice particle size, while it is inversely proportional to cloud droplet size. The results show that growth rate is enhanced by several percent relative to the usual treatment in which vapour is assumed to diffuse from infinity towards a growing ice particle. The study was performed for ice particles between 25 and 150 μm radii, water droplet sizes between 6 and 20 μm diameter and a wide range of liquid water contents. A study was also made to determine the effect of reducing the vapour source at infinity so that the droplets alone provided the vapour for particle growth. A parameterisation of ice particle growth rate is given as a function of liquid water content and ice particle and droplet sizes. These studies are of importance to considerations in thunderstorm electrification processes, where the mechanism of charge transfer between ice particles and graupel could take place.

Crystallization and preliminary X-ray diffraction studies of two thermostable α-galactosidases from glycoside hydrolase family 36

DOE Office of Scientific and Technical Information (OSTI.GOV)

Foucault, M.; Watzlawick, H.; Mattes, R.

2006-02-01

The α-galactosidases AgaA, AgaB and AgaA A355E mutant from Geobacillus stearothermophilus have been overexpressed in Escherichia coli. Crystals of AgaB and AgaA A355E have been obtained by the vapour-diffusion method and synchrotron data have been collected to 2.0 and 2.8 Å resolution, respectively. α-Galactosidases from thermophilic organisms have gained interest owing to their applications in the sugar industry. The α-galactosidases AgaA, AgaB and AgaA A355E mutant from Geobacillus stearothermophilus have been overexpressed in Escherichia coli. Crystals of AgaB and AgaA A355E have been obtained by the vapour-diffusion method and synchrotron data have been collected to 2.0 and 2.8 Å resolution,more » respectively. Crystals of AgaB belong to space group I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 87.5, b = 113.3, c = 161.6 Å. Crystals of AgaA A355E belong to space group P3{sub 1}21 or P3{sub 2}21, with unit-cell parameters a = b = 150.1, c = 233.2 Å.« less

Prediction and validation of diffusion coefficients in a model drug delivery system using microsecond atomistic molecular dynamics simulation and vapour sorption analysis.

PubMed

Forrey, Christopher; Saylor, David M; Silverstein, Joshua S; Douglas, Jack F; Davis, Eric M; Elabd, Yossef A

2014-10-14

Diffusion of small to medium sized molecules in polymeric medical device materials underlies a broad range of public health concerns related to unintended leaching from or uptake into implantable medical devices. However, obtaining accurate diffusion coefficients for such systems at physiological temperature represents a formidable challenge, both experimentally and computationally. While molecular dynamics simulation has been used to accurately predict the diffusion coefficients, D, of a handful of gases in various polymers, this success has not been extended to molecules larger than gases, e.g., condensable vapours, liquids, and drugs. We present atomistic molecular dynamics simulation predictions of diffusion in a model drug eluting system that represent a dramatic improvement in accuracy compared to previous simulation predictions for comparable systems. We find that, for simulations of insufficient duration, sub-diffusive dynamics can lead to dramatic over-prediction of D. We present useful metrics for monitoring the extent of sub-diffusive dynamics and explore how these metrics correlate to error in D. We also identify a relationship between diffusion and fast dynamics in our system, which may serve as a means to more rapidly predict diffusion in slowly diffusing systems. Our work provides important precedent and essential insights for utilizing atomistic molecular dynamics simulations to predict diffusion coefficients of small to medium sized molecules in condensed soft matter systems.

A comparison between protein crystals grown with vapor diffusion methods in microgravity and protein crystals using a gel liquid-liquid diffusion ground-based method

NASA Technical Reports Server (NTRS)

Miller, Teresa Y.; He, Xiao-Min; Carter, Daniel C.

1992-01-01

Crystals of human serum albumin have been successfully grown in a variety of gels using crystallization conditions otherwise equivalent to those utilized in the popular hanging-drop vapor-equilibrium method. Preliminary comparisons of gel grown crystals with crystals grown by the vapor diffusion method via both ground-based and microgravity methods indicate that crystals superior in size and quality may be grown by limiting solutal convection. Preliminary X-ray diffraction statistics are presented.

A highly accurate boundary integral equation method for surfactant-laden drops in 3D

NASA Astrophysics Data System (ADS)

Sorgentone, Chiara; Tornberg, Anna-Karin

2018-05-01

The presence of surfactants alters the dynamics of viscous drops immersed in an ambient viscous fluid. This is specifically true at small scales, such as in applications of droplet based microfluidics, where the interface dynamics become of increased importance. At such small scales, viscous forces dominate and inertial effects are often negligible. Considering Stokes flow, a numerical method based on a boundary integral formulation is presented for simulating 3D drops covered by an insoluble surfactant. The method is able to simulate drops with different viscosities and close interactions, automatically controlling the time step size and maintaining high accuracy also when substantial drop deformation appears. To achieve this, the drop surfaces as well as the surfactant concentration on each surface are represented by spherical harmonics expansions. A novel reparameterization method is introduced to ensure a high-quality representation of the drops also under deformation, specialized quadrature methods for singular and nearly singular integrals that appear in the formulation are evoked and the adaptive time stepping scheme for the coupled drop and surfactant evolution is designed with a preconditioned implicit treatment of the surfactant diffusion.

The effect of lemon, orange and bergamot essential oils and their components on the survival of Campylobacter jejuni, Escherichia coli O157, Listeria monocytogenes, Bacillus cereus and Staphylococcus aureus in vitro and in food systems.

PubMed

Fisher, K; Phillips, C A

2006-12-01

To investigate the effectiveness of oils and vapours of lemon (Citrus limon), sweet orange (Citrus sinensis) and bergamot (Citrus bergamia) and their components against a number of common foodborne pathogens. The disc diffusion method was used to screen the oils and vapours against Listeria monocytogenes, Staphylococcus aureus, Bacillus cereus, Escherichia coli O157 and Campylobacter jejuni. The survival of each species, demonstrated to be susceptible in the in vitro studies, was tested on cabbage leaf for 60 s by direct contact and on chicken skin for 10 min by direct contact and 24 h by vapour. The results indicate that bergamot was the most inhibitory essential oil (EO) and citral and linalool mimicked its effect (P > 0.001). Citral and linalool vapours produced 6 log reductions in L. monocytogenes, Staph. aureus and B. cereus populations on cabbage leaf after 8-10 h exposure but bergamot vapour exposure, while producing a similar reduction in L. monocytogenes and B. cereus populations, had no effect on Staph. aureus. Bergamot was the most effective of the oils tested and linalool the most effective anti-bacterial component. Gram-positive bacteria were more susceptible than Gram-negative bacteria in vitro, although Camp. jejuni and E. coli O157 were inhibited by bergamot and linalool oils and by linalool vapour. All bacteria tested were less susceptible in food systems than in vitro. Of the Gram-positive bacteria tested Staph. aureus was the least susceptible to both the oils and the components tested. Results suggest the possibility that citrus EOs, particularly bergamot, could be used as a way of combating the growth of common causes of food poisoning.

Etiology and Use of the “Hanging Drop” Technique: A Review

PubMed Central

Todorov, Ludmil; VadeBoncouer, Timothy

2014-01-01

Background. The hanging drop (HD) technique presumably relies on the presence of subatmospheric epidural pressure. It is not clear whether this negative pressure is intrinsic or an artifact and how it is affected by body position. There are few data to indicate how often HD is currently being used. Methods. We identified studies that measured subatmospheric pressures and looked at the effect of the sitting position. We also looked at the technique used for cervical and thoracic epidural anesthesia in the last 10 years. Results. Intrinsic subatmospheric pressures were measured in the thoracic and cervical spine. Three trials studied the effect of body position, indicating a higher incidence of subatmospheric pressures when sitting. The results show lower epidural pressure (−10.7 mmHg) with the sitting position. 28.8% of trials of cervical and thoracic epidural anesthesia that documented the technique used, utilized the HD technique. When adjusting for possible bias, the rate of HD use can be as low as 11.7%. Conclusions. Intrinsic negative pressure might be present in the cervical and thoracic epidural space. This effect is more pronounced when sitting. This position might be preferable when using HD. Future studies are needed to compare it with the loss of resistance technique. PMID:24839558

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baig, M.; Brown, A.; Eswaramoorthy, S.

Klebsiella pneumoniae, a gram-negative enteric bacterium, is found in nosocomial infections which are acquired during hospital stays for about 10% of hospital patients in the United States. The crystal structure of a putative oxidoreductase from K. pneumoniae has been determined. The structural information of this K. pneumoniae protein was used to understand its function. Crystals of the putative oxidoreductase enzyme were obtained by the sitting drop vapor diffusion method using Polyethylene glycol (PEG) 3350, Bis-Tris buffer, pH 5.5 as precipitant. These crystals were used to collect X-ray data at beam line X12C of the National Synchrotron Light Source (NSLS) atmore » Brookhaven National Laboratory (BNL). The crystal structure was determined using the SHELX program and refi ned with CNS 1.1. This protein, which is involved in the catalysis of an oxidation-reduction (redox) reaction, has an alpha/beta structure. It utilizes nicotinamide adenine dinucleotide phosphate (NADP) or nicotine adenine dinucleotide (NAD) to perform its function. This structure could be used to determine the active and co-factor binding sites of the protein, information that could help pharmaceutical companies in drug design and in determining the protein’s relationship to disease treatment such as that for pneumonia and other related pathologies.« less

Ionic liquid-based single-drop microextraction/gas chromatographic/mass spectrometric determination of benzene, toluene, ethylbenzene and xylene isomers in waters.

PubMed

Aguilera-Herrador, Eva; Lucena, Rafael; Cárdenas, Soledad; Valcárcel, Miguel

2008-08-01

The direct coupling between ionic liquid-based single-drop microextraction and gas chromatography/mass spectrometry is proposed for the rapid and simple determination of benzene, toluene, ethylbenzene and xylenes isomers (BTEX) in water samples. The extraction procedure exploits not only the high affinity of the selected ionic liquid (1-methyl-3-octyl-imidazolium hexaflourophosphate) to these aromatic compounds but also its special properties like viscosity, low vapour pressure and immiscibility with water. All the variables involved in the extraction process have been studied in depth. The developed method allows the determination of these single-ring compounds in water under the reference concentration level fixed by the international legislation. In this case, limits of detection were in the range 20 ng L(-1) (obtained for benzene) and 91 ng L(-1) (for o-xylene). The repeatability of the proposed method, expressed as RSD (n=5), varied between 3.0% (o-xylene) and 5.2% (toluene).

Growth of microorganisms in Martian-like shallow subsurface conditions: laboratory modelling

NASA Astrophysics Data System (ADS)

Pavlov, A. K.; Shelegedin, V. N.; Vdovina, M. A.; Pavlov, A. A.

2010-01-01

Low atmospheric pressures on Mars and the lack of substantial amounts of liquid water were suggested to be among the major limiting factors for the potential Martian biosphere. However, large amounts of ice were detected in the relatively shallow subsurface layers of Mars by the Odyssey Mission and when ice sublimates the water vapour can diffuse through the porous surface layer of the soil. Here we studied the possibility for the active growth of microorganisms in such a vapour diffusion layer. Our results showed the possibility of metabolism and the reproduction of non-extremophile terrestrial microorganisms (Vibrio sp.) under very low (0.01-0.1 mbar) atmospheric pressures in a Martian-like shallow subsurface regolith.

Preparation of crystals for characterizing the Grb7 SH2 domain before and after complex formation with a bicyclic peptide antagonist.

PubMed

Ambaye, Nigus D; Gunzburg, Menachem J; Traore, Daouda A K; Del Borgo, Mark P; Perlmutter, Patrick; Wilce, Matthew C J; Wilce, Jacqueline A

2014-02-01

Human growth factor receptor-bound protein 7 (Grb7) is an adapter protein involved in cell growth, migration and proliferation. It is now recognized that Grb7 is an emerging therapeutic target in specific cancer subtypes. Recently, the discovery of a bicyclic peptide inhibitor that targets the Grb7 SH2 domain, named G7-B1, was reported. In an attempt to probe the foundation of its interaction with Grb7, the crystallization and preliminary data collection of both the apo and G7-B1-bound forms of the Grb7 SH2 domain are reported here. Diffraction-quality crystals were obtained using the hanging-drop vapour-diffusion method. After several rounds of microseeding, crystals of the apo Grb7 SH2 domain were obtained that diffracted to 1.8 Å resolution, while those of the G7-B1-Grb7 SH2 domain complex diffracted to 2.2 Å resolution. The apo Grb7 SH2 domain crystallized in the trigonal space group P63, whereas the G7-B1-Grb7 SH2 domain complex crystallized in the monoclinic space group P21. The experimental aspects of crystallization, crystal optimization and data collection and the preliminary data are reported.

Purification, crystallization and preliminary X-ray diffraction studies on avian haemoglobin from pigeon (Columba livia).

PubMed

Sathya Moorthy, Pon; Neelagandan, K; Balasubramanian, M; Ponnuswamy, M N

2009-02-01

Haemoglobin is a physiologically significant metalloprotein that is involved in the exchange of gases for sustaining life. The respiratory system of birds is unique and complex compared with that of mammals. Many investigations of avian haemoglobins have revealed the presence of inositol pentaphosphate (IP5), a principal allosteric effector that is involved in regulation of their function. Structural investigations of avian haemoglobins are presently not adequate to explain their function. Efforts have been made in this direction in order to understand the oxygen-binding affinity involved in adapting to hypoxia in avian haemoglobins. Fresh whole blood was collected from pigeon (Columba livia) and purified using a DEAE cellulose anion-exchange chromatographic column. Crystallization of pigeon haemoglobin was accomplished using the hanging-drop vapour-diffusion method using PEG 3350 as a precipitant in 50 mM sodium acetate buffer pH 5.5 with 1 M NaCl. Data collection was carried out using a MAR345 image-plate detector system. The crystals diffracted to 2 A resolution. Pigeon haemoglobin crystallizes in a triclinic space group, with two whole biological molecules in the asymmetric unit and with unit-cell parameters a = 55.005, b = 65.528, c = 104.370 A, alpha = 78.742, beta = 89.819, gamma = 65.320 degrees .

Crystallization and preliminary X-ray diffraction analysis of the arginine repressor of the hyperthermophile Thermotoga neapolitana

DOE Office of Scientific and Technical Information (OSTI.GOV)

Massant, Jan, E-mail: jan.massant@vub.ac.be; Peeters, Eveline; Charlier, Daniel

2006-01-01

The arginine repressor of the hyperthermophile T. neapolitana was crystallized with and without its corepressor arginine. Both crystals diffracted to high resolution and belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with similar unit-cell parameters. The arginine repressor of Thermotoga neapolitana (ArgRTnp) is a member of the family of multifunctional bacterial arginine repressors involved in the regulation of arginine metabolism. This hyperthermophilic repressor shows unique DNA-binding features that distinguish it from its homologues. ArgRTnp exists as a homotrimeric protein that assembles into hexamers at higher protein concentrations and/or in the presence of arginine. ArgRTnp was crystallized with andmore » without its corepressor arginine using the hanging-drop vapour-diffusion method. Crystals of the aporepressor diffracted to a resolution of 2.1 Å and belong to the orthorhombic P2{sub 1}2{sub 1}2{sub 1} space group, with unit-cell parameters a = 117.73, b = 134.15, c = 139.31 Å. Crystals of the repressor in the presence of its corepressor arginine diffracted to a resolution of 2.4 Å and belong to the same space group, with similar unit-cell parameters.« less

Crystallization and preliminary X-ray analysis of binary and ternary complexes of Haloferax mediterranei glucose dehydrogenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Esclapez, Julia; Britton, K. Linda; Baker, Patrick J.

2005-08-01

Single crystals of binary and ternary complexes of wild-type and D38C mutant H. mediterranei glucose dehydrogenase have been obtained by the hanging-drop vapour-diffusion method. Haloferax mediterranei glucose dehydrogenase (EC 1.1.1.47) belongs to the medium-chain alcohol dehydrogenase superfamily and requires zinc for catalysis. In the majority of these family members, the catalytic zinc is tetrahedrally coordinated by the side chains of a cysteine, a histidine, a cysteine or glutamate and a water molecule. In H. mediterranei glucose dehydrogenase, sequence analysis indicates that the zinc coordination is different, with the invariant cysteine replaced by an aspartate residue. In order to analyse themore » significance of this replacement and to contribute to an understanding of the role of the metal ion in catalysis, a range of binary and ternary complexes of the wild-type and a D38C mutant protein have been crystallized. For most of the complexes, crystals belonging to space group I222 were obtained using sodium/potassium citrate as a precipitant. However, for the binary and non-productive ternary complexes with NADPH/Zn, it was necessary to replace the citrate with 2-methyl-2,4-pentanediol. Despite the radical change in conditions, the crystals thus formed were isomorphous.« less

Crystallization of the receptor-binding domain of parathyroid hormone-related protein in complex with a neutralizing monoclonal antibody Fab fragment

DOE Office of Scientific and Technical Information (OSTI.GOV)

McKinstry, William J.; Polekhina, Galina; Diefenbach-Jagger, Hannelore

Parathyroid hormone-related protein (PTHrP) plays an important role in regulating embryonic skeletal development and is abnormally regulated in the pathogenesis of skeletal complications observed with many cancers and osteoporosis. It exerts its action through binding to a G-protein-coupled seven-transmembrane cell-surface receptor (GPCR). Structurally, GPCRs are very difficult to study by X-ray crystallography. In this study, a monoclonal antibody Fab fragment which recognizes the same region of PTHrP as its receptor, PTH1R, was used to aid in the crystallization of PTHrP. The resultant protein complex was crystallized using the hanging-drop vapour-diffusion method with polyethylene glycol as a precipitant. The crystals belongedmore » to the orthorhombic space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 72.6, b = 96.3, c = 88.5 {angstrom}, and diffracted to 2.0 {angstrom} resolution using synchrotron radiation. The crystal structure will shed light on the nature of the key residues of PTHrP that interact with the antibody and will provide insights into how the antibody is able to discriminate between PTHrP and the related molecule parathyroid homone.« less

Simplified conditions holding at the gas-liquid interface during evaporation

NASA Astrophysics Data System (ADS)

Morris, S. J. S.

2017-11-01

We show that on the gas side of the interface between a pure liquid and a binary mixture of its vapour with an insoluble gas, the normal derivative of vapour partial pressure pv satisfies ∂pv/∂n +αc/2 πpD (P -pv) (p -pv) = 0 . Constants α, c, D denote the dimensionless accommodation coefficient, a molecular speed and the diffusivity. Provided the continuum approximation holds within the gas, and α = O(1) , this boundary condition implies that evaporation can take one of two forms. (a) If the coexistence pressure P evaluated at the interface is less than the constant total gas pressure p, liquid at the interface is in local thermodynamic equilibrium with its vapour, and the evaporation rate is determined by diffusion through the gas. (b) Conversely, if P > p , gas at the interface consists of pure vapour, and the evaporation rate is determined by processes within the liquid. In the Wayner theory of the heated evaporating meniscus, such as that in a heat pipe, case (b) is assumed. As an application of our result, we show that some of the published experiments intended to test the Wayner theory instead operate under conditions in which case (a) holds. As a result, they do not perform the test intended.

Transport mechanisms through PE-CVD coatings: influence of temperature, coating properties and defects on permeation of water vapour

NASA Astrophysics Data System (ADS)

Kirchheim, Dennis; Jaritz, Montgomery; Mitschker, Felix; Gebhard, Maximilian; Brochhagen, Markus; Hopmann, Christian; Böke, Marc; Devi, Anjana; Awakowicz, Peter; Dahlmann, Rainer

2017-03-01

Gas transport mechanisms through plastics are usually described by the temperature-dependent Arrhenius-model and compositions of several plastic layers are represented by the CLT. When it comes to thin films such as plasma-enhanced chemical vapour deposition (PE-CVD) or plasma-enhanced atomic layer deposition (PE-ALD) coatings on substrates of polymeric material, a universal model is lacking. While existing models describe diffusion through defects, these models presume that permeation does not occur by other means of transport mechanisms. This paper correlates the existing transport models with data from water vapour transmission experiments.

Crystallization and preliminary crystallographic analysis of porcine acylaminoacyl peptidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wright, Helena; Kiss, András L.; Szeltner, Zoltán

2005-10-01

Acylaminoacyl peptidase from porcine liver has been crystallized. Data were collected to 3.4 Å from native crystals and a search for heavy-atom derivatives is in progress. Acylaminoacyl peptidase (also known as acylamino-acid-releasing enzyme or acylpeptide hydrolase; EC 3.4.19.1) is an unusual member of the prolyl oligopeptidase family catalysing the hydrolysis of an N-acylated peptide to an acylamino acid and a peptide with a free N-terminus. Acylaminoacyl peptidase purified from porcine liver has been crystallized in mother liquor containing 0.1 M Tris–HCl pH 7.0, 10%(w/v) polyethylene glycol 8000, 50 mM MgCl{sub 2} and 1%(w/v) CHAPS using the hanging-drop vapour-diffusion technique. Amore » full data set to 3.4 Å resolution was collected at ESRF beamline ID14-4 and space group C222 was assigned, with unit-cell parameters a = 84.8, b = 421.1, c = 212.0 Å and four molecules in the asymmetric unit.« less

Crystallization, X-ray diffraction analysis and preliminary structure determination of the polygalacturonase PehA from Agrobacterium vitis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vordtriede, Paul B.; Yoder, Marilyn D., E-mail: yoderm@umkc.edu

2008-07-01

The acidic polygalacturonase PehA from A. vitis has been crystallized. A molecular-replacement solution indicated a right-handed parallel β-helix fold. Polygalacturonases are pectate-degrading enzymes that belong to glycoside hydrolase family 28 and hydrolyze the α-1,4 glycosidic bond between neighboring galacturonasyl residues of the homogalacturonan substrate. The acidic polygalacturonase PehA from Agrobacterium vitis was overexpressed in Escherichia coli, where it accumulated in the periplasmic fraction. It was purified to homogeneity via a two-step chromatography procedure and crystallized using the hanging-drop vapour-diffusion technique. PehA crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 52.387, b = 62.738, c = 149.165more » Å, β = 89.98°. Crystals diffracted to 1.59 Å resolution and contained two molecules per asymmetric unit. An initial structure determination by molecular replacement indicated a right-handed parallel β-helix fold.« less

Crystallization and preliminary X-ray diffraction analysis of FabG from Yersinia pestis.

PubMed

Nanson, Jeffrey David; Forwood, Jade Kenneth

2014-01-01

The type II fatty-acid biosynthesis pathway of bacteria provides enormous potential for antibacterial drug development owing to the structural differences between this and the type I fatty-acid biosynthesis system found in mammals. β-Ketoacyl-ACP reductase (FabG) is responsible for the reduction of the β-ketoacyl group linked to acyl carrier protein (ACP), and is essential for the formation of fatty acids and bacterial survival. Here, the cloning, expression, purification, crystallization and diffraction of FabG from Yersinia pestis (ypFabG), the highly virulent causative agent of plague, are reported. Recombinant FabG was expressed, purified to homogeneity and crystallized via the hanging-drop vapour-diffusion technique. Diffraction data were collected at the Australian Synchrotron to 2.30 Å resolution. The crystal displayed P2(1)2(1)2(1) symmetry, with unit-cell parameters a = 68.22, b = 98.68, c = 169.84 Å, and four ypFabG molecules in the asymmetric unit.

Cloning, purification, crystallization and preliminary crystallographic analysis of a penicillin-binding protein homologue from Pyrococcus abyssi

DOE Office of Scientific and Technical Information (OSTI.GOV)

Delfosse, Vanessa; Hugonnet, Jean-Emmanuel; Sougakoff, Wladimir

The crystallization of a hypothetical penicillin-binding protein from the archaeon P. abyssi in space group C2 by hanging-drop vapour diffusion is reported. The genome of the hyperthermophilic archaeon Pyrococcus abyssi contains a gene (pab0087) encoding a penicillin-binding protein (PBP) homologue. This sequence consists of 447 residues and shows significant sequence similarity to low-molecular-weight PBPs and class C β-lactamases. The Pab0087 protein was overexpressed, purified and crystallized. Diffraction data from two different crystal forms were collected to 2.7 and 2.0 Å resolution. Both crystals belong to space group C2, with unit-cell parameters a = 160.59, b = 135.74, c = 113.02more » Å, β = 117.36° and a = 166.97, b = 131.25, c = 189.39 Å, β = 113.81°, respectively. The asymmetric unit contains four and eight molecules, respectively, with fourfold non-crystallographic symmetry.« less

Self-spinning nanoparticle laden microdroplets for sensing and energy harvesting

NASA Astrophysics Data System (ADS)

Bhattacharjee, Mitradip; Pasumarthi, Viswanath; Chaudhuri, Joydip; Singh, Amit Kumar; Nemade, Harshal; Bandyopadhyay, Dipankar

2016-03-01

Exposure of a volatile organic vapour could set in powerful rotational motion a microdroplet composed of an aqueous salt solution loaded with metal nanoparticles. The solutal Marangoni motion on the surface originating from the sharp difference in the surface tension of water and organic vapour stimulated the strong vortices inside the droplet. The vapour sources of methanol, ethanol, diethyl ether, toluene, and chloroform stimulated motions of different magnitudes could easily be correlated to the surface tension gradient on the drop surface. Interestingly, when the nanoparticle laden droplet of aqueous salt solution was connected to an external electric circuit through a pair of electrodes, an ~85-95% reduction in the electrical resistance was observed across the spinning droplet. The extent of reduction in the resistance was found to have a correlation with the difference in the surface tension of the vapour source and the water droplet, which could be employed to distinguish the vapour sources. Remarkably, the power density of the same prototype was estimated to be around 7 μW cm-2, which indicated the potential of the phenomenon in converting surface energy into electrical in a non-destructive manner and under ambient conditions. Theoretical analysis uncovered that the difference in the ζ-potential near the electrodes was the major reason for the voltage generation. The prototype could also detect the repeated exposure and withdrawal of vapour sources, which helped in the development of a proof-of-concept detector to sense alcohol issuing out of the human breathing system.Exposure of a volatile organic vapour could set in powerful rotational motion a microdroplet composed of an aqueous salt solution loaded with metal nanoparticles. The solutal Marangoni motion on the surface originating from the sharp difference in the surface tension of water and organic vapour stimulated the strong vortices inside the droplet. The vapour sources of methanol, ethanol, diethyl ether, toluene, and chloroform stimulated motions of different magnitudes could easily be correlated to the surface tension gradient on the drop surface. Interestingly, when the nanoparticle laden droplet of aqueous salt solution was connected to an external electric circuit through a pair of electrodes, an ~85-95% reduction in the electrical resistance was observed across the spinning droplet. The extent of reduction in the resistance was found to have a correlation with the difference in the surface tension of the vapour source and the water droplet, which could be employed to distinguish the vapour sources. Remarkably, the power density of the same prototype was estimated to be around 7 μW cm-2, which indicated the potential of the phenomenon in converting surface energy into electrical in a non-destructive manner and under ambient conditions. Theoretical analysis uncovered that the difference in the ζ-potential near the electrodes was the major reason for the voltage generation. The prototype could also detect the repeated exposure and withdrawal of vapour sources, which helped in the development of a proof-of-concept detector to sense alcohol issuing out of the human breathing system. Electronic supplementary information (ESI) available: Discussion of simulation with results, characterization and movies of particle motion inside droplets along with detailed explanation. See DOI: 10.1039/c6nr00217j

Laterally Overgrown Structures as Substrates for Lattice Mismatched Epitaxy

DTIC Science & Technology

2002-06-03

low supersaturation substrate [3]. Therefore, equilibrium growth techniques as liquid buffer with TD phase epitaxy (LPE) or vapour phase epitaxy (VPE...phase diffusion during MBE growth, so lateral over- low cost semiconductor devices. Therefore, vapour growth must rely on the surface mobility of...is replaced by graphite film not wetted For the GaAs on GaAs ELO system we attributed by the gallium melt [35]. Similarly, tungsten has been broadening

Development of a method for rating climate seat comfort

NASA Astrophysics Data System (ADS)

Scheffelmeier, M.; Classen, E.

2017-10-01

The comfort aspect in the vehicle interior is becoming increasingly important. A high comfort level offers the driver a good and secure feeling and has a strong influence on passive traffic safety. One important part of comfort is the climate aspect, especially the microclimate that emerges between passenger and seat. In this research, different combinations of typical seat materials are used. Fourteen woven and knitted fabrics and eight leathers and its substitutes for the face fabric layer, one foam, one non-woven and one 3D spacer for the plus pad layer and for the support layer three foam types with variations in structure and raw material as well as one rubber hair structure were investigated. To characterise this sample set by thermo-physiological aspects (e.g. water vapour resistance Ret, thermal resistance Rct, buffering capacity of water vapour Fd) regular and modified sweating guarded hotplates were used according to DIN EN ISO 11092. The results of the material characterisation confirm the common knowledge that seat covers out of textiles have better water vapour resistance values than leathers and its substitutes. Subject trials in a driving simulator were executed to rate the subjective sensation while driving in a vehicle seat. With a thermal, sweating Manikin (Newton Type, Thermetrics) objective product measurements were carried out on the same seat. Indeed the subject trials show that every test subject has his or her own subjective perception concerning the climate comfort. The results of the subject trials offered the parameters for the Newton measuring method. Respectively the sweating rate, sit-in procedure, ambient conditions and sensor positions on and between the seat layers must be comparable with the subject trials. By taking care of all these parameters it is possible to get repeatable and reliable results with the Newton Manikin. The subjective feelings of the test subjects, concerning the microclimate between seat and passenger, provide the evaluation of the Manikins output (Rc and Re values).

Unsaturation of vapour pressure inside leaves of two conifer species

DOE PAGES

Cernusak, Lucas A.; Ubierna, Nerea; Jenkins, Michael W.; ...

2018-05-16

Stomatal conductance (g s) impacts both photosynthesis and transpiration, and is therefore fundamental to the global carbon and water cycles, food production, and ecosystem services. Mathematical models provide the primary means of analysing this important leaf gas exchange parameter. A nearly universal assumption in such models is that the vapour pressure inside leaves (e i) remains saturated under all conditions. The validity of this assumption has not been well tested, because so far e i cannot be measured directly. Here, we test this assumption using a novel technique, based on coupled measurements of leaf gas exchange and the stable isotopemore » compositions of CO 2 and water vapour passing over the leaf. We applied this technique to mature individuals of two semiarid conifer species. In both species, e i routinely dropped below saturation when leaves were exposed to moderate to high air vapour pressure deficits. Typical values of relative humidity in the intercellular air spaces were as low 0.9 in Juniperus monosperma and 0.8 in Pinus edulis. These departures of e i from saturation caused significant biases in calculations of g s and the intercellular CO 2 concentration. Thus, our results refute the longstanding assumption of saturated vapour pressure in plant leaves under all conditions.« less

Unsaturation of vapour pressure inside leaves of two conifer species

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cernusak, Lucas A.; Ubierna, Nerea; Jenkins, Michael W.

Stomatal conductance (g s) impacts both photosynthesis and transpiration, and is therefore fundamental to the global carbon and water cycles, food production, and ecosystem services. Mathematical models provide the primary means of analysing this important leaf gas exchange parameter. A nearly universal assumption in such models is that the vapour pressure inside leaves (e i) remains saturated under all conditions. The validity of this assumption has not been well tested, because so far e i cannot be measured directly. Here, we test this assumption using a novel technique, based on coupled measurements of leaf gas exchange and the stable isotopemore » compositions of CO 2 and water vapour passing over the leaf. We applied this technique to mature individuals of two semiarid conifer species. In both species, e i routinely dropped below saturation when leaves were exposed to moderate to high air vapour pressure deficits. Typical values of relative humidity in the intercellular air spaces were as low 0.9 in Juniperus monosperma and 0.8 in Pinus edulis. These departures of e i from saturation caused significant biases in calculations of g s and the intercellular CO 2 concentration. Thus, our results refute the longstanding assumption of saturated vapour pressure in plant leaves under all conditions.« less

Self-spinning nanoparticle laden microdroplets for sensing and energy harvesting.

PubMed

Bhattacharjee, Mitradip; Pasumarthi, Viswanath; Chaudhuri, Joydip; Singh, Amit Kumar; Nemade, Harshal; Bandyopadhyay, Dipankar

2016-03-21

Exposure of a volatile organic vapour could set in powerful rotational motion a microdroplet composed of an aqueous salt solution loaded with metal nanoparticles. The solutal Marangoni motion on the surface originating from the sharp difference in the surface tension of water and organic vapour stimulated the strong vortices inside the droplet. The vapour sources of methanol, ethanol, diethyl ether, toluene, and chloroform stimulated motions of different magnitudes could easily be correlated to the surface tension gradient on the drop surface. Interestingly, when the nanoparticle laden droplet of aqueous salt solution was connected to an external electric circuit through a pair of electrodes, an ∼85-95% reduction in the electrical resistance was observed across the spinning droplet. The extent of reduction in the resistance was found to have a correlation with the difference in the surface tension of the vapour source and the water droplet, which could be employed to distinguish the vapour sources. Remarkably, the power density of the same prototype was estimated to be around 7 μW cm(-2), which indicated the potential of the phenomenon in converting surface energy into electrical in a non-destructive manner and under ambient conditions. Theoretical analysis uncovered that the difference in the ζ-potential near the electrodes was the major reason for the voltage generation. The prototype could also detect the repeated exposure and withdrawal of vapour sources, which helped in the development of a proof-of-concept detector to sense alcohol issuing out of the human breathing system.

Major diffusion leaks of clamp-on leaf cuvettes still unaccounted: how erroneous are the estimates of Farquhar et al. model parameters?

PubMed

Rodeghiero, Mirco; Niinemets, Ulo; Cescatti, Alessandro

2007-08-01

Estimates of leaf gas-exchange characteristics using standard clamp-on leaf chambers are prone to errors because of diffusion leaks. While some consideration has been given to CO(2) diffusion leaks, potential water vapour diffusion leaks through chamber gaskets have been neglected. We estimated diffusion leaks of two clamp-on Li-Cor LI-6400 (Li-Cor, Inc., Lincoln, NE, USA) leaf chambers with polymer foam gaskets and enclosing either 2 or 6 cm(2) leaf area, and conducted a sensitivity analysis of the diffusion leak effects on Farquhar et al. photosynthesis model parameters - the maximum carboxylase activity of ribulose 1 x 5-bisphosphate carboxylase/oxygenase (Rubisco) (V(cmax)), capacity for photosynthetic electron transport (J(max)) and non-photorespiratory respiration rate in light (R(d)). In addition, net assimilation rate (A(n)) versus intercellular CO(2) (C(i)) responses were measured in leaves of Mediterranean evergreen species Quercus ilex L. enclosing the whole leaf chamber in a polyvinyl fluoride bag flushed with the exhaust air of leaf chamber, thereby effectively reducing the CO(2) and water vapour gradients between ambient air and leaf chamber. For the empty chambers, average diffusion leak for CO(2), K(CO2), (molar flow rate corresponding to unit CO(2) mole fraction difference) was ca. 0.40 micromol s(-1). K(CO2) increased ca. 50% if a dead leaf was clamped between the leaf chamber. Average diffusion leak for H(2)O was ca. 5- to 10-fold larger than the diffusion leak for CO(2). Sensitivity analyses demonstrated that the consequence of a CO(2) diffusion leak was apparent enhancement of A(n) at high CO(2) mole fraction and reduction at lower CO(2) mole fraction, and overall compression of C(i) range. As the result of these modifications, Farquhar et al. model parameters were overestimated. The degree of overestimation increased in the order of V(cmax) < J(max) < R(d), and was larger for smaller chambers and for leaves with lower photosynthetic capacity, leading to overestimation of all three parameters by 70-290% for 2 cm(2), and by 10-60% for 6 cm(2) chamber. Significant diffusion corrections (5-36%) were even required for leaves with high photosynthetic capacity measured in largest chamber. Water vapour diffusion leaks further enhanced the overestimation of model parameters. For small chambers and low photosynthetic capacities, apparent C(i) was simulated to decrease with increasing A(n) because of simultaneous CO(2) and H(2)O diffusion leaks. Measurements in low photosynthetic capacity Quercus ilex leaves enclosed in 2 cm(2) leaf chamber exhibited negative apparent C(i) values at highest A(n). For the same leaves measured with the entire leaf chamber enclosed in the polyvinyl fluoride bag, C(i) and A(n) increased monotonically. While the measurements without the bag could be corrected for diffusion leaks, the required correction in A(n) and transpiration rates was 100-500%, and there was large uncertainty in Farquhar et al. model parameters derived from 'corrected'A(n)/C(i) response curves because of uncertainties in true diffusion leaks. These data demonstrate that both CO(2) and water vapour diffusion leaks need consideration in measurements with clamp-on leaf cuvettes. As plants in natural environments are often characterized by low photosynthetic capacities, cuvette designs need to be improved for reliable measurements in such species.

Coalescence of a Drop inside another Drop

NASA Astrophysics Data System (ADS)

Mugundhan, Vivek; Jian, Zhen; Yang, Fan; Li, Erqiang; Thoroddsen, Sigurdur

2016-11-01

Coalescence dynamics of a pendent drop sitting inside another drop, has been studied experimentally and in numerical simulations. Using an in-house fabricated composite micro-nozzle, a smaller salt-water drop is introduced inside a larger oil drop which is pendent in a tank containing the same liquid as the inner drop. On touching the surface of outer drop, the inner drop coalesces with the surrounding liquid forming a vortex ring, which grows in time to form a mushroom-like structure. The initial dynamics at the first bridge opening up is quantified using Particle Image Velocimetry (PIV), while matching the refractive index of the two liquids. The phenomenon is also numerically simulated using the open-source code Gerris. The problem is fully governed by two non-dimensional parameters: the Ohnesorge number and the diameter ratios of the two drops. The validated numerical model is used to better understand the dynamics of the phenomenon. In some cases a coalescence cascade is observed with liquid draining intermittently and the inner drop reducing in size.

The survival of three strains of Arcobacter butzleri in the presence of lemon, orange and bergamot essential oils and their components in vitro and on food.

PubMed

Fisher, K; Rowe, C; Phillips, C A

2007-05-01

To test the effect of oils and vapours of lemon, sweet orange and bergamot and their components against three Arcobacter butzleri strains. The disc diffusion method was used to screen the oils and vapours against three strains of A. butzleri. In vitro bergamot was the most inhibitory essential oil (EO) and both citral and linalool were effective. On cabbage leaf, the water isolate was the least susceptible to bergamot EO, citral and linalool (1-2 log reduction), with the chicken isolate being the most susceptible (6-8 log reduction). However, the latter appeared not to be susceptible to vapours over 24 h although type strain and water isolate populations reduced by 8 logs. On chicken skin, the effectiveness of the oils was reduced compared with that on cabbage leaf. Bergamot was the most effective of the oils tested and linalool the most effective component. All strains tested were less susceptible in food systems than in vitro. Arcobacter isolates vary in their response to EO suggesting that the results of type strain studies should be interpreted with caution. Bergamot EO has the potential for the inhibition of this 'emerging' pathogen.

Impact of the Bergeron-Findeisen process on the release of aerosol particles during the evolution of cloud ice

NASA Astrophysics Data System (ADS)

Schwarzenböck, A.; Mertes, S.; Heintzenberg, J.; Wobrock, W.; Laj, P.

The paper focuses on the redistribution of aerosol particles (APs) during the artificial nucleation and subsequent growth of ice crystals in a supercooled cloud. A significant number of the supercooled cloud droplets during icing periods (seeding agents: C 3H 8, CO 2) did not freeze as was presumed prior to the experiment but instead evaporated. The net mass flux of water vapour from the evaporating droplets to the nucleating ice crystals (Bergeron-Findeisen mechanism) led to the release of residual particles that simultaneously appeared in the interstitial phase. The strong decrease of the droplet residuals confirms the nucleation of ice particles on seeding germs without natural aerosol particles serving as ice nuclei. As the number of residual particles during the seedings did not drop to zero, other processes such as heterogeneous ice nucleation, spontaneous freezing, entrainment of supercooled droplets and diffusion to the created particle-free ice germs must have contributed to the experimental findings. During the icing periods, residual mass concentrations in the condensed phase dropped by a factor of 1.1-6.7, as compared to the unperturbed supercooled cloud. As the Bergeron-Findeisen process also occurs without artificial seeding in the atmosphere, this study demonstrated that the hydrometeors in mixed-phase clouds might be much cleaner than anticipated for the simple freezing process of supercooled droplets in tropospheric mid latitude clouds.

New method to assess the water vapour permeance of wound coverings.

PubMed

Jonkman, M F; Molenaar, I; Nieuwenhuis, P; Bruin, P; Pennings, A J

1988-05-01

A new method for assessing the permeability to water vapour of wound coverings is presented, using the evaporimeter developed by Nilsson. This new method combines the water vapour transmission rate (WVTR) and the vapour pressure difference across a wound covering in one absolute measure: the water vapour permeance (WVP). The WVP of a wound covering is the steady flow (g) of water vapour per unit (m2) area of surface in unit (h) time induced by unit (kPa) vapour pressure difference, g.m-2.h-1.kPa-1. Since the WVP of a wound covering is a more accurate measure for the permeability than the WVTR is, it facilitates the prediction of the water exchange of a wound covering in clinical situations.

Time-dependent calculations of molten pool formation and thermal plasma with metal vapour in gas tungsten arc welding

NASA Astrophysics Data System (ADS)

Tanaka, M.; Yamamoto, K.; Tashiro, S.; Nakata, K.; Yamamoto, E.; Yamazaki, K.; Suzuki, K.; Murphy, A. B.; Lowke, J. J.

2010-11-01

A gas tungsten arc (GTA) was modelled taking into account the contamination of the plasma by metal vapour from the molten anode. The whole region of GTA atmosphere including the tungsten cathode, the arc plasma and the anode was treated using a unified numerical model. A viscosity approximation was used to express the diffusion coefficient in terms of viscosity of the shielding gas and metal vapour. The transient two-dimensional distributions of temperature, velocity of plasma flow and iron vapour concentration were predicted, together with the molten pool as a function of time for a 150 A arc current at atmospheric pressure, both for helium and argon gases. It was shown that the thermal plasma in the GTA was influenced by iron vapour from the molten pool surface and that the concentration of iron vapour in the plasma was dependent on the temperature of the molten pool. GTA on high sulfur stainless steel was calculated to discuss the differences between a low sulfur and a high sulfur stainless steel anode. Helium was selected as the shielding gas because a helium GTA produces more metal vapour than an argon GTA. In the GTA on a high sulfur stainless steel anode, iron vapour and current path were constricted. Radiative emission density in the GTA on high sulfur stainless steel was also concentrated in the centre area of the arc plasma together with the iron vapour although the temperature distributions were almost the same as that in the case of a low sulfur stainless steel anode.

Effect of air humidity on the removal of carbon tetrachloride from air using Cu-BTC metal-organic framework.

PubMed

Martín-Calvo, Ana; García-Pérez, Elena; García-Sánchez, Almudena; Bueno-Pérez, Rocío; Hamad, Said; Calero, Sofia

2011-06-21

We have used interatomic potential-based simulations to study the removal of carbon tetrachloride from air at 298 K, using Cu-BTC metal organic framework. We have developed new sets of Lennard-Jones parameters that accurately describe the vapour-liquid equilibrium curves of carbon tetrachloride and the main components from air (oxygen, nitrogen, and argon). Using these parameters we performed Monte Carlo simulations for the following systems: (a) single component adsorption of carbon tetrachloride, oxygen, nitrogen, and argon molecules, (b) binary Ar/CCl(4), O(2)/CCl(4), and N(2)/CCl(4) mixtures with bulk gas compositions 99 : 1 and 99.9 : 0.1, (c) ternary O(2)/N(2)/Ar mixtures with both, equimolar and 21 : 78 : 1 bulk gas composition, (d) quaternary mixture formed by 0.1% of CCl(4) pollutant, 20.979% O(2), 77.922% N(2), and 0.999% Ar, and (e) five-component mixtures corresponding to 0.1% of CCl(4) pollutant in air with relative humidity ranging from 0 to 100%. The carbon tetrachloride adsorption selectivity and the self-diffusivity and preferential sitting of the different molecules in the structure are studied for all the systems.

Intrinsic Hydrophobicity of Rammed Earth

NASA Astrophysics Data System (ADS)

Holub, M.; Stone, C.; Balintova, M.; Grul, R.

2015-11-01

Rammed earth is well known for its vapour diffusion properties, its ability to regulate humidity within the built environment. Rammed earth is also an aesthetically iconic material such as marble or granite and therefore is preferably left exposed. However exposed rammed earth is often coated with silane/siloxane water repellents or the structure is modified architecturally (large roof overhangs) to accommodate for the hydrophilic nature of the material. This paper sets out to find out optimal hydrophobicity for rammed earth based on natural composite fibres and surface coating without adversely affecting the vapour diffusivity of the material. The material is not required to be waterproof, but should resist at least driving rain. In order to evaluate different approaches to increase hydrophobicity of rammed earth surface, peat fibres and four types of repellents were used.

Drop deployment system for crystal growth apparatus

NASA Technical Reports Server (NTRS)

Rhodes, Percy (Inventor); Snyder, Robert S. (Inventor); Pusey, Marc L. (Inventor)

1990-01-01

A crystal growth apparatus is presented. It utilizes a vapor diffusion method for growing protein crystals, and particularly such an apparatus wherein a ball mixer is used to mix the fluids that form a drop within which crystals are grown. Particular novelty of this invention lies in utilizing a ball mixer to completely mix the precipitate and protein solutions prior to forming the drop. Additional novelty lies in details of construction of the vials, the fluid deployment system, and the fluid storage system of the preferred embodiment.

Method and apparatus for the production of metal oxide powder

DOEpatents

Harris, Michael T.; Scott, Timothy C.; Byers, Charles H.

1993-01-01

The present invention provides a method for preparing metal oxide powder. A first solution, which is substantially organic, is prepared. A second solution, which is an aqueous solution substantially immiscible in the first solution, is prepared and delivered as drops to the first solution. The drops of the second solution are atomized by a pulsed electric field forming micro-drops of the second solution. Reagents in the first solution diffuse into and react with reactants in the micro-drops of the second solution forming metal hydroxide or oxalate particles. The metal hydroxide or metal oxalate particles are then recovered and dried to produce the metal oxide powder. An apparatus for preparing a metal oxide powder is also disclosed.

Method and apparatus for the production of metal oxide powder

DOEpatents

Harris, Michael T.; Scott, Timothy C.; Byers, Charles H.

1992-01-01

The present invention provides a method for preparing metal oxide powder. A first solution, which is substantially organic, is prepared. A second solution, which is an aqueous solution substantially immiscible in the first solution, is prepared and delivered as drops to the first solution. The drops of the second solution are atomized by a pulsed electric field forming micro-drops of the second solution. Reagents in the first solution diffuse into and react with reactants in the micro-drops of the second solution forming metal hydroxide or oxalate particles. The metal hydroxide or metal oxalate particles are then recovered and dried to produce the metal oxide powder. An apparatus for preparing a metal oxide powder is also disclosed.

Method and apparatus for the production of metal oxide powder

DOEpatents

Harris, M.T.; Scott, T.C.; Byers, C.H.

1992-06-16

The present invention provides a method for preparing metal oxide powder. A first solution, which is substantially organic, is prepared. A second solution, which is an aqueous solution substantially immiscible in the first solution, is prepared and delivered as drops to the first solution. The drops of the second solution are atomized by a pulsed electric field forming micro-drops of the second solution. Reagents in the first solution diffuse into and react with reactants in the micro-drops of the second solution forming metal hydroxide or oxalate particles. The metal hydroxide or metal oxalate particles are then recovered and dried to produce the metal oxide powder. An apparatus for preparing a metal oxide powder is also disclosed. 2 figs.

Experimental and theoretical analysis of the rate of solvent equilibration in the hanging drop method of protein crystal growth

NASA Technical Reports Server (NTRS)

Fowlis, William W.; Delucas, Lawrence J.; Twigg, Pamela J.; Howard, Sandra B.; Meehan, Edward J.

1988-01-01

The principles of the hanging-drop method of crystal growth are discussed, and the rate of water evaporation in a water droplet (containing protein, buffer, and a precipitating agent) suspended above a well containing a double concentration of precipitating agent is investigated theoretically. It is shown that, on earth, the rate of evaporation may be determined from diffusion theory and the colligative properties of solutions. The parameters affecting the rate of evaporation include the temperature, the vapor pressure of water, the ionization constant of the salt, the volume of the drop, the contact angle between the droplet and the coverslip, the number of moles of salt in the droplet, the number of moles of water and salt in the well, the molar volumes of water and salt, the distance from the droplet to the well, and the coefficient of diffusion of water vapor through air. To test the theoretical equations, hanging-drop experiments were conducted using various reagent concentrations in 25-microliter droplets and measuring the evaporation times at 4 C and 25 C. The results showed good agreement with the theory.

Crystal structure of human dual specificity phosphatase, JNK stimulatory phosphatase-1, at 1.5 A resolution.

PubMed

Yokota, Takehiro; Nara, Yukinori; Kashima, Akiko; Matsubara, Keiko; Misawa, Satoru; Kato, Ryohei; Sugio, Shigetoshi

2007-02-01

Human JNK stimulatory phosphatase-1 (JSP-1) is a novel member of dual specificity phosphatases. A C-terminus truncated JSP-1 was expressed in Escherichia coli and was crystallized using the sitting-drop vapor diffusion method. Thin-plate crystals obtained at 278 K belong to a monoclinic space group, C2, with unit-cell parameters a = 84.0 A, b = 49.3 A, c = 47.3 A, and beta = 119.5 degrees , and diffract up to 1.5 A resolution at 100 K. The structure of JSP-1 has a single compact (alpha/beta) domain, which consists of six alpha-helices and five beta-strands, and shows a conserved structural scaffold in regard to both DSPs and PTPs. A cleft formed by a PTP-loop at the active site is very shallow, and is occupied by one sulfonate compound, MES, at the bottom. In the binary complex structure of JSP-1 with MES, the conformations of three important segments in regard to the catalytic mechanism are not similar to those in PTP1B. JSP-1 has no loop corresponding to the Lys120-loop of PTP1B, and tryptophan residue corresponding to the substrate-stacking in PTP1B is substituted by alanine residue in JSP-1. Copyright 2006 Wiley-Liss, Inc.

Purification, characterization, and crystallization of Crocodylus siamensis hemoglobin.

PubMed

Jandaruang, Jinda; Siritapetawee, Jaruwan; Songsiriritthigul, Chomphunuch; Preecharram, Sutthidech; Azuma, Taoka; Dhiravisit, Apisak; Fukumori, Yoshihiro; Thammasirirak, Sompong

2014-08-01

Crocodylus siamensis hemoglobin was purified by a size exclusion chromatography, Sephacryl S-100 with buffer containing dithiothreitol. The purified Hb was dissociated to be two forms (α chain and β chain) which observed by SDS-PAGE, indicated that the C. siamensis Hb was an unpolymerized form. The unpolymerized Hb (composed of two α chains and two β chains) showed high oxygen affinity at 3.13 mmHg (P(50)) and 1.96 (n value), and a small Bohr effect (δH(+) = -0.29) at a pH of 6.9-8.4. Adenosine triphosphate did not affect the oxygenation properties, whereas bicarbonate ions strongly depressed oxygen affinity. Crude C. siamensis Hb solutions were showed high O(2) affinity at P(50) of 2.5 mmHg which may assure efficient utilization of the lung O(2) reserve during breath holding and diving. The purified Hbs were changed to cyanmethemoglobin forms prior crystallization. Rod- and plate-shaped crystals were obtained by the sitting-drop vapor-diffusion method at 5 °C using equal volumes of protein solution (37 mg/ml) and reservoir [10-13 % (w/v) PEG 4000, with 0.1 M Tris buffer in present of 0.2 M MgCl(2)·6H(2)O] solution at a pH of 7.0-8.5.

Purification, crystallization and preliminary X-ray diffraction studies on avian haemoglobin from pigeon (Columba livia)

PubMed Central

Sathya Moorthy, Pon.; Neelagandan, K.; Balasubramanian, M.; Ponnuswamy, M. N.

2009-01-01

Haemoglobin is a physiologically significant metalloprotein that is involved in the exchange of gases for sustaining life. The respiratory system of birds is unique and complex compared with that of mammals. Many investigations of avian haemoglobins have revealed the presence of inositol pentaphosphate (IP5), a principal allosteric effector that is involved in regulation of their function. Structural investigations of avian haemoglobins are presently not adequate to explain their function. Efforts have been made in this direction in order to understand the oxygen-binding affinity involved in adapting to hypoxia in avian haemoglobins. Fresh whole blood was collected from pigeon (Columba livia) and purified using a DEAE cellulose anion-exchange chromatographic column. Crystallization of pigeon haemoglobin was accomplished using the hanging-drop vapour-diffusion method using PEG 3350 as a precipitant in 50 mM sodium acetate buffer pH 5.5 with 1 M NaCl. Data collection was carried out using a MAR345 image-plate detector system. The crystals diffracted to 2 Å resolution. Pigeon haemoglobin crystallizes in a triclinic space group, with two whole biological molecules in the asymmetric unit and with unit-cell parameters a = 55.005, b = 65.528, c = 104.370 Å, α = 78.742, β = 89.819, γ = 65.320°. PMID:19194000

Structural studies of haemoglobin from pisces species shortfin mako shark (Isurus oxyrinchus) at 1.9 Å resolution.

PubMed

Ramesh, Pandian; Sundaresan, S S; Sathya Moorthy, Pon; Balasubramanian, M; Ponnuswamy, M N

2013-11-01

Haemoglobin (Hb) is a tetrameric iron-containing protein that carries oxygen from the lungs to tissues and carbon dioxide from tissues back to the lungs. Pisces are the advanced aquatic vertebrates capable of surviving at wide depth ranges. The shortfin mako shark (SMS) is the pelagic, largest, fastest and most sophisticated species of the shark kingdom with well developed eyes. Mostly the pisces species are cold blooded in nature. Distinctly, the SMSs are warm-blooded animals with an advanced circulatory system. SMSs are capable of maintaining elevated muscle temperatures up to 33 K above the ambient water temperatures at a depth of 150-500 m. SMSs have a diverged air-breathing mechanism compared with other vertebrates. The haemoglobin molecule consists of four polypeptide chains, namely two α chains, each with 140 amino acids and two β chains each having 136 amino acids. The SMS Hb was found to crystallize in monoclinic space group P21 using the hanging-drop vapour-diffusion method at room temperature. The crystal packing parameters for the SMS Hb structure contain one whole biological molecule in the asymmetric unit with a solvent content of 47%. The SMS Hb quaternary structural features interface-interface interactions and heme binding sites are discussed with different state Hbs and the results reveal that SMS Hb adopts an unliganded deoxy T state conformation.

Purification, crystallization and preliminary X-ray analysis of haemoglobin from ostrich (Struthio camelus).

PubMed

Sundaresan, S S; Ramesh, P; Sivakumar, K; Ponnuswamy, M N

2009-07-01

Haemoglobin is a tetrameric protein that carries oxygen from the lungs to tissues and carbon dioxide from tissues back to the lungs. The oxygen-binding properties of haemoglobin are regulated through the binding of allosteric effectors. The respiratory system of avian species is unique and complex in nature when compared with that of mammals. In avian species, inositol pentaphosphate (inositol-P(5)) is present in the erythrocytes of the adult and is thought to be the major factor responsible for the relatively high oxygen affinity of the whole blood. The ostrich (Struthio camelus) is a large flightless bird which contains inositol tetrakisphosphate (inositol-P(4)) in its erythrocytes and its whole blood oxygen affinity is higher. Efforts have been made to explore the structure-function relationship of ostrich haemoglobin. Ostrich haemoglobin was purified using ion-exchange chromatography. Haemoglobin crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350 as the precipitant in 50 mM phosphate buffer pH 7.2. Data were collected using a MAR345 image-plate detector system. The crystals of ostrich haemoglobin diffracted to 2.2 A resolution. They belonged to the orthorhombic space group P2(1)2(1)2(1) with one whole biological molecule in the asymmetric unit; the unit-cell parameters were a = 80.93, b = 81.68, c = 102.05 A.

Purification, crystallization and preliminary crystallographic studies of plant S-adenosyl-l-homocysteine hydrolase (Lupinus luteus)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brzezinski, Krzysztof; Department of Crystallography, Faculty of Chemistry, A. Mickiewicz University, Poznan; Bujacz, Grzegorz

2008-07-01

Single crystals of recombinant S-adenosyl-l-homocysteine hydrolase from L. luteus in complex with adenosine diffract X-rays to 1.17 Å resolution at 100 K. The crystals are tetragonal, space group P4{sub 3}2{sub 1}2, and contain one copy of the dimeric enzyme in the asymmetric unit. By degrading S-adenosyl-l-homocysteine, which is a byproduct of S-adenosyl-l-methionine-dependent methylation reactions, S-adenosyl-l-homocysteine hydrolase (SAHase) acts as a regulator of cellular methylation processes. S-Adenosyl-l-homocysteine hydrolase from the leguminose plant yellow lupin (Lupinus luteus), LlSAHase, which is composed of 485 amino acids and has a molecular weight of 55 kDa, has been cloned, expressed in Escherichia coli and purified.more » Crystals of LlSAHase in complex with adenosine were obtained by the hanging-drop vapour-diffusion method using 20%(w/v) PEG 4000 and 10%(v/v) 2-propanol as precipitants in 0.1 M Tris–HCl buffer pH 8.0. The crystals were tetragonal, space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = 122.4, c = 126.5 Å and contained two protein molecules in the asymmetric unit, corresponding to the functional dimeric form of the enzyme. Atomic resolution (1.17 Å) X-ray diffraction data have been collected using synchrotron radiation.« less

Purification, crystallization and preliminary X-ray diffraction analysis of saxthrombin, a thrombin-like enzyme from Gloydius saxatilis venom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wei, Wenqing; Zhao, Wei; Key Laboratory of Structural Biology, Chinese Academy of Sciences, 96 Jinzhai Road, Hefei, Anhui 230027

2007-08-01

The thrombin-like enzyme saxthrombin has been purified from G. saxatilis snake venom. Crystallization conditions were found and a data set was obtained to 1.43 Å. The snake-venom thrombin-like enzymes (SVTLEs) are a class of serine proteinases that show fibrinogen-clotting and esterolytic activities. Most TLEs convert fibrinogen to fibrin by releasing either fibrinopeptide A or fibrinopeptide B and cannot activate factor XIII. The enzymes hydrolyze fibrinogen to produce non-cross-linked fibrins, which are susceptible to the lytic action of plasmin. Because of these physiological properties, TLEs have important medical applications in myocardial infarction, ischaemic stroke and thrombotic diseases. Here, a three-step chromatographymore » procedure was used to purify saxthrombin (AAP20638) from Gloydius saxatilis venom to homogeneity. Its molecular weight is about 30 kDa as estimated by SDS–PAGE. A saxthrombin crystal was obtained using the hanging-drop vapour-diffusion method and diffracted to a resolution limit of 1.43 Å. The crystal belongs to space group C2, with unit-cell parameters a = 97.23, b = 52.21, c = 50.10 Å, β = 96.72°, and the Matthews coefficient (V{sub M}) was calculated to be 2.13 Å{sup 3} Da{sup −1} with one molecule in the asymmetric unit.« less

Preliminary X-ray analysis of twinned crystals of the Q88Y25_Lacpl esterase from Lactobacillus plantarum WCFS1

PubMed Central

Álvarez, Yanaisis; Esteban-Torres, María; Acebrón, Iván; de las Rivas, Blanca; Muñoz, Rosario; Martínez-Ripoll, Martín; Mancheño, José M.

2011-01-01

Q88Y25_Lacpl is an esterase produced by the lactic acid bacterium Lactobacillus plantarum WCFS1 that shows amino-acid sequence similarity to carboxyl­esterases from the hormone-sensitive lipase family, in particular the AFEST esterase from the archaeon Archaeoglobus fulgidus and the hyperthermophilic esterase EstEI isolated from a metagenomic library. N-­terminally His6-tagged Q88Y25_Lacpl has been overexpressed in Escherichia coli BL21 (DE3) cells, purified and crystallized at 291 K using the hanging-drop vapour-diffusion method. Mass spectrometry was used to determine the purity and homogeneity of the enzyme. Crystals of His6-tagged Q88Y25_Lacpl were prepared in a solution containing 2.8 M sodium acetate trihydrate pH 7.0. X-ray diffraction data were collected to 2.24 Å resolution on beamline ID29 at the ESRF. The apparent crystal point group was 422; however, initial global analysis of the intensity statistics (data processed with high symmetry in space group I422) and subsequent tests on data processed with low symmetry (space group I4) showed that the crystals were almost perfectly merohedrally twinned. Most probably, the true space group is I4, with unit-cell parameters a = 169.05, b = 169.05, c = 183.62 Å. PMID:22102251

The structure of evaporating and combusting sprays: Measurements and predictions

NASA Technical Reports Server (NTRS)

Shuen, J. S.; Solomon, A. S. P.; Faeth, G. M.

1984-01-01

An apparatus developed, to allow observations of monodisperse sprays, consists of a methane-fueled turbulent jet diffusion flame with monodisperse methanol drops injected at the burner exit. Mean and fluctuating-phase velocities, drop sizes, drop-mass fluxes and mean-gas temperatures were measured. Initial drop diameters of 100 and 180 microns are being considered in order to vary drop penetration in the flow and effects of turbulent dispersion. Baseline tests of the burner flame with no drops present were also conducted. Calibration tests, needed to establish methods for predicting drop transport, involve drops supported in the post-flame region of a flat-flame burner operated at various mixture ratios. Spray models which are being evaluated include: (1) locally homogeneous flow (LFH) analysis, (2) deterministic separated flow (DSF) analysis and (3) stochastic separated flow (SSF) analysis.

EDITORIAL: Humidity sensors Humidity sensors

NASA Astrophysics Data System (ADS)

Regtien, Paul P. L.

2012-01-01

All matter is more or less hygroscopic. The moisture content varies with vapour concentration of the surrounding air and, as a consequence, most material properties change with humidity. Mechanical and thermal properties of many materials, such as the tensile strength of adhesives, stiffness of plastics, stoutness of building and packaging materials or the thermal resistivity of isolation materials, all decrease with increasing environmental humidity or cyclic humidity changes. The presence of water vapour may have a detrimental influence on many electrical constructions and systems exposed to humid air, from high-power systems to microcircuits. Water vapour penetrates through coatings, cable insulations and integrated-circuit packages, exerting a fatal influence on the performance of the enclosed systems. For these and many other applications, knowledge of the relationship between moisture content or humidity and material properties or system behaviour is indispensable. This requires hygrometers for process control or test and calibration chambers with high accuracy in the appropriate temperature and humidity range. Humidity measurement methods can roughly be categorized into four groups: water vapour removal (the mass before and after removal is measured); saturation (the air is brought to saturation and the `effort' to reach that state is measured); humidity-dependent parameters (measurement of properties of humid air with a known relation between a specific property and the vapour content, for instance the refractive index, electromagnetic spectrum and acoustic velocity); and absorption (based on the known relation between characteristic properties of non-hydrophobic materials and the amount of absorbed water from the gas to which these materials are exposed). The many basic principles to measure air humidity are described in, for instance, the extensive compilations by Wexler [1] and Sonntag [2]. Absorption-type hygrometers have small dimensions and can be produced at relatively low cost. Therefore, they find wide use in lots of applications. However, the method requires a material that possesses some conflicting properties: stable and reproducible relations between air humidity, moisture uptake and a specific property (for instance the length of a hair, the electrical impedance of the material), fast absorption and desorption of the water vapour (to obtain a short response time), small hysteresis, wide range of relative humidity (RH) and temperature-independent output (only responsive to RH). For these reasons, much research is done and is still going on to find suitable materials that combine high performance and low price. In this special feature, three of the four papers report on absorption sensors, all with different focus. Aziz et al describe experiments with newly developed materials. The surface structure is extensively studied, in view of its ability to rapidly absorb water vapour and exhibit a reproducible change in the resistance and capacitance of the device. Sanchez et al employ optical fibres coated with a thin moisture-absorbing layer as a sensitive humidity sensor. They have studied various coating materials and investigated the possibility of using changes in optical properties of the fibre (here the lossy mode resonance) due to a change in humidity of the surrounding air. The third paper, by Weremczuk et al, focuses on a cheap fabrication method for absorption-based humidity sensors. The inkjet technology appears to be suitable for mass fabrication of such sensors, which is demonstrated by extensive measurements of the electrical properties (resistance and capacitance) of the absorbing layers. Moreover, they have developed a model that describes the relation between humidity and the electrical parameters of the moisture-sensitive layer. Despite intensive research, absorption sensors still do not meet the requirements for high accuracy applications. The dew-point temperature method is more appropriate, since it uses the accurately known relation between temperature and saturation vapour pressure in air. When an object exposed to humid air is cooled down below the dew-point water vapour condenses as drops on its cold surface. The temperature can be kept exactly at the dew point by controlling the amount of dew (equilibrium between evaporation and condensation). In most dew-point hygrometers dew is detected with optical or capacitive means. In the former the dew drops on a reflective surface (chilled mirror) scatter incident light, and the capacitive method uses the change in capacitance due to the large dielectric constant of liquid water (80) compared to air (1). Kunze et al, in the fourth paper of this special feature, use another property of water to detect dew: the relatively high value of the thermal capacitance of liquid water. In traditional technology this method would not be sensitive enough, but with MEMS technology a sufficient detectivity of dew can be achieved, which is demonstrated in this paper. A control system keeps the temperature of the substrate just at the dew-point temperature, the latter being measured by an on-chip diode. The accuracy achieved is comparable with traditional dew-point hygrometers. These four papers in this issue are nice examples of research leading to significant advances in hygrometry. References [1] Wexler A (ed) 1965 Humidity and Moisture. Vol. I: Principles and Methods of Measuring Humidity in Gases; Vol. II: Applications; Vol. III: Fundamentals and Standards; Vol. IV: Principles and Methods of Measuring Moisture in Liquids and Solids (New York: Reinhold) [2] Sonntag D 1966-1968 Hygrometrie (Berlin: Akademie Verlag)

The rate of collisions due to Brownian or gravitational motion of small drops

NASA Technical Reports Server (NTRS)

Zhang, Xiaoguang; Davis, Robert H.

1991-01-01

Quantitative predictions of the collision rate of two spherical drops undergoing Brownian diffusion or gravitational sedimentation are presented. The diffusion equation for relative Brownian motion of two drops is derived, and the relative motion of pairs of drops in gravitational sedimentation is traced via a trajectory analysis in order to develop theoretical models to determine the collision efficiencies, both with and without interparticle forces applied between the drops. It is concluded that finite collision rates between nondeforming fluid drops are possible for Brownian diffusion or gravitational sedimentation in the absence of attractive forces, in stark contrast to the prediction that lubrication forces prevent rigid spheres from contacting each other unless an attractive force that becomes infinite as the separation approaches zero is applied. Collision rates are shown to increase as the viscosity of the drop-phase decreases. In general, hydrodynamic interactions reduce the collision rates more for gravitational collisions than for Brownian collisions.

Determination of trace and minor elements in alloys by atomic-absorption spectroscopy using an induction-heated graphite-well furnace as atom source-II.

PubMed

Ashy, M A; Headridge, J B; Sowerbutts, A

1974-06-01

Results are presented for the atomic-absorption spectrophotometric determination of zinc in aluminium and aluminium-silicon alloys, and aluminium, antimony and tin in steels, by means of solid samples dropped into an induction-heated graphite-well furnace to produce the atomic vapour.

An intercomparison of methods for solving the stochastic collection equation with a focus on cloud radar Doppler spectra in drizzling stratocumulus

NASA Astrophysics Data System (ADS)

Lee, H.; Fridlind, A. M.; Ackerman, A. S.; Kollias, P.

2017-12-01

Cloud radar Doppler spectra provide rich information for evaluating the fidelity of particle size distributions from cloud models. The intrinsic simplifications of bulk microphysics schemes generally preclude the generation of plausible Doppler spectra, unlike bin microphysics schemes, which develop particle size distributions more organically at substantial computational expense. However, bin microphysics schemes face the difficulty of numerical diffusion leading to overly rapid large drop formation, particularly while solving the stochastic collection equation (SCE). Because such numerical diffusion can cause an even greater overestimation of radar reflectivity, an accurate method for solving the SCE is essential for bin microphysics schemes to accurately simulate Doppler spectra. While several methods have been proposed to solve the SCE, here we examine those of Berry and Reinhardt (1974, BR74), Jacobson et al. (1994, J94), and Bott (2000, B00). Using a simple box model to simulate drop size distribution evolution during precipitation formation with a realistic kernel, it is shown that each method yields a converged solution as the resolution of the drop size grid increases. However, the BR74 and B00 methods yield nearly identical size distributions in time, whereas the J94 method produces consistently larger drops throughout the simulation. In contrast to an earlier study, the performance of the B00 method is found to be satisfactory; it converges at relatively low resolution and long time steps, and its computational efficiency is the best among the three methods considered here. Finally, a series of idealized stratocumulus large-eddy simulations are performed using the J94 and B00 methods. The reflectivity size distributions and Doppler spectra obtained from the different SCE solution methods are presented and compared with observations.

Cloning, overexpression, purification and preliminary crystallographic studies of a mitochondrial type II peroxiredoxin from Pisum sativum.

PubMed

Barranco-Medina, Sergio; López-Jaramillo, Francisco Javier; Bernier-Villamor, Laura; Sevilla, Francisca; Lázaro, Juan José

2006-07-01

A cDNA encoding an open reading frame of 199 amino acids corresponding to a type II peroxiredoxin from Pisum sativum with its transit peptide was isolated by RT-PCR. The 171-amino-acid mature protein (estimated molecular weight 18.6 kDa) was cloned into the pET3d vector and overexpressed in Escherichia coli. The recombinant protein was purified and crystallized by the hanging-drop vapour-diffusion technique. A full data set (98.2% completeness) was collected using a rotating-anode generator to a resolution of 2.8 angstroms from a single crystal flash-cooled at 100 K. X-ray data revealed that the protein crystallizes in space group P1, with unit-cell parameters a = 61.88, b = 66.40, c = 77.23 angstroms, alpha = 102.90, beta = 104.40, gamma = 99.07 degrees, and molecular replacement using a theoretical model predicted from the primary structure as a search model confirmed the presence of six molecules in the unit cell as expected from the Matthews coefficient. Refinement of the structure is in progress.

Short-term effects of sports taping on navicular height, navicular drop and peak plantar pressure in healthy elite athletes: A within-subject comparison.

PubMed

Kim, Taegyu; Park, Jong-Chul

2017-11-01

Medial tibial stress syndrome (MTSS) is one of the most common exercise-induced leg pain. The navicular drop (ND) was identified as a risk factor for MTSS. This study aimed to evaluate the short-term effects of sports taping applied to the supporting lower leg during sitting, standing, walking, and jogging to restrict the ND in healthy elite athletes.Twenty-four healthy elite athletes without a history of exercise-induced pain or injuries in the lower limbs participated in this study (median age: 21.00 years; 1st--3rd quartiles; 19.25-22.00). The 4 taping conditions were used: rigid taping (RT), kinesiology taping (KT), placebo taping (PT), and non-taping (NT). The order of taping techniques was randomly assigned. Normalized navicular height (NH), ND, and normalized ND evaluated using 3-dimensional motion analysis, and normalized peak plantar pressure (PP) were compared in 4 taping conditions during sitting, standing, walking, and jogging.During sitting, the normalized NH of RT is higher than that of NT, KT, and PT (χ = 17.30, P = .001), while during jogging, the normalized NH of RT is higher than that of NT and PT (χ = 10.55, P = .014). The normalized peak PP of NT is higher than that of PT (χ = 8.871, P = .031) in the lateral midfoot region.This study showed the RT technique maintained NH during sitting and jogging, and the RT technique could be an effective preventive and treatment strategy for MTSS.

Determination of low solvent concentration by nano-porous silicon photonic sensors using volatile organic compound method.

PubMed

Bui, Huy; Pham, Van Hoi; Pham, Van Dai; Hoang, Thi Hong Cam; Pham, Thanh Binh; Do, Thuy Chi; Ngo, Quang Minh; Nguyen, Thuy Van

2018-05-07

A vast majority of the organic solvents used in industry and laboratories are volatile, hazardous and toxic organic compounds, they are considered as a potent problem for human health and a cause of environmental pollution. Although analytical laboratory methods can determine extremely low solvent concentration, the sensing method with low cost and high sensitivity remains a conundrum. This paper presents and compares three methods (volatile organic compound (VOC), liquid drop and saturated vapour pressure) for determination of organic solvents in liquid environment by using photonic sensor based on nano-porous silicon (pSi) microcavity structures. Among those, the VOC method provides the highest sensitivity at low solvent volume concentrations because it can create a high vapour pressure of the analyte on the sensor surface owing to the capillary deposition of organic solvent into the silicon pores. This VOC method consists of three steps: heating the solution with its particular boiling temperature, controlling the flowing gas through liquid and cooling sensor. It delivers the highest sensitivity of 6.9 nm/% at concentration of 5% and the limit of detection (LOD) of pSi-sensor is 0.014% in case of ethanol in water when using an optical system with a resolution of 0.1 nm. Especially, the VOC method is capable of detecting low volume concentration of methanol in two tested ethanol solutions of 30% (v/v) and 45% (v/v) with the LOD of pSi-sensor up to 0.01% and 0.04%, respectively. This result will help pave a way to control the quality of contaminated liquor beverages.

Pinning-Depinning Mechanisms of the Contact Line during Evaporation of Microdroplets on Rough Surfaces: A Lattice Boltzmann Simulation.

PubMed

Yuan, Wu-Zhi; Zhang, Li-Zhi

2018-06-22

In this study, pinning and depinning of the contact line during droplet evaporation on the rough surfaces with randomly distributed structures is theoretically analyzed and numerically investigated. A fast Fourier transformation (FFT) method is used to generate the rough surfaces, whose skewness ( Sk), kurtosis ( K), and root-mean-square ( Rq) are obtained from real surfaces. A thermal multiphase LB model is proposed to simulate the isothermal pinning and depinning processes. The evaporation processes are recorded with the variations in contact angle, contact radius, and drop shape. It is found that the drops sitting on rough surfaces show different behavior from those on smoother surfaces. The former shows a pinned contact line during almost the whole lifetime. By contrast, the latter experiences a stick-slip-jump behavior until the drop disappears. At mesoscopic scale, the pinning of the contact line is actually a slow motion rather than a complete immobilization at the sharp edges. The dynamic equilibrium is achieved by the self-adjustment of the contact line according to each edge.

A simplified counter diffusion method combined with a 1D simulation program for optimizing crystallization conditions.

PubMed

Tanaka, Hiroaki; Inaka, Koji; Sugiyama, Shigeru; Takahashi, Sachiko; Sano, Satoshi; Sato, Masaru; Yoshitomi, Susumu

2004-01-01

We developed a new protein crystallization method has been developed using a simplified counter-diffusion method for optimizing crystallization condition. It is composed of only a single capillary, the gel in the silicon tube and the screw-top test tube, which are readily available in the laboratory. The one capillary can continuously scan a wide range of crystallization conditions (combination of the concentrations of the precipitant and the protein) unless crystallization occurs, which means that it corresponds to many drops in the vapor-diffusion method. The amount of the precipitant and the protein solutions can be much less than in conventional methods. In this study, lysozyme and alpha-amylase were used as model proteins for demonstrating the efficiency of this method. In addition, one-dimensional (1-D) simulations of the crystal growth were performed based on the 1-D diffusion model. The optimized conditions can be applied to the initial crystallization conditions for both other counter-diffusion methods with the Granada Crystallization Box (GCB) and for the vapor-diffusion method after some modification.

Spontaneous jumping, bouncing and trampolining of hydrogel drops on a heated plate.

PubMed

Pham, Jonathan T; Paven, Maxime; Wooh, Sanghyuk; Kajiya, Tadashi; Butt, Hans-Jürgen; Vollmer, Doris

2017-10-13

The contact between liquid drops and hot solid surfaces is of practical importance for industrial processes, such as thermal spraying and spray cooling. The contact and bouncing of solid spheres is also an important event encountered in ball milling, powder processing, and everyday activities, such as ball sports. Using high speed video microscopy, we demonstrate that hydrogel drops, initially at rest on a surface, spontaneously jump upon rapid heating and continue to bounce with increasing amplitudes. Jumping is governed by the surface wettability, surface temperature, hydrogel elasticity, and adhesion. A combination of low-adhesion impact behavior and fast water vapor formation supports continuous bouncing and trampolining. Our results illustrate how the interplay between solid and liquid characteristics of hydrogels results in intriguing dynamics, as reflected by spontaneous jumping, bouncing, trampolining, and extremely short contact times.Drops of liquid on a hot surface can exhibit fascinating behaviour such as the Leidenfrost effect in which drops hover on a vapour layer. Here Pham et al. show that when hydrogel drops are placed on a rapidly heated plate they bounce to increasing heights even if they were initially at rest.

Discovery of novel inhibitors for Leishmania nucleoside diphosphatase kinase (NDK) based on its structural and functional characterization

NASA Astrophysics Data System (ADS)

Mishra, Arjun K.; Singh, Nidhi; Agnihotri, Pragati; Mishra, Shikha; Singh, Saurabh P.; Kolli, Bala K.; Chang, Kwang Poo; Sahasrabuddhe, Amogh A.; Siddiqi, M. I.; Pratap, J. Venkatesh

2017-06-01

Nucleoside diphosphate kinases (NDKs) are ubiquitous enzymes that catalyze the transfer of the γ-phosphate moiety from an NTP donor to an NDP acceptor, crucial for maintaining the cellular level of nucleoside triphosphates (NTPs). The inability of trypanosomatids to synthesize purines de novo and their dependence on the salvage pathway makes NDK an attractive target to develop drugs for the diseases they cause. Here we report the discovery of novel inhibitors for Leishmania NDK based on the structural and functional characterization of purified recombinant NDK from Leishmania amazonensis. Recombinant LaNDK possesses auto-phosphorylation, phosphotransferase and kinase activities with Histidine 117 playing an essential role. LaNDK crystals were grown by hanging drop vapour diffusion method in a solution containing 18% PEG-MME 500, 100 mM Bis-Tris propane pH 6.0 and 50 mM MgCl2. It belongs to the hexagonal space group P6322 with unit cell parameters a = b = 115.18, c = 62.18 Å and α = β = 90°, γ = 120°. The structure solved by molecular replacement methods was refined to crystallographic R-factor and Rfree values of 22.54 and 26.52%, respectively. Molecular docking and dynamics simulation -based virtual screening identified putative binding compounds. Protein inhibition studies of selected hits identified five inhibitors effective at micromolar concentrations. One of the compounds showed 45% inhibition of Leishmania promastigotes proliferation. Analysis of inhibitor-NDK complexes reveals the mode of their binding, facilitating design of new compounds for optimization of activities as drugs against leishmaniasis.

Investigation of cerebral hemodynamic changes during repeated sit-stand maneuver using functional near-infrared spectroscopy

NASA Astrophysics Data System (ADS)

Niu, Haijing; Li, Lin; Bhave, Gauri S.; Lin, Zi-jing; Tian, Fenghua; Khosrow, Behbehani; Zhang, Rong; Liu, Hanli

2011-03-01

The goal for this study is to examine cerebral autoregulation in response to a repeated sit-stand maneuver using both diffuse functional Near Infrared spectroscopy (fNIRS) and Transcranial Doppler sonography (TCD). While fNIRS can provide transient changes in hemodynamic response to such a physical action, TCD is a noninvasive transcranial method to detect the flow velocities in the basal or middle cerebral arteries (MCA). The initial phase of this study was to measure fNIRS signals from the forehead of subjects during the repeated sit-stand protocol and to understand the corresponding meaning of the detected signals. Also, we acquired preliminary data from simultaneous measurements of fNIRS and TCD during the sit-stand protocol so as to explore the technical difficulty of such an approach. Specifically, ten healthy adult subjects were enrolled to perform the planned protocol, and the fNIRS array probes with 4 sources and 10 detectors were placed on the subject's forehead to detect hemodynamic signal changes from the prefrontal cortex. The fNIRS results show that the oscillations of hemoglobin concentration were spatially global and temporally dynamic across the entire region of subject's forehead. The oscillation patterns in both hemoglobin concentrations and blood flow velocity seemed to follow one another; changes in oxy-hemoglobin concentration were much larger than those in deoxyhemoglobin concentration. These preliminary findings provide us with evidence that fNIRS is an appropriate means readily for studying cerebral hemodynamics and autoregulation during sit-stand maneuvers.

Leidenfrost Point and Estimate of the Vapour Layer Thickness

ERIC Educational Resources Information Center

Gianino, Concetto

2008-01-01

In this article I describe an experiment involving the Leidenfrost phenomenon, which is the long lifetime of a water drop when it is deposited on a metal that is much hotter than the boiling point of water. The experiment was carried out with high-school students. The Leidenfrost point is measured and the heat laws are used to estimate the…

A mechanical-force-driven physical vapour deposition approach to fabricating complex hydride nanostructures.

PubMed

Pang, Yuepeng; Liu, Yongfeng; Gao, Mingxia; Ouyang, Liuzhang; Liu, Jiangwen; Wang, Hui; Zhu, Min; Pan, Hongge

2014-03-24

Nanoscale hydrides desorb and absorb hydrogen at faster rates and lower temperatures than bulk hydrides because of their high surface areas, abundant grain boundaries and short diffusion distances. No current methods exist for the direct fabrication of nanoscale complex hydrides (for example, alanates, borohydrides) with unique morphologies because of their extremely high reducibility, relatively low thermodynamic stability and complicated elemental composition. Here, we demonstrate a mechanical-force-driven physical vapour deposition procedure for preparing nanoscale complex hydrides without scaffolds or supports. Magnesium alanate nanorods measuring 20-40 nm in diameter and lithium borohydride nanobelts measuring 10-40 nm in width are successfully synthesised on the basis of the one-dimensional structure of the corresponding organic coordination polymers. The dehydrogenation kinetics of the magnesium alanate nanorods are improved, and the nanorod morphology persists through the dehydrogenation-hydrogenation process. Our findings may facilitate the fabrication of such hydrides with improved hydrogen storage properties for practical applications.

A mechanical-force-driven physical vapour deposition approach to fabricating complex hydride nanostructures

NASA Astrophysics Data System (ADS)

Pang, Yuepeng; Liu, Yongfeng; Gao, Mingxia; Ouyang, Liuzhang; Liu, Jiangwen; Wang, Hui; Zhu, Min; Pan, Hongge

2014-03-01

Nanoscale hydrides desorb and absorb hydrogen at faster rates and lower temperatures than bulk hydrides because of their high surface areas, abundant grain boundaries and short diffusion distances. No current methods exist for the direct fabrication of nanoscale complex hydrides (for example, alanates, borohydrides) with unique morphologies because of their extremely high reducibility, relatively low thermodynamic stability and complicated elemental composition. Here, we demonstrate a mechanical-force-driven physical vapour deposition procedure for preparing nanoscale complex hydrides without scaffolds or supports. Magnesium alanate nanorods measuring 20-40 nm in diameter and lithium borohydride nanobelts measuring 10-40 nm in width are successfully synthesised on the basis of the one-dimensional structure of the corresponding organic coordination polymers. The dehydrogenation kinetics of the magnesium alanate nanorods are improved, and the nanorod morphology persists through the dehydrogenation-hydrogenation process. Our findings may facilitate the fabrication of such hydrides with improved hydrogen storage properties for practical applications.

Genital and Urinary Tract Defects

MedlinePlus

... wrong place. The clitoris is a female external sex organ. For boys and girls, bladder control problems Some babies need ... to sit down to urinate. And in some boys, the testicles don’t fully drop down ... problems with sex or urinating later in life. Hypospadias usually is ...

Measurement of hemodynamics during postural changes using a new wearable cephalic laser blood flowmeter.

PubMed

Fujikawa, Tetsuya; Tochikubo, Osamu; Kura, Naoki; Kiyokura, Takanori; Shimada, Junichi; Umemura, Satoshi

2009-10-01

Patients with orthostatic hypotension have pathologic hemodynamics related to changes in body posture. A new cephalic laser blood flowmeter that can be worn on the tragus to investigate the hemodynamics upon rising from a sitting or squatting posture was developed. The relationship between cephalic hemodynamics and cerebral ischemic symptoms in 63 subjects in a sitting, squatting, and standing positions using the new device was evaluated. Transient decrease in blood pressure within 15 s after rising to an erect position possibly causes dizziness, syncope, and fall. Subjects exhibiting dizziness upon standing showed a significant decrease in the cephalic blood flow (CBF) and indirect beat-to-beat systolic blood pressure, as monitored by the Finometer, and a significant correlation was observed between the drop ratio (drop value on rising/mean value in the squatting position) of CBF and that of systolic blood pressure. This new wearable CBF-meter is potentially useful for estimating cephalic hemodynamics and objectively diagnosing cerebral ischemic symptoms of subjects in a standing posture.

An in-vitro evaluation of silicone elastomer latex for topical drug delivery.

PubMed

Li, L C; Vu, N T

1995-06-01

A silicone elastomer latex was evaluated as a topical drug-delivery system. With the addition of a fumed silica and the removal of water, the latex produced elastomeric solid films. The water vapour permeability of the solid film was found to be a function of the film composition. An increase in silica content and the incorporation of a water-soluble component, PEG 3350, rendered the silicone elastomer-free film even more permeable to water vapour. The release of hydrocortisone from the elastomer film can be described by a matrix-diffusion-controlled mechanism. Drug diffusion is thought to occur through the hydrophobic silicone polymer network and the hydrated hydrophilic silica region in the film matrix. Silicone elastomer film with a higher silica content exhibited a faster drug-release rate. The addition of PEG 3350 to the film further enhanced the drug-release rate.

A replacement for methoxyflurane (Metofane) in open-circuit anaesthesia.

PubMed

Itah, Refael; Gitelman, Inna; Davis, Claytus

2004-07-01

Methoxyflurane (Metofane) has been widely used as an open-circuit anaesthetic in small laboratory animals for several decades. Its low vapour pressure and high blood solubility have permitted its use in convenient and simple drop-chamber/nose-cone setups. Recently, following the decision by the primary manufacturer to discontinue production, it has become increasingly difficult to obtain methoxyflurane. We describe here a simple and effective adaptation of isoflurane, an excellent inhalation anaesthetic, to open-circuit drop-chamber/nose-cone anaesthesia. It was found that the vapour concentration of isoflurane could be continuously varied by dissolving the anaesthetic in propylene glycol and that a 20% solution produced effective anaesthesia such that in adult mice, 2 ml of 20% isoflurane in propylene glycol induced anaesthesia within 2 min in a one-litre drop chamber. Furthermore, anaesthesia maintenance with 20% isoflurane was tested in two sets of mice. In one set, surgical plane anaesthesia was maintained for 10 min in a head chamber. After removal of the chamber, the animals awoke within one minute and recovered without any indication of post-anaesthetic distress. The second set contained pregnant mice; here anaesthesia was maintained for between 10 and 12 min, during which laparotomy, exposure of one uterine horn, intrauterine injection and wound closure were completed. The recovery from anaesthesia was also within a minute and with no signs of distress. Healthy litters were delivered after a normal gestation. This isoflurane/propylene glycol procedure is simple, effective and humane, and is a good substitute for methoxyflurane.

Fracture development within a stratovolcano: The Karaha-Telaga Bodas geothermal field, Java volcanic arc

USGS Publications Warehouse

Nemcok, M.; Moore, J.N.; Allis, R.; McCulloch, J.

2004-01-01

Karaha-Telaga Bodas, a vapour-dominated geothermal system located in an active volcano in western Java, is penetrated by more than two dozen deep geothermal wells reaching depths of 3 km. Detailed paragenetic and fluid-inclusion studies from over 1000 natural fractures define the liquid-dominated, transitional and vapour-dominated stages in the evolution of this system. The liquid-dominated stage was initiated by ashallow magma intrusion into the base of the volcanic cone. Lava and pyroclastic flows capped a geothermal system. The uppermost andesite flows were only weakly fractured due to the insulating effect of the intervening altered pyroclastics, which absorbed the deformation. Shear and tensile fractures that developed were filled with carbonates at shallow depths, and by quartz, epidote and actinolite at depths and temperatures over 1 km and 300??C. The system underwent numerous cycles of overpressuring, documented by subhorizontal tensile fractures, anastomosing tensile fracture patterns and implosion breccias. The development of the liquidsystem was interrupted by a catastrophic drop in fluid pressures. As the fluids boiled in response to this pressure drop, chalcedony and quartz were selectively deposited in fractures that had the largest apertures and steep dips. The orientations of these fractures indicate that the escaping overpressured fluids used the shortest possible paths to the surface. Vapour-dominated conditions were initiated at this time within a vertical chimney overlying the still hot intrusion. As pressures declined, these conditions spread outward to form the marginal vapour-dominated region encountered in the drill holes. Downward migration of the chimney, accompanied by growth of the marginal vapour-dominated regime, occurred as the intrusion cooled and the brittle-ductile transition migrated to greater depths. As the liquids boiled off, condensate that formed at the top of the vapour-dominated zone percolated downward and low-salinity meteoric water entered the marginal parts of the system. Calcite, anhydrite and fluorite precipitated in fractures on heating. Progressive sealing of the fractures resulted in the downward migration of the cap rock. In response to decreased pore pressure in the expanding vapour zone, walls of the fracture system within the vapour-dominated reservoir progressively collapsed. It left only residual permeability in the remaining fracture volume, with apertures supported only by asperities or propping breccia. In places where normal stresses acting on the fracture walls exceeded the compressive strength of the wall rock, the fractures have completely collapsed. Fractures within the present-day cap rock include strike- and oblique-slip faults, normal faults and tensile fractures, all controlled by a strike-slip stress regime. The reservoir is characterized by normal faults and tensile fractures controlled by a normal-fault stress regime. The fractures show no evidence that the orientation of the stress field has changed since fracture propagation began. Fluid migration in the lava and pyroclastic flows is controlled by fractures. Matrix permeability controls fluid flow in the sedimentary sections of the reservoir. Productive fractures are typically roughly perpendicular to the minimum compressive stress, ??3, and are prone to slip and dilation within the modern stress regime. ?? The Geological Society of London 2004.

Productivity of transcriptionists using a treadmill desk.

PubMed

Thompson, Warren G; Levine, James A

2011-01-01

Time spent sitting increases all-cause mortality. Sedentary occupations are a major contributor to the obesity epidemic. A treadmill desk offers the potential to increase activity while working; however, it is important to make sure that productivity does not decline. The purpose of this study is to evaluate productivity while using a treadmill desk. Eleven experienced medical transcriptionists participated in the study. Transcriptionists were given 4 hours training in the use of a treadmill desk. They were asked to transcribe tapes for 8 hours both while sitting and while using the treadmill desk. Speed and accuracy of transcription were compared as were the average expended calories per hour. The accuracy of transcription did not differ between sitting and walking transcriptions. The speed of transcription was 16% slower while walking than while sitting (p < 0.001). The transcriptionists expended 100 calories per hour more when they transcribed while walking than when they transcribed while sitting (p < 0.001). The treadmill desk offers a way to reduce sedentariness in the workplace and has potential to reduce employee obesity and health care costs. However, more than 4 hours of training will be necessary to prevent a significant drop in employee productivity.

A modified method for diffusive monitoring of 3-ethenylpyridine as a specific marker of environmental tobacco smoke

NASA Astrophysics Data System (ADS)

Kuusimäki, Leea; Peltonen, Kimmo; Vainiotalo, Sinikka

A previously introduced method for monitoring environmental tobacco smoke (ETS) was further validated. The method is based on diffusive sampling of a vapour-phase marker, 3-ethenylpyridine (3-EP), with 3 M passive monitors (type 3500). Experiments were done in a dynamic chamber to assess diffusive sampling in comparison with active sampling in charcoal tubes or XAD-4 tubes. The sampling rate for 3-EP collected on the diffusive sampler was 23.1±0.6 mL min -1. The relative standard deviation for parallel samples ( n=6) ranged from 4% to 14% among experiments ( n=9). No marked reverse diffusion of 3-EP was detected nor any significant effect of relative humidity at 20%, 50% or 80%. The diffusive sampling of 3-EP was validated in field measurements in 15 restaurants in comparison with 3-EP and nicotine measurements using active sampling. The 3-EP concentration in restaurants ranged from 0.01 to 9.8 μg m -3, and the uptake rate for 3-EP based on 92 parallel samples was 24.0±0.4 mL min -1. A linear correlation ( r=0.98) was observed between 3-EP and nicotine concentrations, the average ratio of 3-EP to nicotine being 1:8. Active sampling of 3-EP and nicotine in charcoal tubes provided more reliable results than sampling in XAD-4 tubes. All samples were analysed using gas chromatography-mass spectrometry after elution with a 15% solution of pyridine in toluene. For nicotine, the limit of quantification of the charcoal tube method was 4 ng per sample, corresponding to 0.04 μg m -3 for an air sample of 96 L. For 3-EP, the limit of quantification of the diffusive method was 0.5-1.0 ng per sample, corresponding to 0.04-0.09 μg m -3 for 8 h sampling. The diffusive method proved suitable for ETS monitoring, even at low levels of ETS.

Looking Under a Leidenfrost Drop

NASA Astrophysics Data System (ADS)

Burton, Justin; Sharpe, Aaron; van der Veen, Roeland; Franco, Andres; Nagel, Sidney

2011-11-01

The Leidenfrost effect can be observed when small water drops move around effortlessly without sticking on a hot pan. The transition to a levitated state, where the drops rest on an insulating layer of vapor, occurs at the Leidenfrost temperature. Experiment and theory have examined the lifetime and maximum size of Leidenfrost drops. However, the liquid-vapor interface beneath the drop has not been fully charcterized. We report experiments using laser-light interference to measure the geometry of the liquid-vapor interface. By imaging the interference fringes produced between the bottom surface of the liquid and the hot substrate, we can measure the curvature of the vapor pocket beneath the drop as well as the azimuthal undulations along the neck that sits closest to the surface. From these measurements, we can extrapolate the shape of the bottom of the drop, which fluctuates in time with a period of a few milliseconds for millimeter-sized water drops. Our measurements of the azimuthal neck radius agree with predictions: the difference between the drop and neck radii, (Rd -Rn) ~0.53 λ in the limit of large drops where λ is the capillary length of the fluid. For small drops we recover the result found in that Rn ~Rd2 / λ .

Heat and mass transfer in flames

NASA Technical Reports Server (NTRS)

Faeth, G. M.

1986-01-01

Heat- and mass-transfer processes in turbulent diffusion flames are discussed, considering turbulent mixing and the structure of single-phase flames, drop processes in spray flames, and nonluminous and luminous flame radiation. Interactions between turbulence and other phenomena are emphasized, concentrating on past work of the author and his associates. The conserved-scalar formalism, along with the laminar-flamelet approximation, is shown to provide reasonable estimates of the structure of gas flames, with modest levels of empiricism. Extending this approach to spray flames has highlighted the importance of drop/turbulence interactions; e.g., turbulent dispersion of drops, modification of turbulence by drops, etc. Stochastic methods being developed to treat these phenomena are yielding encouraging results.

Crystallization and preliminary X-ray diffraction studies of the cysteine protease ervatamin A from Ervatamia coronaria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chakraborty, Sibani; Biswas, Sampa; Chakrabarti, Chandana

2005-06-01

Ervatamin A is a papain-family cysteine protease with high activity and stability. It has been isolated and purified from the latex of the medicinal flowering plant E. coronaria and crystallized by the vapour-diffusion technique. Crystals diffracted to 2.1 Å and the structure was solved by molecular replacement. The ervatamins are highly stable cysteine proteases that are present in the latex of the medicinal plant Ervatamia coronaria and belong to the papain family, members of which share similar amino-acid sequences and also a similar fold comprising two domains. Ervatamin A from this family, a highly active protease compared with others frommore » the same source, has been purified to homogeneity by ion-exchange chromatography and crystallized by the vapour-diffusion method. Needle-shaped crystals of ervatamin A diffract to 2.1 Å resolution and belong to space group C222{sub 1}, with unit-cell parameters a = 31.10, b = 144.17, c = 108.61 Å. The solvent content using an ervatamin A molecular weight of 27.6 kDa is 43.9%, with a V{sub M} value of 2.19 Å{sup 3} Da{sup −1} assuming one protein molecule in the asymmetric unit. A molecular-replacement solution has been found using the structure of ervatamin C as a search model.« less

Medium-range predictability of early summer sea ice thickness distribution in the East Siberian Sea based on the TOPAZ4 ice-ocean data assimilation system

NASA Astrophysics Data System (ADS)

Nakanowatari, Takuya; Inoue, Jun; Sato, Kazutoshi; Bertino, Laurent; Xie, Jiping; Matsueda, Mio; Yamagami, Akio; Sugimura, Takeshi; Yabuki, Hironori; Otsuka, Natsuhiko

2018-06-01

Accelerated retreat of Arctic Ocean summertime sea ice has focused attention on the potential use of the Northern Sea Route (NSR), for which sea ice thickness (SIT) information is crucial for safe maritime navigation. This study evaluated the medium-range (lead time below 10 days) forecast of SIT distribution in the East Siberian Sea (ESS) in early summer (June-July) based on the TOPAZ4 ice-ocean data assimilation system. A comparison of the operational model SIT data with reliable SIT estimates (hindcast, satellite and in situ data) showed that the TOPAZ4 reanalysis qualitatively reproduces the tongue-like distribution of SIT in ESS in early summer and the seasonal variations. Pattern correlation analysis of the SIT forecast data over 3 years (2014-2016) reveals that the early summer SIT distribution is accurately predicted for a lead time of up to 3 days, but that the prediction accuracy drops abruptly after the fourth day, which is related to a dynamical process controlled by synoptic-scale atmospheric fluctuations. For longer lead times ( > 4 days), the thermodynamic melting process takes over, which contributes to most of the remaining prediction accuracy. In July 2014, during which an ice-blocking incident occurred, relatively thick SIT ( ˜ 150 cm) was simulated over the ESS, which is consistent with the reduction in vessel speed. These results suggest that TOPAZ4 sea ice information has great potential for practical applications in summertime maritime navigation via the NSR.

Preliminary crystallographic analysis of the major capsid protein P2 of the lipid-containing bacteriophage PM2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abrescia, Nicola G. A.; Kivelä, Hanna M.; Grimes, Jonathan M.

2005-08-01

The viral capsid protein P2 of bacteriophage PM2 has been crystallized. Preliminary X-ray analysis demonstrates the position and orientation of the two trimers in the asymmetric unit. PM2 (Corticoviridae) is a dsDNA bacteriophage which contains a lipid membrane beneath its icosahedral capsid. In this respect it resembles bacteriophage PRD1 (Tectiviridae), although it is not known whether the similarity extends to the detailed molecular architecture of the virus, for instance the fold of the major coat protein P2. Structural analysis of PM2 has been initiated and virus-derived P2 has been crystallized by sitting-nanodrop vapour diffusion. Crystals of P2 have been obtainedmore » in space group P2{sub 1}2{sub 1}2, with two trimers in the asymmetric unit and unit-cell parameters a = 171.1, b = 78.7, c = 130.1 Å. The crystals diffract to 4 Å resolution at the ESRF BM14 beamline (Grenoble, France) and the orientation of the non-crystallographic threefold axes, the spatial relationship between the two trimers and the packing of the trimers within the unit cell have been determined. The trimers form tightly packed layers consistent with the crystal morphology, possibly recapitulating aspects of the arrangement of subunits in the virus.« less

Device For Controlling Crystallization Of Protein

NASA Technical Reports Server (NTRS)

Noever, David A.

1993-01-01

Variable sandwich spacer enables optimization of evaporative driving force that governs crystallization of protein from solution. Mechanically more rigid than hanging-drop and sitting-drop devices. Large oscillations and dislodgment of drop of solution in response to vibrations suppressed by glass plates. Other advantages include: suitable for automated delivery, stable handling, and programmable evaporation of protein solution; controlled configuration enables simple and accurate determination of volume of solution without disrupting crystallization; pH and concentration of precipitant controlled dynamically because pH and concentration coupled to rate of evaporation, controllable via adjustment of gap between plates; and enables variation of ratio between surface area and volume of protein solution. Alternative version, plates oriented vertically instead of horizontally.

Effects of body position on the carbon monoxide diffusing capacity in patients with chronic heart failure: relation to hemodynamic changes.

PubMed

Faggiano, P; D'Aloia, A; Simoni, P; Gualeni, A; Foglio, K; Ambrosino, N; Giordano, A

1998-01-01

Pulmonary diffusion has been found to be reduced in patients with congestive heart failure. The effects of postural changes on the diffusing capacity had been evaluated in healthy subjects, but not in patients with heart failure. The aim of this study was to evaluate the posture-induced changes in diffusing capacity in patients with chronic heart failure and their relation to the hemodynamic profile. The pulmonary carbon monoxide diffusing capacity (DLCO) was measured in the supine position, with 20 degrees passive head elevation, and in the sitting position, both postures maintained for 10 min, in a group of 32 male patients with mild to moderate chronic heart failure due to left ventricular systolic dysfunction (ejection fraction <35%). On a separate day, in the absence of any changes in clinical status and therapy, the hemodynamic parameters were measured by right-heart catheterization. The sequence of postures was assigned randomly. The mean values of DLCO were slightly reduced and did not differ in the two positions (20.3 +/- 5.7 vs. 19.4 +/- 5.6 ml/min/mm Hg, 77 +/- 23 vs. 75 +/- 20% of predicted, respectively). The patients were then subdivided according to changes in DLCO from the supine to the sitting position: DLCO increased (+23%) in 9 patients (28%, group 1), decreased (-17.5%) in 17 patients (53%, group 2), and remained within the coefficient of reproducibility ( +/- 5 %) in 6 patients (group 3). As compared with group 2, group 1 patients showed a significant increase in mean pulmonary artery pressure (+7 vs. -15%, p < 0.01) and pulmonary capillary wedge pressure (+8 vs. -22%, p < 0.005) from the supine to the sitting position, while the cardiac index showed a smaller - but not significant - decrease in group 1 (-5 vs. -12%). The percent changes in DLCO significantly correlated with changes in pulmonary capillary wedge (r = 0.54, p < 0.0005) and mean pulmonary artery (r = 0.47, p < 0.005) pressures. In chronic heart failure postural changes may induce different responses in diffusing capacity. To a greater extent than in healthy subjects, the most common response is a decrease in DLCO in the sitting as compared with the supine position. The DLCO changes correlate with variations in pulmonary circulation pressure, probably due to changes in pulmonary vascular recruitment and pulmonary capillary blood volume.

Crystallization and preliminary crystallographic studies of LipA, a secretory lipase/esterase from Xanthomonas oryzae pv. oryzae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aparna, Gudlur; Chatterjee, Avradip; Jha, Gopaljee

2007-08-01

The crystallization and preliminary crystallographic studies of LipA, a lipase/esterase secreted by X. oryzae pv. oryzae during its infection of rice plants, are reported. Xanthomonas oryzae pv. oryzae is the causal agent of bacterial leaf blight, a serious disease of rice. Several enzymes that are secreted through the type II secretion system of this bacterium play an important role in the plant–microbe interaction, being important for virulence and also being able to induce potent host defence responses. One of these enzymes is a secretory lipase/esterase, LipA, which shows a very weak homology to other bacterial lipases and gives a positivemore » tributyrin plate assay. In this study, LipA was purified from the culture supernatant of an overexpressing clone of X. oryzae pv. oryzae and two types of crystals belonging to space group C2 but with two different unit-cell parameters were obtained using the hanging-drop vapour-diffusion method. Type I crystals diffract to a maximum resolution of 1.89 Å and have unit-cell parameters a = 93.1, b = 62.3, c = 66.1 Å, β = 90.8°. Type II crystals have unit-cell parameters a = 103.6, b = 54.6, c = 66.3 Å, β = 92.6° and diffract to 1.86 Å. Solvent-content analysis shows one monomer in the asymmetric unit in both the crystal forms.« less

Cloning, overexpression, purification and preliminary X-ray analysis of a feast/famine regulatory protein (Rv2779c) from Mycobacterium tuberculosis H37Rv.

PubMed

Dey, Abhishek; Ramachandran, Ravishankar

2014-01-01

Rv2779c from Mycobacterium tuberculosis is a feast/famine regulatory protein. This class of proteins are also known as the leucine-responsive regulatory protein/asparagine synthase C family (Lrp/AsnC) of transcriptional regulators and are known to be involved in various metabolic processes in bacteria and fungi. They contain a RAM (regulator of amino-acid metabolism) domain that is rarely found in humans and acts as the oligomerization domain. Since the oligomeric status is often linked to the particular functional role in these proteins, binding of ligands to the domain can elicit specific functional responses. Full-length Rv2779c corresponding to a molecular mass of 19.8 kDa and 179 residues was cloned and purified to homogeneity following transformation into Escherichia coli C41 (DE3) cells. Crystals were grown by vapour diffusion using the hanging-drop method. Diffraction data extending to 2.8 Å resolution were collected from a single crystal that belonged to space group P2(1)2(1)2, with unit-cell parameters a = 99.6, b = 146.0, c = 49.9 Å. Matthews coefficient (VM) calculations suggest that four molecules are present in the asymmetric unit, corresponding to a solvent content of ∼46%. Molecular-replacement calculations using the crystal structure of a homologue, Rv3291c, as the search model gave an unambiguous solution corresponding to four subunits in the asymmetric unit.

Crystallization and preliminary X-ray diffraction studies of delta-toxin from Clostridium perfringens.

PubMed

Huyet, Jessica; Gilbert, Maryse; Popoff, Michel R; Basak, Ajit

2011-03-01

Clostridium perfringens is a Gram-positive anaerobic bacterium that is responsible for a wide range of diseases in humans and both wild and domesticated animals, including birds. C. perfringens is notable for its ability to produce a plethora of toxins, e.g. phospholipases C (alpha-toxin), pore-forming toxins (epsilon-toxin, beta-toxin and enterotoxin) and binary toxins (iota-toxin). Based on alpha-, beta-, epsilon- and iota-toxin production, the bacterium is classified into five different toxinotypes (A-E). Delta-toxin, which is a 32.6 kDa protein with 290 amino acids, is one of three haemolysins released by type C and possibly by type B strains of C. perfringens. This toxin is immunogenic and lytic to erythrocytes from the even-toed ungulates sheep, goats and pigs, and is cytotoxic to other cell types such as rabbit macrophages, human monocytes and blood platelets from goats, rabbits, guinea pigs and humans. The recombinant delta-toxin has been cloned, expressed, purified and crystallized in two different crystal forms by the hanging-drop vapour-diffusion method. Of these two different crystal forms, only the form II crystal diffracted to atomic resolution (dmin=2.4 Å), while the form I crystal diffracted to only 15 Å resolution. The form II crystals belonged to space group P2(1)2(1)2, with one molecule in the crystallographic asymmetric unit and unit-cell parameters a=49.66, b=58.48, c=112.93 Å.

In vitro comparison of antimicrobial activity of aqueous decoction of Coriandrum sativum, and Dentol Drop with chlorhexidine on Streptococcus mutans

PubMed Central

Moradian, Hamid; Bazargani, Abdollah; Rafiee, Azade; Nazarialam, Ali

2013-01-01

Background and objectives Dental caries is still remained as a major health problem. This problem has created a new interest to search for new antimicrobial agents from various sources including medicinal plants. Since limited data is available so far regarding the antibacterial effect of Coriandrum sativum seed and Dentol Drop against Streptococcus mutans, this study aims to assess this activity. Materials and Methods This experimental study was conducted in Shiraz University of Medical Sciences. In vitro comparison of antimicrobial activity of aqueous decoction of Coriandrum sativum seed and Dentol drop with chlorhexidine against Streptococcus mutans was evaluated using disk diffusion and broth microdilution assays. Positive and negative controls were considered. The data was statistically analyzed by applying Kruskal-Wallis and Tukey post-hoc test to compare the groups using SPSS software (version 17). Results Dentol drop showed a remarkable antibacterial activity, in comparison with chlorhexidine, against S. mutans in the disk diffusion (p value = 0.005), and broth microdilution assays (p value = 0.0001). Based on the results of this study, Coriandrum sativum seed did not posses any antibacterial property. Conclusion Coriandrum sativum seed showed no anti-Streptococcus mutans activity. Dentol drop exhibited a remarkable antibacterial activity against S. mutans when tested in vitro. Dentol drop can be further studied as a preventive measure for dental caries. PMID:24475330

Crystallization and preliminary X-ray diffraction of the DEAD-box protein Mss116p complexed with an RNA oligonucleotide and AMP-PNP

DOE Office of Scientific and Technical Information (OSTI.GOV)

Del Campo, Mark; Lambowitz, Alan M.; Texas)

2009-09-02

The Saccharomyces cerevisiae DEAD-box protein Mss116p is a general RNA chaperone which functions in mitochondrial group I and group II intron splicing, translation and RNA-end processing. For crystallization trials, full-length Mss116p and a C-terminally truncated protein (Mss116p/{Delta}598-664) were overproduced in Escherichia coli and purified to homogeneity. Mss116p exhibited low solubility in standard solutions ({le}1 mg ml{sup -1}), but its solubility could be increased by adding 50 mM L-arginine plus 50 mM L-glutamate and 50% glycerol to achieve concentrations of {approx}10 mg ml{sup -1}. Initial crystals were obtained by the microbatch method in the presence of a U{sub 10} RNA oligonucleotidemore » and the ATP analog AMP-PNP and were then improved by using seeding and sitting-drop vapor diffusion. A cryocooled crystal of Mss116p/{Delta}598-664 in complex with AMP-PNP and U{sub 10} belonged to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 88.54, b = 126.52, c = 55.52 {angstrom}, and diffracted X-rays to beyond 1.9 {angstrom} resolution using synchrotron radiation from sector 21 at the Advanced Photon Source.« less

Studies of the kinetics and mechanism of the oxidation of uranium by dry and moist air A model for determining the oxidation rate over a wide range of temperatures and water vapour pressures

NASA Astrophysics Data System (ADS)

McGillivray, G. W.; Geeson, D. A.; Greenwood, R. C.

1994-01-01

The rate of oxidation of uranium metal by moist air has been measured at temperatures from 115 to 350°C and water vapour pressures from 0 to 47 kPa (350 Torr). From this and from previously reported data, a model has been developed which allows the rate of uranium oxidation to be calculated at any particular combination of temperature and water vapour pressure of interest, in the range 0-350°C and 0-101.3 kPa (760 Torr). The model is based on the assumption that the surface concentration of water determines the rate of reaction and that the adsorption of water onto the oxide follows a Langmuir type isotherm. Theoretical plots of rate as a function of water vapour pressure and Arrhenius plots derived from the model have been shown to be in good agreement with experimental data. The model assumes separate contributions to the overall observed rate from oxygen and water vapour. Surface studies have been carried out using SIMS (secondary ion mass spectrometry). Depth profiling of the oxide produced by isotopically labelled reagents ( 18O 2 and H 218O), has shown that oxygen from both reactants is incorporated into the oxide layer in the ratio predicted by the kinetic model. This supports a mechanism in which oxygen and water vapour produce separate diffusing species (possibly O 2- and OH -).

Effect of Marangoni Convection on Surfactant Transfer Between the Drop Connected to the Reservoir and Surrounding Liquid

NASA Astrophysics Data System (ADS)

Kostarev, K.; Denisova, M.; Shmyrov, A.

2018-03-01

The paper presents the results of comparative investigation of the interaction between the capillary and buoyant mechanisms of motion in a problem of surfactant mass transfer between an insoluble drop and surrounding fluid under different gravity conditions. The research was performed for the drop that is coupled with the reservoir filled with a source mixture through a long thin tube (needle). Visualization of the flow patterns and concentration fields has shown that surfactant diffusion from the needle at normal gravity leads to the onset of the oscillatory mode of the capillary convection in the drop. It has been found that the frequency of the Marangoni convection outbursts, the lifetime of the oscillatory flow modes and the amount of the source mixture involved in the process of mass transfer depend on the drop size and initial concentration of the surfactant. The obtained results are compared with the cases of surfactant diffusion from the isolated drop under terrestrial conditions and from the drop coupled with reservoir in microgravity. Additionally, a series of experiments were performed to investigate diffusion of a surfactant from the surrounding solution into a drop.

The boundary condition for vertical velocity and its interdependence with surface gas exchange

NASA Astrophysics Data System (ADS)

Kowalski, Andrew S.

2017-07-01

The law of conservation of linear momentum is applied to surface gas exchanges, employing scale analysis to diagnose the vertical velocity (w) in the boundary layer. Net upward momentum in the surface layer is forced by evaporation (E) and defines non-zero vertical motion, with a magnitude defined by the ratio of E to the air density, as w = E/ρ. This is true even right down at the surface where the boundary condition is w|0 = E/ρ|0 (where w|0 and ρ|0 represent the vertical velocity and density of air at the surface). This Stefan flow velocity implies upward transport of a non-diffusive nature that is a general feature of the troposphere but is of particular importance at the surface, where it assists molecular diffusion with upward gas migration (of H2O, for example) but opposes that of downward-diffusing species like CO2 during daytime. The definition of flux-gradient relationships (eddy diffusivities) requires rectification to exclude non-diffusive transport, which does not depend on scalar gradients. At the microscopic scale, the role of non-diffusive transport in the process of evaporation from inside a narrow tube - with vapour transport into an overlying, horizontal airstream - was described long ago in classical mechanics and is routinely accounted for by chemical engineers, but has been neglected by scientists studying stomatal conductance. Correctly accounting for non-diffusive transport through stomata, which can appreciably reduce net CO2 transport and marginally boost that of water vapour, should improve characterisations of ecosystem and plant functioning.

Vapour-Phase Processes Control Liquid-Phase Isotope Profiles in Unsaturated Sphagnum Moss

NASA Astrophysics Data System (ADS)

Edwards, T. W.; Yi, Y.; Price, J. S.; Whittington, P. N.

2009-05-01

Seminal work in the early 1980s clearly established the basis for predicting patterns of heavy-isotope enrichment of pore waters in soils undergoing evaporation. A key feature of the process under steady-state conditions is the development of stable, convex-upward profiles whose shape is controlled by the balance between downward-diffusing heavy isotopologues concentrated by evaporative enrichment at the surface and the upward capillary flow of bulk water that maintains the evaporative flux. We conducted an analogous experiment to probe evaporation processes within 20-cm columns of unsaturated, living and dead (but undecomposed) Sphagnum moss evaporating under controlled conditions, while maintaining a constant water table. The experiment provided striking evidence of the importance of vapour-liquid mass and isotope exchange in the air-filled pores of the Sphagnum columns, as evidenced by the rapid development of hydrologic and isotopic steady-state within hours, rather than days, i.e., an order of magnitude faster than possible by liquid-phase processes alone. This is consistent with the notion that vapour-phase processes effectively "short-circuit" mass and isotope fluxes within the Sphagnum columns, as proposed also in recent characterizations of water dynamics in transpiring leaves. Additionally, advection-diffusion modelling of our results supports independent estimates of the effective liquid-phase diffusivities of the respective heavy water isotopologues, 2.380 x 10-5 cm2 s-1 for 1H1H18O and 2.415 x 10-5 cm2 s-1 for 1H2H16O, which are in notably good agreement with the "default" values that are typically assumed in soil and plant water studies.

Oil mist and vapour concentrations from drilling fluids: inter- and intra-laboratory comparison of chemical analyses.

PubMed

Galea, Karen S; Searl, Alison; Sánchez-Jiménez, Araceli; Woldbæk, Torill; Halgard, Kristin; Thorud, Syvert; Steinsvåg, Kjersti; Krüger, Kirsti; Maccalman, Laura; Cherrie, John W; van Tongeren, Martie

2012-01-01

There are no recognized analytical methods for measuring oil mist and vapours arising from drilling fluids used in offshore petroleum drilling industry. To inform the future development of improved methods of analysis for oil mist and vapours this study assessed the inter- and intra-laboratory variability in oil mist and vapour analysis. In addition, sample losses during transportation and storage were assessed. Replicate samples for oil mist and vapour were collected using the 37-mm Millipore closed cassette and charcoal tube assembly. Sampling was conducted in a simulated shale shaker room, similar to that found offshore for processing drilling fluids. Samples were analysed at two different laboratories, one in Norway and one in the UK. Oil mist samples were analysed using Fourier transform infrared spectroscopy (FTIR), while oil vapour samples were analysed by gas chromatography (GC). The comparison of replicate samples showed substantial within- and between-laboratory variability in reported oil mist concentrations. The variability in oil vapour results was considerably reduced compared to oil mist, provided that a common method of calibration and quantification was adopted. The study also showed that losses can occur during transportation and storage of samples. There is a need to develop a harmonized method for the quantification of oil mist on filter and oil vapour on charcoal supported by a suitable proficiency testing scheme for laboratories involved in the analysis of occupational hygiene samples for the petroleum industry. The uncertainties in oil mist and vapour measurement have substantial implications in relation to compliance with occupational exposure limits and also in the reliability of any exposure-response information reported in epidemiological studies.

A review of water recovery by vapour permeation through membranes.

PubMed

Bolto, Brian; Hoang, Manh; Xie, Zongli

2012-02-01

In vapour permeation the feed is a vapour, not a liquid as in pervaporation. The process employs a polymeric membrane as a semi-permeable barrier between the feed side under high pressure and the permeate side under low pressure. Separation is achieved by the different degrees to which components are dissolved in and diffuse through the membrane, the system working according to a solution-diffusion mechanism. The materials used in the membrane depend upon the types of compounds being separated, so water transport is favoured by hydrophilic material, whether organic or inorganic. The process is used for the dehydration of natural gas and various organic solvents, notably alcohol as biofuel, as well as the removal of water from air and its recovery from waste steam. Waste steam can be found in almost every plant/factory where steam is used. It is frequently contaminated and cannot be reused. Discharging the spent steam to the atmosphere is a serious energy loss and environmental issue. Recycling the steam can significantly improve the overall energy efficiency of an industry, which is responsible for massive CO(2) emissions. Steam separation at high fluxes and temperatures has been accomplished with a composite poly(vinyl alcohol) membrane containing silica nanoparticles, and also, less efficiently, with an inorganic zeolite membrane. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

Tailoring barrier properties of thermoplastic corn starch-based films (TPCS) by means of a multilayer design.

PubMed

Fabra, María José; López-Rubio, Amparo; Cabedo, Luis; Lagaron, Jose M

2016-12-01

This work compares the effect of adding different biopolyester electrospun coatings made of polycaprolactone (PCL), polylactic acid (PLA) and polyhydroxybutyrate (PHB) on oxygen and water vapour barrier properties of a thermoplastic corn starch (TPCS) film. The morphology of the developed multilayer structures was also examined by Scanning Electron Microscopy (SEM). Results showed a positive linear relationship between the amount of the electrospun coatings deposited onto both sides of the TPCS film and the thickness of the coating. Interestingly, the addition of electrospun biopolyester coatings led to an exponential oxygen and water vapour permeability drop as the amount of the electrospun coating increased. This study demonstrated the versatility of the technology here proposed to tailor the barrier properties of food packaging materials according to the final intended use. Copyright © 2016 Elsevier Inc. All rights reserved.

A sensitivity study of diffusional mass transfer of gases in tropical storm hydrometeors

NASA Astrophysics Data System (ADS)

Ghosh, Satyajit; Gumber, Siddharth; Varotsos, C.

2017-11-01

This paper quantifies mass transfer and diffusional uptake rates of gases in liquid and solid hydrometeors within a cyclonic system. The non-availability of transfer rates for trace gases diffusing into storm hydrometeors, particularly over polluted urban conurbations, often constrain modellers the world over; however, this is an essential requirement to quantify the scavenging rates over the region concerned. The present paper seeks to provide modellers with such rates. Further, all of the earlier studies apply only to temperate regimes, and surprisingly identical formulations are assumed even for tropical conditions. The present analysis fills this research gap and couples cloud morphology with the associated thermodynamics through Weather Research and Forecasting (WRF) runs for cyclone Chapala (27 October 2015-04 November 2015) which battered the coasts of Yemen (Skamarock et al. 2008). It was a good example for undertaking this sensitivity study because the vertical extent spanned from around 0.75 to 16 km—enabling uptake rate calculations over both droplet and ice phases. Many of the diffusing gases were polar; the dipole moment of sulphur dioxide (SO2) and water vapour (H2O) was also included using a full Lennard-Jones model to compute the binary diffusivities of these gases as they diffused into the droplets mixed with water vapour. The first-order uptake rate constants ranged from 2.08 × 10-07 to 3.44 × 10-06 (s-1) and 1.97 × 10-07 to 7.81 × 10-07 (s-1) for H2O and SO2 respectively. The rates are of the order of 10-09 (s-1) for diffusion of water vapour into ice crystals further aloft. Closely linked with the gas uptake rates is another crucial parameter—the mass accommodation coefficient, α. The most widely used values are 1 and 0.036 (Pruppacher and Klett 1998)—the chosen values are restrictive and warrants a closer look. In storm systems, the vertical extents are in the kilometre range. Chapala with a large vertical extent warrants a full profile calculation. This study shows that for H2O vapour, α values range from a low of 0.004 reaching up to 0.046, and for SO2 impacting the liquid droplets, they are 0.004 to 0.077. Using these values in cloud droplet growth equations showed large changes in the positioning of the cloud base height up to about a maximum of 30%—a classic example illustrating the coupling of microphysics with dynamics suggesting that even large-scale models should cautiously use standard un-corrected accommodation and diffusion coefficients. Over polluted environments, aerosol number concentrations are very high—several hundreds of particles in a cubic centimetre—the cumulative effect involving such large-scale scavenging ends up in causing substantive changes in the actual scavenging rates. This is likely to affect overall radiative transfer calculations and must be corrected.

Crystallization and preliminary X-ray diffraction analysis of Leishmania major dihydroorotate dehydrogenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cordeiro, Artur T.; Feliciano, Patricia R.; Nonato, M. Cristina, E-mail: cristy@fcfrp.usp.br

2006-10-01

Dihydroorotate dehydrogenase from L. major has been crystallized by the vapour-diffusion technique using lithium sulfate as the precipitant agent. A complete data set from a native crystal has been collected to 2.0 Å resolution using an in-house rotating-anode generator. Dihydroorotate dehydrogenases (DHODHs) are flavin-containing enzymes that catalyze the oxidation of l-dihydroorotate to orotate, the fourth step in the de novo pyrimidine nucleotide synthesis pathway. In this study, DHODH from Leishmania major has been crystallized by the vapour-diffusion technique using lithium sulfate as the precipitating agent. The crystals belong to space group P6{sub 1}, with unit-cell parameters a = 143.7, cmore » = 69.8 Å. X-ray diffraction data were collected to 2.0 Å resolution using an in-house rotating-anode generator. Analysis of the solvent content and the self-rotation function indicate the presence of two molecules in the asymmetric unit. The structure has been solved by the molecular-replacement technique.« less

Expression, crystallization and preliminary crystallographic analysis of RNA-binding protein Hfq (YmaH) from Bacillus subtilis in complex with an RNA aptamer.

PubMed

Baba, Seiki; Someya, Tatsuhiko; Kawai, Gota; Nakamura, Kouji; Kumasaka, Takashi

2010-05-01

The Hfq protein is a hexameric RNA-binding protein which regulates gene expression by binding to RNA under the influence of diverse environmental stresses. Its ring structure binds various types of RNA, including mRNA and sRNA. RNA-bound structures of Hfq from Escherichia coli and Staphylococcus aureus have been revealed to have poly(A) RNA at the distal site and U-rich RNA at the proximal site, respectively. Here, crystals of a complex of the Bacillus subtilis Hfq protein with an A/G-repeat 7-mer RNA (Hfq-RNA) that were prepared using the hanging-drop vapour-diffusion technique are reported. The type 1 Hfq-RNA crystals belonged to space group I422, with unit-cell parameters a = b = 123.70, c = 119.13 A, while the type 2 Hfq-RNA crystals belonged to space group F222, with unit-cell parameters a = 91.92, b = 92.50, c = 114.92 A. Diffraction data were collected to a resolution of 2.20 A from both crystal forms. The hexameric structure of the Hfq protein was clearly shown by self-rotation analysis.

Droplets and the three-phase contact line at the nano-scale. Statics and dynamics

NASA Astrophysics Data System (ADS)

Yatsyshin, Petr; Sibley, David; Savva, Nikos; Kalliadasis, Serafim

2014-11-01

Understanding the behaviour of the solid-liquid-vapour contact line at the scale of several tens of molecular diameters is important in wetting hydrodynamics with applications in micro- and nano-fluidics, including the design of lab-on-a-chip devices and surfaces with specific wetting properties. Due to the fluid inhomogeneity at the nano-scale, the application of continuum-mechanical approaches is limited, and a natural way to remedy this is to seek descriptions accounting for the non-local molecular-level interactions. Density Functional Theory (DFT) for fluids offers a statistical-mechanical framework based on expressing the free energy of the fluid-solid pair as a functional of the spatially varying fluid density. DFT allows us to investigate small drops deposited on planar substrates whilst keeping track of the microscopic structural details of the fluid. Starting from a model of intermolecular forces, we systematically obtain interfaces, surface tensions, and the microscopic contact angle. Using a dynamic extension of equilibrium DFT, we investigate the diffusion-driven evolution of the three-phase contact line to gain insight into the dynamic behaviour of the microscopic contact angle, which is still under debate.

Protein Crystal Movements and Fluid Flows During Microgravity Growth

NASA Technical Reports Server (NTRS)

Boggon, Titus J.; Chayen, Naomi E.; Snell, Edward H.; Dong, Jun; Lautenschlager, Peter; Potthast, Lothar; Siddons, D. Peter; Stojanoff, Vivian; Gordon, Elspeth; Thompson, Andrew W.;

Expression, purification and preliminary crystallographic analysis of oligopeptidase B from Trypanosoma brucei

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rea, Dean; Hazell, Carole; Andrews, Norma W.

2006-08-01

Recombinant oligopeptidase B from T. brucei has been prepared and crystallized. Data were collected to 2.7 Å. Heavy-atom soaks and preparation of selenomethionine-substituted protein are in progress for structure determination by MAD or MIR. African sleeping sickness, also called trypanosomiasis, is a significant cause of morbidity and mortality in sub-Saharan Africa. Peptidases from Trypanosoma brucei, the causative agent, include the serine peptidase oligopeptidase B, a documented virulence factor and therapeutic target. Determination of the three-dimensional structure of oligopeptidase B is desirable to facilitate the development of novel inhibitors. Oligopeptidase B was overexpressed in Escherichia coli as an N-terminally hexahistidine-tagged fusionmore » protein, purified using metal-affinity chromatography and crystallized using the hanging-drop vapour-diffusion technique in 7%(w/v) polyethylene glycol 6000, 1 M LiCl, 0.1 M bis-tris propane pH 7.5. Diffraction data to 2.7 Å resolution were collected using synchrotron radiation. The crystals belong to space group P3{sub 1}21 or P3{sub 2}21, with unit-cell parameters a = b = 124.5, c = 249.9 Å. A complete data set to 2.7 Å was collected using synchrotron radiation.« less

Development of water movement model as a module of moisture content simulation in static pile composting.

PubMed

Seng, Bunrith; Kaneko, Hidehiro; Hirayama, Kimiaki; Katayama-Hirayama, Keiko

2012-01-01

This paper presents a mathematical model of vertical water movement and a performance evaluation of the model in static pile composting operated with neither air supply nor turning. The vertical moisture content (MC) model was developed with consideration of evaporation (internal and external evaporation), diffusion (liquid and vapour diffusion) and percolation, whereas additional water from substrate decomposition and irrigation was not taken into account. The evaporation term in the model was established on the basis of reference evaporation of the materials at known temperature, MC and relative humidity of the air. Diffusion of water vapour was estimated as functions of relative humidity and temperature, whereas diffusion of liquid water was empirically obtained from experiment by adopting Fick's law. Percolation was estimated by following Darcy's law. The model was applied to a column of composting wood chips with an initial MC of 60%. The simulation program was run for four weeks with calculation span of 1 s. The simulated results were in reasonably good agreement with the experimental results. Only a top layer (less than 20 cm) had a considerable MC reduction; the deeper layers were comparable to the initial MC, and the bottom layer was higher than the initial MC. This model is a useful tool to estimate the MC profile throughout the composting period, and could be incorporated into biodegradation kinetic simulation of composting.

Explosion of Leidenfrost Droplets

NASA Astrophysics Data System (ADS)

Moreau, Florian; Colinet, Pierre; Dorbolo, Stephane

2012-11-01

When a drop is released on a plate heated above a given temperature, a thin layer of vapour can isolate the droplet so that it levitates over the plate. This effect was first reported by Leidenfrost in 1756. However, this fascinating subject remains an active field of research in both fundamental and applied researches. In this work, we focus on what happens when surfactant is added to the drop. The aim is to study the influence of a decrease of the surface tension. Surprisingly, as the droplet evaporates, suddenly it explodes. The evolution of the droplet and the resulting explosion are followed using a high speed camera. We show that when a critical concentration of surfactant is reached inside the drop, a shell of surfactant is formed leading to the explosion. The authors would like to thank FNRS for financial support. This work is financially supported by ODILE project (Contract No. FRFC 2.4623.11).

Crystallization and initial X-ray diffraction studies of scaffolding protein (gp7) of bacteriophage ϕ29

DOE Office of Scientific and Technical Information (OSTI.GOV)

Badasso, Mohammed O., E-mail: badas001@umn.edu; Anderson, Dwight L.; Department of Oral Science, University of Minnesota, Minneapolis, MN 55455

2005-04-01

ϕ29 bacteriophage scaffolding protein (gp7) has been overproduced in E. coli, purified, crystallized and characterized by X-ray diffraction. Two distinct crystal forms were obtained and a diffraction data set was collected to 1.8 Å resolution. The Bacillus subtilis bacteriophage ϕ29 scaffolding protein (gp7) has been crystallized by the hanging-drop vapour-diffusion method at 293 K. Two new distinct crystal forms that both differed from a previously crystallized and solved scaffolding protein were grown under the same conditions. Form I belongs to the primitive tetragonal space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = b = 77.13, c = 37.12 Å.more » Form II crystals exhibit an orthorhombic crystal form, with space group C222 and unit-cell parameters a = 107.50, b = 107. 80, c = 37.34 Å. Complete data sets have been collected to 1.78 and 1.80 Å for forms I and II, respectively, at 100 K using Cu Kα X-rays from a rotating-anode generator. Calculation of a V{sub M} value of 2.46 Å{sup 3} Da{sup −1} for form I suggests the presence of one molecule in the asymmetric unit, corresponding to a solvent content of 50.90%, whereas form II has a V{sub M} of 4.80 Å{sup 3} Da{sup −1} with a solvent content of 48.76% and two molecules in the asymmetric unit. The structures of both crystal forms are being determined by the molecular-replacement method using the coordinates of the published crystal structure of gp7.« less

Crystallization and preliminary X-ray diffraction studies of vitamin D3 hydroxylase, a novel cytochrome P450 isolated from Pseudonocardia autotrophica

PubMed Central

Yasutake, Yoshiaki; Fujii, Yoshikazu; Cheon, Woo-Kwang; Arisawa, Akira; Tamura, Tomohiro

2009-01-01

Vitamin D3 hydroxylase (Vdh) is a novel cytochrome P450 monooxygenase isolated from the actinomycete Pseudonocardia autotrophica and consisting of 403 amino-acid residues. Vdh catalyzes the activation of vitamin D3 via sequential hydroxylation reactions: these reactions involve the conversion of vitamin D3 (cholecalciferol or VD3) to 25-hydroxyvitamin D3 [25(OH)VD3] and the subsequent conversion of 25(OH)VD3 to 1α,25-dihydroxyvitamin D3 [calciferol or 1α,25(OH)2VD3]. Overexpression of recombinant Vdh was carried out using a Rhodococcus erythropolis expression system and the protein was subsequently purified and crystallized. Two different crystal forms were obtained by the hanging-drop vapour-diffusion method at 293 K using polyethylene glycol as a precipitant. The form I crystal belonged to the trigonal space group P31, with unit-cell parameters a = b = 61.7, c = 98.8 Å. There is one Vdh molecule in the asymmetric unit, with a solvent content of 47.6%. The form II crystal was grown in the presence of 25(OH)VD3 and belonged to the orthorhombic system P212121, with unit-cell parameters a = 63.4, b = 65.6 c = 102.2 Å. There is one Vdh molecule in the asymmetric unit, with a solvent content of 46.7%. Native data sets were collected to resolutions of 1.75 and 3.05 Å for form I and form II crystals, respectively, using synchrotron radiation. The structure solution was obtained by the molecular-replacement method and model refinement is in progress for the form I crystal. PMID:19342783

Topological data analyses and machine learning for detection, classification and characterization of atmospheric rivers

NASA Astrophysics Data System (ADS)

Muszynski, G.; Kashinath, K.; Wehner, M. F.; Prabhat, M.; Kurlin, V.

2017-12-01

We investigate novel approaches to detecting, classifying and characterizing extreme weather events, such as atmospheric rivers (ARs), in large high-dimensional climate datasets. ARs are narrow filaments of concentrated water vapour in the atmosphere that bring much of the precipitation in many mid-latitude regions. The precipitation associated with ARs is also responsible for major flooding events in many coastal regions of the world, including the west coast of the United States and western Europe. In this study we combine ideas from Topological Data Analysis (TDA) with Machine Learning (ML) for detecting, classifying and characterizing extreme weather events, like ARs. TDA is a new field that sits at the interface between topology and computer science, that studies "shape" - hidden topological structure - in raw data. It has been applied successfully in many areas of applied sciences, including complex networks, signal processing and image recognition. Using TDA we provide ARs with a shape characteristic as a new feature descriptor for the task of AR classification. In particular, we track the change in topology in precipitable water (integrated water vapour) fields using the Union-Find algorithm. We use the generated feature descriptors with ML classifiers to establish reliability and classification performance of our approach. We utilize the parallel toolkit for extreme climate events analysis (TECA: Petascale Pattern Recognition for Climate Science, Prabhat et al., Computer Analysis of Images and Patterns, 2015) for comparison (it is assumed that events identified by TECA is ground truth). Preliminary results indicate that our approach brings new insight into the study of ARs and provides quantitative information about the relevance of topological feature descriptors in analyses of a large climate datasets. We illustrate this method on climate model output and NCEP reanalysis datasets. Further, our method outperforms existing methods on detection and classification of ARs. This work illustrates that TDA combined with ML may provide a uniquely powerful approach for detection, classification and characterization of extreme weather phenomena.

Semi-volatile organic compounds at the leaf/atmosphere interface: numerical simulation of dispersal and foliar uptake.

PubMed

Riederer, Markus; Daiss, Andreas; Gilbert, Norbert; Köhle, Harald

2002-08-01

The behaviour of (semi-)volatile organic compounds at the interface between the leaf surface and the atmosphere was investigated by finite-element numerical simulation. Three model systems with increasing complexity and closeness to the real situation were studied. The three-dimensional model systems were translated into appropriate grid structures and diffusive and convective transport in the leaf/atmosphere interface was simulated. Fenpropimorph (cis-4-[3-(4-tert-butylphenyl)-2-methylpropyl]-2,6-dimethylmorpholine) and Kresoxim-methyl ((E)-methyl-2-methoxyimino-2-[2-(o-tolyloxy-methyl)phenyl] acetate) were used as model compounds. The simulation showed that under still and convective conditions the vapours emitted by a point source rapidly form stationary envelopes around the leaves. Vapour concentrations within these unstirred layers depend on the vapour pressure of the compound in question and on its affinity to the lipoid surface layers of the leaf (cuticular waxes, cutin). The rules deduced from the numerical simulation of organic vapour behaviour in the leaf/atmosphere interface are expected to help in assessing how (semi-)volatile plant products (e.g. hormones, pheromones, secondary metabolites) and xenobiotics (e.g. pesticides, pollutants) perform on plant surfaces.

Sorbent-based sampling methods for volatile and semi-volatile organic compounds in air Part 1: Sorbent-based air monitoring options.

PubMed

Woolfenden, Elizabeth

2010-04-16

Sorbent tubes/traps are widely used in combination with gas chromatographic (GC) analytical methods to monitor the vapour-phase fraction of organic compounds in air. Target compounds range in volatility from acetylene and freons to phthalates and PCBs and include apolar, polar and reactive species. Airborne vapour concentrations will vary depending on the nature of the location, nearby pollution sources, weather conditions, etc. Levels can range from low percent concentrations in stack and vent emissions to low part per trillion (ppt) levels in ultra-clean outdoor locations. Hundreds, even thousands of different compounds may be present in any given atmosphere. GC is commonly used in combination with mass spectrometry (MS) detection especially for environmental monitoring or for screening uncharacterised workplace atmospheres. Given the complexity and variability of organic vapours in air, no one sampling approach suits every monitoring scenario. A variety of different sampling strategies and sorbent media have been developed to address specific applications. Key sorbent-based examples include: active (pumped) sampling onto tubes packed with one or more sorbents held at ambient temperature; diffusive (passive) sampling onto sorbent tubes/cartridges; on-line sampling of air/gas streams into cooled sorbent traps; and transfer of air samples from containers (canisters, Tedlar) bags, etc.) into cooled sorbent focusing traps. Whichever sampling approach is selected, subsequent analysis almost always involves either solvent extraction or thermal desorption (TD) prior to GC(/MS) analysis. The overall performance of the air monitoring method will depend heavily on appropriate selection of key sampling and analytical parameters. This comprehensive review of air monitoring using sorbent tubes/traps is divided into 2 parts. (1) Sorbent-based air sampling option. (2) Sorbent selection and other aspects of optimizing sorbent-based air monitoring methods. The paper presents current state-of-the-art and recent developments in relevant areas such as sorbent research, sampler design, enhanced approaches to analytical quality assurance and on-tube derivatisation. Copyright 2009 Elsevier B.V. All rights reserved.

Dynamics of ions in a water drop using the AMOEBA polarizable force field

NASA Astrophysics Data System (ADS)

Thaunay, Florian; Ohanessian, Gilles; Clavaguéra, Carine

2017-03-01

Various ions carrying a charge from -2 to +3 were confined in a drop of 100 water molecules as a way to model coordination properties inside the cluster and at the interface. The behavior of the ions has been followed by molecular dynamics with the AMOEBA polarizable force field. Multiply charged ions and small singly charged ions are found to lie inside the droplet, while bigger monovalent ions sit near the surface. The results provide a coherent picture of average structural properties as well as residence times for which a general trend is proposed, especially for the anions.

Electrowetting on semiconductors

NASA Astrophysics Data System (ADS)

Palma, Cesar; Deegan, Robert

2015-01-01

Applying a voltage difference between a conductor and a sessile droplet sitting on a thin dielectric film separating it from the conductor will cause the drop to spread. When the conductor is a good metal, the change of the drop's contact angle due to the voltage is given by the Young-Lippmann (YL) equation. Here, we report experiments with lightly doped, single crystal silicon as the conductive electrode. We derive a modified YL equation that includes effects due to the semiconductor and contact line pinning. We show that light induces a non-reversible wetting transition, and that our model agrees well with our experimental results.

A fault constitutive relation accounting for thermal pressurization of pore fluid

USGS Publications Warehouse

Andrews, D.J.

2002-01-01

The heat generated in a slip zone during an earthquake can raise fluid pressure and thereby reduce frictional resistance to slip. The amount of fluid pressure rise depends on the associated fluid flow. The heat generated at a given time produces fluid pressure that decreases inversely with the square root of hydraulic diffusivity times the elapsed time. If the slip velocity function is crack-like, there is a prompt fluid pressure rise at the onset of slip, followed by a slower increase. The stress drop associated with the prompt fluid pressure rise increases with rupture propagation distance. The threshold propagation distance at which thermally induced stress drop starts to dominate over frictionally induced stress drop is proportional to hydraulic diffusivity. If hydraulic diffusivity is 0.02 m2/s, estimated from borehole samples of fault zone material, the threshold propagation distance is 300 m. The stress wave in an earthquake will induce an unknown amount of dilatancy and will increase hydraulic diffusivity, both of which will lessen the fluid pressure effect. Nevertheless, if hydraulic diffusivity is no more than two orders of magnitude larger than the laboratory value, then stress drop is complete in large earthquakes.

Pressure-Drop Considerations in the Characterization of Dew-Point Transfer Standards at High Temperatures

NASA Astrophysics Data System (ADS)

Mitter, H.; Böse, N.; Benyon, R.; Vicente, T.

2012-09-01

During calibration of precision optical dew-point hygrometers (DPHs), it is usually necessary to take into account the pressure drop induced by the gas flow between the "point of reference" and the "point of use" (mirror or measuring head of the DPH) either as a correction of the reference dew-point temperature or as part of the uncertainty estimation. At dew-point temperatures in the range of ambient temperature and below, it is sufficient to determine the pressure drop for the required gas flow, and to keep the volumetric flow constant during the measurements. In this case, it is feasible to keep the dry-gas flow into the dew-point generator constant or to measure the flow downstream the DPH at ambient temperature. In normal operation, at least one DPH in addition to the monitoring DPH are used, and this operation has to be applied to each instrument. The situation is different at high dew-point temperatures up to 95 °C, the currently achievable upper limit reported in this paper. With increasing dew-point temperatures, the reference gas contains increasing amounts of water vapour and a constant dry-gas flow will lead to a significant enhanced volume flow at the conditions at the point of use, and therefore, to a significantly varying pressure drop depending on the applied dew-point temperature. At dew-point temperatures above ambient temperature, it is also necessary to heat the reference gas and the mirror head of the DPH sufficiently to avoid condensation which will additionally increase the volume flow and the pressure drop. In this paper, a method is provided to calculate the dry-gas flow rate needed to maintain a known wet-gas flow rate through a chilled mirror for a range of temperature and pressures.

Recent Progress in the Remote Detection of Vapours and Gaseous Pollutants.

ERIC Educational Resources Information Center

Moffat, A. J.; And Others

Work has been continuing on the correlation spectrometry techniques described at previous remote sensing symposiums. Advances in the techniques are described which enable accurate quantitative measurements of diffused atmospheric gases to be made using controlled light sources, accurate quantitative measurements of gas clouds relative to…

Effects of copper vapour on thermophysical properties of CO2-N2 plasma

NASA Astrophysics Data System (ADS)

Zhong, Linlin; Wang, Xiaohua; Rong, Mingzhe; Cressault, Yann

2016-10-01

CO2-N2 mixtures are often used as arc quenching medium (to replace SF6) in circuit breakers and shielding gas in arc welding. In such applications, copper vapour resulting from electrode surfaces can modify characteristics of plasmas. This paper therefore presents an investigation of the effects of copper on thermophysical properties of CO2-N2 plasma. The equilibrium compositions, thermodynamic properties (including mass density, specific enthalpy, and specific heat), transport coefficients (including electrical conductivity, viscosity, and thermal conductivity), and four kinds of combined diffusion coefficients due to composition gradients, applied electric fields, temperature gradients, and pressure gradients respectively, were calculated and discussed for CO2-N2 (mixing ratio 7:3) plasma contaminated by different proportions of copper vapour. The significant influences of copper were observed on all the properties of CO2-N2-Cu mixtures. The better ionization ability and larger molar mass of copper and larger collision integrals related to copper, should be responsible for such influences.

Steam stripping of the unsaturated zone of contaminated sub-soils: The effect of diffusion/dispersion in the start-up phase

NASA Astrophysics Data System (ADS)

Brouwers, H. J. H.; Gilding, B. H.

2006-02-01

The unsteady process of steam stripping of the unsaturated zone of soils contaminated with volatile organic compounds (VOCs) is addressed. A model is presented. It accounts for the effects of water and contaminants remaining in vapour phase, as well as diffusion and dispersion of contaminants in this phase. The model has two components. The first is a one-dimensional description of the propagation of a steam front in the start-up phase. This is based on Darcy's law and conservation laws of mass and energy. The second component describes the transport of volatile contaminants. Taking the view that non-equilibrium between liquid and vapour phases exists, it accounts for evaporation, transport, and condensation at the front. This leads to a moving-boundary problem. The moving-boundary problem is brought into a fixed domain by a suitable transformation of the governing partial differential equations, and solved numerically. For a broad range of the governing dimensionless numbers, such as the Henry, Merkel and Péclet numbers, computational results are discussed. A mathematical asymptotic analysis supports this discussion. The range of parameter values for which the model is valid is investigated. Diffusion and dispersion are shown to be of qualitative importance, but to have little quantitative effect in the start-up phase.

Crystallization and X-ray diffraction analysis of the HMG domain of the chondrogenesis master regulator Sox9 in complex with a ChIP-Seq-identified DNA element

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vivekanandan, Saravanan; Moovarkumudalvan, Balasubramanian; Lescar, Julien

Sox9 is a fundamental sex-determining gene and the master regulator of chondrogenesis, and is involved in the development of various vital organs such as testes, kidney, heart and brain, and in skeletal development. Similar to other known Sox transcription factors, Sox9 recognizes and binds DNA with the consensus sequence C(T/A)TTG(T/A)(T/A) through the highly conserved HMG domain. Nonetheless, the molecular basis of the functional specificity of Sox9 in key developmental processes is still unclear. As an initial step towards a mechanistic understanding of Sox9 transcriptional regulation, the current work describes the details of the purification of the mouse Sox9 HMG domainmore » (mSox9HMG), its crystallization in complex with a ChIP-Seq-identified FOXP2 promoter DNA element and the X-ray diffraction data analysis of this complex. The mSox9HMG–FOXP2 promoter DNA complex was crystallized by the hanging-drop vapour-diffusion method using 20% PEG 3350 in 200 mMsodium/potassium phosphate with 100 mMbis-tris propane at pH 8.5. The crystals diffracted to 2.7 Å resolution and the complex crystallized in the tetragonal space groupP4 12 12, with unit-cell parametersa=b= 99.49,c= 45.89 Å. Crystal-packing parameters revealed that asymmetric unit contained one mSox9HMG–FOXP2 promoter DNA complex with an estimated solvent content of 64%.« less

Crystallization and preliminary crystallographic analysis of l-asparaginase from Erwinia carotovora

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wikman, Linnea E. K.; Krasotkina, Julya; Kuchumova, Anastasia

2005-04-01

Er. carotovoral-asparaginase, a potential antileukaemic agent, has been crystallized. Crystals diffract to 2.6 Å using a rotating-anode source and belong to space group P2{sub 1}, with unit-cell parameters a = 78.0, b = 112.3, c = 78.7 Å, β = 101.9° and a homotetramer in the crystallographic asymmetric unit. Bacterial l-asparaginases have been used as therapeutic agents in the treatment of acute childhood lymphoblastic leukaemia for over 30 y. However, their use is limited owing to the glutaminase activity of the administered enzymes, which results in serious side effects. In contrast, l-asparaginase from Erwinia carotovora exhibits low glutaminase activity atmore » physiological concentrations of l-asparagine and l-glutamine in the blood. Recombinant Er. carotovoral-asparaginase was crystallized in the presence of l-glutamate by the hanging-drop vapour-diffusion method using 10 mg ml{sup −1} purified enzyme, 16–18%(w/v) PEG 3350 and 0.2 M NaF. X-ray diffraction data were collected to 2.6 Å at 293 K using an in-house rotating-anode generator. The crystals belong to the monoclinic P2{sub 1} space group, with unit-cell parameters a = 78.0, b = 112.3, c = 78.7 Å, β = 101.9° and a homotetramer in the crystallographic asymmetric unit. A molecular-replacement solution has been found and refinement is currently in progress. The crystal structure may provide leads towards protein-engineering efforts aimed at safer asparaginase administration in leukaemia treatment.« less

Modelling and intepreting the isotopic composition of water vapour in convective updrafts

NASA Astrophysics Data System (ADS)

Bolot, M.; Legras, B.; Moyer, E. J.

2012-08-01

The isotopic compositions of water vapour and its condensates have long been used as tracers of the global hydrological cycle, but may also be useful for understanding processes within individual convective clouds. We review here the representation of processes that alter water isotopic compositions during processing of air in convective updrafts and present a unified model for water vapour isotopic evolution within undiluted deep convective cores, with a special focus on the out-of-equilibrium conditions of mixed phase zones where metastable liquid water and ice coexist. We use our model to show that a combination of water isotopologue measurements can constrain critical convective parameters including degree of supersaturation, supercooled water content and glaciation temperature. Important isotopic processes in updrafts include kinetic effects that are a consequence of diffusive growth or decay of cloud particles within a supersaturated or subsaturated environment; isotopic re-equilibration between vapour and supercooled droplets, which buffers isotopic distillation; and differing mechanisms of glaciation (droplet freezing vs. the Wegener-Bergeron-Findeisen process). As all of these processes are related to updraft strength, droplet size distribution and the retention of supercooled water, isotopic measurements can serve as a probe of in-cloud conditions of importance to convective processes. We study the sensitivity of the profile of water vapour isotopic composition to differing model assumptions and show how measurements of isotopic composition at cloud base and cloud top alone may be sufficient to retrieve key cloud parameters.

Modelling and interpreting the isotopic composition of water vapour in convective updrafts

NASA Astrophysics Data System (ADS)

Bolot, M.; Legras, B.; Moyer, E. J.

2013-08-01

The isotopic compositions of water vapour and its condensates have long been used as tracers of the global hydrological cycle, but may also be useful for understanding processes within individual convective clouds. We review here the representation of processes that alter water isotopic compositions during processing of air in convective updrafts and present a unified model for water vapour isotopic evolution within undiluted deep convective cores, with a special focus on the out-of-equilibrium conditions of mixed-phase zones where metastable liquid water and ice coexist. We use our model to show that a combination of water isotopologue measurements can constrain critical convective parameters, including degree of supersaturation, supercooled water content and glaciation temperature. Important isotopic processes in updrafts include kinetic effects that are a consequence of diffusive growth or decay of cloud particles within a supersaturated or subsaturated environment; isotopic re-equilibration between vapour and supercooled droplets, which buffers isotopic distillation; and differing mechanisms of glaciation (droplet freezing vs. the Wegener-Bergeron-Findeisen process). As all of these processes are related to updraft strength, particle size distribution and the retention of supercooled water, isotopic measurements can serve as a probe of in-cloud conditions of importance to convective processes. We study the sensitivity of the profile of water vapour isotopic composition to differing model assumptions and show how measurements of isotopic composition at cloud base and cloud top alone may be sufficient to retrieve key cloud parameters.

A diffuse-interface method for two-phase flows with soluble surfactants

PubMed Central

Teigen, Knut Erik; Song, Peng; Lowengrub, John; Voigt, Axel

2010-01-01

A method is presented to solve two-phase problems involving soluble surfactants. The incompressible Navier–Stokes equations are solved along with equations for the bulk and interfacial surfactant concentrations. A non-linear equation of state is used to relate the surface tension to the interfacial surfactant concentration. The method is based on the use of a diffuse interface, which allows a simple implementation using standard finite difference or finite element techniques. Here, finite difference methods on a block-structured adaptive grid are used, and the resulting equations are solved using a non-linear multigrid method. Results are presented for a drop in shear flow in both 2D and 3D, and the effect of solubility is discussed. PMID:21218125

Lennard-Jones fluids in two-dimensional nano-pores. Multi-phase coexistence and fluid structure

NASA Astrophysics Data System (ADS)

Yatsyshin, Petr; Savva, Nikos; Kalliadasis, Serafim

2014-03-01

We present a number of fundamental findings on the wetting behaviour of nano-pores. A popular model for fluid confinement is a one-dimensional (1D) slit pore formed by two parallel planar walls and it exhibits capillary condensation (CC): a first-order phase transition from vapour to capillary-liquid (Kelvin shift). Capping such a pore at one end by a third orthogonal wall forms a prototypical two-dimensional (2D) pore. We show that 2D pores possess a wetting temperature such that below this temperature CC remains of first order, above it becomes a continuous phase transition manifested by a slab of capillary-liquid filling the pore from the capping wall. Continuous CC exhibits hysteresis and can be preceded by a first-order capillary prewetting transition. Additionally, liquid drops can form in the corners of the 2D pore (remnant of 2D wedge prewetting). The three fluid phases, vapour, capillary-liquid slab and corner drops, can coexist at the pore triple point. Our model is based on the statistical mechanics of fluids in the density functional formulation. The fluid-fluid and fluid-substrate interactions are dispersive. We analyze in detail the microscopic fluid structure, isotherms and full phase diagrams. Our findings also suggest novel ways to control wetting of nano-pores. We are grateful to the European Research Council via Advanced Grant No. 247031 for support.

High-Pressure Transport Properties Of Fluids: Theory And Data From Levitated Drops At Combustion-Relevant Temperatures

NASA Technical Reports Server (NTRS)

Bellan, Josette; Harstad, Kenneth; Ohsaka, Kenichi

2003-01-01

Although the high pressure multicomponent fluid conservation equations have already been derived and approximately validated for binary mixtures by this PI, the validation of the multicomponent theory is hampered by the lack of existing mixing rules for property calculations. Classical gas dynamics theory can provide property mixing-rules at low pressures exclusively. While thermal conductivity and viscosity high-pressure mixing rules have been documented in the literature, there is no such equivalent for the diffusion coefficients and the thermal diffusion factors. The primary goal of this investigation is to extend the low pressure mixing rule theory to high pressures and validate the new theory with experimental data from levitated single drops. The two properties that will be addressed are the diffusion coefficients and the thermal diffusion factors. To validate/determine the property calculations, ground-based experiments from levitated drops are being conducted.

Analysis of models for two solution crystal growth problems

NASA Technical Reports Server (NTRS)

Fehribach, Joseph D.; Rosenberger, Franz

1989-01-01

Two diffusive solution crystal growth models are considered which are characterized by two phases separated by an interface, a lack of convective mixing in either phase, and the presence of diffusion components differing widely in diffusivity. The first model describes precipitant-driven solution crystal growth and the second model describes a hanging drop evaporation problem. It is shown that for certain proteins sharp concentration gradients may develop in the drop during evaporation, while under the same conditions the concentrations of other proteins remain uniform.

Development of PIV for Microgravity Diffusion Flames

NASA Technical Reports Server (NTRS)

Greenberg, Paul S.; Wernet, Mark P.; Yanis, William; Urban, David L.; Sunderland, Peter B.

2003-01-01

Results are presented from the application of Particle Image Velocimetry(PIV) to the overfire region of a laminar gas jet diffusion flame in normal gravity. A methane flame burning in air at 0.98 bar was considered. The apparatus demonstrated here is packaged in a drop rig designed for use in the 2.2 second drop tower.

Modelling of intermittent microwave convective drying: parameter sensitivity

NASA Astrophysics Data System (ADS)

Zhang, Zhijun; Qin, Wenchao; Shi, Bin; Gao, Jingxin; Zhang, Shiwei

2017-06-01

The reliability of the predictions of a mathematical model is a prerequisite to its utilization. A multiphase porous media model of intermittent microwave convective drying is developed based on the literature. The model considers the liquid water, gas and solid matrix inside of food. The model is simulated by COMSOL software. Its sensitivity parameter is analysed by changing the parameter values by ±20%, with the exception of several parameters. The sensitivity analysis of the process of the microwave power level shows that each parameter: ambient temperature, effective gas diffusivity, and evaporation rate constant, has significant effects on the process. However, the surface mass, heat transfer coefficient, relative and intrinsic permeability of the gas, and capillary diffusivity of water do not have a considerable effect. The evaporation rate constant has minimal parameter sensitivity with a ±20% value change, until it is changed 10-fold. In all results, the temperature and vapour pressure curves show the same trends as the moisture content curve. However, the water saturation at the medium surface and in the centre show different results. Vapour transfer is the major mass transfer phenomenon that affects the drying process.

A study of pressure losses in residential air distribution systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abushakra, Bass; Walker, Iain S.; Sherman, Max H.

2002-07-01

An experimental study was conducted to evaluate the pressure drop characteristics of residential duct system components that are either not available or not thoroughly (sometimes incorrectly) described in existing duct design literature. The tests were designed to imitate cases normally found in typical residential and light commercial installations. The study included three different sizes of flexible ducts, under different compression configurations, splitter boxes, supply boots, and a fresh air intake hood. The experimental tests conformed to ASHRAE Standard 120P--''Methods of Testing to Determine Flow Resistance of HVAC Air Ducts and Fittings''. The flexible duct study covered compressibility and bending effectsmore » on the total pressure drop, and the results showed that the available published references tend to underestimate the effects of compression in flexible ducts that can increase pressure drops by up to a factor of nine. The supply boots were tested under different configurations including a setup where a flexible duct elbow connection was considered as an integral part of the supply boot. The supply boots results showed that diffusers can increase the pressure drop by up to a factor of two in exit fittings, and the installation configuration can increase the pressure drop by up to a factor of five. The results showed that it is crucial for designers and contractors to be aware of the compressibility effects of the flexible duct, and the installation of supply boots and diffusers.« less

Numerical study of chemical reactions in a surface microdischarge tube with mist flow based on experiment

NASA Astrophysics Data System (ADS)

Shibata, T.; Nishiyama, H.

2014-03-01

Recently, a water treatment method of spraying solution into a discharge region has been developed and shows high energy efficiency. In this study, a simulation model of a water treatment method using a surface microdischarge (SMD) tube with mist flow is proposed for further understanding the detailed chemical reactions. Our model has three phases (plasma, gas and liquid) and three simulation steps. The carrier gas is humid air including 2% or 3% water vapour. The chemical species diffusion characteristics in the SMD tube and the concentrations in a droplet are clarified in a wide pH interval. The simulation results show that the chemical species generated on the SMD tube inner wall are diffused to the central axis and dissolved into fine droplets. Especially, OH radicals dissolve into droplets a few mm away from the SMD tube wall because of acidification of the droplets. Furthermore, the hydrogen peroxide density, which is the most important indicator of a radical reaction in water, is influenced by the initial solution pH. This pH dependence results from ozone self-decomposition in water.

Improving and assessing vapour pressure estimation methods for organic compounds of atmospheric relevance using a Knudsen Effusion Mass Spectrometer (KEMS)

NASA Astrophysics Data System (ADS)

Booth, A. M.; Topping, D. O.; McFiggans, G. B.; Garforth, A.; Percival, C. J.

2009-12-01

Aerosol particles influence climate directly through the scattering and absorbing radiation and indirectly through their role as cloud condensation nuclei (CCN). Traditionally, models aiming to capture the behaviour of aerosols in the atmosphere have concentrated on the role of inorganic compounds. However, organic components, covering a huge range of chemical and physical properties (Jacobson et.al., 2000), may constitute a significant fraction depending on location (Houghton et.al., 2001). Knowledge of pure component vapour pressures is essential for calculations of gas/particle partitioning. There are many methods of estimating vapour pressures but most of the experimental data collected to date has been for intermediate or high pressure compounds (and often measured at temperatures considerably above ambient) and the proportion of experimental data for low (less than 100Pa) vapour pressure compounds has been very small. Hence the datasets used for developing the estimation methods have reflected this bias in addition to the fact that components studied tend to have one or two functional groups at the most. Thus it is unsurprising that some of the estimation methods can give errors in vapour pressure of several orders of magnitude for multifunctional compounds at ambient temperatures. Knudsen Effusion Mass Spectrometer (KEMS) has been used to measure solid state vapour pressures for multifunctional organic compounds based on dicarboxylic acids (Booth et al 2009). In the atmosphere these compounds are likely to exist in the sub-cooled state so Differential Scanning Calorimetry (DSC) was used to obtain thermochemical data to effect a correction between solid and sub-cooled vapour pressures. The group contribution method of Nanoolal and co-workers (Nanoolal et al., 2008) is one of the best predictive methods in terms of reproducing available low volatility vapour pressure data (barley et al., 2009). The Nanoolal method relies on the use of primary and secondary functional groups and interaction parameters, derived from experimental data, to reliably predict boiling points and vapour pressures. A sensitivity study was undertaken to establish the impact of the new experimentally determined vapour pressures on partitioning models. Jacobson, M.C., et al. Rev Geophys, 38 (2), 267-294, 2000. Houghton et al. Climate Change 2001: The Scientific Basis. Contribution of Working Group 1 to the Third Assessment Report of the IPCC., 881 pp., Cambridge University Press, 2001. Johnson, D. , et al. Atmo. Chem. Phys., Vol. 6, 419-431, 2006 Yu, J. Z., et al. J Atmos Chem. 34, 207-258, 1999 Booth, A.M. et al Atmos. Meas. Tech.,2,355-361, 2009 Nanoolal, Y. et al Fluid Phase Equilibria, 269,117-133., 2008. Barley, M. et al Atmos. Chem. Phys., -,to be submitted.

Thermodynamic characterization of Ni3TeO6, Ni2Te3O8 and NiTe2O5

NASA Astrophysics Data System (ADS)

Dawar, Rimpi; Babu, R.; Ananthasivan, K.; Anthonysamy, S.

2017-09-01

Measurement of vapour pressure of TeO2(g) over the biphasic mixture Ni3TeO6 (s) + NiO(s) in the temperature range 1143-1272 K was carried out using transpiration-thermogravimetric technique (TTG). Gibbs energy of formation of Ni3TeO6 was obtained from the temperature dependence of vapour pressure of TeO2 (g) generated by the incongruent vapourisation reaction, Ni3TeO6 (s) → NiO(s) + TeO2 (g) + 1/2 O2 in the temperature range 1143-1272 K. An isoperibol type drop calorimeter was used to measure the enthalpy increments of Ni3TeO6, Ni2Te3O8 and NiTe2O5. Thermodynamic functions viz., heat capacity, entropy and Gibbs energy functions of these compounds were derived from the experimentally measured enthalpy increment values. Third-law analysis was carried out to ascertain absence of temperature dependent systematic errors in the measurement of vapour pressure of TeO2 (g). A value of -1265.1 ± 1.5 kJ mol-1 was obtained for Δ Hf,298K o (Ni3TeO6) using third-law analysis.

Overexpression, purification, crystallization and preliminary structural studies of catabolic ornithine transcarbamylase from Lactobacillus hilgardii

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rivas, Blanca de las; Rodríguez, Héctor; Angulo, Iván

2007-07-01

The catabolic ornithine transcarbamylase (cOTC) from L. hilgardii has been overexpressed in E. coli, purified and crystallized under two different experimental conditions. The structure has been solved by the molecular-replacement method using the atomic coordinates of catabolic ornithine transcarbamylase from P. aeruginosa as the search model. The catabolic ornithine transcarbamylase (cOTC; EC 2.1.3.3) from the lactic acid bacteria Lactobacillus hilgardii is a key protein involved in the degradation of arginine during malolactic fermentation. cOTC containing an N-terminal His{sub 6} tag has been overexpressed in Escherichia coli, purified and crystallized under two different experimental conditions using the hanging-drop vapour-diffusion method. Crystalsmore » obtained from a solution containing 8%(w/v) PEG 4000, 75 mM sodium acetate pH 4.6 belong to the trigonal space group P321 and have unit-cell parameters a = b = 157.04, c = 79.28 Å. Conversely, crystals grown in 20%(v/v) 2-methyl-2,4-pentanediol, 7.5%(w/v) PEG 4000, 100 mM HEPES pH 7.8 belong to the monoclinic space group C2 and have unit-cell parameters a = 80.06, b = 148.90, c = 91.67 Å, β = 100.25°. Diffraction data were collected in-house to 3.00 and 2.91 Å resolution for trigonal and monoclinic crystals, respectively. The estimated Matthews coefficient for the crystal forms were 2.36 and 2.24 Å{sup 3} Da{sup −1}, respectively, corresponding to 48% and 45% solvent content. In both cases, the results are consistent with the presence of three protein subunits in the asymmetric unit. The structure of cOTC has been determined by the molecular-replacement method using the atomic coordinates of cOTC from Pseudomonas aeruginosa (PDB code) as the search model.« less

Determination of 1-octanol-air partition coefficient using gaseous diffusion in the air boundary layer.

PubMed

Ha, Yeonjeong; Kwon, Jung-Hwan

2010-04-15

Exact determination of the partition coefficient between 1-octanol and air (K(OA)) is very important because it is a key descriptor for describing the thermodynamic partitioning between the air and organic phases. In spite of its importance, the number and quality of experimental K(OA) values for hydrophobic organic chemicals are limited because of experimental difficulties. Thus, to measure K(OA) values, a high-throughput method was developed that used liquid-phase extraction with 1-octanol drop at the tip of a microsyringe needle. The concentration in the headspace surrounding the 1 muL octanol drop was equilibrated with liquid octanol containing polycyclic aromatic hydrocarbons (PAHs). The change in concentrations of PAHs in the octanol drop was measured to obtain mass transfer rate constants, and these rate constants were then converted into K(OA) values using a film diffusion model. Thirteen polycyclic aromatic hydrocarbons with log K(OA) between 5 and 12 were chosen for the proof of the principle. Experimental determination of log K(OA) was accomplished in 30 h for PAHs with their log K(OA) less than 11. The measured log K(OA) values were very close to those obtained by various experimental and estimation methods in the literature, suggesting that this new method can provide a fast and easy determination of log K(OA) values for many chemicals of environmental interests. In addition, the applicability of the method can be extended to determine Henry's law constant for compounds with low vapor pressure and to estimate gaseous transfer rate of semivolatile compounds for environmental fate modeling.

The speed of sound in a gas–vapour bubbly liquid

PubMed Central

Prosperetti, Andrea

2015-01-01

In addition to the vapour of the liquid, bubbles in cavitating flows usually contain also a certain amount of permanent gas that diffuses out of the liquid as they grow. This paper presents a simplified linear model for the propagation of monochromatic pressure waves in a bubbly liquid with these characteristics. Phase change effects are included in detail, while the gas is assumed to follow a polytropic law. It is shown that even a small amount of permanent gas can have a major effect on the behaviour of the system. Particular attention is paid to the low-frequency range, which is of special concern in flow cavitation. Numerical results for water and liquid oxygen illustrate the implications of the model. PMID:26442146

The speed of sound in a gas-vapour bubbly liquid.

PubMed

Prosperetti, Andrea

2015-10-06

In addition to the vapour of the liquid, bubbles in cavitating flows usually contain also a certain amount of permanent gas that diffuses out of the liquid as they grow. This paper presents a simplified linear model for the propagation of monochromatic pressure waves in a bubbly liquid with these characteristics. Phase change effects are included in detail, while the gas is assumed to follow a polytropic law. It is shown that even a small amount of permanent gas can have a major effect on the behaviour of the system. Particular attention is paid to the low-frequency range, which is of special concern in flow cavitation. Numerical results for water and liquid oxygen illustrate the implications of the model.

Dropped head congenital muscular dystrophy caused by de novo mutations in LMNA.

PubMed

Karaoglu, Pakize; Quizon, Nicolas; Pergande, Matthias; Wang, Haicui; Polat, Ayşe Ipek; Ersen, Ayca; Özer, Erdener; Willkomm, Lena; Hiz Kurul, Semra; Heredia, Raúl; Yis, Uluç; Selcen, Duygu; Çirak, Sebahattin

2017-04-01

Dropped head syndrome is an easily recognizable clinical presentation of Lamin A/C-related congenital muscular dystrophy. Patients usually present in the first year of life with profound neck muscle weakness, dropped head, and elevated serum creatine kinase. Two patients exhibited head drop during infancy although they were able to sit independently. Later they developed progressive axial and limb-girdle weakness. Creatine kinase levels were elevated and muscle biopsies of both patients showed severe dystrophic changes. The distinctive clinical hallmark of the dropped head led us to the diagnosis of Lamin A/C-related congenital muscular dystrophy, with a pathogenic de novo mutation p.Glu31del in the head domain of the Lamin A/C gene in both patients. Remarkably, one patient also had a central involvement with white matter changes on brain magnetic resonance imaging. Lamin A/C-related dropped-head syndrome is a rapidly progressive congenital muscular dystrophy and may lead to loss of ambulation, respiratory insufficiency, and cardiac complications. Thus, the genetic diagnosis of dropped-head syndrome as L-CMD and the implicated clinical care protocols are of vital importance for these patients. This disease may be underdiagnosed, as only a few genetically confirmed cases have been reported. Copyright © 2016 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Purification, crystallization and preliminary X-ray diffraction studies of D-tagatose 3-epimerase from Pseudomonas cichorii.

PubMed

Yoshida, Hiromi; Yamada, Mitsugu; Nishitani, Takeyori; Takada, Goro; Izumori, Ken; Kamitori, Shigehiro

2007-02-01

D-Tagatose 3-epimerase (D-TE) from Pseudomonas cichorii catalyzes the epimerization of various ketohexoses at the C3 position. The epimerization of D-psicose has not been reported with epimerases other than P. cichorii D-TE and D-psicose 3-epimerase from Agrobacterium tumefaciens. Recombinant P. cichorii D-TE has been purified and crystallized. Crystals of P. cichorii D-TE were obtained by the sitting-drop method at room temperature. The crystal belongs to the monoclinic space group P2(1), with unit-cell parameters a = 76.80, b = 94.92, c = 91.73 A, beta = 102.82 degrees . Diffraction data were collected to 2.5 A resolution. The asymmetric unit is expected to contain four molecules.

Stray Stars Scattered in Space Artist Concept

NASA Image and Video Library

2014-11-06

This artist concept shows a view of a number of galaxies sitting in huge halos of stars. The stars are too distant to be seen individually and instead are seen as a diffuse glow, colored yellow in this illustration.

Expression, crystallization and preliminary crystallographic analysis of RNA-binding protein Hfq (YmaH) from Bacillus subtilis in complex with an RNA aptamer

PubMed Central

Baba, Seiki; Someya, Tatsuhiko; Kawai, Gota; Nakamura, Kouji; Kumasaka, Takashi

2010-01-01

The Hfq protein is a hexameric RNA-binding protein which regulates gene expression by binding to RNA under the influence of diverse environmental stresses. Its ring structure binds various types of RNA, including mRNA and sRNA. RNA-bound structures of Hfq from Escherichia coli and Staphylococcus aureus have been revealed to have poly(A) RNA at the distal site and U-rich RNA at the proximal site, respectively. Here, crystals of a complex of the Bacillus subtilis Hfq protein with an A/G-repeat 7-mer RNA (Hfq–RNA) that were prepared using the hanging-drop vapour-diffusion technique are reported. The type 1 Hfq–RNA crystals belonged to space group I422, with unit-cell parameters a = b = 123.70, c = 119.13 Å, while the type 2 Hfq–RNA crystals belonged to space group F222, with unit-cell parameters a = 91.92, b = 92.50, c = 114.92 Å. Diffraction data were collected to a resolution of 2.20 Å from both crystal forms. The hexameric structure of the Hfq protein was clearly shown by self-rotation analysis. PMID:20445260

Cloning, overexpression, purification and preliminary crystallographic studies of a mitochondrial type II peroxiredoxin from Pisum sativum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barranco-Medina, Sergio; López-Jaramillo, Francisco Javier, E-mail: fjljara@ugr.es; Bernier-Villamor, Laura

2006-07-01

The isolation, purification, crystallization and molecular-replacement solution of mitochondrial type II peroxiredoxin from P. sativum is reported. A cDNA encoding an open reading frame of 199 amino acids corresponding to a type II peroxiredoxin from Pisum sativum with its transit peptide was isolated by RT-PCR. The 171-amino-acid mature protein (estimated molecular weight 18.6 kDa) was cloned into the pET3d vector and overexpressed in Escherichia coli. The recombinant protein was purified and crystallized by the hanging-drop vapour-diffusion technique. A full data set (98.2% completeness) was collected using a rotating-anode generator to a resolution of 2.8 Å from a single crystal flash-cooledmore » at 100 K. X-ray data revealed that the protein crystallizes in space group P1, with unit-cell parameters a = 61.88, b = 66.40, c = 77.23 Å, α = 102.90, β = 104.40, γ = 99.07°, and molecular replacement using a theoretical model predicted from the primary structure as a search model confirmed the presence of six molecules in the unit cell as expected from the Matthews coefficient. Refinement of the structure is in progress.« less

Crystallization and preliminary X-ray diffraction studies of trypsin-like proteases from the gastric fluid of the marine crab Cancer pagurus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hehemann, Jan-Hendrik; Redecke, Lars; Perbandt, Markus

2007-03-01

Two trypsins from the gastric fluid of the marine crab C. pagurus were purified and crystallized and X-ray data were collected to 0.97 and 3.2 Å resolution. The digestive fluid of the marine crab Cancer pagurus (Decapoda, Brachyura) contains highly stable proteases which display enhanced activity in aqueous mixtures of organic solvents. Three trypsins were isolated from the gastric fluid and two of them, C.p.TryII and C.p.TryIII, were purified to homogeneity by anion-exchange chromatography and crystallized by hanging-drop vapour diffusion. Diffraction data were collected at a synchrotron to 0.97 and 3.2 Å resolution, respectively. The crystal of C.p.TryII belongs tomore » the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 52.06, b = 62.00, c = 71.66 Å. Based on the Matthews coefficient, one protein molecule per asymmetric unit is suggested. In contrast, crystals of C.p.TryIII, which belong to the cubic space group P2{sub 1}3 with unit-cell parameters a = b = c = 215.4 Å, are assumed to contain 12 molecules per asymmetric unit.« less

Expression, purification and crystallization of a dye-decolourizing peroxidase from Dictyostelium discoideum.

PubMed

Rai, Amrita; Fedorov, Roman; Manstein, Dietmar J

2014-02-01

Dye-decolourizing peroxidases are haem-containing peroxidases with broad substrate specificity. Using H2O2 as an electron acceptor, they efficiently decolourize various dyes that are of industrial and environmental relevance, such as anthraquninone- and azo-based dyes. In this study, the dye-decolourizing peroxidase DdDyP from Dictyostelium discoideum was overexpressed in Escherichia coli strain Rosetta(DE3)pLysS, purified and crystallized using the vapour-diffusion method. A native crystal diffracted to 1.65 Å resolution and belonged to space group P4(1)2(1)2, with unit-cell parameters a = b = 141.03, c = 95.56 Å, α = β = γ = 90°. The asymmetric unit contains two molecules.

Applications of thin-film sandwich crystallization platforms.

PubMed

Axford, Danny; Aller, Pierre; Sanchez-Weatherby, Juan; Sandy, James

2016-04-01

Examples are shown of protein crystallization in, and data collection from, solutions sandwiched between thin polymer films using vapour-diffusion and batch methods. The crystallization platform is optimal for both visualization and in situ data collection, with the need for traditional harvesting being eliminated. In wells constructed from the thinnest plastic and with a minimum of aqueous liquid, flash-cooling to 100 K is possible without significant ice formation and without any degradation in crystal quality. The approach is simple; it utilizes low-cost consumables but yields high-quality data with minimal sample intervention and, with the very low levels of background X-ray scatter that are observed, is optimal for microcrystals.

Determination of diffusion and partition coefficients of model migrants by direct contact and vapour phase transfer from low-density polyethylene films into cake.

PubMed

Paseiro-Cerrato, Rafael; Rodríguez-Bernaldo de Quirós, Ana; Otero-Pazos, Pablo; Sendón, Raquel; Paseiro-Losada, Perfecto

2018-03-01

The aim of the present study was to determine the migration kinetics of one photoinitiator, benzophenone, and two optical brighteners, Uvitex OB and 1,4-diphenyl-1,3-butadiene (DPBD), from low-density polyethylene (LDPE) films into cake. Transfer was assessed by both direct contact and also the vapour phase. To perform the migration tests by direct contact, plastic films enriched with the additives were placed between two cake slices. To evaluate the migration through the gas phase, cake and the fortified LDPE film were placed with no direct contact in a glass container that was hermetically closed. Samples were stored at different time-temperature conditions. Target compounds were extracted from the films with ethanol (70°C, 24 h) and analysed by HPLC-DAD. Relevant parameters such as partition and diffusion coefficients between food and plastic film were calculated. The Arrhenius equation was applied to estimate the diffusion coefficient at any temperature. The data indicate that migration of benzophenone occurs in a significant extent into cake by both direct contact and through the gas phase (no direct contact). Conversely, very little migration occurred for Uvitex OB by direct contact and none through the gas phase. Results for benzophenone suggest that migration through the gas phase should be considered when evaluating migration from food packaging materials into food.

Diffusion of radon through concrete block walls: A significant source of indoor radon

USGS Publications Warehouse

Lively, R.S.; Goldberg, L.F.

1999-01-01

Basement modules located in southern Minnesota have been the site of continuous radon and environmental measurements during heating seasons since 1993. Concentrations of radon within the basement modules ranged from 70 Bq.m-3 to over 4000 Bq.m-3 between November to April during the three measurement periods. In the soil gas for the same times, concentrations of radon ranged between 25,000 and 70,000 Bq.m-3. Levels of radon within the basement modules changed by factors of five or more within 24 h, in concert with pressure gradients of 4 to 20 Pa that developed between the basement modules and their surroundings. Diffusion is identified as the principal method by which radon is transferred into and out of the basement modules, and appears to be relatively independent of insulating materials and vapour retarders. The variability of radon and correlations with differential pressure gradients may be related to air currents in the block walls and soil that interrupt radon diffusing inward. This yields a net decrease of radon in the basement modules by decay and outward diffusion. Levels of radon within the basement modules increase when the pressure differential is zero and air flow ceases, allowing diffusion gradients to be re-established. Radon levels in both the soil and the basement modules then increase until an equilibrium is achieved.

Assessing Sitting across Contexts: Development of the Multicontext Sitting Time Questionnaire

ERIC Educational Resources Information Center

Whitfield, Geoffrey P.; Pettee Gabriel, Kelley K.; Kohl, Harold W., III.

2013-01-01

Purpose: To describe the development and preliminary evaluation of the Multicontext Sitting Time Questionnaire (MSTQ). Method: During development of the MSTQ, contexts and domains of sitting behavior were utilized as recall cues to improve the accuracy of sitting assessment. The terms "workday" and "nonworkday" were used to…

Electrochemistry in an acoustically levitated drop.

PubMed

Chainani, Edward T; Ngo, Khanh T; Scheeline, Alexander

2013-02-19

Levitated drops show potential as microreactors, especially when radicals are present as reactants or products. Solid/liquid interfaces are absent or minimized, avoiding adsorption and interfacial reaction of conventional microfluidics. We report amperometric detection in an acoustically levitated drop with simultaneous ballistic addition of reactant. A gold microelectrode sensor was fabricated with a lithographic process; active electrode area was defined by a photosensitive polyimide mask. The microdisk gold working electrode of radius 19 μm was characterized using ferrocenemethanol in aqueous buffer. Using cyclic voltammetry, the electrochemically active surface area was estimated by combining a recessed microdisk electrode model with the Randles-Sevcik equation. Computer-controlled ballistic introduction of reactant droplets into the levitated drop was developed. Chronoamperometric measurements of ferrocyanide added ballistically demonstrate electrochemical monitoring using the microfabricated electrode in a levitated drop. Although concentration increases with time due to drop evaporation, the extent of concentration is predictable with a linear evaporation model. Comparison of diffusion-limited currents in pendant and levitated drops show that convection arising from acoustic levitation causes an enhancement of diffusion-limited current on the order of 16%.

Aerosol assisted chemical vapour deposition of gas sensitive SnO2 and Au-functionalised SnO2 nanorods via a non-catalysed vapour solid (VS) mechanism

PubMed Central

Vallejos, Stella; Selina, Soultana; Annanouch, Fatima Ezahra; Gràcia, Isabel; Llobet, Eduard; Blackman, Chris

2016-01-01

Tin oxide nanorods (NRs) are vapour synthesised at relatively lower temperatures than previously reported and without the need for substrate pre-treatment, via a vapour-solid mechanism enabled using an aerosol-assisted chemical vapour deposition method. Results demonstrate that the growth of SnO2 NRs is promoted by a compression of the nucleation rate parallel to the substrate and a decrease of the energy barrier for growth perpendicular to the substrate, which are controlled via the deposition conditions. This method provides both single-step formation of the SnO2 NRs and their integration with silicon micromachined platforms, but also allows for in-situ functionalization of the NRs with gold nanoparticles via co-deposition with a gold precursor. The functional properties are demonstrated for gas sensing, with microsensors using functionalised NRs demonstrating enhanced sensing properties towards H2 compared to those based on non-functionalised NRs. PMID:27334232

Ball lightning from atmospheric discharges via metal nanosphere oxidation: from soils, wood or metals.

PubMed

Abrahamson, John

2002-01-15

The slow (diffusion-limited) oxidation of metal nanoparticles has previously been proposed as the mechanism for ball lightning energy release, and argued to be the result of a normal lightning strike on soil. Here this basic model of networked nanoparticles is detailed further, and extended to lightning strikes on metal structures, and also to the action of other storm-related discharges or man-made discharges. The basic model predicted the important properties of "average" observed ball lightning, and the extension in this paper also covers high-energy examples of ball lightning. Laboratory checks of the theory are described, and predictions given of what conditions are necessary for observing ball lightning in the laboratory. Key requirements of the model are a sheltered region near the strike foot and starting materials which can generate a metal vapour under intensive heating, including soil, wood or a metal structure. The evolution of hydrocarbons (often plastics) along with metal vapour can ensure the local survival of the metal vapour even in an oxidizing atmosphere. Subsequent condensation of this vapour to metallic nanoparticles in networks provides the coherence of a ball structure, which also releases light over an extended time. Also discussed is the passage of ball lightning through a sheet of building material, including glass, and its occasional charring of flesh on close contact.

An incomplete assembly with thresholding algorithm for systems of reaction-diffusion equations in three space dimensions IAT for reaction-diffusion systems

NASA Astrophysics Data System (ADS)

Moore, Peter K.

2003-07-01

Solving systems of reaction-diffusion equations in three space dimensions can be prohibitively expensive both in terms of storage and CPU time. Herein, I present a new incomplete assembly procedure that is designed to reduce storage requirements. Incomplete assembly is analogous to incomplete factorization in that only a fixed number of nonzero entries are stored per row and a drop tolerance is used to discard small values. The algorithm is incorporated in a finite element method-of-lines code and tested on a set of reaction-diffusion systems. The effect of incomplete assembly on CPU time and storage and on the performance of the temporal integrator DASPK, algebraic solver GMRES and preconditioner ILUT is studied.

Hidden marker position estimation during sit-to-stand with walker.

PubMed

Yoon, Sang Ho; Jun, Hong Gul; Dan, Byung Ju; Jo, Byeong Rim; Min, Byung Hoon

2012-01-01

Motion capture analysis of sit-to-stand task with assistive device is hard to achieve due to obstruction on reflective makers. Previously developed robotic system, Smart Mobile Walker, is used as an assistive device to perform motion capture analysis in sit-to-stand task. All lower limb markers except hip markers are invisible through whole session. The link-segment and regression method is applied to estimate the marker position during sit-to-stand. Applying a new method, the lost marker positions are restored and the biomechanical evaluation of the sit-to-stand movement with a Smart Mobile Walker could be carried out. The accuracy of the marker position estimation is verified with normal sit-to-stand data from more than 30 clinical trials. Moreover, further research on improving the link segment and regression method is addressed.

The modelling routes for the chemical vapour deposition process: application to Si 1- xGe x deposition

NASA Astrophysics Data System (ADS)

Pons, M.; Bernard, C.; Rouch, H.; Madar, R.

1995-10-01

The purpose of this article is to present the modelling routes for the chemical vapour deposition process with a special emphasis on mass transport models with near local thermochemical equilibrium imposed in the gas-phase and at the deposition surface. The theoretical problems arising from the linking of the two selected approaches, thermodynamics and mass transport, are shown and a solution procedure is proposed. As an illustration, selected results of thermodynamic and mass transport analysis and of the coupled approach showed that, for the deposition of Si 1- xGe x solid solution at 1300 K (system SiGeClHAr), the thermodynamic heterogeneous stability of the reactive gases and the thermal diffusion led to the germanium depletion of the deposit.

Science 101: What Is the Difference between Solids and Liquids?

ERIC Educational Resources Information Center

Robertson, Bill

2013-01-01

Figuring out the difference between liquids and solids seems like a silly question at first. After all, don't we know that liquids do not have a definite shape and therefore assume the shape of their container? Place a drop of water in a short glass. Does this water take the shape of the glass? Nope. It just sits there on the bottom of the…

Standing and sitting adlayers in atomic layer deposition of ZnO

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gao, Zhengning; Banerjee, Parag, E-mail: parag.banerjee@wustl.edu; Wu, Fei

The extent of reactivity of diethyl zinc (DEZ) with a hydroxylated surface during atomic layer deposition (ALD) of ZnO using DEZ and water is measured. Two adlayer configurations of DEZ are possible. The “standing” adlayer releases one ethyl group from DEZ. The “sitting” adlayer releases both ethyl groups, thus forming a Zn bridge between two O anions. Density functional theory calculations suggest the sitting configuration is more stable than the standing configuration by 790 meV. In situ quadrupole mass spectroscopy of by-product ethane generated in ALD half cycles indicate that ∼1.56 OH sites react with a DEZ molecule resulting in 71.6%more » of sitting sites. A simple simulation of a “ball-and-stick” DEZ molecule randomly collapsing on a neighboring site remarkably captures this adlayer behavior. It is concluded that DEZ fraction sitting is a competitive process of a standing DEZ molecule collapsing onto an available neighboring hydroxyl site, as sites vie for occupancy via adsorption and surface diffusion.« less

Structure of the buffalo secretory signalling glycoprotein at 2.8 Å resolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ethayathulla, Abdul S.; Srivastava, Devendra B.; Kumar, Janesh

2007-04-01

The crystal structure of a signalling glycoprotein isolated from buffalo dry secretions (SPB-40) has been determined at 2.8 Å resolution. Two unique residues, Tyr120 and Glu269, found in SPB-40 distort the shape of the sugar-binding groove considerably. The water structure in the groove is also different. The conformations of three flexible loops, His188–His197, Phe202–Arg212 and Tyr244–Pro260, also differ from those found in other structurally similar proteins. The crystal structure of a 40 kDa signalling glycoprotein from buffalo (SPB-40) has been determined at 2.8 Å resolution. SPB-40 acts as a protective signalling factor by binding to viable cells during the earlymore » phase of involution, during which extensive tissue remodelling occurs. It was isolated from the dry secretions of Murrah buffalo. It was purified and crystallized using the hanging-drop vapour-diffusion method with 19% ethanol as the precipitant. The protein was also cloned and its complete nucleotide and amino-acid sequences were determined. When compared with the sequences of other members of the family, the sequence of SPB-40 revealed two very important mutations in the sugar-binding region, in which Tyr120 changed to Trp120 and Glu269 changed to Trp269. The structure showed a significant distortion in the shape of the sugar-binding groove. The water structure in the groove is also drastically altered. The folding of the protein chain in the flexible region comprising segments His188–His197, Phe202–Arg212 and Tyr244–Pro260 shows large variations when compared with other proteins of the family.« less

Crystallization and preliminary X-ray crystallographic analysis of an ice-binding protein (FfIBP) from Flavobacterium frigoris PS1.

PubMed

Do, Hackwon; Lee, Jun Hyuck; Lee, Sung Gu; Kim, Hak Jun

2012-07-01

Ice growth in a cold environment is fatal for polar organisms, not only because of the physical destruction of inner cell organelles but also because of the resulting chemical damage owing to processes such as osmotic shock. The properties of ice-binding proteins (IBPs), which include antifreeze proteins (AFPs), have been characterized and IBPs exhibit the ability to inhibit ice growth by binding to specific ice planes and lowering the freezing point. An ice-binding protein (FfIBP) from the Gram-negative bacterium Flavobacterium frigoris PS1, which was isolated from the Antarctic, has recently been overexpressed. Interestingly, the thermal hysteresis activity of FfIBP was approximately 2.5 K at 50 µM, which is ten times higher than that of the moderately active IBP from Arctic yeast (LeIBP). Although FfIBP closely resembles LeIBP in its amino-acid sequence, the antifreeze activity of FfIBP appears to be much greater than that of LeIBP. In an effort to understand the reason for this difference, an attempt was made to solve the crystal structure of FfIBP. Here, the crystallization and X-ray diffraction data of FfIBP are reported. FfIBP was crystallized using the hanging-drop vapour-diffusion method with 0.1 M sodium acetate pH 4.4 and 3 M sodium chloride as precipitant. A complete diffraction data set was collected to a resolution of 2.9 Å. The crystal belonged to space group P4(1)22, with unit-cell parameters a = b = 69.4, c = 178.2 Å. The asymmetric unit contained one monomer.

Expression, purification and crystallization of two major envelope proteins from white spot syndrome virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang, Xuhua; Hew, Choy Leong, E-mail: dbshewcl@nus.edu.sg

2007-07-01

The crystallization of the N-terminal transmembrane region-truncated VP26 and VP28 of white spot syndrome virus is described. White spot syndrome virus (WSSV) is a major virulent pathogen known to infect penaeid shrimp and other crustaceans. VP26 and VP28, two major envelope proteins from WSSV, have been identified and overexpressed in Escherichia coli. In order to facilitate purification and crystallization, predicted N-terminal transmembrane regions of approximately 35 amino acids have been truncated from both VP26 and VP28. Truncated VP26 and VP28 and their corresponding SeMet-labelled proteins were purified and the SeMet proteins were crystallized by the hanging-drop vapour-diffusion method. Crystals ofmore » SeMet-labelled VP26 were obtained using a reservoir consisting of 0.1 M citric acid pH 3.5, 3.0 M sodium chloride and 1%(w/v) polyethylene glycol 3350, whereas SeMet VP28 was crystallized using a reservoir solution consisting of 25% polyethylene glycol 8000, 0.2 M calcium acetate, 0.1 M Na HEPES pH 7.5 and 1.5%(w/v) 1,2,3-heptanetriol. Crystals of SeMet-labelled VP26 diffract to 2.2 Å resolution and belong to space group R32, with unit-cell parameters a = b = 73.92, c = 199.31 Å. SeMet-labelled VP28 crystallizes in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 105.33, b = 106.71, c = 200.37 Å, and diffracts to 2.0 Å resolution.« less

Crystallization and preliminary X-ray diffraction studies of Seneca Valley Virus-001, a new member of the Picornaviridae family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Venkataraman, Sangita; Reddy, Seshidhar P.; Loo, Jackie

2008-04-01

Seneca Valley Virus-001 of the Picornavirdae family was crystallized in the space group R3 and X-ray diffraction data was collected to a resolution of 2.3 Å. Rotation-function studies suggested the presence of two distict sets of 20 protomers that belong to two different virus particles in the crystallographic asymmetric unit. Seneca Valley Virus-001 (SVV-001) is a newly found species in the Picornaviridae family. SVV-001 is the first naturally occurring nonpathogenic picorna@@virus observed to mediate selective cytotoxicity towards tumor cells with neuroendocrine cancer features. The nonsegmented (+)ssRNA genome of SVV-001 shares closest sequence similarity to the genomes of the members ofmore » the Cardiovirus genus. However, based on the distinct characteristics of the genome organization and other biochemical properties, it has been suggested that SVV-001 represents a new genus, namely ‘Senecavirus’, in the Picornaviridae family. In order to understand the oncolytic properties of SVV-001, the native virus was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group R3, with unit-cell parameters (in the hexagonal setting) a = b = 311.5, c = 1526.4 Å. Although the SVV crystals diffracted to better than 2.3 Å resolution, the data quality is acceptable [I/σ(I) > 2.0] to 2.6 Å resolution. The unit-cell volume and the locked rotation-function analysis suggest that six particles could be accommodated in the unit cell, with two distinct sets of one third of a particle, each containing 20 protomers, occupying the crystallographic asymmetric unit.« less

Sensing response of copper phthalocyanine salt dispersed glass with organic vapours

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ridhi, R.; Sachdeva, Sheenam; Saini, G. S. S.

2016-05-06

Copper Phthalocyanine and other Metal Phthalocyanines are very flexible and tuned easily to modify their structural, spectroscopic, optical and electrical properties by either functionalizing them with various substituent groups or by replacing or adding a ligand to the central metal atom in the phthalocyanine ring and accordingly can be made sensitive and selective to various organic species or gaseous vapours. In the present work, we have dispersed Copper Phthalocyanine Salt (CuPcS) in sol-gel glass form using chemical route sol-gel method and studied its sensing mechanism with organic vapours like methanol and benzene and found that current increases onto their exposuremore » with vapours. A variation in the activation energies was also observed with exposure of vapours.« less

Sensing response of copper phthalocyanine salt dispersed glass with organic vapours

NASA Astrophysics Data System (ADS)

Ridhi, R.; Sachdeva, Sheenam; Saini, G. S. S.; Tripathi, S. K.

2016-05-01

Copper Phthalocyanine and other Metal Phthalocyanines are very flexible and tuned easily to modify their structural, spectroscopic, optical and electrical properties by either functionalizing them with various substituent groups or by replacing or adding a ligand to the central metal atom in the phthalocyanine ring and accordingly can be made sensitive and selective to various organic species or gaseous vapours. In the present work, we have dispersed Copper Phthalocyanine Salt (CuPcS) in sol-gel glass form using chemical route sol-gel method and studied its sensing mechanism with organic vapours like methanol and benzene and found that current increases onto their exposure with vapours. A variation in the activation energies was also observed with exposure of vapours.

Water Vapour Effects in Mass Measurement

NASA Astrophysics Data System (ADS)

Khélifa, N.

2008-01-01

Water vapour density inside the mass comparator enclosure is a critical parameter whose fluctuations during mass weighing can lead to errors in the determination of an unknown mass. To monitor them, a method using DFB laser diode in the near infrared has been proposed and tested. Preliminary results of our observation of water vapour sorption and de-sorption processes from the walls and the mass standard are reported.

Liquid and vapour-phase antifungal activities of selected essential oils against candida albicans: microscopic observations and chemical characterization of cymbopogon citratus

PubMed Central

2010-01-01

Background Use of essential oils for controlling Candida albicans growth has gained significance due to the resistance acquired by pathogens towards a number of widely-used drugs. The aim of this study was to test the antifungal activity of selected essential oils against Candida albicans in liquid and vapour phase and to determine the chemical composition and mechanism of action of most potent essential oil. Methods Minimum Inhibitory concentration (MIC) of different essential oils in liquid phase, assayed through agar plate dilution, broth dilution & 96-well micro plate dilution method and vapour phase activity evaluated through disc volatilization method. Reduction of C. albicans cells with vapour exposure was estimated by kill time assay. Morphological alteration in treated/untreated C. albicans cells was observed by the Scanning electron microscopy (SEM)/Atomic force microscopy (AFM) and chemical analysis of the strongest antifungal agent/essential oil has been done by GC, GC-MS. Results Lemon grass (Cymbopogon citratus) essential oil exhibited the strongest antifungal effect followed by mentha (Mentha piperita) and eucalyptus (Eucalyptus globulus) essential oil. The MIC of lemon grass essential oil in liquid phase (288 mg/l) was significantly higher than that in the vapour phase (32.7 mg/l) and a 4 h exposure was sufficient to cause 100% loss in viability of C. albicans cells. SEM/AFM of C. albicans cells treated with lemon grass essential oil at MIC level in liquid and vapour phase showed prominent shrinkage and partial degradation, respectively, confirming higher efficacy of vapour phase. GC-MS analysis revealed that lemon grass essential oil was dominated by oxygenated monoterpenes (78.2%); α-citral or geranial (36.2%) and β-citral or neral (26.5%), monoterpene hydrocarbons (7.9%) and sesquiterpene hydrocarbons (3.8%). Conclusion Lemon grass essential oil is highly effective in vapour phase against C. albicans, leading to deleterious morphological changes in cellular structures and cell surface alterations. PMID:21067604

Evaporation-triggered microdroplet nucleation and the four life phases of an evaporating Ouzo drop

NASA Astrophysics Data System (ADS)

Tan, Huanshu; Diddens, Christian; Lv, Pengyu; Kuerten, J. G. M.; Zhang, Xuehua; Lohse, Detlef

2016-11-01

Evaporating liquid droplets are omnipresent in nature and technology, such as in inkjet printing, coating, deposition of materials, medical diagnostics, agriculture, the food industry, cosmetics, or spills of liquids. Here we show that the evaporation of such ternary mixtures can trigger a phase transition and the nucleation of microdroplets of one of the components of the mixture. As a model system, we pick a sessile Ouzo droplet (as known from daily life) and reveal and theoretically explain its four life phases: In phase I, the spherical cap-shaped droplet remains transparent while the more volatile ethanol is evaporating, preferentially at the rim of the drop because of the singularity there. This leads to a local ethanol concentration reduction and correspondingly to oil droplet nucleation there. This is the beginning of phase II, in which oil microdroplets quickly nucleate in the whole drop, leading to its milky color that typifies the so-called "Ouzo effect." Once all ethanol has evaporated, the drop, which now has a characteristic nonspherical cap shape, has become clear again, with a water drop sitting on an oil ring (phase III), finalizing the phase inversion. Finally, in phase IV, all water has evaporated, leaving behind a tiny spherical cap-shaped oil drop.

Structure and sublimation of water ice films grown in vacuo at 120-190 K studied by positron and positronium annihilation.

PubMed

Townrow, S; Coleman, P G

2014-03-26

The crystalline structure of ∼ 5-20 μm water ice films grown at 165 and 172 K has been probed by measuring the fraction of positrons forming ortho-positronium (ortho-Ps) and decaying into three gamma photons. It has been established that films grown at slower rates (water vapour pressure ≥ 1 mPa) have lower concentrations of lattice defects and closed pores, which act as Ps traps, than those grown at higher rates (vapour pressure ∼ 100 mPa), evidenced by ortho-Ps diffusion lengths being approximately four times greater in the former. By varying the growth temperature between 162 and 182 K it was found that films become less disordered at temperatures above ∼ 172 K, with the ortho-Ps diffusion length rising by ∼ 60%, in this range. The sublimation energy for water ice films grown on copper has been measured to be 0.462(5) eV using the time dependence of positron annihilation parameters from 165 to 195 K, in agreement with earlier studies and with no measurable dependence on growth rate and thermal history.

Method and apparatus for flash evaporation of liquids

DOEpatents

Bharathan, Desikan

1984-01-01

A vertical tube flash evaporator for introducing a superheated liquid into a flash evaporation chamber includes a vertical inlet tube with a flared diffuser portion at its upper outlet end. A plurality of annular screens are positioned in axially spaced-apart relation to each other around the periphery of the vertical tube and below the diffuser portion thereof. The screens are preferably curved upward in a cup-shaped configuration. These flash evaporators are shown in an ocean thermal energy conversion unit designed for generating electric power from differential temperature gradients in ocean water. The method of use of the flash evaporators of this invention includes flowing liquid upwardly through the vertical tube into the diffuser where initial expansion and boiling occurs quite violently and explosively. Unvaporized liquid sheets and drops collide with each other to enhance surface renewal and evaporation properties, and liquid flowing over the outlet end of the diffuser falls onto the curved screens for further surface renewal and evaporation.

Method and apparatus for flash evaporation of liquids

DOEpatents

Bharathan, D.

1984-01-01

A vertical tube flash evaporator for introducing a super-heated liquid into a flash evaporation chamber includes a vertical inlet tube with a flared diffuser portion at its upper outlet end. A plurality of annular screens are positioned in axially spaced-apart relation to each other around the periphery of the vertical tube and below the diffuser portion thereof. The screens are preferably curved upward in a cup-shaped configuration. These flash evaporators are shown in an ocean thermal energy conversion unit designed for generating electric power from differential temperature gradients in ocean water. The method of use of the flash evaporators of this invention includes flowing liquid upwardly through the vertical tube into the diffuser where initial expansion and boiling occurs quite violently and explosively. Unvaporized liquid sheets and drops collide with each other to enhance surface renewal and evaporation properties, and liquid flowing over the outlet end of the diffuser falls onto the curved screens for further surface renewal and evaporation.

Numerical Simulation of Pulsation Flow in the Vapour Channel of Short Low Temperature Heat Pipes at High Heat Loads

NASA Astrophysics Data System (ADS)

Seryakov, A. V.; Konkin, A. V.

2017-11-01

The results of the numerical simulation of pulsations in the Laval-liked vapour channel of short low-temperature range heat pipes (HPs) are presented. The numerical results confirmed the experimentally obtained increase of the frequency of pulsations in the vapour channel of short HPs with increasing overheat of the porous evaporator relative to the boiling point of the working fluid. The occurrence of pressure pulsations inside the vapour channel in a short HPs is a complex phenomenon associated with the boiling beginning in the capillary-porous evaporator at high heat loads, and appearance the excess amount of vapour above it, leading to the increase in pressure P to a value at which the boiling point TB of the working fluid becomes higher than the evaporator temperature Tev. Vapour clot spreads through the vapour channel and condense, and then a rarefaction wave return from condenser in the evaporator, the boiling in which is resumed and the next cycle of the pulsations is repeated. Numerical simulation was performed using finite element method implemented in the commercial program ANSYS Multiphisics 14.5 in the two-dimensional setting of axis symmetric moist vapour flow with third kind boundary conditions.

Transport of metals and sulphur in magmas by flotation of sulphide melt on vapour bubbles

NASA Astrophysics Data System (ADS)

Mungall, J. E.; Brenan, J. M.; Godel, B.; Barnes, S. J.; Gaillard, F.

2015-03-01

Emissions of sulphur and metals from magmas in Earth’s shallow crust can have global impacts on human society. Sulphur-bearing gases emitted into the atmosphere during volcanic eruptions affect climate, and metals and sulphur can accumulate in the crust above a magma reservoir to form giant copper and gold ore deposits, as well as massive sulphur anomalies. The volumes of sulphur and metals that accumulate in the crust over time exceed the amounts that could have been derived from an isolated magma reservoir. They are instead thought to come from injections of multiple new batches of vapour- and sulphide-saturated magmas into the existing reservoirs. However, the mechanism for the selective upward transfer of sulphur and metals is poorly understood because their main carrier phase, sulphide melt, is dense and is assumed to settle to the bottoms of magma reservoirs. Here we use laboratory experiments as well as gas-speciation and mass-balance models to show that droplets of sulphide melt can attach to vapour bubbles to form compound drops that float. We demonstrate the feasibility of this mechanism for the upward mobility of sulphide liquids to the shallow crust. Our work provides a mechanism for the atmospheric release of large amounts of sulphur, and contradicts the widely held assumption that dense sulphide liquids rich in sulphur, copper and gold will remain sequestered in the deep crust.

Theoretical investigation of flash vaporisation in a screw expander

NASA Astrophysics Data System (ADS)

Vasuthevan, Hanushan; Brümmer, Andreas

2017-08-01

In the present study flash vaporisation of liquid injection in a twin screw expander for a Trilateral Flash Cycle (TFC) is examined theoretically. The TFC process comprises a pressure increase in the working fluid, followed by heating the liquid close to boiling point. The hot liquid is injected into the working chamber of a screw expander. During this process the pressure of the liquid drops below the saturation pressure, while the temperature of the liquid remains virtually constant. Hence the liquid is superheated and in a metastable state. The liquid jet seeks to achieve a stable state in thermodynamic equilibrium and is therefore partially vaporised. This effect is referred to as flash vaporisation. Accordingly, a two-phase mixture, consisting of vapour and liquid, exists in the working chamber. Thermodynamic simulations were carried out using water as the working fluid for representative screw expander geometry. The simulations presented are performed from two different aspects during the filling process of a screw expander. The first case is the vaporisation of the injected liquid in a state of thermodynamic equilibrium, whereby the two-phase mixture is treated entirely as a compressible and homogeneous gas. The second case considers flashing efficiency. It describes the quantity of flashed vapour and consists of a liquid and vapour domain. Both models are compared and analysed with respect to the operational behaviour of a screw expander.

Diffusion Of Mass In Evaporating Multicomponent Drops

NASA Technical Reports Server (NTRS)

Bellan, Josette; Harstad, Kenneth G.

1992-01-01

Report summarizes study of diffusion of mass and related phenomena occurring in evaporation of dense and dilute clusters of drops of multicomponent liquids intended to represent fuels as oil, kerosene, and gasoline. Cluster represented by simplified mathematical model, including global conservation equations for entire cluster and conditions on boundary between cluster and ambient gas. Differential equations of model integrated numerically. One of series of reports by same authors discussing evaporation and combustion of sprayed liquid fuels.

Self-Reported Sitting Time in New York City Adults, The Physical Activity and Transit Survey, 2010–2011

PubMed Central

Bartley, Katherine F.; Firestone, Melanie J.; Lee, Karen K.; Eisenhower, Donna L.

2015-01-01

Introduction Recent studies have demonstrated the negative health consequences associated with extended sitting time, including metabolic disturbances and decreased life expectancy. The objectives of this study were to characterize sitting time in an urban adult population and assess the validity of a 2-question method of self-reported sitting time. Methods The New York City Health Department conducted the 2010–2011 Physical Activity and Transit Survey (N = 3,597); a subset of participants wore accelerometers for 1 week (n = 667). Self-reported sitting time was assessed from 2 questions on time spent sitting (daytime and evening hours). Sedentary time was defined as accelerometer minutes with less than 100 counts on valid days. Descriptive statistics were used to estimate the prevalence of sitting time by demographic characteristics. Validity of sitting time with accelerometer-measured sedentary time was assessed using Spearman’s correlation and Bland-Altman techniques. All data were weighted to be representative of the New York City adult population based on the 2006–2008 American Community Survey. Results Mean daily self-reported sitting time was 423 minutes; mean accelerometer-measured sedentary time was 490 minutes per day (r = 0.32, P < .001). The mean difference was 49 minutes per day (limits of agreement: −441 to 343). Sitting time was higher in respondents at lower poverty and higher education levels and lower in Hispanics and people who were foreign-born. Conclusion Participants of higher socioeconomic status, who are not typically the focus of health disparities–related research, had the highest sitting times; Hispanics had the lowest levels. Sitting time may be accurately assessed by self-report with the 2-question method for population surveillance but may be limited in accurately characterizing individual-level behavior. PMID:26020549

The sitting position during neurosurgical procedures does not influence serum biomarkers of pulmonary parenchymal injury.

PubMed

Duda, Izabela; Grzybowska, Konstancja; Jędrzejowska-Szypułka, Halina; Lewin-Kowalik, Joanna

2012-12-05

The sitting position during neurosurgical operations predisposes to air penetration through veins and the movement of the air through the pulmonary circulation. Contact of an air bubble with the endothelium can lead to acute lung injury. The presence of specific pulmonary proteins in the plasma such as surfactant protein D (SP-D) and Clara cell protein (CC16) is a biomarker of damaging processes at the air-blood barrier. The aim of our study was to examine the hypothesis that the level of investigated pulmonary biomarkers in plasma is higher in patients operated on in the sitting position. The study included patients undergoing planned neurosurgical operations, who were divided into two groups: the sitting group (40 patients, operated on in the sitting position) and the supine group (24 patients, operated in the supine position). After the operation blood samples were drawn, centrifuged, frozen and stored until analyses were conducted. The determination of the SP-D and CC16 levels was performed using an ELISA test. Air embolism (VAE) was defined as a sudden drop in etCO2 of more than 2 mmHg and the presence of air bubbles in the aspirated blood from the central cannula. In all patients, the number of hospitalization days in the postoperative period was calculated. There were no differences in the average levels of SP-D between the groups (the mean in the sitting group was 95.56 ng/mL and the mean in the supine group was 101.21 ng/mL). The average levels of CC16 were similar in both groups as well (6.56 ng/mL in the sitting group and 6.79 ng/mL in the supine group). There was a statistically significant positive correlation between SP-D and CC16 values in both groups. VAE was diagnosed clinically in 12.5% of cases in the sitting group without a significant increase in SP-D and CC16 levels. On average, patients in both groups were discharged from the hospital within 9 days of surgery. The sitting position and intraoperative VAE during neurosurgical procedures do not affect the concentration of plasma biomarkers of pulmonary parenchymal injury such as SP-D and CC16.

In situ study of the growth and degradation processes in tetragonal lysozyme crystals on a silicon substrate by high-resolution X-ray diffractometry

NASA Astrophysics Data System (ADS)

Kovalchuk, M. V.; Prosekov, P. A.; Marchenkova, M. A.; Blagov, A. E.; D'yakova, Yu. A.; Tereshchenko, E. Yu.; Pisarevskii, Yu. V.; Kondratev, O. A.

2014-09-01

The results of an in situ study of the growth of tetragonal lysozyme crystals by high-resolution X-ray diffractometry are considered. The crystals are grown by the sitting-drop method on crystalline silicon substrates of different types: both on smooth substrates and substrates with artificial surface-relief structures using graphoepitaxy. The crystals are grown in a special hermetically closed crystallization cell, which enables one to obtain images with an optical microscope and perform in situ X-ray diffraction studies in the course of crystal growth. Measurements for lysozyme crystals were carried out in different stages of the crystallization process, including crystal nucleation and growth, developed crystals, the degradation of the crystal structure, and complete destruction.

Purification, crystallization and preliminary X-ray diffraction studies of d-tagatose 3-epimerase from Pseudomonas cichorii

PubMed Central

Yoshida, Hiromi; Yamada, Mitsugu; Nishitani, Takeyori; Takada, Goro; Izumori, Ken; Kamitori, Shigehiro

2007-01-01

d-Tagatose 3-epimerase (D-TE) from Pseudomonas cichorii catalyzes the epimerization of various ketohexoses at the C3 position. The epimerization of d-­psicose has not been reported with epimerases other than P. cichorii D-­TE and d-psicose 3-epimerase from Agrobacterium tumefaciens. Recombinant P. cichorii D-TE has been purified and crystallized. Crystals of P. cichorii D-TE were obtained by the sitting-drop method at room temperature. The crystal belongs to the monoclinic space group P21, with unit-cell parameters a = 76.80, b = 94.92, c = 91.73 Å, β = 102.82°. Diffraction data were collected to 2.5 Å resolution. The asymmetric unit is expected to contain four molecules. PMID:17277456

Pan-derived isotopic composition of atmospheric vapour in a Mediterranean wetland (Rhône River Delta, France).

PubMed

Vallet-Coulomb, Christine; Cartapanis, Olivier; Radakovitch, Olivier; Sonzogni, Corinne; Pichaud, Marc

2010-03-01

A continuous record of atmospheric vapour isotopic composition (delta(A)) can be derived from the isotope mass balance of a water body submitted to natural evaporation. In this paper, we present preliminary results of the application of this method to a drying evaporation pan, located in a Mediterranean wetland, during a two-month summer period. Results seem consistent with few atmospheric vapour data based on the assumption of isotopic equilibrium with precipitation, but we observed a shift between pan-derived delta(A) and the composition of vapour samples collected by cold trapping. These results suggest that further investigations are necessary to evaluate the effect of diurnal variations of atmospheric conditions on the applicability of the pan-evaporation method, and on the representative of grab atmospheric samples. We also propose a sensitivity analysis for evaluating the impact of the different measured components on delta(A) calculation, and show an improvement in the method efficiency as the pan is drying.

Drop deployment system for crystal growth apparatus

NASA Technical Reports Server (NTRS)

Rhodes, Percy H. (Inventor); Snyder, Robert S. (Inventor); Pusey, Marc L. (Inventor)

1992-01-01

This invention relates to a crystal growth apparatus (10) generally used for growing protein crystals wherein a vapor diffusion method is used for growing the crystals. In this apparatus, a precipitating solution and a solution containing dissolved crystalline material are stored in separate vials (12, 14), each having a resilient diaphragm (28) across one end and an opening (24) with a puncturable septum (26) thereacross at an opposite end. The vials are placed in receptacles (30) having a manifold (41) with a manifold diaphragm (42) in contact with the vial diaphragm at one end of the receptacle and a hollow needle (36) for puncturing the septum at the other end of the manifold. The needles of each vial communicate with a ball mixer (40) that mixes the precipitate and protein solutions and directs the mixed solution to a drop support (64) disposed in a crystal growth chamber (16), the drop support being a tube with an inner bevelled surface (66) that provides more support for the drop (68) than the tubes of the prior art. A sealable storage region (70) intermediate the drop support and mixer provides storage of the drop (68) and the grown crystals.

Reducing ingress of organic vapours into homes situated on contaminated land.

PubMed

Crump, D; Brown, V; Rowley, J; Squire, R

2004-04-01

The efficacy of current landfill gas and radon mitigation measures for the prevention of ingress of organic vapours was investigated by the study of four houses situated on contaminated land in North West England. The chemical present in the ground of greatest concern for health due to exposure to vapour in the indoor air was hexachlorobutadiene (HCBD) and the concentration of this compound was used to assess the effectiveness of the remedial measures. A two stage remediation was undertaken. For a house with a solid floor the top surface of the floor was sealed and then for the second stage a fan was used to pressurise the soil gas beneath the house. In a house with a suspended timber floor, extra air bricks were installed to increase ventilation of the floor void and then a fan to further increase air exchange in the void. HCBD in air was monitored by both pumped and diffusive sampling methods. Control houses were also monitored that were not subject to remediation. It is concluded that the remedial measures used for radon protection of a suspended floor have the potential to reduce indoor HCBD concentrations by about 80%, at least in downstairs rooms (where initial levels were highest). The two techniques used for properties with solid floors do not appear to be as effective, and no benefit at all was seen without making allowances for changes in concentration that occurred in the control house over the same period. Further work is required to test the efficacy of the techniques over a longer period and under different circumstances of type of contamination and building characteristics.

Vapor Cartesian diver

NASA Astrophysics Data System (ADS)

Grebenev, Igor V.; Lebedeva, Olga V.; Polushkina, Svetlana V.

2018-07-01

The article proposes a new research object for a general physics course—the vapour Cartesian diver, designed to study the properties of saturated water vapour. Physics education puts great importance on the study of the saturated vapour state, as it is related to many fundamental laws and theories. For example, the temperature dependence of the saturated water vapour pressure allows the teacher to demonstrate the Le Chatelier’s principle: increasing the temperature of a system in a dynamic equilibrium favours the endothermic change. That means that increasing the temperature increases the amount of vapour present, and so increases the saturated vapour pressure. The experimental setup proposed in this paper can be used as an example of an auto-oscillatory system, based on the properties of saturated vapour. The article describes a mathematical model of physical processes that occur in the experiment, and proposes a numerical solution method for the acquired system of equations. It shows that the results of numerical simulation coincide with the self-oscillation parameters from the real experiment. The proposed installation can also be considered as a model of a thermal engine.

Applications of thin-film sandwich crystallization platforms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Axford, Danny, E-mail: danny.axford@diamond.ac.uk; Aller, Pierre; Sanchez-Weatherby, Juan

2016-03-24

Crystallization via sandwiches of thin polymer films is presented and discussed. Examples are shown of protein crystallization in, and data collection from, solutions sandwiched between thin polymer films using vapour-diffusion and batch methods. The crystallization platform is optimal for both visualization and in situ data collection, with the need for traditional harvesting being eliminated. In wells constructed from the thinnest plastic and with a minimum of aqueous liquid, flash-cooling to 100 K is possible without significant ice formation and without any degradation in crystal quality. The approach is simple; it utilizes low-cost consumables but yields high-quality data with minimal samplemore » intervention and, with the very low levels of background X-ray scatter that are observed, is optimal for microcrystals.« less

On the acceleration of charged particles at relativistic shock fronts

NASA Technical Reports Server (NTRS)

Kirk, J. G.; Schneider, P.

1987-01-01

The diffusive acceleration of highly relativistic particles at a shock is reconsidered. Using the same physical assumptions as Blandford and Ostriker (1978), but dropping the restriction to nonrelativistic shock velocities, the authors find approximate solutions of the particle kinetic equation by generalizing the diffusion approximation to higher order terms in the anisotropy of the particle distribution. The general solution of the transport equation on either side of the shock is constructed, which involves the solution of an eigenvalue problem. By matching the two solutions at the shock, the spectral index of the resulting power law is found by taking into account a sufficiently large number of eigenfunctions. Low-order truncation corresponds to the standard diffusion approximation and to a somewhat more general method described by Peacock (1981). In addition to the energy spectrum, the method yields the angular distribution of the particles and its spatial dependence.

Reliable determination of oxygen and hydrogen isotope ratios in atmospheric water vapour adsorbed on 3A molecular sieve.

PubMed

Han, Liang-Feng; Gröning, Manfred; Aggarwal, Pradeep; Helliker, Brent R

2006-01-01

The isotope ratio of atmospheric water vapour is determined by wide-ranging feedback effects from the isotope ratio of water in biological water pools, soil surface horizons, open water bodies and precipitation. Accurate determination of atmospheric water vapour isotope ratios is important for a broad range of research areas from leaf-scale to global-scale isotope studies. In spite of the importance of stable isotopic measurements of atmospheric water vapour, there is a paucity of published data available, largely because of the requirement for liquid nitrogen or dry ice for quantitative trapping of water vapour. We report results from a non-cryogenic method for quantitatively trapping atmospheric water vapour using 3A molecular sieve, although water is removed from the column using standard cryogenic methods. The molecular sieve column was conditioned with water of a known isotope ratio to 'set' the background signature of the molecular sieve. Two separate prototypes were developed, one for large collection volumes (3 mL) and one for small collection volumes (90 microL). Atmospheric water vapour was adsorbed to the column by pulling air through the column for several days to reach the desired final volume. Water was recovered from the column by baking at 250 degrees C in a dry helium or nitrogen air stream and cryogenically trapped. For the large-volume apparatus, the recovered water differed from water that was simultaneously trapped by liquid nitrogen (the experimental control) by 2.6 per thousand with a standard deviation (SD) of 1.5 per thousand for delta(2)H and by 0.3 per thousand with a SD of 0.2 per thousand for delta(18)O. Water-vapour recovery was not satisfactory for the small volume apparatus. Copyright (c) 2006 John Wiley & Sons, Ltd.

A hybrid interface tracking - level set technique for multiphase flow with soluble surfactant

NASA Astrophysics Data System (ADS)

Shin, Seungwon; Chergui, Jalel; Juric, Damir; Kahouadji, Lyes; Matar, Omar K.; Craster, Richard V.

2018-04-01

A formulation for soluble surfactant transport in multiphase flows recently presented by Muradoglu and Tryggvason (JCP 274 (2014) 737-757) [17] is adapted to the context of the Level Contour Reconstruction Method, LCRM, (Shin et al. IJNMF 60 (2009) 753-778, [8]) which is a hybrid method that combines the advantages of the Front-tracking and Level Set methods. Particularly close attention is paid to the formulation and numerical implementation of the surface gradients of surfactant concentration and surface tension. Various benchmark tests are performed to demonstrate the accuracy of different elements of the algorithm. To verify surfactant mass conservation, values for surfactant diffusion along the interface are compared with the exact solution for the problem of uniform expansion of a sphere. The numerical implementation of the discontinuous boundary condition for the source term in the bulk concentration is compared with the approximate solution. Surface tension forces are tested for Marangoni drop translation. Our numerical results for drop deformation in simple shear are compared with experiments and results from previous simulations. All benchmarking tests compare well with existing data thus providing confidence that the adapted LCRM formulation for surfactant advection and diffusion is accurate and effective in three-dimensional multiphase flows with a structured mesh. We also demonstrate that this approach applies easily to massively parallel simulations.

Hanging drop crystal growth apparatus and method

NASA Technical Reports Server (NTRS)

Carter, Daniel C. (Inventor); Smith, Robbie E. (Inventor)

1989-01-01

An apparatus (10) is constructed having a cylindrical enclosure (16) within which a disc-shaped wicking element (18) is positioned. A well or recess (22) is cut into an upper side (24) of this wicking element, and a glass cover plate or slip (28) having a protein drop disposed thereon is sealably positioned on the wicking element (18), with drop (12) being positioned over well or recess (22). A flow of control fluid is generated by a programmable gradient former (16), with this control fluid having a vapor pressure that is selectively variable. This flow of control fluid is coupled to the wicking element (18) where control fluid vapor diffusing from walls (26) of the recess (22) is exposed to the drop (12), forming a vapor pressure gradient between the drop (12) and the control fluid vapor. Initially, this gradient is adjusted to draw solvent from the drop (12) at a relatively high rate, and as the critical supersaturation point is approached (the point at which crystal nucleation occurs), the gradient is reduced to more slowly draw solvent from the drop (12). This allows discrete protein molecules more time to orient themselves into an ordered crystalline lattice, producing protein crystals which, when processed by X-ray crystallography, possess a high degree of resolution.

Properties of the carbon-palladium nanocomposites studied by Raman spectroscopy method

NASA Astrophysics Data System (ADS)

Belka, Radosław; Suchańska, Małgorzata

2013-10-01

In this paper, the results for thin carbon-palladium (C-Pd) nanocomposites obtained by PVD (Physical Vapour Deposition) and PVD/CVD (Chemical Vapour Deposition) method, carried out using Raman spectroscopy method are presented. Studies reveal the dominance of fullerene-like structure for PVD samples and graphite-like structures for CVD samples. The type of substrate and metal content have great impact on spectra shapes.

Crystallization and X-ray analysis of the salmon-egg lectin SEL24K

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murata, Kenji; Fisher, Andrew J.; Hedrick, Jerry L., E-mail: jlhedrick@ucdavis.edu

2007-05-01

The 24 kDa egg lectin of Chinook salmon (Oncorhynchus tshawytscha) was purified by affinity chromatography from salmon eggs and crystallized by the hanging-drop vapor-diffusion method using 15/4 EO/OH (pentaerythritol ethoxylate) as a precipitant. The 24 kDa egg lectin of Chinook salmon (Oncorhynchus tshawytscha) is released from the egg during the cortical reaction. The lectin functions in blocking polyspermy during the fertilization process. The egg lectin was purified by affinity chromatography from salmon eggs and crystallized by the hanging-drop vapor-diffusion method using 15/4 EO/OH (pentaerythritol ethoxylate) as a precipitant. The crystal diffracted synchrotron-radiation X-rays to 1.63 Å resolution. The crystal belongsmore » to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 93.0, b = 73.6, c = 113.6 Å, α = 90, β = 92.82, γ = 90°. The crystal is likely to contain eight molecules in the asymmetric unit (V{sub M} = 2.3 Å{sup 3} Da{sup −1}), corresponding to a solvent content of 45.5%. A self-rotation function suggests an arrangement with 222 point symmetry within the asymmetric unit.« less

An advanced model of heat and mass transfer in the protective clothing - verification

NASA Astrophysics Data System (ADS)

Łapka, P.; Furmański, P.

2016-09-01

The paper presents an advanced mathematical and numerical models of heat and mass transfer in the multi-layers protective clothing and in elements of the experimental stand subjected to either high surroundings temperature or high radiative heat flux emitted by hot objects. The model included conductive-radiative heat transfer in the hygroscopic porous fabrics and air gaps as well as conductive heat transfer in components of the stand. Additionally, water vapour diffusion in the pores and air spaces as well as phase transition of the bound water in the fabric fibres (sorption and desorption) were accounted for. The thermal radiation was treated in the rigorous way e.g.: semi-transparent absorbing, emitting and scattering fabrics were assumed a non-grey and all optical phenomena at internal or external walls were modelled. The air was assumed transparent. Complex energy and mass balance as well as optical conditions at internal or external interfaces were formulated in order to find exact values of temperatures, vapour densities and radiation intensities at these interfaces. The obtained highly non-linear coupled system of discrete equation was solve by the in-house iterative algorithm which was based on the Finite Volume Method. The model was then successfully partially verified against the results obtained from commercial software for simplified cases.

Flow field investigation in a bulb turbine diffuser

NASA Astrophysics Data System (ADS)

Pereira, M.; Duquesne, P.; Aeschlimann, V.; Deschênes, C.

2017-04-01

An important drop in turbine performances has been measured in a bulb turbine model operated at overload. Previous investigations have correlated the performance drop with diffuser losses, and particularly to the flow separation zone at the diffuser wall. The flow has been investigated in the transition part of the diffuser using two LDV measurement sections. The transition part is a diffuser section that transforms from a circular to a rectangular section. The two measurement sections are at the inlet and outlet of the diffuser transition part. The turbine has been operated at three operating points, which are representative of different flow patterns at the diffuser exit at overload. In addition to the average velocity field, the analysis is conducted based on a backflow occurrence function and on the swirl level. Results reveal a counter-rotating zone in the diffuser, which intensifies with the guide vanes opening. The guide vanes opening induces a modification of the flow phenomena: from a central backflow recirculation zone at the lowest flowrate to a backflow zone induced by flow separation at the wall at the highest flowrate.

Comprehensive analysis of earthquake source spectra and swarms in the Salton Trough, California

NASA Astrophysics Data System (ADS)

Chen, X.; Shearer, P. M.

2011-09-01

We study earthquakes within California's Salton Trough from 1981 to 2009 from a precisely relocated catalog. We process the seismic waveforms to isolate source spectra, station spectra and travel-time dependent spectra. The results suggest an average P wave Q of 340, agreeing with previous results indicating relatively high attenuation in the Salton Trough. Stress drops estimated from the source spectra using an empirical Green's function (EGF) method reveal large scatter among individual events but a low median stress drop of 0.56 MPa for the region. The distribution of stress drop after applying a spatial-median filter indicates lower stress drops near geothermal sites. We explore the relationships between seismicity, stress drops and geothermal injection activities. Seismicity within the Salton Trough shows strong spatial clustering, with 20 distinct earthquake swarms with at least 50 events. They can be separated into early-Mmax and late-Mmax groups based on the normalized occurrence time of their largest event. These swarms generally have a low skew value of moment release history, ranging from -9 to 3.0. The major temporal difference between the two groups is the excess of seismicity and an inverse power law increase of seismicity before the largest event for the late-Mmax group. All swarms exhibit spatial migration of seismicity at a statistical significance greater than 85%. A weighted L1-norm inversion of linear migration parameters yields migration velocities from 0.008 to 0.8 km/hour. To explore the influence of fluid injection in geothermal sites, we also model the migration behavior with the diffusion equation, and obtain a hydraulic diffusion coefficient of approximately 0.25 m2/s for the Salton Sea geothermal site, which is within the range of expected values for a typical geothermal reservoir. The swarms with migration velocities over 0.1 km/hour cannot be explained by the diffusion curve, rather, their velocity is consistent with the propagation velocity of creep and slow slip events. These variations in migration behavior allow us to distinguish among different driving processes.

Sticking non-stick: Surface and Structure control of Diamond-like Carbon in Plasma Enhanced Chemical Vapour Deposition

NASA Astrophysics Data System (ADS)

Jones, B. J.; Nelson, N.

2016-10-01

This short review article explores the practical use of diamond-like carbon (DLC) produced by plasma enhanced chemical vapour deposition (PECVD). Using as an example issues relating to the DLC coating of a hand-held surgical device, we draw on previous works using atomic force microscopy, X-ray photoelectron spectroscopy, Raman spectroscopy, scanning electron microscopy, tensiometry and electron paramagnetic resonance. Utilising data from these techniques, we examine the surface structure, substrate-film interface and thin film microstructure, such as sp2/sp3 ratio (graphitic/diamond-like bonding ratio) and sp2 clustering. We explore the variations in parameters describing these characteristics, and relate these to the final device properties such as friction, wear resistance, and diffusion barrier integrity. The material and device characteristics are linked to the initial plasma and substrate conditions.

Maxwell-Stefan diffusion: a framework for predicting condensed phase diffusion and phase separation in atmospheric aerosol

NASA Astrophysics Data System (ADS)

Fowler, Kathryn; Connolly, Paul J.; Topping, David O.; O'Meara, Simon

2018-02-01

The composition of atmospheric aerosol particles has been found to influence their micro-physical properties and their interaction with water vapour in the atmosphere. Core-shell models have been used to investigate the relationship between composition, viscosity and equilibration timescales. These models have traditionally relied on the Fickian laws of diffusion with no explicit account of non-ideal interactions. We introduce the Maxwell-Stefan diffusion framework as an alternative method, which explicitly accounts for non-ideal interactions through activity coefficients. e-folding time is the time it takes for the difference in surface and bulk concentration to change by an exponential factor and was used to investigate the interplay between viscosity and solubility and the effect this has on equilibration timescales within individual aerosol particles. The e-folding time was estimated after instantaneous increases in relative humidity to binary systems of water and an organic component. At low water mole fractions, viscous effects were found to dominate mixing. However, at high water mole fractions, equilibration times were more sensitive to a range in solubility, shown through the greater variation in e-folding times. This is the first time the Maxwell-Stefan framework has been applied to an atmospheric aerosol core-shell model and shows that there is a complex interplay between the viscous and solubility effects on aerosol composition that requires further investigation.

Application of Machine Learning Approaches for Classifying Sitting Posture Based on Force and Acceleration Sensors.

PubMed

Zemp, Roland; Tanadini, Matteo; Plüss, Stefan; Schnüriger, Karin; Singh, Navrag B; Taylor, William R; Lorenzetti, Silvio

2016-01-01

Occupational musculoskeletal disorders, particularly chronic low back pain (LBP), are ubiquitous due to prolonged static sitting or nonergonomic sitting positions. Therefore, the aim of this study was to develop an instrumented chair with force and acceleration sensors to determine the accuracy of automatically identifying the user's sitting position by applying five different machine learning methods (Support Vector Machines, Multinomial Regression, Boosting, Neural Networks, and Random Forest). Forty-one subjects were requested to sit four times in seven different prescribed sitting positions (total 1148 samples). Sixteen force sensor values and the backrest angle were used as the explanatory variables (features) for the classification. The different classification methods were compared by means of a Leave-One-Out cross-validation approach. The best performance was achieved using the Random Forest classification algorithm, producing a mean classification accuracy of 90.9% for subjects with which the algorithm was not familiar. The classification accuracy varied between 81% and 98% for the seven different sitting positions. The present study showed the possibility of accurately classifying different sitting positions by means of the introduced instrumented office chair combined with machine learning analyses. The use of such novel approaches for the accurate assessment of chair usage could offer insights into the relationships between sitting position, sitting behaviour, and the occurrence of musculoskeletal disorders.

Baseline predictors of maintenance of intervention-induced changes in physical activity and sitting time among diabetic and pre-diabetic patients: a descriptive case series.

PubMed

Helmink, Judith H M; Gubbels, Jessica S; van Brussel-Visser, Femke N; de Vries, Nanne K; Kremers, Stef P J

2013-05-08

The aim of this study was to explore the predictive value of baseline characteristics in relation to changes in physical activity (PA) and sedentary behaviour among diabetic and pre-diabetic patients participating in a primary care based exercise intervention. We used a descriptive case series among diabetic and pre-diabetic patients (n = 119, 50.8% male, mean age 65.5 (SD = 7.8)). Measurements took place with questionnaires at baseline and two years after the start of the intervention. Predictor variables included demographic factors, Body Mass Index, baseline PA and sitting time, and baseline socio-cognitive profile. At follow-up, respondents spent more time being physically active than at baseline. For the total group, the average sitting time remained almost unchanged between the two measurements. Further exploration showed that respondents who had relatively high levels of PA at the start of the intervention, increased their total sitting time, while respondents with relatively low levels of PA at the start decreased their sitting time. The socio-cognitive profile did not predict behaviour change. The intervention appeared to be suitable for people with a low-education level, but the results should be interpreted in view of the limitations of the study such as the non-controlled design, self-reported outcomes and selective drop-out of participants. Interventions for this specific target group may need to put more emphasis on the prevention of increased sitting time. The finding that the socio-cognitive profile did not predict behaviour change may underline the proposition that decisions to initiate and maintain PA behaviour change are to a large extend non-linear events. Acknowledging the possible non-linearity of the relationship between socio-cognitive determinants and behaviour change will help our understanding of this complex and dynamic process.

Film boiling of mercury droplets

NASA Technical Reports Server (NTRS)

Baumeister, K. J.; Schoessow, G. J.; Chmielewski, C. E.

1975-01-01

Vaporization times of mercury droplets in Leidenfrost film boiling on a flat horizontal plate are measured in an air atmosphere. Extreme care was used to prevent large amplitude droplet vibrations and surface wetting; therefore, these data can be compared to film boiling theory. Diffusion from the upper surface of the drop appears as a dominant mode of mass transfer from the drop. A closed-form analytical film boiling theory is developed to account for the diffusive evaporation. Reasonable agreement between data and theory is seen.

Determination of mass and heat transfer parameters during freeze-drying cycles of pharmaceutical products.

PubMed

Hottot, A; Vessot, S; Andrieu, J

2005-01-01

The principal aim of this study was to evaluate the water vapour mass transfer resistance of the dried layer and the vial heat transfer coefficient values of a pharmaceutical product during the primary drying period. First, overall vial heat transfer coefficient values, Kv, were determined by a gravimetric method based on pure ice sublimation experiments. Thus, it was possible to set up a map of the total heat flux received by each vial throughout the plate surface of our pilot scale freeze-dryer. Important heterogeneities were observed for the vials placed at the plate edges and for the vials placed at the center of the plate. As well, the same gravimetric method was also used to precisely determine the influence of main lyophilization operating parameters (shelf temperature and gas total pressure) or the vial types and sizes on these overall heat transfer coefficient values. A semi-empirical relationship as a function of total gas pressure was proposed. The transient method by pressure rise analysis (PRA method) after interrupting the water vapour flow between the sublimation chamber and the condenser, previously set up and validated in our laboratory, was then extensively used with an amorphous BSA-based formulation to identify the dried layer mass transfer resistance values, Rp, the ice front temperature, and the total heat transfer coefficient values, Kv, with or without annealing treatment. It was proved that this method gave accurate and coherent data only during the first half of the sublimation period when the totality of the vials of the set was still sublimating. Thus, this rapid method allowed estimation of, on line and in situ, the sublimation front temperature and the characterization of the morphology and structure of the freeze-dried layer, all along the first part of the sublimation period. The estimated sublimation temperatures shown by the PRA model were about 2 degrees C lower than the experimental values obtained using thermocouples inserted inside the vial, in accordance with previous data given by this method for similar freeze-drying conditions. As well, by using this method we could confirm the homogenization of the dried layer porous structure by annealing treatment after the freezing step. Furthermore, frozen matrix structure analysis (mean pore diameter) using optical microscopy and mass transfer modelling of water vapour by molecular diffusion (Knudsen regime) allowed, in some cases, to predict the experimental values of this overall mass transfer resistance directly related to the freeze-dried cake permeability.

Consistent Large-Eddy Simulation of a Temporal Mixing Layer Laden with Evaporating Drops. Part 2; A Posteriori Modelling

NASA Technical Reports Server (NTRS)

Leboissertier, Anthony; Okong'O, Nora; Bellan, Josette

2005-01-01

Large-eddy simulation (LES) is conducted of a three-dimensional temporal mixing layer whose lower stream is initially laden with liquid drops which may evaporate during the simulation. The gas-phase equations are written in an Eulerian frame for two perfect gas species (carrier gas and vapour emanating from the drops), while the liquid-phase equations are written in a Lagrangian frame. The effect of drop evaporation on the gas phase is considered through mass, species, momentum and energy source terms. The drop evolution is modelled using physical drops, or using computational drops to represent the physical drops. Simulations are performed using various LES models previously assessed on a database obtained from direct numerical simulations (DNS). These LES models are for: (i) the subgrid-scale (SGS) fluxes and (ii) the filtered source terms (FSTs) based on computational drops. The LES, which are compared to filtered-and-coarsened (FC) DNS results at the coarser LES grid, are conducted with 64 times fewer grid points than the DNS, and up to 64 times fewer computational than physical drops. It is found that both constant-coefficient and dynamic Smagorinsky SGS-flux models, though numerically stable, are overly dissipative and damp generated small-resolved-scale (SRS) turbulent structures. Although the global growth and mixing predictions of LES using Smagorinsky models are in good agreement with the FC-DNS, the spatial distributions of the drops differ significantly. In contrast, the constant-coefficient scale-similarity model and the dynamic gradient model perform well in predicting most flow features, with the latter model having the advantage of not requiring a priori calibration of the model coefficient. The ability of the dynamic models to determine the model coefficient during LES is found to be essential since the constant-coefficient gradient model, although more accurate than the Smagorinsky model, is not consistently numerically stable despite using DNS-calibrated coefficients. With accurate SGS-flux models, namely scale-similarity and dynamic gradient, the FST model allows up to a 32-fold reduction in computational drops compared to the number of physical drops, without degradation of accuracy; a 64-fold reduction leads to a slight decrease in accuracy.

The role of mass transport in protein crystallization.

PubMed

García-Ruiz, Juan Manuel; Otálora, Fermín; García-Caballero, Alfonso

2016-02-01

Mass transport takes place within the mesoscopic to macroscopic scale range and plays a key role in crystal growth that may affect the result of the crystallization experiment. The influence of mass transport is different depending on the crystallization technique employed, essentially because each technique reaches supersaturation in its own unique way. In the case of batch experiments, there are some complex phenomena that take place at the interface between solutions upon mixing. These transport instabilities may drastically affect the reproducibility of crystallization experiments, and different outcomes may be obtained depending on whether or not the drop is homogenized. In diffusion experiments with aqueous solutions, evaporation leads to fascinating transport phenomena. When a drop starts to evaporate, there is an increase in concentration near the interface between the drop and the air until a nucleation event eventually takes place. Upon growth, the weight of the floating crystal overcomes the surface tension and the crystal falls to the bottom of the drop. The very growth of the crystal then triggers convective flow and inhomogeneities in supersaturation values in the drop owing to buoyancy of the lighter concentration-depleted solution surrounding the crystal. Finally, the counter-diffusion technique works if, and only if, diffusive mass transport is assured. The technique relies on the propagation of a supersaturation wave that moves across the elongated protein chamber and is the result of the coupling of reaction (crystallization) and diffusion. The goal of this review is to convince protein crystal growers that in spite of the small volume of the typical protein crystallization setup, transport plays a key role in the crystal quality, size and phase in both screening and optimization experiments.

A field evaluation of a SO 2 passive sampler in tropical industrial and urban air

NASA Astrophysics Data System (ADS)

Cruz, Lícia P. S.; Campos, Vânia P.; Silva, Adriana M. C.; Tavares, Tania M.

Passive samplers have been widely used for over 30 years in the measurement of personal exposure to vapours and gases in the workplace. These samplers have just recently been applied in the monitoring of ambient air, which presents concentrations that are normally much smaller than those found in occupational environments. The locally constructed passive sampler was based on gas molecular diffusion through static air layer. The design used minimizes particle interference and turbulent diffusion. After exposure, the SO 2 trapped in impregnated filters with Na 2CO 3 was extracted by means of an ultrasonic bath, for 15 min, using 1.0×10 -2 mol L -1 H 2O 2. It was determined as SO 4-2 by ion chromatography. The performance of the passive sampler was evaluated at different exposure periods, being applied in industrial and urban areas. Method precision as relative standard deviation for three simultaneously applied passive samplers was within 10%. Passive sampling, when compared to active monitoring methods under real conditions, used in urban and industrial areas, showed an overall accuracy of 15%. A statistical comparison with an active method was performed to demonstrate the validity of the passive method. Sampler capacity varied between 98 and 421 μg SO 2 m -3 for exposure periods of one month and one week, respectively, which allows its use in highly polluted areas.

Wetting and drying of liquid on crossed fibers

NASA Astrophysics Data System (ADS)

Sauret, Alban; Bick, Alison D.; Stone, Howard A.; Complex Fluids Group Team

2013-11-01

Fibrous media are common in various engineered systems such as filters, paper or the textile industry. Many of these materials can be described as a network of fibers in which a wetting liquid tends to accumulate at its nodes and changes the bulk properties. Here we study a drop of silicone oil sitting on the simplest element of the array: two rigid crossed fibers. In particular, we investigate experimentally how the structure of the material affects the wetting and drying dynamics of that liquid drop. We first show that the liquid can adopt different shapes from a long liquid column to a drop. The transition between these morphologies depends on the volume of liquid, the tilting angle between the fibers, as well as the fiber radius. The wetting length in the column state can be predicted analytically. Because of these different shapes, the liquid exhibits different drying kinetics, which effects the overall drying time. Our study suggests that shearing a wetted array of fibers, by tuning the liquid morphology, may enhance the drying rate.

A Validated All-Pressure Fluid Drop Model and Lewis Number Effects for a Binary Mixture

NASA Technical Reports Server (NTRS)

Harstad, K.; Bellan, J.

1999-01-01

The differences between subcritical liquid drop and supercritical fluid drop behavior are discussed. Under subcritical, evaporative high emission rate conditions, a film layer is present in the inner part of the drop surface which contributes to the unique determination of the boundary conditions; it is this film layer which contributes to the solution's convective-diffusive character. In contrast, under supercritical condition as the boundary conditions contain a degree of arbitrariness due to the absence of a surface, and the solution has then a purely diffusive character. Results from simulations of a free fluid drop under no-gravity conditions are compared to microgravity experimental data from suspended, large drop experiments at high, low and intermediary temperatures and in a range of pressures encompassing the sub-and supercritical regime. Despite the difference between the conditions of the simulations and experiments (suspension vs. free floating), the time rate of variation of the drop diameter square is remarkably well predicted in the linear curve regime. The drop diameter is determined in the simulations from the location of the maximum density gradient, and agrees well with the data. It is also shown that the classical calculation of the Lewis number gives qualitatively erroneous results at supercritical conditions, but that an effective Lewis number previously defined gives qualitatively correct estimates of the length scales for heat and mass transfer at all pressures.

A new technique to assess dermal absorption of volatile chemicals in vitro by thermal gravimetric analysis.

PubMed

Rauma, Matias; Isaksson, Tina S; Johanson, Gunnar

2006-10-01

Potential health hazards of dermal exposure, variability in reported dermal absorption rates and potential losses from the skin by evaporation indicate a need for a simple, inexpensive and standardized procedure to measure dermal absorption and desorption of chemical substances. The aim of this study was to explore the possibility to measure dermal absorption and desorption of volatile chemicals using a new gravimetric technique, namely thermal gravimetric analysis (TGA), and trypsinated stratum corneum from pig. Changes in skin weight were readily detected before, during and after exposure to vapours of water, 2-propanol, methanol and toluene. The shape and height of the weight curves differed between the four chemicals, reflecting differences in diffusivity and partial pressure and skin:air partitioning, respectively. As the skin weight is highly sensitive to the partial pressure of volatile chemicals, including water, this technique requires carefully controlled conditions with respect to air flow, temperature, chemical vapour generation and humidity. This new technique may help in the assessment of dermal uptake of volatile chemicals. Only a small piece of skin is needed and skin integrity is not necessary, facilitating the use of human samples. The high resolution weight-time curves obtained may also help to elucidate the characteristics of absorption, desorption and diffusion of chemicals in skin.

Numerical and experimental study of the dynamics of a superheated jet

NASA Astrophysics Data System (ADS)

Sinha, Avick; Gopalakrishnan, Shivasubramanian; Balasubramanian, Sridhar

2015-11-01

Flash-boiling is a phenomenon where a liquid experiences low pressures in a system resulting in it getting superheated. The sudden drop in pressures results in accelerated expansion and violent vapour formation. Understanding the physics behind the jet disintegration and flash-boiling phenomenon is still an open problem, with applications in automotive and aerospace combustors. The behaviour of a flash-boiling jet is highly dependent on the input parameters, inlet temperature and pressure. In the present study, the external (outside nozzle) and the internal (inside nozzle) flow characteristics of the two-phase flow has been studied numerically and experimentally. The phase change from liquid to vapour takes place over a finite period of time, modeled sing Homogeneous Relaxation Model (HRM). In order to validate the numerical results, controlled experiments were performed. Optical diagnostic techniques such as Particle Image Velocimetry (PIV) and Shadowgraphy were used to study the flow characteristics. Spray angle, penetration depth, droplet spectra were obtained which provides a better understanding of the break-up mechanism. Linear stability analysis is performed to study the stability characteristics of the jet.

Energy gap opening by crossing drop cast single-layer graphene nanoribbons.

PubMed

Yamada, Toyo Kazu; Fukuda, Hideto; Fujiwara, Taizo; Liu, Polin; Nakamura, Kohji; Kasai, Seiya; Vazquez de Parga, Amadeo L; Tanaka, Hirofumi

2018-08-03

Band gap opening of a single-layer graphene nanoribbon (sGNR) sitting on another sGNR, fabricated by drop casting GNR solution on Au(111) substrate in air, was studied by means of scanning tunneling microscopy and spectroscopy in an ultra-high vacuum at 78 K and 300 K. GNRs with a width of ∼45 nm were prepared by unzipping double-walled carbon nanotubes (diameter ∼15 nm) using the ultrasonic method. In contrast to atomically-flat GNRs fabricated via the bottom-up process, the drop cast sGNRs were buckled on Au(111), i.e., some local points of the sGNR are in contact with the substrate (d ∼ 0.5 nm), but other parts float (d ∼ 1-3 nm), where d denotes the measured distance between the sGNR and the substrate. In spite of the fact that the nanoribbons were buckled, dI/dV maps confirmed that each buckled sGNR had a metallic character (∼3.5 G o ) with considerable uniform local density of states, comparable to a flat sGNR. However, when two sGNRs crossed each other, the crossed areas showed a band gap between -50 and +200 meV around the Fermi energy, i.e., the only upper sGNR electronic property changed from metallic to p-type semiconducting, which was not due to the bending, but the electronic interactions between the up and down sGNRs.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barber, Jacqueline; Aix-Marseille Universite; Brutin, David

Boiling in microchannels remains elusive due to the lack of full understanding of the mechanisms involved. A powerful tool in achieving better comprehension of the mechanisms is detailed imaging and analysis of the two-phase flow at a fundamental level. Boiling is induced in a single microchannel geometry (hydraulic diameter 727 {mu}m), using a refrigerant FC-72, to investigate the effect of channel confinement on bubble growth. A transparent, metallic, conductive deposit has been developed on the exterior of the rectangular microchannel, allowing simultaneous uniform heating and visualisation to be achieved. The data presented in this paper is for a particular casemore » with a uniform heat flux applied to the microchannel and inlet liquid mass flowrate held constant. In conjunction with obtaining high-speed images and videos, sensitive pressure sensors are used to record the pressure drop across the microchannel over time. Bubble nucleation and growth, as well as periodic slug flow, are observed in the microchannel test section. The periodic pressure fluctuations evidenced across the microchannel are caused by the bubble dynamics and instances of vapour blockage during confined bubble growth in the channel. The variation of the aspect ratio and the interface velocities of the growing vapour slug over time, are all observed and analysed. We follow visually the nucleation and subsequent both 'free' and 'confined' growth of a vapour bubble during flow boiling of FC-72 in a microchannel, from analysis of our results, images and video sequences with the corresponding pressure data obtained. (author)« less

A Leidenfrost Engine

NASA Astrophysics Data System (ADS)

Wells, Gary; Ledesma-Aguillar, Ridrigo; McHale, Glen; Sefiane, Khellil

2015-11-01

The Leidenfrost effect, the sustained levitation of evaporating liquid droplets by a cushion of their on vapour on very hot surfaces, has received increased attention over the past few years. On patterned surfaces, rectification of the vapour layer flow can lead to rich dynamics of evaporating drops or sublimating blocks of dry ice, including self-propulsion, orbiting and conjoint rotation. In this paper we show that the Leidenfrost effect can be exploited to drive the rotation of rigid objects, such as solid hydrophilic plates coupled to water droplets and blocks of dry ice, by using turbine-like substrates. Using a hydrodynamic model, we show that drag-based rotation is achieved at low-Reynolds number by a rectification mechanism of the flow in the vapour layer caused by the underlying turbine-like geometry. Our theoretical model determines the maximum weight of Leidenfrost rotors and the net torque driving their motion in terms of operational parameters, showing an excellent agreement with experiments using dry-ice blocks. We generalise the concept of rotation into a new concept for a heat engine capable of harvesting thermal energy using either thin-film boiling or sublimation as a phase-change mechanism. As a proof principle, we implement the new sublimation engine in the lab to create a simple electromagnetic generator. Our results support the feasibility of low-friction in situ energy harvesting from both liquids and ices in challenging situations such as deep drilling, outer space exploration or micro-mechanical manipulation.

Effects of side lying on lung function in older individuals.

PubMed

Manning, F; Dean, E; Ross, J; Abboud, R T

1999-05-01

Body positioning exerts a strong effect on pulmonary function, but its effect on other components of the oxygen transport pathway are less well understood, especially the effects of side-lying positions. This study investigated the interrelationships between side-lying positions and indexes of lung function such as spirometry, alveolar diffusing capacity, and inhomogeneity of ventilation in older individuals. Nineteen nonsmoking subjects (mean age=62.8 years, SD=6.8, range=50-74) with no history of cardiac or pulmonary disease were tested over 2 sessions. The test positions were sitting and left side lying in one session and sitting and right side lying in the other session. In each of the positions, forced vital capacity (FVC), forced expiratory volume in 1 second (FEV1), single-breath pulmonary diffusing capacity (DLCO/VA), and the slope of phase III (DN2%/L) of the single-breath nitrogen washout test to determine inhomogeneity of ventilation were measured. Compared with measurements obtained in the sitting position, FVC and FEV1 were decreased equally in the side-lying positions, but no change was observed in DLCO/VA or DN2%/L. Side-lying positions resulted in decreases in FVC and FEV1, which is consistent with the well-documented effects of the supine position. These findings further support the need for prescriptive rather than routine body positioning of patients with risks of cardiopulmonary compromise and the need to use upright positions in which lung volumes and capacities are maximized.

Medical cannabis use in Canada: vapourization and modes of delivery.

PubMed

Shiplo, Samantha; Asbridge, Mark; Leatherdale, Scott T; Hammond, David

2016-10-29

The mode of medical cannabis delivery-whether cannabis is smoked, vapourized, or consumed orally-may have important implications for its therapeutic efficacy and health risks. However, there is very little evidence on current patterns of use among Canadian medical cannabis users, particularly with respect to modes of delivery. The current study examined modes of medical cannabis delivery following regulatory changes in 2014 governing how Canadians access medical cannabis. A total of 364 approved adult Canadian medical cannabis users completed an online cross-sectional survey between April and June 2015. The survey examined patterns of medical cannabis use, modes of delivery used, and reasons for use. Participants were recruited through a convenience sample from nine Health Canada licensed producers. Using a vapourizer was the most popular mode of delivery for medical cannabis (53 %), followed by smoking a joint (47 %). The main reason for using a vapourizer was to reduce negative health consequences associated with smoking. A majority of current vapourizer users reported using a portable vapourizer (67.2 %), followed by a stationary vapourizer (41.7 %), and an e-cigarette or vape pen (19.3 %). Current use of a vapourizer was associated with fewer respiratory symptoms (AOR = 1.28, 95 % CI 1.05-1.56, p = 0.01). The findings suggest an increase in the popularity of vapourizers as the primary mode of delivery among approved medical users. Using vapourizers has the potential to prevent some of the adverse respiratory health consequences associated with smoking and may serve as an effective harm reduction method. Monitoring implications of such current and future changes to medical cannabis regulations may be beneficial to policymakers.

On the autonomous motion of active drops or bubbles.

PubMed

Ryazantsev, Yuri S; Velarde, Manuel G; Guzman, Eduardo; Rubio, Ramón G; Ortega, Francisco; Montoya, Juan-Jose

2018-05-19

Thermo-capillary stresses on the surface of a drop can be the result of a non-isothermal surface chemical conversion of a reactant dissolved in the host fluid. The strength of heat production (with e.g. absorption) on the surface is ruled by the diffusion of the reactant and depends on the state of motion of the drop. Such thermo-capillary stresses can provoke the motion of the drop or its motionless state in the presence of an external body force. If in the balance of forces, including indeed viscous drag, the net resultant force vanishes there is the possibility of autonomous motion with constant velocity of the drop. Focusing on drops with radii in the millimeter range provided here is a quantitative study of the possibility of such autonomous motion when the drop, considered as active unit, is seat of endo- or exo-thermic reactive processes that dominate its motion. The framework is restricted to Stokes flows in the hydrodynamics, negligible heat Peclet number while the solute Peclet number is considered very high. A boundary layer approximation is used in the description of reactant diffusion. Those processes eventually end up in the action being expressed by surface tension gradients and the Marangoni effect. Explicit expressions of the force acting on the drop and the velocity fields inside and outside the drop are provided. Some significant particular cases are discussed to illustrate the usefulness of the theory. Copyright © 2018. Published by Elsevier Inc.

Tuning crystalline ordering by annealing and additives to study its effect on exciton diffusion in a polyalkylthiophene copolymer.

PubMed

Chowdhury, Mithun; Sajjad, Muhammad T; Savikhin, Victoria; Hergué, Noémie; Sutija, Karina B; Oosterhout, Stefan D; Toney, Michael F; Dubois, Philippe; Ruseckas, Arvydas; Samuel, Ifor D W

2017-05-17

The influence of various processing conditions on the singlet exciton diffusion is explored in films of a conjugated random copolymer poly-(3-hexylthiophene-co-3-dodecylthiophene) (P3HT-co-P3DDT) and correlated with the degree of crystallinity probed by grazing incidence X-ray scattering and with exciton bandwidth determined from absorption spectra. The exciton diffusion coefficient is deduced from exciton-exciton annihilation measurements and is found to increase by more than a factor of three when thin films are annealed using CS 2 solvent vapour. A doubling of exciton diffusion coefficient is observed upon melt annealing at 200 °C and the corresponding films show about 50% enhancement in the degree of crystallinity. In contrast, films fabricated from polymer solutions containing a small amount of either solvent additive or nucleating agent show a decrease in exciton diffusion coefficient possibly due to formation of traps for excitons. Our results suggest that the enhancement of exciton diffusivity occurs because of increased crystallinity of alkyl-stacking and longer conjugation of aggregated chains which reduces the exciton bandwidth.

Electrophoretically deposited multiwalled carbon nanotube based amperometric genosensor for E.coli detection

NASA Astrophysics Data System (ADS)

Bhardwaj, Hema; Solanki, Shipra; Sumana, Gajjala

2016-04-01

This work reports on a sensitive and selective genosensor fabrication method for Escherichia coli (E.coli) detection. The functionalized multiwalled carbon nanotubes (MWCNT) synthesized via chemical vapour deposition have been deposited electrophoretically onto indium tin oxide coated glass surface and have been utilized as matrices for the covalent immobilization of E.coli specific probe oligonucleotide that was identified from the 16s rRNA coding region of the E.coli genome. This fabricated functionalized MWCNT based platform sought to provide improved fundamental characteristics to electrode interface in terms of electro-active surface area and diffusion coefficient. Electrochemical cyclic voltammetry revealed that this genosensor exhibits a linear response to complementary DNA in the concentration range of 10-7 to 10-12 M with a detection limit of 1×10-12 M.

Effect of Atmospheric Press on Wet Bulb Depression

NASA Technical Reports Server (NTRS)

Wheeler, Raymond M.; Stasiak, Michael A.; Lawson, Jamie; Wehkamp, Cara Ann P.; Dixon, Michael A.

2008-01-01

Our measurements of wet bulb depression at different pressures matched the modeled adiabatic saturation temps reasonably well. At a dry bulb temp of 25 C, the normal wet bulb temp for 30% RH and 100 kPa is approx.15 C, but this dropped to approx.8 C at 10 kPa. The results suggest that psychrometers need direct calibration at the target pressures or that pressure corrected charts are required. For a given vapour pressure deficit, any moist surfaces, including transpiring plant leaves, will be cooler at lower pressures due to the increased evaporation rates.

Daughters and mothers exercising together: effects of home- and community-based programs.

PubMed

Ransdell, Lynda B; Taylor, Alison; Oakland, Darcie; Schmidt, Jenny; Moyer-Mileur, Laurie; Shultz, Barry

2003-02-01

This pilot study compares the effectiveness of home- and community-based physical activity interventions that target mothers and daughters to increase physical activity and improve health-related fitness. Mothers (45.18 +/- 7.49 yr) and daughters (15.41 +/- 1.33 yr) were randomly assigned to a community-based (CB) (N = 20 participants) or home-based (HB) (N = 14 participants) program. CB participants attended three instructor-led sessions per week for 12 wk. HB participants were asked to participate in 3 sessions per week for 12 wk in a program similar to the CB program. The main difference between the programs was that CB activities were completed at a fitness facility within a university and HB activities were completed in or near the home. Before and after the intervention, changes in health-related fitness and physical activity were assessed. A series of 2 (group assignment) x 2 (time) ANOVAs were conducted to assess changes separately for mothers and daughters. CB participants attended 77% of the sessions, and none of the pairs dropped out. HB participants completed 70% of the recommended sessions, and three pairs dropped out. Mothers and daughters in both groups significantly increased their participation in aerobic, muscular strength, and flexibility activities (P = 0.02 to 0.000). Daughters in both groups significantly improved their muscular endurance (sit-ups,P = 0.000). Mothers in both groups improved their muscular strength (push-ups, P = 0.003), muscular endurance (sit-ups, P = 0.000), flexibility (sit-and-reach, P = 0.008), and aerobic capacity (1-mile walk, P = 0.002). Positive changes in diastolic blood pressure also occurred (P = 0.008). Mothers and daughters responded positively to CB and HB physical activity programs. Home-based physical activity programming is a cost-effective means to increase physical activity and improve health-related fitness in these groups.

Long distance spin communication in chemical vapour deposited graphene

NASA Astrophysics Data System (ADS)

Kamalakar, M. Venkata; Groenveld, Christiaan; Dankert, André; Dash, Saroj P.

2015-04-01

Graphene is an ideal medium for long-distance spin communication in future spintronic technologies. So far, the prospect is limited by the smaller sizes of exfoliated graphene flakes and lower spin transport properties of large-area chemical vapour-deposited (CVD) graphene. Here we demonstrate a high spintronic performance in CVD graphene on SiO2/Si substrate at room temperature. We show pure spin transport and precession over long channel lengths extending up to 16 μm with a spin lifetime of 1.2 ns and a spin diffusion length ~6 μm at room temperature. These spin parameters are up to six times higher than previous reports and highest at room temperature for any form of pristine graphene on industrial standard SiO2/Si substrates. Our detailed investigation reinforces the observed performance in CVD graphene over wafer scale and opens up new prospects for the development of lateral spin-based memory and logic applications.

A practical method of determining water current velocities and diffusion coefficients in coastal waters by remote sensing techniques

NASA Technical Reports Server (NTRS)

James, W. P.

1971-01-01

A simplified procedure is presented for determining water current velocities and diffusion coefficients. Dye drops which form dye patches in the receiving water are made from an aircraft. The changes in position and size of the patches are recorded from two flights over the area. The simplified data processing procedure requires only that the ground coordinates about the dye patches be determined at the time of each flight. With an automatic recording coordinatograph for measuring coordinates and a computer for processing the data, this technique provides a practical method of determining circulation patterns and mixing characteristics of large aquatic systems. This information is useful in assessing the environmental impact of waste water discharges and for industrial plant siting.

Functional Iron Oxide-Silver Hetero-Nanocomposites: Controlled Synthesis and Antibacterial Activity

NASA Astrophysics Data System (ADS)

Trang, Vu Thi; Tam, Le Thi; Van Quy, Nguyen; Huy, Tran Quang; Thuy, Nguyen Thanh; Tri, Doan Quang; Cuong, Nguyen Duy; Tuan, Pham Anh; Van Tuan, Hoang; Le, Anh-Tuan; Phan, Vu Ngoc

2017-06-01

Iron oxide-silver nanocomposites are of great interest for their antibacterial and antifungal activities. We report a two-step synthesis of functional magnetic hetero-nanocomposites of iron oxide nanoparticles and silver nanoparticles (Fe3O4-Ag). Iron oxide nanoparticles were prepared first by a co-precipitation method followed by the deposition of silver nanoparticles via a hydrothermal route. The prepared Fe3O4-Ag hetero-nanocomposites were characterized by x-ray diffraction, transmission electron microscopy, high resolution transmission electron microscopy and vibrating sample magnetometry. Their antibacterial activities were investigated by using paper-disc diffusion and direct-drop diffusion methods. The results indicate that the Fe3O4-Ag hetero-nanocomposites exhibit excellent antibacterial activities against two Gram-negative bacterial strains ( Salmonella enteritidis and Klebsiella pneumoniae).

Self-reported sitting time in New York City adults, the Physical Activity and Transit Survey, 2010-2011.

PubMed

Yi, Stella S; Bartley, Katherine F; Firestone, Melanie J; Lee, Karen K; Eisenhower, Donna L

2015-05-28

Recent studies have demonstrated the negative health consequences associated with extended sitting time, including metabolic disturbances and decreased life expectancy. The objectives of this study were to characterize sitting time in an urban adult population and assess the validity of a 2-question method of self-reported sitting time. The New York City Health Department conducted the 2010-2011 Physical Activity and Transit Survey (N = 3,597); a subset of participants wore accelerometers for 1 week (n = 667). Self-reported sitting time was assessed from 2 questions on time spent sitting (daytime and evening hours). Sedentary time was defined as accelerometer minutes with less than 100 counts on valid days. Descriptive statistics were used to estimate the prevalence of sitting time by demographic characteristics. Validity of sitting time with accelerometer-measured sedentary time was assessed using Spearman's correlation and Bland-Altman techniques. All data were weighted to be representative of the New York City adult population based on the 2006-2008 American Community Survey. Mean daily self-reported sitting time was 423 minutes; mean accelerometer-measured sedentary time was 490 minutes per day (r = 0.32, P < .001). The mean difference was 49 minutes per day (limits of agreement: -441 to 343). Sitting time was higher in respondents at lower poverty and higher education levels and lower in Hispanics and people who were foreign-born. Participants of higher socioeconomic status, who are not typically the focus of health disparities-related research, had the highest sitting times; Hispanics had the lowest levels. Sitting time may be accurately assessed by self-report with the 2-question method for population surveillance but may be limited in accurately characterizing individual-level behavior.

Numerical analysis of fume formation mechanism in arc welding

NASA Astrophysics Data System (ADS)

Tashiro, Shinichi; Zeniya, Tasuku; Yamamoto, Kentaro; Tanaka, Manabu; Nakata, Kazuhiro; Murphy, Anthony B.; Yamamoto, Eri; Yamazaki, Kei; Suzuki, Keiichi

2010-11-01

In order to clarify the fume formation mechanism in arc welding, a quantitative investigation based on the knowledge of interaction among the electrode, arc and weld pool is indispensable. A fume formation model consisting of a heterogeneous condensation model, a homogeneous nucleation model and a coagulation model has been developed and coupled with the GTA or GMA welding model. A series of processes from evaporation of metal vapour to fume formation from the metal vapour was totally investigated by employing this simulation model. The aim of this paper is to visualize the fume formation process and clarify the fume formation mechanism theoretically through a numerical analysis. Furthermore, the reliability of the simulation model was also evaluated through a comparison of the simulation result with the experimental result. As a result, it was found that the size of the secondary particles consisting of small particles with a size of several tens of nanometres reached 300 nm at maximum and the secondary particle was in a U-shaped chain form in helium GTA welding. Furthermore, it was also clarified that most part of the fume was produced in the downstream region of the arc originating from the metal vapour evaporated mainly from the droplet in argon GMA welding. The fume was constituted by particles with a size of several tens of nanometres and had similar characteristics to that of GTA welding. On the other hand, if the metal transfer becomes unstable and the metal vapour near the droplet diffuses directly towards the surroundings of the arc not getting into the plasma flow, the size of the particles reaches several hundred nanometres.

Improving Hip-Worn Accelerometer Estimates of Sitting Using Machine Learning Methods.

PubMed

Kerr, Jacqueline; Carlson, Jordan; Godbole, Suneeta; Cadmus-Bertram, Lisa; Bellettiere, John; Hartman, Sheri

2018-02-13

To improve estimates of sitting time from hip worn accelerometers used in large cohort studies by employing machine learning methods developed on free living activPAL data. Thirty breast cancer survivors concurrently wore a hip worn accelerometer and a thigh worn activPAL for 7 days. A random forest classifier, trained on the activPAL data, was employed to detect sitting, standing and sit-stand transitions in 5 second windows in the hip worn accelerometer. The classifier estimates were compared to the standard accelerometer cut point and significant differences across different bout lengths were investigated using mixed effect models. Overall, the algorithm predicted the postures with moderate accuracy (stepping 77%, standing 63%, sitting 67%, sit to stand 52% and stand to sit 51%). Daily level analyses indicated that errors in transition estimates were only occurring during sitting bouts of 2 minutes or less. The standard cut point was significantly different from the activPAL across all bout lengths, overestimating short bouts and underestimating long bouts. This is among the first algorithms for sitting and standing for hip worn accelerometer data to be trained from entirely free living activPAL data. The new algorithm detected prolonged sitting which has been shown to be most detrimental to health. Further validation and training in larger cohorts is warranted.This is an open access article distributed under the Creative Commons Attribution License 4.0 (CCBY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Perceived body discomfort and trunk muscle activity in three prolonged sitting postures

PubMed Central

Waongenngarm, Pooriput; Rajaratnam, Bala S.; Janwantanakul, Prawit

2015-01-01

[Purpose] This study aimed to investigate the perceived discomfort and trunk muscle activity in three different 1-hour sitting postures. [Subjects] A repeated-measures design study was conducted on 10 healthy subjects. [Methods] Each subject sat for an hour in three sitting postures (i.e., upright, slumped, and forward leaning sitting postures). Subjects rated perceived body discomfort using Borg’s CR-10 scale at the beginning and after 1 hour sitting. The electromyographic activity of the trunk muscle activity was recorded during the 1-hour period of sitting. [Results] The forward leaning sitting posture led to higher Borg scores in the low back than those in the upright (p = 0.002) and slumped sitting postures (p < 0.001). The forward leaning posture was significantly associated with increased iliocostalis lumborum pars thoracis (ICL) and superficial lumbar multifidus (MF) muscle activity compared with the upright and slumped sitting postures. The upright sitting posture was significantly associated with increased internal oblique (IO)/transversus abdominis (TrA) and ICL muscle activity compared with the slumped sitting posture. [Conclusion] The sitting posture with the highest low back discomfort after prolonged sitting was the forward leaning posture. Sitting in an upright posture is recommended because it increases IO/TrA muscle activation and induces only relatively moderate ICL and MF muscle activation. PMID:26311951

Comparative analysis of tumor spheroid generation techniques for differential in vitro drug toxicity

PubMed Central

Raghavan, Shreya; Rowley, Katelyn R.; Mehta, Geeta

2016-01-01

Multicellular tumor spheroids are powerful in vitro models to perform preclinical chemosensitivity assays. We compare different methodologies to generate tumor spheroids in terms of resultant spheroid morphology, cellular arrangement and chemosensitivity. We used two cancer cell lines (MCF7 and OVCAR8) to generate spheroids using i) hanging drop array plates; ii) liquid overlay on ultra-low attachment plates; iii) liquid overlay on ultra-low attachment plates with rotating mixing (nutator plates). Analysis of spheroid morphometry indicated that cellular compaction was increased in spheroids generated on nutator and hanging drop array plates. Collagen staining also indicated higher compaction and remodeling in tumor spheroids on nutator and hanging drop arrays compared to conventional liquid overlay. Consequently, spheroids generated on nutator or hanging drop plates had increased chemoresistance to cisplatin treatment (20-60% viability) compared to spheroids on ultra low attachment plates (10-20% viability). Lastly, we used a mathematical model to demonstrate minimal changes in oxygen and cisplatin diffusion within experimentally generated spheroids. Our results demonstrate that in vitro methods of tumor spheroid generation result in varied cellular arrangement and chemosensitivity. PMID:26918944

The physics of confined flow and its application to water leaks, water permeation and water nanoflows: a review.

PubMed

Lei, Wenwen; Rigozzi, Michelle K; McKenzie, David R

2016-02-01

This review assesses the current state of understanding of the calculation of the rate of flow of gases, vapours and liquids confined in channels, in porous media and in permeable materials with an emphasis on the flow of water and its vapour. One motivation is to investigate the relation between the permeation rate of moisture and that of a noncondensable test gas such as helium, another is to assist in unifying theory and experiment across disparate fields. Available theories of single component ideal gas flows in channels of defined geometry (cylindrical, rectangular and elliptical) are described and their predictions compared with measurement over a wide range of conditions defined by the Knudsen number. Theory for two phase flows is assembled in order to understand the behaviour of four standard water leak configurations: vapour, slug, Washburn and liquid flow, distinguished by the number and location of phase boundaries (menisci). Air may or may not be present as a background gas. Slip length is an important parameter that greatly affects leak rates. Measurements of water vapour flows confirm that water vapour shows ideal gas behaviour. Results on carbon nanotubes show that smooth walls may lead to anomalously high slip lengths arising from the properties of 'confined' water. In porous media, behaviour can be matched to the four standard leaks. Traditional membrane permeation models consider that the permeant dissolves, diffuses and evaporates at the outlet side, ideas we align with those from channel flow. Recent results on graphite oxide membranes show examples where helium which does not permeate while at the same time moisture is almost unimpeded, again a result of confined water. We conclude that while there is no a priori relation between a noncondensable gas flow and a moisture flow, measurements using helium will give results within two orders of magnitude of the moisture flow rate, except in the case where there is anomalous slip or confined water, when moisture specific measurements are essential.

Full scale evaluation of diffuser ageing with clean water oxygen transfer tests.

PubMed

Krampe, J

2011-01-01

Aeration is a crucial part of the biological wastewater treatment in activated sludge systems and the main energy user of WWTPs. Approximately 50 to 60% of the total energy consumption of a WWTP can be attributed to the aeration system. The performance of the aeration system, and in the case of fine bubble diffused aeration the diffuser performance, has a significant impact on the overall plant efficiency. This paper seeks to isolate the changes of the diffuser performance over time by eliminating all other influencing parameters like sludge retention time, surfactants and reactor layout. To achieve this, different diffusers have been installed and tested in parallel treatment trains in two WWTPs. The diffusers have been performance tested in clean water tests under new conditions and after one year of operation. A set of material property tests describing the diffuser membrane quality was also performed. The results showed a significant drop in the performance of the EPDM diffuser in the first year which resulted in similar oxygen transfer efficiency around 16 g/m3/m for all tested systems. Even though the tested silicone diffusers did not show a drop in performance they had a low efficiency in the initial tests. The material properties indicate that the EPDM performance loss is partly due to the washout of additives.

Experimental Investigation of two-phase nitrogen Cryo transfer line

NASA Astrophysics Data System (ADS)

Singh, G. K.; Nimavat, H.; Panchal, R.; Garg, A.; Srikanth, GLN; Patel, K.; Shah, P.; Tanna, V. L.; Pradhan, S.

2017-02-01

A 6-m long liquid nitrogen based cryo transfer line has been designed, developed and tested at IPR. The test objectives include the thermo-hydraulic characteristics of Cryo transfer line under single phase as well as two phase flow conditions. It is always easy in experimentation to investigate the thermo-hydraulic parameters in case of single phase flow of cryogen but it is real challenge when one deals with the two phase flow of cryogen due to availibity of mass flow measurements (direct) under two phase flow conditions. Established models have been reported in the literature where one of the well-known model of Lockhart-Martenelli relationship has been used to determine the value of quality at the outlet of Cryo transfer line. Under homogenous flow conditions, by taking the ratio of the single-phase pressure drop and the two-phase pressure drop, we estimated the quality at the outlet. Based on these equations, vapor quality at the outlet of the transfer line was predicted at different heat loads. Experimental rresults shown that from inlet to outlet, there is a considerable increment in the pressure drop and vapour quality of the outlet depending upon heat load and mass flow rate of nitrogen flowing through the line.

Dynamics of an Unsteady Diffusion Flame: Effects of Heat Release and Gravity

DTIC Science & Technology

1990-09-27

UNSTEADY DIFFUSION FLAME: EFFECTS OF HEAT RELEASE AND GRAVITY INTRODUCTION Experiments on laminar diffusion flames have shown that gravity affects the flame ... length and width as well as its extinction characteristics (1-4). These studies have been conducted in drop towers and have focused on fuel jets with

Regolith-atmosphere exchange of water in Mars' recent past

NASA Astrophysics Data System (ADS)

Steele, Liam J.; Balme, Matthew R.; Lewis, Stephen R.

2017-03-01

We investigate the exchange of water vapour between the regolith and atmosphere of Mars, and how it varies with different orbital parameters, atmospheric dust contents and surface water ice reservoirs. This is achieved through the coupling of a global circulation model (GCM) and a regolith diffusion model. GCM simulations are performed for hundreds of Mars years, with additional one-dimensional simulations performed for 50 kyr. At obliquities ɛ =15∘ and 30°, the thermal inertia and albedo of the regolith have more control on the subsurface water distribution than changes to the eccentricity or solar longitude of perihelion. At ɛ =45∘ , atmospheric water vapour abundances become much larger, allowing stable subsurface ice to form in the tropics and mid-latitudes. The circulation of the atmosphere is important in producing the subsurface water distribution, with increased water content in various locations due to vapour transport by topographically-steered flows and stationary waves. As these circulation patterns are due to topographic features, it is likely the same regions will also experience locally large amounts of subsurface water at different epochs. The dustiness of the atmosphere plays an important role in the distribution of subsurface water, with a dusty atmosphere resulting in a wetter water cycle and increased stability of subsurface ice deposits.

Ge-rich islands grown on patterned Si substrates by low-energy plasma-enhanced chemical vapour deposition.

PubMed

Bollani, M; Chrastina, D; Fedorov, A; Sordan, R; Picco, A; Bonera, E

2010-11-26

Si(1-x)Ge(x) islands grown on Si patterned substrates have received considerable attention during the last decade for potential applications in microelectronics and optoelectronics. In this work we propose a new methodology to grow Ge-rich islands using a chemical vapour deposition technique. Electron-beam lithography is used to pre-pattern Si substrates, creating material traps. Epitaxial deposition of thin Ge films by low-energy plasma-enhanced chemical vapour deposition then leads to the formation of Ge-rich Si(1-x)Ge(x) islands (x > 0.8) with a homogeneous size distribution, precisely positioned with respect to the substrate pattern. The island morphology was characterized by atomic force microscopy, and the Ge content and strain in the islands was studied by μRaman spectroscopy. This characterization indicates a uniform distribution of islands with high Ge content and low strain: this suggests that the relatively high growth rate (0.1 nm s(-1)) and low temperature (650 °C) used is able to limit Si intermixing, while maintaining a long enough adatom diffusion length to prevent nucleation of islands outside pits. This offers the novel possibility of using these Ge-rich islands to induce strain in a Si cap.

The impact of non-isothermal soil moisture transport on evaporation fluxes in a maize cropland

NASA Astrophysics Data System (ADS)

Shao, Wei; Coenders-Gerrits, Miriam; Judge, Jasmeet; Zeng, Yijian; Su, Ye

2018-06-01

The process of evaporation interacts with the soil, which has various comprehensive mechanisms. Multiphase flow models solve air, vapour, water, and heat transport equations to simulate non-isothermal soil moisture transport of both liquid water and vapor flow, but are only applied in non-vegetated soils. For (sparsely) vegetated soils often energy balance models are used, however these lack the detailed information on non-isothermal soil moisture transport. In this study we coupled a multiphase flow model with a two-layer energy balance model to study the impact of non-isothermal soil moisture transport on evaporation fluxes (i.e., interception, transpiration, and soil evaporation) for vegetated soils. The proposed model was implemented at an experimental agricultural site in Florida, US, covering an entire maize-growing season (67 days). As the crops grew, transpiration and interception became gradually dominated, while the fraction of soil evaporation dropped from 100% to less than 20%. The mechanisms of soil evaporation vary depending on the soil moisture content. After precipitation the soil moisture content increased, exfiltration of the liquid water flow could transport sufficient water to sustain evaporation from soil, and the soil vapor transport was not significant. However, after a sufficient dry-down period, the soil moisture content significantly reduced, and the soil vapour flow significantly contributed to the upward moisture transport in topmost soil. A sensitivity analysis found that the simulations of moisture content and temperature at the soil surface varied substantially when including the advective (i.e., advection and mechanical dispersion) vapour transport in simulation, including the mechanism of advective vapour transport decreased soil evaporation rate under wet condition, while vice versa under dry condition. The results showed that the formulation of advective soil vapor transport in a soil-vegetation-atmosphere transfer continuum can affect the simulated evaporation fluxes, especially under dry condition.

Multifractal comparison of the extremes of rain rates and integrated vapour content

NASA Astrophysics Data System (ADS)

Gires, Auguste; Ni, Vincent; Bosser, Pierre; Tchiguirinskaia, Ioulia; Schertzer, Daniel

2015-04-01

Rainfall extremes are studied through the analyse of three related fields measured with the help of co-located devices installed in the roof of the Ecole des Ponts ParisTech building: (i) Integrated Water Vapour (IWV); it corresponds the amount of water vapour present in the vertical columns between a GPS ground receiver and corresponding satellites. It is estimated from the time shift between the expected duration the signal needs to reach the receiver (the two positions are known) and the actual one (ii) Rain rate measured by three optical disdrometers of two different types (Campbell Scientific PWS100 and OTT Parsivel2) (iii) Relative humidity measured by a dedicated sensor First the correlations between these quantities during significant events is analysed. It appears that although IWV tends to decrease (vapour condense to form drops that fall) and relative humidity to increase during a rainfall event, it turns out difficult to quantitatively characterize this link. It is possibly due to the fact that the scale gap between a punctual measure for the rain rate and an average over a few km height column for the IWV is too large. Finally the scaling features of these three fields are investigated with the help of the Universal Multifractal framework which has been extensively used to analyse and simulate geophysical fields extremely variable over wide ranges of scales. Only three parameters are used to characterize variability across scales: C1 the mean intermittency, alpha the multifractality index and H the non-conservative exponent. Retrieved features are compared and the notion of maximum observable singularity is used to quantify the extremes of the various fields. Authors acknowledge the financial support of the Interreg IV NEW RainGain project (www.raingain.eu) and the chair "hydrology for resilient cities" sponsored by Véolia, and the Climate-KIC Blue Green Dream project (bgd.org.uk/).

The ESA DUE GlobVapour Project

NASA Astrophysics Data System (ADS)

Schröder, M.; ESA Due Globvapour Project Team

2010-12-01

The European Space Agency (ESA) Data User Element (DUE) project series aims at bridging the gap between research projects and the sustainable provision of Earth Observation (EO) climate data products at an information level that fully responds to the operational needs of user communities. The ultimate objective of GlobVapour is to provide long-term coherent water vapour data sets exploiting the synergistic capabilities of different EO missions aiming at improved accuracies and enhanced temporal and spatial sampling better than those provided by the single sources. The project seeks to utilize the increasing potential of the synergistic capabilities of past, existing and upcoming satellite missions (ERS-1 and -2, ENVISAT, METOP, MSG as well as relevant non-European missions and in-situ data) in order to meet the increasing needs for coherent long-term water vapour datasets required by the scientific community. GlobVapour develops, validates and applies novel water vapour climate data sets derived from various sensors. More specifically, the primary objectives of the GlobVapour project are: 1)The development of multi-annual global water vapour data sets inclusive of error estimates based on carefully calibrated and inter-calibrated radiances. 2)The validation of the water vapour products against ground based, airborne and other satellite based measurements. 3) The provision of an assessment of the quality of different IASI water vapour profile algorithms developed by the project partners and other groups. 4) The provision of a complete processing system that can further strengthen operational production of the developed products. 5) A demonstration of the use of the products in the field of climate modelling, including applying alternative ways of climate model validation using forward radiation operators. 6) The promotion of the strategy of data set construction and the data sets themselves to the global research and operational community. The ultimate goal of the DUE GlobVapour project is the preparation of recognised data sets and successful concepts that can be used to ensure a sustainable provision of such data from operational entities such as the European Organisation for the Exploitation of Meteorological Satellites (EUMETSAT) Satellite Application Facility (SAF) network. Key scientific questions which GlobVapour data can contribute to are climate monitoring and attribution, assimilation of different water vapour datasets to form a consistent analysis, model process studies, evaluation of in-situ water vapour measurements, validation of climate models and reanalyses, assessing the relationship between water vapour and dynamics, research and development for operational applications and input to atmospheric reanalyses. This presentation will introduce the GlobVapour project and concept as well as the products which are the global total column water vapour (TCWV) time series from a combination of MERIS and SSM/I as well as TCWV data sets derived from the GOME/SCIAMACHY/GOME-2 and the (A)ATSR instruments. A shorter time series of water vapour profiles will be derived from a combination of IASI and SEVIRI. The retrieval and combination methods as well as first validation results will also be discussed.

Eucalyptus essential oil as a natural food preservative: in vivo and in vitro antiyeast potential.

PubMed

Tyagi, Amit Kumar; Bukvicki, Danka; Gottardi, Davide; Tabanelli, Giulia; Montanari, Chiara; Malik, Anushree; Guerzoni, Maria Elisabetta

2014-01-01

In this study, the application of eucalyptus essential oil/vapour as beverages preservative is reported. The chemical composition of eucalyptus oil was determined by gas chromatography-mass spectrometry (GC-MS) and solid phase microextraction GC-MS (SPME/GC-MS) analyses. GC-MS revealed that the major constituents were 1,8-cineole (80.5%), limonene (6.5%), α-pinene (5%), and γ-terpinene (2.9%) while SPME/GC-MS showed a relative reduction of 1,8-cineole (63.9%) and an increase of limonene (13.8%), α-pinene (8.87%), and γ-terpinene (3.98%). Antimicrobial potential of essential oil was initially determined in vitro against 8 different food spoilage yeasts by disc diffusion, disc volatilization, and microdilution method. The activity of eucalyptus vapours was significantly higher than the eucalyptus oil. Minimum inhibitory concentration (MIC) and minimum fungicidal concentration (MFC) varied from 0.56 to 4.50 mg/mL and from 1.13 to 9 mg/mL, respectively. Subsequently, the combined efficacy of essential oil and thermal treatment were used to evaluate the preservation of a mixed fruit juice in a time-dependent manner. These results suggest eucalyptus oil as a potent inhibitor of food spoilage yeasts not only in vitro but also in a real food system. Currently, this is the first report that uses eucalyptus essential oil for fruit juice preservation against food spoiling yeast.

Eucalyptus Essential Oil as a Natural Food Preservative: In Vivo and In Vitro Antiyeast Potential

PubMed Central

Bukvicki, Danka; Gottardi, Davide; Malik, Anushree; Guerzoni, Maria Elisabetta

2014-01-01

In this study, the application of eucalyptus essential oil/vapour as beverages preservative is reported. The chemical composition of eucalyptus oil was determined by gas chromatography-mass spectrometry (GC-MS) and solid phase microextraction GC-MS (SPME/GC-MS) analyses. GC-MS revealed that the major constituents were 1,8-cineole (80.5%), limonene (6.5%), α-pinene (5%), and γ-terpinene (2.9%) while SPME/GC-MS showed a relative reduction of 1,8-cineole (63.9%) and an increase of limonene (13.8%), α-pinene (8.87%), and γ-terpinene (3.98%). Antimicrobial potential of essential oil was initially determined in vitro against 8 different food spoilage yeasts by disc diffusion, disc volatilization, and microdilution method. The activity of eucalyptus vapours was significantly higher than the eucalyptus oil. Minimum inhibitory concentration (MIC) and minimum fungicidal concentration (MFC) varied from 0.56 to 4.50 mg/mL and from 1.13 to 9 mg/mL, respectively. Subsequently, the combined efficacy of essential oil and thermal treatment were used to evaluate the preservation of a mixed fruit juice in a time-dependent manner. These results suggest eucalyptus oil as a potent inhibitor of food spoilage yeasts not only in vitro but also in a real food system. Currently, this is the first report that uses eucalyptus essential oil for fruit juice preservation against food spoiling yeast. PMID:25177704

Simulation of drop movement over an inclined surface using smoothed particle hydrodynamics.

PubMed

Das, Arup K; Das, Prasanta K

2009-10-06

Smoothed particle hydrodynamics (SPH) is used to numerically simulate the movement of drops down an inclined plane. Diffuse interfaces have been assumed for tracking the motion of the contact line. The asymmetric shape of the three-dimensional drop and the variation of contact angle along its periphery can be calculated using the simulation. During the motion of a liquid drop down an inclined plane, an internal circulation of liquid particles is observed due to gravitational pull which causes periodic change in the drop shape. The critical angle of inclination required for the inception of drop motion is also evaluated for different fluids as a function of drop volume. The numerical predictions exhibit a good agreement with the published experimental results.

Exposure assessment of ETBE in gas station workers and gasoline tanker truck drivers.

PubMed

Eitaki, Yoko; Kawai, Toshio; Omae, Kazuyuki

2011-01-01

In order to measure occupational exposure concentrations of ethyl tertiary-butyl ether (ETBE), we developed a diffusive sampling method for monitoring ETBE and performed an ETBE exposure assessment. The applicability of diffusive samplers was examined by exposing the samplers to ETBE vapor in test chambers. The personal exposure levels of workers and airborne concentrations were measured at 4 gas stations. The ETBE sampling rate for the diffusive samplers (VOC-SD, Sigma-Aldrich Japan) was 25.04 ml/min (25°C). Compared with the active sampling method, the diffusive samplers could be used for short-term measurements and in environments containing a mixture of organic solvents. The geometric mean (GM) of TWA-8h ETBE was 0.08 ppm (0.02-0.28 ppm) in 28 gas station workers and 0.04 ppm (0.01-0.21 ppm) in 2 gasoline tanker truck drivers. With regard to ETBE airborne concentrations, the GM was 4.12 ppm (0.93-8.71 ppm) at the handles of hanging pumps but dropped to less than 0.01 ppm (less than 0.01-0.01 ppm) at the side of a public road. The diffusive sampling method can be used for the measurement of occupational ETBE exposure. The threshold limit of TLV-TWA 5 ppm recommended by the ACGIH was not exceeded in any of the workers in this study.

In vitro comparison of antimicrobial activity of aqueous decoction of Coriandrum sativum, and Dentol Drop with chlorhexidine on Streptococcus mutans.

PubMed

Moradian, Hamid; Bazargani, Abdollah; Rafiee, Azade; Nazarialam, Ali

2013-09-01

Dental caries is still remained as a major health problem. This problem has created a new interest to search for new antimicrobial agents from various sources including medicinal plants. Since limited data is available so far regarding the antibacterial effect of Coriandrum sativum seed and Dentol Drop against Streptococcus mutans, this study aims to assess this activity. This experimental study was conducted in Shiraz University of Medical Sciences. In vitro comparison of antimicrobial activity of aqueous decoction of Coriandrum sativum seed and Dentol drop with chlorhexidine against Streptococcus mutans was evaluated using disk diffusion and broth microdilution assays. Positive and negative controls were considered. The data was statistically analyzed by applying Kruskal-Wallis and Tukey post-hoc test to compare the groups using SPSS software (version 17). Dentol drop showed a remarkable antibacterial activity, in comparison with chlorhexidine, against S. mutans in the disk diffusion (p value = 0.005), and broth microdilution assays (p value = 0.0001). Based on the results of this study, Coriandrum sativum seed did not posses any antibacterial property. Coriandrum sativum seed showed no anti-Streptococcus mutans activity. Dentol drop exhibited a remarkable antibacterial activity against S. mutans when tested in vitro. Dentol drop can be further studied as a preventive measure for dental caries.

When is an INP not an INP?

NASA Astrophysics Data System (ADS)

Simpson, Emma; Connolly, Paul; McFiggans, Gordon

2016-04-01

Processes such as precipitation and radiation depend on the concentration and size of different hydrometeors within clouds therefore it is important to accurately predict them in weather and climate models. A large fraction of clouds present in our atmosphere are mixed phase; contain both liquid and ice particles. The number of drops and ice crystals present in mixed phase clouds strongly depends on the size distribution of aerosols. Cloud condensation nuclei (CCN), a subset of atmospheric aerosol particles, are required for liquid drops to form in the atmosphere. These particles are ubiquitous in the atmosphere. To nucleate ice particles in mixed phase clouds ice nucleating particles (INP) are required. These particles are rarer than CCN. Here we investigate the case where CCN and INPs are in direct competition with each other for water vapour within a cloud. Focusing on the immersion and condensation modes of freezing (where an INP must be immersed within a liquid drop before it can freeze) we show that the presence of CCN can suppress the formation of ice. CCN are more hydrophilic than IN and as such are better able to compete for water vapour than, typically insoluble, INPs. Therefore water is more likely to condense onto a CCN than INP, leaving the INP without enough condensed water on it to be able to freeze in the immersion or condensation mode. The magnitude of this suppression effect strongly depends on a currently unconstrained quantity. Here we refer to this quantity as the critical mass of condensed water required for freezing, Mwc. Mwc is the threshold amount of water that must be condensed onto a INP before it can freeze in the immersion or condensation mode. Using the detailed cloud parcel model, Aerosol-Cloud-Precipiation-Interaction Model (ACPIM), developed at the University of Manchester we show that if only a small amount of water is required for freezing there is little suppression effect and if a large amount of water is required there is a large suppression effect. In this poster possible ways to constrain Mwc are discussed as well as conditions where the suppression effect is likely to be greatest. Key Words: Clouds, aerosol, CCN, IN, modelling

High-throughput method for optimum solubility screening for homogeneity and crystallization of proteins

DOEpatents

Kim, Sung-Hou [Moraga, CA; Kim, Rosalind [Moraga, CA; Jancarik, Jamila [Walnut Creek, CA

2012-01-31

An optimum solubility screen in which a panel of buffers and many additives are provided in order to obtain the most homogeneous and monodisperse protein condition for protein crystallization. The present methods are useful for proteins that aggregate and cannot be concentrated prior to setting up crystallization screens. A high-throughput method using the hanging-drop method and vapor diffusion equilibrium and a panel of twenty-four buffers is further provided. Using the present methods, 14 poorly behaving proteins have been screened, resulting in 11 of the proteins having highly improved dynamic light scattering results allowing concentration of the proteins, and 9 were crystallized.

Dropwise condensation

PubMed Central

Leach, R. N.; Stevens, F.; Langford, S. C.; Dickinson, J. T.

2008-01-01

Dropwise condensation of water vapor from a naturally cooling, hot water reservoir onto a hydrophobic polymer film and a silanized glass slide was studied by direct observation and simulations. The observed drop growth kinetics suggest that smallest drops grow principally by the diffusion of water adsorbed on the substrate to the drop perimeter, while drops larger than 50 μm in diameter grow principally by direct deposition from the vapor onto the drop surface. Drop coalescence plays a critical role in determining the drop size distribution, and stimulates the nucleation of new, small drops on the substrates. Simulations of drop growth incorporating these growth mechanisms provide a good description of the observed drop size distribution. Because of the large role played by coalescence, details of individual drop growth make little difference to the final drop size distribution. The rate of condensation per unit substrate area is especially high for the smallest drops, and may help account for the high heat transfer rates associated with dropwise condensation relative to filmwise condensation in heat exchange applications. PMID:17014129

Surface thermodynamics of planar, cylindrical, and spherical vapour-liquid interfaces of water

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lau, Gabriel V.; Müller, Erich A.; Jackson, George

2015-03-21

The test-area (TA) perturbation approach has been gaining popularity as a methodology for the direct computation of the interfacial tension in molecular simulation. Though originally implemented for planar interfaces, the TA approach has also been used to analyze the interfacial properties of curved liquid interfaces. Here, we provide an interpretation of the TA method taking the view that it corresponds to the change in free energy under a transformation of the spatial metric for an affine distortion. By expressing the change in configurational energy of a molecular configuration as a Taylor expansion in the distortion parameter, compact relations are derivedmore » for the interfacial tension and its energetic and entropic components for three different geometries: planar, cylindrical, and spherical fluid interfaces. While the tensions of the planar and cylindrical geometries are characterized by first-order changes in the energy, that of the spherical interface depends on second-order contributions. We show that a greater statistical uncertainty is to be expected when calculating the thermodynamic properties of a spherical interface than for the planar and cylindrical cases, and the evaluation of the separate entropic and energetic contributions poses a greater computational challenge than the tension itself. The methodology is employed to determine the vapour-liquid interfacial tension of TIP4P/2005 water at 293 K by molecular dynamics simulation for planar, cylindrical, and spherical geometries. A weak peak in the curvature dependence of the tension is observed in the case of cylindrical threads of condensed liquid at a radius of about 8 Å, below which the tension is found to decrease again. In the case of spherical drops, a marked decrease in the tension from the planar limit is found for radii below ∼ 15 Å; there is no indication of a maximum in the tension with increasing curvature. The vapour-liquid interfacial tension tends towards the planar limit for large system sizes for both the cylindrical and spherical cases. Estimates of the entropic and energetic contributions are also evaluated for the planar and cylindrical geometries and their magnitudes are in line with the expectations of our simple analysis.« less

Reducing cyclone pressure drop with evasés

USDA-ARS?s Scientific Manuscript database

Cyclones are widely used to separate particles from gas flows and as air emissions control devices. Their cost of operation is proportional to the fan energy required to overcome their pressure drop. Evasés or exit diffusers potentially could reduce exit pressure losses without affecting collection...

Experimental determination of turbulence in a GH2-GOX rocket combustion chamber

NASA Technical Reports Server (NTRS)

Tou, P.; Russell, R.; Ohara, J.

1974-01-01

The intensity of turbulence and the Lagrangian correlation coefficient for a gaseous rocket combustion chamber have been determined from the experimental measurements of the tracer gas diffusion. A combination of Taylor's turbulent diffusion theory and Spalding's numerical method for solving the conservation equations of fluid mechanics was used to calculate these quantities. Taylor's theory was extended to consider the inhomogeneity of the turbulence field in the axial direction of the combustion chamber. An exponential function was used to represent the Lagrangian correlation coefficient. The results indicate that the maximum value of the intensity of turbulence is about 15% and the Lagrangian correlation coefficient drops to about 0.12 in one inch of the chamber length.

Quantification of the sit-to-stand movement for monitoring age-related motor deterioration using the Nintendo Wii Balance Board.

PubMed

Yamako, Go; Chosa, Etsuo; Totoribe, Koji; Fukao, Yuu; Deng, Gang

2017-01-01

Simple methods for quantitative evaluations of individual motor performance are crucial for the early detection of motor deterioration. Sit-to-stand movement from a chair is a mechanically demanding component of activities of daily living. Here, we developed a novel method using the ground reaction force and center of pressure measured from the Nintendo Wii Balance Board to quantify sit-to-stand movement (sit-to-stand score) and investigated the age-related change in the sit-to-stand score as a method to evaluate reduction in motor performance. The study enrolled 503 participants (mean age ± standard deviation, 51.0 ± 19.7 years; range, 20-88 years; male/female ratio, 226/277) without any known musculoskeletal conditions that limit sit-to-stand movement, which were divided into seven 10-year age groups. The participants were instructed to stand up as quickly as possible, and the sit-to-stand score was calculated as the combination of the speed and balance indices, which have a tradeoff relationship. We also performed the timed up and go test, a well-known clinical test used to evaluate an individual's mobility. There were significant differences in the sit-to-stand score and timed up and go time among age groups. The mean sit-to-stand score for 60s, 70s, and 80s were 77%, 68%, and 53% of that for the 20s, respectively. The timed up and go test confirmed the age-related decrease in mobility of the participants. In addition, the sit-to-stand score measured using the Wii Balance Board was compared with that from a laboratory-graded force plate using the Bland-Altman plot (bias = -3.1 [ms]-1, 95% limit of agreement: -11.0 to 3.9 [ms]-1). The sit-to-stand score has good inter-device reliability (intraclass correlation coefficient = 0.87). Furthermore, the test-retest reliability is substantial (intraclass correlation coefficient = 0.64). Thus, the proposed STS score will be useful to detect the early deterioration of motor performance.

Quantification of the sit-to-stand movement for monitoring age-related motor deterioration using the Nintendo Wii Balance Board

PubMed Central

Chosa, Etsuo; Totoribe, Koji; Fukao, Yuu; Deng, Gang

2017-01-01

Simple methods for quantitative evaluations of individual motor performance are crucial for the early detection of motor deterioration. Sit-to-stand movement from a chair is a mechanically demanding component of activities of daily living. Here, we developed a novel method using the ground reaction force and center of pressure measured from the Nintendo Wii Balance Board to quantify sit-to-stand movement (sit-to-stand score) and investigated the age-related change in the sit-to-stand score as a method to evaluate reduction in motor performance. The study enrolled 503 participants (mean age ± standard deviation, 51.0 ± 19.7 years; range, 20–88 years; male/female ratio, 226/277) without any known musculoskeletal conditions that limit sit-to-stand movement, which were divided into seven 10-year age groups. The participants were instructed to stand up as quickly as possible, and the sit-to-stand score was calculated as the combination of the speed and balance indices, which have a tradeoff relationship. We also performed the timed up and go test, a well-known clinical test used to evaluate an individual’s mobility. There were significant differences in the sit-to-stand score and timed up and go time among age groups. The mean sit-to-stand score for 60s, 70s, and 80s were 77%, 68%, and 53% of that for the 20s, respectively. The timed up and go test confirmed the age-related decrease in mobility of the participants. In addition, the sit-to-stand score measured using the Wii Balance Board was compared with that from a laboratory-graded force plate using the Bland–Altman plot (bias = −3.1 [ms]-1, 95% limit of agreement: −11.0 to 3.9 [ms]-1). The sit-to-stand score has good inter-device reliability (intraclass correlation coefficient = 0.87). Furthermore, the test–retest reliability is substantial (intraclass correlation coefficient = 0.64). Thus, the proposed STS score will be useful to detect the early deterioration of motor performance. PMID:29136031

Crystallization of the Na+-translocating NADH:quinone oxidoreductase from Vibrio cholerae

PubMed Central

Casutt, Marco S.; Wendelspiess, Severin; Steuber, Julia; Fritz, Günter

2010-01-01

The Na+-translocating NADH:quinone oxidoreductase (Na+-NQR) from the human pathogen Vibrio cholerae couples the exergonic oxidation of NADH by membrane-bound quinone to Na+ translocation across the membrane. Na+-NQR consists of six different subunits (NqrA–NqrF) and contains a [2Fe–2S] cluster, a noncovalently bound FAD, a noncovalently bound riboflavin, two covalently bound FMNs and potentially Q8 as cofactors. Initial crystallization of the entire Na+-NQR complex was achieved by the sitting-drop method using a nanolitre dispenser. Optimization of the crystallization conditions yielded flat yellow-coloured crystals with dimensions of up to 200 × 80 × 20 µm. The crystals diffracted to 4.0 Å resolution and belonged to space group P21, with unit-cell parameters a = 94, b = 146, c = 105 Å, α = γ = 90, β = 111°. PMID:21139223

Surface modification of polylactic acid films by atmospheric pressure plasma treatment

NASA Astrophysics Data System (ADS)

Kudryavtseva, V. L.; Zhuravlev, M. V.; Tverdokhlebov, S. I.

2017-09-01

A new approach for the modification of polylactic acid (PLA) materials using atmospheric pressure plasma (APP) is described. PLA films plasma exposure time was 20, 60, 120 s. The surface morphology and wettability of the obtained PLA films were investigated by atomic force microscopy (AFM) and the sitting drop method. The atmospheric pressure plasma increased the roughness and surface energy of PLA film. The wettability of PLA has been improved with the application of an atmospheric plasma surface treatment. It was shown that it is possible to obtain PLA films with various surface relief and tunable wettability. Additionally, we demonstrated that the use of cold atmospheric pressure plasma for surface activation allows for the immobilization of bioactive compounds like hyaluronic acid (HA) on the surface of obtained films. It was shown that composite PLA-HA films have an increased long-term hydrophilicity of the films surface.

Modelling the Effect of Fruit Growth on Surface Conductance to Water Vapour Diffusion

PubMed Central

GIBERT, CAROLINE; LESCOURRET, FRANÇOISE; GÉNARD, MICHEL; VERCAMBRE, GILLES; PÉREZ PASTOR, ALEJANDRO

2005-01-01

• Background and Aims A model of fruit surface conductance to water vapour diffusion driven by fruit growth is proposed. It computes the total fruit conductance by integrating each of its components: stomata, cuticle and cracks. • Methods The stomatal conductance is computed from the stomatal density per fruit and the specific stomatal conductance. The cuticular component is equal to the proportion of cuticle per fruit multiplied by its specific conductance. Cracks are assumed to be generated when pulp expansion rate exceeds cuticle expansion rate. A constant percentage of cracks is assumed to heal each day. The proportion of cracks to total fruit surface area multiplied by the specific crack conductance accounts for the crack component. The model was applied to peach fruit (Prunus persica) and its parameters were estimated from field experiments with various crop load and irrigation regimes. • Key Results The predictions were in good agreement with the experimental measurements and for the different conditions (irrigation and crop load). Total fruit surface conductance decreased during early growth as stomatal density, and hence the contribution of the stomatal conductance, decreased from 80 to 20 % with fruit expansion. Cracks were generated for fruits exhibiting high growth rates during late growth and the crack component could account for up to 60 % of the total conductance during the rapid fruit growth. The cuticular contribution was slightly variable (around 20 %). Sensitivity analysis revealed that simulated conductance was highly affected by stomatal parameters during the early period of growth and by both crack and stomatal parameters during the late period. Large fruit growth rate leads to earlier and greater increase of conductance due to higher crack occurrence. Conversely, low fruit growth rate accounts for a delayed and lower increase of conductance. • Conclusions By predicting crack occurrence during fruit growth, this model could be helpful in managing cropping practices for integrated plant protection. PMID:15655107

Fundamental mass transfer modeling of emission of volatile organic compounds from building materials

NASA Astrophysics Data System (ADS)

Bodalal, Awad Saad

In this study, a mass transfer theory based model is presented for characterizing the VOC emissions from building materials. A 3-D diffusion model is developed to describe the emissions of volatile organic compounds (VOCs) from individual sources. Then the formulation is extended to include the emissions from composite sources (system comprising an assemblage of individual sources). The key parameters for the model (The diffusion coefficient of the VOC in the source material D, and the equilibrium partition coefficient k e) were determined independently (model parameters are determined without the use of chamber emission data). This procedure eliminated to a large extent the need for emission testing using environmental chambers, which is costly, time consuming, and may be subject to confounding sink effects. An experimental method is developed and implemented to measure directly the internal diffusion (D) and partition coefficients ( ke). The use of the method is illustrated for three types of VOC's: (i) Aliphatic Hydrocarbons, (ii) Aromatic Hydrocarbons and ( iii) Aldehydes, through typical dry building materials (carpet, plywood, particleboard, vinyl floor tile, gypsum board, sub-floor tile and OSB). Then correlations for predicting D and ke based solely on commonly available properties such as molecular weight and vapour pressure were proposed for each product and type of VOC. These correlations can be used to estimate the D and ke when direct measurement data are not available, and thus facilitate the prediction of VOC emissions from the building materials using mass transfer theory. The VOC emissions from a sub-floor material (made of the recycled automobile tires), and a particleboard are measured and predicted. Finally, a mathematical model to predict the diffusion coefficient through complex sources (floor adhesive) as a function of time was developed. Then this model (for diffusion coefficient in complex sources) was used to predict the emission rate from material system (namely, substrate//glue//vinyl tile).

Rotating diffuser for pressure recovery in a steam cooling circuit of a gas turbine

DOEpatents

Eldrid, Sacheverel Q.; Salamah, Samir A.; DeStefano, Thomas Daniel

2002-01-01

The buckets of a gas turbine are steam-cooled via a bore tube assembly having concentric supply and spent cooling steam return passages rotating with the rotor. A diffuser is provided in the return passage to reduce the pressure drop. In a combined cycle system, the spent return cooling steam with reduced pressure drop is combined with reheat steam from a heat recovery steam generator for flow to the intermediate pressure turbine. The exhaust steam from the high pressure turbine of the combined cycle unit supplies cooling steam to the supply conduit of the gas turbine.

Immediate effects of dynamic sitting exercise on the lower back mobility of sedentary young adults

PubMed Central

Chatchawan, Uraiwan; Jupamatangb, Unthika; Chanchitc, Sunisa; Puntumetakul, Rungthip; Donpunha, Wanida; Yamauchi, Junichiro

2015-01-01

[Purpose] The aim of this study was to investigate the effects of dynamic sitting exercises during prolonged sitting on the lower back mobility of sedentary young adults. [Subjects and Methods] Seventy-one subjects aged between 18–25 years participated in this study. Following a randomized crossover study design, subjects were randomly assigned to two groups: sitting only and dynamic sitting exercise. The dynamic sitting exercise was a combination of lower back hyperextension and abdominal drawing-in movements which were repeated 6 times in a 1-minute period and performed every 20 minutes during a 2-hour sitting session. Lumbar range of movement was measured with the modified-modified Schober test, and the pain intensity was evaluated using the visual analog scale. [Results] After the experiment, the lumbar range of movement was significantly impaired in the sitting only group; however, it was significantly improved in the dynamic sitting exercise group. There were significant differences in lumbar range of movement of both flexion and extension between the groups. No significant difference in pain intensity between the groups was found. [Conclusion] These results suggest that dynamic sitting exercises during prolonged sitting can prevent decreases in lumbar range of movement in both back flexion and extension following a 2-hour sitting period. PMID:26696698

Efficient quantification of water content in edible oils by headspace gas chromatography with vapour phase calibration.

PubMed

Xie, Wei-Qi; Gong, Yi-Xian; Yu, Kong-Xian

2018-06-01

An automated and accurate headspace gas chromatographic (HS-GC) technique was investigated for rapidly quantifying water content in edible oils. In this method, multiple headspace extraction (MHE) procedures were used to analyse the integrated water content from the edible oil sample. A simple vapour phase calibration technique with an external vapour standard was used to calibrate both the water content in the gas phase and the total weight of water in edible oil sample. After that the water in edible oils can be quantified. The data showed that the relative standard deviation of the present HS-GC method in the precision test was less than 1.13%, the relative differences between the new method and a reference method (i.e. the oven-drying method) were no more than 1.62%. The present HS-GC method is automated, accurate, efficient, and can be a reliable tool for quantifying water content in edible oil related products and research. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Synthesis of Ordered Mesoporous Phenanthrenequinone-Carbon via π-π Interaction-Dependent Vapor Pressure for Rechargeable Batteries

PubMed Central

Kwon, Mi-Sook; Choi, Aram; Park, Yuwon; Cheon, Jae Yeong; Kang, Hyojin; Jo, Yong Nam; Kim, Young-Jun; Hong, Sung You; Joo, Sang Hoon; Yang, Changduk; Lee, Kyu Tae

2014-01-01

The π-π interaction-dependent vapour pressure of phenanthrenequinone can be used to synthesize a phenanthrenequinone-confined ordered mesoporous carbon. Intimate contact between the insulating phenanthrenequinone and the conductive carbon framework improves the electrical conductivity. This enables a more complete redox reaction take place. The confinement of the phenanthrenequinone in the mesoporous carbon mitigates the diffusion of the dissolved phenanthrenequinone out of the mesoporous carbon, and improves cycling performance. PMID:25490893

Ex-situ gas diffusion layer intrusion effect determination of polymer electrolyte membrane fuel cell flow fields

NASA Astrophysics Data System (ADS)

Haase, S.; Rauber, M.

2015-09-01

In automotive PEM fuel cell systems, one of the most important targets is to reduce the parasitic power of balance of plant components, e.g. the air supply. This can be achieved for example by decreasing air stoichiometry. However, this could lead to bad flow sharing in the fuel cell stack. Therefore the fluid distribution in the flow field has to be evaluated, understood and optimized. This work evaluates the effect of GDL intrusion on the pressure drop via ex-situ determination of GDL intrusion using CFD simulation. The intruded GDL geometries, evaluated by an optical microscope with 200 times enlargement, are transferred to pressure drop behaviors by a numerical CFD model. These results are compared to the results of the differential pressure method of mapping the pressure distribution, described in [43]. The intrusion of the GDL leads to homogeneous flow distribution up to clamping pressures of 2.5 MPa. The inhomogeneous intrusion, induced by cracked fibers that extend into the channel, dominates the flow at higher clamping pressures and leads to the exponential increase in pressure drop in the differential pressure method. For clamping pressures used in typical fuel cell applications, the results of both methods show homogeneous flow through the channels.

A Calibration of the MeteoSwiss RAman Lidar for Meteorological Observations (RALMO)Water Vapour Mixing Ratio Measurements using a Radiosonde Trajectory Method

NASA Astrophysics Data System (ADS)

Hicks-Jalali, Shannon; Sica, R. J.; Haefele, Alexander; Martucci, Giovanni

2018-04-01

With only 50% downtime from 2007-2016, the RALMO lidar in Payerne, Switzerland, has one of the largest continuous lidar data sets available. These measurements will be used to produce an extensive lidar water vapour climatology using the Optimal Estimation Method introduced by Sica and Haefele (2016). We will compare our improved technique for external calibration using radiosonde trajectories with the standard external methods, and present the evolution of the lidar constant from 2007 to 2016.

Geologic Map of the Diana Chasma Quadrangle (V-37), Venus

USGS Publications Warehouse

Hansen, V.L.; DeShon, H.R.

2002-01-01

Diana Chasma quadrangle hosts some of the steepest topography on Venus. Altimetry measurements range from -2.5 to 4.7 km (0.0 = mean planetary radius), with a surface mean of 0.6 km. Fractures and faults within the central fracture/rift zone create large blocks of down-dropped material, especially along the east-central edge of the map area. The Dali and Diana chasmata display slopes of >30°, the steepest and deepest trenches on Venus. Both chasmata host landslide deposits presumably sourced from the steep chasmata walls. The tessera inlier, coronae, and ridge belts sit topographically above Rusalka and Zhibek planitiae. Rusalka Planitia topography describes broad undulations having northwest-trending ridges spaced ~200 km apart. The most distinctive ridge, Vetsorgo Dorsum, centered at 6.5° S., 163° E., is a Class I ridge belt owing to its simple arch morphology. The central interior of Markham crater sits topographically lower than the surrounding region, which slopes downward to the east.

Reliability and Validity of the Hip Stability Isometric Test (HipSIT): A New Method to Assess Hip Posterolateral Muscle Strength.

PubMed

Almeida, Gabriel Peixoto Leão; das Neves Rodrigues, Helena Larissa; de Freitas, Bruno Wesley; de Paula Lima, Pedro Olavo

2017-12-01

Study Design Cross-sectional study. Background The Hip Stability Isometric Test (HipSIT) evaluates the strength of the hip posterolateral stabilizers in a position that favors greater activation of the gluteus maximus and gluteus medius and lower activation of the tensor fascia lata. Objectives To check the validity and reliability of the HipSIT and to evaluate the HipSIT in women with patellofemoral pain (PFP). Methods The HipSIT was evaluated with a handheld dynamometer. During testing, the participants were sidelying, with their legs positioned at 45° of hip flexion and 90° of knee flexion. Participants were instructed to raise the knee of the upper leg while keeping the upper and lower heels in contact. To establish reliability and validity, 49 women were tested with the HipSIT by 2 different evaluators on day 1, and then again 7 days later. The strength of the hip extensors, abductors, and external rotators was also evaluated. Twenty women with unilateral PFP were also evaluated. Results The HipSIT has excellent intrarater and interrater reliability. The standard error of measurement was 0.01 kgf/kg, and the minimal detectable change was 0.036 kgf/kg. The HipSIT showed good validity in isolated hip abduction, external rotation, and extension (P<.01). Women with PFP showed a 10% deficit in the HipSIT results for the symptomatic limb (P = .01). Conclusion The HipSIT showed excellent interrater and intrarater reliability, moderate to good validity in women, and was able to identify strength deficits in women with PFP. J Orthop Sports Phys Ther 2017;47(12):906-913. Epub 9 Oct 2017. doi:10.2519/jospt.2017.7274.

Impact of increasing social media use on sitting time and body mass index.

PubMed

Alley, Stephanie; Wellens, Pauline; Schoeppe, Stephanie; de Vries, Hein; Rebar, Amanda L; Short, Camille E; Duncan, Mitch J; Vandelanotte, Corneel

2017-08-01

Issue addressed Sedentary behaviours, in particular sitting, increases the risk of cardiovascular disease, type 2 diabetes, obesity and poorer mental health status. In Australia, 70% of adults sit for more than 8h per day. The use of social media applications (e.g. Facebook, Twitter, and Instagram) is on the rise; however, no studies have explored the association of social media use with sitting time and body mass index (BMI). Methods Cross-sectional self-report data on demographics, BMI and sitting time were collected from 1140 participants in the 2013 Queensland Social Survey. Generalised linear models were used to estimate associations of a social media score calculated from social media use, perceived importance of social media, and number of social media contacts with sitting time and BMI. Results Participants with a high social media score had significantly greater sitting times while using a computer in leisure time and significantly greater total sitting time on non-workdays. However, no associations were found between social media score and sitting to view TV, use motorised transport, work or participate in other leisure activities; or total workday, total sitting time or BMI. Conclusions These results indicate that social media use is associated with increased sitting time while using a computer, and total sitting time on non-workdays. So what? The rise in social media use may have a negative impact on health by contributing to computer sitting and total sitting time on non-workdays. Future longitudinal research with a representative sample and objective sitting measures is needed to confirm findings.

[Eco-physiological investigations on wild and cultivated plants in the Negev Desert : II. The influence of climatic factors on carbon dioxide exchange and transpiration at the end of the dry period].

PubMed

Schulze, E -D; Lange, O L; Koch, W

1972-12-01

The influence of climatic factors on net photosynthesis, dark respiration and transpiration was investigated in the Negev Desert at the end of the dry summer period when plant water stress was at a maximum. Species studied included: dominant species of the natural vegetation (Artemisia herba-alba, Hammada scoparia, Noaea mucronata, Reaumuria negevensis, Salsola inermis, Zygophyllum dumosum), cultivated plants receiving rainfall and run-off water during the winter season in the run-off farm Avdat (Prunus armeniaca, Vitis vinifera), and irrigated cultivated plants receiving additional water during the summer season (Citrullus colocynthis, Datura metel). 1. Light saturation of net photosynthesis was reached at 60-90 klx conforming to the high solar radiation intensities of the desert. 2. Maximum rates of CO 2 uptake per unit of dry weight for the irrigated mesomorphic plants was ten times that of the wild plants. However, in comparison to the other species, maximal rates of CO 2 uptake for wild plants were higher when calculated on a leaf area basis than when represented on a dry weight basis. Maximum rates of net photosynthesis per unit chlorophyll content for some of the wild plants (Salsola and Noaea) were comparable to those of the cultivated Vitis and irrigated Citrullus and Datura, Hammada exhibited even higher rates than Prunus. This demonstrates the great photosynthetic capacity of the wild plants even at the end of the dry season. 3. The upper temperature compensation point for net photosynthesis of the wild plants was unusually high as an adaptation to the temperatures of the habitat. Compensation points higher than 49°C exceed the maxima known so far for other flowering species. Maximum rates of net photosynthesis of Hammada were measured when the temperature of the photosynthetic organs was 37°C; at 49°C photosynthesis was only reduced by 50%. 4. Leaf temperature affects plant gas exchange by influencing stomatal aperture. Diffusion resistance of leaves to water vapour was reduced at low temperatures and increased at high temperatures. Reduction of net photosynthesis and transpiration of desert plants at midday may, therefore, be the result of temperature-induced stomatal closure. The possible influence of peristomatal transpiration on stomatal aperture is also discussed. Peristomatal transpiration is directly related to the vapour pressure gradient between the leaf mesophyll and the ambient air which increases with increasing temperatures. 5. Diffusion resistance to water vapour was reduced at high temperatures approaching the limits of heat resistance, due to increased stomatal aperture. This resulted in greater transpirational cooling. 6. Under conditions of increased leaf water stress, diffusion resistance increased, either by sudden stomatal closure at specific threshold values of water stress or through a continuous increase in resistance. This increased resistance is coupled with decreases in transpiration and photosynthesis. 7. In several plant species increased diffusion resistance during the course of the day caused decreased transpiration without a corresponding decrease in photosynthesis. Under these conditions, the ratio of CO 2 uptake to transpiration became more favourable as the day progressed. The possibility that this favourable gas exchange response is the result of an increased mesophyll resistance to water vapour loss is discussed.

Structure determination of an integral membrane protein at room temperature from crystals in situ

DOE Office of Scientific and Technical Information (OSTI.GOV)

Axford, Danny; Foadi, James; Imperial College London, London SW7 2AZ

2015-05-14

The X-ray structure determination of an integral membrane protein using synchrotron diffraction data measured in situ at room temperature is demonstrated. The structure determination of an integral membrane protein using synchrotron X-ray diffraction data collected at room temperature directly in vapour-diffusion crystallization plates (in situ) is demonstrated. Exposing the crystals in situ eliminates manual sample handling and, since it is performed at room temperature, removes the complication of cryoprotection and potential structural anomalies induced by sample cryocooling. Essential to the method is the ability to limit radiation damage by recording a small amount of data per sample from many samplesmore » and subsequently assembling the resulting data sets using specialized software. The validity of this procedure is established by the structure determination of Haemophilus influenza TehA at 2.3 Å resolution. The method presented offers an effective protocol for the fast and efficient determination of membrane-protein structures at room temperature using third-generation synchrotron beamlines.« less

Refractometry studies of the optical properties of polymer films and the development of polymer coated refractive index sensors

NASA Astrophysics Data System (ADS)

Saunders, John Edward

Sensors for real-time monitoring of environmental contaminants are essential for protecting ecosystems and human health. Refractive index sensing is a non-selective technique that can be used to measure almost any analyte. Miniaturized refractive index sensors, such as silicon-on-insulator (SOI) microring resonators are one possible platform, but require coatings selective to the analytes of interest. A homemade prism refractometer is reported and used to characterize the interactions between polymer films and liquid or vapour-phase analytes. A camera was used to capture both Fresnel reflection and total internal reflection within the prism. For thin-films (d = 10 μm - 100 μm), interference fringes were also observed. Fourier analysis of the interferogram allowed for simultaneous extraction of the average refractive index and film thickness with accuracies of Δn = 1-7 x10-4 and Δd < 3-5%. The refractive indices of 29 common organic solvents as well as aqueous solutions of sodium chloride, sucrose, ethylene glycol, glycerol, and dimethylsulfoxide were measured at λ = 1550 nm. These measurements will be useful for future calibrations of near-infrared refractive index sensors. A mathematical model is presented, where the concentration of analyte adsorbed in a film can be calculated from the refractive index and thickness changes during uptake. This model can be used with Fickian diffusion models to measure the diffusion coefficients through the bulk film and at the film-substrate interface. The diffusion of water and other organic solvents into SU-8 epoxy was explored using refractometry and the diffusion coefficient of water into SU-8 is presented. Exposure of soft baked SU-8 films to acetone, acetonitrile and methanol resulted in rapid delamination. The diffusion of volatile organic compound (VOC) vapours into polydimethylsiloxane and polydimethyl-co-polydiphenylsiloxane polymers was also studied using refractometry. Diffusion and partition coefficients are reported for several analytes. As a model system, polydimethyl-co-diphenylsiloxane films were coated onto SOI microring resonators. After the development of data acquisition software, coated devices were exposed to VOCs and the refractive index response was assessed. More studies with other polymers are required to test the viability of this platform for environmental sensing applications.

STS-96 Crew Training

NASA Technical Reports Server (NTRS)

1999-01-01

The training for the crew members of the STS-96 Discovery Shuttle is presented. Crew members are Kent Rominger, Commander; Rick Husband, Pilot; Mission Specialists, Tamara Jernigan, Ellen Ochoa, and Daniel Barry; Julie Payette, Mission Specialist (CSA); and Valery Ivanovich Tokarev, Mission Specialist (RSA). Scenes show the crew sitting and talking about the Electrical Power System; actively taking part in virtual training in the EVA Training VR (Virtual Reality) Lab; using the Orbit Space Vision Training System; being dropped in water as a part of the Bail-Out Training Program; and taking part in the crew photo session.

Effects of deep breathing on internal oblique and multifidus muscle activity in three sitting postures

PubMed Central

Ko, Min-Joo; Jung, Eun-Joo; Kim, Moon-Hwan; Oh, Jae-Seop

2018-01-01

[Purpose] This study was to investigate differences in the level of activity of the external oblique (EO), internal oblique (IO), and multifidus (MF) muscles with deep breathing in three sitting postures. [Subjects and Methods] Sixteen healthy women were recruited. The muscle activity (EO, IO, MF) of all subjects was measured in three sitting postures (slumped, thoracic upright, and lumbo-pelvic upright sitting postures) using surface electromyography. The activity of the same muscles was then remeasured in the three sitting postures during deep breathing. [Results] Deep breathing significantly increased activity in the EO, IO, and MF compared with normal breathing. Comparing postures, the activity of the MF and IO muscles was highest in the lumbo-pelvic upright sitting posture. [Conclusion] An lumbo-pelvic upright sitting posture with deep breathing could increase IO and MF muscle activity, thus improving lumbo-pelvic region stability. PMID:29706695

Characterization of aqueous interactions of copper-doped phosphate-based glasses by vapour sorption.

PubMed

Stähli, Christoph; Shah Mohammadi, Maziar; Waters, Kristian E; Nazhat, Showan N

2014-07-01

Owing to their adjustable dissolution properties, phosphate-based glasses (PGs) are promising materials for the controlled release of bioinorganics, such as copper ions. This study describes a vapour sorption method that allowed for the investigation of the kinetics and mechanisms of aqueous interactions of PGs of the formulation 50P2O5-30CaO-(20-x)Na2O-xCuO (x=0, 1, 5 and 10mol.%). Initial characterization was performed using (31)P magic angle spinning nuclear magnetic resonance and attenuated total reflectance-Fourier transform infrared spectroscopy. Increasing CuO content resulted in chemical shifts of the predominant Q(2) NMR peak and of the (POP)as and (PO(-)) Fourier transform infrared absorptions, owing to the higher strength of the POCu bond compared to PONa. Vapour sorption and desorption were gravimetrically measured in PG powders exposed to variable relative humidity (RH). Sorption was negligible below 70% RH and increased exponentially with RH from 70 to 90%, where it exhibited a negative correlation with CuO content. Vapour sorption in 0% and 1% CuO glasses resulted in phosphate chain hydration and hydrolysis, as evidenced by protonated Q(0)(1H) and Q(1)(1H) species. Dissolution rates in deionized water showed a linear correlation (R(2)>0.99) with vapour sorption. Furthermore, cation release rates could be predicted based on dissolution rates and PG composition. The release of orthophosphate and short polyphosphate species corroborates the action of hydrolysis and was correlated with pH changes. In conclusion, the agreement between vapour sorption and routine characterization techniques in water demonstrates the potential of this method for the study of PG aqueous reactions. Copyright © 2014 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Copper diffusion in Ti Si N layers formed by inductively coupled plasma implantation

NASA Astrophysics Data System (ADS)

Ee, Y. C.; Chen, Z.; Law, S. B.; Xu, S.; Yakovlev, N. L.; Lai, M. Y.

2006-11-01

Ternary Ti-Si-N refractory barrier films of 15 nm thick was prepared by low frequency, high density, inductively coupled plasma implantation of N into TixSiy substrate. This leads to the formation of Ti-N and Si-N compounds in the ternary film. Diffusion of copper in the barrier layer after annealing treatment at various temperatures was investigated using time-of-flight secondary ion mass spectrometer (ToF-SIMS) depth profiling, X-ray diffractometer (XRD), field emission scanning electron microscopy (FESEM), energy dispersive X-ray (EDX) and sheet resistance measurement. The current study found that barrier failure did not occur until 650 °C annealing for 30 min. The failure occurs by the diffusion of copper into the Ti-Si-N film to form Cu-Ti and Cu-N compounds. FESEM surface morphology and EDX show that copper compounds were formed on the ridge areas of the Ti-Si-N film. The sheet resistance verifies the diffusion of Cu into the Ti-Si-N film; there is a sudden drop in the resistance with Cu compound formation. This finding provides a simple and effective method of monitoring Cu diffusion in TiN-based diffusion barriers.

Study protocol for Chronic Obstructive Pulmonary Disease-Sitting and ExacerbAtions Trial (COPD-SEAT): a randomised controlled feasibility trial of a home-based self-monitoring sedentary behaviour intervention

PubMed Central

Orme, Mark; Weedon, Amie; Esliger, Dale; Saukko, Paula; Morgan, Mike; Steiner, Michael; Downey, John; Singh, Sally; Sherar, Lauren

2016-01-01

Introduction An acute exacerbation of chronic obstructive pulmonary disease (COPD) marks a critical life event, which can lower patient quality of life and ability to perform daily activities. Patients with COPD tend to lead inactive and highly sedentary lifestyles, which may contribute to reductions in functional capacity. Targeting sedentary behaviour (SB) may be more attainable than exercise (at a moderate-to-vigorous intensity) for behaviour change in patients following an exacerbation. This study aims to evaluate the feasibility and acceptability of a 2-week at-home intervention providing education and self-monitoring to reduce prolonged periods of SB in patients with COPD discharged following an acute exacerbation. Methods and analysis Patients will be randomised into 1 of 3 conditions: usual care (control), education or education+feedback. The education group will receive information and suggestions about reducing long periods of sitting. The education+feedback group will receive real-time feedback on their sitting time, stand-ups and step count at home through an inclinometer linked to a smart device app. The inclinometer will also provide vibration prompts to encourage movement when the wearer has been sedentary for too long. Data will be collected during hospital admission and 2 weeks after discharge. Qualitative interviews will be conducted with patients in the intervention groups to explore patient experiences. Interviews with healthcare staff will also be conducted. All data will be collected January to August 2016. The primary outcomes are feasibility and acceptability, which will be assessed by qualitative interviews, uptake and drop-out rates, reasons for refusing the intervention, compliance, app usage and response to vibration prompts. Ethics and dissemination The research ethics committee East Midlands Leicester-Central has provided ethical approval for the conduct of this study. The results of the study will be disseminated through appropriate conference proceedings and peer-reviewed journals. Trial registration number ISRCTN13790881; Pre-results. PMID:27697880

Quantitative Measurement of Oxygen in Microgravity Combustion

NASA Technical Reports Server (NTRS)

Silver, Joel A.

1997-01-01

A low-gravity environment, in space or in ground-based facilities such as drop towers, provides a unique setting for studying combustion mechanisms. Understanding the physical phenomena controlling the ignition and spread of flames in microgravity has importance for space safety as well as for better characterization of dynamical and chemical combustion processes which are normally masked by buoyancy and other gravity-related effects. Due to restrictions associated with performing measurements in reduced gravity, diagnostic methods which have been applied to microgravity combustion studies have generally been limited to capture of flame emissions on film or video, laser Schlieren imaging and (intrusive) temperature measurements using thermocouples. Given the development of detailed theoretical models, more sophisticated diagnostic methods are needed to provide the kind of quantitative data necessary to characterize the properties of microgravity combustion processes as well as provide accurate feedback to improve the predictive capabilities of the models. When the demands of space flight are considered, the need for improved diagnostic systems which are rugged, compact, reliable, and operate at low power becomes apparent. The objective of this research is twofold. First, we want to develop a better understanding of the relative roles of diffusion and reaction of oxygen in microgravity combustion. As the primary oxidizer species, oxygen plays a major role in controlling the observed properties of flames, including flame front speed (in solid or liquid flames), extinguishment characteristics, flame size and flame temperature. The second objective is to develop better diagnostics based on diode laser absorption which can be of real value in both microgravity combustion research and as a sensor on-board Spacelab as either an air quality monitor or as part of a fire detection system. In our prior microgravity work, an eight line-of-sight fiber optic system measured water vapor mole fractions in the NASA Lewis 2.2-sec Drop Tower. In that system, the laser and all electronics resided at the top of the drop tower and was connected via a fiber optic cable to the rig, on which a 'pitch and catch' set of fiber collimating lenses were used to transmit the laser beam across a jet diffusion flame. This system required eight independent detection/demodulation units and had poor spatial resolution. This research builds on this earlier work, resulting in an improved capability for quantitative, nonintrusive measurement of major combustion species. A vertical cavity surface-emitting diode laser (VCSEL) and a continuous spatial scanning method permit the measurement of temporal and spatial profiles of the concentrations and temperatures of molecular oxygen. High detection sensitivity is achieved with wavelength modulation spectroscopy (WMS). One-g experiments are performed using a slot diffusion flame. Microgravity measurements on a solid fuel (cellulose sheet) system are planned for the NASA Lewis 2.2-second Drop Tower Facility.

Crystallization and identification of the glycosylated moieties of two isoforms of the main allergen Hev b 2 and preliminary X-ray analysis of two polymorphs of isoform II

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fuentes-Silva, D.; Mendoza-Hernández, G.; Stojanoff, V.

2007-09-01

Crystallization of important glycoenzymes involved in IgE-mediated latex allergy. Latex from Hevea brasiliensis contains several allergenic proteins that are involved in type I allergy. One of them is Hev b 2, which is a β-1,3-glucanase enzyme that exists in different isoforms with variable glycosylation content. Two glucanase isoforms were isolated from trees of the GV-42 clone by gel filtration, affinity and ion-exchange chromatography. Isoform I had a carbohydrate content of about 20%, with N-linked N-acetyl-glucosamine, N-acetyl-galactosamine, fucose and galactose residues as the main sugars, while isoform II showed 6% carbohydrate content constisting of N-acetyl-glucosamine, fucose, mannose and xylose. Both isoformsmore » were crystallized by the hanging-drop vapour-diffusion method. Isoform I crystals were grown using 0.2 M trisodium citrate dihydrate, 0.1 M Na HEPES pH 7.5 and 20%(v/v) 2-propanol, but these crystals were not appropriate for data collection. Isoform II crystals were obtained under two conditions and X-ray diffraction data were collected from both. In the first condition (0.2 M trisodium citrate, 0.1 M sodium cacodylate pH 6.5, 30% 2-propanol), crystals belonging to the tetragonal space group P4{sub 1} with unit-cell parameters a = b = 150.17, c = 77.41 Å were obtained. In the second condition [0.2 M ammonium acetate, 0.1 M trisodium citrate dihydrate pH 5.6, 30%(w/v) polyethylene glycol 4000] the isoform II crystals belonged to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 85.08, b = 89.67, c = 101.80 Å, β = 113.6°. Preliminary analysis suggests that there are four molecules of isoform II in both asymmetric units.« less

X-ray crystallographic studies on C-phycocyanins from cyanobacteria from different habitats: marine and freshwater

DOE Office of Scientific and Technical Information (OSTI.GOV)

Satyanarayana, L.; Suresh, C. G., E-mail: cgsuresh@ncl.res.in; Patel, Anamika

2005-09-01

The protein C-phycocyanin, involved in photosynthesis, has been purified from three cyanobacterial species: Spirulina, Phormidium and Lyngbya. These three proteins have been crystallized and characterized using X-ray crystallography. C-phycocyanins from three cyanobacterial cultures of freshwater and marine habitat, Spirulina, Phormidium and Lyngbya spp., were purified to homogeneity and crystallized using the hanging-drop vapour-diffusion method. Blue-coloured crystals in different crystal forms, monoclinic and hexagonal, were obtained for the three species. The crystals took 1–12 weeks to grow to full size using polyethylene glycols of different molecular weights as precipitants. The amino-acid sequences of these proteins show high similarity to other knownmore » C-phycocyanins from related organisms; however, the C-phycocyanins reported here showed different biochemical and biophysical properties, i.e. molecular weight, stability etc. The X-ray diffraction data were collected at resolutions of 3.0 Å for the monoclinic and 3.2 and 3.6 Å for the hexagonal forms. The unit-cell parameters corresponding to the monoclinic space group P2{sub 1} are a = 107.33, b = 115.64, c = 183.26 Å, β = 90.03° for Spirulina sp. C-phycocyanin and are similar for crystals of Phormidium and Lyngbya spp. C-phycocyanins. Crystals belonging to the hexagonal space group P6{sub 3}, with unit-cell parameters a = b = 154.97, c = 40.35 Å and a = b = 151.96, c = 39.06 Å, were also obtained for the C-phycocyanins from Spirulina and Lyngbya spp., respectively. The estimated solvent content is around 50% for the monoclinic crystals of all three species assuming the presence of two hexamers per asymmetric unit. The solvent content is 66.5 and 64.1% for the hexagonal crystals of C-phycocyanin from Spirulina and Lyngbya spp. assuming the presence of one αβ monomer per asymmetric unit.« less

Compatibility of stainless steels and lithiated ceramics with beryllium

NASA Astrophysics Data System (ADS)

Flament, T.; Fauvet, P.; Sannier, J.

1988-07-01

The introduction of beryllium as a neutron multiplier in ceramic blankets of thermonuclear fusion reactors may give rise to the following compatibility problems: (i) oxidation of Be by ceramics (lithium aluminate and silicates) or by water vapour; (ii) interaction between beryllium and austenitic and martensitic steels. The studies were done in contact tests under vacuum and in tests under wet sweeping helium. The contact tests under vacuum have revealed that the interaction of beryllium with ceramics seems to be low up to 700°C, the interaction of beryllium with steels is significant and is characterized by the formation of a diffusion layer and of a brittle Be-Fe-Ni compound. With type 316 L austenitic steel, this interaction appears quite large at 600°C whereas it is noticeable only at 700°C with martensitic steels. The experiments carried out with sweeping wet helium at 600°C have evidenced a slight oxidation of beryllium due to water vapour which can be enhanced in the front of uncompletely dehydrated ceramics.

Evaporation-triggered microdroplet nucleation and the four life phases of an evaporating Ouzo drop.

PubMed

Tan, Huanshu; Diddens, Christian; Lv, Pengyu; Kuerten, J G M; Zhang, Xuehua; Lohse, Detlef

2016-08-02

Evaporating liquid droplets are omnipresent in nature and technology, such as in inkjet printing, coating, deposition of materials, medical diagnostics, agriculture, the food industry, cosmetics, or spills of liquids. Whereas the evaporation of pure liquids, liquids with dispersed particles, or even liquid mixtures has intensively been studied over the past two decades, the evaporation of ternary mixtures of liquids with different volatilities and mutual solubilities has not yet been explored. Here we show that the evaporation of such ternary mixtures can trigger a phase transition and the nucleation of microdroplets of one of the components of the mixture. As a model system, we pick a sessile Ouzo droplet (as known from daily life-a transparent mixture of water, ethanol, and anise oil) and reveal and theoretically explain its four life phases: In phase I, the spherical cap-shaped droplet remains transparent while the more volatile ethanol is evaporating, preferentially at the rim of the drop because of the singularity there. This leads to a local ethanol concentration reduction and correspondingly to oil droplet nucleation there. This is the beginning of phase II, in which oil microdroplets quickly nucleate in the whole drop, leading to its milky color that typifies the so-called "Ouzo effect." Once all ethanol has evaporated, the drop, which now has a characteristic nonspherical cap shape, has become clear again, with a water drop sitting on an oil ring (phase III), finalizing the phase inversion. Finally, in phase IV, all water has evaporated, leaving behind a tiny spherical cap-shaped oil drop.

Evaporation-triggered microdroplet nucleation and the four life phases of an evaporating Ouzo drop

NASA Astrophysics Data System (ADS)

Tan, Huanshu; Diddens, Christian; Lv, Pengyu; Kuerten, J. G. M.; Zhang, Xuehua; Lohse, Detlef

2016-08-01

Evaporating liquid droplets are omnipresent in nature and technology, such as in inkjet printing, coating, deposition of materials, medical diagnostics, agriculture, the food industry, cosmetics, or spills of liquids. Whereas the evaporation of pure liquids, liquids with dispersed particles, or even liquid mixtures has intensively been studied over the past two decades, the evaporation of ternary mixtures of liquids with different volatilities and mutual solubilities has not yet been explored. Here we show that the evaporation of such ternary mixtures can trigger a phase transition and the nucleation of microdroplets of one of the components of the mixture. As a model system, we pick a sessile Ouzo droplet (as known from daily life—a transparent mixture of water, ethanol, and anise oil) and reveal and theoretically explain its four life phases: In phase I, the spherical cap-shaped droplet remains transparent while the more volatile ethanol is evaporating, preferentially at the rim of the drop because of the singularity there. This leads to a local ethanol concentration reduction and correspondingly to oil droplet nucleation there. This is the beginning of phase II, in which oil microdroplets quickly nucleate in the whole drop, leading to its milky color that typifies the so-called “Ouzo effect.” Once all ethanol has evaporated, the drop, which now has a characteristic nonspherical cap shape, has become clear again, with a water drop sitting on an oil ring (phase III), finalizing the phase inversion. Finally, in phase IV, all water has evaporated, leaving behind a tiny spherical cap-shaped oil drop.

Evaporation-triggered microdroplet nucleation and the four life phases of an evaporating Ouzo drop

PubMed Central

Tan, Huanshu; Diddens, Christian; Lv, Pengyu; Kuerten, J. G. M.; Zhang, Xuehua; Lohse, Detlef

2016-01-01

Evaporating liquid droplets are omnipresent in nature and technology, such as in inkjet printing, coating, deposition of materials, medical diagnostics, agriculture, the food industry, cosmetics, or spills of liquids. Whereas the evaporation of pure liquids, liquids with dispersed particles, or even liquid mixtures has intensively been studied over the past two decades, the evaporation of ternary mixtures of liquids with different volatilities and mutual solubilities has not yet been explored. Here we show that the evaporation of such ternary mixtures can trigger a phase transition and the nucleation of microdroplets of one of the components of the mixture. As a model system, we pick a sessile Ouzo droplet (as known from daily life—a transparent mixture of water, ethanol, and anise oil) and reveal and theoretically explain its four life phases: In phase I, the spherical cap-shaped droplet remains transparent while the more volatile ethanol is evaporating, preferentially at the rim of the drop because of the singularity there. This leads to a local ethanol concentration reduction and correspondingly to oil droplet nucleation there. This is the beginning of phase II, in which oil microdroplets quickly nucleate in the whole drop, leading to its milky color that typifies the so-called “Ouzo effect.” Once all ethanol has evaporated, the drop, which now has a characteristic nonspherical cap shape, has become clear again, with a water drop sitting on an oil ring (phase III), finalizing the phase inversion. Finally, in phase IV, all water has evaporated, leaving behind a tiny spherical cap-shaped oil drop. PMID:27418601

Dispersal of seeds from splash-cup plants

NASA Astrophysics Data System (ADS)

Pepper, Rachel

2017-11-01

Splash cup plants disperse their seeds with the help of raindrops. The seeds sit in a small (mm-scale) conical cup and are ejected upon drop impact. The seeds are ejected at velocities up to five times the impact speed of the raindrop, and are dispersed up to 1 m away from the parent plant, which is only a few cm high. Previous work investigating the mechanism of this remarkable dispersal predicted an optimum cup opening angle of around 40°, which matched reasonably well with experiments performed with 3D-printed splash cup models. Those experiments were done with off-center drop impacts on initially empty cups with no seeds. We discuss similar experiments for cups that are not initially empty, but rather contain seed mimics, water, or both seeds and water. For some of these realistic initial states results are strikingly different from empty cups. Connections to theory will also be discussed.

A novel method of measuring the concentration of anaesthetic vapours using a dew-point hygrometer.

PubMed

Wilkes, A R; Mapleson, W W; Mecklenburgh, J S

1994-02-01

The Antoine equation relates the saturated vapour pressure of a volatile substance, such as an anaesthetic agent, to the temperature. The measurement of the 'dew-point' of a dry gas mixture containing a volatile anaesthetic agent by a dew-point hygrometer permits the determination of the partial pressure of the anaesthetic agent. The accuracy of this technique is limited only by the accuracy of the Antoine coefficients and of the temperature measurement. Comparing measurements by the dew-point method with measurements by refractometry showed systematic discrepancies up to 0.2% and random discrepancies with SDS up to 0.07% concentration in the 1% to 5% range for three volatile anaesthetics. The systematic discrepancies may be due to errors in available data for the vapour pressures and/or the refractive indices of the anaesthetics.

Drop evaporation in a single-axis acoustic levitator

NASA Technical Reports Server (NTRS)

Lierke, E. G.; Croonquist, A. P.

1990-01-01

A 20 kHz single-axis acoustic positioner is used to levitate aqueous-solution drops (volumes less than or approximately equal to 100 micro-liters). Drop evaporation rates are measured under ambient, isothermal conditions for different relative humidities. Acoustic convection around the levitated sample enhances the mass loss over that due to natural convection and diffusion. A theoretical treatment of the mass flow is developed in analogy to previous studies of the heat transfer from a sphere in an acoustic field. Predictions of the enhanced mass loss, in the form of Nusselt (Sherwood) numbers, are compared with observed rages of drop shrinking. The work is part of an ESA crystal growth from levitated solution drops.

Is questionnaire-based sitting time inaccurate and can it be improved? A cross-sectional investigation using accelerometer-based sitting time

PubMed Central

Gupta, Nidhi; Christiansen, Caroline Stordal; Hanisch, Christiana; Bay, Hans; Burr, Hermann; Holtermann, Andreas

2017-01-01

Objectives To investigate the differences between a questionnaire-based and accelerometer-based sitting time, and develop a model for improving the accuracy of questionnaire-based sitting time for predicting accelerometer-based sitting time. Methods 183 workers in a cross-sectional study reported sitting time per day using a single question during the measurement period, and wore 2 Actigraph GT3X+ accelerometers on the thigh and trunk for 1–4 working days to determine their actual sitting time per day using the validated Acti4 software. Least squares regression models were fitted with questionnaire-based siting time and other self-reported predictors to predict accelerometer-based sitting time. Results Questionnaire-based and accelerometer-based average sitting times were ≈272 and ≈476 min/day, respectively. A low Pearson correlation (r=0.32), high mean bias (204.1 min) and wide limits of agreement (549.8 to −139.7 min) between questionnaire-based and accelerometer-based sitting time were found. The prediction model based on questionnaire-based sitting explained 10% of the variance in accelerometer-based sitting time. Inclusion of 9 self-reported predictors in the model increased the explained variance to 41%, with 10% optimism using a resampling bootstrap validation. Based on a split validation analysis, the developed prediction model on ≈75% of the workers (n=132) reduced the mean and the SD of the difference between questionnaire-based and accelerometer-based sitting time by 64% and 42%, respectively, in the remaining 25% of the workers. Conclusions This study indicates that questionnaire-based sitting time has low validity and that a prediction model can be one solution to materially improve the precision of questionnaire-based sitting time. PMID:28093433

Closed-chamber transepidermal water loss measurement: microclimate, calibration and performance.

PubMed

Imhof, R E; De Jesus, M E P; Xiao, P; Ciortea, L I; Berg, E P

2009-04-01

The importance of transepidermal water loss (TEWL) as a measure of the skin barrier is well recognized. Currently, the open-chamber method is dominant, but it is increasingly challenged by newer closed-chamber technologies. Whilst there is familiarity with open-chamber characteristics, there is uncertainty about the capabilities of the challengers. The main issues are related to how microclimate affects TEWL measurements. The aim of this paper is to provide a framework for understanding the effects of microclimate on TEWL measurement. Part of the problem is that TEWL measurement is indirect. TEWL is the diffusion of condensed water through the stratum corneum (SC), whereas TEWL methods measure water vapour flux in the air above the SC. This vapour flux depends on (i) the rate of supply of water to the skin surface and (ii) the rate of evaporation of water from the skin surface. Rate (i) is a skin property (TEWL), rate (ii) is a microclimate property. The controlling rate for the combined process is the lower of the above two rates. Therefore, TEWL instruments measure TEWL only when TEWL is the rate-limiting process. Another problem is that SC barrier property and SC hydration are affected by the microclimate adjacent to the skin surface. This is discussed insofar as it affects the measurement of TEWL. The conclusion is that such changes occur on a timescale that is long compared with TEWL measurement times. An important aspect of TEWL measurement is calibration. We present an analysis of the traditional wet-cup method and a new droplet method that is traceable and has been independently verified by a standards laboratory. Finally, we review performance indicators of commercial closed-chamber instruments with reference to open-chamber instruments. The main findings are that TEWL readings correlate well, but there are significant differences in the other aspects of performance.

Concentration methods for high-resolution THz spectroscopy of nucleic-acid biomolecules and crystals

NASA Astrophysics Data System (ADS)

Brown, E. R.; Zhang, W.; Mendoza, E. A.; Kuznetsova, Y.; Brueck, S. R. J.; Rahman, M.; Norton, M. L.

2012-03-01

Biomolecules can exhibit low-lying vibrational modes in the THz region which are detectable in transmission given a strong molecular dipole moment and optical depth, and a spectrometer of adequate sensitivity. The nucleic acids are particularly interesting because of applications such as label-free gene assay, bio-agent detection, etc. However for nucleic acids, sample preparation and THz coupling are of paramount importance because of the strong absorption by liquid water and the small concentration of molecules present in physiological solutions. Concentration methods become necessary to make the THz vibrational modes detectable, either by concentrating the nucleic-acid sample itself in a small volume but large area, or by concentrating the THz radiation down to the volume of the sample. This paper summarizes one type of the first method: nanofluidic channel arrays for biological nucleic acids; and two types of the second method: (1) a circular-waveguide pinhole, and (2) a circular-waveguide, conical-horn coupling structure, both for DNA crystals. The first method has been demonstrated on a very short artificial nucleic acid [small-interfering (si) RNA (17-to-25 bp)] and a much longer, biological molecule [Lambda-phage DNA (48.5 kbp)]. The second method has been demonstrated on small (~100 micron) single crystals of DNA grown by the sitting-drop method.

Design of distributed JT (Joule-Thomson) effect heat exchanger for superfluid 2 K cooling device

NASA Astrophysics Data System (ADS)

Jeong, S.; Park, C.; Kim, K.

2018-03-01

Superfluid at 2 K or below is readily obtained from liquid helium at 4.2 K by reducing its vapour pressure. For better cooling performance, however, the cold energy of vaporized helium at 2 K chamber can be effectively utilized in a recuperator which is specially designed in this paper for accomplishing so-called the distributed Joule-Thomson (JT) expansion effect. This paper describes the design methodology of distributed JT effect heat exchanger for 2 K JT cooling device. The newly developed heat exchanger allows continuous significant pressure drop at high-pressure part of the recuperative heat exchanger by using a capillary tube. Being different from conventional recuperative heat exchangers, the efficient JT effect HX must consider the pressure drop effect as well as the heat transfer characteristic. The heat exchanger for the distributed JT effect actively utilizes continuous pressure loss at the hot stream of the heat exchanger by using an OD of 0.64 mm and an ID of 0.4 mm capillary tube. The analysis is performed by dividing the heat exchanger into the multiple sub-units of the heat exchange part and JT valve. For more accurate estimation of the pressure drop of spirally wound capillary tube, preliminary experiments are carried out to investigate the friction factor at high Reynolds number. By using the developed pressure drop correlation and the heat transfer correlation, the specification of the heat exchanger with distributed JT effect for 2 K JT refrigerator is determined.

Atomistic modeling of dropwise condensation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sikarwar, B. S., E-mail: bssikarwar@amity.edu; Singh, P. L.; Muralidhar, K.

The basic aim of the atomistic modeling of condensation of water is to determine the size of the stable cluster and connect phenomena occurring at atomic scale to the macroscale. In this paper, a population balance model is described in terms of the rate equations to obtain the number density distribution of the resulting clusters. The residence time is taken to be large enough so that sufficient time is available for all the adatoms existing in vapor-phase to loose their latent heat and get condensed. The simulation assumes clusters of a given size to be formed from clusters of smallermore » sizes, but not by the disintegration of the larger clusters. The largest stable cluster size in the number density distribution is taken to be representative of the minimum drop radius formed in a dropwise condensation process. A numerical confirmation of this result against predictions based on a thermodynamic model has been obtained. Results show that the number density distribution is sensitive to the surface diffusion coefficient and the rate of vapor flux impinging on the substrate. The minimum drop radius increases with the diffusion coefficient and the impinging vapor flux; however, the dependence is weak. The minimum drop radius predicted from thermodynamic considerations matches the prediction of the cluster model, though the former does not take into account the effect of the surface properties on the nucleation phenomena. For a chemically passive surface, the diffusion coefficient and the residence time are dependent on the surface texture via the coefficient of friction. Thus, physical texturing provides a means of changing, within limits, the minimum drop radius. The study reveals that surface texturing at the scale of the minimum drop radius does not provide controllability of the macro-scale dropwise condensation at large timescales when a dynamic steady-state is reached.« less

Laser scattering in a hanging drop vapor diffusion apparatus for protein crystal growth in a microgravity environment

NASA Technical Reports Server (NTRS)

Casay, G. A.; Wilson, W. W.

1992-01-01

One type of hardware used to grow protein crystals in the microgravity environment aboard the U.S. Space Shuttle is a hanging drop vapor diffusion apparatus (HDVDA). In order to optimize crystal growth conditions, dynamic control of the HDVDA is desirable. A critical component in the dynamically controlled system is a detector for protein nucleation. We have constructed a laser scattering detector for the HDVDA capable of detecting the nucleation stage. The detector was successfully tested for several scatterers differing in size using dynamic light scattering techniques. In addition, the ability to detect protein nucleation using the HDVDA was demonstrated for lysozyme.

Modelling Soil Heat and Water Flow as a Coupled Process in Land Surface Models

NASA Astrophysics Data System (ADS)

García González, Raquel; Verhoef, Anne; Vidale, Pier Luigi; Braud, Isabelle

2010-05-01

To improve model estimates of soil water and heat flow by land surface models (LSMs), in particular in the first few centimetres of the near-surface soil profile, we have to consider in detail all the relevant physical processes involved (see e.g. Milly, 1982). Often, thermal and iso-thermal vapour fluxes in LSMs are neglected and the simplified Richard's equation is used as a result. Vapour transfer may affect the water fluxes and heat transfer in LSMs used for hydrometeorological and climate simulations. Processes occurring in the top 50 cm soil may be relevant for water and heat flux dynamics in the deeper layers, as well as for estimates of evapotranspiration and heterotrophic respiration, or even for climate and weather predictions. Water vapour transfer, which was not incorporated in previous versions of the MOSES/JULES model (Joint UK Land Environment Simulator; Cox et al., 1999), has now been implemented. Furthermore, we also assessed the effect of the soil vertical resolution on the simulated soil moisture and temperature profiles and the effect of the processes occurring at the upper boundary, mainly in terms of infiltration rates and evapotranspiration. SiSPAT (Simple Soil Plant Atmosphere Transfer Model; Braud et al., 1995) was initially used to quantify the changes that we expect to find when we introduce vapour transfer in JULES, involving parameters such as thermal vapour conductivity and diffusivity. Also, this approach allows us to compare JULES to a more complete and complex numerical model. Water vapour flux varied with soil texture, depth and soil moisture content, but overall our results suggested that water vapour fluxes change temperature gradients in the entire soil profile and introduce an overall surface cooling effect. Increasing the resolution smoothed and reduced temperature differences between liquid (L) and liquid/vapour (LV) simulations at all depths, and introduced a temperature increase over the entire soil profile. Thermal gradients rather than soil water potential gradients seem to cause temporal and spatial (vertical) soil temperature variability. We conclude that a multi-soil layer configuration may improve soil water dynamics, heat transfer and coupling of these processes, as well as evapotranspiration estimates and land surface-atmosphere coupling. However, a compromise should be reached between numerical and process-simulation aspects. References: Braud I., A.C. Dantas-Antonino, M. Vauclin, J.L. Thony and P. Ruelle, 1995b: A Simple Soil Plant Atmo- sphere Transfer model (SiSPAT), Development and field verification, J. Hydrol, 166: 213-250 Cox, P.M., R.A. Betts, C.B. Bunton, R.L.H. Essery, P.R. Rowntree, and J. Smith (1999), The impact of new land surface physics on the GCM simulation of climate and climate sensitivity. Clim. Dyn., 15, 183-203. Milly, P.C.D., 1982. Moisture and heat transport in hysteric inhomogeneous porous media: a matric head- based formulation and a numerical model, Water Resour. Res., 18:489-498

Magnetic Resonance Imaging of Solids Using Oscillating Field Gradients

NASA Astrophysics Data System (ADS)

Daud, Yaacob Mat

1992-01-01

Available from UMI in association with The British Library. A fully automatic solid state NMR imaging spectrometer is described. Use has been made of oscillating field gradients to frequency and phase encode the spatial localisation of the nuclear spins. The RF pulse is applied during the zero crossing of the field gradient, so only low RF power is needed to cover the narrow spectral width of the spins. The oscillating field gradient coils were operated on resonance hence large gradient strength could be applied (up to 200G/cm). Two image reconstruction methods were used, filtered back-projection and two dimensional Fourier transformation. The use of phase encoding, both with oscillating and with pulsed field gradients, enabled us to acquire the data when the gradients were off, and this method proved to be insensitive to eddy currents. It also allowed the use of narrow bandwidth receiver thus improving the signal to noise ratio. The maximum entropy method was used in an effort to remove data truncation effects, although the results were not too convincing. The application of these new imaging schemes, was tested by mapping the T_1 and T_2 of polymers. The calculated relaxation maps produced precise spatial information about T_1 and T_2 which is not possible to achieve by conventional relaxation weight mapping. In a second application, the diffusion of water vapour into dried zeolite powder was studied. We found that the diffusion process is not Fickian.

Stepwise and Pulse Transient Methods of Thermophysical Parameters Measurement

NASA Astrophysics Data System (ADS)

Malinarič, Svetozár; Dieška, Peter

2016-12-01

Stepwise transient and pulse transient methods are experimental techniques for measuring the thermal diffusivity and conductivity of solid materials. Theoretical models and experimental apparatus are presented, and the influence of the heat source capacity and the heat transfer coefficient is investigated using the experiment simulation. The specimens from low-density polyethylene (LDPE) and polymethylmethacrylate (PMMA) were measured by both methods. Coefficients of variation were better than 0.9 % for LDPE and 2.8 % for PMMA measurements. The time dependence of the temperature response to the input heat flux showed a small drop, which was caused by thermoelastic wave generated by thermal expansions of the heat source.

Locating bomb factories by detecting hydrogen peroxide.

PubMed

Romolo, Francesco Saverio; Connell, Samantha; Ferrari, Carlotta; Suarez, Guillaume; Sauvain, Jean-Jacques; Hopf, Nancy B

2016-11-01

The analytical capability to detect hydrogen peroxide vapour can play a key role in localizing a site where a H2O2 based Improvised Explosive (IE) is manufactured. In security activities it is very important to obtain information in a short time. For this reason, an analytical method to be used in security activity needs portable devices. The authors have developed the first analytical method based on a portable luminometer, specifically designed and validated to locate IE manufacturing sites using quantitative on-site vapour analysis for H2O2. The method was tested both indoor and outdoor. The results demonstrate that the detection of H2O2 vapours could allow police forces to locate the site, while terrorists are preparing an attack. The collected data are also very important in developing new sensors, able to give an early alarm if located at a proper distance from a site where an H2O2 based IE is prepared. Copyright © 2016 Elsevier B.V. All rights reserved.