Sample records for six-dof parallel minimanipulators

  1. Six-degree-of-freedom parallel minimanipulator with three inextensible limbs

    NASA Technical Reports Server (NTRS)

    Tahmasebi, Farhad (Inventor); Tsai, Lung-Wen (Inventor)

    1994-01-01

    A Six-Degree-of-Freedom Parallel-Manipulator having three inextensible limbs for manipulating a platform is described. The three inextensible limbs are attached via universal joints to the platform at non-collinear points. Each of the inextensible limbs is also attached via universal joints to a two-degree-of-freedom parallel driver such as a five-bar linkage, a pantograph, or a bidirectional linear stepper motor. The drivers move the lower ends of the limbs parallel to a fixed base and thereby provide manipulation of the platform. The actuators are mounted on the fixed base without using any power transmission devices such as gears or belts.

  2. A piezoelectric six-DOF vibration energy harvester based on parallel mechanism: dynamic modeling, simulation, and experiment

    NASA Astrophysics Data System (ADS)

    Yuan, G.; Wang, D. H.

    2017-03-01

    Multi-directional and multi-degree-of-freedom (multi-DOF) vibration energy harvesting are attracting more and more research interest in recent years. In this paper, the principle of a piezoelectric six-DOF vibration energy harvester based on parallel mechanism is proposed to convert the energy of the six-DOF vibration to single-DOF vibrations of the limbs on the energy harvester and output voltages. The dynamic model of the piezoelectric six-DOF vibration energy harvester is established to estimate the vibrations of the limbs. On this basis, a Stewart-type piezoelectric six-DOF vibration energy harvester is developed and explored. In order to validate the established dynamic model and the analysis results, the simulation model of the Stewart-type piezoelectric six-DOF vibration energy harvester is built and tested with different vibration excitations by SimMechanics, and some preliminary experiments are carried out. The results show that the vibration of the limbs on the piezoelectric six-DOF vibration energy harvester can be estimated by the established dynamic model. The developed Stewart-type piezoelectric six-DOF vibration energy harvester can harvest the energy of multi-directional linear vibration and multi-axis rotating vibration with resonance frequencies of 17 Hz, 25 Hz, and 47 Hz. Moreover, the resonance frequencies of the developed piezoelectric six-DOF vibration energy harvester are not affected by the direction changing of the vibration excitation.

  3. Novel Door-opening Method for Six-legged Robots Based on Only Force Sensing

    NASA Astrophysics Data System (ADS)

    Chen, Zhi-Jun; Gao, Feng; Pan, Yang

    2017-09-01

    Current door-opening methods are mainly developed on tracked, wheeled and biped robots by applying multi-DOF manipulators and vision systems. However, door-opening methods for six-legged robots are seldom studied, especially using 0-DOF tools to operate and only force sensing to detect. A novel door-opening method for six-legged robots is developed and implemented to the six-parallel-legged robot. The kinematic model of the six-parallel-legged robot is established and the model of measuring the positional relationship between the robot and the door is proposed. The measurement model is completely based on only force sensing. The real-time trajectory planning method and the control strategy are designed. The trajectory planning method allows the maximum angle between the sagittal axis of the robot body and the normal line of the door plane to be 45º. A 0-DOF tool mounted to the robot body is applied to operate. By integrating with the body, the tool has 6 DOFs and enough workspace to operate. The loose grasp achieved by the tool helps release the inner force in the tool. Experiments are carried out to validate the method. The results show that the method is effective and robust in opening doors wider than 1 m. This paper proposes a novel door-opening method for six-legged robots, which notably uses a 0-DOF tool and only force sensing to detect and open the door.

  4. A kinematic analysis of the modified flight telerobotic servicer manipulator system

    NASA Technical Reports Server (NTRS)

    Crane, Carl; Carnahan, Tim; Duffy, Joseph

    1992-01-01

    A reverse kinematic analysis is presented of a six-DOF subchain of a modified seven-DOF flight telerobotic servicer manipulator system. The six-DOF subchain is designated as a TR-RT chain, which describes the sequence of manipulator joints beginning with the first grounded hook joint (universal joint) T, where the sequence R-R designates a pair of revolute joints with parallel axes. At the outset, it had been thought that the reverse kinematic analysis would be similar to a TTT manipulator previously analyzed, in which the third and fourth joints intersected at a finite point. However, this is shown not the case, and a 16th-degree tan-half-angle polynomial is derived for the TR-RT manipulator.

  5. A surgical parallel continuum manipulator with a cable-driven grasper.

    PubMed

    Orekhov, Andrew L; Bryson, Caroline E; Till, John; Chung, Scotty; Rucker, D Caleb

    2015-01-01

    In this paper, we present the design, construction, and control of a six-degree-of-freedom (DOF), 12 mm diameter, parallel continuum manipulator with a 2-DOF, cable-driven grasper. This work is a proof-of-concept first step towards miniaturization of this type of manipulator design to provide increased dexterity and stability in confined-space surgical applications, particularly for endoscopic procedures. Our robotic system consists of six superelastic NiTi (Nitinol) tubes in a standard Stewart-Gough configuration and an end effector with 180 degree motion of its two jaws. Two Kevlar cables pass through the centers of the tube legs to actuate the end effector. A computationally efficient inverse kinematics model provides low-level control inputs to ten independent linear actuators, which drive the Stewart-Gough platform and end-effector actuation cables. We demonstrate the performance and feasibility of this design by conducting open-loop range-of-motion tests for our system.

  6. Measurement of six-degree-of-freedom planar motions by using a multiprobe surface encoder

    NASA Astrophysics Data System (ADS)

    Li, Xinghui; Shimizu, Yuki; Ito, Takeshi; Cai, Yindi; Ito, So; Gao, Wei

    2014-12-01

    A multiprobe surface encoder for optical metrology of six-degree-of-freedom (six-DOF) planar motions is presented. The surface encoder is composed of an XY planar scale grating with identical microstructures in X- and Y-axes and an optical sensor head. In the optical sensor head, three paralleled laser beams were used as laser probes. After being divided by a beam splitter, the three laser probes were projected onto the scale grating and a reference grating with identical microstructures, respectively. For each probe, the first-order positive and negative diffraction beams along the X- and Y-directions from the scale grating and from the reference grating superimposed with each other and four pieces of interference signals were generated. Three-DOF translational motions of the scale grating Δx, Δy, and Δz can be obtained simultaneously from the interference signals of each probe. Three-DOF angular error motions θX, θY, and θZ can also be calculated simultaneously from differences of displacement output variations and the geometric relationship among the three probes. A prototype optical sensor head was designed, constructed, and evaluated. Experimental results verified that this surface encoder could provide measurement resolutions of subnanometer and better than 0.1 arc sec for three-DOF translational motions and three-DOF angular error motions, respectively.

  7. Type synthesis for 4-DOF parallel press mechanism using GF set theory

    NASA Astrophysics Data System (ADS)

    He, Jun; Gao, Feng; Meng, Xiangdun; Guo, Weizhong

    2015-07-01

    Parallel mechanisms is used in the large capacity servo press to avoid the over-constraint of the traditional redundant actuation. Currently, the researches mainly focus on the performance analysis for some specific parallel press mechanisms. However, the type synthesis and evaluation of parallel press mechanisms is seldom studied, especially for the four degrees of freedom(DOF) press mechanisms. The type synthesis of 4-DOF parallel press mechanisms is carried out based on the generalized function(GF) set theory. Five design criteria of 4-DOF parallel press mechanisms are firstly proposed. The general procedure of type synthesis of parallel press mechanisms is obtained, which includes number synthesis, symmetrical synthesis of constraint GF sets, decomposition of motion GF sets and design of limbs. Nine combinations of constraint GF sets of 4-DOF parallel press mechanisms, ten combinations of GF sets of active limbs, and eleven combinations of GF sets of passive limbs are synthesized. Thirty-eight kinds of press mechanisms are presented and then different structures of kinematic limbs are designed. Finally, the geometrical constraint complexity( GCC), kinematic pair complexity( KPC), and type complexity( TC) are proposed to evaluate the press types and the optimal press type is achieved. The general methodologies of type synthesis and evaluation for parallel press mechanism are suggested.

  8. [The relation of workspace and installation space of epicyclic kinematics with six degrees of freedom].

    PubMed

    Pott, Peter P; Schwarz, Markus L R

    2007-10-01

    The kinematics of a robotic device significantly determines its installation space when it comes to technical realisation. With regard to the deployment of robotic manipulators in surgery, manipulators with a preferably small installation space are needed. This study describes six versions of novel epicyclic kinematics with six degrees of freedom (DOF). At first, the kinematics functionality was analysed using Gruebler's formula. Subsequently, the quantitative determination of the relation of workspace and installation space was performed using Matlab algorithms. To qualitatively describe the shape of the workspace, the Matlab visualisation features were utilised. For comparison, the well-known Hexapod was used. The assessed kinematics had 6-DOF-functionality. It became apparent that one version of the epicyclic kinematics having two 3-DOF disk systems mounted in a parallel way featured a particularly good relation of workspace and installation space. Compared to the Hexapod, this is approximately four times better. The shape of the workspaces of all epicyclic kinematics assessed was convex and compact. It could be shown that a novel epicyclic kinematics has a notably advantageous relation of workspace and installation space. Apparently, it seems to be well suited for the deployment in robotic machines for surgical procedures.

  9. Real-time simultaneous and proportional myoelectric control using intramuscular EMG

    PubMed Central

    Kuiken, Todd A; Hargrove, Levi J

    2014-01-01

    Objective Myoelectric prostheses use electromyographic (EMG) signals to control movement of prosthetic joints. Clinically available myoelectric control strategies do not allow simultaneous movement of multiple degrees of freedom (DOFs); however, the use of implantable devices that record intramuscular EMG signals could overcome this constraint. The objective of this study was to evaluate the real-time simultaneous control of three DOFs (wrist rotation, wrist flexion/extension, and hand open/close) using intramuscular EMG. Approach We evaluated task performance of five able-bodied subjects in a virtual environment using two control strategies with fine-wire EMG: (i) parallel dual-site differential control, which enabled simultaneous control of three DOFs and (ii) pattern recognition control, which required sequential control of DOFs. Main Results Over the course of the experiment, subjects using parallel dual-site control demonstrated increased use of simultaneous control and improved performance in a Fitts' Law test. By the end of the experiment, performance using parallel dual-site control was significantly better (up to a 25% increase in throughput) than when using sequential pattern recognition control for tasks requiring multiple DOFs. The learning trends with parallel dual-site control suggested that further improvements in performance metrics were possible. Subjects occasionally experienced difficulty in performing isolated single-DOF movements with parallel dual-site control but were able to accomplish related Fitts' Law tasks with high levels of path efficiency. Significance These results suggest that intramuscular EMG, used in a parallel dual-site configuration, can provide simultaneous control of a multi-DOF prosthetic wrist and hand and may outperform current methods that enforce sequential control. PMID:25394366

  10. Real-time simultaneous and proportional myoelectric control using intramuscular EMG

    NASA Astrophysics Data System (ADS)

    Smith, Lauren H.; Kuiken, Todd A.; Hargrove, Levi J.

    2014-12-01

    Objective. Myoelectric prostheses use electromyographic (EMG) signals to control movement of prosthetic joints. Clinically available myoelectric control strategies do not allow simultaneous movement of multiple degrees of freedom (DOFs); however, the use of implantable devices that record intramuscular EMG signals could overcome this constraint. The objective of this study was to evaluate the real-time simultaneous control of three DOFs (wrist rotation, wrist flexion/extension, and hand open/close) using intramuscular EMG. Approach. We evaluated task performance of five able-bodied subjects in a virtual environment using two control strategies with fine-wire EMG: (i) parallel dual-site differential control, which enabled simultaneous control of three DOFs and (ii) pattern recognition control, which required sequential control of DOFs. Main results. Over the course of the experiment, subjects using parallel dual-site control demonstrated increased use of simultaneous control and improved performance in a Fitts’ Law test. By the end of the experiment, performance using parallel dual-site control was significantly better (up to a 25% increase in throughput) than when using sequential pattern recognition control for tasks requiring multiple DOFs. The learning trends with parallel dual-site control suggested that further improvements in performance metrics were possible. Subjects occasionally experienced difficulty in performing isolated single-DOF movements with parallel dual-site control but were able to accomplish related Fitts’ Law tasks with high levels of path efficiency. Significance. These results suggest that intramuscular EMG, used in a parallel dual-site configuration, can provide simultaneous control of a multi-DOF prosthetic wrist and hand and may outperform current methods that enforce sequential control.

  11. Modeling and controller design of a 6-DOF precision positioning system

    NASA Astrophysics Data System (ADS)

    Cai, Kunhai; Tian, Yanling; Liu, Xianping; Fatikow, Sergej; Wang, Fujun; Cui, Liangyu; Zhang, Dawei; Shirinzadeh, Bijan

    2018-05-01

    A key hurdle to meet the needs of micro/nano manipulation in some complex cases is the inadequate workspace and flexibility of the operation ends. This paper presents a 6-degree of freedom (DOF) serial-parallel precision positioning system, which consists of two compact type 3-DOF parallel mechanisms. Each parallel mechanism is driven by three piezoelectric actuators (PEAs), guided by three symmetric T-shape hinges and three elliptical flexible hinges, respectively. It can extend workspace and improve flexibility of the operation ends. The proposed system can be assembled easily, which will greatly reduce the assembly errors and improve the positioning accuracy. In addition, the kinematic and dynamic model of the 6-DOF system are established, respectively. Furthermore, in order to reduce the tracking error and improve the positioning accuracy, the Discrete-time Model Predictive Controller (DMPC) is applied as an effective control method. Meanwhile, the effectiveness of the DMCP control method is verified. Finally, the tracking experiment is performed to verify the tracking performances of the 6-DOF stage.

  12. Parallel Photonic Quantum Computation Assisted by Quantum Dots in One-Side Optical Microcavities

    PubMed Central

    Luo, Ming-Xing; Wang, Xiaojun

    2014-01-01

    Universal quantum logic gates are important elements for a quantum computer. In contrast to previous constructions on one degree of freedom (DOF) of quantum systems, we investigate the possibility of parallel quantum computations dependent on two DOFs of photon systems. We construct deterministic hyper-controlled-not (hyper-CNOT) gates operating on the spatial-mode and the polarization DOFs of two-photon or one-photon systems by exploring the giant optical circular birefringence induced by quantum-dot spins in one-sided optical microcavities. These hyper-CNOT gates show that the quantum states of two DOFs can be viewed as independent qubits without requiring auxiliary DOFs in theory. This result can reduce the quantum resources by half for quantum applications with large qubit systems, such as the quantum Shor algorithm. PMID:25030424

  13. Parallel photonic quantum computation assisted by quantum dots in one-side optical microcavities.

    PubMed

    Luo, Ming-Xing; Wang, Xiaojun

    2014-07-17

    Universal quantum logic gates are important elements for a quantum computer. In contrast to previous constructions on one degree of freedom (DOF) of quantum systems, we investigate the possibility of parallel quantum computations dependent on two DOFs of photon systems. We construct deterministic hyper-controlled-not (hyper-CNOT) gates operating on the spatial-mode and the polarization DOFs of two-photon or one-photon systems by exploring the giant optical circular birefringence induced by quantum-dot spins in one-sided optical microcavities. These hyper-CNOT gates show that the quantum states of two DOFs can be viewed as independent qubits without requiring auxiliary DOFs in theory. This result can reduce the quantum resources by half for quantum applications with large qubit systems, such as the quantum Shor algorithm.

  14. Topology search of 3-DOF translational parallel manipulators with three identical limbs for leg mechanisms

    NASA Astrophysics Data System (ADS)

    Wang, Mingfeng; Ceccarelli, Marco

    2015-07-01

    Three-degree of freedom(3-DOF) translational parallel manipulators(TPMs) have been widely studied both in industry and academia in the past decades. However, most architectures of 3-DOF TPMs are created mainly on designers' intuition, empirical knowledge, or associative reasoning and the topology synthesis researches of 3-DOF TPMs are still limited. In order to find out the atlas of designs for 3-DOF TPMs, a topology search is presented for enumeration of 3-DOF TPMs whose limbs can be modeled as 5-DOF serial chains. The proposed topology search of 3-DOF TPMs is aimed to overcome the sensitivities of the design solution of a 3-DOF TPM for a LARM leg mechanism in a biped robot. The topology search, which is based on the concept of generation and specialization in graph theory, is reported as a step-by-step procedure with desired specifications, principle and rules of generalization, design requirements and constraints, and algorithm of number synthesis. In order to obtain new feasible designs for a chosen example and to limit the search domain under general considerations, one topological generalized kinematic chain is chosen to be specialized. An atlas of new feasible designs is obtained and analyzed for a specific solution as leg mechanisms. The proposed methodology provides a topology search for 3-DOF TPMs for leg mechanisms, but it can be also expanded for other applications and tasks.

  15. 76 FR 50796 - Self-Regulatory Organizations; Financial Industry Regulatory Authority, Inc.; Notice of Filing...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-16

    ... designed to minimize the potential for mini-manipulations and for corners or squeezes of the underlying... movements by automated surveillance techniques to identify unusual activity in both options and underlying...

  16. Determination of the position and orientation of a flat piezoelectric micro-stage by moving the optical axis.

    PubMed

    Zhuang, Guo-Yuan; Lee, Hau-Wei; Liu, Chien-Hung

    2014-10-01

    A moving optical axis measurement system with six degrees-of-freedom (DOF) is proposed in this study. The system is very simple and can be placed inside a flat piezoelectric micro-stage. The system comprises three two-DOF optical measurement modules, each having a quadrant photo diode (QPD), a lens, and a laser diode. These three modules and the geometric configuration of their installation allow displacement measurements with up to six-DOF to be made. A mathematical model of this system is also presented. By analyzing the sensitivity and relationship between the displacement of the stage and each of the QPD light spots, movement can be observed. Signal feedback enables multi-axis nano-scale positioning control. We also present a new six-DOF nano stage, which uses piezoelectric actuators for displacement. This stage was used to verify the proposed six-DOF measurement system. Linear and angular resolution of the system can be down to 10 nm and 0.1 arcsec. Linear and angular displacement measurement errors of this six-DOF measurement system are in the range of ±70 nm and ±0.65 arcsec.

  17. Determination of the position and orientation of a flat piezoelectric micro-stage by moving the optical axis

    NASA Astrophysics Data System (ADS)

    Zhuang, Guo-Yuan; Lee, Hau-Wei; Liu, Chien-Hung

    2014-10-01

    A moving optical axis measurement system with six degrees-of-freedom (DOF) is proposed in this study. The system is very simple and can be placed inside a flat piezoelectric micro-stage. The system comprises three two-DOF optical measurement modules, each having a quadrant photo diode (QPD), a lens, and a laser diode. These three modules and the geometric configuration of their installation allow displacement measurements with up to six-DOF to be made. A mathematical model of this system is also presented. By analyzing the sensitivity and relationship between the displacement of the stage and each of the QPD light spots, movement can be observed. Signal feedback enables multi-axis nano-scale positioning control. We also present a new six-DOF nano stage, which uses piezoelectric actuators for displacement. This stage was used to verify the proposed six-DOF measurement system. Linear and angular resolution of the system can be down to 10 nm and 0.1 arcsec. Linear and angular displacement measurement errors of this six-DOF measurement system are in the range of ±70 nm and ±0.65 arcsec.

  18. Architectural study of the design and operation of advanced force feedback manual controllers

    NASA Technical Reports Server (NTRS)

    Tesar, Delbert; Kim, Whee-Kuk

    1990-01-01

    A teleoperator system consists of a manual controller, control hardware/software, and a remote manipulator. It was employed in either hazardous or unstructured, and/or remote environments. In teleoperation, the main-in-the-loop is the central concept that brings human intelligence to the teleoperator system. When teleoperation involves contact with an uncertain environment, providing the feeling of telepresence to the human operator is one of desired characteristics of the teleoperator system. Unfortunately, most available manual controllers in bilateral or force-reflecting teleoperator systems can be characterized by their bulky size, high costs, or lack of smoothness and transparency, and elementary architectures. To investigate other alternatives, a force-reflecting, 3 degree of freedom (dof) spherical manual controller is designed, analyzed, and implemented as a test bed demonstration in this research effort. To achieve an improved level of design to meet criteria such as compactness, portability, and a somewhat enhanced force-reflecting capability, the demonstration manual controller employs high gear-ratio reducers. To reduce the effects of the inertia and friction on the system, various force control strategies are applied and their performance investigated. The spherical manual controller uses a parallel geometry to minimize inertial and gravitational effects on its primary task of transparent information transfer. As an alternative to the spherical 3-dof manual controller, a new conceptual (or parallel) spherical 3-dof module is introduced with a full kinematic analysis. Also, the resulting kinematic properties are compared to those of other typical spherical 3-dof systems. The conceptual design of a parallel 6-dof manual controller and its kinematic analysis is presented. This 6-dof manual controller is similar to the Stewart Platform with the actuators located on the base to minimize the dynamic effects. Finally, a combination of the new 3-dof and 6-dof concepts is presented as a feasible test-bed for enhanced performance in a 9-dof system.

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, J; Nguyen, D; O’Brien, R

    Purpose: Kilovoltage intrafraction monitoring (KIM) scheme has been successfully used to simultaneously monitor 3D tumor motion during radiotherapy. Recently, an iterative closest point (ICP) algorithm was implemented in KIM to also measure rotations about three axes, enabling real-time tracking of tumor motion in six degrees-of-freedom (DoF). This study aims to evaluate the accuracy of the six DoF motion estimates of KIM by comparing it with the corresponding motion (i) measured by the Calypso; and (ii) derived from kV/MV triangulation. Methods: (i) Various motions (static and dynamic) were applied to a CIRS phantom with three embedded electromagnetic transponders (Calypso Medical) usingmore » a 5D motion platform (HexaMotion) and a rotating treatment couch while both KIM and Calypso were used to concurrently track the phantom motion in six DoF. (ii) KIM was also used to retrospectively estimate six DoF motion from continuous sets of kV projections of a prostate, implanted with three gold fiducial markers (2 patients with 80 fractions in total), acquired during the treatment. Corresponding motion was obtained from kV/MV triangulation using a closed form least squares method based on three markers’ positions. Only the frames where all three markers were present were used in the analysis. The mean differences between the corresponding motion estimates were calculated for each DoF. Results: Experimental results showed that the mean of absolute differences in six DoF phantom motion measured by Calypso and KIM were within 1.1° and 0.7 mm. kV/MV triangulation derived six DoF prostate tumor better agreed with KIM estimated motion with the mean (s.d.) difference of up to 0.2° (1.36°) and 0.2 (0.25) mm for rotation and translation, respectively. Conclusion: These results suggest that KIM can provide an accurate six DoF intrafraction tumor during radiotherapy.« less

  20. Lower Limb Rehabilitation Using Patient Data

    PubMed Central

    Saadat, Mozafar

    2016-01-01

    The aim of this study is to investigate the performance of a 6-DoF parallel robot in tracking the movement of the foot trajectory of a paretic leg during a single stride. The foot trajectories of nine patients with a paretic leg including both males and females have been measured and analysed by a Vicon system in a gait laboratory. Based on kinematic and dynamic analysis of a 6-DoF UPS parallel robot, an algorithm was developed in MATLAB to calculate the length of the actuators and their required forces during all trajectories. The workspace and singularity points of the robot were then investigated in nine different cases. A 6-DoF UPS parallel robot prototype with high repeatability was designed and built in order to simulate a single stride. Results showed that the robot was capable of tracking all of the trajectories with the maximum position error of 1.2 mm. PMID:27721648

  1. Kinematic Analysis and Performance Evaluation of Novel PRS Parallel Mechanism

    NASA Astrophysics Data System (ADS)

    Balaji, K.; Khan, B. Shahul Hamid

    2018-02-01

    In this paper, a 3 DoF (Degree of Freedom) novel PRS (Prismatic-Revolute- Spherical) type parallel mechanisms has been designed and presented. The combination of striaght and arc type linkages for 3 DOF parallel mechanism is introduced for the first time. The performances of the mechanisms are evaluated based on the indices such as Minimum Singular Value (MSV), Condition Number (CN), Local Conditioning Index (LCI), Kinematic Configuration Index (KCI) and Global Conditioning Index (GCI). The overall reachable workspace of all mechanisms are presented. The kinematic measure, dexterity measure and workspace analysis for all the mechanism have been evaluated and compared.

  2. Synchronized motion control and precision positioning compensation of a 3-DOFs macro-micro parallel manipulator fully actuated by piezoelectric actuators

    NASA Astrophysics Data System (ADS)

    Zhang, Quan; Li, Chaodong; Zhang, Jiantao; Zhang, Xu

    2017-11-01

    The macro-micro combined approach, as an effective way to realize trans-scale nano-precision positioning with multi-dimensions and high velocity, plays a significant role in integrated circuit manufacturing field. A 3-degree-of-freedoms (3-DOFs) macro-micro manipulator is designed and analyzed to compromise the conflictions among the large stroke, high precision and multi-DOFs. The macro manipulator is a 3-Prismatic-Revolute-Revolute (3-PRR) structure parallel manipulator which is driven by three linear ultrasonic motors. The dynamic model and the cross-coupling error based synchronized motion controller of the 3-PRR parallel manipulator are theoretical analyzed and experimental tested. To further improve the positioning accuracy, a 3-DOFs monolithic compliant manipulator actuated by three piezoelectric stack actuators is designed. Then a multilayer BP neural network based inverse kinematic model identifier is developed to perform the positioning control. Finally, by forming the macro-micro structure, the dual stage manipulator successfully achieved the positioning task from the point (2 mm, 2 mm, 0 rad) back to the original point (0 mm, 0 mm, 0 rad) with the translation errors in X and Y directions less than ±50 nm and the rotation error around Z axis less than ±1 μrad, respectively.

  3. 77 FR 65600 - Self-Regulatory Organizations; Chicago Board Options Exchange, Incorporated; Order Granting...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-29

    ... activity in both options and underlying stocks.\\23\\ In addition, the Exchange states that its surveillance... exercise limits are designed to minimize the potential for mini-manipulations and for corners or squeezes... believes that this liquidity would lessen the opportunity for manipulation of this product and disruption...

  4. Genome-wide characterization of the SiDof gene family in foxtail millet (Setaria italica).

    PubMed

    Zhang, Li; Liu, Baoling; Zheng, Gewen; Zhang, Aiying; Li, Runzhi

    2017-01-01

    Dof (DNA binding with one finger) proteins, which constitute a class of transcription factors found exclusively in plants, are involved in numerous physiological and biochemical reactions affecting growth and development. A genome-wide analysis of SiDof genes was performed in this study. Thirty five SiDof genes were identified and those genes were unevenly distributed across nine chromosomes in the Seteria italica genome. Protein lengths, molecular weights, and theoretical isoelectric points of SiDofs all vary greatly. Gene structure analysis demonstrated that most SiDof genes lack introns. Phylogenetic analysis of SiDof proteins and Dof proteins from Arabidopsis thaliana, rice, sorghum, and Setaria viridis revealed six major groups. Analysis of RNA-Seq data indicated that SiDof gene expression levels varied across roots, stems, leaves, and spike. In addition, expression profiling of SiDof genes in response to stress suggested that SiDof 7 and SiDof 15 are involved in drought stress signalling. Overall, this study could provide novel information on SiDofs for further investigation in foxtail millet. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  5. Singularity and workspace analysis of three isoconstrained parallel manipulators with schoenflies motion

    NASA Astrophysics Data System (ADS)

    Lee, Po-Chih; Lee, Jyh-Jone

    2012-06-01

    This paper presents the analysis of three parallel manipulators with Schoenflies-motion. Each parallel manipulator possesses two limbs in structure and the end-effector has three DOFs (degree of freedom) in the translational motion and one DOF in rotational motion about a given direction axis with respect to the world coordinate system. The three isoconstrained parallel manipulators have the structures denoted as C{u/u}UwHw-//-C{v/v}UwHw, CuR{u/u}Uhw-//-CvR{v/v}Uhw and CuPuUhw-//-CvPvUhw. The kinematic equations are first introduced for each manipulator. Then, Jacobian matrix, singularity, workspace, and performance index for each mechanism are subsequently derived and analysed for the first time. The results can be helpful for the engineers to evaluate such kind of parallel robots for possible application in industry where pick-and-place motion is required.

  6. Six degree of freedom sensor

    DOEpatents

    Vann, Charles S.

    1999-01-01

    This small, non-contact optical sensor increases the capability and flexibility of computer controlled machines by detecting its relative position to a workpiece in all six degrees of freedom (DOF). At a fraction of the cost, it is over 200 times faster and up to 25 times more accurate than competing 3-DOF sensors. Applications range from flexible manufacturing to a 6-DOF mouse for computers. Until now, highly agile and accurate machines have been limited by their inability to adjust to changes in their tasks. By enabling them to sense all six degrees of position, these machines can now adapt to new and complicated tasks without human intervention or delay--simplifying production, reducing costs, and enhancing the value and capability of flexible manufacturing.

  7. Six degree of freedom sensor

    DOEpatents

    Vann, C.S.

    1999-03-16

    This small, non-contact optical sensor increases the capability and flexibility of computer controlled machines by detecting its relative position to a workpiece in all six degrees of freedom (DOF). At a fraction of the cost, it is over 200 times faster and up to 25 times more accurate than competing 3-DOF sensors. Applications range from flexible manufacturing to a 6-DOF mouse for computers. Until now, highly agile and accurate machines have been limited by their inability to adjust to changes in their tasks. By enabling them to sense all six degrees of position, these machines can now adapt to new and complicated tasks without human intervention or delay--simplifying production, reducing costs, and enhancing the value and capability of flexible manufacturing. 3 figs.

  8. An analytical study of a six degree-of-freedom active truss for use in vibration control

    NASA Technical Reports Server (NTRS)

    Wynn, Robert H., Jr.; Robertshaw, Harry H.; Horner, C. Garnett

    1990-01-01

    An analytical study of the vibration control capabilities of three configurations of an active truss is presented. The truss studied is composed of two bays of an octahedral-octahedral configuration. The three configurations of the active truss studies are: all six battens activated (6 DOF), the top three battens activated (3 DOF), and the bottom three battens activated (3 DOF). The closed-loop vibration control response of these three configurations are studied with respect to: vibration attenuation, energy utilized, and the effects of motor drive amplifier saturation non-linearities.

  9. Optimal combination of minimum degrees of freedom to be actuated in the lower limbs to facilitate arm-free paraplegic standing.

    PubMed

    Kim, Joon-Young; Mills, James K; Vette, Albert H; Popovic, Milos R

    2007-12-01

    Arm-free paraplegic standing via functional electrical stimulation (FES) has drawn much attention in the biomechanical field as it might allow a paraplegic to stand and simultaneously use both arms to perform daily activities. However, current FES systems for standing require that the individual actively regulates balance using one or both arms, thus limiting the practical use of these systems. The purpose of the present study was to show that actuating only six out of 12 degrees of freedom (12-DOFs) in the lower limbs to allow paraplegics to stand freely is theoretically feasible with respect to multibody stability and physiological torque limitations of the lower limb DOF. Specifically, the goal was to determine the optimal combination of the minimum DOF that can be realistically actuated using FES while ensuring stability and able-bodied kinematics during perturbed arm-free standing. The human body was represented by a three-dimensional dynamics model with 12-DOFs in the lower limbs. Nakamura's method (Nakamura, Y., and Ghodoussi, U., 1989, "Dynamics Computation of Closed-Link Robot Mechanisms With Nonredundant and Redundant Actuators," IEEE Trans. Rob. Autom., 5(3), pp. 294-302) was applied to estimate the joint torques of the system using experimental motion data from four healthy subjects. The torques were estimated by applying our previous finding that only 6 (6-DOFs) out of 12-DOFs in the lower limbs need to be actuated to facilitate stable standing. Furthermore, it was shown that six cases of 6-DOFs exist, which facilitate stable standing. In order to characterize each of these cases in terms of the torque generation patterns and to identify a potential optimal 6-DOF combination, the joint torques during perturbations in eight different directions were estimated for all six cases of 6-DOFs. The results suggest that the actuation of both ankle flexionextension, both knee flexionextension, one hip flexionextension, and one hip abductionadduction DOF will result in the minimum torque requirements to regulate balance during perturbed standing. To facilitate unsupported FES-assisted standing, it is sufficient to actuate only 6-DOFs. An optimal combination of 6-DOFs exists, for which this system can generate able-bodied kinematics while requiring lower limb joint torques that are producible using contemporary FES technology. These findings suggest that FES-assisted arm-free standing of paraplegics is theoretically feasible, even when limited by the fact that muscles actuating specific DOFs are often denervated or difficult to access.

  10. An 8-DOF dual-arm system for advanced teleoperation performance experiments

    NASA Technical Reports Server (NTRS)

    Bejczy, Antal K.; Szakaly, Zoltan F.

    1992-01-01

    This paper describes the electro-mechanical and control features of an 8-DOF manipulator manufactured by AAI Corporation and installed at the Jet Propulsion Lab. (JPL) in a dual-arm setting. The 8-DOF arm incorporates a variety of features not found in other lab or industrial manipulators. Some of the unique features are: 8-DOF revolute configuration with no lateral offsets at joint axes; 1 to 5 payload to weight ratio with 20 kg (44 lb) payload at a 1.75 m (68.5 in.) reach; joint position measurement with dual relative encoders and potentiometer; infinite roll of joint 8 with electrical and fiber optic slip rings; internal fiber optic link of 'smart' end effectors; four-axis wrist; graphite epoxy links; high link and joint stiffness; use of an upgraded JPL Universal Motor Controller (UMC) capable of driving up to 16 joints. The 8-DOF arm is equipped with a 'smart' end effector which incorporates a 6-DOF forcemoment sensor at the end effector base and grasp force sensors at the base of the parallel jaws. The 8-DOF arm is interfaced to a 6 DOF force reflecting hand controller. The same system is duplicated for and installed at NASA-Langley.

  11. Quantum computation based on photonic systems with two degrees of freedom assisted by the weak cross-Kerr nonlinearity

    PubMed Central

    Luo, Ming-Xing; Li, Hui-Ran; Lai, Hong

    2016-01-01

    Most of previous quantum computations only take use of one degree of freedom (DoF) of photons. An experimental system may possess various DoFs simultaneously. In this paper, with the weak cross-Kerr nonlinearity, we investigate the parallel quantum computation dependent on photonic systems with two DoFs. We construct nearly deterministic controlled-not (CNOT) gates operating on the polarization spatial DoFs of the two-photon or one-photon system. These CNOT gates show that two photonic DoFs can be encoded as independent qubits without auxiliary DoF in theory. Only the coherent states are required. Thus one half of quantum simulation resources may be saved in quantum applications if more complicated circuits are involved. Hence, one may trade off the implementation complexity and simulation resources by using different photonic systems. These CNOT gates are also used to complete various applications including the quantum teleportation and quantum superdense coding. PMID:27424767

  12. Quantum computation based on photonic systems with two degrees of freedom assisted by the weak cross-Kerr nonlinearity.

    PubMed

    Luo, Ming-Xing; Li, Hui-Ran; Lai, Hong

    2016-07-18

    Most of previous quantum computations only take use of one degree of freedom (DoF) of photons. An experimental system may possess various DoFs simultaneously. In this paper, with the weak cross-Kerr nonlinearity, we investigate the parallel quantum computation dependent on photonic systems with two DoFs. We construct nearly deterministic controlled-not (CNOT) gates operating on the polarization spatial DoFs of the two-photon or one-photon system. These CNOT gates show that two photonic DoFs can be encoded as independent qubits without auxiliary DoF in theory. Only the coherent states are required. Thus one half of quantum simulation resources may be saved in quantum applications if more complicated circuits are involved. Hence, one may trade off the implementation complexity and simulation resources by using different photonic systems. These CNOT gates are also used to complete various applications including the quantum teleportation and quantum superdense coding.

  13. Selecting seats for steel industry mobile machines based on seat effective amplitude transmissibility and comfort.

    PubMed

    Conrad, Leanne F; Oliver, Michele L; Jack, Robert J; Dickey, James P; Eger, Tammy R

    2014-01-01

    The purpose of this work was to help a steel industry partner select the most appropriate of three high end heavy equipment seats to retrofit a number of their heavy mobile machines used in the steel making process. The participants included 8 males (22.3 ± 2.0 yrs.) and 8 females (23.5 ± 1.8 yrs.) with no experience operating heavy mobile equipment. Previously recorded 6-DOF chassis acceleration data from a Pot Hauler (a machine which picks up and transports pots of slag) were used to extract six, 20 second representative profiles for implementation on a lab-based heavy machine simulator (6-DOF Parallel Robotics System Corporation robot). Subjects sat on three heavy equipment seats (BeGe7150, Grammar MSG 95G1721, and a 6801 Isringhausen with the seat pan cushion retrofitted with a Skydex cushion) mounted on the simulator. Each subject completed three trials for each combination of seat (n=3) and vibration profile (n=6). Chassis and operator/seat interface vibration were measured by 2, 6-DOF vibration transducers. Variables included Seat Effective Amplitude Transmissibility (SEAT) (X,Y,Z,Roll,Pitch,Yaw,6DOF Vector Sum) to determine if the seat was attenuating or amplifying the vibration, 6-degree of freedom (DOF) vibration total value weighted predicted comfort (Avc) (according to ISO 2631-1) and operator reported comfort (ORC). Factorial ANOVAs revealed significant differences (p < or = 0.05) between seats for all SEAT variables but different seats performed better than others depending on the axis. Significant differences between males and females were observed for SEAT in X,Y, and Pitch as well as for Avs. As expected there were significant differences between vibration profiles for all assessed variables. A number of interaction effects were observed, the most frequently occurring of which was between seat and vibration profile. Based upon the number of seat and vibration profile interactions, results suggest that a single seat is not suited for all tested conditions. However, SEAT values for all of the seats tested were extremely low (e.g., 6-DOF SEAT < 30%) indicating that all of the seats were capable of providing good vibration attenuation.

  14. Parallel Implicit Runge-Kutta Methods Applied to Coupled Orbit/Attitude Propagation

    NASA Astrophysics Data System (ADS)

    Hatten, Noble; Russell, Ryan P.

    2017-12-01

    A variable-step Gauss-Legendre implicit Runge-Kutta (GLIRK) propagator is applied to coupled orbit/attitude propagation. Concepts previously shown to improve efficiency in 3DOF propagation are modified and extended to the 6DOF problem, including the use of variable-fidelity dynamics models. The impact of computing the stage dynamics of a single step in parallel is examined using up to 23 threads and 22 associated GLIRK stages; one thread is reserved for an extra dynamics function evaluation used in the estimation of the local truncation error. Efficiency is found to peak for typical examples when using approximately 8 to 12 stages for both serial and parallel implementations. Accuracy and efficiency compare favorably to explicit Runge-Kutta and linear-multistep solvers for representative scenarios. However, linear-multistep methods are found to be more efficient for some applications, particularly in a serial computing environment, or when parallelism can be applied across multiple trajectories.

  15. Towards frameless maskless SRS through real-time 6DoF robotic motion compensation.

    PubMed

    Belcher, Andrew H; Liu, Xinmin; Chmura, Steven; Yenice, Kamil; Wiersma, Rodney D

    2017-11-13

    Stereotactic radiosurgery (SRS) uses precise dose placement to treat conditions of the CNS. Frame-based SRS uses a metal head ring fixed to the patient's skull to provide high treatment accuracy, but patient comfort and clinical workflow may suffer. Frameless SRS, while potentially more convenient, may increase uncertainty of treatment accuracy and be physiologically confining to some patients. By incorporating highly precise robotics and advanced software algorithms into frameless treatments, we present a novel frameless and maskless SRS system where a robot provides real-time 6DoF head motion stabilization allowing positional accuracies to match or exceed those of traditional frame-based SRS. A 6DoF parallel kinematics robot was developed and integrated with a real-time infrared camera in a closed loop configuration. A novel compensation algorithm was developed based on an iterative closest-path correction approach. The robotic SRS system was tested on six volunteers, whose motion was monitored and compensated for in real-time over 15 min simulated treatments. The system's effectiveness in maintaining the target's 6DoF position within preset thresholds was determined by comparing volunteer head motion with and without compensation. Comparing corrected and uncorrected motion, the 6DoF robotic system showed an overall improvement factor of 21 in terms of maintaining target position within 0.5 mm and 0.5 degree thresholds. Although the system's effectiveness varied among the volunteers examined, for all volunteers tested the target position remained within the preset tolerances 99.0% of the time when robotic stabilization was used, compared to 4.7% without robotic stabilization. The pre-clinical robotic SRS compensation system was found to be effective at responding to sub-millimeter and sub-degree cranial motions for all volunteers examined. The system's success with volunteers has demonstrated its capability for implementation with frameless and maskless SRS treatments, potentially able to achieve the same or better treatment accuracies compared to traditional frame-based approaches.

  16. Towards frameless maskless SRS through real-time 6DoF robotic motion compensation

    NASA Astrophysics Data System (ADS)

    Belcher, Andrew H.; Liu, Xinmin; Chmura, Steven; Yenice, Kamil; Wiersma, Rodney D.

    2017-12-01

    Stereotactic radiosurgery (SRS) uses precise dose placement to treat conditions of the CNS. Frame-based SRS uses a metal head ring fixed to the patient’s skull to provide high treatment accuracy, but patient comfort and clinical workflow may suffer. Frameless SRS, while potentially more convenient, may increase uncertainty of treatment accuracy and be physiologically confining to some patients. By incorporating highly precise robotics and advanced software algorithms into frameless treatments, we present a novel frameless and maskless SRS system where a robot provides real-time 6DoF head motion stabilization allowing positional accuracies to match or exceed those of traditional frame-based SRS. A 6DoF parallel kinematics robot was developed and integrated with a real-time infrared camera in a closed loop configuration. A novel compensation algorithm was developed based on an iterative closest-path correction approach. The robotic SRS system was tested on six volunteers, whose motion was monitored and compensated for in real-time over 15 min simulated treatments. The system’s effectiveness in maintaining the target’s 6DoF position within preset thresholds was determined by comparing volunteer head motion with and without compensation. Comparing corrected and uncorrected motion, the 6DoF robotic system showed an overall improvement factor of 21 in terms of maintaining target position within 0.5 mm and 0.5 degree thresholds. Although the system’s effectiveness varied among the volunteers examined, for all volunteers tested the target position remained within the preset tolerances 99.0% of the time when robotic stabilization was used, compared to 4.7% without robotic stabilization. The pre-clinical robotic SRS compensation system was found to be effective at responding to sub-millimeter and sub-degree cranial motions for all volunteers examined. The system’s success with volunteers has demonstrated its capability for implementation with frameless and maskless SRS treatments, potentially able to achieve the same or better treatment accuracies compared to traditional frame-based approaches.

  17. Experimental Observation of the Effects of Translational and Rotational Electrode Misalignment on a Planar Linear Ion Trap Mass Spectrometer

    NASA Astrophysics Data System (ADS)

    Tian, Yuan; Decker, Trevor K.; McClellan, Joshua S.; Wu, Qinghao; De la Cruz, Abraham; Hawkins, Aaron R.; Austin, Daniel E.

    2018-04-01

    The performance of miniaturized ion trap mass analyzers is limited, in part, by the accuracy with which electrodes can be fabricated and positioned relative to each other. Alignment of plates in a two-plate planar LIT is ideal to characterize misalignment effects, as it represents the simplest possible case, having only six degrees of freedom (DOF) (three translational and three rotational). High-precision motorized actuators were used to vary the alignment between the two ion trap plates in five DOFs—x, y, z, pitch, and yaw. A comparison between the experiment and previous simulations shows reasonable agreement. Pitch, or the degree to which the plates are parallel along the axial direction, has the largest and sharpest impact to resolving power, with resolving power dropping noticeably with pitch misalignment of a fraction of a degree. Lateral displacement (x) and yaw (rotation of one plate, but plates remain parallel) both have a strong impact on ion ejection efficiency, but little effect on resolving power. The effects of plate spacing (y-displacement) on both resolving power and ion ejection efficiency are attributable to higher-order terms in the trapping field. Varying the DC (axial) trapping potential can elucidate the effects where more misalignments in more than one DOF affect performance. Implications of these results for miniaturized ion traps are discussed. [Figure not available: see fulltext.

  18. Workspace analysis and design improvement of a carotid flow measurement system.

    PubMed

    Carbone, G; Nakadate, R; Solis, J; Ceccarelli, M; Takanishi, A; Minagawa, E; Sugawara, M; Niki, K

    2010-11-01

    Heart and cerebrovascular diseases such as arteriosclerosis and myocardial ischemia dysfunction are currently among the main causes of death in developed countries. Recently, wave intensity (WI), which is an index used to obtain the force of cardiac contraction, has been investigated as a method for early-stage diagnosis of the above-mentioned diseases. Nevertheless, experimental tests have proven that the manual measurements of WI by means of commercial ultrasonic diagnostic systems require too much time and can be affected by the operator's skills. For this purpose, the introduction of robotic-assisted technology has advantages in terms of repetitiveness and accuracy of the measurement procedure. Therefore, at Waseda University, the development of a carotid blood flow measurement system has been proposed to support doctors while using ultrasound diagnostic equipment to measure the WI. This robotic system is composed of a serial robot with a wrist having a six-degree-of-freedom (6-DOF) parallel mechanism. The main focus is to obtain a suitable workspace performance of the 6-DOF parallel mechanism wrist. In this paper, a workspace analysis is carried out on a wrist prototype built for the Waseda-Tokyo Women's Medical Aloka Blood Flow Measurement System No.1 Refined (WTA-1R). Then, mechanical design enhancements are proposed and validated to provide a suitable workspace performance both as reachable workspace and dexterity, and a refined prototype WTA-1RII has been built.

  19. Super Strypi HWIL 6DOF (Hardware-In-Loop six-degree-of-freedom) Rev. 2175

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gilkey, Jeff C.; Harl, Nathan R.; Kowalchuk, Scott A.

    2016-02-23

    The Super Strypi HWIL is a six degree-of-freedom (6DOF) simulation for the Super Strypi Launch Vehicle. The simulation is used to test the NGC flight software including the navigation software. Aerodynamic and propulsive forces, mass properties, ACS (attitude control system) parameters are defined in input files. Output parameters are saved to a Matlab mat file.

  20. Six Degree-of-Freedom Measurements of Human Mild Traumatic Brain Injury.

    PubMed

    Hernandez, Fidel; Wu, Lyndia C; Yip, Michael C; Laksari, Kaveh; Hoffman, Andrew R; Lopez, Jaime R; Grant, Gerald A; Kleiven, Svein; Camarillo, David B

    2015-08-01

    This preliminary study investigated whether direct measurement of head rotation improves prediction of mild traumatic brain injury (mTBI). Although many studies have implicated rotation as a primary cause of mTBI, regulatory safety standards use 3 degree-of-freedom (3DOF) translation-only kinematic criteria to predict injury. Direct 6DOF measurements of human head rotation (3DOF) and translation (3DOF) have not been previously available to examine whether additional DOFs improve injury prediction. We measured head impacts in American football, boxing, and mixed martial arts using 6DOF instrumented mouthguards, and predicted clinician-diagnosed injury using 12 existing kinematic criteria and 6 existing brain finite element (FE) criteria. Among 513 measured impacts were the first two 6DOF measurements of clinically diagnosed mTBI. For this dataset, 6DOF criteria were the most predictive of injury, more than 3DOF translation-only and 3DOF rotation-only criteria. Peak principal strain in the corpus callosum, a 6DOF FE criteria, was the strongest predictor, followed by two criteria that included rotation measurements, peak rotational acceleration magnitude and Head Impact Power (HIP). These results suggest head rotation measurements may improve injury prediction. However, more 6DOF data is needed to confirm this evaluation of existing injury criteria, and to develop new criteria that considers directional sensitivity to injury.

  1. A parallel computer implementation of fast low-rank QR approximation of the Biot-Savart law

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    White, D A; Fasenfest, B J; Stowell, M L

    2005-11-07

    In this paper we present a low-rank QR method for evaluating the discrete Biot-Savart law on parallel computers. It is assumed that the known current density and the unknown magnetic field are both expressed in a finite element expansion, and we wish to compute the degrees-of-freedom (DOF) in the basis function expansion of the magnetic field. The matrix that maps the current DOF to the field DOF is full, but if the spatial domain is properly partitioned the matrix can be written as a block matrix, with blocks representing distant interactions being low rank and having a compressed QR representation.more » The matrix partitioning is determined by the number of processors, the rank of each block (i.e. the compression) is determined by the specific geometry and is computed dynamically. In this paper we provide the algorithmic details and present computational results for large-scale computations.« less

  2. Design of a biologically inspired lower limb exoskeleton for human gait rehabilitation.

    PubMed

    Lyu, Mingxing; Chen, Weihai; Ding, Xilun; Wang, Jianhua; Bai, Shaoping; Ren, Huichao

    2016-10-01

    This paper proposes a novel bionic model of the human leg according to the theory of physiology. Based on this model, we present a biologically inspired 3-degree of freedom (DOF) lower limb exoskeleton for human gait rehabilitation, showing that the lower limb exoskeleton is fully compatible with the human knee joint. The exoskeleton has a hybrid serial-parallel kinematic structure consisting of a 1-DOF hip joint module and a 2-DOF knee joint module in the sagittal plane. A planar 2-DOF parallel mechanism is introduced in the design to fully accommodate the motion of the human knee joint, which features not only rotation but also relative sliding. Therefore, the design is consistent with the requirements of bionics. The forward and inverse kinematic analysis is studied and the workspace of the exoskeleton is analyzed. The structural parameters are optimized to obtain a larger workspace. The results using MATLAB-ADAMS co-simulation are shown in this paper to demonstrate the feasibility of our design. A prototype of the exoskeleton is also developed and an experiment performed to verify the kinematic analysis. Compared with existing lower limb exoskeletons, the designed mechanism has a large workspace, while allowing knee joint rotation and small amount of sliding.

  3. Design of a biologically inspired lower limb exoskeleton for human gait rehabilitation

    NASA Astrophysics Data System (ADS)

    Lyu, Mingxing; Chen, Weihai; Ding, Xilun; Wang, Jianhua; Bai, Shaoping; Ren, Huichao

    2016-10-01

    This paper proposes a novel bionic model of the human leg according to the theory of physiology. Based on this model, we present a biologically inspired 3-degree of freedom (DOF) lower limb exoskeleton for human gait rehabilitation, showing that the lower limb exoskeleton is fully compatible with the human knee joint. The exoskeleton has a hybrid serial-parallel kinematic structure consisting of a 1-DOF hip joint module and a 2-DOF knee joint module in the sagittal plane. A planar 2-DOF parallel mechanism is introduced in the design to fully accommodate the motion of the human knee joint, which features not only rotation but also relative sliding. Therefore, the design is consistent with the requirements of bionics. The forward and inverse kinematic analysis is studied and the workspace of the exoskeleton is analyzed. The structural parameters are optimized to obtain a larger workspace. The results using MATLAB-ADAMS co-simulation are shown in this paper to demonstrate the feasibility of our design. A prototype of the exoskeleton is also developed and an experiment performed to verify the kinematic analysis. Compared with existing lower limb exoskeletons, the designed mechanism has a large workspace, while allowing knee joint rotation and small amount of sliding.

  4. Design of a 6-DOF upper limb rehabilitation exoskeleton with parallel actuated joints.

    PubMed

    Chen, Yanyan; Li, Ge; Zhu, Yanhe; Zhao, Jie; Cai, Hegao

    2014-01-01

    In this paper, a 6-DOF wearable upper limb exoskeleton with parallel actuated joints which perfectly mimics human motions is proposed. The upper limb exoskeleton assists the movement of physically weak people. Compared with the existing upper limb exoskeletons which are mostly designed using a serial structure with large movement space but small stiffness and poor wearable ability, a prototype for motion assistance based on human anatomy structure has been developed in our design. Moreover, the design adopts balls instead of bearings to save space, which simplifies the structure and reduces the cost of the mechanism. The proposed design also employs deceleration processes to ensure that the transmission ratio of each joint is coincident.

  5. Rapid optimization of tension distribution for cable-driven parallel manipulators with redundant cables

    NASA Astrophysics Data System (ADS)

    Ouyang, Bo; Shang, Weiwei

    2016-03-01

    The solution of tension distributions is infinite for cable-driven parallel manipulators(CDPMs) with redundant cables. A rapid optimization method for determining the optimal tension distribution is presented. The new optimization method is primarily based on the geometry properties of a polyhedron and convex analysis. The computational efficiency of the optimization method is improved by the designed projection algorithm, and a fast algorithm is proposed to determine which two of the lines are intersected at the optimal point. Moreover, a method for avoiding the operating point on the lower tension limit is developed. Simulation experiments are implemented on a six degree-of-freedom(6-DOF) CDPM with eight cables, and the results indicate that the new method is one order of magnitude faster than the standard simplex method. The optimal distribution of tension distribution is thus rapidly established on real-time by the proposed method.

  6. Six-Degree-of-Freedom Trajectory Optimization Utilizing a Two-Timescale Collocation Architecture

    NASA Technical Reports Server (NTRS)

    Desai, Prasun N.; Conway, Bruce A.

    2005-01-01

    Six-degree-of-freedom (6DOF) trajectory optimization of a reentry vehicle is solved using a two-timescale collocation methodology. This class of 6DOF trajectory problems are characterized by two distinct timescales in their governing equations, where a subset of the states have high-frequency dynamics (the rotational equations of motion) while the remaining states (the translational equations of motion) vary comparatively slowly. With conventional collocation methods, the 6DOF problem size becomes extraordinarily large and difficult to solve. Utilizing the two-timescale collocation architecture, the problem size is reduced significantly. The converged solution shows a realistic landing profile and captures the appropriate high-frequency rotational dynamics. A large reduction in the overall problem size (by 55%) is attained with the two-timescale architecture as compared to the conventional single-timescale collocation method. Consequently, optimum 6DOF trajectory problems can now be solved efficiently using collocation, which was not previously possible for a system with two distinct timescales in the governing states.

  7. Conceptual design and kinematic analysis of a novel parallel robot for high-speed pick-and-place operations

    NASA Astrophysics Data System (ADS)

    Meng, Qizhi; Xie, Fugui; Liu, Xin-Jun

    2018-06-01

    This paper deals with the conceptual design, kinematic analysis and workspace identification of a novel four degrees-of-freedom (DOFs) high-speed spatial parallel robot for pick-and-place operations. The proposed spatial parallel robot consists of a base, four arms and a 1½ mobile platform. The mobile platform is a major innovation that avoids output singularity and offers the advantages of both single and double platforms. To investigate the characteristics of the robot's DOFs, a line graph method based on Grassmann line geometry is adopted in mobility analysis. In addition, the inverse kinematics is derived, and the constraint conditions to identify the correct solution are also provided. On the basis of the proposed concept, the workspace of the robot is identified using a set of presupposed parameters by taking input and output transmission index as the performance evaluation criteria.

  8. TH-AB-202-11: Spatial and Rotational Quality Assurance of 6DOF Patient Tracking Systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Belcher, AH; Liu, X; Grelewicz, Z

    2016-06-15

    Purpose: External tracking systems used for patient positioning and motion monitoring during radiotherapy are now capable of detecting both translations and rotations (6DOF). In this work, we develop a novel technique to evaluate the 6DOF performance of external motion tracking systems. We apply this methodology to an infrared (IR) marker tracking system and two 3D optical surface mapping systems in a common tumor 6DOF workspace. Methods: An in-house designed and built 6DOF parallel kinematics robotic motion phantom was used to follow input trajectories with sub-millimeter and sub-degree accuracy. The 6DOF positions of the robotic system were then tracked and recordedmore » independently by three optical camera systems. A calibration methodology which associates the motion phantom and camera coordinate frames was first employed, followed by a comprehensive 6DOF trajectory evaluation, which spanned a full range of positions and orientations in a 20×20×16 mm and 5×5×5 degree workspace. The intended input motions were compared to the calibrated 6DOF measured points. Results: The technique found the accuracy of the IR marker tracking system to have maximal root mean square error (RMSE) values of 0.25 mm translationally and 0.09 degrees rotationally, in any one axis, comparing intended 6DOF positions to positions measured by the IR camera. The 6DOF RSME discrepancy for the first 3D optical surface tracking unit yielded maximal values of 0.60 mm and 0.11 degrees over the same 6DOF volume. An earlier generation 3D optical surface tracker was observed to have worse tracking capabilities than both the IR camera unit and the newer 3D surface tracking system with maximal RMSE of 0.74 mm and 0.28 degrees within the same 6DOF evaluation space. Conclusion: The proposed technique was effective at evaluating the performance of 6DOF patient tracking systems. All systems examined exhibited tracking capabilities at the sub-millimeter and sub-degree level within a 6DOF workspace.« less

  9. Performance of low-rank QR approximation of the finite element Biot-Savart law

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    White, D; Fasenfest, B

    2006-10-16

    In this paper we present a low-rank QR method for evaluating the discrete Biot-Savart law. Our goal is to develop an algorithm that is easily implemented on parallel computers. It is assumed that the known current density and the unknown magnetic field are both expressed in a finite element expansion, and we wish to compute the degrees-of-freedom (DOF) in the basis function expansion of the magnetic field. The matrix that maps the current DOF to the field DOF is full, but if the spatial domain is properly partitioned the matrix can be written as a block matrix, with blocks representingmore » distant interactions being low rank and having a compressed QR representation. While an octree partitioning of the matrix may be ideal, for ease of parallel implementation we employ a partitioning based on number of processors. The rank of each block (i.e. the compression) is determined by the specific geometry and is computed dynamically. In this paper we provide the algorithmic details and present computational results for large-scale computations.« less

  10. Development of an Underactuated 2-DOF Wrist Joint using McKibben PAMs

    NASA Astrophysics Data System (ADS)

    Rajagopal, S. P.; Jain, S.; Ramasubramanian, S. N.; Johnson, B. V.; Dwivedy, S. K.

    2014-10-01

    In this work, model of an underactuated 2-DOF wrist joint with pneumatically actuated muscles is proposed. For the joint, McKibben-type artificial muscles are used in parallel configuration for the actuation. For each Degree of Freedom (DOF) one agonist-antagonist pair arrangement is usually used with a pulley mechanism. A mathematical model of wrist joint is derived using conventional forward kinematic analysis. The static model relating pressure in the muscle with the orientation of the wrist joint is obtained by combining the experimental data and mathematical model. Regulation of pressure can be achieved by pulse width modulation control of on/off solenoid valves. A set of free vibration experiments are done for the dynamic identification of the muscle characteristics.

  11. Telerobotic control of a dextrous manipulator using master and six-DOF hand-controllers for space assembly and servicing tasks

    NASA Technical Reports Server (NTRS)

    O'Hara, John M.

    1987-01-01

    Two studies were conducted evaluating methods of controlling a telerobot; bilateral force reflecting master controllers and proportional rate six degrees of freedom (DOF) hand controllers. The first study compared the controllers on performance of single manipulator arm tasks, a peg-in-the-hole task, and simulated satellite orbital replacement unit changeout. The second study, a Space Station truss assembly task, required simultaneous operation of both manipulator arms (all 12 DOFs) and complex multiaxis slave arm movements. Task times were significantly longer and fewer errors were committed with the hand controllers. The hand controllers were also rated significantly higher in cognitive and manual control workload on the two-arm task. The master controllers were rated significantly higher in physical workload. There were no significant differences in ratings of manipulator control quality.

  12. Assessment of suturing in the vertical plane shows the efficacy of the multi-degree-of-freedom needle driver for neonatal laparoscopy.

    PubMed

    Takazawa, Shinya; Ishimaru, Tetsuya; Fujii, Masahiro; Harada, Kanako; Sugita, Naohiko; Mitsuishi, Mamoru; Iwanaka, Tadashi

    2013-11-01

    We have developed a thin needle driver with multiple degrees-of-freedom (DOFs) for neonatal laparoscopic surgery. The tip of this needle driver has three DOFs for grasp, deflection and rotation. Our aim was to evaluate the performance of the multi-DOF needle driver in vertical plane suturing. Six pediatric surgeons performed four directional suturing tasks in the vertical plane using the multi-DOF needle driver and a conventional one. Assessed parameters were the accuracy of insertion and exit, the depth of suture, the inclination angle of the needle and the force applied on the model. In left and right direction sutures, the inclination angle of the needle with the multi-DOF needle driver was significantly smaller than that with the conventional one (p = 0.014, 0.042, respectively). In left and right direction sutures, the force for pulling the model with the multi-DOF needle driver was smaller than that with the conventional one (p = 0.036, 0.010, respectively). This study showed that multi-directional suturing on a vertical plane using the multi-DOF needle driver had better needle trajectories and was less invasive as compared to a conventional needle driver.

  13. TH-EF-BRB-08: Robotic Motion Compensation for Radiation Therapy: A 6DOF Phantom Study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Belcher, AH; Liu, X; Wiersma, R

    Purpose: The high accuracy of frame-based stereotactic radiosurgery (SRS), which uses a rigid frame fixed to the patient’s skull, is offset by potential drawbacks of poor patient compliance and clinical workflow restrictions. Recent research into frameless SRS has so far resulted in reduced accuracy. In this study, we investigate the use of a novel 6 degree-of-freedom (6DOF) robotic head motion cancellation system that continuously detects and compensates for patient head motions during a SRS delivery. This approach has the potential to reduce invasiveness while still achieving accuracies better or equal to traditional frame-based SRS. Methods: A 6DOF parallel kinematics roboticsmore » stage was constructed, and controlled using an inverse kinematics-based motion compensation algorithm. A 6DOF stereoscopic infrared (IR) marker tracking system was used to monitor real-time motions at sub-millimeter and sub-degree levels. A novel 6DOF calibration technique was first applied to properly orient the camera coordinate frame to match that of the LINAC and robotic control frames. Simulated head motions were measured by the system, and the robotic stage responded to these 6DOF motions automatically, returning the reflective marker coordinate frame to its original position. Results: After the motions were introduced to the system in the phantom-based study, the robotic stage automatically and rapidly returned the phantom to LINAC isocenter. When errors exceeded the compensation lower threshold of 0.25 mm or 0.25 degrees, the system registered the 6DOF error and generated a cancellation trajectory. The system responded in less than 0.5 seconds and returned all axes to less than 0.1 mm and 0.1 degree after the 6DOF compensation was performed. Conclusion: The 6DOF real-time motion cancellation system was found to be effective at compensating for translational and rotational motions to current SRS requirements. This system can improve frameless SRS by automatically returning patients to isocenter with high 6DOF accuracy.« less

  14. Study on Parallel 2-DOF Rotation Machanism in Radar

    NASA Astrophysics Data System (ADS)

    Jiang, Ming; Hu, Xuelong; Liu, Lei; Yu, Yunfei

    The spherical parallel machine has become the world's academic and industrial focus of the field in recent years due to its simple and economical manufacture as well as its structural compactness especially suitable for areas where space gesture changes. This paper dwells upon its present research and development home and abroad. The newer machine (RGRR-II) can rotate around the axis z within 360° and the axis y1 from -90° to +90°. It has the advantages such as less moving parts (only 3 parts), larger ratio of work space to machine size, zero mechanic coupling, no singularity. Constructing rotation machine with spherical parallel 2-DOF rotation join (RGRR-II) may realize semispherical movement with zero dead point and extent the range. Control card (PA8000NT Series CNC) is installed in the computer. The card can run the corresponding software which realizes radar movement control. The machine meets the need of radars in plane and satellite which require larger detection range, lighter weight and compacter structure.

  15. Principle research on a single mass piezoelectric six-degrees-of-freedom accelerometer.

    PubMed

    Liu, Jun; Li, Min; Qin, Lan; Liu, Jingcheng

    2013-08-16

    A signal mass piezoelectric six-degrees-of-freedom (six-DOF) accelerometer is put forward in response to the need for health monitoring of the dynamic vibration characteristics of high grade digitally controlled machine tools. The operating principle of the piezoelectric six-degrees-of-freedom accelerometer is analyzed, and its structure model is constructed. The numerical simulation model (finite element model) of the six axis accelerometer is established. Piezoelectric quartz is chosen for the acceleration sensing element and conversion element, and its static sensitivity, static coupling interference and dynamic natural frequency, dynamic cross coupling are analyzed by ANSYS software. Research results show that the piezoelectric six-DOF accelerometer has advantages of simple and rational structure, correct sensing principle and mathematic model, good linearity, high rigidity, and theoretical natural frequency is more than 25 kHz, no nonlinear cross coupling and no complex decoupling work.

  16. Principle Research on a Single Mass Piezoelectric Six-Degrees-of-Freedom Accelerometer

    PubMed Central

    Liu, Jun; Li, Min; Qin, Lan; Liu, Jingcheng

    2013-01-01

    A signal mass piezoelectric six-degrees-of-freedom (six-DOF) accelerometer is put forward in response to the need for health monitoring of the dynamic vibration characteristics of high grade digitally controlled machine tools. The operating principle of the piezoelectric six-degrees-of-freedom accelerometer is analyzed, and its structure model is constructed. The numerical simulation model (finite element model) of the six axis accelerometer is established. Piezoelectric quartz is chosen for the acceleration sensing element and conversion element, and its static sensitivity, static coupling interference and dynamic natural frequency, dynamic cross coupling are analyzed by ANSYS software. Research results show that the piezoelectric six-DOF accelerometer has advantages of simple and rational structure, correct sensing principle and mathematic model, good linearity, high rigidity, and theoretical natural frequency is more than 25 kHz, no nonlinear cross coupling and no complex decoupling work. PMID:23959243

  17. Model identification and vision-based H∞ position control of 6-DoF cable-driven parallel robots

    NASA Astrophysics Data System (ADS)

    Chellal, R.; Cuvillon, L.; Laroche, E.

    2017-04-01

    This paper presents methodologies for the identification and control of 6-degrees of freedom (6-DoF) cable-driven parallel robots (CDPRs). First a two-step identification methodology is proposed to accurately estimate the kinematic parameters independently and prior to the dynamic parameters of a physics-based model of CDPRs. Second, an original control scheme is developed, including a vision-based position controller tuned with the H∞ methodology and a cable tension distribution algorithm. The position is controlled in the operational space, making use of the end-effector pose measured by a motion-tracking system. A four-block H∞ design scheme with adjusted weighting filters ensures good trajectory tracking and disturbance rejection properties for the CDPR system, which is a nonlinear-coupled MIMO system with constrained states. The tension management algorithm generates control signals that maintain the cables under feasible tensions. The paper makes an extensive review of the available methods and presents an extension of one of them. The presented methodologies are evaluated by simulations and experimentally on a redundant 6-DoF INCA 6D CDPR with eight cables, equipped with a motion-tracking system.

  18. Hand controller commonality evaluation process

    NASA Technical Reports Server (NTRS)

    Stuart, Mark A.; Bierschwale, John M.; Wilmington, Robert P.; Adam, Susan C.; Diaz, Manuel F.; Jensen, Dean G.

    1990-01-01

    A hand controller evaluation process has been developed to determine the appropriate hand controller configurations for supporting remotely controlled devices. These devices include remote manipulator systems (RMS), dexterous robots, and remotely-piloted free flyers. Standard interfaces were developed to evaluate six different hand controllers in three test facilities including dynamic computer simulations, kinematic computer simulations, and physical simulations. The hand controllers under consideration were six degree-of-freedom (DOF) position and rate minimaster and joystick controllers, and three-DOF rate controllers. Task performance data, subjective comments, and anthropometric data obtained during tests were used for controller configuration recommendations to the SSF Program.

  19. Software Tools for Design and Performance Evaluation of Intelligent Systems

    DTIC Science & Technology

    2004-08-01

    Self-calibration of Three-Legged Modular Reconfigurable Parallel Robots Based on Leg-End Distance Errors,” Robotica , Vol. 19, pp. 187-198. [4...9] Lintott, A. B., and Dunlop, G. R., “Parallel Topology Robot Calibration,” Robotica . [10] Vischer, P., and Clavel, R., “Kinematic Calibration...of the Parallel Delta Robot,” Robotica , Vol. 16, pp.207- 218, 1998. [11] Joshi, S.A., and Surianarayan, A., “Calibration of a 6-DOF Cable Robot Using

  20. Vibration isolation using six degree-of-freedom quasi-zero stiffness magnetic levitation

    NASA Astrophysics Data System (ADS)

    Zhu, Tao; Cazzolato, Benjamin; Robertson, William S. P.; Zander, Anthony

    2015-12-01

    In laboratories and high-tech manufacturing applications, passive vibration isolators are often used to isolate vibration sensitive equipment from ground-borne vibrations. However, in traditional passive isolation devices, where the payload weight is supported by elastic structures with finite stiffness, a design trade-off between the load capacity and the vibration isolation performance is unavoidable. Low stiffness springs are often required to achieve vibration isolation, whilst high stiffness is desired for supporting payload weight. In this paper, a novel design of a six degree of freedom (six-dof) vibration isolator is presented, as well as the control algorithms necessary for stabilising the passively unstable maglev system. The system applies magnetic levitation as the payload support mechanism, which realises inherent quasi-zero stiffness levitation in the vertical direction, and zero stiffness in the other five dofs. While providing near zero stiffness in multiple dofs, the design is also able to generate static magnetic forces to support the payload weight. This negates the trade-off between load capacity and vibration isolation that often exists in traditional isolator designs. The paper firstly presents the novel design concept of the isolator and associated theories, followed by the mechanical and control system designs. Experimental results are then presented to demonstrate the vibration isolation performance of the proposed system in all six directions.

  1. Dimensional synthesis of a 3-DOF parallel manipulator with full circle rotation

    NASA Astrophysics Data System (ADS)

    Ni, Yanbing; Wu, Nan; Zhong, Xueyong; Zhang, Biao

    2015-07-01

    Parallel robots are widely used in the academic and industrial fields. In spite of the numerous achievements in the design and dimensional synthesis of the low-mobility parallel robots, few research efforts are directed towards the asymmetric 3-DOF parallel robots whose end-effector can realize 2 translational and 1 rotational(2T1R) motion. In order to develop a manipulator with the capability of full circle rotation to enlarge the workspace, a new 2T1R parallel mechanism is proposed. The modeling approach and kinematic analysis of this proposed mechanism are investigated. Using the method of vector analysis, the inverse kinematic equations are established. This is followed by a vigorous proof that this mechanism attains an annular workspace through its circular rotation and 2 dimensional translations. Taking the first order perturbation of the kinematic equations, the error Jacobian matrix which represents the mapping relationship between the error sources of geometric parameters and the end-effector position errors is derived. With consideration of the constraint conditions of pressure angles and feasible workspace, the dimensional synthesis is conducted with a goal to minimize the global comprehensive performance index. The dimension parameters making the mechanism to have optimal error mapping and kinematic performance are obtained through the optimization algorithm. All these research achievements lay the foundation for the prototype building of such kind of parallel robots.

  2. MIT research in telerobotics

    NASA Technical Reports Server (NTRS)

    Sheridan, T. B.

    1987-01-01

    Ongoing MIT research in telerobotics (vehicles capable of some autonomous sensing and manipulating, having some remote supervisory control by people) and teleoperation (vehicles for sensing and manipulating which are fully controlled remotely by people) is discussed. The current efforts mix human and artificial intelligence/control. The idea of adjustable impedance at either end of pure master-slave teleoperation, and simultaneous coordinated control of teleoperator/telerobotic systems which have more than six degrees of freedom (e.g., a combined vehicle and arm, each with five or six DOF) are discussed. A new cable-controlled parallel link arm which offers many advantages over conventional arms for space is briefly described. Predictor displays to compensate for time delay in teleoperator loops, the use of state estimation to help human control decisions in space, and ongoing research in supervisory command language are covered. Finally, efforts to build a human flyable real-time dynamic computer-graphic telerobot simulator are described. These projects represent most, but not all, of the telerobotics research in our laboratory, supported by JPL, NASA Ames and NOAA.

  3. Cable-driven elastic parallel humanoid head with face tracking for Autism Spectrum Disorder interventions.

    PubMed

    Su, Hao; Dickstein-Fischer, Laurie; Harrington, Kevin; Fu, Qiushi; Lu, Weina; Huang, Haibo; Cole, Gregory; Fischer, Gregory S

    2010-01-01

    This paper presents the development of new prismatic actuation approach and its application in human-safe humanoid head design. To reduce actuator output impedance and mitigate unexpected external shock, the prismatic actuation method uses cables to drive a piston with preloaded spring. By leveraging the advantages of parallel manipulator and cable-driven mechanism, the developed neck has a parallel manipulator embodiment with two cable-driven limbs embedded with preloaded springs and one passive limb. The eye mechanism is adapted for low-cost webcam with succinct "ball-in-socket" structure. Based on human head anatomy and biomimetics, the neck has 3 degree of freedom (DOF) motion: pan, tilt and one decoupled roll while each eye has independent pan and synchronous tilt motion (3 DOF eyes). A Kalman filter based face tracking algorithm is implemented to interact with the human. This neck and eye structure is translatable to other human-safe humanoid robots. The robot's appearance reflects a non-threatening image of a penguin, which can be translated into a possible therapeutic intervention for children with Autism Spectrum Disorders.

  4. Pressure-constrained, reduced-DOF, interconnected parallel manipulators with applications to space suit design

    NASA Astrophysics Data System (ADS)

    Jacobs, Shane Earl

    This dissertation presents the concept of a Morphing Upper Torso, an innovative pressure suit design that incorporates robotic elements to enable a resizable, highly mobile and easy to don/doff spacesuit. The torso is modeled as a system of interconnected, pressure-constrained, reduced-DOF, wire-actuated parallel manipulators, that enable the dimensions of the suit to be reconfigured to match the wearer. The kinematics, dynamics and control of wire-actuated manipulators are derived and simulated, along with the Jacobian transforms, which relate the total twist vector of the system to the vector of actuator velocities. Tools are developed that allow calculation of the workspace for both single and interconnected reduced-DOF robots of this type, using knowledge of the link lengths. The forward kinematics and statics equations are combined and solved to produce the pose of the platforms along with the link tensions. These tools allow analysis of the full Morphing Upper Torso design, in which the back hatch of a rear-entry torso is interconnected with the waist ring, helmet ring and two scye bearings. Half-scale and full-scale experimental models are used along with analytical models to examine the feasibility of this novel space suit concept. The analytical and experimental results demonstrate that the torso could be expanded to facilitate donning and doffng, and then contracted to match different wearer's body dimensions. Using the system of interconnected parallel manipulators, suit components can be accurately repositioned to different desired configurations. The demonstrated feasibility of the Morphing Upper Torso concept makes it an exciting candidate for inclusion in a future planetary suit architecture.

  5. A Generalized Method for Automatic Downhand and Wirefeed Control of a Welding Robot and Positioner

    NASA Technical Reports Server (NTRS)

    Fernandez, Ken; Cook, George E.

    1988-01-01

    A generalized method for controlling a six degree-of-freedom (DOF) robot and a two DOF positioner used for arc welding operations is described. The welding path is defined in the part reference frame, and robot/positioner joint angles of the equivalent eight DOF serial linkage are determined via an iterative solution. Three algorithms are presented: the first solution controls motion of the eight DOF mechanism such that proper torch motion is achieved while minimizing the sum-of-squares of joint displacements; the second algorithm adds two constraint equations to achieve torch control while maintaining part orientation so that welding occurs in the downhand position; and the third algorithm adds the ability to control the proper orientation of a wire feed mechanism used in gas tungsten arc (GTA) welding operations. A verification of these algorithms is given using ROBOSIM, a NASA developed computer graphic simulation software package design for robot systems development.

  6. Spatial and rotational quality assurance of 6DOF patient tracking systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Belcher, Andrew H.; Liu, Xinmin; Grelewicz, Zachary

    Purpose: External tracking systems used for patient positioning and motion monitoring during radiotherapy are now capable of detecting both translations and rotations. In this work, the authors develop a novel technique to evaluate the 6 degree of freedom 6(DOF) (translations and rotations) performance of external motion tracking systems. The authors apply this methodology to an infrared marker tracking system and two 3D optical surface mapping systems in a common tumor 6DOF workspace. Methods: An in-house designed and built 6DOF parallel kinematics robotic motion phantom was used to perform motions with sub-millimeter and subdegree accuracy in a 6DOF workspace. An infraredmore » marker tracking system was first used to validate a calibration algorithm which associates the motion phantom coordinate frame to the camera frame. The 6DOF positions of the mobile robotic system in this space were then tracked and recorded independently by an optical surface tracking system after a cranial phantom was rigidly fixed to the moveable platform of the robotic stage. The calibration methodology was first employed, followed by a comprehensive 6DOF trajectory evaluation, which spanned a full range of positions and orientations in a 20 × 20 × 16 mm and 5° × 5° × 5° workspace. The intended input motions were compared to the calibrated 6DOF measured points. Results: The technique found the accuracy of the infrared (IR) marker tracking system to have maximal root-mean square error (RMSE) values of 0.18, 0.25, 0.07 mm, 0.05°, 0.05°, and 0.09° in left–right (LR), superior–inferior (SI), anterior–posterior (AP), pitch, roll, and yaw, respectively, comparing the intended 6DOF position and the measured position by the IR camera. Similarly, the 6DOF RSME discrepancy for the HD optical surface tracker yielded maximal values of 0.46, 0.60, 0.54 mm, 0.06°, 0.11°, and 0.08° in LR, SI, AP, pitch, roll, and yaw, respectively, over the same 6DOF evaluative workspace. An earlier generation 3D optical surface tracking unit was observed to have worse tracking capabilities than both the IR camera unit and the newer 3D surface tracking system with maximal RMSE of 0.69, 0.74, 0.47 mm, 0.28°, 0.19°, and 0.18°, in LR, SI, AP, pitch, roll, and yaw, respectively, in the same 6DOF evaluation space. Conclusions: The proposed technique was found to be effective at evaluating the performance of 6DOF patient tracking systems. All observed optical tracking systems were found to exhibit tracking capabilities at the sub-millimeter and subdegree level within a 6DOF workspace.« less

  7. Large-area Overhead Manipulator for Access of Fields

    USDA-ARS?s Scientific Manuscript database

    Multi-axis, cable-driven manipulators have evolved over many years providing large area suspended platform access, programmability, relatively rigid and flexibly-positioned platform control and full six degree of freedom (DOF) manipulation of sensors and tools. We describe innovations for a new six...

  8. Direct and Inverse Kinematics of a Novel Tip-Tilt-Piston Parallel Manipulator

    NASA Technical Reports Server (NTRS)

    Tahmasebi, Farhad

    2004-01-01

    Closed-form direct and inverse kinematics of a new three degree-of-freedom (DOF) parallel manipulator with inextensible limbs and base-mounted actuators are presented. The manipulator has higher resolution and precision than the existing three DOF mechanisms with extensible limbs. Since all of the manipulator actuators are base-mounted; higher payload capacity, smaller actuator sizes, and lower power dissipation can be obtained. The manipulator is suitable for alignment applications where only tip, tilt, and piston motions are significant. The direct kinematics of the manipulator is reduced to solving an eighth-degree polynomial in the square of tangent of half-angle between one of the limbs and the base plane. Hence, there are at most 16 assembly configurations for the manipulator. In addition, it is shown that the 16 solutions are eight pairs of reflected configurations with respect to the base plane. Numerical examples for the direct and inverse kinematics of the manipulator are also presented.

  9. Kinematics of a New High Precision Three Degree-of-Freedom Parallel Manipulator

    NASA Technical Reports Server (NTRS)

    Tahmasebi, Farhad

    2005-01-01

    Closed-form direct and inverse kinematics of a new three degree-of-freedom (DOF) parallel manipulator with inextensible limbs and base-mounted actuators are presented. The manipulator has higher resolution and precision than the existing three DOF mechanisms with extensible limbs. Since all of the manipulator actuators are base-mounted; higher payload capacity, smaller actuator sizes, and lower power dissipation can be obtained. The manipulator is suitable for alignment applications where only tip, tilt, and piston motions are significant. The direct kinematics of the manipulator is reduced to solving an eighth-degree polynomial in the square of tangent of half-angle between one of the limbs and the base plane. Hence, there are at most sixteen assembly configurations for the manipulator. In addition, it is shown that the sixteen solutions are eight pairs of reflected configurations with respect to the base plane. Numerical examples for the direct and inverse kinematics of the manipulator are also presented.

  10. Aberration-free superresolution imaging via binary speckle pattern encoding and processing

    NASA Astrophysics Data System (ADS)

    Ben-Eliezer, Eyal; Marom, Emanuel

    2007-04-01

    We present an approach that provides superresolution beyond the classical limit as well as image restoration in the presence of aberrations; in particular, the ability to obtain superresolution while extending the depth of field (DOF) simultaneously is tested experimentally. It is based on an approach, recently proposed, shown to increase the resolution significantly for in-focus images by speckle encoding and decoding. In our approach, an object multiplied by a fine binary speckle pattern may be located anywhere along an extended DOF region. Since the exact magnification is not known in the presence of defocus aberration, the acquired low-resolution image is electronically processed via a parallel-branch decoding scheme, where in each branch the image is multiplied by the same high-resolution synchronized time-varying binary speckle but with different magnification. Finally, a hard-decision algorithm chooses the branch that provides the highest-resolution output image, thus achieving insensitivity to aberrations as well as DOF variations. Simulation as well as experimental results are presented, exhibiting significant resolution improvement factors.

  11. Predicting tibiotalar and subtalar joint angles from skin-marker data with dual-fluoroscopy as a reference standard.

    PubMed

    Nichols, Jennifer A; Roach, Koren E; Fiorentino, Niccolo M; Anderson, Andrew E

    2016-09-01

    Evidence suggests that the tibiotalar and subtalar joints provide near six degree-of-freedom (DOF) motion. Yet, kinematic models frequently assume one DOF at each of these joints. In this study, we quantified the accuracy of kinematic models to predict joint angles at the tibiotalar and subtalar joints from skin-marker data. Models included 1 or 3 DOF at each joint. Ten asymptomatic subjects, screened for deformities, performed 1.0m/s treadmill walking and a balanced, single-leg heel-rise. Tibiotalar and subtalar joint angles calculated by inverse kinematics for the 1 and 3 DOF models were compared to those measured directly in vivo using dual-fluoroscopy. Results demonstrated that, for each activity, the average error in tibiotalar joint angles predicted by the 1 DOF model were significantly smaller than those predicted by the 3 DOF model for inversion/eversion and internal/external rotation. In contrast, neither model consistently demonstrated smaller errors when predicting subtalar joint angles. Additionally, neither model could accurately predict discrete angles for the tibiotalar and subtalar joints on a per-subject basis. Differences between model predictions and dual-fluoroscopy measurements were highly variable across subjects, with joint angle errors in at least one rotation direction surpassing 10° for 9 out of 10 subjects. Our results suggest that both the 1 and 3 DOF models can predict trends in tibiotalar joint angles on a limited basis. However, as currently implemented, neither model can predict discrete tibiotalar or subtalar joint angles for individual subjects. Inclusion of subject-specific attributes may improve the accuracy of these models. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Database Driven 6-DOF Trajectory Simulation for Debris Transport Analysis

    NASA Technical Reports Server (NTRS)

    West, Jeff

    2008-01-01

    Debris mitigation and risk assessment have been carried out by NASA and its contractors supporting Space Shuttle Return-To-Flight (RTF). As a part of this assessment, analysis of transport potential for debris that may be liberated from the vehicle or from pad facilities prior to tower clear (Lift-Off Debris) is being performed by MSFC. This class of debris includes plume driven and wind driven sources for which lift as well as drag are critical for the determination of the debris trajectory. As a result, NASA MSFC has a need for a debris transport or trajectory simulation that supports the computation of lift effect in addition to drag without the computational expense of fully coupled CFD with 6-DOF. A database driven 6-DOF simulation that uses aerodynamic force and moment coefficients for the debris shape that are interpolated from a database has been developed to meet this need. The design, implementation, and verification of the database driven six degree of freedom (6-DOF) simulation addition to the Lift-Off Debris Transport Analysis (LODTA) software are discussed in this paper.

  13. Intelligent Robotic Systems Study (IRSS), phase 4

    NASA Technical Reports Server (NTRS)

    1991-01-01

    Under the Intelligent Robotics Systems Study (IRSS), a generalized robotic control architecture was developed for use with the ProtoFlight Manipulator Arm (PFMA). Based upon the NASREM system design concept, the controller built for the PFMA provides localized position based force control, teleoperation, and advanced path recording and playback capabilities. The PFMA has six computer controllable degrees of freedom (DOF) plus a 7th manually indexable DOF, making the manipulator a pseudo 7 DOF mechanism. Joints on the PFMA are driven via 7 pulse width modulated amplifiers. Digital control of the PFMA is implemented using a variety of single board computers. There were two major activities under the IRSS phase 4 study: (1) enhancement of the PFMA control system software functionality; and (2) evaluation of operating modes via a teleoperation performance study. These activities are described and results are given.

  14. Babybot: a biologically inspired developing robotic agent

    NASA Astrophysics Data System (ADS)

    Metta, Giorgio; Panerai, Francesco M.; Sandini, Giulio

    2000-10-01

    The study of development, either artificial or biological, can highlight the mechanisms underlying learning and adaptive behavior. We shall argue whether developmental studies might provide a different and potentially interesting perspective either on how to build an artificial adaptive agent, or on understanding how the brain solves sensory, motor, and cognitive tasks. It is our opinion that the acquisition of the proper behavior might indeed be facilitated because within an ecological context, the agent, its adaptive structure and the environment dynamically interact thus constraining the otherwise difficult learning problem. In very general terms we shall describe the proposed approach and supporting biological related facts. In order to further analyze these aspects from the modeling point of view, we shall demonstrate how a twelve degrees of freedom baby humanoid robot acquires orienting and reaching behaviors, and what advantages the proposed framework might offer. In particular, the experimental setup consists of five degrees-of-freedom (dof) robot head, and an off-the-shelf six dof robot manipulator, both mounted on a rotating base: i.e. the torso. From the sensory point of view, the robot is equipped with two space-variant cameras, an inertial sensor simulating the vestibular system, and proprioceptive information through motor encoders. The biological parallel is exploited at many implementation levels. It is worth mentioning, for example, the space- variant eyes, exploiting foveal and peripheral vision in a single arrangement, the inertial sensor providing efficient image stabilization (vestibulo-ocular reflex).

  15. 3D-2D registration in mobile radiographs: algorithm development and preliminary clinical evaluation

    NASA Astrophysics Data System (ADS)

    Otake, Yoshito; Wang, Adam S.; Uneri, Ali; Kleinszig, Gerhard; Vogt, Sebastian; Aygun, Nafi; Lo, Sheng-fu L.; Wolinsky, Jean-Paul; Gokaslan, Ziya L.; Siewerdsen, Jeffrey H.

    2015-03-01

    An image-based 3D-2D registration method is presented using radiographs acquired in the uncalibrated, unconstrained geometry of mobile radiography. The approach extends a previous method for six degree-of-freedom (DOF) registration in C-arm fluoroscopy (namely ‘LevelCheck’) to solve the 9-DOF estimate of geometry in which the position of the source and detector are unconstrained. The method was implemented using a gradient correlation similarity metric and stochastic derivative-free optimization on a GPU. Development and evaluation were conducted in three steps. First, simulation studies were performed that involved a CT scan of an anthropomorphic body phantom and 1000 randomly generated digitally reconstructed radiographs in posterior-anterior and lateral views. A median projection distance error (PDE) of 0.007 mm was achieved with 9-DOF registration compared to 0.767 mm for 6-DOF. Second, cadaver studies were conducted using mobile radiographs acquired in three anatomical regions (thorax, abdomen and pelvis) and three levels of source-detector distance (~800, ~1000 and ~1200 mm). The 9-DOF method achieved a median PDE of 0.49 mm (compared to 2.53 mm for the 6-DOF method) and demonstrated robustness in the unconstrained imaging geometry. Finally, a retrospective clinical study was conducted with intraoperative radiographs of the spine exhibiting real anatomical deformation and image content mismatch (e.g. interventional devices in the radiograph that were not in the CT), demonstrating a PDE = 1.1 mm for the 9-DOF approach. Average computation time was 48.5 s, involving 687 701 function evaluations on average, compared to 18.2 s for the 6-DOF method. Despite the greater computational load, the 9-DOF method may offer a valuable tool for target localization (e.g. decision support in level counting) as well as safety and quality assurance checks at the conclusion of a procedure (e.g. overlay of planning data on the radiograph for verification of the surgical product) in a manner consistent with natural surgical workflow.

  16. Surgical bedside master console for neurosurgical robotic system.

    PubMed

    Arata, Jumpei; Kenmotsu, Hajime; Takagi, Motoki; Hori, Tatsuya; Miyagi, Takahiro; Fujimoto, Hideo; Kajita, Yasukazu; Hayashi, Yuichiro; Chinzei, Kiyoyuki; Hashizume, Makoto

    2013-01-01

    We are currently developing a neurosurgical robotic system that facilitates access to residual tumors and improves brain tumor removal surgical outcomes. The system combines conventional and robotic surgery allowing for a quick conversion between the procedures. This concept requires a new master console that can be positioned at the surgical bedside and be sterilized. The master console was developed using new technologies, such as a parallel mechanism and pneumatic sensors. The parallel mechanism is a purely passive 5-DOF (degrees of freedom) joystick based on the author's haptic research. The parallel mechanism enables motion input of conventional brain tumor removal surgery with a compact, intuitive interface that can be used in a conventional surgical environment. In addition, the pneumatic sensors implemented on the mechanism provide an intuitive interface and electrically isolate the tool parts from the mechanism so they can be easily sterilized. The 5-DOF parallel mechanism is compact (17 cm width, 19cm depth, and 15cm height), provides a 505,050 mm and 90° workspace and is highly backdrivable (0.27N of resistance force representing the surgical motion). The evaluation tests revealed that the pneumatic sensors can properly measure the suction strength, grasping force, and hand contact. In addition, an installability test showed that the master console can be used in a conventional surgical environment. The proposed master console design was shown to be feasible for operative neurosurgery based on comprehensive testing. This master console is currently being tested for master-slave control with a surgical robotic system.

  17. In vivo six-degree-of-freedom knee-joint kinematics in overground and treadmill walking following total knee arthroplasty.

    PubMed

    Guan, Shanyuanye; Gray, Hans A; Schache, Anthony G; Feller, Julian; de Steiger, Richard; Pandy, Marcus G

    2017-08-01

    No data are available to describe six-degree-of-freedom (6-DOF) knee-joint kinematics for one complete cycle of overground walking following total knee arthroplasty (TKA). The aims of this study were firstly, to measure 6-DOF knee-joint kinematics and condylar motion for overground walking following TKA; and secondly, to determine whether such data differed between overground and treadmill gait when participants walked at the same speed during both tasks. A unique mobile biplane X-ray imaging system enabled accurate measurement of 6-DOF TKA knee kinematics during overground walking by simultaneously tracking and imaging the joint. The largest rotations occurred for flexion-extension and internal-external rotation whereas the largest translations were associated with joint distraction and anterior-posterior drawer. Strong associations were found between flexion-extension and adduction-abduction (R 2  = 0.92), joint distraction (R 2  = 1.00), and anterior-posterior translation (R 2  = 0.77), providing evidence of kinematic coupling in the TKA knee. Although the measured kinematic profiles for overground walking were grossly similar to those for treadmill walking, several statistically significant differences were observed between the two conditions with respect to temporo-spatial parameters, 6-DOF knee-joint kinematics, and condylar contact locations and sliding. Thus, caution is advised when making recommendations regarding knee implant performance based on treadmill-measured knee-joint kinematic data. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 35:1634-1643, 2017. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  18. An Inertial and Optical Sensor Fusion Approach for Six Degree-of-Freedom Pose Estimation

    PubMed Central

    He, Changyu; Kazanzides, Peter; Sen, Hasan Tutkun; Kim, Sungmin; Liu, Yue

    2015-01-01

    Optical tracking provides relatively high accuracy over a large workspace but requires line-of-sight between the camera and the markers, which may be difficult to maintain in actual applications. In contrast, inertial sensing does not require line-of-sight but is subject to drift, which may cause large cumulative errors, especially during the measurement of position. To handle cases where some or all of the markers are occluded, this paper proposes an inertial and optical sensor fusion approach in which the bias of the inertial sensors is estimated when the optical tracker provides full six degree-of-freedom (6-DOF) pose information. As long as the position of at least one marker can be tracked by the optical system, the 3-DOF position can be combined with the orientation estimated from the inertial measurements to recover the full 6-DOF pose information. When all the markers are occluded, the position tracking relies on the inertial sensors that are bias-corrected by the optical tracking system. Experiments are performed with an augmented reality head-mounted display (ARHMD) that integrates an optical tracking system (OTS) and inertial measurement unit (IMU). Experimental results show that under partial occlusion conditions, the root mean square errors (RMSE) of orientation and position are 0.04° and 0.134 mm, and under total occlusion conditions for 1 s, the orientation and position RMSE are 0.022° and 0.22 mm, respectively. Thus, the proposed sensor fusion approach can provide reliable 6-DOF pose under long-term partial occlusion and short-term total occlusion conditions. PMID:26184191

  19. An Inertial and Optical Sensor Fusion Approach for Six Degree-of-Freedom Pose Estimation.

    PubMed

    He, Changyu; Kazanzides, Peter; Sen, Hasan Tutkun; Kim, Sungmin; Liu, Yue

    2015-07-08

    Optical tracking provides relatively high accuracy over a large workspace but requires line-of-sight between the camera and the markers, which may be difficult to maintain in actual applications. In contrast, inertial sensing does not require line-of-sight but is subject to drift, which may cause large cumulative errors, especially during the measurement of position. To handle cases where some or all of the markers are occluded, this paper proposes an inertial and optical sensor fusion approach in which the bias of the inertial sensors is estimated when the optical tracker provides full six degree-of-freedom (6-DOF) pose information. As long as the position of at least one marker can be tracked by the optical system, the 3-DOF position can be combined with the orientation estimated from the inertial measurements to recover the full 6-DOF pose information. When all the markers are occluded, the position tracking relies on the inertial sensors that are bias-corrected by the optical tracking system. Experiments are performed with an augmented reality head-mounted display (ARHMD) that integrates an optical tracking system (OTS) and inertial measurement unit (IMU). Experimental results show that under partial occlusion conditions, the root mean square errors (RMSE) of orientation and position are 0.04° and 0.134 mm, and under total occlusion conditions for 1 s, the orientation and position RMSE are 0.022° and 0.22 mm, respectively. Thus, the proposed sensor fusion approach can provide reliable 6-DOF pose under long-term partial occlusion and short-term total occlusion conditions.

  20. Surgical scissors extension adds the 7th axis of force feedback to the Freedom 6S.

    PubMed

    Powers, Marilyn J; Sinclair, Ian P W; Brouwer, Iman; Laroche, Denis

    2007-01-01

    A virtual reality surgical simulator ideally allows seamless transition between the real and virtual world. In that respect, all of a surgeon's motions and tools must be simulated. Until now researchers have been limited to using a pen-like tool in six degrees-of-freedom. This paper presents the addition of haptically enabled scissors to the end effector of a 6-DOF haptic device, the Freedom 6S. The scissors are capable of pinching a maximum torque of 460 mN.m with low inertia and low back-drive friction. The device is a balanced design so that the user feels like they are holding no more than actual scissors, although with some added inertia on the load end. The system is interchangeable between the 6-DOF and 7-DOF configurations to allow switching tools quickly.

  1. A 6DOF passive vibration isolator using X-shape supporting structures

    NASA Astrophysics Data System (ADS)

    Wu, Zhijing; Jing, Xingjian; Sun, Bo; Li, Fengming

    2016-10-01

    A novel 6 degree of freedom (6-DOF) passive vibration isolator is studied theoretically and validated with experiments. Based on the Stewart platform configuration, the 6-DOF isolator is constructed by 6 X-shape structures as legs, which can realize very good and tunable vibration isolation performance in all 6 directions with a passive manner. The mechanic model is established for static analysis of the working range, static stiffness and loading capacity. Thereafter, the equation of motion of the isolator is derived with the Hamilton principle. The equivalent stiffness and the displacement transmissibility in the six decoupled DOFs direction are then discussed with experimental results for validation. The results reveal that (a) by designing the structure parameters, the system can possess flexible stiffness such as negative, quasi-zero and positive stiffness, (b) due to the combination of the Stewart platform and the X-shape structure, the system can have very good vibration isolation performance in all the 6 directions and in a passive manner, and (c) compared with the simplified linear-stiffness legs, the nonlinearity of the X-shape structures enhance the passive isolator to have much better vibration isolation performance.

  2. A Flexure-Based Mechanism for Precision Adjustment of National Ignition Facility Target Shrouds in Three Rotational Degrees of Freedom

    DOE PAGES

    Boehm, K. -J.; Gibson, C. R.; Hollaway, J. R.; ...

    2016-09-01

    This study presents the design of a flexure-based mount allowing adjustment in three rotational degrees of freedom (DOFs) through high-precision set-screw actuators. The requirements of the application called for small but controlled angular adjustments for mounting a cantilevered beam. The proposed design is based on an array of parallel beams to provide sufficiently high stiffness in the translational directions while allowing angular adjustment through the actuators. A simplified physical model in combination with standard beam theory was applied to estimate the deflection profile and maximum stresses in the beams. A finite element model was built to calculate the stresses andmore » beam profiles for scenarios in which the flexure is simultaneously actuated in more than one DOF.« less

  3. Output Error Analysis of Planar 2-DOF Five-bar Mechanism

    NASA Astrophysics Data System (ADS)

    Niu, Kejia; Wang, Jun; Ting, Kwun-Lon; Tao, Fen; Cheng, Qunchao; Wang, Quan; Zhang, Kaiyang

    2018-03-01

    Aiming at the mechanism error caused by clearance of planar 2-DOF Five-bar motion pair, the method of equivalent joint clearance of kinematic pair to virtual link is applied. The structural error model of revolute joint clearance is established based on the N-bar rotation laws and the concept of joint rotation space, The influence of the clearance of the moving pair is studied on the output error of the mechanis. and the calculation method and basis of the maximum error are given. The error rotation space of the mechanism under the influence of joint clearance is obtained. The results show that this method can accurately calculate the joint space error rotation space, which provides a new way to analyze the planar parallel mechanism error caused by joint space.

  4. Contact dynamics math model

    NASA Technical Reports Server (NTRS)

    Glaese, John R.; Tobbe, Patrick A.

    1986-01-01

    The Space Station Mechanism Test Bed consists of a hydraulically driven, computer controlled six degree of freedom (DOF) motion system with which docking, berthing, and other mechanisms can be evaluated. Measured contact forces and moments are provided to the simulation host computer to enable representation of orbital contact dynamics. This report describes the development of a generalized math model which represents the relative motion between two rigid orbiting vehicles. The model allows motion in six DOF for each body, with no vehicle size limitation. The rotational and translational equations of motion are derived. The method used to transform the forces and moments from the sensor location to the vehicles' centers of mass is also explained. Two math models of docking mechanisms, a simple translational spring and the Remote Manipulator System end effector, are presented along with simulation results. The translational spring model is used in an attempt to verify the simulation with compensated hardware in the loop results.

  5. Exact analytical approach for six-degree-of-freedom measurement using image-orientation-change method.

    PubMed

    Tsai, Chung-Yu

    2012-04-01

    An exact analytical approach is proposed for measuring the six-degree-of-freedom (6-DOF) motion of an object using the image-orientation-change (IOC) method. The proposed measurement system comprises two reflector systems, where each system consists of two reflectors and one position sensing detector (PSD). The IOCs of the object in the two reflector systems are described using merit functions determined from the respective PSD readings before and after motion occurs, respectively. The three rotation variables are then determined analytically from the eigenvectors of the corresponding merit functions. After determining the three rotation variables, the order of the translation equations is downgraded to a linear form. Consequently, the solution for the three translation variables can also be analytically determined. As a result, the motion transformation matrix describing the 6-DOF motion of the object is fully determined. The validity of the proposed approach is demonstrated by means of an illustrative example.

  6. Six degree of freedom fine motion positioning stage based on magnetic levitation

    NASA Technical Reports Server (NTRS)

    Arling, R. W.; Kohler, S. M.

    1994-01-01

    The design of a magnetically suspended six degree of freedom positioning system capable of nanometer positioning is presented. The sample holder is controlled in six degrees of freedom (DOF) over 300 micrometers of travel in the X, Y, and Z directions. A design and control summary and test results indicating stability and power dissipation are included in the paper. The system is vacuum compatible, uses commercially available materials, and requires minimal assembly and setup.

  7. Feasibility and concept study to convert the NASA/AMES vertical motion simulator to a helicopter simulator

    NASA Technical Reports Server (NTRS)

    Belsterling, C. A.; Chou, R. C.; Davies, E. G.; Tsui, K. C.

    1978-01-01

    The conceptual design for converting the vertical motion simulator (VMS) to a multi-purpose aircraft and helicopter simulator is presented. A unique, high performance four degrees of freedom (DOF) motion system was developed to permanently replace the present six DOF synergistic system. The new four DOF system has the following outstanding features: (1) will integrate with the two large VMS translational modes and their associated subsystems; (2) can be converted from helicopter to fixed-wing aircraft simulation through software changes only; (3) interfaces with an advanced cab/visual display system of large dimensions; (4) makes maximum use of proven techniques, convenient materials and off-the-shelf components; (5) will operate within the existing building envelope without modifications; (6) can be built within the specified weight limit and avoid compromising VMS performance; (7) provides maximum performance with a minimum of power consumption; (8) simple design minimizes coupling between motions and maximizes reliability; and (9) can be built within existing budgetary figures.

  8. Kinematic Analysis of a Six-Degrees-of-Freedom Model Based on ISB Recommendation: A Repeatability Analysis and Comparison with Conventional Gait Model.

    PubMed

    Żuk, Magdalena; Pezowicz, Celina

    2015-01-01

    Objective. The purpose of the present work was to assess the validity of a six-degrees-of-freedom gait analysis model based on the ISB recommendation on definitions of joint coordinate systems (ISB 6DOF) through a quantitative comparison with the Helen Hays model (HH) and repeatability assessment. Methods. Four healthy subjects were analysed with both marker sets: an HH marker set and four marker clusters in ISB 6DOF. A navigated pointer was used to indicate the anatomical landmark position in the cluster reference system according to the ISB recommendation. Three gait cycles were selected from the data collected simultaneously for the two marker sets. Results. Two protocols showed good intertrial repeatability, which apart from pelvic rotation did not exceed 2°. The greatest differences between protocols were observed in the transverse plane as well as for knee angles. Knee internal/external rotation revealed the lowest subject-to-subject and interprotocol repeatability and inconsistent patterns for both protocols. Knee range of movement in transverse plane was overestimated for the HH set (the mean is 34°), which could indicate the cross-talk effect. Conclusions. The ISB 6DOF anatomically based protocol enabled full 3D kinematic description of joints according to the current standard with clinically acceptable intertrial repeatability and minimal equipment requirements.

  9. Computational Fluid Dynamics Demonstration of Rigid Bodies in Motion

    NASA Technical Reports Server (NTRS)

    Camarena, Ernesto; Vu, Bruce T.

    2011-01-01

    The Design Analysis Branch (NE-Ml) at the Kennedy Space Center has not had the ability to accurately couple Rigid Body Dynamics (RBD) and Computational Fluid Dynamics (CFD). OVERFLOW-D is a flow solver that has been developed by NASA to have the capability to analyze and simulate dynamic motions with up to six Degrees of Freedom (6-DOF). Two simulations were prepared over the course of the internship to demonstrate 6DOF motion of rigid bodies under aerodynamic loading. The geometries in the simulations were based on a conceptual Space Launch System (SLS). The first simulation that was prepared and computed was the motion of a Solid Rocket Booster (SRB) as it separates from its core stage. To reduce computational time during the development of the simulation, only half of the physical domain with respect to the symmetry plane was simulated. Then a full solution was prepared and computed. The second simulation was a model of the SLS as it departs from a launch pad under a 20 knot crosswind. This simulation was reduced to Two Dimensions (2D) to reduce both preparation and computation time. By allowing 2-DOF for translations and 1-DOF for rotation, the simulation predicted unrealistic rotation. The simulation was then constrained to only allow translations.

  10. A PC-Based Controller for Dextrous Arms

    NASA Technical Reports Server (NTRS)

    Fiorini, Paolo; Seraji, Homayoun; Long, Mark

    1996-01-01

    This paper describes the architecture and performance of a PC-based controller for 7-DOF dextrous manipulators. The computing platform is a 486-based personal computer equipped with a bus extender to access the robot Multibus controller, together with a single board computer as the graphical engine, and with a parallel I/O board to interface with a force-torque sensor mounted on the manipulator wrist.

  11. Experiments in advanced control concepts for space robotics - An overview of the Stanford Aerospace Robotics Laboratory

    NASA Technical Reports Server (NTRS)

    Hollars, M. G.; Cannon, R. H., Jr.; Alexander, H. L.; Morse, D. F.

    1987-01-01

    The Stanford University Aerospace Robotics Laboratory is actively developing and experimentally testing advanced robot control strategies for space robotic applications. Early experiments focused on control of very lightweight one-link manipulators and other flexible structures. The results are being extended to position and force control of mini-manipulators attached to flexible manipulators and multilink manipulators with flexible drive trains. Experimental results show that end-point sensing and careful dynamic modeling or adaptive control are key to the success of these control strategies. Free-flying space robot simulators that operate on an air cushion table have been built to test control strategies in which the dynamics of the base of the robot and the payload are important.

  12. Development of a Pneumatic Robot for MRI-guided Transperineal Prostate Biopsy and Brachytherapy: New Approaches

    PubMed Central

    Song, Sang-Eun; Cho, Nathan B.; Fischer, Gregory; Hata, Nobuhito; Tempany, Clare; Fichtinger, Gabor; Iordachita, Iulian

    2011-01-01

    Magnetic Resonance Imaging (MRI) guided prostate biopsy and brachytherapy has been introduced in order to enhance the cancer detection and treatment. For the accurate needle positioning, a number of robotic assistants have been developed. However, problems exist due to the strong magnetic field and limited workspace. Pneumatically actuated robots have shown the minimum distraction in the environment but the confined workspace limits optimal robot design and thus controllability is often poor. To overcome the problem, a simple external damping mechanism using timing belts was sought and a 1-DOF mechanism test result indicated sufficient positioning accuracy. Based on the damping mechanism and modular system design approach, a new workspace-optimized 4-DOF parallel robot was developed for the MRI-guided prostate biopsy and brachytherapy. A preliminary evaluation of the robot was conducted using previously developed pneumatic controller and satisfying results were obtained. PMID:21399734

  13. Personnel occupied woven envelope robot

    NASA Technical Reports Server (NTRS)

    Wessling, Francis; Teoh, William; Ziemke, M. Carl

    1988-01-01

    The Personnel Occupied Woven Envelope Robot (POWER) provides an alternative to extravehicular activity (EVA) of space suited astronauts and/or use of long slender manipulator arms such as are used in the Shuttle Remote Manipulator System. POWER provides the capability for a shirt sleeved astronaut to perform such work by entering a control pod through air locks at both ends of an inflated flexible bellows (access tunnel). The exoskeleton of the tunnel is a series of six degrees of freedom (Six-DOF) articulated links compressible to 1/6 of their fully extended length. The operator can maneuver the control pod to almost any location within about 50 m of the base attachment to the space station. POWER can be envisioned as a series of hollow Six-DOF manipulator segments or arms wherein each arm grasps the shoulder of the next arm. Inside the hollow arms ia a bellow-type access tunnel. The control pod is the fist of the series of linked hollow arms. The fingers of the fist are conventional manipulator arms under direct visual control of the nearby operator in the pod. The applications and progress to date of the POWER system is given.

  14. Joint-space adaptive control of a 6 DOF end-effector with closed-kinematic chain mechanism

    NASA Technical Reports Server (NTRS)

    Nguyen, Charles C.; Zhou, Zhen-Lei

    1989-01-01

    The development is presented for a joint-space adaptive scheme that controls the joint position of a six-degree-of-freedom (DOF) robot end-effector performing fine and precise motion within a very limited workspace. The end-effector was built to study autonomous assembly of NASA hardware in space. The design of the adaptive controller is based on the concept of model reference adaptive control (MRAC) and Lyapunov direct method. In the development, it is assumed that the end-effector performs slowly varying motion. Computer simulation is performed to investigate the performance of the developed control scheme on position control of the end-effector. Simulation results manifest that the adaptive control scheme provides excellent tracking of several test paths.

  15. Measurement system and model for simultaneously measuring 6DOF geometric errors.

    PubMed

    Zhao, Yuqiong; Zhang, Bin; Feng, Qibo

    2017-09-04

    A measurement system to simultaneously measure six degree-of-freedom (6DOF) geometric errors is proposed. The measurement method is based on a combination of mono-frequency laser interferometry and laser fiber collimation. A simpler and more integrated optical configuration is designed. To compensate for the measurement errors introduced by error crosstalk, element fabrication error, laser beam drift, and nonparallelism of two measurement beam, a unified measurement model, which can improve the measurement accuracy, is deduced and established using the ray-tracing method. A numerical simulation using the optical design software Zemax is conducted, and the results verify the correctness of the model. Several experiments are performed to demonstrate the feasibility and effectiveness of the proposed system and measurement model.

  16. Modeling of Nonlinear Dynamics of a Powered Paraglider

    NASA Astrophysics Data System (ADS)

    Watanabe, Masahito; Ochi, Yoshimasa

    This paper presents a nonlinear dynamic model of a powered paraglider (PPG). The PPG is composed of a canopy and a payload with a propelling unit. The canopy is connected with the payload at two points. The model has been derived as a state vector equation under the assumption that the canopy has six degrees of freedom (DOF) and the payload has two DOF of pitching and yawing motions relative to the canopy. Friction at the connecting points between the canopy and the payload is taken into account. Time responses of the PPG without thrust have been computed using the model and the results are compared with flight experiment data. Simulation of a level flight with thrust has also been conducted.

  17. Six degree of freedom simulation system for evaluating automated rendezvous and docking spacecraft

    NASA Technical Reports Server (NTRS)

    Rourke, Kenneth H.; Tsugawa, Roy K.

    1991-01-01

    Future logistics supply and servicing vehicles such as cargo transfer vehicles (CTV) must have full 6 degree of freedom (6DOF) capability in order to perform requisite rendezvous, proximity operations, and capture operations. The design and performance issues encountered when developing a 6DOF maneuvering spacecraft are very complex with subtle interactions which are not immediately obvious or easily anticipated. In order to deal with these complexities and develop robust maneuvering spacecraft designs, a simulation system and associated family of tools are used at TRW for generating and validating spacecraft performance requirements and guidance algorithms. An overview of the simulator and tools is provided. These are used by TRW for autonomous rendezvous and docking research projects including CTV studies.

  18. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    PubMed

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  19. Compliance analysis of a 3-DOF spindle head by considering gravitational effects

    NASA Astrophysics Data System (ADS)

    Li, Qi; Wang, Manxin; Huang, Tian; Chetwynd, Derek G.

    2015-01-01

    The compliance modeling is one of the most significant issues in the stage of preliminary design for parallel kinematic machine(PKM). The gravity ignored in traditional compliance analysis has a significant effect on pose accuracy of tool center point(TCP) when a PKM is horizontally placed. By taking gravity into account, this paper presents a semi-analytical approach for compliance analysis of a 3-DOF spindle head named the A3 head. The architecture behind the A3 head is a 3-R PS parallel mechanism having one translational and two rotational movement capabilities, which can be employed to form the main body of a 5-DOF hybrid kinematic machine especially designed for high-speed machining of large aircraft components. The force analysis is carried out by considering both the externally applied wrench imposed upon the platform as well as gravity of all moving components. Then, the deflection analysis is investigated to establish the relationship between the deflection twist and compliances of all joints and links using semi-analytical method. The merits of this approach lie in that platform deflection twist throughout the entire task workspace can be evaluated in a very efficient manner. The effectiveness of the proposed approach is verified by the FEA and experiment at different configurations and the results show that the discrepancy of the compliances is less than 0.04 μm/N-1 and that of the deformations is less than 10μm. The computational and experimental results show that the deflection twist induced by gravity forces of the moving components has significant bearings on pose accuracy of the platform, providing an informative guidance for the improvement of the current design. The proposed approach can be easily applied to the compliance analysis of PKM by considering gravitational effects and to evaluate the deformation caused by gravity throughout the entire workspace.

  20. ZmDof3, a maize endosperm-specific Dof protein gene, regulates starch accumulation and aleurone development in maize endosperm.

    PubMed

    Qi, Xin; Li, Shixue; Zhu, Yaxi; Zhao, Qian; Zhu, Dengyun; Yu, Jingjuan

    2017-01-01

    To explore the function of Dof transcription factors during kernel development in maize, we first identified Dof genes in the maize genome. We found that ZmDof3 was exclusively expressed in the endosperm of maize kernel and had the features of a Dof transcription factor. Suppression of ZmDof3 resulted in a defective kernel phenotype with reduced starch content and a partially patchy aleurone layer. The expression levels of starch synthesis-related genes and aleurone differentiation-associated genes were down-regulated in ZmDof3 knockdown kernels, indicating that ZmDof3 plays an important role in maize endosperm development. The maize endosperm, occupying a large proportion of the kernel, plays an important role in seed development and germination. Current knowledge regarding the regulation of endosperm development is limited. Dof proteins, a family of plant-specific transcription factors, play critical roles in diverse biological processes. In this study, an endosperm-specific Dof protein gene, ZmDof3, was identified in maize through genome-wide screening. Suppression of ZmDof3 resulted in a defective kernel phenotype. The endosperm of ZmDof3 knockdown kernels was loosely packed with irregular starch granules observed by electronic microscope. Through genome-wide expression profiling, we found that down-regulated genes were enriched in GO terms related to carbohydrate metabolism. Moreover, ZmDof3 could bind to the Dof core element in the promoter of starch biosynthesis genes Du1 and Su2 in vitro and in vivo. In addition, the aleurone at local position in mature ZmDof3 knockdown kernels varied from one to three layers, which consisted of smaller and irregular cells. Further analyses showed that knockdown of ZmDof3 reduced the expression of Nkd1, which is involved in aleurone cell differentiation, and that ZmDof3 could bind to the Dof core element in the Nkd1 promoter. Our study reveals that ZmDof3 functions in maize endosperm development as a positive regulator in the signaling system controlling starch accumulation and aleurone development.

  1. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    PubMed Central

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

  2. Fluctuation of Dof1/Dof2 expression ratio under the influence of varying nitrogen and light conditions: involvement in differential regulation of nitrogen metabolism in two genotypes of finger millet (Eleusine coracana L.).

    PubMed

    Gupta, Supriya; Gupta, Sanjay Mohan; Gupta, Alok Kumar; Gaur, Vikram Singh; Kumar, Anil

    2014-08-10

    In order to gain insights into the mechanism of high nitrogen use efficiency (NUE) of finger millet (FM) the role of Dof2 transcription factor (TF), which is a repressor of genes involved in C/N metabolism was investigated. The partial cDNA fragment of EcDof2 (912-bp; GenBank acc. no. KF261117) was isolated and characterized from finger millet (FM) that showed 63% and 58% homology with Dof2 of Zea mays at nucleotide and protein level, respectively. Its expression studies were carried out along with the activator EcDof1 in two genotypes (GE3885, high protein genotype (HPG); GE1437, low protein genotype (LPG)) of FM differing in grain protein contents (13.8% and 6.2%) showed that EcDof2 is expressed in both shoot and root tissues with significantly (p≤0.05) higher expression in the roots. The diurnal expression of both EcDof1 and EcDof2 in shoots was differential having different time of peak expression indicating a differential response to diurnal condition. Under continuous dark conditions, expression of EcDof1 and EcDof2 oscillated in both the genotypes whereas on illumination, the fold expression of EcDof1 was higher as compared to EcDof2. Under increasing nitrate concentration, EcDof2 expression increases in roots and shoots of LPG while it remains unchanged in HPG. However, the EcDof1 expression was found to increase in both genotypes. Further, time kinetics studies under single nitrate concentration revealed that EcDof2 was repressed in the roots of both genotypes whereas EcDof1 oscillated with time. The EcDof1/EcDof2 ratio measured showed differential response under different light and nitrogen conditions. It was higher in the roots of HPG indicating higher activation of genes involved in N uptake and assimilation resulting in high grain protein accumulation. The results indicate that both light and nitrogen concentration influence Dof1 and Dof2 expression and suggests a complex pattern of regulation of genes influenced by these plant specific TFs. In nutshell, the Dof1/Dof2 ratio can serve as an index for measuring the N responsiveness and NUE of crops and can be further validated by Dof2 knock down approach. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Design and development of miniature parallel robot for eye surgery.

    PubMed

    Sakai, Tomoya; Harada, Kanako; Tanaka, Shinichi; Ueta, Takashi; Noda, Yasuo; Sugita, Naohiko; Mitsuishi, Mamoru

    2014-01-01

    A five degree-of-freedom (DOF) miniature parallel robot has been developed to precisely and safely remove the thin internal limiting membrane in the eye ground during vitreoretinal surgery. A simulator has been developed to determine the design parameters of this robot. The developed robot's size is 85 mm × 100 mm × 240 mm, and its weight is 770 g. This robot incorporates an emergency instrument retraction function to quickly remove the instrument from the eye in case of sudden intraoperative complications such as bleeding. Experiments were conducted to evaluate the robot's performance in the master-slave configuration, and the results demonstrated that it had a tracing accuracy of 40.0 μm.

  4. High-capacity quantum secure direct communication with two-photon six-qubit hyperentangled states

    NASA Astrophysics Data System (ADS)

    Wu, FangZhou; Yang, GuoJian; Wang, HaiBo; Xiong, Jun; Alzahrani, Faris; Hobiny, Aatef; Deng, FuGuo

    2017-12-01

    This study proposes the first high-capacity quantum secure direct communication (QSDC) with two-photon six-qubit hyper-entangled Bell states in two longitudinal momentum and polarization degrees of freedom (DOFs) of photon pairs, which can be generated using two 0.5 mm-thick type-I β barium borate crystal slabs aligned one behind the other and an eight-hole screen. The secret message can be independently encoded on the photon pairs with 64 unitary operations in all three DOFs. This protocol has a higher capacity than previous QSDC protocols because each photon pair can carry 6 bits of information, not just 2 or 4 bits. Our QSDC protocol decreases the influence of decoherence from environment noise by exploiting the decoy photons to check the security of the transmission of the first photon sequence. Compared with two-way QSDC protocols, our QSDC protocol is immune to an attack by an eavesdropper using Trojan horse attack strategies because it is a one-way quantum communication. The QSDC protocol has good applications in the future quantum communication because of all these features.

  5. A Generic Inner-Loop Control Law Structure for Six-Degree-of-Freedom Conceptual Aircraft Design

    NASA Technical Reports Server (NTRS)

    Cox, Timothy H.; Cotting, Christopher

    2005-01-01

    A generic control system framework for both real-time and batch six-degree-of-freedom (6-DOF) simulations is presented. This framework uses a simplified dynamic inversion technique to allow for stabilization and control of any type of aircraft at the pilot interface level. The simulation, designed primarily for the real-time simulation environment, also can be run in a batch mode through a simple guidance interface. Direct vehicle-state acceleration feedback is required with the simplified dynamic inversion technique. The estimation of surface effectiveness within real-time simulation timing constraints also is required. The generic framework provides easily modifiable control variables, allowing flexibility in the variables that the pilot commands. A direct control allocation scheme is used to command aircraft effectors. Primary uses for this system include conceptual and preliminary design of aircraft, when vehicle models are rapidly changing and knowledge of vehicle 6-DOF performance is required. A simulated airbreathing hypersonic vehicle and simulated high-performance fighter aircraft are used to demonstrate the flexibility and utility of the control system.

  6. Towards Optimal Platform-Based Robot Design for Ankle Rehabilitation: The State of the Art and Future Prospects

    PubMed Central

    Li, Hongsheng

    2018-01-01

    This review aims to compare existing robot-assisted ankle rehabilitation techniques in terms of robot design. Included studies mainly consist of selected papers in two published reviews involving a variety of robot-assisted ankle rehabilitation techniques. A free search was also made in Google Scholar and Scopus by using keywords “ankle∗,” and “robot∗,” and (“rehabilitat∗” or “treat∗”). The search is limited to English-language articles published between January 1980 and September 2016. Results show that existing robot-assisted ankle rehabilitation techniques can be classified into wearable exoskeleton and platform-based devices. Platform-based devices are mostly developed for the treatment of a variety of ankle musculoskeletal and neurological injuries, while wearable ones focus more on ankle-related gait training. In terms of robot design, comparative analysis indicates that an ideal ankle rehabilitation robot should have aligned rotation center as the ankle joint, appropriate workspace, and actuation torque, no matter how many degrees of freedom (DOFs) it has. Single-DOF ankle robots are mostly developed for specific applications, while multi-DOF devices are more suitable for comprehensive ankle rehabilitation exercises. Other factors including posture adjustability and sensing functions should also be considered to promote related clinical applications. An ankle rehabilitation robot with reconfigurability to maximize its functions will be a new research point towards optimal design, especially on parallel mechanisms. PMID:29736230

  7. Towards Optimal Platform-Based Robot Design for Ankle Rehabilitation: The State of the Art and Future Prospects.

    PubMed

    Miao, Qing; Zhang, Mingming; Wang, Congzhe; Li, Hongsheng

    2018-01-01

    This review aims to compare existing robot-assisted ankle rehabilitation techniques in terms of robot design. Included studies mainly consist of selected papers in two published reviews involving a variety of robot-assisted ankle rehabilitation techniques. A free search was also made in Google Scholar and Scopus by using keywords "ankle ∗ ," and "robot ∗ ," and ("rehabilitat ∗ " or "treat ∗ "). The search is limited to English-language articles published between January 1980 and September 2016. Results show that existing robot-assisted ankle rehabilitation techniques can be classified into wearable exoskeleton and platform-based devices. Platform-based devices are mostly developed for the treatment of a variety of ankle musculoskeletal and neurological injuries, while wearable ones focus more on ankle-related gait training. In terms of robot design, comparative analysis indicates that an ideal ankle rehabilitation robot should have aligned rotation center as the ankle joint, appropriate workspace, and actuation torque, no matter how many degrees of freedom (DOFs) it has. Single-DOF ankle robots are mostly developed for specific applications, while multi-DOF devices are more suitable for comprehensive ankle rehabilitation exercises. Other factors including posture adjustability and sensing functions should also be considered to promote related clinical applications. An ankle rehabilitation robot with reconfigurability to maximize its functions will be a new research point towards optimal design, especially on parallel mechanisms.

  8. Mars Microprobe Entry Analysis

    NASA Technical Reports Server (NTRS)

    Braun, Robert D.; Mitcheltree, Robert A.; Cheatwood, F. McNeil

    1998-01-01

    The Mars Microprobe mission will provide the first opportunity for subsurface measurements, including water detection, near the south pole of Mars. In this paper, performance of the Microprobe aeroshell design is evaluated through development of a six-degree-of-freedom (6-DOF) aerodynamic database and flight dynamics simulation. Numerous mission uncertainties are quantified and a Monte-Carlo analysis is performed to statistically assess mission performance. Results from this 6-DOF Monte-Carlo simulation demonstrate that, in a majority of the cases (approximately 2-sigma), the penetrator impact conditions are within current design tolerances. Several trajectories are identified in which the current set of impact requirements are not satisfied. From these cases, critical design parameters are highlighted and additional system requirements are suggested. In particular, a relatively large angle-of-attack range near peak heating is identified.

  9. Large-scale 3D geoelectromagnetic modeling using parallel adaptive high-order finite element method

    DOE PAGES

    Grayver, Alexander V.; Kolev, Tzanio V.

    2015-11-01

    Here, we have investigated the use of the adaptive high-order finite-element method (FEM) for geoelectromagnetic modeling. Because high-order FEM is challenging from the numerical and computational points of view, most published finite-element studies in geoelectromagnetics use the lowest order formulation. Solution of the resulting large system of linear equations poses the main practical challenge. We have developed a fully parallel and distributed robust and scalable linear solver based on the optimal block-diagonal and auxiliary space preconditioners. The solver was found to be efficient for high finite element orders, unstructured and nonconforming locally refined meshes, a wide range of frequencies, largemore » conductivity contrasts, and number of degrees of freedom (DoFs). Furthermore, the presented linear solver is in essence algebraic; i.e., it acts on the matrix-vector level and thus requires no information about the discretization, boundary conditions, or physical source used, making it readily efficient for a wide range of electromagnetic modeling problems. To get accurate solutions at reduced computational cost, we have also implemented goal-oriented adaptive mesh refinement. The numerical tests indicated that if highly accurate modeling results were required, the high-order FEM in combination with the goal-oriented local mesh refinement required less computational time and DoFs than the lowest order adaptive FEM.« less

  10. Large-scale 3D geoelectromagnetic modeling using parallel adaptive high-order finite element method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Grayver, Alexander V.; Kolev, Tzanio V.

    Here, we have investigated the use of the adaptive high-order finite-element method (FEM) for geoelectromagnetic modeling. Because high-order FEM is challenging from the numerical and computational points of view, most published finite-element studies in geoelectromagnetics use the lowest order formulation. Solution of the resulting large system of linear equations poses the main practical challenge. We have developed a fully parallel and distributed robust and scalable linear solver based on the optimal block-diagonal and auxiliary space preconditioners. The solver was found to be efficient for high finite element orders, unstructured and nonconforming locally refined meshes, a wide range of frequencies, largemore » conductivity contrasts, and number of degrees of freedom (DoFs). Furthermore, the presented linear solver is in essence algebraic; i.e., it acts on the matrix-vector level and thus requires no information about the discretization, boundary conditions, or physical source used, making it readily efficient for a wide range of electromagnetic modeling problems. To get accurate solutions at reduced computational cost, we have also implemented goal-oriented adaptive mesh refinement. The numerical tests indicated that if highly accurate modeling results were required, the high-order FEM in combination with the goal-oriented local mesh refinement required less computational time and DoFs than the lowest order adaptive FEM.« less

  11. Modification of a Limbed Robot to Favor Climbing

    NASA Technical Reports Server (NTRS)

    Okon, Avi; Kennedy, Brett; Garrett, Michael; Magnone, Lee

    2006-01-01

    The figure shows the LEMUR IIb, which is a modified version of the LEMUR II the second generation of the Limbed Excursion Mechanical Utility Robot (LEMUR). Except as described below, the LEMUR IIb hardware is mostly the same as that of the LEMUR II. The IIb and II versions differ in their kinematic configurations and characteristics associated with their kinematic configurations. The differences are such that relative to the LEMUR II, the LEMUR IIb is simpler and is better suited to climbing on inclined surfaces. The first-generation LEMUR, now denoted the LEMUR I, was described in Six-Legged Experimental Robot (NPO-20897), NASA Tech Briefs, Vol. 25, No. 12 (December 2001), page 58. The LEMUR II was described in Second-Generation Six-Limbed Experimental Robot (NPO-35140) NASA Tech Briefs, Vol. 28, No. 11 (November 2004), page 55. To recapitulate: the LEMUR I and LEMUR II were six-legged or sixlimbed robots for demonstrating robotic capabilities for assembly, maintenance, and inspection. They were designed to be capable of walking autonomously along a truss structure toward a mechanical assembly at a prescribed location. They were equipped with stereoscopic video cameras and image-data-processing circuitry for navigation and mechanical operations. They were also equipped with wireless modems, through which they could be commanded remotely. Upon arrival at a mechanical assembly, the LEMUR I would perform simple mechanical operations by use of one or both of its front legs (or in the case of the LEMUR II, any of its limbs could be used to perform mechanical operations). Either LEMUR could also transmit images to a host computer. The differences between the LEMUR IIb and the LEMUR II are the following: Whereas the LEMUR II had six limbs, the LEMUR IIb has four limbs. This change has reduced both the complexity and mass of the legs and of the overall robot. Whereas each limb of the LEMUR II had four degrees of freedom (DOFs), each limb of the LEMUR IIb has three DOFs. This change has also reduced both complexity and mass. Notwithstanding the decrease in the number of DOFs, the three remaining DOFs are configured to provide greater dexterity for motion along a surface. To extend reach, the limbs of the LEMUR IIb are 25 percent longer than those of the LEMUR II. Additional benefits stemming from the modifications are that the robot body supported by the limbs is now less massive and its center of gravity is now closer to the surface along which the robot is to move. These benefits have been obtained without sacrificing load-carrying capacity. Hence, overall, the LEMUR IIb is a more adept climber.

  12. Design and Calibration of a New 6 DOF Haptic Device

    PubMed Central

    Qin, Huanhuan; Song, Aiguo; Liu, Yuqing; Jiang, Guohua; Zhou, Bohe

    2015-01-01

    For many applications such as tele-operational robots and interactions with virtual environments, it is better to have performance with force feedback than without. Haptic devices are force reflecting interfaces. They can also track human hand positions simultaneously. A new 6 DOF (degree-of-freedom) haptic device was designed and calibrated in this study. It mainly contains a double parallel linkage, a rhombus linkage, a rotating mechanical structure and a grasping interface. Benefited from the unique design, it is a hybrid structure device with a large workspace and high output capability. Therefore, it is capable of multi-finger interactions. Moreover, with an adjustable base, operators can change different postures without interrupting haptic tasks. To investigate the performance regarding position tracking accuracy and static output forces, we conducted experiments on a three-dimensional electric sliding platform and a digital force gauge, respectively. Displacement errors and force errors are calculated and analyzed. To identify the capability and potential of the device, four application examples were programmed. PMID:26690449

  13. Measurement of the passive stiffness of ankle joint in 3 DOF using stewart platform type ankle foot device.

    PubMed

    Nomura, Kenta; Yonezawa, Teru; Mizoguchi, Hiroshi; Takemura, Hiroshi

    2016-08-01

    This paper presents a method to measure the passive stiffness of an ankle joint in three degrees of freedom (DOF) under two motion speeds (1 Hz and 5 degree/s) using a developed Stewart platform-type device. The developed device can reproduce input motions of the foot in 6 DOF by controlling six pneumatic linear motion actuators. We used the device to measure the passive stiffness of an ankle joint undergoing three kinds of motion, namely dorsi-plantar flexion, inversion-eversion, and adduction-abduction. The measured values of the passive stiffness of the ankle joint in dorsiflexion that we obtained agreed well with that obtained in a previous study, indicating that the developed device is useful for measuring the passive stiffness of ankle joint. In addition, the developed device can be used to measure the stiffness in inversion-eversion and adduction-abduction motions as well, parameters that have never been measured. The results we obtained demonstrated certain interesting features as we varied both the direction and pace of motion (e.g., there were significant differences in the stiffness not only between adduction and abduction during the faster pace, but also between these and the other motions).

  14. Development of a Smooth Trajectory Maneuver Method to Accommodate the Ares I Flight Control Constraints

    NASA Technical Reports Server (NTRS)

    Pinson, Robin M.; Schmitt, Terri L.; Hanson, John M.

    2008-01-01

    Six degree-of-freedom (DOF) launch vehicle trajectories are designed to follow an optimized 3-DOF reference trajectory. A vehicle has a finite amount of control power that it can allocate to performing maneuvers. Therefore, the 3-DOF trajectory must be designed to refrain from using 100% of the allowable control capability to perform maneuvers, saving control power for handling off-nominal conditions, wind gusts and other perturbations. During the Ares I trajectory analysis, two maneuvers were found to be hard for the control system to implement; a roll maneuver prior to the gravity turn and an angle of attack maneuver immediately after the J-2X engine start-up. It was decided to develop an approach for creating smooth maneuvers in the optimized reference trajectories that accounts for the thrust available from the engines. A feature of this method is that no additional angular velocity in the direction of the maneuver has been added to the vehicle after the maneuver completion. This paper discusses the equations behind these new maneuvers and their implementation into the Ares I trajectory design cycle. Also discussed is a possible extension to adjusting closed-loop guidance.

  15. Parallel Robot for Lower Limb Rehabilitation Exercises.

    PubMed

    Rastegarpanah, Alireza; Saadat, Mozafar; Borboni, Alberto

    2016-01-01

    The aim of this study is to investigate the capability of a 6-DoF parallel robot to perform various rehabilitation exercises. The foot trajectories of twenty healthy participants have been measured by a Vicon system during the performing of four different exercises. Based on the kinematics and dynamics of a parallel robot, a MATLAB program was developed in order to calculate the length of the actuators, the actuators' forces, workspace, and singularity locus of the robot during the performing of the exercises. The calculated length of the actuators and the actuators' forces were used by motion analysis in SolidWorks in order to simulate different foot trajectories by the CAD model of the robot. A physical parallel robot prototype was built in order to simulate and execute the foot trajectories of the participants. Kinect camera was used to track the motion of the leg's model placed on the robot. The results demonstrate the robot's capability to perform a full range of various rehabilitation exercises.

  16. Parallel Robot for Lower Limb Rehabilitation Exercises

    PubMed Central

    Saadat, Mozafar; Borboni, Alberto

    2016-01-01

    The aim of this study is to investigate the capability of a 6-DoF parallel robot to perform various rehabilitation exercises. The foot trajectories of twenty healthy participants have been measured by a Vicon system during the performing of four different exercises. Based on the kinematics and dynamics of a parallel robot, a MATLAB program was developed in order to calculate the length of the actuators, the actuators' forces, workspace, and singularity locus of the robot during the performing of the exercises. The calculated length of the actuators and the actuators' forces were used by motion analysis in SolidWorks in order to simulate different foot trajectories by the CAD model of the robot. A physical parallel robot prototype was built in order to simulate and execute the foot trajectories of the participants. Kinect camera was used to track the motion of the leg's model placed on the robot. The results demonstrate the robot's capability to perform a full range of various rehabilitation exercises. PMID:27799727

  17. An interdimensional correlation framework for real-time estimation of six degree of freedom target motion using a single x-ray imager during radiotherapy

    NASA Astrophysics Data System (ADS)

    Nguyen, D. T.; Bertholet, J.; Kim, J.-H.; O'Brien, R.; Booth, J. T.; Poulsen, P. R.; Keall, P. J.

    2018-01-01

    Increasing evidence suggests that intrafraction tumour motion monitoring needs to include both 3D translations and 3D rotations. Presently, methods to estimate the rotation motion require the 3D translation of the target to be known first. However, ideally, translation and rotation should be estimated concurrently. We present the first method to directly estimate six-degree-of-freedom (6DoF) motion from the target’s projection on a single rotating x-ray imager in real-time. This novel method is based on the linear correlations between the superior-inferior translations and the motion in the other five degrees-of-freedom. The accuracy of the method was evaluated in silico with 81 liver tumour motion traces from 19 patients with three implanted markers. The ground-truth motion was estimated using the current gold standard method where each marker’s 3D position was first estimated using a Gaussian probability method, and the 6DoF motion was then estimated from the 3D positions using an iterative method. The 3D position of each marker was projected onto a gantry-mounted imager with an imaging rate of 11 Hz. After an initial 110° gantry rotation (200 images), a correlation model between the superior-inferior translations and the five other DoFs was built using a least square method. The correlation model was then updated after each subsequent frame to estimate 6DoF motion in real-time. The proposed algorithm had an accuracy (±precision) of  -0.03  ±  0.32 mm, -0.01  ±  0.13 mm and 0.03  ±  0.52 mm for translations in the left-right (LR), superior-inferior (SI) and anterior-posterior (AP) directions respectively; and, 0.07  ±  1.18°, 0.07  ±  1.00° and 0.06  ±  1.32° for rotations around the LR, SI and AP axes respectively on the dataset. The first method to directly estimate real-time 6DoF target motion from segmented marker positions on a 2D imager was devised. The algorithm was evaluated using 81 motion traces from 19 liver patients and was found to have sub-mm and sub-degree accuracy.

  18. Evolution analysis of Dof transcription factor family and their expression in response to multiple abiotic stresses in Malus domestica.

    PubMed

    Zhang, Zhengrong; Yuan, Li; Liu, Xin; Chen, Xuesen; Wang, Xiaoyun

    2018-01-10

    As a family of transcription factors, DNA binding with one figure (Dof) proteins play important roles in various biological processes in plants. Here, a total of 60 putative apple (Malus domestica) Dof genes (MdDof) were identified and mapped to different chromosomes. Chromosomal distribution and synteny analysis indicated that the expansion of the MdDof genes came primarily from segmental and duplication events, and from whole genome duplication, which lead to more Dof members in apples than in other plants. All 60 MdDof genes were classified into thirteen groups, according to multiple sequence alignment and the phylogenetic tree constructed of Dof genes from apple, peach (Prunus persica), Arabidopsis and rice. Within each group, the members shared a similar exon/intron and motif compositions, although the sizes of the MdDof genes and encoding proteins were quite different. Several Dof genes from the apple and peach were identified to be homologues based on their close synteny relationship, which suggested that these genes bear similar functions. Half of the MdDof genes were randomly selected to determine their responses to different stresses. The majority of MdDof genes were quite sensitive to PEG, NaCl, cold and exogenous ABA treatment. Our results suggested that MdDof family members may play important roles in plant tolerance to abiotic stress. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. The first clinical implementation of a real-time six degree of freedom target tracking system during radiation therapy based on Kilovoltage Intrafraction Monitoring (KIM).

    PubMed

    Nguyen, Doan Trang; O'Brien, Ricky; Kim, Jung-Ha; Huang, Chen-Yu; Wilton, Lee; Greer, Peter; Legge, Kimberley; Booth, Jeremy T; Poulsen, Per Rugaard; Martin, Jarad; Keall, Paul J

    2017-04-01

    We present the first clinical implementation of a real-time six-degree of freedom (6DoF) Kilovoltage Intrafraction Monitoring (KIM) system which tracks the cancer target translational and rotational motions during treatment. The method was applied to measure and correct for target motion during stereotactic body radiotherapy (SBRT) for prostate cancer. Patient: A patient with prostate adenocarcinoma undergoing SBRT with 36.25Gy, delivered in 5 fractions was enrolled in the study. 6DoF KIM technology: 2D positions of three implanted gold markers in each of the kV images (125kV, 10mA at 11Hz) were acquired continuously during treatment. The 2D→3D target position estimation was based on a probability distribution function. The 3D→6DoF target rotation was calculated using an iterative closest point algorithm. The accuracy and precision of the KIM method was measured by comparing the real-time results with kV-MV triangulation. Of the five treatment fractions, KIM was utilised successfully in four fractions. The intrafraction prostate motion resulted in three couch shifts in two fractions when the prostate motion exceeded the pre-set action threshold of 2mm for more than 5s. KIM translational accuracy and precision were 0.3±0.6mm, -0.2±0.3mm and 0.2±0.7mm in the Left-Right (LR), Superior-Inferior (SI) and Anterior-Posterior (AP) directions, respectively. The KIM rotational accuracy and precision were 0.8°±2.0°, -0.5°±3.3° and 0.3°±1.6° in the roll, pitch and yaw directions, respectively. This treatment represents, to the best of our knowledge, the first time a cancer patient's tumour position and rotation have been monitored in real-time during treatment. The 6 DoF KIM system has sub-millimetre accuracy and precision in all three translational axes, and less than 1° accuracy and 4° precision in all three rotational axes. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Anderson, Mark A.; Bigelow, Matthew; Gilkey, Jeff C.

    The Super Strypi SWIL is a six degree-of-freedom (6DOF) simulation for the Super Strypi Launch Vehicle that includes a subset of the Super Strypi NGC software (guidance, ACS and sequencer). Aerodynamic and propulsive forces, mass properties, ACS (attitude control system) parameters, guidance parameters and Monte-Carlo parameters are defined in input files. Output parameters are saved to a Matlab mat file.

  1. Genome-wide analysis of the DNA-binding with one zinc finger (Dof) transcription factor family in bananas.

    PubMed

    Dong, Chen; Hu, Huigang; Xie, Jianghui

    2016-12-01

    DNA-binding with one finger (Dof) domain proteins are a multigene family of plant-specific transcription factors involved in numerous aspects of plant growth and development. In this study, we report a genome-wide search for Musa acuminata Dof (MaDof) genes and their expression profiles at different developmental stages and in response to various abiotic stresses. In addition, a complete overview of the Dof gene family in bananas is presented, including the gene structures, chromosomal locations, cis-regulatory elements, conserved protein domains, and phylogenetic inferences. Based on the genome-wide analysis, we identified 74 full-length protein-coding MaDof genes unevenly distributed on 11 chromosomes. Phylogenetic analysis with Dof members from diverse plant species showed that MaDof genes can be classified into four subgroups (StDof I, II, III, and IV). The detailed genomic information of the MaDof gene homologs in the present study provides opportunities for functional analyses to unravel the exact role of the genes in plant growth and development.

  2. Gender dimorphic ACL strain in response to combined dynamic 3D knee joint loading: implications for ACL injury risk.

    PubMed

    Mizuno, Kiyonori; Andrish, Jack T; van den Bogert, Antonie J; McLean, Scott G

    2009-12-01

    While gender-based differences in knee joint anatomies/laxities are well documented, the potential for them to precipitate gender-dimorphic ACL loading and resultant injury risk has not been considered. To this end, we generated gender-specific models of ACL strain as a function of any six degrees of freedom (6DOF) knee joint load state via a combined cadaveric and analytical approach. Continuously varying joint forces and torques were applied to five male and five female cadaveric specimens and recorded along with synchronous knee flexion and ACL strain data. All data (approximately 10,000 samples) were submitted to specimen-specific regression analyses, affording ACL strain predictions as a function of the combined 6 DOF knee loads. Following individual model verifications, generalized gender-specific models were generated and subjected to 6 DOF external load scenarios consistent with both a clinical examination and a dynamic sports maneuver. The ensuing model-based strain predictions were subsequently examined for gender-based discrepancies. Male and female specimen-specific models predicted ACL strain within 0.51%+/-0.10% and 0.52%+/-0.07% of the measured data respectively, and explained more than 75% of the associated variance in each case. Predicted female ACL strains were also significantly larger than respective male values for both simulated 6 DOF load scenarios. Outcomes suggest that the female ACL will rupture in response to comparatively smaller external load applications. Future work must address the underlying anatomical/laxity contributions to knee joint mechanical and resultant ACL loading, ultimately affording prevention strategies that may cater to individual joint vulnerabilities.

  3. Extrinsic finger and thumb muscles command a virtual hand to allow individual finger and grasp control.

    PubMed

    Birdwell, J Alexander; Hargrove, Levi J; Weir, Richard F ff; Kuiken, Todd A

    2015-01-01

    Fine-wire intramuscular electrodes were used to obtain electromyogram (EMG) signals from six extrinsic hand muscles associated with the thumb, index, and middle fingers. Subjects' EMG activity was used to control a virtual three-degree-of-freedom (DOF) hand as they conformed the hand to a sequence of hand postures testing two controllers: direct EMG control and pattern recognition control. Subjects tested two conditions using each controller: starting the hand from a predefined neutral posture before each new posture and starting the hand from the previous posture in the sequence. Subjects demonstrated their abilities to simultaneously, yet individually, move all three DOFs during the direct EMG control trials; however, results showed subjects did not often utilize this feature. Performance metrics such as failure rate and completion time showed no significant difference between the two controllers.

  4. Numerical Investigation of Swimmer’s Gliding Stage with 6-DOF Movement

    PubMed Central

    Li, Tianzeng; Cai, Wenhao; Zhan, Jiemin

    2017-01-01

    The purpose of this study is to analyze the motion status of swimmers during their gliding stage using a numerical simulation method. This simulation strategy is conducted by solving the 3D incompressible Navier-Stokes equations using the Realizable k-ε turbulence closure equations in combination with the Six Degrees of Freedom (6-DOF) method. The uneven mass distribution of a swimmer and the roughness of the surface of the body are taken into consideration. The hydrodynamic characteristics and movement characteristics of the swimmers at different launch speeds were analyzed. The calculated results suggest that an optimal instant for starting propulsive movement is when the velocity of the swimmer decreases by 1.75 m/s to 2.0 m/s from an initial horizontal velocity of 3.1 m/s to 3.5 m/s. PMID:28125724

  5. Capabilities and applications of the Program to Optimize Simulated Trajectories (POST). Program summary document

    NASA Technical Reports Server (NTRS)

    Brauer, G. L.; Cornick, D. E.; Stevenson, R.

    1977-01-01

    The capabilities and applications of the three-degree-of-freedom (3DOF) version and the six-degree-of-freedom (6DOF) version of the Program to Optimize Simulated Trajectories (POST) are summarized. The document supplements the detailed program manuals by providing additional information that motivates and clarifies basic capabilities, input procedures, applications and computer requirements of these programs. The information will enable prospective users to evaluate the programs, and to determine if they are applicable to their problems. Enough information is given to enable managerial personnel to evaluate the capabilities of the programs and describes the POST structure, formulation, input and output procedures, sample cases, and computer requirements. The report also provides answers to basic questions concerning planet and vehicle modeling, simulation accuracy, optimization capabilities, and general input rules. Several sample cases are presented.

  6. Assessment of Healthcare Worker Protocol Deviations and Self-Contamination During Personal Protective Equipment Donning and Doffing.

    PubMed

    Kwon, Jennie H; Burnham, Carey-Ann D; Reske, Kimberly A; Liang, Stephen Y; Hink, Tiffany; Wallace, Meghan A; Shupe, Angela; Seiler, Sondra; Cass, Candice; Fraser, Victoria J; Dubberke, Erik R

    2017-09-01

    OBJECTIVE To evaluate healthcare worker (HCW) risk of self-contamination when donning and doffing personal protective equipment (PPE) using fluorescence and MS2 bacteriophage. DESIGN Prospective pilot study. SETTING Tertiary-care hospital. PARTICIPANTS A total of 36 HCWs were included in this study: 18 donned/doffed contact precaution (CP) PPE and 18 donned/doffed Ebola virus disease (EVD) PPE. INTERVENTIONS HCWs donned PPE according to standard protocols. Fluorescent liquid and MS2 bacteriophage were applied to HCWs. HCWs then doffed their PPE. After doffing, HCWs were scanned for fluorescence and swabbed for MS2. MS2 detection was performed using reverse transcriptase PCR. The donning and doffing processes were videotaped, and protocol deviations were recorded. RESULTS Overall, 27% of EVD PPE HCWs and 50% of CP PPE HCWs made ≥1 protocol deviation while donning, and 100% of EVD PPE HCWs and 67% of CP PPE HCWs made ≥1 protocol deviation while doffing (P=.02). The median number of doffing protocol deviations among EVD PPE HCWs was 4, versus 1 among CP PPE HCWs. Also, 15 EVD PPE protocol deviations were committed by doffing assistants and/or trained observers. Fluorescence was detected on 8 EVD PPE HCWs (44%) and 5 CP PPE HCWs (28%), most commonly on hands. MS2 was recovered from 2 EVD PPE HCWs (11%) and 3 CP PPE HCWs (17%). CONCLUSIONS Protocol deviations were common during both EVD and CP PPE doffing, and some deviations during EVD PPE doffing were committed by the HCW doffing assistant and/or the trained observer. Self-contamination was common. PPE donning/doffing are complex and deserve additional study. Infect Control Hosp Epidemiol 2017;38:1077-1083.

  7. Characterization of Dof Transcription Factors and Their Responses to Osmotic Stress in Poplar (Populus trichocarpa)

    PubMed Central

    Wang, Han; Zhao, Shicheng; Gao, Yuchi; Yang, Jingli

    2017-01-01

    The DNA-binding One Zinc Finger (Dof) genes are ubiquitous in many plant species and are especial transcription regulators that participate in plant growth, development and various procedures, including biotic and abiotic stress reactions. In this study, we identified 41 PtrDof members from Populus trichocarpa genomes and classified them into four groups. The conserved motifs and gene structures of some PtrDof genes belonging to the same subgroup were almost the same. The 41 PtrDof genes were dispersed on 18 of the 19 Populus chromosomes. Many key stress- or phytohormone-related cis-elements were discovered in the PtrDof gene promoter regions. Consequently, we undertook expression profiling of the PtrDof genes in leaves and roots in response to osmotic stress and abscisic acid. A total of seven genes (PtrDof14, 16, 25, 27, 28, 37 and 39) in the Populus Dof gene family were consistently upregulated at point in all time in the leaves and roots under osmotic and abscisic acid (ABA) stress. We observed that 12 PtrDof genes could be targeted by 15 miRNAs. Moreover, we mapped the cleavage site in PtrDof30 using the 5’RLM-RACE. The results showed that PtrDofs may have a role in resistance to abiotic stress in Populus trichocarpa. PMID:28095469

  8. Positioning accuracy during VMAT of gynecologic malignancies and the resulting dosimetric impact by a 6-degree-of-freedom couch in combination with daily kilovoltage cone beam computed tomography.

    PubMed

    Yao, Lihong; Zhu, Lihong; Wang, Junjie; Liu, Lu; Zhou, Shun; Jiang, ShuKun; Cao, Qianqian; Qu, Ang; Tian, Suqing

    2015-04-26

    To improve the delivery of radiotherapy in gynecologic malignancies and to minimize the irradiation of unaffected tissues by using daily kilovoltage cone beam computed tomography (kV-CBCT) to reduce setup errors. Thirteen patients with gynecologic cancers were treated with postoperative volumetric-modulated arc therapy (VMAT). All patients had a planning CT scan and daily CBCT during treatment. Automatic bone anatomy matching was used to determine initial inter-fraction positioning error. Positional correction on a six-degrees-of-freedom (6DoF) couch was followed by a second scan to calculate the residual inter-fraction error, and a post-treatment scan assessed intra-fraction motion. The margins of the planning target volume (MPTV) were calculated from these setup variations and the effect of margin size on normal tissue sparing was evaluated. In total, 573 CBCT scans were acquired. Mean absolute pre-/post-correction errors were obtained in all six planes. With 6DoF couch correction, the MPTV accounting for intra-fraction errors was reduced by 3.8-5.6 mm. This permitted a reduction in the maximum dose to the small intestine, bladder and femoral head (P=0.001, 0.035 and 0.032, respectively), the average dose to the rectum, small intestine, bladder and pelvic marrow (P=0.003, 0.000, 0.001 and 0.000, respectively) and markedly reduced irradiated normal tissue volumes. A 6DoF couch in combination with daily kV-CBCT can considerably improve positioning accuracy during VMAT treatment in gynecologic malignancies, reducing the MPTV. The reduced margin size permits improved normal tissue sparing and a smaller total irradiated volume.

  9. Perturbation analysis of 6DoF flight dynamics and passive dynamic stability of hovering fruit fly Drosophila melanogaster.

    PubMed

    Gao, Na; Aono, Hikaru; Liu, Hao

    2011-02-07

    Insects exhibit exquisite control of their flapping flight, capable of performing precise stability and steering maneuverability. Here we develop an integrated computational model to investigate flight dynamics of insect hovering based on coupling the equations of 6 degree of freedom (6DoF) motion with the Navier-Stokes (NS) equations. Unsteady aerodynamics is resolved by using a biology-inspired dynamic flight simulator that integrates models of realistic wing-body morphology and kinematics, and a NS solver. We further develop a dynamic model to solve the rigid body equations of 6DoF motion by using a 4th-order Runge-Kutta method. In this model, instantaneous forces and moments based on the NS-solutions are represented in terms of Fourier series. With this model, we perform a systematic simulation-based analysis on the passive dynamic stability of a hovering fruit fly, Drosophila melanogaster, with a specific focus on responses of state variables to six one-directional perturbation conditions during latency period. Our results reveal that the flight dynamics of fruit fly hovering does not have a straightforward dynamic stability in a conventional sense that perturbations damp out in a manner of monotonous convergence. However, it is found to exist a transient interval containing an initial converging response observed for all the six perturbation variables and a terminal instability that at least one state variable subsequently tends to diverge after several wing beat cycles. Furthermore, our results illustrate that a fruit fly does have sufficient time to apply some active mediation to sustain a steady hovering before losing body attitudes. Copyright © 2010 Elsevier Ltd. All rights reserved.

  10. Members of the Dof transcription factor family in Triticum aestivum are associated with light-mediated gene regulation.

    PubMed

    Shaw, Lindsay M; McIntyre, C Lynne; Gresshoff, Peter M; Xue, Gang-Ping

    2009-11-01

    DNA binding with One Finger (Dof) protein is a plant-specific transcription factor implicated in the regulation of many important plant-specific processes, including photosynthesis and carbohydrate metabolism. This study has identified 31 Dof genes (TaDof) in bread wheat through extensive analysis of current nucleotide databases. Phylogenetic analysis suggests that the TaDof family can be divided into four clades. Expression analysis of the TaDof family across all major organs using quantitative RT-PCR and searches of the wheat genome array database revealed that the majority of TaDof members were predominately expressed in vegetative organs. A large number of TaDof members were down-regulated by drought and/or were responsive to the light and dark cycle. Further expression analysis revealed that light up-regulated TaDof members were highly correlated in expression with a number of genes that are involved in photosynthesis or sucrose transport. These data suggest that the TaDof family may have an important role in light-mediated gene regulation, including involvement in the photosynthetic process.

  11. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    PubMed

    Guo, Yong; Qiu, Li-Juan

    2013-01-01

    The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max). In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs) were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  12. Genome-Wide Screening and Characterization of the Dof Gene Family in Physic Nut (Jatropha curcas L.).

    PubMed

    Wang, Peipei; Li, Jing; Gao, Xiaoyang; Zhang, Di; Li, Anlin; Liu, Changning

    2018-05-29

    Physic nut ( Jatropha curcas L.) is a species of flowering plant with great potential for biofuel production and as an emerging model organism for functional genomic analysis, particularly in the Euphorbiaceae family. DNA binding with one finger (Dof) transcription factors play critical roles in numerous biological processes in plants. Nevertheless, the knowledge about members, and the evolutionary and functional characteristics of the Dof gene family in physic nut is insufficient. Therefore, we performed a genome-wide screening and characterization of the Dof gene family within the physic nut draft genome. In total, 24 JcDof genes (encoding 33 JcDof proteins) were identified. All the JcDof genes were divided into three major groups based on phylogenetic inference, which was further validated by the subsequent gene structure and motif analysis. Genome comparison revealed that segmental duplication may have played crucial roles in the expansion of the JcDof gene family, and gene expansion was mainly subjected to positive selection. The expression profile demonstrated the broad involvement of JcDof genes in response to various abiotic stresses, hormonal treatments and functional divergence. This study provides valuable information for better understanding the evolution of JcDof genes, and lays a foundation for future functional exploration of JcDof genes.

  13. A 6-DOF parallel bone-grinding robot for cervical disc replacement surgery.

    PubMed

    Tian, Heqiang; Wang, Chenchen; Dang, Xiaoqing; Sun, Lining

    2017-12-01

    Artificial cervical disc replacement surgery has become an effective and main treatment method for cervical disease, which has become a more common and serious problem for people with sedentary work. To improve cervical disc replacement surgery significantly, a 6-DOF parallel bone-grinding robot is developed for cervical bone-grinding by image navigation and surgical plan. The bone-grinding robot including mechanical design and low level control is designed. The bone-grinding robot navigation is realized by optical positioning with spatial registration coordinate system defined. And a parametric robot bone-grinding plan and high level control have been developed for plane grinding for cervical top endplate and tail endplate grinding by a cylindrical grinding drill and spherical grinding for two articular surfaces of bones by a ball grinding drill. Finally, the surgical flow for a robot-assisted cervical disc replacement surgery procedure is present. The final experiments results verified the key technologies and performance of the robot-assisted surgery system concept excellently, which points out a promising clinical application with higher operability. Finally, study innovations, study limitations, and future works of this present study are discussed, and conclusions of this paper are also summarized further. This bone-grinding robot is still in the initial stage, and there are many problems to be solved from a clinical point of view. Moreover, the technique is promising and can give a good support for surgeons in future clinical work.

  14. Evidence for sparse synergies in grasping actions.

    PubMed

    Prevete, Roberto; Donnarumma, Francesco; d'Avella, Andrea; Pezzulo, Giovanni

    2018-01-12

    Converging evidence shows that hand-actions are controlled at the level of synergies and not single muscles. One intriguing aspect of synergy-based action-representation is that it may be intrinsically sparse and the same synergies can be shared across several distinct types of hand-actions. Here, adopting a normative angle, we consider three hypotheses for hand-action optimal-control: sparse-combination hypothesis (SC) - sparsity in the mapping between synergies and actions - i.e., actions implemented using a sparse combination of synergies; sparse-elements hypothesis (SE) - sparsity in synergy representation - i.e., the mapping between degrees-of-freedom (DoF) and synergies is sparse; double-sparsity hypothesis (DS) - a novel view combining both SC and SE - i.e., both the mapping between DoF and synergies and between synergies and actions are sparse, each action implementing a sparse combination of synergies (as in SC), each using a limited set of DoFs (as in SE). We evaluate these hypotheses using hand kinematic data from six human subjects performing nine different types of reach-to-grasp actions. Our results support DS, suggesting that the best action representation is based on a relatively large set of synergies, each involving a reduced number of degrees-of-freedom, and that distinct sets of synergies may be involved in distinct tasks.

  15. A eutectic-alloy-infused soft actuator with sensing, tunable degrees of freedom, and stiffness properties

    NASA Astrophysics Data System (ADS)

    Hao, Yufei; Wang, Tianmiao; Xie, Zhexin; Sun, Wenguang; Liu, Zemin; Fang, Xi; Yang, Minxuan; Wen, Li

    2018-02-01

    This paper presents a soft actuator embedded with two types of eutectic alloys which enable sensing, tunable mechanical degrees of freedom (DOF), and variable stiffness properties. To modulate the stiffness of the actuator, we embedded a low melting point alloy (LMPA) in the bottom portion of the soft actuator. Different sections of the LMPA could be selectively melted by the Ni-Cr wires twined underneath. To acquire the curvature information, EGaIn (eutectic gallium indium) was infused into a microchannel surrounding the chambers of the soft actuator. Systematic experiments were performed to characterize the stiffness, tunable DOF, and sensing the bending curvature. We found that the average bending force and elasticity modulus could be increased about 35 and 4000 times, respectively, with the LMPA in a solid state. The entire LMPA could be melted from a solid to a liquid state within 12 s. In particular, up to six different motion patterns could be achieved under each pneumatic pressure of the soft actuator. Furthermore, the kinematics of the actuator under different motion patterns could be obtained by a mathematical model whose input was provided by the EGaIn sensor. For demonstration purposes, a two-fingered gripper was fabricated to grasp various objects by adjusting the DOF and mechanical stiffness.

  16. Entry, Descent, and Landing Performance for a Mid-Lift-to-Drag Ratio Vehicle at Mars

    NASA Technical Reports Server (NTRS)

    Johnson, Breanna J.; Braden, Ellen M.; Sostaric, Ronald R.; Cerimele, Christopher J.; Lu, Ping

    2018-01-01

    In an effort to mature the design of the Mid-Lift-to-Drag ratio Rigid Vehicle (MRV) candidate of the NASA Evolvable Mars Campaign (EMC) architecture study, end-to-end six-degree-of-freedom (6DOF) simulations are needed to ensure a successful entry, descent, and landing (EDL) design. The EMC study is assessing different vehicle and mission architectures to determine which candidate would be best to deliver a 20 metric ton payload to the surface of Mars. Due to the large mass payload and the relatively low atmospheric density of Mars, all candidates of the EMC study propose to use Supersonic Retro-Propulsion (SRP) throughout the descent and landing phase, as opposed to parachutes, in order to decelerate to a subsonic touchdown. This paper presents a 6DOF entry-to-landing performance and controllability study with sensitivities to dispersions, particularly in the powered descent and landing phases.

  17. Learning-based position control of a closed-kinematic chain robot end-effector

    NASA Technical Reports Server (NTRS)

    Nguyen, Charles C.; Zhou, Zhen-Lei

    1990-01-01

    A trajectory control scheme whose design is based on learning theory, for a six-degree-of-freedom (DOF) robot end-effector built to study robotic assembly of NASA hardwares in space is presented. The control scheme consists of two control systems: the feedback control system and the learning control system. The feedback control system is designed using the concept of linearization about a selected operating point, and the method of pole placement so that the closed-loop linearized system is stabilized. The learning control scheme consisting of PD-type learning controllers, provides additional inputs to improve the end-effector performance after each trial. Experimental studies performed on a 2 DOF end-effector built at CUA, for three tracking cases show that actual trajectories approach desired trajectories as the number of trials increases. The tracking errors are substantially reduced after only five trials.

  18. Understanding of and applications for robot vision guidance at KSC

    NASA Technical Reports Server (NTRS)

    Shawaga, Lawrence M.

    1988-01-01

    The primary thrust of robotics at KSC is for the servicing of Space Shuttle remote umbilical docking functions. In order for this to occur, robots performing servicing operations must be capable of tracking a swaying Orbiter in Six Degrees of Freedom (6-DOF). Currently, in NASA KSC's Robotic Applications Development Laboratory (RADL), an ASEA IRB-90 industrial robot is being equipped with a real-time computer vision (hardware and software) system to allow it to track a simulated Orbiter interface (target) in 6-DOF. The real-time computer vision system effectively becomes the eyes for the lab robot, guiding it through a closed loop visual feedback system to move with the simulated Orbiter interface. This paper will address an understanding of this vision guidance system and how it will be applied to remote umbilical servicing at KSC. In addition, other current and future applications will be addressed.

  19. Genome wide in silico characterization of Dof gene families of pigeonpea (Cajanus cajan (L) Millsp.).

    PubMed

    Malviya, N; Gupta, S; Singh, V K; Yadav, M K; Bisht, N C; Sarangi, B K; Yadav, D

    2015-02-01

    The DNA binding with One Finger (Dof) protein is a plant specific transcription factor involved in the regulation of wide range of processes. The analysis of whole genome sequence of pigeonpea has identified 38 putative Dof genes (CcDof) distributed on 8 chromosomes. A total of 17 out of 38 CcDof genes were found to be intronless. A comprehensive in silico characterization of CcDof gene family including the gene structure, chromosome location, protein motif, phylogeny, gene duplication and functional divergence has been attempted. The phylogenetic analysis resulted in 3 major clusters with closely related members in phylogenetic tree revealed common motif distribution. The in silico cis-regulatory element analysis revealed functional diversity with predominance of light responsive and stress responsive elements indicating the possibility of these CcDof genes to be associated with photoperiodic control and biotic and abiotic stress. The duplication pattern showed that tandem duplication is predominant over segmental duplication events. The comparative phylogenetic analysis of these Dof proteins along with 78 soybean, 36 Arabidopsis and 30 rice Dof proteins revealed 7 major clusters. Several groups of orthologs and paralogs were identified based on phylogenetic tree constructed. Our study provides useful information for functional characterization of CcDof genes.

  20. Gender Dimorphic ACL Strain In Response to Combined Dynamic 3D Knee Joint Loading: Implications for ACL Injury Risk

    PubMed Central

    Mizuno, Kiyonori; Andrish, Jack T.; van den Bogert, Antonie J.; McLean, Scott G.

    2009-01-01

    While gender-based differences in knee joint anatomies/laxities are well documented, the potential for them to precipitate gender-dimorphic ACL loading and resultant injury risk has not been considered. To this end, we generated gender-specific models of ACL strain as a function of any six degrees of freedom (6DOF) knee joint load state via a combined cadaveric and analytical approach. Continuously varying joint forces and torques were applied to five male and five female cadaveric specimens and recorded along with synchronous knee flexion and ACL strain data. All data (~10,000 samples) were submitted to specimen-specific regression analyses, affording ACL strain predictions as a function of the combined 6 DOF knee loads. Following individual model verifications, generalized gender-specific models were generated and subjected to 6 DOF external load scenarios consistent with both a clinical examination and a dynamic sports maneuver. The ensuing model-based strain predictions were subsequently examined for gender-based discrepancies. Male and female specimen specific models predicted ACL strain within 0.51% ± 0.10% and 0.52% ± 0.07% of the measured data respectively, and explained more than 75% of the associated variance in each case. Predicted female ACL strains were also significantly larger than respective male values for both of simulated 6 DOF load scenarios. Outcomes suggest that the female ACL will rupture in response to comparatively smaller external load applications. Future work must address the underlying anatomical/laxity contributions to knee joint mechanical and resultant ACL loading, ultimately affording prevention strategies that may cater to individual joint vulnerabilities. PMID:19464897

  1. Six degree-of-freedom analysis of hip, knee, ankle and foot provides updated understanding of biomechanical work during human walking.

    PubMed

    Zelik, Karl E; Takahashi, Kota Z; Sawicki, Gregory S

    2015-03-01

    Measuring biomechanical work performed by humans and other animals is critical for understanding muscle-tendon function, joint-specific contributions and energy-saving mechanisms during locomotion. Inverse dynamics is often employed to estimate joint-level contributions, and deformable body estimates can be used to study work performed by the foot. We recently discovered that these commonly used experimental estimates fail to explain whole-body energy changes observed during human walking. By re-analyzing previously published data, we found that about 25% (8 J) of total positive energy changes of/about the body's center-of-mass and >30% of the energy changes during the Push-off phase of walking were not explained by conventional joint- and segment-level work estimates, exposing a gap in our fundamental understanding of work production during gait. Here, we present a novel Energy-Accounting analysis that integrates various empirical measures of work and energy to elucidate the source of unexplained biomechanical work. We discovered that by extending conventional 3 degree-of-freedom (DOF) inverse dynamics (estimating rotational work about joints) to 6DOF (rotational and translational) analysis of the hip, knee, ankle and foot, we could fully explain the missing positive work. This revealed that Push-off work performed about the hip may be >50% greater than conventionally estimated (9.3 versus 6.0 J, P=0.0002, at 1.4 m s(-1)). Our findings demonstrate that 6DOF analysis (of hip-knee-ankle-foot) better captures energy changes of the body than more conventional 3DOF estimates. These findings refine our fundamental understanding of how work is distributed within the body, which has implications for assistive technology, biomechanical simulations and potentially clinical treatment. © 2015. Published by The Company of Biologists Ltd.

  2. Quantum Computation Based on Photons with Three Degrees of Freedom

    PubMed Central

    Luo, Ming-Xing; Li, Hui-Ran; Lai, Hong; Wang, Xiaojun

    2016-01-01

    Quantum systems are important resources for quantum computer. Different from previous encoding forms using quantum systems with one degree of freedom (DoF) or two DoFs, we investigate the possibility of photon systems encoding with three DoFs consisting of the polarization DoF and two spatial DoFs. By exploring the optical circular birefringence induced by an NV center in a diamond embedded in the photonic crystal cavity, we propose several hybrid controlled-NOT (hybrid CNOT) gates operating on the two-photon or one-photon system. These hybrid CNOT gates show that three DoFs may be encoded as independent qubits without auxiliary DoFs. Our result provides a useful way to reduce quantum simulation resources by exploring complex quantum systems for quantum applications requiring large qubit systems. PMID:27174302

  3. Quantum Computation Based on Photons with Three Degrees of Freedom.

    PubMed

    Luo, Ming-Xing; Li, Hui-Ran; Lai, Hong; Wang, Xiaojun

    2016-05-13

    Quantum systems are important resources for quantum computer. Different from previous encoding forms using quantum systems with one degree of freedom (DoF) or two DoFs, we investigate the possibility of photon systems encoding with three DoFs consisting of the polarization DoF and two spatial DoFs. By exploring the optical circular birefringence induced by an NV center in a diamond embedded in the photonic crystal cavity, we propose several hybrid controlled-NOT (hybrid CNOT) gates operating on the two-photon or one-photon system. These hybrid CNOT gates show that three DoFs may be encoded as independent qubits without auxiliary DoFs. Our result provides a useful way to reduce quantum simulation resources by exploring complex quantum systems for quantum applications requiring large qubit systems.

  4. Aerobraking strategies for the sample of comet coma earth return mission

    NASA Astrophysics Data System (ADS)

    Abe, Takashi; Kawaguchi, Jun'ichiro; Uesugi, Kuninori; Yen, Chen-Wan L.

    The results of a study to the validate the applicability of the aerobraking concept to the SOCCER (sample of comet coma earth return) mission using a six-DOF computer simulation of the aerobraking process are presented. The SOCCER spacecraft and the aerobraking scenario and power supply problem are briefly described. Results are presented for the spin effect, payload exposure problem, and sun angle effect.

  5. Aerobraking strategies for the sample of comet coma earth return mission

    NASA Technical Reports Server (NTRS)

    Abe, Takashi; Kawaguchi, Jun'ichiro; Uesugi, Kuninori; Yen, Chen-Wan L.

    1990-01-01

    The results of a study to the validate the applicability of the aerobraking concept to the SOCCER (sample of comet coma earth return) mission using a six-DOF computer simulation of the aerobraking process are presented. The SOCCER spacecraft and the aerobraking scenario and power supply problem are briefly described. Results are presented for the spin effect, payload exposure problem, and sun angle effect.

  6. The LET Procedure for Prosthetic Myocontrol: Towards Multi-DOF Control Using Single-DOF Activations.

    PubMed

    Nowak, Markus; Castellini, Claudio

    2016-01-01

    Simultaneous and proportional myocontrol of dexterous hand prostheses is to a large extent still an open problem. With the advent of commercially and clinically available multi-fingered hand prostheses there are now more independent degrees of freedom (DOFs) in prostheses than can be effectively controlled using surface electromyography (sEMG), the current standard human-machine interface for hand amputees. In particular, it is uncertain, whether several DOFs can be controlled simultaneously and proportionally by exclusively calibrating the intended activation of single DOFs. The problem is currently solved by training on all required combinations. However, as the number of available DOFs grows, this approach becomes overly long and poses a high cognitive burden on the subject. In this paper we present a novel approach to overcome this problem. Multi-DOF activations are artificially modelled from single-DOF ones using a simple linear combination of sEMG signals, which are then added to the training set. This procedure, which we named LET (Linearly Enhanced Training), provides an augmented data set to any machine-learning-based intent detection system. In two experiments involving intact subjects, one offline and one online, we trained a standard machine learning approach using the full data set containing single- and multi-DOF activations as well as using the LET-augmented data set in order to evaluate the performance of the LET procedure. The results indicate that the machine trained on the latter data set obtains worse results in the offline experiment compared to the full data set. However, the online implementation enables the user to perform multi-DOF tasks with almost the same precision as single-DOF tasks without the need of explicitly training multi-DOF activations. Moreover, the parameters involved in the system are statistically uniform across subjects.

  7. Ground Based Investigation of Electrostatic Accelerometer in HUST

    NASA Astrophysics Data System (ADS)

    Bai, Y.; Zhou, Z.

    2013-12-01

    High-precision electrostatic accelerometers with six degrees of freedom (DOF) acceleration measurement were successfully used in CHAMP, GRACE and GOCE missions which to measure the Earth's gravity field. In our group, space inertial sensor based on the capacitance transducer and electrostatic control technique has been investigated for test of equivalence principle (TEPO), searching non-Newtonian force in micrometer range, and satellite Earth's field recovery. The significant techniques of capacitive position sensor with the noise level at 2×10-7pF/Hz1/2 and the μV/Hz1/2 level electrostatic actuator are carried out and all the six servo loop controls by using a discrete PID algorithm are realized in a FPGA device. For testing on ground, in order to compensate one g earth's gravity, the fiber torsion pendulum facility is adopt to measure the parameters of the electrostatic controlled inertial sensor such as the resolution, and the electrostatic stiffness, the cross couple between different DOFs. A short distance and a simple double capsule equipment the valid duration about 0.5 second is set up in our lab for the free fall tests of the engineering model which can directly verify the function of six DOF control. Meanwhile, high voltage suspension method is also realized and preliminary results show that the horizontal axis of acceleration noise is about 10-8m/s2/Hz1/2 level which limited mainly by the seismic noise. Reference: [1] Fen Gao, Ze-Bing Zhou, Jun Luo, Feasibility for Testing the Equivalence Principle with Optical Readout in Space, Chin. Phys. Lett. 28(8) (2011) 080401. [2] Z. Zhu, Z. B. Zhou, L. Cai, Y. Z. Bai, J. Luo, Electrostatic gravity gradiometer design for the advanced GOCE mission, Adv. Sp. Res. 51 (2013) 2269-2276. [3] Z B Zhou, L Liu, H B Tu, Y Z Bai, J Luo, Seismic noise limit for ground-based performance measurements of an inertial sensor using a torsion balance, Class. Quantum Grav. 27 (2010) 175012. [4] H B Tu, Y Z Bai, Z B Zhou, L Liu, L Cai, and J Luo, Performance measurements of an inertial sensor with a two-stage controlled torsion pendulum, Class Quantum. Grav. 27 (2010) 205016.

  8. Missile Aerodynamics for Ascent and Re-entry

    NASA Technical Reports Server (NTRS)

    Watts, Gaines L.; McCarter, James W.

    2012-01-01

    Aerodynamic force and moment equations are developed for 6-DOF missile simulations of both the ascent phase of flight and a tumbling re-entry. The missile coordinate frame (M frame) and a frame parallel to the M frame were used for formulating the aerodynamic equations. The missile configuration chosen as an example is a cylinder with fixed fins and a nose cone. The equations include both the static aerodynamic coefficients and the aerodynamic damping derivatives. The inclusion of aerodynamic damping is essential for simulating a tumbling re-entry. Appended information provides insight into aerodynamic damping.

  9. Computer program for the load and trajectory analysis of two DOF bodies connected by an elastic tether: Users manual

    NASA Technical Reports Server (NTRS)

    Doyle, G. R., Jr.; Burbick, J. W.

    1973-01-01

    The derivation of the differential equations of motion of a 3 Degrees of Freedom body joined to a 3 Degrees of Freedom body by an elastic tether. The tether is represented by a spring and dashpot in parallel. A computer program which integrates the equations of motion is also described. Although the derivation of the equations of motions are for a general system, the computer program is written for defining loads in large boosters recovered by parachutes.

  10. The banana fruit Dof transcription factor MaDof23 acts as a repressor and interacts with MaERF9 in regulating ripening-related genes

    PubMed Central

    Feng, Bi-hong; Han, Yan-chao; Xiao, Yun-yi; Kuang, Jian-fei; Fan, Zhong-qi; Chen, Jian-ye; Lu, Wang-jin

    2016-01-01

    The DNA binding with one finger (Dof) proteins, a family of plant-specific transcription factors, are involved in a variety of plant biological processes. However, little information is available on their involvement in fruit ripening. We have characterized 25 MaDof genes from banana fruit (Musa acuminata), designated as MaDof1–MaDof25. Gene expression analysis in fruit subjected to different ripening conditions revealed that MaDofs were differentially expressed during different stages of ripening. MaDof10, 23, 24, and 25 were ethylene-inducible and nuclear-localized, and their transcript levels increased during fruit ripening. Moreover, yeast two-hybrid and bimolecular fluorescence complementation analyses demonstrated a physical interaction between MaDof23 and MaERF9, a potential regulator of fruit ripening reported in a previous study. We determined that MaDof23 is a transcriptional repressor, whereas MaERF9 is a transcriptional activator. We suggest that they might act antagonistically in regulating 10 ripening-related genes, including MaEXP1/2/3/5, MaXET7, MaPG1, MaPME3, MaPL2, MaCAT, and MaPDC, which are associated with cell wall degradation and aroma formation. Taken together, our findings provide new insight into the transcriptional regulation network controlling banana fruit ripening. PMID:26889012

  11. Mechanism test bed. Flexible body model report

    NASA Technical Reports Server (NTRS)

    Compton, Jimmy

    1991-01-01

    The Space Station Mechanism Test Bed is a six degree-of-freedom motion simulation facility used to evaluate docking and berthing hardware mechanisms. A generalized rigid body math model was developed which allowed the computation of vehicle relative motion in six DOF due to forces and moments from mechanism contact, attitude control systems, and gravity. No vehicle size limitations were imposed in the model. The equations of motion were based on Hill's equations for translational motion with respect to a nominal circular earth orbit and Newton-Euler equations for rotational motion. This rigid body model and supporting software were being refined.

  12. Two-degrees-of-freedom piezo-driven fast steering mirror with cross-axis decoupling capability

    NASA Astrophysics Data System (ADS)

    Shao, Shubao; Tian, Zheng; Song, Siyang; Xu, Minglong

    2018-05-01

    Because mechanical cross coupling between its axes would lead to degradation of the scanning precision of a piezo-driven fast steering mirror (PFSM), a two-degrees-of-freedom (2-DoF) PFSM with a cross-axis decoupling capability, in which 2-DoF flexure hinges are used, is proposed in this work. The overall structure of the proposed PFSM is first introduced and then both static and dynamic models are established analytically; in addition, the decoupling mechanism is described in detail and the low dynamic cross coupling ratios that occur between the two DoFs are shown. Because of the decoupling property of the PFSM, the 2-DoF motion is treated as a combination of two independent one-degree-of-freedom (1-DoF) motions and two independent proportional-integral-derivative controllers are thus used separately in the control of the two DoFs. Based on this control strategy, experiments involving both 1-DoF trajectory tracking and 2-DoF trajectory tracking are implemented. The test results show that the proposed PFSM can achieve the tilt range of ±7 mrad for both axes with the low coupling ratios that are less than 2% (-34 dB), and the bandwidths of both axes are higher than 810 Hz; in addition, the maximal tracking full scale range errors for 1-DoF trajectory tracking and 2-DoF trajectory tracking are less than 0.2% and 1%, respectively, where the larger error of 2-DoF trajectory tracking is mainly caused by the remaining cross coupling between axes.

  13. Trajectory control of an articulated robot with a parallel drive arm based on splines under tension

    NASA Astrophysics Data System (ADS)

    Yi, Seung-Jong

    Today's industrial robots controlled by mini/micro computers are basically simple positioning devices. The positioning accuracy depends on the mathematical description of the robot configuration to place the end-effector at the desired position and orientation within the workspace and on following the specified path which requires the trajectory planner. In addition, the consideration of joint velocity, acceleration, and jerk trajectories are essential for trajectory planning of industrial robots to obtain smooth operation. The newly designed 6 DOF articulated robot with a parallel drive arm mechanism which permits the joint actuators to be placed in the same horizontal line to reduce the arm inertia and to increase load capacity and stiffness is selected. First, the forward kinematic and inverse kinematic problems are examined. The forward kinematic equations are successfully derived based on Denavit-Hartenberg notation with independent joint angle constraints. The inverse kinematic problems are solved using the arm-wrist partitioned approach with independent joint angle constraints. Three types of curve fitting methods used in trajectory planning, i.e., certain degree polynomial functions, cubic spline functions, and cubic spline functions under tension, are compared to select the best possible method to satisfy both smooth joint trajectories and positioning accuracy for a robot trajectory planner. Cubic spline functions under tension is the method selected for the new trajectory planner. This method is implemented for a 6 DOF articulated robot with a parallel drive arm mechanism to improve the smoothness of the joint trajectories and the positioning accuracy of the manipulator. Also, this approach is compared with existing trajectory planners, 4-3-4 polynomials and cubic spline functions, via circular arc motion simulations. The new trajectory planner using cubic spline functions under tension is implemented into the microprocessor based robot controller and motors to produce combined arc and straight-line motion. The simulation and experiment show interesting results by demonstrating smooth motion in both acceleration and jerk and significant improvements of positioning accuracy in trajectory planning.

  14. A preliminary 6 DOF attitude and translation control system design for Starprobe

    NASA Technical Reports Server (NTRS)

    Mak, P.; Mettler, E.; Vijayarahgavan, A.

    1981-01-01

    The extreme thermal environment near perihelion and the high-accuracy gravitational science experiments impose unique design requirements on various subsystems of Starprobe. This paper examines some of these requirements and their impact on the preliminary design of a six-degree-of-freedom attitude and translational control system. Attention is given to design considerations, the baseline attitude/translational control system, system modeling, and simulation studies.

  15. An all-joint-control master device for single-port laparoscopic surgery robots.

    PubMed

    Shim, Seongbo; Kang, Taehun; Ji, Daekeun; Choi, Hyunseok; Joung, Sanghyun; Hong, Jaesung

    2016-08-01

    Robots for single-port laparoscopic surgery (SPLS) typically have all of their joints located inside abdomen during surgery, whereas with the da Vinci system, only the tip part of the robot arm is inserted and manipulated. A typical master device that controls only the tip with six degrees of freedom (DOFs) is not suitable for use with SPLS robots because of safety concerns. We designed an ergonomic six-DOF master device that can control all of the joints of an SPLS robot. We matched each joint of the master, the slave, and the human arm to decouple all-joint motions of the slave robot. Counterbalance masses were used to reduce operator fatigue. Mapping factors were determined based on kinematic analysis and were used to achieve all-joint control with minimal error at the tip of the slave robot. The proposed master device has two noteworthy features: efficient joint matching to the human arm to decouple each joint motion of the slave robot and accurate mapping factors, which can minimize the trajectory error of the tips between the master and the slave. We confirmed that the operator can manipulate the slave robot intuitively with the master device and that both tips have similar trajectories with minimal error.

  16. Main regulatory pathways, key genes and microRNAs involved in flower formation and development of moso bamboo (Phyllostachys edulis).

    PubMed

    Ge, Wei; Zhang, Ying; Cheng, Zhanchao; Hou, Dan; Li, Xueping; Gao, Jian

    2017-01-01

    Moso bamboo is characterized by infrequent sexual reproduction and erratic flowering habit; however, the molecular biology of flower formation and development is not well studied in this species. We studied the molecular regulation mechanisms of moso bamboo development and flowering by selecting three key regulatory pathways: plant-pathogen interaction, plant hormone signal transduction and protein processing in endoplasmic reticulum at different stages of flowering in moso bamboo. We selected PheDof1, PheMADS14 and six microRNAs involved in the three pathways through KEGG pathway and cluster analysis. Subcellular localization, transcriptional activation, Western blotting, in situ hybridization and qRT-PCR were used to further investigate the expression patterns and regulatory roles of pivotal genes at different flower development stages. Differential expression patterns showed that PheDof1, PheMADS14 and six miRNAs may play vital regulatory roles in flower development and floral transition in moso bamboo. Our research paves way for further studies on metabolic regulatory networks and provides insight into the molecular regulation mechanisms of moso bamboo flowering and senescence. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  17. Berthing simulator for space station and orbiter

    NASA Technical Reports Server (NTRS)

    Veerasamy, Sam

    1991-01-01

    The development of a real-time man-in-the-loop berthing simulator is in progress at NASA Lyndon B. Johnson Space Center (JSC) to conduct a parametric study and to measure forces during contact conditions of the actual docking mechanisms for the Space Station Freedom and the orbiter. In berthing, the docking ports of the Space Station and the orbiter are brought together using the orbiter robotic arm to control the relative motion of the vehicles. The berthing simulator consists of a dynamics docking test system (DDTS), computer system, simulator software, and workstations. In the DDTS, the Space Station, and the orbiter docking mechanisms are mounted on a six-degree-of-freedom (6 DOF) table and a fixed platform above the table. Six load cells are used on the fixed platform to measure forces during contact conditions of the docking mechanisms. Two Encore Concept 32/9780 computers are used to simulate the orbiter robotic arm and to operate the berthing simulator. A systematic procedure for a real-time dynamic initialization is being developed to synchronize the Space Station docking port trajectory with the 6 DOF table movement. The berthing test can be conducted manually or automatically and can be extended for any two orbiting vehicles using a simulated robotic arm. The real-time operation of the berthing simulator is briefly described.

  18. Design and control of a decoupled two degree of freedom translational parallel micro-positioning stage.

    PubMed

    Lai, Lei-Jie; Gu, Guo-Ying; Zhu, Li-Min

    2012-04-01

    This paper presents a novel decoupled two degrees of freedom (2-DOF) translational parallel micro-positioning stage. The stage consists of a monolithic compliant mechanism driven by two piezoelectric actuators. The end-effector of the stage is connected to the base by four independent kinematic limbs. Two types of compound flexure module are serially connected to provide 2-DOF for each limb. The compound flexure modules and mirror symmetric distribution of the four limbs significantly reduce the input and output cross couplings and the parasitic motions. Based on the stiffness matrix method, static and dynamic models are constructed and optimal design is performed under certain constraints. The finite element analysis results are then given to validate the design model and a prototype of the XY stage is fabricated for performance tests. Open-loop tests show that maximum static and dynamic cross couplings between the two linear motions are below 0.5% and -45 dB, which are low enough to utilize the single-input-single-out control strategies. Finally, according to the identified dynamic model, an inversion-based feedforward controller in conjunction with a proportional-integral-derivative controller is applied to compensate for the nonlinearities and uncertainties. The experimental results show that good positioning and tracking performances are achieved, which verifies the effectiveness of the proposed mechanism and controller design. The resonant frequencies of the loaded stage at 2 kg and 5 kg are 105 Hz and 68 Hz, respectively. Therefore, the performance of the stage is reasonably good in term of a 200 N load capacity. © 2012 American Institute of Physics

  19. Effect of ACL graft material on joint forces during a simulated in vivo motion in the porcine knee: examining force during the initial cycles.

    PubMed

    Boguszewski, Daniel V; Wagner, Christopher T; Butler, David L; Shearn, Jason T

    2014-11-01

    This study compared three-dimensional forces in knees containing anterior cruciate ligament (ACL) graft materials versus the native porcine ACL. A six-degree-of-freedom (DOF) robot simulated gait while recording the joint forces and moments. Knees were subjected to 10 cycles of simulated gait in intact, ACL-deficient, and ACL-reconstructed knee states to examine time zero biomechanical performance. Reconstruction was performed using bone-patellar tendon-bone allograft (BPTB), reconstructive porcine tissue matrix (RTM), and an RTM-polymer hybrid (Hybrid). Forces and moments were examined about anatomic DOFs throughout the gait cycle and at three key points during gait: heel strike (HS), mid stance (MS), toe off (TO). Compared to native ACL, each graft restored antero-posterior (A-P) forces throughout gait. However, all failed to mimic normal joint forces in other DOFs. For example, each reconstructed knee showed greater compressive forces at HS and TO compared to the native ACL knee. Overall, the Hybrid graft restored more of the native ACL forces following reconstruction than did BPTB, while RTM grafts were the least successful. If early onset osteoarthritis is in part caused by altered knee kinematics, then understanding how reconstruction materials restore critical force generation during gait is an essential step in improving a patient's long-term prognosis. © 2014 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  20. Knowledge capture and the retirement of the director of finance: succession planning in the San Mateo County Human Services Agency.

    PubMed

    Winship, Kathy

    2012-01-01

    Concern over the impending retirement of several top-level managers led a county agency to engage in efforts aimed at more efficient succession management. Administrators developed plans to prevent the loss of invaluable knowledge and wisdom accompanying retirement of experienced agency leaders. The agency's Director of Finance (DoF) was one of the first key figures projected to retire, and a succession plan was implemented to transfer his knowledge for use after his departure. The knowledge transfer process involved three stages, including: (1) employing the DoF as teacher, having him develop curricula and conduct trainings; (2) engaging the DoF as mentor, allowing an existing staff member and the DoF's successor to shadow and be coached by the DoF; and (3) developing a knowledge management system that could be used after the DoF departed. This case study describes the knowledge transfer process and experiences shared by the DoF and this agency. Copyright © Taylor & Francis Group, LLC

  1. A comparison of the real-time controllability of pattern recognition to conventional myoelectric control for discrete and simultaneous movements

    PubMed Central

    2014-01-01

    Myoelectric control has been used for decades to control powered upper limb prostheses. Conventional, amplitude-based control has been employed to control a single prosthesis degree of freedom (DOF) such as closing and opening of the hand. Within the last decade, new and advanced arm and hand prostheses have been constructed that are capable of actuating numerous DOFs. Pattern recognition control has been proposed to control a greater number of DOFs than conventional control, but has traditionally been limited to sequentially controlling DOFs one at a time. However, able-bodied individuals use multiple DOFs simultaneously, and it may be beneficial to provide amputees the ability to perform simultaneous movements. In this study, four amputees who had undergone targeted motor reinnervation (TMR) surgery with previous training using myoelectric prostheses were configured to use three control strategies: 1) conventional amplitude-based myoelectric control, 2) sequential (one-DOF) pattern recognition control, 3) simultaneous pattern recognition control. Simultaneous pattern recognition was enabled by having amputees train each simultaneous movement as a separate motion class. For tasks that required control over just one DOF, sequential pattern recognition based control performed the best with the lowest average completion times, completion rates and length error. For tasks that required control over 2 DOFs, the simultaneous pattern recognition controller performed the best with the lowest average completion times, completion rates and length error compared to the other control strategies. In the two strategies in which users could employ simultaneous movements (conventional and simultaneous pattern recognition), amputees chose to use simultaneous movements 78% of the time with simultaneous pattern recognition and 64% of the time with conventional control for tasks that required two DOF motions to reach the target. These results suggest that when amputees are given the ability to control multiple DOFs simultaneously, they choose to perform tasks that utilize multiple DOFs with simultaneous movements. Additionally, they were able to perform these tasks with higher performance (faster speed, lower length error and higher completion rates) without losing substantial performance in 1 DOF tasks. PMID:24410948

  2. The wave-based substructuring approach for the efficient description of interface dynamics in substructuring

    NASA Astrophysics Data System (ADS)

    Donders, S.; Pluymers, B.; Ragnarsson, P.; Hadjit, R.; Desmet, W.

    2010-04-01

    In the vehicle design process, design decisions are more and more based on virtual prototypes. Due to competitive and regulatory pressure, vehicle manufacturers are forced to improve product quality, to reduce time-to-market and to launch an increasing number of design variants on the global market. To speed up the design iteration process, substructuring and component mode synthesis (CMS) methods are commonly used, involving the analysis of substructure models and the synthesis of the substructure analysis results. Substructuring and CMS enable efficient decentralized collaboration across departments and allow to benefit from the availability of parallel computing environments. However, traditional CMS methods become prohibitively inefficient when substructures are coupled along large interfaces, i.e. with a large number of degrees of freedom (DOFs) at the interface between substructures. The reason is that the analysis of substructures involves the calculation of a number of enrichment vectors, one for each interface degree of freedom (DOF). Since large interfaces are common in vehicles (e.g. the continuous line connections to connect the body with the windshield, roof or floor), this interface bottleneck poses a clear limitation in the vehicle noise, vibration and harshness (NVH) design process. Therefore there is a need to describe the interface dynamics more efficiently. This paper presents a wave-based substructuring (WBS) approach, which allows reducing the interface representation between substructures in an assembly by expressing the interface DOFs in terms of a limited set of basis functions ("waves"). As the number of basis functions can be much lower than the number of interface DOFs, this greatly facilitates the substructure analysis procedure and results in faster design predictions. The waves are calculated once from a full nominal assembly analysis, but these nominal waves can be re-used for the assembly of modified components. The WBS approach thus enables efficient structural modification predictions of the global modes, so that efficient vibro-acoustic design modification, optimization and robust design become possible. The results show that wave-based substructuring offers a clear benefit for vehicle design modifications, by improving both the speed of component reduction processes and the efficiency and accuracy of design iteration predictions, as compared to conventional substructuring approaches.

  3. National Fire News- Current Wildfires

    MedlinePlus

    ... of Denali Bella Creek Southwest Area Forestry, DOF ST 2,631 0 Bismark Galena Zone BLM 876 ... of Hughes Devil's Elbow Southwest Area Forestry, DOF ST 180 0 Door Mountains Southwest Area Forestry, DOF ...

  4. Theoretical performance analysis of doped optical fibers based on pseudo parameters

    NASA Astrophysics Data System (ADS)

    Karimi, Maryam; Seraji, Faramarz E.

    2010-09-01

    Characterization of doped optical fibers (DOFs) is an essential primary stage for design of DOF-based devices. This paper presents design of novel measurement techniques to determine DOFs parameters using mono-beam propagation in a low-loss medium by generating pseudo parameters for the DOFs. The designed techniques are able to characterize simultaneously the absorption, emission cross-sections (ACS and ECS), and dopant concentration of DOFs. In both the proposed techniques, we assume pseudo parameters for the DOFs instead of their actual values and show that the choice of these pseudo parameters values for design of DOF-based devices, such as erbium-doped fiber amplifier (EDFA), are appropriate and the resulting error is quite negligible when compared with the actual parameters values.Utilization of pseudo ACS and ECS values in design procedure of EDFAs does not require the measurement of background loss coefficient (BLC) and makes the rate equation of the DOFs simple. It is shown that by using the pseudo parameters values obtained by the proposed techniques, the error in the gain of a designed EDFA with a BLC of about 1 dB/km, are about 0.08 dB. It is further indicated that the same scenario holds good for BLC lower than 5 dB/m and higher than 12 dB/m. The proposed characterization techniques have simple procedures and are low cost that can have an advantageous use in manufacturing of the DOFs.

  5. Shared Memory Parallelism for 3D Cartesian Discrete Ordinates Solver

    NASA Astrophysics Data System (ADS)

    Moustafa, Salli; Dutka-Malen, Ivan; Plagne, Laurent; Ponçot, Angélique; Ramet, Pierre

    2014-06-01

    This paper describes the design and the performance of DOMINO, a 3D Cartesian SN solver that implements two nested levels of parallelism (multicore+SIMD) on shared memory computation nodes. DOMINO is written in C++, a multi-paradigm programming language that enables the use of powerful and generic parallel programming tools such as Intel TBB and Eigen. These two libraries allow us to combine multi-thread parallelism with vector operations in an efficient and yet portable way. As a result, DOMINO can exploit the full power of modern multi-core processors and is able to tackle very large simulations, that usually require large HPC clusters, using a single computing node. For example, DOMINO solves a 3D full core PWR eigenvalue problem involving 26 energy groups, 288 angular directions (S16), 46 × 106 spatial cells and 1 × 1012 DoFs within 11 hours on a single 32-core SMP node. This represents a sustained performance of 235 GFlops and 40:74% of the SMP node peak performance for the DOMINO sweep implementation. The very high Flops/Watt ratio of DOMINO makes it a very interesting building block for a future many-nodes nuclear simulation tool.

  6. Adding Liquid Payloads Effects to the 6-DOF Trajectory of Spinning Projectiles

    DTIC Science & Technology

    2010-03-01

    Adding Liquid Payloads Effects to the 6-DOF Trajectory of Spinning Projectiles by Gene R. Cooper ARL-TR-5118 March 2010...Liquid Payloads Effects to the 6-DOF Trajectory of Spinning Projectiles Gene R. Cooper Weapons and Materials Research Directorate, ARL...September 2007 4. TITLE AND SUBTITLE Adding Liquid Payloads Effects to the 6-DOF Trajectory of Spinning Projectiles 5a. CONTRACT NUMBER 5b. GRANT

  7. A fast high-precision six-degree-of-freedom relative position sensor

    NASA Astrophysics Data System (ADS)

    Hughes, Gary B.; Macasaet, Van P.; Griswold, Janelle; Sison, Claudia A.; Lubin, Philip; Meinhold, Peter; Suen, Jonathan; Brashears, Travis; Zhang, Qicheng; Madajian, Jonathan

    2016-03-01

    Lasers are commonly used in high-precision measurement and profiling systems. Some laser measurement systems are based on interferometry principles, and others are based on active triangulation, depending on requirements of the application. This paper describes an active triangulation laser measurement system for a specific application wherein the relative position of two fixed, rigid mechanical components is to be measured dynamically with high precision in six degrees of freedom (DOF). Potential applications include optical systems with feedback to control for mechanical vibration, such as target acquisition devices with multiple focal planes. The method uses an array of several laser emitters mounted on one component. The lasers are directed at a reflective surface on the second component. The reflective surface consists of a piecewise-planar pattern such as a pyramid, or more generally a curved reflective surface such as a hyperbolic paraboloid. The reflected spots are sensed at 2-dimensional photodiode arrays on the emitter component. Changes in the relative position of the emitter component and reflective surface will shift the location of the reflected spots within photodiode arrays. Relative motion in any degree of freedom produces independent shifts in the reflected spot locations, allowing full six-DOF relative position determination between the two component positions. Response time of the sensor is limited by the read-out rate of the photodiode arrays. Algorithms are given for position determination with limits on uncertainty and sensitivity, based on laser and spot-sensor characteristics, and assuming regular surfaces. Additional uncertainty analysis is achievable for surface irregularities based on calibration data.

  8. Built-in hyperspectral camera for smartphone in visible, near-infrared and middle-infrared lights region (third report): spectroscopic imaging for broad-area and real-time componential analysis system against local unexpected terrorism and disasters

    NASA Astrophysics Data System (ADS)

    Hosono, Satsuki; Kawashima, Natsumi; Wollherr, Dirk; Ishimaru, Ichiro

    2016-05-01

    The distributed networks for information collection of chemical components with high-mobility objects, such as drones or smartphones, will work effectively for investigations, clarifications and predictions against unexpected local terrorisms and disasters like localized torrential downpours. We proposed and reported the proposed spectroscopic line-imager for smartphones in this conference. In this paper, we will mention the wide-area spectroscopic-image construction by estimating 6 DOF (Degrees Of Freedom: parallel movements=x,y,z and rotational movements=θx, θy, θz) from line data to observe and analyze surrounding chemical-environments. Recently, smartphone movies, what were photographed by peoples happened to be there, had worked effectively to analyze what kinds of phenomenon had happened around there. But when a gas tank suddenly blew up, we did not recognize from visible-light RGB-color cameras what kinds of chemical gas components were polluting surrounding atmospheres. Conventionally Fourier spectroscopy had been well known as chemical components analysis in laboratory usages. But volatile gases should be analyzed promptly at accident sites. And because the humidity absorption in near and middle infrared lights has very high sensitivity, we will be able to detect humidity in the sky from wide field spectroscopic image. And also recently, 6-DOF sensors are easily utilized for estimation of position and attitude for UAV (Unmanned Air Vehicle) or smartphone. But for observing long-distance views, accuracies of angle measurements were not sufficient to merge line data because of leverage theory. Thus, by searching corresponding pixels between line spectroscopic images, we are trying to estimate 6-DOF in high accuracy.

  9. Impedance Control of the Rehabilitation Robot Based on Sliding Mode Control

    NASA Astrophysics Data System (ADS)

    Zhou, Jiawang; Zhou, Zude; Ai, Qingsong

    As an auxiliary treatment, the 6-DOF parallel robot plays an important role in lower limb rehabilitation. In order to improve the efficiency and flexibility of the lower limb rehabilitation training, this paper studies the impedance controller based on the position control. A nonsingular terminal sliding mode control is developed to ensure the trajectory tracking precision and in contrast to traditional PID control strategy in the inner position loop, the system will be more stable. The stability of the system is proved by Lyapunov function to guarantee the convergence of the control errors. Simulation results validate the effectiveness of the target impedance model and show that the parallel robot can adjust gait trajectory online according to the human-machine interaction force to meet the gait request of patients, and changing the impedance parameters can meet the demands of different stages of rehabilitation training.

  10. In-Bore Prostate Transperineal Interventions with an MRI-guided Parallel Manipulator: System Development and Preliminary Evaluation

    PubMed Central

    Eslami, Sohrab; Shang, Weijian; Li, Gang; Patel, Nirav; Fischer, Gregory S.; Tokuda, Junichi; Hata, Nobuhiko; Tempany, Clare M.; Iordachita, Iulian

    2015-01-01

    Background The robot-assisted minimally-invasive surgery is well recognized as a feasible solution for diagnosis and treatment of the prostate cancer in human. Methods In this paper the kinematics of a parallel 4 Degrees-of-Freedom (DOF) surgical manipulator designed for minimally invasive in-bore prostate percutaneous interventions through the patient's perineum. The proposed manipulator takes advantage of 4 sliders actuated by MRI-compatible piezoelectric motors and incremental rotary encoders. Errors, mostly originating from the design and manufacturing process, need to be identified and reduced before the robot is deployed in the clinical trials. Results The manipulator has undergone several experiments to evaluate the repeatability and accuracy of the needle placement which is an essential concern in percutaneous prostate interventions. Conclusion The acquired results endorse the sustainability, precision (about 1 mm in air (in x or y direction) at the needle's reference point) and reliability of the manipulator. PMID:26111458

  11. Quality assurance for a six degrees-of-freedom table using a 3D printed phantom.

    PubMed

    Woods, Kyle; Ayan, Ahmet S; Woollard, Jeffrey; Gupta, Nilendu

    2018-01-01

    To establish a streamlined end-to-end test of a 6 degrees-of-freedom (6DoF) robotic table using a 3D printed phantom for periodic quality assurance. A 3D printed phantom was fabricated with translational and rotational offsets and an imbedded central ball-bearing (BB). The phantom underwent each step of the radiation therapy process: CT simulation in a straight orientation, plan generation using the treatment planning software, setup to offset marks at the linac, registration and corrected 6DoF table adjustments via hidden target test, delivery of a Winston-Lutz test to the BB, and verification of table positioning via field and laser lights. The registration values, maximum total displacement of the combined Winston-Lutz fields, and a pass or fail criterion of the laser and field lights were recorded. The quality assurance process for each of the three linacs were performed for the first 30 days. Within a 95% confidence interval, the overall uncertainty values for both translation and rotation were below 1.0 mm and 0.5° for each linac respectively. When combining the registration values and other uncertainties for all three linacs, the average deviations were within 2.0 mm and 1.0° of the designed translation and rotation offsets of the 3D print respectively. For all three linacs, the maximum total deviation for the Winston-Lutz test did not exceed 1.0 mm. Laser and light field verification was within tolerance every day for all three linacs given the latest guidance documentation for table repositioning. The 3D printer is capable of accurately fabricating a quality assurance phantom for 6DoF positioning verification. The end-to-end workflow allows for a more efficient test of the 6DoF mechanics while including other important tests needed for routine quality assurance. © 2017 The Authors. Journal of Applied Clinical Medical Physics published by Wiley Periodicals, Inc. on behalf of American Association of Physicists in Medicine.

  12. A 3-DOF parallel robot with spherical motion for the rehabilitation and evaluation of balance performance.

    PubMed

    Patanè, Fabrizio; Cappa, Paolo

    2011-04-01

    In this paper a novel electrically actuated parallel robot with three degrees-of-freedom (3 DOF) for dynamic postural studies is presented. The design has been described, the solution to the inverse kinematics has been found, and a numerical solution for the direct kinematics has been proposed. The workspace of the implemented robot is characterized by an angular range of motion of about ±10° for roll and pitch when yaw is in the range ±15°. The robot was constructed and the orientation accuracy was tested by means of an optoelectronic system and by imposing a sinusoidal input, with a frequency of 1 Hz and amplitude of 10°, along the three axes, in sequence. The collected data indicated a phase delay of 1° and an amplitude error of 0.5%-1.5%; similar values were observed for cross-axis sensitivity errors. We also conducted a clinical application on a group of normal subjects, who were standing in equilibrium on the robot base with eyes open (EO) and eyes closed (EC), which was rotated with a tri-axial sinusoidal trajectory with a frequency of 0.5 Hz and amplitude 5° for roll and pitch and 10° for the yaw. The postural configuration of the subjects was recorded with an optoelectronic system. However, due to the mainly technical nature of this paper, only initial validation outcomes are reported here. The clinical application showed that only the tilt and displacement on the sagittal pane of head, trunk, and pelvis in the trials conducted with eyes closed were affected by drift and that the reduction of the yaw rotation and of the mediolateral translation was not a controlled parameter, as happened, instead, for the other anatomical directions.

  13. Controllability of Large SEP for Earth Orbit Raising

    NASA Technical Reports Server (NTRS)

    Woodcock, Gordon

    2004-01-01

    A six-degree-of-freedom (6DOF) simulation was constructed and exercised for a large solar electric propulsion (SEP) vehicle operating in low Earth orbit Nominal power was 500 kWe, with the large array sizes implied. Controllability issues, including gravity gradient, roll maneuvering for Sun tracking, and flexible arrays, and flight control methods, were investigated. Initial findings are that a SEP vehicle of this size is controllable and could be used for orbit raising of heavy payloads.

  14. Autonomous docking ground demonstration (category 3)

    NASA Technical Reports Server (NTRS)

    Lamkin, Steve L.; Eick, Richard E.; Baxter, James M.; Boyd, M. G.; Clark, Fred D.; Lee, Thomas Q.; Othon, L. T.; Prather, Joseph L.; Spehar, Peter T.; Teders, Rebecca J.

    1991-01-01

    The NASA Johnson Space Center (JSC) is involved in the development of an autonomous docking ground demonstration. The demonstration combines the technologies, expertise and facilities of the JSC Tracking and Communications Division (EE), Structures and Mechanics Division (ES), and the Navigation, Guidance and Control Division (EG) and their supporting contractors. The autonomous docking ground demonstration is an evaluation of the capabilities of the laser sensor system to support the docking phase (12ft to contact) when operated in conjunction with the Guidance, Navigation and Control Software. The docking mechanism being used was developed for the Apollo Soyuz Test Program. This demonstration will be conducted using the Six-Degrees of Freedom (6-DOF) Dynamic Test System (DTS). The DTS environment simulates the Space Station Freedom as the stationary or target vehicle and the Orbiter as the active or chase vehicle. For this demonstration the laser sensor will be mounted on the target vehicle and the retroreflectors on the chase vehicle. This arrangement was used to prevent potential damage to the laser. The sensor system. GN&C and 6-DOF DTS will be operated closed-loop. Initial condition to simulate vehicle misalignments, translational and rotational, will be introduced within the constraints of the systems involved. Detailed description of each of the demonstration components (e.g., Sensor System, GN&C, 6-DOF DTS and supporting computer configuration) including their capabilities and limitations will be discussed. A demonstration architecture drawing and photographs of the test configuration will be presented.

  15. Autonomous docking ground demonstration (category 3)

    NASA Astrophysics Data System (ADS)

    Lamkin, Steve L.; Eick, Richard E.; Baxter, James M.; Boyd, M. G.; Clark, Fred D.; Lee, Thomas Q.; Othon, L. T.; Prather, Joseph L.; Spehar, Peter T.; Teders, Rebecca J.

    The NASA Johnson Space Center (JSC) is involved in the development of an autonomous docking ground demonstration. The demonstration combines the technologies, expertise and facilities of the JSC Tracking and Communications Division (EE), Structures and Mechanics Division (ES), and the Navigation, Guidance and Control Division (EG) and their supporting contractors. The autonomous docking ground demonstration is an evaluation of the capabilities of the laser sensor system to support the docking phase (12ft to contact) when operated in conjunction with the Guidance, Navigation and Control Software. The docking mechanism being used was developed for the Apollo Soyuz Test Program. This demonstration will be conducted using the Six-Degrees of Freedom (6-DOF) Dynamic Test System (DTS). The DTS environment simulates the Space Station Freedom as the stationary or target vehicle and the Orbiter as the active or chase vehicle. For this demonstration the laser sensor will be mounted on the target vehicle and the retroreflectors on the chase vehicle. This arrangement was used to prevent potential damage to the laser. The sensor system. GN&C and 6-DOF DTS will be operated closed-loop. Initial condition to simulate vehicle misalignments, translational and rotational, will be introduced within the constraints of the systems involved. Detailed description of each of the demonstration components (e.g., Sensor System, GN&C, 6-DOF DTS and supporting computer configuration) including their capabilities and limitations will be discussed. A demonstration architecture drawing and photographs of the test configuration will be presented.

  16. A versatile photogrammetric camera automatic calibration suite for multispectral fusion and optical helmet tracking

    NASA Astrophysics Data System (ADS)

    de Villiers, Jason; Jermy, Robert; Nicolls, Fred

    2014-06-01

    This paper presents a system to determine the photogrammetric parameters of a camera. The lens distortion, focal length and camera six degree of freedom (DOF) position are calculated. The system caters for cameras of different sensitivity spectra and fields of view without any mechanical modifications. The distortion characterization, a variant of Brown's classic plumb line method, allows many radial and tangential distortion coefficients and finds the optimal principal point. Typical values are 5 radial and 3 tangential coefficients. These parameters are determined stably and demonstrably produce superior results to low order models despite popular and prevalent misconceptions to the contrary. The system produces coefficients to model both the distorted to undistorted pixel coordinate transformation (e.g. for target designation) and the inverse transformation (e.g. for image stitching and fusion) allowing deterministic rates far exceeding real time. The focal length is determined to minimise the error in absolute photogrammetric positional measurement for both multi camera systems or monocular (e.g. helmet tracker) systems. The system determines the 6 DOF position of the camera in a chosen coordinate system. It can also determine the 6 DOF offset of the camera relative to its mechanical mount. This allows faulty cameras to be replaced without requiring a recalibration of the entire system (such as an aircraft cockpit). Results from two simple applications of the calibration results are presented: stitching and fusion of the images from a dual-band visual/ LWIR camera array, and a simple laboratory optical helmet tracker.

  17. Robust Real-Time Musculoskeletal Modeling Driven by Electromyograms.

    PubMed

    Durandau, Guillaume; Farina, Dario; Sartori, Massimo

    2018-03-01

    Current clinical biomechanics involves lengthy data acquisition and time-consuming offline analyses with biomechanical models not operating in real-time for man-machine interfacing. We developed a method that enables online analysis of neuromusculoskeletal function in vivo in the intact human. We used electromyography (EMG)-driven musculoskeletal modeling to simulate all transformations from muscle excitation onset (EMGs) to mechanical moment production around multiple lower-limb degrees of freedom (DOFs). We developed a calibration algorithm that enables adjusting musculoskeletal model parameters specifically to an individual's anthropometry and force-generating capacity. We incorporated the modeling paradigm into a computationally efficient, generic framework that can be interfaced in real-time with any movement data collection system. The framework demonstrated the ability of computing forces in 13 lower-limb muscle-tendon units and resulting moments about three joint DOFs simultaneously in real-time. Remarkably, it was capable of extrapolating beyond calibration conditions, i.e., predicting accurate joint moments during six unseen tasks and one unseen DOF. The proposed framework can dramatically reduce evaluation latency in current clinical biomechanics and open up new avenues for establishing prompt and personalized treatments, as well as for establishing natural interfaces between patients and rehabilitation systems. The integration of EMG with numerical modeling will enable simulating realistic neuromuscular strategies in conditions including muscular/orthopedic deficit, which could not be robustly simulated via pure modeling formulations. This will enable translation to clinical settings and development of healthcare technologies including real-time bio-feedback of internal mechanical forces and direct patient-machine interfacing.

  18. Can a semi-automated surface matching and principal axis-based algorithm accurately quantify femoral shaft fracture alignment in six degrees of freedom?

    PubMed

    Crookshank, Meghan C; Beek, Maarten; Singh, Devin; Schemitsch, Emil H; Whyne, Cari M

    2013-07-01

    Accurate alignment of femoral shaft fractures treated with intramedullary nailing remains a challenge for orthopaedic surgeons. The aim of this study is to develop and validate a cone-beam CT-based, semi-automated algorithm to quantify the malalignment in six degrees of freedom (6DOF) using a surface matching and principal axes-based approach. Complex comminuted diaphyseal fractures were created in nine cadaveric femora and cone-beam CT images were acquired (27 cases total). Scans were cropped and segmented using intensity-based thresholding, producing superior, inferior and comminution volumes. Cylinders were fit to estimate the long axes of the superior and inferior fragments. The angle and distance between the two cylindrical axes were calculated to determine flexion/extension and varus/valgus angulation and medial/lateral and anterior/posterior translations, respectively. Both surfaces were unwrapped about the cylindrical axes. Three methods of matching the unwrapped surface for determination of periaxial rotation were compared based on minimizing the distance between features. The calculated corrections were compared to the input malalignment conditions. All 6DOF were calculated to within current clinical tolerances for all but two cases. This algorithm yielded accurate quantification of malalignment of femoral shaft fractures for fracture gaps up to 60 mm, based on a single CBCT image of the fractured limb. Copyright © 2012 IPEM. Published by Elsevier Ltd. All rights reserved.

  19. Omnidirectional angle constraint based dynamic six-degree-of-freedom measurement for spacecraft rendezvous and docking simulation

    NASA Astrophysics Data System (ADS)

    Shi, Shendong; Yang, Linghui; Lin, Jiarui; Ren, Yongjie; Guo, Siyang; Zhu, Jigui

    2018-04-01

    In this paper we present a novel omnidirectional angle constraint based method for dynamic 6-DOF (six-degree-of-freedom) measurement. A photoelectric scanning measurement network is employed whose photoelectric receivers are fixed on the measured target. They are in a loop distribution and receive signals from rotating transmitters. Each receiver indicates an angle constraint direction. Therefore, omnidirectional angle constraints can be constructed in each rotation cycle. By solving the constrained optimization problem, 6-DOF information can be obtained, which is independent of traditional rigid coordinate system transformation. For the dynamic error caused by the measurement principle, we present an interpolation method for error reduction. Accuracy testing is performed in an 8  ×  8 m measurement area with four transmitters. The experimental results show that the dynamic orientation RMSEs (root-mean-square errors) are reduced from 0.077° to 0.044°, 0.040° to 0.030° and 0.032° to 0.015° in the X, Y, and Z axes, respectively. The dynamic position RMSE is reduced from 0.65 mm to 0.24 mm. This method is applied during the final approach phase in the rendezvous and docking simulation. Experiments under different conditions are performed in a 40  ×  30 m area, and the method is verified to be effective.

  20. Computer-aided surgical planner for a new bone deformity correction device using axis-angle representation.

    PubMed

    Wu, Ying Ying; Plakseychuk, Anton; Shimada, Kenji

    2014-11-01

    Current external fixators for distraction osteogenesis (DO) are unable to correct all types of deformities in the lower limb and are difficult to use because of the lack of a pre-surgical planning system. We propose a DO system that consists of a surgical planner and a new, easy-to-setup unilateral fixator that not only corrects all lower limb deformity, but also generates the contralateral/predefined bone shape. Conventionally, bulky constructs with six or more joints (six degrees of freedom, 6DOF) are needed to correct a 3D deformity. By applying the axis-angle representation, we can achieve that with a compact construct with only two joints (2DOF). The proposed system makes use of computer-aided design software and computational methods to plan and simulate the planned procedure. Results of our stress analysis suggest that the stiffness of our proposed fixator is comparable to that of the Orthofix unilateral external fixator. We tested the surgical system on a model of an adult deformed tibia and the resulting bone trajectory deviates from the target bone trajectory by 1.8mm, which is below our defined threshold error of 2mm. We also extracted the transformation matrix that defines the deformity from the bone model and simulated the planned procedure. Copyright © 2014 IPEM. Published by Elsevier Ltd. All rights reserved.

  1. Transcriptome analyses of the Dof-like gene family in grapevine reveal its involvement in berry, flower and seed development.

    PubMed

    da Silva, Danielle Costenaro; da Silveira Falavigna, Vítor; Fasoli, Marianna; Buffon, Vanessa; Porto, Diogo Denardi; Pappas, Georgios Joannis; Pezzotti, Mario; Pasquali, Giancarlo; Revers, Luís Fernando

    2016-01-01

    The Dof (DNA-binding with one finger) protein family spans a group of plant transcription factors involved in the regulation of several functions, such as plant responses to stress, hormones and light, phytochrome signaling and seed germination. Here we describe the Dof-like gene family in grapevine (Vitis vinifera L.), which consists of 25 genes coding for Dof. An extensive in silico characterization of the VviDofL gene family was performed. Additionally, the expression of the entire gene family was assessed in 54 grapevine tissues and organs using an integrated approach with microarray (cv Corvina) and real-time PCR (cv Pinot Noir) analyses. The phylogenetic analysis comparing grapevine sequences with those of Arabidopsis, tomato, poplar and already described Dof genes in other species allowed us to identify several duplicated genes. The diversification of grapevine DofL genes during evolution likely resulted in a broader range of biological roles. Furthermore, distinct expression patterns were identified between samples analyzed, corroborating such hypothesis. Our expression results indicate that several VviDofL genes perform their functional roles mainly during flower, berry and seed development, highlighting their importance for grapevine growth and production. The identification of similar expression profiles between both approaches strongly suggests that these genes have important regulatory roles that are evolutionally conserved between grapevine cvs Corvina and Pinot Noir.

  2. Transcriptome analyses of the Dof-like gene family in grapevine reveal its involvement in berry, flower and seed development

    PubMed Central

    da Silva, Danielle Costenaro; da Silveira Falavigna, Vítor; Fasoli, Marianna; Buffon, Vanessa; Porto, Diogo Denardi; Pappas, Georgios Joannis; Pezzotti, Mario; Pasquali, Giancarlo; Revers, Luís Fernando

    2016-01-01

    The Dof (DNA-binding with one finger) protein family spans a group of plant transcription factors involved in the regulation of several functions, such as plant responses to stress, hormones and light, phytochrome signaling and seed germination. Here we describe the Dof-like gene family in grapevine (Vitis vinifera L.), which consists of 25 genes coding for Dof. An extensive in silico characterization of the VviDofL gene family was performed. Additionally, the expression of the entire gene family was assessed in 54 grapevine tissues and organs using an integrated approach with microarray (cv Corvina) and real-time PCR (cv Pinot Noir) analyses. The phylogenetic analysis comparing grapevine sequences with those of Arabidopsis, tomato, poplar and already described Dof genes in other species allowed us to identify several duplicated genes. The diversification of grapevine DofL genes during evolution likely resulted in a broader range of biological roles. Furthermore, distinct expression patterns were identified between samples analyzed, corroborating such hypothesis. Our expression results indicate that several VviDofL genes perform their functional roles mainly during flower, berry and seed development, highlighting their importance for grapevine growth and production. The identification of similar expression profiles between both approaches strongly suggests that these genes have important regulatory roles that are evolutionally conserved between grapevine cvs Corvina and Pinot Noir. PMID:27610237

  3. Transfer of bacteriophage MS2 and fluorescein from N95 filtering facepiece respirators to hands: Measuring fomite potential

    PubMed Central

    Brady, Tyler M.; Strauch, Amanda L.; Almaguer, Claudia M.; Niezgoda, George; Shafer, Ronald E.; Yorio, Patrick L.; Fisher, Edward M.

    2017-01-01

    Contact transmission of pathogens from personal protective equipment is a concern within the healthcare industry. During public health emergency outbreaks, resources become constrained and the reuse of personal protective equipment, such as N95 filtering facepiece respirators, may be needed. This study was designed to characterize the transfer of bacteriophage MS2 and fluorescein between filtering facepiece respirators and the wearer’s hands during three simulated use scenarios. Filtering facepiece respirators were contaminated with MS2 and fluorescein in droplets or droplet nuclei. Thirteen test subjects performed filtering facepiece respirator use scenarios including improper doffing, proper doffing and reuse, and improper doffing and reuse. Fluorescein and MS2 contamination transfer were quantified. The average MS2 transfer from filtering facepiece respirators to the subjects’ hands ranged from 7.6–15.4% and 2.2–2.7% for droplet and droplet nuclei derived contamination, respectively. Handling filtering facepiece respirators contaminated with droplets resulted in higher levels of MS2 transfer compared to droplet nuclei for all use scenarios (p = 0.007). MS2 transfer from droplet contaminated filtering facepiece respirators during improper doffing and reuse was greater than transfer during improper doffing (p = 0.008) and proper doffing and reuse (p = 0.042). Droplet contamination resulted in higher levels of fluorescein transfer compared to droplet nuclei contaminated filtering facepiece respirators for all use scenarios (p = 0.009). Fluorescein transfer was greater for improper doffing and reuse (p = 0.007) from droplet contaminated masks compared to droplet nuclei contaminated filtering facepiece respirators and for improper doffing and reuse when compared improper doffing (p = 0.017) and proper doffing and reuse (p = 0.018) for droplet contaminated filtering facepiece respirators. For droplet nuclei contaminated filtering facepiece respirators, the difference in MS2 and fluorescein transfer did not reach statistical significance when comparing any of the use scenarios. The findings suggest that the results of fluorescein and MS2 transfer were consistent and highly correlated across the conditions of study. The data supports CDC recommendations for using proper doffing techniques and discarding filtering facepiece respirators that are directly contaminated with secretions from a cough or sneeze. PMID:28650715

  4. Comparing position and orientation accuracy of different electromagnetic sensors for tracking during interventions.

    PubMed

    Nijkamp, Jasper; Schermers, Bram; Schmitz, Sander; de Jonge, Sofieke; Kuhlmann, Koert; van der Heijden, Ferdinand; Sonke, Jan-Jakob; Ruers, Theo

    2016-08-01

    To compare the position and orientation accuracy between using one 6-degree of freedom (DOF) electromagnetic (EM) sensor, or the position information of three 5DOF sensors within the scope of tumor tracking. The position accuracy of Northern Digital Inc Aurora 5DOF and 6DOF sensors was determined for a table-top field generator (TTFG) up to a distance of 52 cm. For each sensor 716 positions were measured for 10 s at 15 Hz. Orientation accuracy was determined for each of the orthogonal axis at the TTFG distances of 17, 27, 37 and 47 cm. For the 6DOF sensors, orientation was determined for sensors in-line with the orientation axis, and perpendicular. 5DOF orientation accuracy was determined for a theoretical 4 cm tumor. An optical tracking system was used as reference. Position RMSE and jitter were comparable between the sensors and increasing with distance. Jitter was within 0.1 cm SD within 45 cm distance to the TTFG. Position RMSE was approximately 0.1 cm up to 32 cm distance, increasing to 0.4 cm at 52 cm distance. Orientation accuracy of the 6DOF sensor was within 1[Formula: see text], except when the sensor was in-line with the rotation axis perpendicular to the TTFG plane (4[Formula: see text] errors at 47 cm). Orientation accuracy using 5DOF positions was within 1[Formula: see text] up to 37 cm and 2[Formula: see text] at 47 cm. The position and orientation accuracy of a 6DOF sensor was comparable with a sensor configuration consisting of three 5DOF sensors. To achieve tracking accuracy within 1 mm and 1[Formula: see text], the distance to the TTFG should be limited to approximately 30 cm.

  5. Design and implementation of a 2-DOF PID compensation for magnetic levitation systems.

    PubMed

    Ghosh, Arun; Rakesh Krishnan, T; Tejaswy, Pailla; Mandal, Abhisek; Pradhan, Jatin K; Ranasingh, Subhakant

    2014-07-01

    This paper employs a 2-DOF (degree of freedom) PID controller for compensating a physical magnetic levitation system. It is shown that because of having a feedforward gain in the proposed 2-DOF PID control, the transient performance of the compensated system can be changed in a desired manner unlike the conventional 1-DOF PID control. It is also shown that for a choice of PID parameters, although the theoretical loop robustness is the same for both the compensated systems, in real-time, 2-DOF PID control may provide superior robustness if a suitable choice of the feedforward parameter is made. The results are verified through simulations and experiments. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.

  6. Cycle time reduction using lean six sigma in make-to-order (MTO) environment: Conceptual framework

    NASA Astrophysics Data System (ADS)

    Man, Siti Mariam; Zain, Zakiyah; Nawawi, Mohd Kamal Mohd

    2015-12-01

    This paper outlines the framework for application of lean six sigma (LSS) methodology to improve semiconductor assembly cycle time in a make-to-order (MTO) business environment. The cycle time reduction is the prime objective in the context of an overall productivity improvement particularly in the MTO environment. The interaction of the production rate and cycle time is described, while the emphasis is on Define-Measure-Analyze-Improve-Control (DMAIC) and Plan-Do-Check-Act (PDCA) activities. A framework for the conceptual understanding is provided along with practical implementation issues. A relevant measure for the degree of flexibility (DOF) in the context of quick setup is also discussed.

  7. Design and fabrication of a 1-DOF drive mode and 2-DOF sense mode micro-gyroscope using SU-8 based UV-LIGA process

    NASA Astrophysics Data System (ADS)

    Verma, Payal; Juneja, Sucheta; Savelyev, Dmitry A.; Khonina, Svetlana N.; Gopal, Ram

    2016-04-01

    This paper presents design and fabrication of a 1-DOF (degree-of-freedom) drive mode and 2-DOF sense mode micro-gyroscope. It is an inherently robust structure and offers a high sense frequency bandwidth. The proposed design utilizes resonance of the1-DOF drive mode oscillator and employs dynamic amplification concept in sense modes to increase the sensitivity while maintaining robustness. The 2-DOF in the sense direction renders the device immune to process imperfections and environmental effects. The design is simulated using FEA software (CoventorWare®). The device is designed considering process compatibility with SU-8 based UV-LIGA process, which is an economical fabrication technique. The complete fabrication process is presented along with SEM images of the fabricated device. The device has 9 µm thick Nickel as the key structural layer with an overall reduced key structure size of 2.2 mm by 2.1 mm.

  8. From reaching to reach-to-grasp: the arm posture difference and its implications on human motion control strategy.

    PubMed

    Li, Zhi; Milutinović, Dejan; Rosen, Jacob

    2017-05-01

    Reach-to-grasp arm postures differ from those in pure reaching because they are affected by grasp position/orientation, rather than simple transport to a position during a reaching motion. This paper investigates this difference via an analysis of experimental  data collected on reaching and reach-to-grasp motions. A seven-degree-of-freedom (DOFs) kinematic arm model with the swivel angle is used for the motion analysis. Compared to a widely used anatomical arm model, this model distinguishes clearly the four grasping-relevant DOFs (GR-DOFs) that are affected by positions and orientations of the objects to be grasped. These four GR-DOFs include the swivel angle that measures the elbow rotation about the shoulder-wrist axis, and three wrist joint angles. For each GR-DOF, we quantify position vs orientation task-relevance bias that measures how much the DOF is affected by the grasping position vs orientation. The swivel angle and forearm supination have similar bias, and the analysis of their motion suggests two hypotheses regarding the synergistic coordination of the macro- and micro-structures of the human arm (1) DOFs with similar task-relevance are synergistically coordinated; and (2) such synergy breaks when a task-relevant DOF is close to its joint limit without necessarily reaching the limit. This study provides a motion analysis method to reduce the control complexity for reach-to-grasp tasks, and suggests using dynamic coupling to coordinate the hand and arm of upper-limb exoskeletons.

  9. Structural and thermal interface characteristics of Stirling cycle cryocoolers for space applications

    NASA Technical Reports Server (NTRS)

    Boyle, R.; James, E.; Miller, P.; Arillo, V.; Sparr, L.; Castles, S.

    1991-01-01

    Integration of a Stirling cycle cryocooler into a flight system will require careful attention to the thermal, structural, and electrical interfaces between the cryocooler, the instrument and the spacecraft. These issues are currently under investigation by National Aeronautics and Space Administration/Goddard Space Flight Center personnel in laboratory tests of representative longlife cryocoolers. An 80 K cryocooler has been instrumented as a testbed for vibration control systems characterization. Initial vibration data using a new six-DOF force dynamometer is presented in this report.

  10. An integrated environment for tactical guidance research and evaluation

    NASA Technical Reports Server (NTRS)

    Goodrich, Kenneth H.; Mcmanus, John W.

    1990-01-01

    NASA-Langley's Tactical Guidance Research and Evaluation System (TGRES) constitutes an integrated environment for the development of tactical guidance algorithms and evaluating the effects of novel technologies; the modularity of the system allows easy modification or replacement of system elements in order to conduct evaluations of alternative technologies. TGRES differs from existing systems in its capitalization on AI programming techniques for guidance-logic implementation. Its ability to encompass high-fidelity, six-DOF simulation models will facilitate the analysis of complete aircraft dynamics.

  11. A novel method for simultaneous measurement of doped optical fiber parameters

    NASA Astrophysics Data System (ADS)

    Karimi, M.; Seraji, F. E.

    2010-05-01

    Simultaneous measurement technique of evaluating the doped optical fibers (DOF) parameters is a suitable scheme for DOF production industries. In this paper, we introduce a novel technique to characterize simultaneously the main parameters of DOF such as absorption and emission cross-sections (ACS, ECS), background loss coefficient (BLC), and low dopant concentration using the gain equation of DOFs. We used this new method to determine the ACS, ECS, BLC in a standard sample of Al-P-Erbium doped optical fiber. The results have been analyzed and compared with other reports.

  12. Expression of the Maize Dof1 Transcription Factor in Wheat and Sorghum

    PubMed Central

    Peña, Pamela A.; Quach, Truyen; Sato, Shirley; Ge, Zhengxiang; Nersesian, Natalya; Changa, Taity; Dweikat, Ismail; Soundararajan, Madhavan; Clemente, Tom E.

    2017-01-01

    Nitrogen is essential for plant growth and development. Improving the ability of plants to acquire and assimilate nitrogen more efficiently is a key agronomic parameter that will augment sustainability in agriculture. A transcription factor approach was pursued to address improvement of nitrogen use efficiency in two major commodity crops. To this end, the Zea mays Dof1 (ZmDof1) transcription factor was expressed in both wheat (Triticum aestivum) and sorghum (Sorghum bicolor) either constitutively, UBI4 promoter from sugarcane, or in a tissue specific fashion via the maize rbcS1 promoter. The primary transcription activation target of ZmDof1, phosphoenolpyruvate carboxylase (PEPC), is observed in transgenic wheat events. Expression ZmDof1 under control of the rbcs1 promoter translates to increase in biomass and yield components in wheat. However, constitutive expression of ZmDof1 led to the down-regulation of genes involved in photosynthesis and the functional apparatus of chloroplasts, and an outcome that negatively impacts photosynthesis, height, and biomass in wheat. Similar patterns were also observed in sorghum transgenic events harboring the constitutive expression cassette of ZmDof1. These results indicate that transcription factor strategies to boost agronomic phenotypic outcomes in crops need to consider expression patterns of the genetic elements to be introduced. PMID:28424717

  13. Spectral Upscaling for Graph Laplacian Problems with Application to Reservoir Simulation

    DOE PAGES

    Barker, Andrew T.; Lee, Chak S.; Vassilevski, Panayot S.

    2017-10-26

    Here, we consider coarsening procedures for graph Laplacian problems written in a mixed saddle-point form. In that form, in addition to the original (vertex) degrees of freedom (dofs), we also have edge degrees of freedom. We extend previously developed aggregation-based coarsening procedures applied to both sets of dofs to now allow more than one coarse vertex dof per aggregate. Those dofs are selected as certain eigenvectors of local graph Laplacians associated with each aggregate. Additionally, we coarsen the edge dofs by using traces of the discrete gradients of the already constructed coarse vertex dofs. These traces are defined on themore » interface edges that connect any two adjacent aggregates. The overall procedure is a modification of the spectral upscaling procedure developed in for the mixed finite element discretization of diffusion type PDEs which has the important property of maintaining inf-sup stability on coarse levels and having provable approximation properties. We consider applications to partitioning a general graph and to a finite volume discretization interpreted as a graph Laplacian, developing consistent and accurate coarse-scale models of a fine-scale problem.« less

  14. Biomimetic shoulder complex based on 3-PSS/S spherical parallel mechanism

    NASA Astrophysics Data System (ADS)

    Hou, Yulei; Hu, Xinzhe; Zeng, Daxing; Zhou, Yulin

    2015-01-01

    The application of the parallel mechanism is still limited in the humanoid robot fields, and the existing parallel humanoid robot joint has not yet been reflected the characteristics of the parallel mechanism completely, also failed to solve the problem, such as small workspace, effectively. From the structural and functional bionic point of view, a three degrees of freedom(DOFs) spherical parallel mechanism for the shoulder complex of the humanoid robot is presented. According to the structure and kinetic characteristics analysis of the human shoulder complex, 3-PSS/S(P for prismatic pair, S for spherical pair) is chosen as the original configuration for the shouder complex. Using genetic algorithm, the optimization of the 3-PSS/S spherical parallel mechanism is performed, and the orientation workspace of the prototype mechanism is enlarged obviously. Combining the practical structure characteristics of the human shouder complex, an offset output mode, which means the output rod of the mechanism turn to any direction at the point a certain distance from the rotation center of the mechanism, is put forward, which provide possibility for the consistent of the workspace of the mechanism and the actual motion space of the human body shoulder joint. The relationship of the attitude angles between different coordinate system is derived, which establishs the foundation for the motion descriptions under different conditions and control development. The 3-PSS/S spherical parallel mechanism is proposed for the shoulder complex, and the consistence of the workspace of the mechanism and the human shoulder complex is realized by the stuctural parameter optimization and the offset output design.

  15. A 3-RSR Haptic Wearable Device for Rendering Fingertip Contact Forces.

    PubMed

    Leonardis, Daniele; Solazzi, Massimiliano; Bortone, Ilaria; Frisoli, Antonio

    2017-01-01

    A novel wearable haptic device for modulating contact forces at the fingertip is presented. Rendering of forces by skin deformation in three degrees of freedom (DoF), with contact-no contact capabilities, was implemented through rigid parallel kinematics. The novel asymmetrical three revolute-spherical-revolute (3-RSR) configuration allowed compact dimensions with minimum encumbrance of the hand workspace. The device was designed to render constant to low frequency deformation of the fingerpad in three DoF, combining light weight with relatively high output forces. A differential method for solving the non-trivial inverse kinematics is proposed and implemented in real time for controlling the device. The first experimental activity evaluated discrimination of different fingerpad stretch directions in a group of five subjects. The second experiment, enrolling 19 subjects, evaluated cutaneous feedback provided in a virtual pick-and-place manipulation task. Stiffness of the fingerpad plus device was measured and used to calibrate the physics of the virtual environment. The third experiment with 10 subjects evaluated interaction forces in a virtual lift-and-hold task. Although with different performance in the two manipulation experiments, overall results show that participants better controlled interaction forces when the cutaneous feedback was active, with significant differences between the visual and visuo-haptic experimental conditions.

  16. Supporting 64-bit global indices in Epetra and other Trilinos packages :

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jhurani, Chetan; Austin, Travis M.; Heroux, Michael Allen

    The Trilinos Project is an effort to facilitate the design, development, integration and ongoing support of mathematical software libraries within an object-oriented framework. It is intended for large-scale, complex multiphysics engineering and scientific applications [2, 4, 3]. Epetra is one of its basic packages. It provides serial and parallel linear algebra capabilities. Before Trilinos version 11.0, released in 2012, Epetra used the C++ int data-type for storing global and local indices for degrees of freedom (DOFs). Since int is typically 32-bit, this limited the largest problem size to be smaller than approximately two billion DOFs. This was true even ifmore » a distributed memory machine could handle larger problems. We have added optional support for C++ long long data-type, which is at least 64-bit wide, for global indices. To save memory, maintain the speed of memory-bound operations, and reduce further changes to the code, the local indices are still 32-bit. We document the changes required to achieve this feature and how the new functionality can be used. We also report on the lessons learned in modifying a mature and popular package from various perspectives design goals, backward compatibility, engineering decisions, C++ language features, effects on existing users and other packages, and build integration.« less

  17. UDOF direct improvement by modulating mask absorber thickness

    NASA Astrophysics Data System (ADS)

    Yu, Tuan-Yen; Lio, En Chuan; Chen, Po Tsang; Wei, Chih I.; Chen, Yi Ting; Peng, Ming Chun; Chou, William; Yu, Chun Chi

    2016-10-01

    As the process generation migrate to advanced and smaller dimension or pitch, the mask and resist 3D effects will impact the lithography focus common window severely because of both individual depth-of-focus (iDOF) range decrease and center mismatch. Furthermore, some chemical or thermal factors, such as PEB (Post Exposure Bake) also worsen the usable depth-of-focus (uDOF) performance. So the mismatch of thru-pitch iDOF center should be considered as a lithography process integration issue, and more complicated to partition the 3D effects induced by optical or chemical factors. In order to reduce the impact of 3D effects induced by both optical and chemical issues, and improve iDOF center mismatch, we would like to propose a mask absorber thickness offset approach, which is directly to compensate the iDOF center bias by adjusting mask absorber thickness, for iso, semi-iso or dense characteristics in line, space or via patterns to enlarge common process window, i.e uDOF, which intends to provide similar application as Flexwave[1] (ASML trademark). By the way, since mask absorber thickness offset approach is similar to focus tuning or change on wafer lithography process, it could be acted as the process tuning method of photoresist (PR) profile optimization locally, PR scum improvement in specific patterns or to modulate etching bias to meet process integration request. For mass production consideration, and available material, current att-PSM blank, quartz, MoSi with chrome layer as hard-mask in reticle process, will be implemented in this experiment, i.e. chrome will be kept remaining above partial thru-pitch patterns, and act as the absorber thickness bias in different patterns. And then, from the best focus offset of thru-pitch patterns, the iDOF center shifts could be directly corrected and to enlarge uDOF by increasing the overlap of iDOF. Finally, some negative tone development (NTD) result in line patterns will be demonstrated as well.

  18. Intelligent Robotic Systems Study (IRSS), phase 2

    NASA Technical Reports Server (NTRS)

    1990-01-01

    Under the Intelligent Robotics System Study (IRSS) contract, a generalized robotic control architecture was developed for use with the ProtoFlight Manipulator Arm (PFMA). The controller built for the PFMA provides localized position based force control, teleoperation and advanced path recording and playback capabilities. Various hand controllers can be used with the system in conjunction with a synthetic time delay capability to provide a realistic test bed for typical satellite servicing tasks. The configuration of the IRSS system is illustrated and discussed. The PFMA has six computer controllable degrees of freedom (DOF) plus a seventh manually indexable DOF, making the manipulator a pseudo 7 DOF mechanism. Because the PFMA was not developed to operate in a gravity field, but rather in space, it is counter balanced at the shoulder, elbow and wrist and a spring counterbalance has been added near the wrist to provide additional support. Built with long slender intra-joint linkages, the PFMA has a workspace nearly 2 meters deep and possesses sufficient dexterity to perform numerous satellite servicing tasks. The manipulator is arranged in a shoulder-yaw, pitch, elbow-pitch, and wrist-pitch, yaw, roll configuration, with an indexable shoulder roll joint. Digital control of the PFMA is implemented using a variety of single board computers developed by Heurikon Corporation and other manufacturers. The IRSS controller is designed to be a multi-rate, multi-tasking system. Independent joint servos run at a 134 Hz rate and position based impedance control functions at 67 Hz. Autonomous path generation and hand controller inputs are processed at a 33 Hz.

  19. Six degree-of-freedom knee joint kinematics in obese individuals with knee pain during gait.

    PubMed

    Li, Jing-Sheng; Tsai, Tsung-Yuan; Felson, David T; Li, Guoan; Lewis, Cara L

    2017-01-01

    Knee joint pain is a common symptom in obese individuals and walking is often prescribed as part of management programs. Past studies in obese individuals have focused on standing alignment and kinematics in the sagittal and coronal planes. Investigation of 6 degree-of-freedom (6DOF) knee joint kinematics during standing and gait is important to thoroughly understand knee function in obese individuals with knee pain. This study aimed to investigate the 6DOF knee joint kinematics in standing and during gait in obese patients using a validated fluoroscopic imaging system. Ten individuals with obesity and knee pain were recruited. While standing, the knee was in 7.4±6.3°of hyperextension, 2.8±3.3° of abduction and 5.6±7.3° of external rotation. The femoral center was located 0.7±3.1mm anterior and 5.1±1.5mm medial to the tibial center. During treadmill gait, the sagittal plane motion, i.e., flexion/extension and anterior-posterior translation, showed a clear pattern. Specifically, obese individuals with knee pain maintained the knee in more flexion and more anterior tibial translation during most of the stance phase of the gait cycle and had a reduced total range of knee flexion when compared to a healthy non-obese group. In conclusion, obese individuals with knee pain used hyperextension knee posture while standing, but maintained the knee in more flexion during gait with reduced overall range of motion in the 6DOF analysis.

  20. Six degree-of-freedom knee joint kinematics in obese individuals with knee pain during gait

    PubMed Central

    Li, Jing-Sheng; Tsai, Tsung-Yuan; Felson, David T.; Li, Guoan; Lewis, Cara L.

    2017-01-01

    Knee joint pain is a common symptom in obese individuals and walking is often prescribed as part of management programs. Past studies in obese individuals have focused on standing alignment and kinematics in the sagittal and coronal planes. Investigation of 6 degree-of-freedom (6DOF) knee joint kinematics during standing and gait is important to thoroughly understand knee function in obese individuals with knee pain. This study aimed to investigate the 6DOF knee joint kinematics in standing and during gait in obese patients using a validated fluoroscopic imaging system. Ten individuals with obesity and knee pain were recruited. While standing, the knee was in 7.4±6.3°of hyperextension, 2.8±3.3° of abduction and 5.6±7.3° of external rotation. The femoral center was located 0.7±3.1mm anterior and 5.1±1.5mm medial to the tibial center. During treadmill gait, the sagittal plane motion, i.e., flexion/extension and anterior-posterior translation, showed a clear pattern. Specifically, obese individuals with knee pain maintained the knee in more flexion and more anterior tibial translation during most of the stance phase of the gait cycle and had a reduced total range of knee flexion when compared to a healthy non-obese group. In conclusion, obese individuals with knee pain used hyperextension knee posture while standing, but maintained the knee in more flexion during gait with reduced overall range of motion in the 6DOF analysis. PMID:28339477

  1. Simulation and training of lumbar punctures using haptic volume rendering and a 6DOF haptic device

    NASA Astrophysics Data System (ADS)

    Färber, Matthias; Heller, Julika; Handels, Heinz

    2007-03-01

    The lumbar puncture is performed by inserting a needle into the spinal chord of the patient to inject medicaments or to extract liquor. The training of this procedure is usually done on the patient guided by experienced supervisors. A virtual reality lumbar puncture simulator has been developed in order to minimize the training costs and the patient's risk. We use a haptic device with six degrees of freedom (6DOF) to feedback forces that resist needle insertion and rotation. An improved haptic volume rendering approach is used to calculate the forces. This approach makes use of label data of relevant structures like skin, bone, muscles or fat and original CT data that contributes information about image structures that can not be segmented. A real-time 3D visualization with optional stereo view shows the punctured region. 2D visualizations of orthogonal slices enable a detailed impression of the anatomical context. The input data consisting of CT and label data and surface models of relevant structures is defined in an XML file together with haptic rendering and visualization parameters. In a first evaluation the visible human male data has been used to generate a virtual training body. Several users with different medical experience tested the lumbar puncture trainer. The simulator gives a good haptic and visual impression of the needle insertion and the haptic volume rendering technique enables the feeling of unsegmented structures. Especially, the restriction of transversal needle movement together with rotation constraints enabled by the 6DOF device facilitate a realistic puncture simulation.

  2. Role of fruA and csgA genes in gene expression during development of Myxococcus xanthus. Analysis by two-dimensional gel electrophoresis.

    PubMed

    Horiuchi, Takayuki; Taoka, Masato; Isobe, Toshiaki; Komano, Teruya; Inouye, Sumiko

    2002-07-26

    Two genes, fruA and csgA, encoding a putative transcription factor and C-factor, respectively, are essential for fruiting body formation of Myxococcus xanthus. To investigate the role of fruA and csgA genes in developmental gene expression, developing cells as well as vegetative cells of M. xanthus wild-type, fruA::Tc, and csgA731 strains were pulse-labeled with [(35)S]methionine, and the whole cell proteins were analyzed using two-dimensional immobilized pH gradient/SDS-PAGE. Differences in protein synthesis patterns among more than 700 protein spots were detected during development of the three strains. Fourteen proteins showing distinctly different expression patterns in mutant cells were analyzed in more detail. Five of the 14 proteins were identified as elongation factor Tu (EF-Tu), Dru, DofA, FruA, and protein S by immunoblot analysis and mass spectroscopy. A gene encoding DofA was cloned and sequenced. Although both fruA and csgA genes regulate early development of M. xanthus, they were found to differently regulate expression of several developmental genes. The production of six proteins, including DofA and protein S, was dependent on fruA, whereas the production of two proteins was dependent on csgA, and one protein was dependent on both fruA and csgA. To explain the present findings, a new model was presented in which different levels of FruA phosphorylation may distinctively regulate the expression of two groups of developmental genes.

  3. Human Factors Risk Analyses of a Doffing Protocol for Ebola-Level Personal Protective Equipment: Mapping Errors to Contamination.

    PubMed

    Mumma, Joel M; Durso, Francis T; Ferguson, Ashley N; Gipson, Christina L; Casanova, Lisa; Erukunuakpor, Kimberly; Kraft, Colleen S; Walsh, Victoria L; Zimring, Craig; DuBose, Jennifer; Jacob, Jesse T

    2018-03-05

    Doffing protocols for personal protective equipment (PPE) are critical for keeping healthcare workers (HCWs) safe during care of patients with Ebola virus disease. We assessed the relationship between errors and self-contamination during doffing. Eleven HCWs experienced with doffing Ebola-level PPE participated in simulations in which HCWs donned PPE marked with surrogate viruses (ɸ6 and MS2), completed a clinical task, and were assessed for contamination after doffing. Simulations were video recorded, and a failure modes and effects analysis and fault tree analyses were performed to identify errors during doffing, quantify their risk (risk index), and predict contamination data. Fifty-one types of errors were identified, many having the potential to spread contamination. Hand hygiene and removing the powered air purifying respirator (PAPR) hood had the highest total risk indexes (111 and 70, respectively) and number of types of errors (9 and 13, respectively). ɸ6 was detected on 10% of scrubs and the fault tree predicted a 10.4% contamination rate, likely occurring when the PAPR hood inadvertently contacted scrubs during removal. MS2 was detected on 10% of hands, 20% of scrubs, and 70% of inner gloves and the predicted rates were 7.3%, 19.4%, 73.4%, respectively. Fault trees for MS2 and ɸ6 contamination suggested similar pathways. Ebola-level PPE can both protect and put HCWs at risk for self-contamination throughout the doffing process, even among experienced HCWs doffing with a trained observer. Human factors methodologies can identify error-prone steps, delineate the relationship between errors and self-contamination, and suggest remediation strategies.

  4. Design and characterization of an ocean wave powered lifejacket using 2DOF floating boards

    NASA Astrophysics Data System (ADS)

    Mi, Jia; Xu, Lin; Yang, Yaling; Zuo, Lei

    2018-04-01

    Lifejacket is an indispensable life-saving equipment for ships and airplanes. Traditional lifejacket is designed to prevent human from drowning. However, the water temperature is usually low, especially in winter, which significantly reduces the human body temperature and leads to death. Meanwhile, power is critical for drowning people to use emergency communication equipment. This paper proposed an ocean wave powered lifejacket using 2DOF floating boards to provide both buoyance and electricity for drowning people. Hence, they can use this continuous electric power to keep key body warm and send distress signal. This lifejacket is featured with two 2DOF floating boards and the mechanical motion rectifier (MMR) can convert the 2-DOF motions to the unidirectional rotation of generator. The design principle is illustrated and the dynamic modelling for the 2-DOF motions has been analyzed. Bench test and lake test have been conducted to validate the design concept.

  5. Robotic Arm Manipulator Using Active Control for Sample Acquisition and Transfer, and Passive Mode for Surface Compliance

    NASA Technical Reports Server (NTRS)

    Liu, Jun; Underhill, Michael L.; Trease, Brian P.; Lindemann, Randel A.

    2010-01-01

    A robotic arm that consists of three joints with four degrees of freedom (DOF) has been developed. It can carry an end-effector to acquire and transfer samples by using active control and comply with surface topology in a passive mode during a brief surface contact. The three joints are arranged in such a way that one joint of two DOFs is located at the shoulder, one joint of one DOF is located at the elbow, and one joint of one DOF is located at the wrist. Operationally, three DOFs are moved in the same plane, and the remaining one on the shoulder is moved perpendicular to the other three for better compliance with ground surface and more flexibility of sample handling. Three out of four joints are backdriveable, making the mechanism less complex and more cost effective

  6. Force-reflective teleoperated system with shared and compliant control capabilities

    NASA Technical Reports Server (NTRS)

    Szakaly, Z.; Kim, W. S.; Bejczy, A. K.

    1989-01-01

    The force-reflecting teleoperator breadboard is described. It is the first system among available Research and Development systems with the following combined capabilities: (1) The master input device is not a replica of the slave arm. It is a general purpose device which can be applied to the control of different robot arms through proper mathematical transformations. (2) Force reflection generated in the master hand controller is referenced to forces and moments measured by a six DOF force-moment sensor at the base of the robot hand. (3) The system permits a smooth spectrum of operations between full manual, shared manual and automatic, and full automatic (called traded) control. (4) The system can be operated with variable compliance or stiffness in force-reflecting control. Some of the key points of the system are the data handling and computing architecture, the communication method, and the handling of mathematical transformations. The architecture is a fully synchronized pipeline. The communication method achieves optimal use of a parallel communication channel between the local and remote computing nodes. A time delay box is also implemented in this communication channel permitting experiments with up to 8 sec time delay. The mathematical transformations are computed faster than 1 msec so that control at each node can be operated at 1 kHz servo rate without interpolation. This results in an overall force-reflecting loop rate of 200 Hz.

  7. Swarm Counter-Asymmetric-Threat (CAT) 6-DOF Dynamics Simulation

    DTIC Science & Technology

    2005-07-01

    NAWCWD TP 8593 Swarm Counter-Asymmetric-Threat ( CAT ) 6-DOF Dynamics Simulation by James Bobinchak Weapons and Energetics...mathematical models used in the swarm counter- asymmetric-threat ( CAT ) simulation and the results of extensive Monte Carlo simulations. The swarm CAT ...Asymmetric-Threat ( CAT ) 6-DOF Dynamics Simulation (U) 6. AUTHOR(S) James Bobinchak and Gary Hewer 7. PERFORMING ORGANIZATION NAME(S) AND

  8. Controlled Photon Switch Assisted by Coupled Quantum Dots

    PubMed Central

    Luo, Ming-Xing; Ma, Song-Ya; Chen, Xiu-Bo; Wang, Xiaojun

    2015-01-01

    Quantum switch is a primitive element in quantum network communication. In contrast to previous switch schemes on one degree of freedom (DOF) of quantum systems, we consider controlled switches of photon system with two DOFs. These controlled photon switches are constructed by exploring the optical selection rules derived from the quantum-dot spins in one-sided optical microcavities. Several double controlled-NOT gate on different joint systems are greatly simplified with an auxiliary DOF of the controlling photon. The photon switches show that two DOFs of photons can be independently transmitted in quantum networks. This result reduces the quantum resources for quantum network communication. PMID:26095049

  9. Depth of focus enhancement of a modified imaging quasi-fractal zone plate.

    PubMed

    Zhang, Qinqin; Wang, Jingang; Wang, Mingwei; Bu, Jing; Zhu, Siwei; Gao, Bruce Z; Yuan, Xiaocong

    2012-10-01

    We propose a new parameter w for optimization of foci distribution of conventional fractal zone plates (FZPs) with a greater depth of focus (DOF) in imaging. Numerical simulations of DOF distribution on axis directions indicate that the values of DOF can be extended by a factor of 1.5 or more by a modified quasi-FZP. In experiments, we employ a simple object-lens-image-plane arrangement to pick up images at various positions within the DOF of a conventional FZP and a quasi-FZP, respectively. Experimental results show that the parameter w improves foci distribution of FZPs in good agreement with theoretical predictions.

  10. Depth of focus enhancement of a modified imaging quasi-fractal zone plate

    PubMed Central

    Zhang, Qinqin; Wang, Jingang; Wang, Mingwei; Bu, Jing; Zhu, Siwei; Gao, Bruce Z.; Yuan, Xiaocong

    2013-01-01

    We propose a new parameter w for optimization of foci distribution of conventional fractal zone plates (FZPs) with a greater depth of focus (DOF) in imaging. Numerical simulations of DOF distribution on axis directions indicate that the values of DOF can be extended by a factor of 1.5 or more by a modified quasi-FZP. In experiments, we employ a simple object–lens–image-plane arrangement to pick up images at various positions within the DOF of a conventional FZP and a quasi-FZP, respectively. Experimental results show that the parameter w improves foci distribution of FZPs in good agreement with theoretical predictions. PMID:24285908

  11. A novel approach to the design of a needle driver with multiple DOFs for pediatric laparoscopic surgery.

    PubMed

    Fujii, Masahiro; Sugita, Naohiko; Ishimaru, Tetsuya; Iwanaka, Tadashi; Mitsuishi, Mamoru

    2013-02-01

    The objective of our research was to design and develop a novel needle driver with multiple degrees of freedom (DOFs) for pediatric laparoscopic surgery. Pediatric laparoscopic surgery has many advantages for patients, but the difficulty of the operation is increased due to many restrictions. For example, the motion of the needle driver is restricted by the insertion points, and the operation workspace is smaller in children than in adults. A needle driver with 3 DOFs and a 3.5-mm diameter is proposed and implemented in this study. Grasping DOF is achieved using a piston mechanism actuated by a wire. Deflection and rotation DOFs are actuated by gears. Experiments were conducted to evaluate the workspace and ligation force, and the results confirmed that the needle driver meets all the necessary requirements. Finally, a first reaction of a pediatric surgeon on the suturing and ligaturing capabilities of the prototype is reported. A multi-DOF needle driver with a new mechanism was proposed for pediatric laparoscopic surgery and a first prototype was developed. It is expected that further elaboration of the developed first prototype of the needle driver may contribute to the advancement of pediatric laparoscopic surgery.

  12. Downstream-of-FGFR Is a Fibroblast Growth Factor-Specific Scaffolding Protein and Recruits Corkscrew upon Receptor Activation

    PubMed Central

    Petit, Valérie; Nussbaumer, Ute; Dossenbach, Caroline; Affolter, Markus

    2004-01-01

    Fibroblast growth factor (FGF) receptor (FGFR) signaling controls the migration of glial, mesodermal, and tracheal cells in Drosophila melanogaster. Little is known about the molecular events linking receptor activation to cytoskeletal rearrangements during cell migration. We have performed a functional characterization of Downstream-of-FGFR (Dof), a putative adapter protein that acts specifically in FGFR signal transduction in Drosophila. By combining reverse genetic, cell culture, and biochemical approaches, we demonstrate that Dof is a specific substrate for the two Drosophila FGFRs. After defining a minimal Dof rescue protein, we identify two regions important for Dof function in mesodermal and tracheal cell migration. The N-terminal 484 amino acids are strictly required for the interaction of Dof with the FGFRs. Upon receptor activation, tyrosine residue 515 becomes phosphorylated and recruits the phosphatase Corkscrew (Csw). Csw recruitment represents an essential step in FGF-induced cell migration and in the activation of the Ras/MAPK pathway. However, our results also indicate that the activation of Ras is not sufficient to activate the migration machinery in tracheal and mesodermal cells. Additional proteins binding either to the FGFRs, to Dof, or to Csw appear to be crucial for a chemotactic response. PMID:15082772

  13. Downstream-of-FGFR is a fibroblast growth factor-specific scaffolding protein and recruits Corkscrew upon receptor activation.

    PubMed

    Petit, Valérie; Nussbaumer, Ute; Dossenbach, Caroline; Affolter, Markus

    2004-05-01

    Fibroblast growth factor (FGF) receptor (FGFR) signaling controls the migration of glial, mesodermal, and tracheal cells in Drosophila melanogaster. Little is known about the molecular events linking receptor activation to cytoskeletal rearrangements during cell migration. We have performed a functional characterization of Downstream-of-FGFR (Dof), a putative adapter protein that acts specifically in FGFR signal transduction in Drosophila. By combining reverse genetic, cell culture, and biochemical approaches, we demonstrate that Dof is a specific substrate for the two Drosophila FGFRs. After defining a minimal Dof rescue protein, we identify two regions important for Dof function in mesodermal and tracheal cell migration. The N-terminal 484 amino acids are strictly required for the interaction of Dof with the FGFRs. Upon receptor activation, tyrosine residue 515 becomes phosphorylated and recruits the phosphatase Corkscrew (Csw). Csw recruitment represents an essential step in FGF-induced cell migration and in the activation of the Ras/MAPK pathway. However, our results also indicate that the activation of Ras is not sufficient to activate the migration machinery in tracheal and mesodermal cells. Additional proteins binding either to the FGFRs, to Dof, or to Csw appear to be crucial for a chemotactic response.

  14. A novel 6-DOF parallel robot and its pose errors compensation

    NASA Astrophysics Data System (ADS)

    Shi, Zhixin; Ye, Meiyan; Luo, Yufeng

    2011-10-01

    In the traditional security solution conditions, software firewall cannot intercept and respond the invasion before being attacked. And because of the high cost, the hardware firewall does not apply to the security strategy of the end nodes, so we have designed a kind of solution of embedded firewall with hardware and software. With ARM embedding Linux operating system, we have designed packet filter module and intrusion detection module to implement the basic function of firewall. Experiments and results show that that firewall has the advantages of low cost, high processing speed, high safety and the application of the computer terminals. This paper focuses on packet filtering module design and implementation.

  15. Parallel controller construction for a multi-DOF hand rehabilitation equipment

    NASA Astrophysics Data System (ADS)

    Ito, Satoshi; Ueki, Satoshi; Ishihara, Koji; Miura, Masayuki; Kawasaki, Haruhisa; Ishigure, Yasuhiko; Nishimoto, Yutakai

    2007-12-01

    This paper describes the development of a hand rehabilitation system for stroke patients. Our aim is to provide fine motion exercise for a hand and fingers. Thus, a hand rehabilitation device that assists patients' finger movements was developed. Because this device has 18 degrees of freedom of motion, it is diffcult for disabled patients to use it by themselves. Therefore, an appropriate control strategy and control system are required to allow its safe and effective use. In light of this requirement, a control system was constructed which is comprised of four separated controllers. This paper presents the structure of the control system and introduces the control protocols used in our hand rehabilitation system.

  16. The Impact of Environmental Design on Doffing Personal Protective Equipment in a Healthcare Environment: A Formative Human Factors Trial.

    PubMed

    Herlihey, Tracey A; Gelmi, Stefano; Cafazzo, Joseph A; Hall, Trevor N T

    2017-06-01

    OBJECTIVE To explore the impact of environmental design on doffing personal protective equipment in a simulated healthcare environment. METHODS A mixed-methods approach was used that included human-factors usability testing and qualitative questionnaire responses. A patient room and connecting anteroom were constructed for testing purposes. This experimental doffing area was designed to overcome the environmental failures identified in a previous study and was not constructed based on any generalizable hospital standard. RESULTS In total, 72 healthcare workers from Ontario, Canada, took part in the study and tested the simulated doffing area. The following environmental design changes were tested and were deemed effective: increasing prominence of color-coded zones; securing disinfectant wipes and hand sanitizer; outlining disposal bins locations; providing mirrors to detect possible contamination; providing hand rails to assist with doffing; and restricting the space to doff. Further experimentation and iterative design are required with regard to several important features: positioning the disposal bins for safety, decreasing the risk of contamination and user accessibility; optimal positioning of mirrors for safety; communication within the team; and positioning the secondary team member for optimal awareness. Additional design suggestions also emerged during this study, and they require future investigation. CONCLUSIONS This study highlights the importance of the environment on doffing personal protective equipment in a healthcare setting. Iterative testing and modification of the design of the environment (doffing area) are important to enhancing healthcare worker safety. Infect Control Hosp Epidemiol 2017;38:712-717.

  17. Industrial dual arm robot manipulator for precise assembly of mechanical parts

    NASA Astrophysics Data System (ADS)

    Park, Chanhun; Kim, Doohyung; Park, Kyoungtaik; Choi, Youngjin

    2007-12-01

    A new structure of dual arm robot manipulator which consists of two industrial 6-DOF arms and one 2-DOF Torso is introduced. Each industrial 6-DOF arm is able to be used as a stand-alone industrial 6-DOF robot manipulator and as a part of dual arm manipulator at the same time. These structures help the robot maker which is willing to succeed in the emerging dual arm robot market in order to have high competition for the current industrial robot market at same time. Self-collision detection algorithm for multi-arm robot and kinematics algorithms for the developed dual arm robot manipulator which are implemented in our controller are introduced.

  18. Verifying genuine high-order entanglement.

    PubMed

    Li, Che-Ming; Chen, Kai; Reingruber, Andreas; Chen, Yueh-Nan; Pan, Jian-Wei

    2010-11-19

    High-order entanglement embedded in multipartite multilevel quantum systems (qudits) with many degrees of freedom (DOFs) plays an important role in quantum foundation and quantum engineering. Verifying high-order entanglement without the restriction of system complexity is a critical need in any experiments on general entanglement. Here, we introduce a scheme to efficiently detect genuine high-order entanglement, such as states close to genuine qudit Bell, Greenberger-Horne-Zeilinger, and cluster states as well as multilevel multi-DOF hyperentanglement. All of them can be identified with two local measurement settings per DOF regardless of the qudit or DOF number. The proposed verifications together with further utilities such as fidelity estimation could pave the way for experiments by reducing dramatically the measurement overhead.

  19. An Evolutionarily Conserved DOF-CONSTANS Module Controls Plant Photoperiodic Signaling1[OPEN

    PubMed Central

    2015-01-01

    The response to daylength is a crucial process that evolved very early in plant evolution, entitling the early green eukaryote to predict seasonal variability and attune its physiological responses to the environment. The photoperiod responses evolved into the complex signaling pathways that govern the angiosperm floral transition today. The Chlamydomonas reinhardtii DNA-Binding with One Finger (CrDOF) gene controls transcription in a photoperiod-dependent manner, and its misexpression influences algal growth and viability. In short days, CrDOF enhances CrCO expression, a homolog of plant CONSTANS (CO), by direct binding to its promoter, while it reduces the expression of cell division genes in long days independently of CrCO. In Arabidopsis (Arabidopsis thaliana), transgenic plants overexpressing CrDOF show floral delay and reduced expression of the photoperiodic genes CO and FLOWERING LOCUS T. The conservation of the DOF-CO module during plant evolution could be an important clue to understanding diversification by the inheritance of conserved gene toolkits in key developmental programs. PMID:25897001

  20. Development of biomimetic quadruped walking robot with 2-DOF waist joint

    NASA Astrophysics Data System (ADS)

    Kim, Kyoung-Ho; Park, Se-Hoon; Lee, Yun-Jung

    2005-12-01

    This paper presented a novel bio-mimetic quadruped walking robot with 2-DOF (Degree Of Freedom) waist joint, which connects the front and the rear parts of the body. The waist-jointed walking robot can guarantee more stable and more animal-like gait than that of a conventional single-rigid-body walking robot. The developed robot, called ELIRO-II (Eating LIzard RObot version 2), can bend its body from side to side by using 1-DOF passive waist joint while the legs is transferred, thereby increasing the stride and speed of the robot. In addition, ELIRO-II has one more active DOF to bend its body up and down, which increases the mobility in irregular terrain such as slope and stairs. We design the mechanical structure of the robot, which is small and light to have high mobility. This research described characteristics of the 2-DOF waists joint and leg mechanism as well as a hardware and software of the controller of ELIRO-II.

  1. Position calibration of a 3-DOF hand-controller with hybrid structure

    NASA Astrophysics Data System (ADS)

    Zhu, Chengcheng; Song, Aiguo

    2017-09-01

    A hand-controller is a human-robot interactive device, which measures the 3-DOF (Degree of Freedom) position of the human hand and sends it as a command to control robot movement. The device also receives 3-DOF force feedback from the robot and applies it to the human hand. Thus, the precision of 3-DOF position measurements is a key performance factor for hand-controllers. However, when using a hybrid type 3-DOF hand controller, various errors occur and are considered originating from machining and assembly variations within the device. This paper presents a calibration method to improve the position tracking accuracy of hybrid type hand-controllers by determining the actual size of the hand-controller parts. By re-measuring and re-calibrating this kind of hand-controller, the actual size of the key parts that cause errors is determined. Modifying the formula parameters with the actual sizes, which are obtained in the calibrating process, improves the end position tracking accuracy of the device.

  2. A double torsion pendulum with two cascade soft degrees of freedom

    NASA Astrophysics Data System (ADS)

    Marconi, L.; Stanga, R.; Bassan, M.

    2012-06-01

    We report on a double torsion pendulum, where motion along two degrees of freedom (DoFs) is almost free. The Test Mass (TM) is enclosed in a replica of the LISA-Pathfinder electrostatic readout and actuation system. This apparatus is designed to perform extensive ground testing of undesired effects such as leakage of the readout noise from one DoF to another, or actuation cross talks with closed feedback loop. Such investigation is relevant to the noise budget of LISA and LISA-Pathfinder missions, as the TM will be sensitive to weak forces along all 6 degrees of freedom (DoFs). The instrument being developed in Firenze is capable of measuring the forces and stiffnesses acting simultaneously along the 2 soft DoFs. We have completed an upgrade of the apparatus to a definitive configuration and we report on both advances in the commissioning tests and on measurements of residual charge, with the first DoF released.

  3. Efficient Kinematic Computations For 7-DOF Manipulators

    NASA Technical Reports Server (NTRS)

    Seraji, Homayoun; Long, Mark K.; Kreutz-Delgado, Kenneth

    1994-01-01

    Efficient algorithms for forward kinematic mappings of seven-degree-of-freedom (7-DOF) robotic manipulator having revolute joints developed on basis of representation of redundant DOF in terms of parameter called "arm angle." Continuing effort to exploit redundancy in manipulator according to concept of basic and additional tasks. Concept also discussed in "Configuration-Control Scheme Copes With Singularities" (NPO-18556) and "Increasing the Dexterity of Redundant Robots" (NPO-17801).

  4. A quantitative measure for degree of automation and its relation to system performance and mental load.

    PubMed

    Wei, Z G; Macwan, A P; Wieringa, P A

    1998-06-01

    In this paper we quantitatively model degree of automation (DofA) in supervisory control as a function of the number and nature of tasks to be performed by the operator and automation. This model uses a task weighting scheme in which weighting factors are obtained from task demand load, task mental load, and task effect on system performance. The computation of DofA is demonstrated using an experimental system. Based on controlled experiments using operators, analyses of the task effect on system performance, the prediction and assessment of task demand load, and the prediction of mental load were performed. Each experiment had a different DofA. The effect of a change in DofA on system performance and mental load was investigated. It was found that system performance became less sensitive to changes in DofA at higher levels of DofA. The experimental data showed that when the operator controlled a partly automated system, perceived mental load could be predicted from the task mental load for each task component, as calculated by analyzing a situation in which all tasks were manually controlled. Actual or potential applications of this research include a methodology to balance and optimize the automation of complex industrial systems.

  5. A methodological framework for detecting ulcers' risk in diabetic foot subjects by combining gait analysis, a new musculoskeletal foot model and a foot finite element model.

    PubMed

    Scarton, Alessandra; Guiotto, Annamaria; Malaquias, Tiago; Spolaor, Fabiola; Sinigaglia, Giacomo; Cobelli, Claudio; Jonkers, Ilse; Sawacha, Zimi

    2018-02-01

    Diabetic foot is one of the most debilitating complications of diabetes and may lead to plantar ulcers. In the last decade, gait analysis, musculoskeletal modelling (MSM) and finite element modelling (FEM) have shown their ability to contribute to diabetic foot prevention and suggested that the origin of the plantar ulcers is in deeper tissue layers rather than on the plantar surface. Hence the aim of the current work is to develop a methodology that improves FEM-derived foot internal stresses prediction, for diabetic foot prevention applications. A 3D foot FEM was combined with MSM derived force to predict the sites of excessive internal stresses on the foot. In vivo gait analysis data, and an MRI scan of a foot from a healthy subject were acquired and used to develop a six degrees of freedom (6 DOF) foot MSM and a 3D subject-specific foot FEM. Ankle kinematics were applied as boundary conditions to the FEM together with: 1. only Ground Reaction Forces (GRFs); 2. OpenSim derived extrinsic muscles forces estimated with a standard OpenSim MSM; 3. extrinsic muscle forces derived through the (6 DOF) foot MSM; 4. intrinsic and extrinsic muscles forces derived through the 6 DOF foot MSM. For model validation purposes, simulated peak pressures were extracted and compared with those measured experimentally. The importance of foot muscles in controlling plantar pressure distribution and internal stresses is confirmed by the improved accuracy in the estimation of the peak pressures obtained with the inclusion of intrinsic and extrinsic muscle forces. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Kinematic performance of a six degree-of-freedom hand model (6DHand) for use in occupational biomechanics.

    PubMed

    Buczek, Frank L; Sinsel, Erik W; Gloekler, Daniel S; Wimer, Bryan M; Warren, Christopher M; Wu, John Z

    2011-06-03

    Upper extremity musculoskeletal disorders represent an important health issue across all industry sectors; as such, the need exists to develop models of the hand that provide comprehensive biomechanics during occupational tasks. Previous optical motion capture studies used a single marker on the dorsal aspect of finger joints, allowing calculation of one and two degree-of-freedom (DOF) joint angles; additional algorithms were needed to define joint centers and the palmar surface of fingers. We developed a 6DOF model (6DHand) to obtain unconstrained kinematics of finger segments, modeled as frusta of right circular cones that approximate the palmar surface. To evaluate kinematic performance, twenty subjects gripped a cylindrical handle as a surrogate for a powered hand tool. We hypothesized that accessory motions (metacarpophalangeal pronation/supination; proximal and distal interphalangeal radial/ulnar deviation and pronation/supination; all joint translations) would be small (less than 5° rotations, less than 2mm translations) if segment anatomical reference frames were aligned correctly, and skin movement artifacts were negligible. For the gripping task, 93 of 112 accessory motions were small by our definition, suggesting this 6DOF approach appropriately models joints of the fingers. Metacarpophalangeal supination was larger than expected (approximately 10°), and may be adjusted through local reference frame optimization procedures previously developed for knee kinematics in gait analysis. Proximal translations at the metacarpophalangeal joints (approximately 10mm) were explained by skin movement across the metacarpals, but would not corrupt inverse dynamics calculated for the phalanges. We assessed performance in this study; a more rigorous validation would likely require medical imaging. Published by Elsevier Ltd.

  7. Non-orthogonal tool/flange and robot/world calibration.

    PubMed

    Ernst, Floris; Richter, Lars; Matthäus, Lars; Martens, Volker; Bruder, Ralf; Schlaefer, Alexander; Schweikard, Achim

    2012-12-01

    For many robot-assisted medical applications, it is necessary to accurately compute the relation between the robot's coordinate system and the coordinate system of a localisation or tracking device. Today, this is typically carried out using hand-eye calibration methods like those proposed by Tsai/Lenz or Daniilidis. We present a new method for simultaneous tool/flange and robot/world calibration by estimating a solution to the matrix equation AX = YB. It is computed using a least-squares approach. Because real robots and localisation are all afflicted by errors, our approach allows for non-orthogonal matrices, partially compensating for imperfect calibration of the robot or localisation device. We also introduce a new method where full robot/world and partial tool/flange calibration is possible by using localisation devices providing less than six degrees of freedom (DOFs). The methods are evaluated on simulation data and on real-world measurements from optical and magnetical tracking devices, volumetric ultrasound providing 3-DOF data, and a surface laser scanning device. We compare our methods with two classical approaches: the method by Tsai/Lenz and the method by Daniilidis. In all experiments, the new algorithms outperform the classical methods in terms of translational accuracy by up to 80% and perform similarly in terms of rotational accuracy. Additionally, the methods are shown to be stable: the number of calibration stations used has far less influence on calibration quality than for the classical methods. Our work shows that the new method can be used for estimating the relationship between the robot's and the localisation device's coordinate systems. The new method can also be used for deficient systems providing only 3-DOF data, and it can be employed in real-time scenarios because of its speed. Copyright © 2012 John Wiley & Sons, Ltd.

  8. Kinase impact assessment in the landscape of fusion genes that retain kinase domains: a pan-cancer study

    PubMed Central

    Kim, Pora; Jia, Peilin; Zhao, Zhongming

    2018-01-01

    Abstract Assessing the impact of kinase in gene fusion is essential for both identifying driver fusion genes (FGs) and developing molecular targeted therapies. Kinase domain retention is a crucial factor in kinase fusion genes (KFGs), but such a systematic investigation has not been done yet. To this end, we analyzed kinase domain retention (KDR) status in chimeric protein sequences of 914 KFGs covering 312 kinases across 13 major cancer types. Based on 171 kinase domain-retained KFGs including 101 kinases, we studied their recurrence, kinase groups, fusion partners, exon-based expression depth, short DNA motifs around the break points and networks. Our results, such as more KDR than 5′-kinase fusion genes, combinatorial effects between 3′-KDR kinases and their 5′-partners and a signal transduction-specific DNA sequence motif in the break point intronic sequences, supported positive selection on 3′-kinase fusion genes in cancer. We introduced a degree-of-frequency (DoF) score to measure the possible number of KFGs of a kinase. Interestingly, kinases with high DoF scores tended to undergo strong gene expression alteration at the break points. Furthermore, our KDR gene fusion network analysis revealed six of the seven kinases with the highest DoF scores (ALK, BRAF, MET, NTRK1, NTRK3 and RET) were all observed in thyroid carcinoma. Finally, we summarized common features of ‘effective’ (highly recurrent) kinases in gene fusions such as expression alteration at break point, redundant usage in multiple cancer types and 3′-location tendency. Collectively, our findings are useful for prioritizing driver kinases and FGs and provided insights into KFGs’ clinical implications. PMID:28013235

  9. Contributions of different degrees of freedom to thermal transport in the C60 molecular crystal

    NASA Astrophysics Data System (ADS)

    Kumar, Sushant; Shao, Cheng; Lu, Simon; McGaughey, Alan J. H.

    2018-03-01

    Three models of the C60 molecular crystal are studied using molecular dynamics simulations to resolve the roles played by intermolecular and intramolecular degrees of freedom (DOF) in its structural, mechanical, and thermal properties at temperatures between 35 and 400 K. In the full DOF model, all DOF are active. In the rigid body model, the intramolecular DOF are frozen, such that only center of mass (COM) translations and molecular rotations/librations are active. In the point mass model, the molecule is replaced by a point mass, such that only COM translations are active. The zero-pressure lattice constants and bulk moduli predicted from the three models fall within ranges of 0.15 and 20%. The thermal conductivity of the point mass model is the largest across the temperature range, showing a crystal-like temperature dependence (i.e., it decreases with increasing temperature) due to the presence of phonon modes associated with the COM translations. The rigid body model thermal conductivity is the smallest and follows two distinct regimes. It is crystal-like at low temperatures and becomes temperature invariant at high temperatures. The latter is typical of the behavior of an amorphous material. By calculating the rotational diffusion coefficient, the transition between the two regimes is found to occur at the temperature where the molecules begin to rotate freely. Above this temperature, phonons related to COM translations are scattered by the rotational DOF. The full DOF model thermal conductivity is larger than that of the rigid body model, indicating that intramolecular DOF contribute to thermal transport.

  10. Real-time robustness evaluation of regression based myoelectric control against arm position change and donning/doffing.

    PubMed

    Hwang, Han-Jeong; Hahne, Janne Mathias; Müller, Klaus-Robert

    2017-01-01

    There are some practical factors, such as arm position change and donning/doffing, which prevent robust myoelectric control. The objective of this study is to precisely characterize the impacts of the two representative factors on myoelectric controllability in practical control situations, thereby providing useful references that can be potentially used to find better solutions for clinically reliable myoelectric control. To this end, a real-time target acquisition task was performed by fourteen subjects including one individual with congenital upper-limb deficiency, where the impacts of arm position change, donning/doffing and a combination of both factors on control performance was systematically evaluated. The changes in online performance were examined with seven different performance metrics to comprehensively evaluate various aspects of myoelectric controllability. As a result, arm position change significantly affects offline prediction accuracy, but not online control performance due to real-time feedback, thereby showing no significant correlation between offline and online performance. Donning/doffing was still problematic in online control conditions. It was further observed that no benefit was attained when using a control model trained with multiple position data in terms of arm position change, and the degree of electrode shift caused by donning/doffing was not severely associated with the degree of performance loss under practical conditions (around 1 cm electrode shift). Since this study is the first to concurrently investigate the impacts of arm position change and donning/doffing in practical myoelectric control situations, all findings of this study provide new insights into robust myoelectric control with respect to arm position change and donning/doffing.

  11. Use of probabilistic weights to enhance linear regression myoelectric control

    NASA Astrophysics Data System (ADS)

    Smith, Lauren H.; Kuiken, Todd A.; Hargrove, Levi J.

    2015-12-01

    Objective. Clinically available prostheses for transradial amputees do not allow simultaneous myoelectric control of degrees of freedom (DOFs). Linear regression methods can provide simultaneous myoelectric control, but frequently also result in difficulty with isolating individual DOFs when desired. This study evaluated the potential of using probabilistic estimates of categories of gross prosthesis movement, which are commonly used in classification-based myoelectric control, to enhance linear regression myoelectric control. Approach. Gaussian models were fit to electromyogram (EMG) feature distributions for three movement classes at each DOF (no movement, or movement in either direction) and used to weight the output of linear regression models by the probability that the user intended the movement. Eight able-bodied and two transradial amputee subjects worked in a virtual Fitts’ law task to evaluate differences in controllability between linear regression and probability-weighted regression for an intramuscular EMG-based three-DOF wrist and hand system. Main results. Real-time and offline analyses in able-bodied subjects demonstrated that probability weighting improved performance during single-DOF tasks (p < 0.05) by preventing extraneous movement at additional DOFs. Similar results were seen in experiments with two transradial amputees. Though goodness-of-fit evaluations suggested that the EMG feature distributions showed some deviations from the Gaussian, equal-covariance assumptions used in this experiment, the assumptions were sufficiently met to provide improved performance compared to linear regression control. Significance. Use of probability weights can improve the ability to isolate individual during linear regression myoelectric control, while maintaining the ability to simultaneously control multiple DOFs.

  12. Real-time robustness evaluation of regression based myoelectric control against arm position change and donning/doffing

    PubMed Central

    Hahne, Janne Mathias; Müller, Klaus-Robert

    2017-01-01

    There are some practical factors, such as arm position change and donning/doffing, which prevent robust myoelectric control. The objective of this study is to precisely characterize the impacts of the two representative factors on myoelectric controllability in practical control situations, thereby providing useful references that can be potentially used to find better solutions for clinically reliable myoelectric control. To this end, a real-time target acquisition task was performed by fourteen subjects including one individual with congenital upper-limb deficiency, where the impacts of arm position change, donning/doffing and a combination of both factors on control performance was systematically evaluated. The changes in online performance were examined with seven different performance metrics to comprehensively evaluate various aspects of myoelectric controllability. As a result, arm position change significantly affects offline prediction accuracy, but not online control performance due to real-time feedback, thereby showing no significant correlation between offline and online performance. Donning/doffing was still problematic in online control conditions. It was further observed that no benefit was attained when using a control model trained with multiple position data in terms of arm position change, and the degree of electrode shift caused by donning/doffing was not severely associated with the degree of performance loss under practical conditions (around 1 cm electrode shift). Since this study is the first to concurrently investigate the impacts of arm position change and donning/doffing in practical myoelectric control situations, all findings of this study provide new insights into robust myoelectric control with respect to arm position change and donning/doffing. PMID:29095846

  13. Activation of a development-specific gene, dofA, by FruA, an essential transcription factor for development of Myxococcus xanthus.

    PubMed

    Ueki, Toshiyuki; Inouye, Sumiko

    2005-12-01

    FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.

  14. Motion control of 7-DOF arms - The configuration control approach

    NASA Technical Reports Server (NTRS)

    Seraji, Homayoun; Long, Mark K.; Lee, Thomas S.

    1993-01-01

    Graphics simulation and real-time implementation of configuration control schemes for a redundant 7-DOF Robotics Research arm are described. The arm kinematics and motion control schemes are described briefly. This is followed by a description of a graphics simulation environment for 7-DOF arm control on the Silicon Graphics IRIS Workstation. Computer simulation results are presented to demonstrate elbow control, collision avoidance, and optimal joint movement as redundancy resolution goals. The laboratory setup for experimental validation of motion control of the 7-DOF Robotics Research arm is then described. The configuration control approach is implemented on a Motorola-68020/VME-bus-based real-time controller, with elbow positioning for redundancy resolution. Experimental results demonstrate the efficacy of configuration control for real-time control.

  15. A Novel Methodology for the Simulation of Athletic Tasks on Cadaveric Knee Joints with Respect to In Vivo Kinematics

    PubMed Central

    Bates, Nathaniel A.; Nesbitt, Rebecca J.; Shearn, Jason T.; Myer, Gregory D.; Hewett, Timothy E.

    2015-01-01

    Six degree of freedom (6-DOF) robotic manipulators have simulated clinical tests and gait on cadaveric knees to examine knee biomechanics. However, these activities do not necessarily emulate the kinematics and kinetics that lead to anterior cruciate ligament (ACL) rupture. The purpose of this study was to determine the techniques needed to derive reproducible, in vitro simulations from in vivo skin-marker kinematics recorded during simulated athletic tasks. Input of raw, in vivo, skin-marker-derived motion capture kinematics consistently resulted in specimen failure. The protocol described in this study developed an in-depth methodology to adapt in vivo kinematic recordings into 6-DOF knee motion simulations for drop vertical jumps and sidestep cutting. Our simulation method repeatably produced kinetics consistent with vertical ground reaction patterns while preserving specimen integrity. Athletic task simulation represents an advancement that allows investigators to examine ACL-intact and graft biomechanics during motions that generate greater kinetics, and the athletic tasks are more representative of documented cases of ligament rupture. Establishment of baseline functional mechanics within the knee joint during athletic tasks will serve to advance the prevention, repair and rehabilitation of ACL injuries. PMID:25869454

  16. Orbital Manuvering System Design and Performance For the Magnetosperic Multiscale Constellation

    NASA Technical Reports Server (NTRS)

    Queen, Steven Z.; Chai, Dean J.; Placanica, Sam

    2013-01-01

    The Magnetospheric Multiscale (MMS) mission, launched on March 13, 2015, is the fourth mission of NASA's Solar Terrestrial Probe program. The MMS mission consists of four identically instrumented observatories that function as a constellation to provide the first definitive study of magnetic reconnection in space. Since it is frequently desirable to isolate electric and magnetic field sensors from stray effects caused by the spacecraft's core-body, the suite of instruments on MMS includes six radial and two axial instrument-booms with deployed lengths ranging from 5-60 meters (see Figure 1). The observatory is spin-stabilized about its positive z-axis with a nominal rate slightly above 3 rev/min (RPM). The spin is also used to maintain tension in the four radial wire-booms. Each observatory's Attitude Control System (ACS) consists of digital sun sensors, star cameras, accelerometers, and mono-propellant hydrazine thrusters-responsible for orbital adjustments, attitude control, and spin adjustments. The sections that follow describe performance requirements, the hardware and algorithms used for 6-DOF estimation, and then similarly for 6-DOF control. The paper concludes with maneuver performance based on both simulated and on-orbit telem.

  17. The Space Operations Simulation Center (SOSC) and Closed-loop Hardware Testing for Orion Rendezvous System Design

    NASA Technical Reports Server (NTRS)

    D'Souza, Christopher; Milenkovich, Zoran; Wilson, Zachary; Huich, David; Bendle, John; Kibler, Angela

    2011-01-01

    The Space Operations Simulation Center (SOSC) at the Lockheed Martin (LM) Waterton Campus in Littleton, Colorado is a dynamic test environment focused on Autonomous Rendezvous and Docking (AR&D) development testing and risk reduction activities. The SOSC supports multiple program pursuits and accommodates testing Guidance, Navigation, and Control (GN&C) algorithms for relative navigation, hardware testing and characterization, as well as software and test process development. The SOSC consists of a high bay (60 meters long by 15.2 meters wide by 15.2 meters tall) with dual six degree-of-freedom (6DOF) motion simulators and a single fixed base 6DOF robot. The large testing area (maximum sensor-to-target effective range of 60 meters) allows for large-scale, flight-like simulations of proximity maneuvers and docking events. The facility also has two apertures for access to external extended-range outdoor target test operations. In addition, the facility contains four Mission Operations Centers (MOCs) with connectivity to dual high bay control rooms and a data/video interface room. The high bay is rated at Class 300,000 (. 0.5 m maximum particles/m3) cleanliness and includes orbital lighting simulation capabilities.

  18. Oscillation Amplitude Growth for a Decelerating Object with Constant Pitch Damping

    NASA Technical Reports Server (NTRS)

    Schoenenberger, Mark; Queen, Eric M.; Litton, Daniel

    2006-01-01

    The equations governing the deceleration and oscillation of a blunt body moving along a planar trajectory are re-expressed in the form of the Euler-Cauchy equation. An analytic solution of this equation describes the oscillation amplitude growth and frequency dilation with time for a statically stable decelerating body with constant pitch damping. The oscillation histories for several constant pitch damping values, predicted by the solution of the Euler-Cauchy equation are compared to POST six degree-of-freedom (6-DoF) trajectory simulations. The simulations use simplified aerodynamic coefficients matching the Euler-Cauchy approximations. Agreement between the model predictions and simulation results are excellent. Euler-Cauchy curves are also fit through nonlinear 6-DoF simulations and ballistic range data to identify static stability and pitch damping coefficients. The model os shown to closely fit through the data points and capture the behavior of the blunt body observed in simulation and experiment. The extracted coefficients are in reasonable agreement with higher fidelity, nonlinear parameter identification results. Finally, a nondimensional version of the Euler-Cauchy equation is presented and shown to be a simple and effective tool for designing dynamically scaled experiments for decelerating blunt capsule flight.

  19. Depth-of-Focus and its Association with the Spherical Aberration Sign. A Ray-Tracing Analysis

    PubMed Central

    Bakaraju, Ravi C.; Ehrmann, Klaus; Papas, Eric B.; Ho, Arthur

    2010-01-01

    Purpose To investigate the relationship between the sign of spherical aberration (SA) and the corresponding depth-of-focus (DoF) values around best focus, at three different spatial frequencies (SF). Additionally, to study the influence of the Stiles-Crawford effect (SCE) on DoF. Methods We modeled schematic eyes having a range of SA values, C (4, 0), from -0.20 to 0.20 μm, at 6 mm pupil, in a ray-tracing software (Zemax). The through-focus optical performance was obtained via Modulation Transfer Function (MTF) calculations using thin paraxial lenses in-front of the model eye, from -2.00 to+2.00 D in 0.05D steps. Through-focus full-width (defocus) occurring at the half maximum of MTF value was considered as DoF, in diopters. Results For the low-SF configuration, +SA and –SA results were close to being mirror symmetries of one another. However, for midand high- SF targets, in the SA range spanning from -0.15 to 0.15 μm, models of equal SA magnitude but opposite sign produced similar DoF measures, but those with SA more negative than -0.15 μm showed marginally higher DoF than their positive counterparts. The SCE improved DoF for low SF (10 cycles/mm), while for mid and higher SF (>30 cycles/mm) mixed results were observed. Conclusions As regards presbyopic-correction strategies that use deliberately induced aberrations to increase the depth of focus, the current study suggests that both positive and negative SA have equal potential. However, practical considerations will probably limit the useful DoF achievable through the utilization of SCE in presbyopes. for reference to a contemporary record detailing refractive history.

  20. Characteristics of energy exchange between inter- and intramolecular degrees of freedom in crystalline 1,3,5-triamino-2,4,6-trinitrobenzene (TATB) with implications for coarse-grained simulations of shock waves in polyatomic molecular crystals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kroonblawd, Matthew P.; Sewell, Thomas D., E-mail: sewellt@missouri.edu; Maillet, Jean-Bernard, E-mail: jean-bernard.maillet@cea.fr

    2016-02-14

    In this report, we characterize the kinetics and dynamics of energy exchange between intramolecular and intermolecular degrees of freedom (DoF) in crystalline 1,3,5-triamino-2,4,6-trinitrobenzene (TATB). All-atom molecular dynamics (MD) simulations are used to obtain predictions for relaxation from certain limiting initial distributions of energy between the intra- and intermolecular DoF. The results are used to parameterize a coarse-grained Dissipative Particle Dynamics at constant Energy (DPDE) model for TATB. Each TATB molecule in the DPDE model is represented as an all-atom, rigid-molecule mesoparticle, with explicit external (molecular translational and rotational) DoF and coarse-grained implicit internal (vibrational) DoF. In addition to conserving linearmore » and angular momentum, the DPDE equations of motion conserve the total system energy provided that particles can exchange energy between their external and internal DoF. The internal temperature of a TATB molecule is calculated using an internal equation of state, which we develop here, and the temperatures of the external and internal DoF are coupled using a fluctuation-dissipation relation. The DPDE force expression requires specification of the input parameter σ that determines the rate at which energy is exchanged between external and internal DoF. We adjusted σ based on the predictions for relaxation processes obtained from MD simulations. The parameterized DPDE model was employed in large-scale simulations of shock compression of TATB. We show that the rate of energy exchange governed by σ can significantly influence the transient behavior of the system behind the shock.« less

  1. Assessment of Self-Contamination During Removal of Personal Protective Equipment for Ebola Patient Care.

    PubMed

    Casanova, Lisa M; Teal, Lisa J; Sickbert-Bennett, Emily E; Anderson, Deverick J; Sexton, Daniel J; Rutala, William A; Weber, David J

    2016-10-01

    OBJECTIVE Ebola virus disease (EVD) places healthcare personnel (HCP) at high risk for infection during patient care, and personal protective equipment (PPE) is critical. Protocols for EVD PPE doffing have not been validated for prevention of viral self-contamination. Using surrogate viruses (non-enveloped MS2 and enveloped Φ6), we assessed self-contamination of skin and clothes when trained HCP doffed EVD PPE using a standardized protocol. METHODS A total of 15 HCP donned EVD PPE for this study. Virus was applied to PPE, and a trained monitor guided them through the doffing protocol. Of the 15 participants, 10 used alcohol-based hand rub (ABHR) for glove and hand hygiene and 5 used hypochlorite for glove hygiene and ABHR for hand hygiene. Inner gloves, hands, face, and scrubs were sampled after doffing. RESULTS After doffing, MS2 virus was detected on the inner glove worn on the dominant hand for 8 of 15 participants, on the non-dominant inner glove for 6 of 15 participants, and on scrubs for 2 of 15 participants. All MS2 on inner gloves was observed when ABHR was used for glove hygiene; none was observed when hypochlorite was used. When using hypochlorite for glove hygiene, 1 participant had MS2 on hands, and 1 had MS2 on scrubs. CONCLUSIONS A structured doffing protocol using a trained monitor and ABHR protects against enveloped virus self-contamination. Non-enveloped virus (MS2) contamination was detected on inner gloves, possibly due to higher resistance to ABHR. Doffing protocols protective against all viruses need to incorporate highly effective glove and hand hygiene agents. Infect Control Hosp Epidemiol 2016;1-6.

  2. Activation of a Development-Specific Gene, dofA, by FruA, an Essential Transcription Factor for Development of Myxococcus xanthus

    PubMed Central

    Ueki, Toshiyuki; Inouye, Sumiko

    2005-01-01

    FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development. PMID:16321956

  3. Effect of suspension kinematic on 14 DOF vehicle model

    NASA Astrophysics Data System (ADS)

    Wongpattananukul, T.; Chantharasenawong, C.

    2017-12-01

    Computer simulations play a major role in shaping modern science and engineering. They reduce time and resource consumption in new studies and designs. Vehicle simulations have been studied extensively to achieve a vehicle model used in minimum lap time solution. Simulation result accuracy depends on the abilities of these models to represent real phenomenon. Vehicles models with 7 degrees of freedom (DOF), 10 DOF and 14 DOF are normally used in optimal control to solve for minimum lap time. However, suspension kinematics are always neglected on these models. Suspension kinematics are defined as wheel movements with respect to the vehicle body. Tire forces are expressed as a function of wheel slip and wheel position. Therefore, the suspension kinematic relation is appended to the 14 DOF vehicle model to investigate its effects on the accuracy of simulate trajectory. Classical 14 DOF vehicle model is chosen as baseline model. Experiment data is collected from formula student style car test runs as baseline data for simulation and comparison between baseline model and model with suspension kinematic. Results show that in a single long turn there is an accumulated trajectory error in baseline model compared to model with suspension kinematic. While in short alternate turns, the trajectory error is much smaller. These results show that suspension kinematic had an effect on the trajectory simulation of vehicle. Which optimal control that use baseline model will result in inaccuracy control scheme.

  4. Standardized Observational Assessment of Attention Deficit Hyperactivity Disorder Combined and Predominantly Inattentive Subtypes. II. Classroom Observations.

    PubMed

    McConaughy, Stephanie H; Ivanova, Masha Y; Antshel, Kevin; Eiraldi, Ricardo B; Dumenci, Levent

    2009-07-01

    Trained classroom observers used the Direct Observation Form (DOF; McConaughy & Achenbach, 2009) to rate observations of 163 6- to 11-year-old children in their school classrooms. Participants were assigned to four groups based on a parent diagnostic interview and parent and teacher rating scales: Attention Deficit Hyperactivity Disorder (ADHD)-Combined type (n = 64); ADHD-Inattentive type (n = 22); clinically referred without ADHD (n = 51); and nonreferred control children (n = 26). The ADHD-Combined group scored significantly higher than the referred without ADHD group and controls on the DOF Intrusive and Oppositional syndromes, Attention Deficit Hyperactivity Problems scale, Hyperactivity-Impulsivity subscale, and Total Problems; and significantly lower on the DOF On-Task score. The ADHD-Inattentive group scored significantly higher than controls on the DOF Sluggish Cognitive Tempo and Attention Problems syndromes, Inattention subscale, and Total Problems; and significantly lower on the DOF On-Task score. Implications are discussed regarding the discriminative validity of standardized classroom observations for identifying children with ADHD and differentiating between the two ADHD subtypes.

  5. An Evolutionarily Conserved DOF-CONSTANS Module Controls Plant Photoperiodic Signaling.

    PubMed

    Lucas-Reina, Eva; Romero-Campero, Francisco J; Romero, José M; Valverde, Federico

    2015-06-01

    The response to daylength is a crucial process that evolved very early in plant evolution, entitling the early green eukaryote to predict seasonal variability and attune its physiological responses to the environment. The photoperiod responses evolved into the complex signaling pathways that govern the angiosperm floral transition today. The Chlamydomonas reinhardtii DNA-Binding with One Finger (CrDOF) gene controls transcription in a photoperiod-dependent manner, and its misexpression influences algal growth and viability. In short days, CrDOF enhances CrCO expression, a homolog of plant CONSTANS (CO), by direct binding to its promoter, while it reduces the expression of cell division genes in long days independently of CrCO. In Arabidopsis (Arabidopsis thaliana), transgenic plants overexpressing CrDOF show floral delay and reduced expression of the photoperiodic genes CO and FLOWERING LOCUS T. The conservation of the DOF-CO module during plant evolution could be an important clue to understanding diversification by the inheritance of conserved gene toolkits in key developmental programs. © 2015 American Society of Plant Biologists. All Rights Reserved.

  6. Comparative study of 2-DOF micromirrors for precision light manipulation

    NASA Astrophysics Data System (ADS)

    Young, Johanna I.; Shkel, Andrei M.

    2001-08-01

    Many industry experts predict that the future of fiber optic telecommunications depends on the development of all-optical components for switching of photonic signals from fiber to fiber throughout the networks. MEMS is a promising technology for providing all-optical switching at high speeds with significant cost reductions. This paper reports on the the analysis of two designs for 2-DOF electrostatically actuated MEMS micromirrors for precision controllable large optical switching arrays. The behavior of the micromirror designs is predicted by coupled-field electrostatic and modal analysis using a finite element analysis (FEA) multi-physics modeling software. The analysis indicates that the commonly used gimbal type mirror design experiences electrostatic interference and would therefore be difficult to precisely control for 2-DOF motion. We propose a new design approach which preserves 2-DOF actuation while minimizing electrostatic interference between the drive electrodes and the mirror. Instead of using two torsional axes, we use one actuator which combines torsional and flexural DOFs. A comparative analysis of the conventional gimbal design and the one proposed in this paper is performed.

  7. Standardized Observational Assessment of Attention Deficit Hyperactivity Disorder Combined and Predominantly Inattentive Subtypes. II. Classroom Observations

    PubMed Central

    McConaughy, Stephanie H.; Ivanova, Masha Y.; Antshel, Kevin; Eiraldi, Ricardo B.; Dumenci, Levent

    2010-01-01

    Trained classroom observers used the Direct Observation Form (DOF; McConaughy & Achenbach, 2009) to rate observations of 163 6- to 11-year-old children in their school classrooms. Participants were assigned to four groups based on a parent diagnostic interview and parent and teacher rating scales: Attention Deficit Hyperactivity Disorder (ADHD)—Combined type (n = 64); ADHD—Inattentive type (n = 22); clinically referred without ADHD (n = 51); and nonreferred control children (n = 26). The ADHD—Combined group scored significantly higher than the referred without ADHD group and controls on the DOF Intrusive and Oppositional syndromes, Attention Deficit Hyperactivity Problems scale, Hyperactivity-Impulsivity subscale, and Total Problems; and significantly lower on the DOF On-Task score. The ADHD—Inattentive group scored significantly higher than controls on the DOF Sluggish Cognitive Tempo and Attention Problems syndromes, Inattention subscale, and Total Problems; and significantly lower on the DOF On-Task score. Implications are discussed regarding the discriminative validity of standardized classroom observations for identifying children with ADHD and differentiating between the two ADHD subtypes. PMID:20802813

  8. Distributed Optical Fiber Sensors Based on Optical Frequency Domain Reflectometry: A review

    PubMed Central

    Wang, Chenhuan; Liu, Kun; Jiang, Junfeng; Yang, Di; Pan, Guanyi; Pu, Zelin; Liu, Tiegen

    2018-01-01

    Distributed optical fiber sensors (DOFS) offer unprecedented features, the most unique one of which is the ability of monitoring variations of the physical and chemical parameters with spatial continuity along the fiber. Among all these distributed sensing techniques, optical frequency domain reflectometry (OFDR) has been given tremendous attention because of its high spatial resolution and large dynamic range. In addition, DOFS based on OFDR have been used to sense many parameters. In this review, we will survey the key technologies for improving sensing range, spatial resolution and sensing performance in DOFS based on OFDR. We also introduce the sensing mechanisms and the applications of DOFS based on OFDR including strain, stress, vibration, temperature, 3D shape, flow, refractive index, magnetic field, radiation, gas and so on. PMID:29614024

  9. Distributed Optical Fiber Sensors Based on Optical Frequency Domain Reflectometry: A review.

    PubMed

    Ding, Zhenyang; Wang, Chenhuan; Liu, Kun; Jiang, Junfeng; Yang, Di; Pan, Guanyi; Pu, Zelin; Liu, Tiegen

    2018-04-03

    Distributed optical fiber sensors (DOFS) offer unprecedented features, the most unique one of which is the ability of monitoring variations of the physical and chemical parameters with spatial continuity along the fiber. Among all these distributed sensing techniques, optical frequency domain reflectometry (OFDR) has been given tremendous attention because of its high spatial resolution and large dynamic range. In addition, DOFS based on OFDR have been used to sense many parameters. In this review, we will survey the key technologies for improving sensing range, spatial resolution and sensing performance in DOFS based on OFDR. We also introduce the sensing mechanisms and the applications of DOFS based on OFDR including strain, stress, vibration, temperature, 3D shape, flow, refractive index, magnetic field, radiation, gas and so on.

  10. Sensory-Feedback Exoskeletal Arm Controller

    NASA Technical Reports Server (NTRS)

    An, Bin; Massie, Thomas H.; Vayner, Vladimir

    2004-01-01

    An electromechanical exoskeletal arm apparatus has been designed for use in controlling a remote robotic manipulator arm. The apparatus, called a force-feedback exoskeleton arm master (F-EAM) is comfortable to wear and easy to don and doff. It provides control signals from the wearer s arm to a robot arm or a computer simulator (e.g., a virtual-reality system); it also provides force and torque feedback from sensors on the robot arm or from the computer simulator to the wearer s arm. The F-EAM enables the wearer to make the robot arm gently touch objects and finely manipulate them without exerting excessive forces. The F-EAM features a lightweight design in which the motors and gear heads that generate force and torque feedback are made smaller than they ordinarily would be: this is achieved by driving the motors to power levels greater than would ordinarily be used in order to obtain higher torques, and by providing active liquid cooling of the motors to prevent overheating at the high drive levels. The F-EAM (see figure) includes an assembly that resembles a backpack and is worn like a backpack, plus an exoskeletal arm mechanism. The FEAM has five degrees of freedom (DOFs) that correspond to those of the human arm: 1. The first DOF is that of the side-to-side rotation of the upper arm about the shoulder (rotation about axis 1). The reflected torque for this DOF is provided by motor 1 via drum 1 and a planar four-bar linkage. 2. The second DOF is that of the up-and-down rotation of the arm about the shoulder. The reflected torque for this DOF is provided by motor 2 via drum 2. 3. The third DOF is that of twisting of the upper arm about its longitudinal axis. This DOF is implemented in a cable remote-center mechanism (CRCM). The reflected torque for this DOF is provided by motor 3, which drives the upper-arm cuff and the mechanism below it. A bladder inflatable by gas or liquid is placed between the cuff and the wearer s upper arm to compensate for misalignment between the exoskeletal mechanism and the shoulder. 4. The fourth DOF is that of flexion and extension of the elbow. The reflected torque for this DOF is provided by motor 4 and drum 4, which are mounted on a bracket that can slide longitudinally by a pin-and-slot engagement with the upper-arm cuff to compensate for slight variations in the position of the kinematic center of the elbow. Attached to drum 4 is an adapter plate to which is attached a CRCM for the lower arm. 5. The lower-arm CRCM implements the fifth DOF, which is the twist of the forearm about its longitudinal axis. Motor 5 provides the reflected torque for this DOF by driving the lower-arm cuff. A rod transmits twist and torsion between the lower-arm cuff and the hand cuff. With this system, the motion of the wearer s joints and the reflected torques applied to these joints can be measured and controlled in a relatively simple manner. This is because the anthropomorphic design of the mechanism imitates the kinematics of the human arm, eliminating the need for kinematic conversion of joint-torque and joint-angle data.

  11. Design and Analysis of Precise Pointing Systems

    NASA Technical Reports Server (NTRS)

    Kim, Young K.

    2000-01-01

    The mathematical models of Glovebox Integrated Microgravity Isolation Technology (g- LIMIT) dynamics/control system, which include six degrees of freedom (DOF) equations of motion, mathematical models of position sensors, accelerometers and actuators, and acceleration and position controller, were developed using MATLAB and TREETOPS simulations. Optimal control parameters of G-LIMIT control system were determined through sensitivity studies and its performance were evaluated with the TREETOPS model of G-LIMIT dynamics and control system. The functional operation and performance of the Tektronix DTM920 digital thermometer were studied and the inputs to the crew procedures and training of the DTM920 were documented.

  12. Vibration characterization and control of miniature Stirling-cycle cryocoolers for space application

    NASA Technical Reports Server (NTRS)

    Ross, R. G., Jr.; Johnson, D. L.; Kotsubo, V.

    1991-01-01

    This paper provides a summary overview of the vibration characteristics of split Stirling cryocoolers of the Oxford type and describes means being developed to achieve vibration levels consistent with the exacting requirements of sensitive infrared spectrometer instruments currently under development for NASA applications. A key emphasis of the paper is on exploring both active and passive means of reducing the residual upper harmonics of the drive frequency that remain with nulled back-to-back compressor and displacer units. Vibration supression results, measured with JPL's unique six-DOF force dynamometer, are presented for an 80 K Stirling cooler.

  13. Robust inverse kinematics using damped least squares with dynamic weighting

    NASA Technical Reports Server (NTRS)

    Schinstock, D. E.; Faddis, T. N.; Greenway, R. B.

    1994-01-01

    This paper presents a general method for calculating the inverse kinematics with singularity and joint limit robustness for both redundant and non-redundant serial-link manipulators. Damped least squares inverse of the Jacobian is used with dynamic weighting matrices in approximating the solution. This reduces specific joint differential vectors. The algorithm gives an exact solution away from the singularities and joint limits, and an approximate solution at or near the singularities and/or joint limits. The procedure is here implemented for a six d.o.f. teleoperator and a well behaved slave manipulator resulted under teleoperational control.

  14. Distance-to-Agreement Investigation of Tomotherapy's Bony Anatomy-Based Autoregistration and Planning Target Volume Contour-Based Optimization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Suh, Steve, E-mail: ssuh@coh.org; Schultheiss, Timothy E.

    Purpose: To compare Tomotherapy's megavoltage computed tomography bony anatomy autoregistration with the best achievable registration, assuming no deformation and perfect knowledge of planning target volume (PTV) location. Methods and Materials: Distance-to-agreement (DTA) of the PTV was determined by applying a rigid-body shift to the PTV region of interest of the prostate from its reference position, assuming no deformations. Planning target volume region of interest of the prostate was extracted from the patient archives. The reference position was set by the 6 degrees of freedom (dof)—x, y, z, roll, pitch, and yaw—optimization results from the previous study at this institution. Themore » DTA and the compensating parameters were calculated by the shift of the PTV from the reference 6-dof to the 4-dof—x, y, z, and roll—optimization. In this study, the effectiveness of Tomotherapy's 4-dof bony anatomy–based autoregistration was compared with the idealized 4-dof PTV contour-based optimization. Results: The maximum DTA (maxDTA) of the bony anatomy-based autoregistration was 3.2 ± 1.9 mm, with the maximum value of 8.0 mm. The maxDTA of the contour-based optimization was 1.8 ± 1.3 mm, with the maximum value of 5.7 mm. Comparison of Pearson correlation of the compensating parameters between the 2 4-dof optimization algorithms shows that there is a small but statistically significant correlation in y and z (0.236 and 0.300, respectively), whereas there is very weak correlation in x and roll (0.062 and 0.025, respectively). Conclusions: We find that there is an average improvement of approximately 1 mm in terms of maxDTA on the PTV going from 4-dof bony anatomy-based autoregistration to the 4-dof contour-based optimization. Pearson correlation analysis of the 2 4-dof optimizations suggests that uncertainties due to deformation and inadequate resolution account for much of the compensating parameters, but pitch variation also makes a statistically significant contribution.« less

  15. Gene- and environment-dependent neuroendocrine etiogenesis of homosexuality and transsexualism.

    PubMed

    Dörner, G; Poppe, I; Stahl, F; Kölzsch, J; Uebelhack, R

    1991-01-01

    Sexual brain organization is dependent on sex hormone and neurotransmitter levels occurring during critical developmental periods. The higher the androgen levels during brain organization, caused by genetic and/or environmental factors, the higher is the biological predisposition to bi- and homosexuality or even transsexualism in females and the lower it is in males. Adrenal androgen excess, leading to heterotypical sexual orientation and/or gender role behavior in genetic females, can be caused by 21-hydroxylase deficiency, especially when associated with prenatal stress. The cortisol (F) precursor 21-deoxycortisol (21-DOF) was found to be significantly increased after ACTH stimulation in homosexual as compared to heterosexual females. 21-DOF was increased significantly before and even highly significantly after ACTH stimulation in female-to-male transsexuals. In view of these data, heterozygous and homozygous forms, respectively, of 21-hydroxylase deficiency represent a genetic predisposition to androgen-dependent development of homosexuality and transsexualism in females. Testicular androgen deficiency in prenatal life, giving rise to heterotypical sexual orientation and/or gender role behavior in genetic males, may be induced by prenatal stress and/or maternal or fetal genetic alterations. Most recently, in mothers of homosexual men--following ACTH stimulation--a significantly increased prevalence of high 21-DOF plasma values and 21-DOF/F ratios was found, which surpassed the mean + 1 SD level of heterosexual control women. In homosexual men as well--following ACTH stimulation--most of the 21-DOF plasma values and 21-DOF/F ratios also surpassed the mean + 1 SD level of heterosexual men. In only one out of 9 homosexual males, neither in his blood nor in that of his mother increased 21-DOF values and 21-DOF/F ratios were found after ACTH stimulation. In this homosexual man, however, the plasma dehydroepiandrosterone sulfate (DHEA-S) values and the DHEA-S/1000 x A (A = androstenedione) ratio were increased before and after ACTH stimulation. Furthermore, highly significantly increased basal plasma levels of dehydroepiandrosterone sulfate were found in male-to-female transsexuals as compared to normal males, suggesting partial 3 beta-ol hydroxysteroid dehydrogenase deficiency to be a predisposing factor for the development of male-to-female transsexualism.

  16. Design and implementation of a novel modal space active force control concept for spatial multi-DOF parallel robotic manipulators actuated by electrical actuators.

    PubMed

    Yang, Chifu; Zhao, Jinsong; Li, Liyi; Agrawal, Sunil K

    2018-01-01

    Robotic spine brace based on parallel-actuated robotic system is a new device for treatment and sensing of scoliosis, however, the strong dynamic coupling and anisotropy problem of parallel manipulators result in accuracy loss of rehabilitation force control, including big error in direction and value of force. A novel active force control strategy named modal space force control is proposed to solve these problems. Considering the electrical driven system and contact environment, the mathematical model of spatial parallel manipulator is built. The strong dynamic coupling problem in force field is described via experiments as well as the anisotropy problem of work space of parallel manipulators. The effects of dynamic coupling on control design and performances are discussed, and the influences of anisotropy on accuracy are also addressed. With mass/inertia matrix and stiffness matrix of parallel manipulators, a modal matrix can be calculated by using eigenvalue decomposition. Making use of the orthogonality of modal matrix with mass matrix of parallel manipulators, the strong coupled dynamic equations expressed in work space or joint space of parallel manipulator may be transformed into decoupled equations formulated in modal space. According to this property, each force control channel is independent of others in the modal space, thus we proposed modal space force control concept which means the force controller is designed in modal space. A modal space active force control is designed and implemented with only a simple PID controller employed as exampled control method to show the differences, uniqueness, and benefits of modal space force control. Simulation and experimental results show that the proposed modal space force control concept can effectively overcome the effects of the strong dynamic coupling and anisotropy problem in the physical space, and modal space force control is thus a very useful control framework, which is better than the current joint space control and work space control. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.

  17. Six Degrees-of-Freedom Prostate and Lung Tumor Motion Measurements Using Kilovoltage Intrafraction Monitoring

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huang, Chen-Yu; Tehrani, Joubin Nasehi; Ng, Jin Aun

    2015-02-01

    Purpose: Tumor positional uncertainty has been identified as a major issue that deteriorates the efficacy of radiation therapy. Tumor rotational movement, which is not well understood, can result in significant geometric and dosimetric inaccuracies. The objective of this study was to measure 6 degrees-of-freedom (6 DoF) prostate and lung tumor motion, focusing on the more novel rotation, using kilovoltage intrafraction monitoring (KIM). Methods and Materials: Continuous kilovoltage (kV) projections of tumors with gold fiducial markers were acquired during radiation therapy for 267 fractions from 10 prostate cancer patients and immediately before or after radiation therapy for 50 fractions from 3more » lung cancer patients. The 6 DoF motion measurements were determined from the individual 3-dimensional (3D) marker positions, after using methods to reject spurious and smooth noisy data, using an iterative closest point algorithm. Results: There were large variations in the magnitude of the tumor rotation among different fractions and patients. Various rotational patterns were observed. The average prostate rotation angles around the left-right (LR), superior-inferior (SI), and anterior-posterior (AP) axes were 1.0 ± 5.0°, 0.6 ± 3.3°, and 0.3 ± 2.0°, respectively. For 35% of the time, the prostate rotated more than 5° about the LR axis, indicating the need for intrafractional adaptation during radiation delivery. For lung patients, the average LR, SI, and AP rotation angles were 0.8 ± 4.2°, −0.8 ± 4.5°, and 1.7 ± 3.1°, respectively. For about 30% of the time, the lung tumors rotated more than 5° around the SI axis. Respiration-induced rotation was detected in 2 of the 3 lung patients. Conclusions: The prostate and lung tumors were found to undergo rotations of more than 5° for about a third of the time. The lung tumor data represent the first 6 DoF tumor motion measured by kV images. The 6 DoF KIM method can enable rotational and translational adaptive radiation therapy and potentially reduce treatment margins.« less

  18. Improved estimation of random vibration loads in launch vehicles

    NASA Technical Reports Server (NTRS)

    Mehta, R.; Erwin, E.; Suryanarayan, S.; Krishna, Murali M. R.

    1993-01-01

    Random vibration induced load is an important component of the total design load environment for payload and launch vehicle components and their support structures. The current approach to random vibration load estimation is based, particularly at the preliminary design stage, on the use of Miles' equation which assumes a single degree-of-freedom (DOF) system and white noise excitation. This paper examines the implications of the use of multi-DOF system models and response calculation based on numerical integration using the actual excitation spectra for random vibration load estimation. The analytical study presented considers a two-DOF system and brings out the effects of modal mass, damping and frequency ratios on the random vibration load factor. The results indicate that load estimates based on the Miles' equation can be significantly different from the more accurate estimates based on multi-DOF models.

  19. Development of a simple system for simultaneously measuring 6DOF geometric motion errors of a linear guide.

    PubMed

    Qibo, Feng; Bin, Zhang; Cunxing, Cui; Cuifang, Kuang; Yusheng, Zhai; Fenglin, You

    2013-11-04

    A simple method for simultaneously measuring the 6DOF geometric motion errors of the linear guide was proposed. The mechanisms for measuring straightness and angular errors and for enhancing their resolution are described in detail. A common-path method for measuring the laser beam drift was proposed and it was used to compensate the errors produced by the laser beam drift in the 6DOF geometric error measurements. A compact 6DOF system was built. Calibration experiments with certain standard measurement meters showed that our system has a standard deviation of 0.5 µm in a range of ± 100 µm for the straightness measurements, and standard deviations of 0.5", 0.5", and 1.0" in the range of ± 100" for pitch, yaw, and roll measurements, respectively.

  20. The 2 Degrees of Freedom facility in Firenze for the study of weak forces

    NASA Astrophysics Data System (ADS)

    Marconi, L.; Stanga, R.; Lorenzini, M.; Grimani, C.; Bassan, M.; Pucacco, G.; Di Fiore, L.; De Rosa, R.; Garufi, F.; Milano, L.

    2010-05-01

    The LISA test-mass (TM) is sensitive to weak forces along all 6 Degrees of Freedom (DoFs). Extensi ve ground test ing is required in order to evaluate the influence of cross-talks of read-outs and actuators operating on different DoFs. To best represent the flight conditions, we developed in Firenze a facility with 2 soft DoFs. Using this facility we measure the forces and stiffnesses acting simultaneously along the 2 soft DoFs, and, more specifically, we will be able to de b ug residual couplings between the TM and the capacitive position sensor that reads the TM position, and to measure actuation cross talks with closed feedback loop. The facility is now ready, and here we report on the co mmi ssioning test s, and on the first measurements.

  1. Developing a multi-joint upper limb exoskeleton robot for diagnosis, therapy, and outcome evaluation in neurorehabilitation.

    PubMed

    Ren, Yupeng; Kang, Sang Hoon; Park, Hyung-Soon; Wu, Yi-Ning; Zhang, Li-Qun

    2013-05-01

    Arm impairments in patients post stroke involve the shoulder, elbow and wrist simultaneously. It is not very clear how patients develop spasticity and reduced range of motion (ROM) at the multiple joints and the abnormal couplings among the multiple joints and the multiple degrees-of-freedom (DOF) during passive movement. It is also not clear how they lose independent control of individual joints/DOFs and coordination among the joints/DOFs during voluntary movement. An upper limb exoskeleton robot, the IntelliArm, which can control the shoulder, elbow, and wrist, was developed, aiming to support clinicians and patients with the following integrated capabilities: 1) quantitative, objective, and comprehensive multi-joint neuromechanical pre-evaluation capabilities aiding multi-joint/DOF diagnosis for individual patients; 2) strenuous and safe passive stretching of hypertonic/deformed arm for loosening up muscles/joints based on the robot-aided diagnosis; 3) (assistive/resistive) active reaching training after passive stretching for regaining/improving motor control ability; and 4) quantitative, objective, and comprehensive neuromechanical outcome evaluation at the level of individual joints/DOFs, multiple joints, and whole arm. Feasibility of the integrated capabilities was demonstrated through experiments with stroke survivors and healthy subjects.

  2. Passive stiffness of coupled wrist and forearm rotations.

    PubMed

    Drake, Will B; Charles, Steven K

    2014-09-01

    Coordinated movement requires that the neuromuscular system account and compensate for movement dynamics. One particularly complex aspect of movement dynamics is the interaction that occurs between degrees of freedom (DOF), which may be caused by inertia, damping, and/or stiffness. During wrist rotations, the two DOF of the wrist (flexion-extension and radial-ulnar deviation, FE and RUD) are coupled through interaction torques arising from passive joint stiffness. One important unanswered question is whether the DOF of the forearm (pronation-supination, PS) is coupled to the two DOF of the wrist. Answering this question, and understanding the dynamics of wrist and forearm rotations in general, requires knowledge of the stiffness encountered during rotations involving all three DOF (PS, FE, and RUD). Here we present the first-ever measurement of the passive stiffness encountered during simultaneous wrist and forearm rotations. Using a wrist and forearm robot, we measured coupled wrist and forearm stiffness in 10 subjects and present it as a 3-by-3 stiffness matrix. This measurement of passive wrist and forearm stiffness will enable future studies investigating the dynamics of wrist and forearm rotations, exposing the dynamics for which the neuromuscular system must plan and compensate during movements involving the wrist and forearm.

  3. TALARIS project update: Overview of flight testing and development of a prototype planetary surface exploration hopper

    NASA Astrophysics Data System (ADS)

    Rossi, Christopher; Cunio, Phillip M.; Alibay, Farah; Morrow, Joe; Nothnagel, Sarah L.; Steiner, Ted; Han, Christopher J.; Lanford, Ephraim; Hoffman, Jeffrey A.

    2012-12-01

    The TALARIS (Terrestrial Artificial Lunar And Reduced GravIty Simulator) project is intended to test GNC (Guidance, Navigation, and Control) algorithms on a prototype planetary surface exploration hopper in a dynamic environment with simulated reduced gravity. The vehicle is being developed by the Charles Stark Draper Laboratory and Massachusetts Institute of Technology in support of efforts in the Google Lunar X-Prize contest. This paper presents progress achieved since September 2010 in vehicle development and flight testing. Upgrades to the vehicle are described, including a redesign of the power train for the gravity-offset propulsion system and a redesign of key elements of the spacecraft emulator propulsion system. The integration of flight algorithms into modular flight software is also discussed. Results are reported for restricted degree of freedom (DOF) tests used to tune GNC algorithms on the path to a full 6-DOF hover-hop flight profile. These tests include 3-DOF tests on flat surfaces restricted to horizontal motion, and 2-DOF vertical tests restricted to vertical motion and 1-DOF attitude control. The results of tests leading up to full flight operations are described, as are lessons learned and future test plans.

  4. Design and evaluation of prosthetic shoulder controller

    PubMed Central

    Barton, Joseph E.; Sorkin, John D.

    2015-01-01

    We developed a 2-degree-of-freedom (DOF) shoulder position transducer (sensing shoulder protraction-retraction and elevation-depression) that can be used to control two of a powered prosthetic humerus' DOFs. We also developed an evaluation protocol based on Fitts' law to assess the performance of our device. The primary motivation for this work was to support development of powered prosthetic shoulder joints of a new generation of prosthetic arms for people with shoulder disarticulation and very high-level transhumeral amputation. We found that transducers that provided resistance to shoulder movement performed better than those providing no resistance. We also found that a position control scheme, where effector position is proportional to shoulder position, performed better than a velocity control scheme, where effector velocity is proportional to shoulder position. More generally, our transducer can be used to control motion along any two DOFs. It can also be used in a more general 4-DOF control scheme by sequentially controlling two DOFs at a time. The evaluation protocol has general applicability for researchers and practitioners. Researchers can employ it to compare different prosthesis designs and control schemes, while practitioners may find the evaluation protocol useful in evaluating and training people with amputation in the use of prostheses. PMID:25357185

  5. Design and Evaluation of Shape-Changing Haptic Interfaces for Pedestrian Navigation Assistance.

    PubMed

    Spiers, Adam J; Dollar, Aaron M

    2017-01-01

    Shape-changing interfaces are a category of device capable of altering their form in order to facilitate communication of information. In this work, we present a shape-changing device that has been designed for navigation assistance. 'The Animotus' (previously, 'The Haptic Sandwich' ), resembles a cube with an articulated upper half that is able to rotate and extend (translate) relative to the bottom half, which is fixed in the user's grasp. This rotation and extension, generally felt via the user's fingers, is used to represent heading and proximity to navigational targets. The device is intended to provide an alternative to screen or audio based interfaces for visually impaired, hearing impaired, deafblind, and sighted pedestrians. The motivation and design of the haptic device is presented, followed by the results of a navigation experiment that aimed to determine the role of each device DOF, in terms of facilitating guidance. An additional device, 'The Haptic Taco', which modulated its volume in response to target proximity (negating directional feedback), was also compared. Results indicate that while the heading (rotational) DOF benefited motion efficiency, the proximity (translational) DOF benefited velocity. Combination of the two DOF improved overall performance. The volumetric Taco performed comparably to the Animotus' extension DOF.

  6. Robot-assisted microsurgical forceps with haptic feedback for transoral laser microsurgery.

    PubMed

    Deshpande, Nikhil; Chauhan, Manish; Pacchierotti, Claudio; Prattichizzo, Domenico; Caldwell, Darwin G; Mattos, Leonardo S

    2016-08-01

    In this paper, a novel, motorized, multi-degrees-of-freedom (DoF), microsurgical forceps tool is presented, which is based on a master-slave teleoperation architecture. The slave device is a 7-DoF manipulator with: (i) 6-DoF positioning and orientation, (ii) 1 open/close gripper DoF; and (iii) an integrated force/torque sensor for tissue grip-force measurement. The master device is a 7-DoF haptic interface which teleoperates the slave device, and provides haptic feedback in its gripper interface. The combination of the device and the surgeon interface replaces the manual, hand-held device providing easy-to-use and ergonomic tissue control, simplifying the surgical tasks. This makes the system suitable to real surgical scenarios in the operating room (OR). The performance of the system was analysed through the evaluation of teleoperation control and characterization of gripping force. The new system offers an overall positioning error of less than 400 μm demonstrating its safety and accuracy. Improved system precision, usability, and ergonomics point to the potential suitability of the device for the OR and its ability to advance haptic-feedback-enhanced transoral laser microsurgeries.

  7. Electrical generation and control of the valley carriers in a monolayer transition metal dichalcogenide

    NASA Astrophysics Data System (ADS)

    Ye, Yu; Xiao, Jun; Wang, Hailong; Ye, Ziliang; Zhu, Hanyu; Zhao, Mervin; Wang, Yuan; Zhao, Jianhua; Yin, Xiaobo; Zhang, Xiang

    2016-07-01

    Electrically controlling the flow of charge carriers is the foundation of modern electronics. By accessing the extra spin degree of freedom (DOF) in electronics, spintronics allows for information processes such as magnetoresistive random-access memory. Recently, atomic membranes of transition metal dichalcogenides (TMDCs) were found to support unequal and distinguishable carrier distribution in different crystal momentum valleys. This valley polarization of carriers enables a new DOF for information processing. A variety of valleytronic devices such as valley filters and valves have been proposed, and optical valley excitation has been observed. However, to realize its potential in electronics it is necessary to electrically control the valley DOF, which has so far remained a significant challenge. Here, we experimentally demonstrate the electrical generation and control of valley polarization. This is achieved through spin injection via a diluted ferromagnetic semiconductor and measured through the helicity of the electroluminescence due to the spin-valley locking in TMDC monolayers. We also report a new scheme of electronic devices that combine both the spin and valley DOFs. Such direct electrical generation and control of valley carriers opens up new dimensions in utilizing both the spin and valley DOFs for next-generation electronics and computing.

  8. Six-Degree-of-Freedom Sensor Fish Design and Instrumentation

    PubMed Central

    Deng, Zhiqun; Carlson, Thomas J.; Duncan, Joanne P.; Richmond, Marshall C.

    2007-01-01

    Fish passing through dams may be injured or killed despite advances in turbine design, project operations and other fish bypass systems. The six-degree-of-freedom (6DOF) Sensor Fish device is an autonomous sensor package that characterizes the physical conditions and physical stresses to which fish are exposed when they pass through complex hydraulic environments. It has been used to identify the locations and operations where conditions are severe enough to injure or kill fish. During the design process, a set of governing equations of motion for the Sensor Fish was derived and simulated to understand the design implications of instrument selection and placement within the body of the device. The Sensor Fish package includes three rotation sensors, three acceleration sensors, a pressure sensor, and a temperature sensor with a sampling frequency of 2,000 Hz. Its housing is constructed of clear polycarbonate plastic. It is 24.5 mm in diameter and 90 mm in length and weighs about 43 g, similar to the size and density of a yearling salmon smolt. The accuracy of the pressure sensor was determined to be within 0.2 psi. In laboratory acceptance tests, the relative errors of both the linear acceleration and angular velocity measurements were determined to be less than 5%. An exposure is defined as a significant event when the acceleration reaches predefined thresholds. Based on the different characteristic of acceleration and rotation velocities, the exposure event is categorized as either a collision between the Sensor Fish and a solid structure or shear caused by turbulence. Since its development in 2005, the 6DOF Sensor Fish has been deployed successfully at many major dams in the United States. PMID:28903301

  9. A novel Morse code-inspired method for multiclass motor imagery brain-computer interface (BCI) design.

    PubMed

    Jiang, Jun; Zhou, Zongtan; Yin, Erwei; Yu, Yang; Liu, Yadong; Hu, Dewen

    2015-11-01

    Motor imagery (MI)-based brain-computer interfaces (BCIs) allow disabled individuals to control external devices voluntarily, helping us to restore lost motor functions. However, the number of control commands available in MI-based BCIs remains limited, limiting the usability of BCI systems in control applications involving multiple degrees of freedom (DOF), such as control of a robot arm. To address this problem, we developed a novel Morse code-inspired method for MI-based BCI design to increase the number of output commands. Using this method, brain activities are modulated by sequences of MI (sMI) tasks, which are constructed by alternately imagining movements of the left or right hand or no motion. The codes of the sMI task was detected from EEG signals and mapped to special commands. According to permutation theory, an sMI task with N-length allows 2 × (2(N)-1) possible commands with the left and right MI tasks under self-paced conditions. To verify its feasibility, the new method was used to construct a six-class BCI system to control the arm of a humanoid robot. Four subjects participated in our experiment and the averaged accuracy of the six-class sMI tasks was 89.4%. The Cohen's kappa coefficient and the throughput of our BCI paradigm are 0.88 ± 0.060 and 23.5bits per minute (bpm), respectively. Furthermore, all of the subjects could operate an actual three-joint robot arm to grasp an object in around 49.1s using our approach. These promising results suggest that the Morse code-inspired method could be used in the design of BCIs for multi-DOF control. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Intervertebral anticollision constraints improve out-of-plane translation accuracy of a single-plane fluoroscopy-to-CT registration method for measuring spinal motion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lin, Cheng-Chung; Tsai, Tsung-Yuan; Hsu, Shih-Jung

    2013-03-15

    Purpose: The study aimed to propose a new single-plane fluoroscopy-to-CT registration method integrated with intervertebral anticollision constraints for measuring three-dimensional (3D) intervertebral kinematics of the spine; and to evaluate the performance of the method without anticollision and with three variations of the anticollision constraints via an in vitro experiment. Methods: The proposed fluoroscopy-to-CT registration approach, called the weighted edge-matching with anticollision (WEMAC) method, was based on the integration of geometrical anticollision constraints for adjacent vertebrae and the weighted edge-matching score (WEMS) method that matched the digitally reconstructed radiographs of the CT models of the vertebrae and the measured single-plane fluoroscopymore » images. Three variations of the anticollision constraints, namely, T-DOF, R-DOF, and A-DOF methods, were proposed. An in vitro experiment using four porcine cervical spines in different postures was performed to evaluate the performance of the WEMS and the WEMAC methods. Results: The WEMS method gave high precision and small bias in all components for both vertebral pose and intervertebral pose measurements, except for relatively large errors for the out-of-plane translation component. The WEMAC method successfully reduced the out-of-plane translation errors for intervertebral kinematic measurements while keeping the measurement accuracies for the other five degrees of freedom (DOF) more or less unaltered. The means (standard deviations) of the out-of-plane translational errors were less than -0.5 (0.6) and -0.3 (0.8) mm for the T-DOF method and the R-DOF method, respectively. Conclusions: The proposed single-plane fluoroscopy-to-CT registration method reduced the out-of-plane translation errors for intervertebral kinematic measurements while keeping the measurement accuracies for the other five DOF more or less unaltered. With the submillimeter and subdegree accuracy, the WEMAC method was considered accurate for measuring 3D intervertebral kinematics during various functional activities for research and clinical applications.« less

  11. Frequency Response Function Expansion for Unmeasured Translation and Rotation Dofs for Impedance Modelling Applications

    NASA Astrophysics Data System (ADS)

    Avitabile, P.; O'Callahan, J.

    2003-07-01

    Inclusion of rotational effects is critical for the accuracy of the predicted system characteristics, in almost all system modelling studies. However, experimentally derived information for the description of one or more of the components for the system will generally not have any rotational effects included in the description of the component. The lack of rotational effects has long affected the results from any system model development whether using a modal-based approach or an impedance-based approach. Several new expansion processes are described herein for the development of FRFs needed for impedance-based system models. These techniques expand experimentally derived mode shapes, residual modes from the modal parameter estimation process and FRFs directly to allow for the inclusion of the necessary rotational dof. The FRFs involving translational to rotational dofs are developed as well as the rotational to rotational dof. Examples are provided to show the use of these techniques.

  12. Simulations of 6-DOF Motion with a Cartesian Method

    NASA Technical Reports Server (NTRS)

    Murman, Scott M.; Aftosmis, Michael J.; Berger, Marsha J.; Kwak, Dochan (Technical Monitor)

    2003-01-01

    Coupled 6-DOF/CFD trajectory predictions using an automated Cartesian method are demonstrated by simulating a GBU-32/JDAM store separating from an F-18C aircraft. Numerical simulations are performed at two Mach numbers near the sonic speed, and compared with flight-test telemetry and photographic-derived data. Simulation results obtained with a sequential-static series of flow solutions are contrasted with results using a time-dependent flow solver. Both numerical methods show good agreement with the flight-test data through the first half of the simulations. The sequential-static and time-dependent methods diverge over the last half of the trajectory prediction. after the store produces peak angular rates. A cost comparison for the Cartesian method is included, in terms of absolute cost and relative to computing uncoupled 6-DOF trajectories. A detailed description of the 6-DOF method, as well as a verification of its accuracy, is provided in an appendix.

  13. Direct Method Transcription for a Human-Class Translunar Injection Trajectory Optimization

    NASA Technical Reports Server (NTRS)

    Witzberger, Kevin E.; Zeiler, Tom

    2012-01-01

    This paper presents a new trajectory optimization software package developed in the framework of a low-to-high fidelity 3 degrees-of-freedom (DOF)/6-DOF vehicle simulation program named Mission Analysis Simulation Tool in Fortran (MASTIF) and its application to a translunar trajectory optimization problem. The functionality of the developed optimization package is implemented as a new "mode" in generalized settings to make it applicable for a general trajectory optimization problem. In doing so, a direct optimization method using collocation is employed for solving the problem. Trajectory optimization problems in MASTIF are transcribed to a constrained nonlinear programming (NLP) problem and solved with SNOPT, a commercially available NLP solver. A detailed description of the optimization software developed is provided as well as the transcription specifics for the translunar injection (TLI) problem. The analysis includes a 3-DOF trajectory TLI optimization and a 3-DOF vehicle TLI simulation using closed-loop guidance.

  14. Design of a surgical robot with dynamic vision field control for Single Port Endoscopic Surgery.

    PubMed

    Kobayashi, Yo; Sekiguchi, Yuta; Tomono, Yu; Watanabe, Hiroki; Toyoda, Kazutaka; Konishi, Kozo; Tomikawa, Morimasa; Ieiri, Satoshi; Tanoue, Kazuo; Hashizume, Makoto; Fujie, Masaktsu G

    2010-01-01

    Recently, a robotic system was developed to assist Single Port Endoscopic Surgery (SPS). However, the existing system required a manual change of vision field, hindering the surgical task and increasing the degrees of freedom (DOFs) of the manipulator. We proposed a surgical robot for SPS with dynamic vision field control, the endoscope view being manipulated by a master controller. The prototype robot consisted of a positioning and sheath manipulator (6 DOF) for vision field control, and dual tool tissue manipulators (gripping: 5DOF, cautery: 3DOF). Feasibility of the robot was demonstrated in vitro. The "cut and vision field control" (using tool manipulators) is suitable for precise cutting tasks in risky areas while a "cut by vision field control" (using a vision field control manipulator) is effective for rapid macro cutting of tissues. A resection task was accomplished using a combination of both methods.

  15. Development of a robotic patient positioning system with a wide beam-angle range for fixed-beam particle therapy

    NASA Astrophysics Data System (ADS)

    Choi, Hongseok; Park, Jong-Oh; Ko, Seong Young; Park, Sukho; Cho, Sungho; Jung, Won-Gyun; Park, Yong Kyun; Kang, Jung Suk

    2016-10-01

    This paper describes a robotic patient positioning system (PPS) for a fixed-beam heavy-ion therapy system. In order to extend the limited irradiation angle range of the fixed beam, we developed a 6-degree-of-freedom (6-DOF) serial-link robotic arm and used it as the robotic PPS for the fixed-beam heavy-ion therapy system. This research aims to develop a robotic PPS for use in the Korea Heavy Ion Medical Accelerator (KHIMA) system, which is under development at the Korea Institute of Radiological & Medical Sciences (KIRAMS). In particular, we select constraints and criteria that will be used for designing and evaluating the robotic PPS through full consultation with KIRAMS. In accordance with the constraints and criteria, we develop a 6-DOF serial-link robotic arm that consists of six revolute joints for the robotic PPS, where the robotic arm covers the upper body of a patient as a treatment area and achieves a 15 ° roll and pitch angle in the treatment area without any collision. Various preliminary experiments confirm that the robotic PPS can meet all criteria for extension of the limited irradiation angle range in the treatment area and has a positioning repeatability of 0.275 mm.

  16. The Aircraft Simulation Role in Improving Flight Safety Through Control Room Training

    NASA Technical Reports Server (NTRS)

    Shy, Karla S.; Hageman, Jacob J.; Le, Jeanette H.; Sitz, Joel (Technical Monitor)

    2002-01-01

    NASA Dryden Flight Research Center uses its six-degrees-of-freedom (6-DOF) fixed-base simulations for mission control room training to improve flight safety and operations. This concept is applied to numerous flight projects such as the F-18 High Alpha Research Vehicle (HARV), the F-15 Intelligent Flight Control System (IFCS), the X-38 Actuator Control Test (XACT), and X-43A (Hyper-X). The Dryden 6-DOF simulations are typically used through various stages of a project, from design to ground tests. The roles of these simulations have expanded to support control room training, reinforcing flight safety by building control room staff proficiency. Real-time telemetry, radar, and video data are generated from flight vehicle simulation models. These data are used to drive the control room displays. Nominal static values are used to complete information where appropriate. Audio communication is also an integral part of training sessions. This simulation capability is used to train control room personnel and flight crew for nominal missions and emergency situations. Such training sessions are also opportunities to refine flight cards and control room display pages, exercise emergency procedures, and practice control room setup for the day of flight. This paper describes this technology as it is used in the X-43A and F-15 IFCS and XACT projects.

  17. Kinematics Simulation Analysis of Packaging Robot with Joint Clearance

    NASA Astrophysics Data System (ADS)

    Zhang, Y. W.; Meng, W. J.; Wang, L. Q.; Cui, G. H.

    2018-03-01

    Considering the influence of joint clearance on the motion error, repeated positioning accuracy and overall position of the machine, this paper presents simulation analysis of a packaging robot — 2 degrees of freedom(DOF) planar parallel robot based on the characteristics of high precision and fast speed of packaging equipment. The motion constraint equation of the mechanism is established, and the analysis and simulation of the motion error are carried out in the case of turning the revolute clearance. The simulation results show that the size of the joint clearance will affect the movement accuracy and packaging efficiency of the packaging robot. The analysis provides a reference point of view for the packaging equipment design and selection criteria and has a great significance on the packaging industry automation.

  18. Robust energy harvesting from walking vibrations by means of nonlinear cantilever beams

    NASA Astrophysics Data System (ADS)

    Kluger, Jocelyn M.; Sapsis, Themistoklis P.; Slocum, Alexander H.

    2015-04-01

    In the present work we examine how mechanical nonlinearity can be appropriately utilized to achieve strong robustness of performance in an energy harvesting setting. More specifically, for energy harvesting applications, a great challenge is the uncertain character of the excitation. The combination of this uncertainty with the narrow range of good performance for linear oscillators creates the need for more robust designs that adapt to a wider range of excitation signals. A typical application of this kind is energy harvesting from walking vibrations. Depending on the particular characteristics of the person that walks as well as on the pace of walking, the excitation signal obtains completely different forms. In the present work we study a nonlinear spring mechanism that is composed of a cantilever wrapping around a curved surface as it deflects. While for the free cantilever, the force acting on the free tip depends linearly on the tip displacement, the utilization of a contact surface with the appropriate distribution of curvature leads to essentially nonlinear dependence between the tip displacement and the acting force. The studied nonlinear mechanism has favorable mechanical properties such as low frictional losses, minimal moving parts, and a rugged design that can withstand excessive loads. Through numerical simulations we illustrate that by utilizing this essentially nonlinear element in a 2 degrees-of-freedom (DOF) system, we obtain strongly nonlinear energy transfers between the modes of the system. We illustrate that this nonlinear behavior is associated with strong robustness over three radically different excitation signals that correspond to different walking paces. To validate the strong robustness properties of the 2DOF nonlinear system, we perform a direct parameter optimization for 1DOF and 2DOF linear systems as well as for a class of 1DOF and 2DOF systems with nonlinear springs similar to that of the cubic spring that are physically realized by the cantilever-surface mechanism. The optimization results show that the 2DOF nonlinear system presents the best average performance when the excitation signals have three possible forms. Moreover, we observe that while for the linear systems the optimal performance is obtained for small values of the electromagnetic damping, for the 2DOF nonlinear system optimal performance is achieved for large values of damping. This feature is of particular importance for the system's robustness to parasitic damping.

  19. Six Years of Parallel Computing at NAS (1987 - 1993): What Have we Learned?

    NASA Technical Reports Server (NTRS)

    Simon, Horst D.; Cooper, D. M. (Technical Monitor)

    1994-01-01

    In the fall of 1987 the age of parallelism at NAS began with the installation of a 32K processor CM-2 from Thinking Machines. In 1987 this was described as an "experiment" in parallel processing. In the six years since, NAS acquired a series of parallel machines, and conducted an active research and development effort focused on the use of highly parallel machines for applications in the computational aerosciences. In this time period parallel processing for scientific applications evolved from a fringe research topic into the one of main activities at NAS. In this presentation I will review the history of parallel computing at NAS in the context of the major progress, which has been made in the field in general. I will attempt to summarize the lessons we have learned so far, and the contributions NAS has made to the state of the art. Based on these insights I will comment on the current state of parallel computing (including the HPCC effort) and try to predict some trends for the next six years.

  20. Development of a Rotary Wing Unmanned Aerial Vehicle (UAV) Simulation Model

    DTIC Science & Technology

    2014-03-01

    Features Language URL Autopilot: DIY UAV - 2 DOF proportional controller - Kalman filtering C http://autopilot.sour ceforge.net Paperazzi - 3 DOF...proprtional controller - Basic navigation OCaml http://paparazzi.ena c.fr JSBSim - Basic control system blockset - Sample autopilot

  1. Total teleportation of a single-photon state

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Humble, Travis S; Bennink, Ryan S; Grice, Warren P

    2008-01-01

    Recent demonstrations of teleportation have transferred quantum information encoded into either polarization or field-quadrature degrees of freedom (DOFs), but an outstanding question is how to simultaneously teleport quantum information encoded into multiple DOFs. We describe how the transverse-spatial, spectral and polarization states of a single photon can be simultaneously teleported using a pair of multimode, polarization-entangled photons derived from spontaneous parametric down-conversion. Furthermore, when the initial photon pair is maximally entangled in the spatial, spectral, and polarization DOFs then the photon s full quantum state can be reliably teleported using a Bell-state measurement based on sum-frequency generation.

  2. Spacsuit donning and doffing in zero-g training for Story Musgrave STS-6

    NASA Image and Video Library

    1982-07-14

    S82-33603 (November 1982) --- Astronaut F. Story Musgrave, STS-6 mission specialist, is assisted in a suit donning and doffing exercise in the weightlessness provided by a KC-135 ?zero-gravity? aircraft. Dr. Musgrave and the next mission?s other mission specialist, astronaut Donald H. Peterson, participated in the donning and doffing as a simulation for their preparations aboard the Challenger when they are called upon to perform an extravehicular activity (EVA) which was postponed from NASA?s first operational STS flight earlier this month. The suit is called an Extravehicular Mobility Unit (EMU). Photo credit: NASA

  3. X-33 Ascent Flight Controller Design by Trajectory Linearization: A Singular Perturbational Approach

    NASA Technical Reports Server (NTRS)

    Zhu, J. Jim; Banker, Brad D.; Hall, Charles E.

    2000-01-01

    The flight control of X-33 poses a challenge to conventional gain-scheduled flight controllers due to its large attitude maneuvers from liftoff to orbit and reentry. In addition, a wide range of uncertainties in vehicle handling qualities and disturbances must be accommodated by the attitude control system. Nonlinear tracking and decoupling control by trajectory linearization can be viewed as the ideal gain-scheduling controller designed at every point on the flight trajectory. Therefore it provides robust stability and performance at all stages of flight without interpolation of controller gains and eliminates costly controller redesigns due to minor airframe alteration or mission reconfiguration. In this paper, a prototype trajectory linearization design for an X-33 ascent flight controller is presented along with 3-DOF and 6-DOF simulation results. It is noted that the 6-DOF results were obtained from the 3-DOF design with only a few hours of tuning, which demonstrates the inherent robustness of the design technique. It is this "plug-and-play" feature that is much needed by NASA for the development, test and routine operations of the RLV'S. Plans for further research are also presented, and refined 6-DOF simulation results will be presented in the final version of the paper.

  4. Embedded Distributed Optical Fiber Sensors in Reinforced Concrete Structures—A Case Study

    PubMed Central

    Villalba, Sergi

    2018-01-01

    When using distributed optical fiber sensors (DOFS) on reinforced concrete structures, a compromise must be achieved between the protection requirements and robustness of the sensor deployment and the accuracy of the measurements both in the uncracked and cracked stages and under loading, unloading and reloading processes. With this in mind the authors have carried out an experiment where polyimide-coated DOFS were installed on two concrete beams, both embedded in the rebar elements and also bonded to the concrete surface. The specimens were subjected to a three-point load test where after cracking, they are unloaded and reloaded again to assess the capability of the sensor when applied to a real loading scenarios in concrete structures. Rayleigh Optical Frequency Domain Reflectometry (OFDR) was used as the most suitable technique for crack detection in reinforced concrete elements. To verify the reliability and accuracy of the DOFS measurements, additional strain gauges were also installed at three locations along the rebar. The results show the feasibility of using a thin coated polyimide DOFS directly bonded on the reinforcing bar without the need of indention or mechanization. A proposal for a Spectral Shift Quality (SSQ) threshold is also obtained and proposed for future works when using polyimide-coated DOFS bonded to rebars with cyanoacrylate adhesive. PMID:29587449

  5. Embedded Distributed Optical Fiber Sensors in Reinforced Concrete Structures-A Case Study.

    PubMed

    Barrias, António; Casas, Joan R; Villalba, Sergi

    2018-03-26

    When using distributed optical fiber sensors (DOFS) on reinforced concrete structures, a compromise must be achieved between the protection requirements and robustness of the sensor deployment and the accuracy of the measurements both in the uncracked and cracked stages and under loading, unloading and reloading processes. With this in mind the authors have carried out an experiment where polyimide-coated DOFS were installed on two concrete beams, both embedded in the rebar elements and also bonded to the concrete surface. The specimens were subjected to a three-point load test where after cracking, they are unloaded and reloaded again to assess the capability of the sensor when applied to a real loading scenarios in concrete structures. Rayleigh Optical Frequency Domain Reflectometry (OFDR) was used as the most suitable technique for crack detection in reinforced concrete elements. To verify the reliability and accuracy of the DOFS measurements, additional strain gauges were also installed at three locations along the rebar. The results show the feasibility of using a thin coated polyimide DOFS directly bonded on the reinforcing bar without the need of indention or mechanization. A proposal for a Spectral Shift Quality (SSQ) threshold is also obtained and proposed for future works when using polyimide-coated DOFS bonded to rebars with cyanoacrylate adhesive.

  6. Functional insights into the late embryogenesis abundant (LEA) protein family from Dendrobium officinale (Orchidaceae) using an Escherichia coli system

    PubMed Central

    Ling, Hong; Zeng, Xu; Guo, Shunxing

    2016-01-01

    Late embryogenesis abundant (LEA) proteins, a diverse family, accumulate during seed desiccation in the later stages of embryogenesis. LEA proteins are associated with tolerance to abiotic stresses, such as drought, salinity and high or cold temperature. Here, we report the first comprehensive survey of the LEA gene family in Dendrobium officinale, an important and widely grown medicinal orchid in China. Based on phylogenetic relationships with the complete set of Arabidopsis and Oryza LEA proteins, 17 genes encoding D. officinale LEAs (DofLEAs) were identified and their deduced proteins were classified into seven groups. The motif composition of these deduced proteins was correlated with the gene structure found in each LEA group. Our results reveal the DofLEA genes are widely distributed and expressed in tissues. Additionally, 11 genes from different groups were introduced into Escherichia coli to assess the functions of DofLEAs. Expression of 6 and 7 DofLEAs in E. coli improved growth performance compared with the control under salt and heat stress, respectively. Based on qPCR data, all of these genes were up-regulated in various tissues following exposure to salt and heat stresses. Our results suggest that DofLEAs play an important role in responses to abiotic stress. PMID:28004781

  7. [Effect of extracts from Dendrobii ifficinalis flos on hyperthyroidism Yin deficiency mice].

    PubMed

    Lei, Shan-shan; Lv, Gui-yuan; Jin, Ze-wu; Li, Bo; Yang, Zheng-biao; Chen, Su-hong

    2015-05-01

    Some unhealthy life habits, such as long-term smoking, heavy drinking, sexual overstrain and frequent stay-up could induce the Yin deficiency symptoms of zygomatic red and dysphoria. Stems of Dendrobii officinalis flos (DOF) showed the efficacy of nourishing Yin. In this study, the hyperthyroidism Yin deficiency model was set up to study the yin nourishing effect and action mechanism of DOF, in order to provide the pharmacological basis for developing DOF resources and decreasing resource wastes. ICR mice were divided into five groups: the normal control group, the model control group, the positive control group and DOF extract groups (6.4 g · kg(-1)). Except for the normal group, the other groups were administrated with thyroxine for 30 d to set up the hyperthyroidism yin deficiency model. At the same time, the other groups were administrated with the corresponding drugs for 30 d. After administration for 4 weeks, the signs (facial temperature, pain domain, heart rate and autonomic activity) in mice were measured, and the facial and ear micro-circulation blood flow were detected by laser Doppler technology. After the last administration, all mice were fasted for 12 hours, blood were collected from their orbits, and serum were separated to detect AST, ALT, TG and TP by the automatic biochemistry analyzer and test T3, T4 and TSH levels by ELISA. (1) Compared with the normal control group, the model control group showed significant increases in facial and ear micro-circulation blood flow, facial temperature and heart rate (P < 0.05, P < 0.01), serum AST, ALT (P < 0.01), T3 level (P < 0.05), TSH level (P < 0.05) and notable deceases in pain domain (P < 0.01), TG level (P < 0.01). (2) Compared with the model control group, extracts from DOF (6 g · kg(-1)) could notably reduce facial and ear micro-circulation blood flow, facial temperature and heart rate (P < 0.05, P < 0.01) and AST (P < 0.05) and enhance pain domain (P < 0.01) and TG (P < 0.01). Extracts from DOF (4 g · kg(-1)) could remarkably reduce AST and ALT levels (P < 0.01, 0.05). Extracts from DOF (6 g · kg(-1) 4 g · kg(-1)) could significantly reduce T3 and increase serum TSH level (P < 0.05). DOF could improve Yin deficiency symptoms of zygomatic red and dysphoria in mice as well as liver function injury caused by overactive thyroid axis. According to its action mechanism, DOF may show yin nourishing and hepatic protective effects by impacting thyroxin substance metabolism, improving micro-circulation and reducing heart rate.

  8. Accuracy analysis and design of A3 parallel spindle head

    NASA Astrophysics Data System (ADS)

    Ni, Yanbing; Zhang, Biao; Sun, Yupeng; Zhang, Yuan

    2016-03-01

    As functional components of machine tools, parallel mechanisms are widely used in high efficiency machining of aviation components, and accuracy is one of the critical technical indexes. Lots of researchers have focused on the accuracy problem of parallel mechanisms, but in terms of controlling the errors and improving the accuracy in the stage of design and manufacturing, further efforts are required. Aiming at the accuracy design of a 3-DOF parallel spindle head(A3 head), its error model, sensitivity analysis and tolerance allocation are investigated. Based on the inverse kinematic analysis, the error model of A3 head is established by using the first-order perturbation theory and vector chain method. According to the mapping property of motion and constraint Jacobian matrix, the compensatable and uncompensatable error sources which affect the accuracy in the end-effector are separated. Furthermore, sensitivity analysis is performed on the uncompensatable error sources. The sensitivity probabilistic model is established and the global sensitivity index is proposed to analyze the influence of the uncompensatable error sources on the accuracy in the end-effector of the mechanism. The results show that orientation error sources have bigger effect on the accuracy in the end-effector. Based upon the sensitivity analysis results, the tolerance design is converted into the issue of nonlinearly constrained optimization with the manufacturing cost minimum being the optimization objective. By utilizing the genetic algorithm, the allocation of the tolerances on each component is finally determined. According to the tolerance allocation results, the tolerance ranges of ten kinds of geometric error sources are obtained. These research achievements can provide fundamental guidelines for component manufacturing and assembly of this kind of parallel mechanisms.

  9. A Nonlinear, Six-Degree of Freedom Precision Formation Control Algorithm, Based on Restricted Three Body Dynamics

    NASA Technical Reports Server (NTRS)

    Bauer, Frank (Technical Monitor); Luquette, Richard J.; Sanner, Robert M.

    2003-01-01

    Precision Formation Flying is an enabling technology for a variety of proposed space-based observatories, including the Micro-Arcsecond X-ray Imaging Mission (MAXIM), the associated MAXIM pathfinder mission, and the Stellar Imager. An essential element of the technology is the control algorithm. This paper discusses the development of a nonlinear, six-degree of freedom (6DOF) control algorithm for maintaining the relative position and attitude of a spacecraft within a formation. The translation dynamics are based on the equations of motion for the restricted three body problem. The control law guarantees the tracking error convergences to zero, based on a Lyapunov analysis. The simulation, modelled after the MAXIM Pathfinder mission, maintains the relative position and attitude of a Follower spacecraft with respect to a Leader spacecraft, stationed near the L2 libration point in the Sun-Earth system.

  10. Emulation of rocket trajectory based on a six degree of freedom model

    NASA Astrophysics Data System (ADS)

    Zhang, Wenpeng; Li, Fan; Wu, Zhong; Li, Rong

    2008-10-01

    In this paper, a 6-DOF motion mathematical model is discussed. It is consisted of body dynamics and kinematics block, aero dynamics block and atmosphere block. Based on Simulink, the whole rocket trajectory mathematical model is developed. In this model, dynamic system simulation becomes easy and visual. The method of modularization design gives more convenience to transplant. At last, relevant data is given to be validated by Monte Carlo means. Simulation results show that the flight trajectory of the rocket can be simulated preferably by means of this model, and it also supplies a necessary simulating tool for the development of control system.

  11. SU-F-J-53: A 3D Printed Phantom for the Use of Daily Quality Assurance Alignment Tests

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Woods, K; Ayan, A; Woollard, J

    Purpose: To discuss experiences and results for a 3D printed QA phantom used for daily alignment purposes for a six degrees-of-freedom (6DoF) table Methods: A 3D model was created using a fused deposition modeling (FDM) printer using free online computer-aided design (CAD) software. The model has been under use for daily QA alignment tests for a 6DoF couch. An aligned and angled baseplate were also printed in order to introduce known angles for 6DoF corrections during image-guidance. Unique registration contours were created on the faces of the phantom in order to achieve a better cone-beam computed tomography (CBCT) match usingmore » an auto-registration algorithm. A BB was also introduced at the center of the phantom in order to deliver an integrated daily Winston-Lutz (WL) test. Translational, rotational, and WL results were tabulated over one month. Results: The ’honeycomb’ structure of the print was apparent in the EPID images for the WL test, which affected the results of the analysis software. This was fixed by inserting a cube made of polyoxymethylene within the 3D phantom that encompass the BB. Auto-registration results for the three translational and three rotational from a known offset to the BB isocenter consistently fell within 1 mm and 0.2°, respectively. WL tests resulted in an average of 0.71 ± 0.14 mm. Conclusion: 3D printed models allow for accurate builds that can be customized to a variety of clinical needs. Results from translational, rotational, and WL show consistent results over a month’s time. Given its relatively cheap and streamlined workflow, 3D printing could be implemented into any clinic looking to create customized phantoms.« less

  12. A 6-DOF vibration isolation system for hydraulic hybrid vehicles

    NASA Astrophysics Data System (ADS)

    Nguyen, The; Elahinia, Mohammad; Olson, Walter W.; Fontaine, Paul

    2006-03-01

    This paper presents the results of vibration isolation analysis for the pump/motor component of hydraulic hybrid vehicles (HHVs). The HHVs are designed to combine gasoline/diesel engine and hydraulic power in order to improve the fuel efficiency and reduce the pollution. Electric hybrid technology is being applied to passenger cars with small and medium engines to improve the fuel economy. However, for heavy duty vehicles such as large SUVs, trucks, and buses, which require more power, the hydraulic hybridization is a more efficient choice. In function, the hydraulic hybrid subsystem improves the fuel efficiency of the vehicle by recovering some of the energy that is otherwise wasted in friction brakes. Since the operation of the main component of HHVs involves with rotating parts and moving fluid, noise and vibration are an issue that affects both passengers (ride comfort) as well as surrounding people (drive-by noise). This study looks into the possibility of reducing the transmitted noise and vibration from the hydraulic subsystem to the vehicle's chassis by using magnetorheological (MR) fluid mounts. To this end, the hydraulic subsystem is modeled as a six degree of freedom (6-DOF) rigid body. A 6-DOF isolation system, consisting of five mounts connected to the pump/motor at five different locations, is modeled and simulated. The mounts are designed by combining regular elastomer components with MR fluids. In the simulation, the real loading and working conditions of the hydraulic subsystem are considered and the effects of both shock and vibration are analyzed. The transmissibility of the isolation system is monitored in a wide range of frequencies. The geometry of the isolation system is considered in order to sustain the weight of the hydraulic system without affecting the design of the chassis and the effectiveness of the vibration isolating ability. The simulation results shows reduction in the transmitted vibration force for different working cycles of the regenerative system.

  13. 12 CFR 313.3 - Definitions.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... Banking FEDERAL DEPOSIT INSURANCE CORPORATION PROCEDURE AND RULES OF PRACTICE PROCEDURES FOR CORPORATE...) Director means the Director of the Division of Finance (DOF), the Director of the Division of...) Division of Finance (DOF) means the Division of Finance of the FDIC. (n) Division of Resolutions and...

  14. A comparison of optimisation methods and knee joint degrees of freedom on muscle force predictions during single-leg hop landings.

    PubMed

    Mokhtarzadeh, Hossein; Perraton, Luke; Fok, Laurence; Muñoz, Mario A; Clark, Ross; Pivonka, Peter; Bryant, Adam L

    2014-09-22

    The aim of this paper was to compare the effect of different optimisation methods and different knee joint degrees of freedom (DOF) on muscle force predictions during a single legged hop. Nineteen subjects performed single-legged hopping manoeuvres and subject-specific musculoskeletal models were developed to predict muscle forces during the movement. Muscle forces were predicted using static optimisation (SO) and computed muscle control (CMC) methods using either 1 or 3 DOF knee joint models. All sagittal and transverse plane joint angles calculated using inverse kinematics or CMC in a 1 DOF or 3 DOF knee were well-matched (RMS error<3°). Biarticular muscles (hamstrings, rectus femoris and gastrocnemius) showed more differences in muscle force profiles when comparing between the different muscle prediction approaches where these muscles showed larger time delays for many of the comparisons. The muscle force magnitudes of vasti, gluteus maximus and gluteus medius were not greatly influenced by the choice of muscle force prediction method with low normalised root mean squared errors (<48%) observed in most comparisons. We conclude that SO and CMC can be used to predict lower-limb muscle co-contraction during hopping movements. However, care must be taken in interpreting the magnitude of force predicted in the biarticular muscles and the soleus, especially when using a 1 DOF knee. Despite this limitation, given that SO is a more robust and computationally efficient method for predicting muscle forces than CMC, we suggest that SO can be used in conjunction with musculoskeletal models that have a 1 or 3 DOF knee joint to study the relative differences and the role of muscles during hopping activities in future studies. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Non-Parametric Blur Map Regression for Depth of Field Extension.

    PubMed

    D'Andres, Laurent; Salvador, Jordi; Kochale, Axel; Susstrunk, Sabine

    2016-04-01

    Real camera systems have a limited depth of field (DOF) which may cause an image to be degraded due to visible misfocus or too shallow DOF. In this paper, we present a blind deblurring pipeline able to restore such images by slightly extending their DOF and recovering sharpness in regions slightly out of focus. To address this severely ill-posed problem, our algorithm relies first on the estimation of the spatially varying defocus blur. Drawing on local frequency image features, a machine learning approach based on the recently introduced regression tree fields is used to train a model able to regress a coherent defocus blur map of the image, labeling each pixel by the scale of a defocus point spread function. A non-blind spatially varying deblurring algorithm is then used to properly extend the DOF of the image. The good performance of our algorithm is assessed both quantitatively, using realistic ground truth data obtained with a novel approach based on a plenoptic camera, and qualitatively with real images.

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Unseren, M.A.

    This report proposes a method for resolving the kinematic redundancy of a serial link manipulator moving in a three-dimensional workspace. The underspecified problem of solving for the joint velocities based on the classical kinematic velocity model is transformed into a well-specified problem. This is accomplished by augmenting the original model with additional equations which relate a new vector variable quantifying the redundant degrees of freedom (DOF) to the joint velocities. The resulting augmented system yields a well specified solution for the joint velocities. Methods for selecting the redundant DOF quantifying variable and the transformation matrix relating it to the jointmore » velocities are presented so as to obtain a minimum Euclidean norm solution for the joint velocities. The approach is also applied to the problem of resolving the kinematic redundancy at the acceleration level. Upon resolving the kinematic redundancy, a rigid body dynamical model governing the gross motion of the manipulator is derived. A control architecture is suggested which according to the model, decouples the Cartesian space DOF and the redundant DOF.« less

  17. State-space control of prosthetic hand shape.

    PubMed

    Velliste, M; McMorland, A J C; Diril, E; Clanton, S T; Schwartz, A B

    2012-01-01

    In the field of neuroprosthetic control, there is an emerging need for simplified control of high-dimensional devices. Advances in robotic technology have led to the development of prosthetic arms that now approach the look and number of degrees of freedom (DoF) of a natural arm. These arms, and especially hands, now have more controllable DoFs than the number of control DoFs available in many applications. In natural movements, high correlations exist between multiple joints, such as finger flexions. Therefore, discrepancy between the number of control and effector DoFs can be overcome by a control scheme that maps low-DoF control space to high-DoF joint space. Imperfect effectors, sensor noise and interactions with external objects require the use of feedback controllers. The incorporation of feedback in a system where the command is in a different space, however, is challenging, requiring a potentially difficult inverse high-DoF to low-DoF transformation. Here we present a solution to this problem based on the Extended Kalman Filter.

  18. Research on parallel load sharing principle of piezoelectric six-dimensional heavy force/torque sensor

    NASA Astrophysics Data System (ADS)

    Liu, Wei; Li, Ying-jun; Jia, Zhen-yuan; Zhang, Jun; Qian, Min

    2011-01-01

    In working process of huge heavy-load manipulators, such as the free forging machine, hydraulic die-forging press, forging manipulator, heavy grasping manipulator, large displacement manipulator, measurement of six-dimensional heavy force/torque and real-time force feedback of the operation interface are basis to realize coordinate operation control and force compliance control. It is also an effective way to raise the control accuracy and achieve highly efficient manufacturing. Facing to solve dynamic measurement problem on six-dimensional time-varying heavy load in extremely manufacturing process, the novel principle of parallel load sharing on six-dimensional heavy force/torque is put forward. The measuring principle of six-dimensional force sensor is analyzed, and the spatial model is built and decoupled. The load sharing ratios are analyzed and calculated in vertical and horizontal directions. The mapping relationship between six-dimensional heavy force/torque value to be measured and output force value is built. The finite element model of parallel piezoelectric six-dimensional heavy force/torque sensor is set up, and its static characteristics are analyzed by ANSYS software. The main parameters, which affect load sharing ratio, are analyzed. The experiments for load sharing with different diameters of parallel axis are designed. The results show that the six-dimensional heavy force/torque sensor has good linearity. Non-linearity errors are less than 1%. The parallel axis makes good effect of load sharing. The larger the diameter is, the better the load sharing effect is. The results of experiments are in accordance with the FEM analysis. The sensor has advantages of large measuring range, good linearity, high inherent frequency, and high rigidity. It can be widely used in extreme environments for real-time accurate measurement of six-dimensional time-varying huge loads on manipulators.

  19. Parallel robot for micro assembly with integrated innovative optical 3D-sensor

    NASA Astrophysics Data System (ADS)

    Hesselbach, Juergen; Ispas, Diana; Pokar, Gero; Soetebier, Sven; Tutsch, Rainer

    2002-10-01

    Recent advances in the fields of MEMS and MOEMS often require precise assembly of very small parts with an accuracy of a few microns. In order to meet this demand, a new approach using a robot based on parallel mechanisms in combination with a novel 3D-vision system has been chosen. The planar parallel robot structure with 2 DOF provides a high resolution in the XY-plane. It carries two additional serial axes for linear and rotational movement in/about z direction. In order to achieve high precision as well as good dynamic capabilities, the drive concept for the parallel (main) axes incorporates air bearings in combination with a linear electric servo motors. High accuracy position feedback is provided by optical encoders with a resolution of 0.1 μm. To allow for visualization and visual control of assembly processes, a camera module fits into the hollow tool head. It consists of a miniature CCD camera and a light source. In addition a modular gripper support is integrated into the tool head. To increase the accuracy a control loop based on an optoelectronic sensor will be implemented. As a result of an in-depth analysis of different approaches a photogrammetric system using one single camera and special beam-splitting optics was chosen. A pattern of elliptical marks is applied to the surfaces of workpiece and gripper. Using a model-based recognition algorithm the image processing software identifies the gripper and the workpiece and determines their relative position. A deviation vector is calculated and fed into the robot control to guide the gripper.

  20. Control of a Serpentine Robot for Inspection Tasks

    NASA Technical Reports Server (NTRS)

    Colbaugh, R.; Glass, K.; Seraji, H.

    1994-01-01

    This paper presents a simple and robust kinematic control scheme for the JPL serpentine robot system. The proposed strategy is developed using the dampened-least-squares/configuration control methodology, and permits the considerable dexterity of the JPL serpentine robot to be effectively utilized for maneuvering in the congested and uncertain workspaces often encountered in inspection tasks. Computer simulation results are given for the 20 degree-of-freedom (DOF) manipulator system obtained by mounting the twelve DOF serpentine robot at the end-effector of an eight DOF Robotics Research arm/lathe-bed system. These simulations demonstrate that the proposed approach provides an effective method of controlling this complex system.

  1. Earthquake response analysis of 11-story RC building that suffered damage in 2011 East Japan Earthquake

    NASA Astrophysics Data System (ADS)

    Shibata, Akenori; Masuno, Hidemasa

    2017-10-01

    An eleven-story RC apartment building suffered medium damage in the 2011 East Japan earthquake and was retrofitted for re-use. Strong motion records were obtained near the building. This paper discusses the inelastic earthquake response analysis of the building using the equivalent single-degree-of-freedom (1-DOF) system to account for the features of damage. The method of converting the building frame into 1-DOF system with tri-linear reducing-stiffness restoring force characteristics was given. The inelastic response analysis of the building against the earthquake using the inelastic 1-DOF equivalent system could interpret well the level of actual damage.

  2. Comparative study of lossy and lossless data compression in distributed optical fiber sensing systems

    NASA Astrophysics Data System (ADS)

    Atubga, David; Wu, Huijuan; Lu, Lidong; Sun, Xiaoyan

    2017-02-01

    Typical fully distributed optical fiber sensors (DOFS) with dozens of kilometers are equivalent to tens of thousands of point sensors along the whole monitoring line, which means tens of thousands of data will be generated for one pulse launching period. Therefore, in an all-day nonstop monitoring, large volumes of data are created thereby triggering the demand for large storage space and high speed for data transmission. In addition, when the monitoring length and channel numbers increase, the data also increase extensively. The task of mitigating large volumes of data accumulation, large storage capacity, and high-speed data transmission is, therefore, the aim of this paper. To demonstrate our idea, we carried out a comparative study of two lossless methods, Huffman and Lempel Ziv Welch (LZW), with a lossy data compression algorithm, fast wavelet transform (FWT) based on three distinctive DOFS sensing data, such as Φ-OTDR, P-OTDR, and B-OTDA. Our results demonstrated that FWT yielded the best compression ratio with good consumption time, irrespective of errors in signal construction of the three DOFS data. Our outcomes indicate the promising potentials of FWT which makes it more suitable, reliable, and convenient for real-time compression of the DOFS data. Finally, it was observed that differences in the DOFS data structure have some influence on both the compression ratio and computational cost.

  3. MEMS 3-DoF gyroscope design, modeling and simulation through equivalent circuit lumped parameter model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mian, Muhammad Umer, E-mail: umermian@gmail.com; Khir, M. H. Md.; Tang, T. B.

    Pre-fabrication, behavioural and performance analysis with computer aided design (CAD) tools is a common and fabrication cost effective practice. In light of this we present a simulation methodology for a dual-mass oscillator based 3 Degree of Freedom (3-DoF) MEMS gyroscope. 3-DoF Gyroscope is modeled through lumped parameter models using equivalent circuit elements. These equivalent circuits consist of elementary components which are counterpart of their respective mechanical components, used to design and fabricate 3-DoF MEMS gyroscope. Complete designing of equivalent circuit model, mathematical modeling and simulation are being presented in this paper. Behaviors of the equivalent lumped models derived for themore » proposed device design are simulated in MEMSPRO T-SPICE software. Simulations are carried out with the design specifications following design rules of the MetalMUMPS fabrication process. Drive mass resonant frequencies simulated by this technique are 1.59 kHz and 2.05 kHz respectively, which are close to the resonant frequencies found by the analytical formulation of the gyroscope. The lumped equivalent circuit modeling technique proved to be a time efficient modeling technique for the analysis of complex MEMS devices like 3-DoF gyroscopes. The technique proves to be an alternative approach to the complex and time consuming couple field analysis Finite Element Analysis (FEA) previously used.« less

  4. Evolving locomotion for a 12-DOF quadruped robot in simulated environments.

    PubMed

    Klaus, Gordon; Glette, Kyrre; Høvin, Mats

    2013-05-01

    We demonstrate the power of evolutionary robotics (ER) by comparing to a more traditional approach its performance and cost on the task of simulated robot locomotion. A novel quadruped robot is introduced, the legs of which - each having three non-coplanar degrees of freedom - are very maneuverable. Using a simplistic control architecture and a physics simulation of the robot, gaits are designed both by hand and using a highly parallel evolutionary algorithm (EA). It is found that the EA produces, in a small fraction of the time that takes to design by hand, gaits that travel at two to four times the speed of the hand-designed one. The flexibility of this approach is demonstrated by applying it across a range of differently configured simulators. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  5. Adaptive macro finite elements for the numerical solution of monodomain equations in cardiac electrophysiology.

    PubMed

    Heidenreich, Elvio A; Ferrero, José M; Doblaré, Manuel; Rodríguez, José F

    2010-07-01

    Many problems in biology and engineering are governed by anisotropic reaction-diffusion equations with a very rapidly varying reaction term. This usually implies the use of very fine meshes and small time steps in order to accurately capture the propagating wave while avoiding the appearance of spurious oscillations in the wave front. This work develops a family of macro finite elements amenable for solving anisotropic reaction-diffusion equations with stiff reactive terms. The developed elements are incorporated on a semi-implicit algorithm based on operator splitting that includes adaptive time stepping for handling the stiff reactive term. A linear system is solved on each time step to update the transmembrane potential, whereas the remaining ordinary differential equations are solved uncoupled. The method allows solving the linear system on a coarser mesh thanks to the static condensation of the internal degrees of freedom (DOF) of the macroelements while maintaining the accuracy of the finer mesh. The method and algorithm have been implemented in parallel. The accuracy of the method has been tested on two- and three-dimensional examples demonstrating excellent behavior when compared to standard linear elements. The better performance and scalability of different macro finite elements against standard finite elements have been demonstrated in the simulation of a human heart and a heterogeneous two-dimensional problem with reentrant activity. Results have shown a reduction of up to four times in computational cost for the macro finite elements with respect to equivalent (same number of DOF) standard linear finite elements as well as good scalability properties.

  6. Spacsuit donning and doffing in zero-g training for Don Peterson STS-6

    NASA Technical Reports Server (NTRS)

    1982-01-01

    Spacsuit donning and doffing in zero-g training for Don Peterson of the STS-6 crew. The training is being held aboard the KC-135 to simulate weightlessness. He is being assisted to don the lower torso of the extravehicular mobility unit (EMU) by an ILC technician.

  7. Development of 6-DOF painting robot control system

    NASA Astrophysics Data System (ADS)

    Huang, Junbiao; Liu, Jianqun; Gao, Weiqiang

    2017-01-01

    With the development of society, the spraying technology of manufacturing industry in China has changed from the manual operation to the 6-DOF (Degree Of Freedom)robot automatic spraying. Spraying painting robot can not only complete the work which does harm to human being, but also improve the production efficiency and save labor costs. Control system is the most critical part of the 6-DOF robots, however, there is still a lack of relevant technology research in China. It is very necessary to study a kind of control system of 6-DOF spraying painting robots which is easy to operation, and has high efficiency and stable performance. With Googol controller platform, this paper develops programs based on Windows CE embedded systems to control the robot to finish the painting work. Software development is the core of the robot control system, including the direct teaching module, playback module, motion control module, setting module, man-machine interface, alarm module, log module, etc. All the development work of the entire software system has been completed, and it has been verified that the entire software works steady and efficient.

  8. Forward kinematic analysis of in-vivo robot for stomach biopsy.

    PubMed

    Sutar, Mihir Kumar; Pathak, P M; Sharma, A K; Mehta, N K; Gupta, V K

    2013-09-01

    The introduction of robotic medical assistance in biopsy and stomach cavity exploration is one of the most important milestones in the field of medical science. The research is still in its infancy and many issues like limitations in dexterity, control, and abdominal cavity vision are the main concerns of many researchers around the globe. This paper presents the design aspects and the kinematic analysis of a 4 degrees of freedom (DOF) hyper-redundant in-vivo robot for stomach biopsy. The proposed robot will be inserted through the tool channel of a conventional 4-DOF endoscope and this will increase the dexterity and ease in reaching the furthest parts of the stomach beyond the duodenum. Unlike the traditional biopsy tool, the present design will enhance dexterity due to its 4 DOF in addition to the endoscope's DOF. The endoscope will be positioned at the entrance to the stomach in the esophagus and the robot will move to the desired position inside the stomach for biopsy and exploration. The current robot is wire-actuated and possesses better maneuverability. The forward kinematic analysis of the proposed robot is presented in this paper.

  9. Input relegation control for gross motion of a kinematically redundant manipulator

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Unseren, M.A.

    1992-10-01

    This report proposes a method for resolving the kinematic redundancy of a serial link manipulator moving in a three-dimensional workspace. The underspecified problem of solving for the joint velocities based on the classical kinematic velocity model is transformed into a well-specified problem. This is accomplished by augmenting the original model with additional equations which relate a new vector variable quantifying the redundant degrees of freedom (DOF) to the joint velocities. The resulting augmented system yields a well specified solution for the joint velocities. Methods for selecting the redundant DOF quantifying variable and the transformation matrix relating it to the jointmore » velocities are presented so as to obtain a minimum Euclidean norm solution for the joint velocities. The approach is also applied to the problem of resolving the kinematic redundancy at the acceleration level. Upon resolving the kinematic redundancy, a rigid body dynamical model governing the gross motion of the manipulator is derived. A control architecture is suggested which according to the model, decouples the Cartesian space DOF and the redundant DOF.« less

  10. Bilateral, Misalignment-Compensating, Full-DOF Hip Exoskeleton: Design and Kinematic Validation

    PubMed Central

    Degelaen, Marc; Lefeber, Nina; Swinnen, Eva; Vanderborght, Bram; Lefeber, Dirk

    2017-01-01

    A shared design goal for most robotic lower limb exoskeletons is to reduce the metabolic cost of locomotion for the user. Despite this, only a limited amount of devices was able to actually reduce user metabolic consumption. Preservation of the natural motion kinematics was defined as an important requirement for a device to be metabolically beneficial. This requires the inclusion of all human degrees of freedom (DOF) in a design, as well as perfect alignment of the rotation axes. As perfect alignment is impossible, compensation for misalignment effects should be provided. A misalignment compensation mechanism for a 3-DOF system is presented in this paper. It is validated by the implementation in a bilateral hip exoskeleton, resulting in a compact and lightweight device that can be donned fast and autonomously, with a minimum of required adaptations. Extensive testing of the prototype has shown that hip range of motion of the user is maintained while wearing the device and this for all three hip DOFs. This allowed the users to maintain their natural motion patterns when they are walking with the novel hip exoskeleton. PMID:28790799

  11. Programmable diffractive optical elements for extending the depth of focus in ophthalmic optics

    NASA Astrophysics Data System (ADS)

    Romero, Lenny A.; Millán, María. S.; Jaroszewicz, Zbigniew; Kołodziejczyk, Andrzej

    2015-01-01

    The depth of focus (DOF) defines the axial range of high lateral resolution in the image space for object position. Optical devices with a traditional lens system typically have a limited DOF. However, there are applications such as in ophthalmology, which require a large DOF in comparison to a traditional optical system, this is commonly known as extended DOF (EDOF). In this paper we explore Programmable Diffractive Optical Elements (PDOEs), with EDOF, as an alternative solution to visual impairments, especially presbyopia. These DOEs were written onto a reflective liquid cystal on silicon (LCoS) spatial light modulator (SLM). Several designs of the elements are analyzed: the Forward Logarithmic Axicon (FLAX), the Axilens (AXL), the Light sword Optical Element (LSOE), the Peacock Eye Optical Element (PE) and Double Peacock Eye Optical Element (DPE). These elements focus an incident plane wave into a segment of the optical axis. The performances of the PDOEs are compared with those of multifocal lenses. In all cases, we obtained the point spread function and the image of an extended object. The results are presented and discussed.

  12. Design and development of biomimetic quadruped robot for behavior studies of rats and mice.

    PubMed

    Ishii, Hiroyuki; Masuda, Yuichi; Miyagishima, Syunsuke; Fumino, Shogo; Takanishi, Atsuo; Laschi, Cecilia; Mazzolai, Barbara; Mattoli, Virgilio; Dario, Paolo

    2009-01-01

    This paper presents the design and development of a novel biomimetic quadruped robot for behavior studies of rats and mice. Many studies have been performed using these animals for the purpose of understanding human mind in psychology, pharmacology and brain science. In these fields, several experiments on social interactions have been performed using rats as basic studies of mental disorders or social learning. However, some researchers mention that the experiments on social interactions using animals are poorly-reproducible. Therefore, we consider that reproducibility of these experiments can be improved by using a robotic agent that interacts with an animal subject. Thus, we developed a small quadruped robot WR-2 (Waseda Rat No. 2) that behaves like a real rat. Proportion and DOF arrangement of WR-2 are designed based on those of a mature rat. This robot has four 3-DOF legs, a 2-DOF waist and a 1-DOF neck. A microcontroller and a wireless communication module are implemented on it. A battery is also implemented. Thus, it can walk, rear by limbs and groom its body.

  13. A study on model fidelity for model predictive control-based obstacle avoidance in high-speed autonomous ground vehicles

    NASA Astrophysics Data System (ADS)

    Liu, Jiechao; Jayakumar, Paramsothy; Stein, Jeffrey L.; Ersal, Tulga

    2016-11-01

    This paper investigates the level of model fidelity needed in order for a model predictive control (MPC)-based obstacle avoidance algorithm to be able to safely and quickly avoid obstacles even when the vehicle is close to its dynamic limits. The context of this work is large autonomous ground vehicles that manoeuvre at high speed within unknown, unstructured, flat environments and have significant vehicle dynamics-related constraints. Five different representations of vehicle dynamics models are considered: four variations of the two degrees-of-freedom (DoF) representation as lower fidelity models and a fourteen DoF representation with combined-slip Magic Formula tyre model as a higher fidelity model. It is concluded that the two DoF representation that accounts for tyre nonlinearities and longitudinal load transfer is necessary for the MPC-based obstacle avoidance algorithm in order to operate the vehicle at its limits within an environment that includes large obstacles. For less challenging environments, however, the two DoF representation with linear tyre model and constant axle loads is sufficient.

  14. A Research on the Primary Mirror Manipulator of Large Segmented-mirror Telescope

    NASA Astrophysics Data System (ADS)

    Zuo, H.

    2012-09-01

    Since Galileo firstly used the telescope to observe the sky 400 years ago, the aperture of the telescope has become larger and larger to observe the deeper universe, and the segmented-mirror telescope is becoming more and more popular with increasing aperture. In the early 21st century, a series of segmented-mirror telescopes have been constructed including the Large Sky Area Multi-object Fiber Spectroscopic Telescope (LAMOST) of China. LAMOST is a meridian reflecting Schmidt telescope, and the dimension of the primary mirror is about 6.7 m× 6 m, which is composed of 37 hexagonal sub-mirrors. However, a problem about the mirror installation appears with the increasing aperture. If there are hundreds of sub-mirrors in the telescope, it is a challenging job to mount and dismount them to the truss. This problem is discussed in this paper and a manipulator for the primary mirror of LAMOST is designed to perform the mount and dismount work. In chapter 1, all the segmented-mirror telescopes in the world are introduced and how the sub-mirrors of these telescopes are installed has been investigated. After comparing with the serial and the parallel robot, a serial robot manipulator proposal, which has several redundant degrees of freedom (DOFs), has been chosen from a series of design proposals. In chapter 2, the theoretical analysis has been carried out on the basis of the design proposal, which includes the forward kinematics and the inverse kinematics. Firstly the D-H coordinate is built according to the structure of the manipulator, so it is possible to obtain the end-effector position and orientation from the individual joint motion thanks to the forward kinematics. Because of the redundant DOFs of the manipulator, the inverse kinematics solution can be a very trick task, and the result may not be only, therefore a kind of simulation is carried out to get the numerical solution using ADAMS (Automatic Dynamic Analysis of Mechanical System). In the dynamics analysis the Lagrange formulation is introduced, and the dynamic equations of the manipulator have been obtained by using the Lagrange method. Since the manipulator is a serious coupling system, the dynamic curve of the key joints is plotted by using the ADAMS software. According to the theoretical analysis, the manipulator for the primary mirror of LAMOST is designed and fabricated. The whole manipulator consists of three parts. The first part is the mechanical arm which is used to realize the high speed and the long distance location, and it is rebuilt from a small truck crane; The second part is a serial mechanical hand which is used to realize the low speed and the short distance location. It has six DOFs including the pitch, the rotate about the vertical axis, the elevation along the vertical axis, and two horizontal translations. Subsequently the structure is analyzed in the ANSYS software to confirm that the strength is enough and the displacement is in the tolerance; The third part is a mechanical wrist, in which part a hydraulic rod is used to keep the bottom of the mechanical hand horizontal. In chapter 6, the control characteristics of the whole manipulator are analyzed. Furthermore, the control method and flowchart are proposed. Based on this method the control device was selected. In the end of this paper, the main work and the results of this project are summarized. Further research is prospected and it provides a reference for the future large telescope projects.

  15. Dynamic simulation of knee-joint loading during gait using force-feedback control and surrogate contact modelling.

    PubMed

    Walter, Jonathan P; Pandy, Marcus G

    2017-10-01

    The aim of this study was to perform multi-body, muscle-driven, forward-dynamics simulations of human gait using a 6-degree-of-freedom (6-DOF) model of the knee in tandem with a surrogate model of articular contact and force control. A forward-dynamics simulation incorporating position, velocity and contact force-feedback control (FFC) was used to track full-body motion capture data recorded for multiple trials of level walking and stair descent performed by two individuals with instrumented knee implants. Tibiofemoral contact force errors for FFC were compared against those obtained from a standard computed muscle control algorithm (CMC) with a 6-DOF knee contact model (CMC6); CMC with a 1-DOF translating hinge-knee model (CMC1); and static optimization with a 1-DOF translating hinge-knee model (SO). Tibiofemoral joint loads predicted by FFC and CMC6 were comparable for level walking, however FFC produced more accurate results for stair descent. SO yielded reasonable predictions of joint contact loading for level walking but significant differences between model and experiment were observed for stair descent. CMC1 produced the least accurate predictions of tibiofemoral contact loads for both tasks. Our findings suggest that reliable estimates of knee-joint loading may be obtained by incorporating position, velocity and force-feedback control with a multi-DOF model of joint contact in a forward-dynamics simulation of gait. Copyright © 2017 IPEM. Published by Elsevier Ltd. All rights reserved.

  16. Piezoelectrically Actuated Robotic System for MRI-Guided Prostate Percutaneous Therapy

    PubMed Central

    Su, Hao; Shang, Weijian; Cole, Gregory; Li, Gang; Harrington, Kevin; Camilo, Alexander; Tokuda, Junichi; Tempany, Clare M.; Hata, Nobuhiko; Fischer, Gregory S.

    2014-01-01

    This paper presents a fully-actuated robotic system for percutaneous prostate therapy under continuously acquired live magnetic resonance imaging (MRI) guidance. The system is composed of modular hardware and software to support the surgical workflow of intra-operative MRI-guided surgical procedures. We present the development of a 6-degree-of-freedom (DOF) needle placement robot for transperineal prostate interventions. The robot consists of a 3-DOF needle driver module and a 3-DOF Cartesian motion module. The needle driver provides needle cannula translation and rotation (2-DOF) and stylet translation (1-DOF). A custom robot controller consisting of multiple piezoelectric motor drivers provides precision closed-loop control of piezoelectric motors and enables simultaneous robot motion and MR imaging. The developed modular robot control interface software performs image-based registration, kinematics calculation, and exchanges robot commands and coordinates between the navigation software and the robot controller with a new implementation of the open network communication protocol OpenIGTLink. Comprehensive compatibility of the robot is evaluated inside a 3-Tesla MRI scanner using standard imaging sequences and the signal-to-noise ratio (SNR) loss is limited to 15%. The image deterioration due to the present and motion of robot demonstrates unobservable image interference. Twenty-five targeted needle placements inside gelatin phantoms utilizing an 18-gauge ceramic needle demonstrated 0.87 mm root mean square (RMS) error in 3D Euclidean distance based on MRI volume segmentation of the image-guided robotic needle placement procedure. PMID:26412962

  17. Equivalence principle for quantum systems: dephasing and phase shift of free-falling particles

    NASA Astrophysics Data System (ADS)

    Anastopoulos, C.; Hu, B. L.

    2018-02-01

    We ask the question of how the (weak) equivalence principle established in classical gravitational physics should be reformulated and interpreted for massive quantum objects that may also have internal degrees of freedom (dof). This inquiry is necessary because even elementary concepts like a classical trajectory are not well defined in quantum physics—trajectories originating from quantum histories become viable entities only under stringent decoherence conditions. From this investigation we posit two logically and operationally distinct statements of the equivalence principle for quantum systems. Version A: the probability distribution of position for a free-falling particle is the same as the probability distribution of a free particle, modulo a mass-independent shift of its mean. Version B: any two particles with the same velocity wave-function behave identically in free fall, irrespective of their masses. Both statements apply to all quantum states, including those without a classical correspondence, and also for composite particles with quantum internal dof. We also investigate the consequences of the interaction between internal and external dof induced by free fall. For a class of initial states, we find dephasing occurs for the translational dof, namely, the suppression of the off-diagonal terms of the density matrix, in the position basis. We also find a gravitational phase shift in the reduced density matrix of the internal dof that does not depend on the particle’s mass. For classical states, the phase shift has a natural classical interpretation in terms of gravitational red-shift and special relativistic time-dilation.

  18. Improved Multiple-DOF SAW Piezoelectric Motors

    NASA Technical Reports Server (NTRS)

    Bar-Cohen, Yoseph; Bao, Xiaoqi; Hull, Anthony; Wright, John

    2003-01-01

    Surface-acoustic-wave (SAW) piezoelectric motors of a proposed type would be capable of operating in multiple degrees of freedom (DOFs) simultaneously and would be amenable to integration into diverse structures and mechanisms. These motors would be compact and structurally simple and would not contain bearings or lead screws. One example of a particularly useful motor of this type would be a two-dimensional- translation stage. Another such example would be a self-actuated spherical joint that could be made to undergo controlled, simultaneous rotations about two orthogonal axes: Such a motor could serve as a mechanism for aiming an "eyeball" camera or as a compact transducer in, and an integral part of, a joint in a robot arm. The multiple-DOF SAW piezoelectric motors as now proposed would be successors to the ones reported in "Multiple-DOF Surface-Acoustic-Wave Piezoelectric Motors" (NPO-20735), NASA Tech Briefs, Vol. 24, No. 12 (December 2000), page 5b. The basic principle of operation of a multiple-DOF SAW piezoelectric motor is a straightforward extension of that of single-DOF SAW piezoelectric motors, which have been reported in several previous NASA Tech Briefs articles: For example, in the case of a linear SAW piezoelectric motor, piezoelectric transducers at opposite ends of a stator excite surface acoustic waves that travel along the surface of the stator. An object (denoted the slider) is pressed against the stator with sufficient pressure (in practice .300 MPa) that it remains in frictional contact with the stator at all times. The slider rides the crests of the waves and is thereby made to move along the surface of the stator. The direction of motion (forward or backward) is controlled by selecting the relative phase of waves generated by the two piezoelectric transducers. The speed increases with the amplitude of the waves and thus with the magnitude of the voltage applied to the transducers.

  19. Hamiltonian formalism for f (T ) gravity

    NASA Astrophysics Data System (ADS)

    Ferraro, Rafael; Guzmán, María José

    2018-05-01

    We present the Hamiltonian formalism for f (T ) gravity, and prove that the theory has n/(n -3 ) 2 +1 degrees of freedom (d.o.f.) in n dimensions. We start from a scalar-tensor action for the theory, which represents a scalar field minimally coupled with the torsion scalar T that defines the teleparallel equivalent of general relativity (TEGR) Lagrangian. T is written as a quadratic form of the coefficients of anholonomy of the vierbein. We obtain the primary constraints through the analysis of the structure of the eigenvalues of the multi-index matrix involved in the definition of the canonical momenta. The auxiliary scalar field generates one extra primary constraint when compared with the TEGR case. The secondary constraints are the super-Hamiltonian and supermomenta constraints, that are preserved from the Arnowitt-Deser-Misner formulation of GR. There is a set of n/(n -1 ) 2 primary constraints that represent the local Lorentz transformations of the theory, which can be combined to form a set of n/(n -1 ) 2 -1 first-class constraints, while one of them becomes second class. This result is irrespective of the dimension, due to the structure of the matrix of the brackets between the constraints. The first-class canonical Hamiltonian is modified due to this local Lorentz violation, and the only one local Lorentz transformation that becomes second-class pairs up with the second-class constraint π ≈0 to remove one d.o.f. from the n2+1 pairs of canonical variables. The remaining n/(n -1 ) 2 +2 n -1 primary constraints remove the same number of d.o.f., leaving the theory with n/(n -3 ) 2 +1 d.o.f. This means that f (T ) gravity has only one extra d.o.f., which could be interpreted as a scalar d.o.f.

  20. Risk Factors for Immediate and Delayed-Onset Fever After Percutaneous Transhepatic Biliary Drainage

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lucatelli, Pierleone, E-mail: pierleone.lucatelli@gmail.com; Corradini, Stefano Ginanni, E-mail: stefano.corradini@uniroma1.it; Corona, Mario, E-mail: mario.corona@uniroma1.it

    ObjectivesTo prospectively investigate the pre and intra-procedural risk factors for immediate (IF) and delayed-onset (DOF) fever development after percutaneous transhepatic biliary drainage (PTBD).MethodsInstitutional review board approval and informed patient consent were obtained. Between February 2013 and February 2014, 97 afebrile patients (77 at the Sapienza University of Rome, Italy and 20 at the Sun Yat-sen University of Guangzhou, China) with benign (n = 31) and malignant (n = 66) indications for a first PTBD were prospectively enrolled. Thirty pre- and intra-procedural clinical/radiological characteristics, including the amount of contrast media injected prior to PTBD placement, were collected in relation to the development of IF (withinmore » 24 h) or DOF (after 24 h). Fever was defined as ≥37.5 °C. Binary logistic regression analysis was used to assess independent associations with IF and DOF.ResultsFourteen (14.4 %) patients developed IF and 17 (17.5 %) developed DOF. At multivariable analysis, IF was associated with pre-procedural absence of intrahepatic bile duct dilatation (OR 63.359; 95 % CI 2.658–1510.055; P = 0.010) and low INR (OR 4.7 × 10{sup −4}; 95 % CI 0.000–0.376; P = 0.025), while DOF was associated with unsatisfactory biliary drainage at the end of PTBD (OR 4.571; 95 % CI 1.161–17.992; P = 0.030).ConclusionsThe amount of contrast injected is not associated with post-PTBD fever development. Unsatisfactory biliary drainage at the end of PTBD is associated with DOF, suggesting that complete biliary tree decompression should be pursued within the first PTBD. Patients with unsatisfactory drainage and those with the absence of pre-procedural intrahepatic bile duct dilatation, which is associated with IF, require tailored post-PTBD management.« less

  1. The JPL Serpentine Robot: A 12 DOF System for Inspection

    NASA Technical Reports Server (NTRS)

    Paljug, E.; Ohm, T.; Hayati, S.

    1995-01-01

    The Serpentine Robot is a prototype hyper-redundant (snake-like) manipulator system developed at the Jet Propulsion Laboratory. It is designed to navigate and perform tasks in obstructed and constrained environments in which conventional 6 DOF manipulators cannot function. Described are the robot mechanical design, a joint assembly low level inverse kinematic algorithm, control development, and applications.

  2. The Duke of Edinburgh's Award: A "Simply Brilliant" Program

    ERIC Educational Resources Information Center

    Lico, Abner

    2008-01-01

    While speaking to Gold Award Achievers in Toronto in 2002, Tony Comper, past President and Chief Executive Officer of the BMO Financial Group, referred to the Duke of Edinburgh's (DofE) Award as a program "so brilliantly simple, it's simply brilliant." This ironic statement has echoed in the Ontario division of the DofE Award ever since.…

  3. CSI related dynamics and control issues in space robotics

    NASA Technical Reports Server (NTRS)

    Schmitz, Eric; Ramey, Madison

    1993-01-01

    The research addressed includes: (1) CSI issues in space robotics; (2) control of elastic payloads, which includes 1-DOF example, and 3-DOF harmonic drive arm with elastic beam; and (3) control of large space arms with elastic links, which includes testbed description, modeling, and experimental implementation of colocated PD and end-point tip position controllers.

  4. Communication: importance sampling including path correlation in semiclassical initial value representation calculations for time correlation functions.

    PubMed

    Pan, Feng; Tao, Guohua

    2013-03-07

    Full semiclassical (SC) initial value representation (IVR) for time correlation functions involves a double phase space average over a set of two phase points, each of which evolves along a classical path. Conventionally, the two initial phase points are sampled independently for all degrees of freedom (DOF) in the Monte Carlo procedure. Here, we present an efficient importance sampling scheme by including the path correlation between the two initial phase points for the bath DOF, which greatly improves the performance of the SC-IVR calculations for large molecular systems. Satisfactory convergence in the study of quantum coherence in vibrational relaxation has been achieved for a benchmark system-bath model with up to 21 DOF.

  5. Drosophila Heartless Acts with Heartbroken/Dof in Muscle Founder Differentiation

    PubMed Central

    Dutta, Devkanya; Shaw, Sanjeev; Maqbool, Tariq; Pandya, Hetal

    2005-01-01

    The formation of a multi-nucleate myofibre is directed, in Drosophila, by a founder cell. In the embryo, founders are selected by Notch-mediated lateral inhibition, while during adult myogenesis this mechanism of selection does not appear to operate. We show, in the muscles of the adult abdomen, that the Fibroblast growth factor pathway mediates founder cell choice in a novel manner. We suggest that the developmental patterns of Heartbroken/Dof and Sprouty result in defining the domain and timing of activation of the Fibroblast growth factor receptor Heartless in specific myoblasts, thereby converting them into founder cells. Our results point to a way in which muscle differentiation could be initiated and define a critical developmental function for Heartbroken/Dof in myogenesis. PMID:16207075

  6. High-fidelity cluster state generation for ultracold atoms in an optical lattice.

    PubMed

    Inaba, Kensuke; Tokunaga, Yuuki; Tamaki, Kiyoshi; Igeta, Kazuhiro; Yamashita, Makoto

    2014-03-21

    We propose a method for generating high-fidelity multipartite spin entanglement of ultracold atoms in an optical lattice in a short operation time with a scalable manner, which is suitable for measurement-based quantum computation. To perform the desired operations based on the perturbative spin-spin interactions, we propose to actively utilize the extra degrees of freedom (DOFs) usually neglected in the perturbative treatment but included in the Hubbard Hamiltonian of atoms, such as, (pseudo-)charge and orbital DOFs. Our method simultaneously achieves high fidelity, short operation time, and scalability by overcoming the following fundamental problem: enhancing the interaction strength for shortening the operation time breaks the perturbative condition of the interaction and inevitably induces unwanted correlations among the spin and extra DOFs.

  7. Evaluation of the effect of a laparoscopic robotized needle holder on ergonomics and skills.

    PubMed

    Bensignor, Thierry; Morel, Guillaume; Reversat, David; Fuks, David; Gayet, Brice

    2016-02-01

    Laparoscopy generates technical and ergonomics difficulties due to limited degrees of freedom (DOF) of forceps. To reduce this limitation, a new 5-mm robotized needle holder with two intracorporeal DOF, Jaimy(®), has been developed. The aim of this study was to evaluate its effects on ergonomics and skills. Fourteen surgeons including eight senior and six residents were crossover randomized and stratified based on experience. Three suturing tasks were performed with both Jaimy(®) and a classic needle holder (NH): task 1: Peg-Board; task 2: hexagonal suture; task 3: frontal suture. Postural ergonomics of the dominant arm were evaluated with an ergonomics score (RULA score) thanks to motion capture, and muscular ergonomics with electromyography of six muscular groups (flexor and extensor carpis, biceps, triceps, deltoid, trapeze). Performance outcomes are a quantitative and qualitative score, and skills outcomes are the measurement of the number of movements and the path length travelled by the instrument. The RULA score showed a statistically improved posture with Jaimy(®) (p < 0.001). The cumulative muscular workload (CMW) of four muscles was not different. However, the CMW was in favor of the NH for the flexor carpi ulnaris (p < 0.001) and the triceps (p = 0.027). The number of movements was not different (p = 0.39) although the path length was shorter with Jaimy(®) (p = 0.012). The score for task 1 was in favor of the NH (p = 0.006) with a higher quantity score. Task 2 score was not different (p = 0.086): The quality part of the score was in favor of Jaimy(®) (p = 0.009) and the quantity part was higher with the NH (p = 0.04). The score for task 3 was higher with Jaimy(®) (p = 0.001). This study suggests that the use of a robotized needle holder improves both posture and the quality of laparoscopic sutures.

  8. Rotational motions for teleseismic surface waves

    NASA Astrophysics Data System (ADS)

    Lin, Chin-Jen; Huang, Han-Pang; Pham, Nguyen Dinh; Liu, Chun-Chi; Chi, Wu-Cheng; Lee, William H. K.

    2011-08-01

    We report the findings for the first teleseismic six degree-of-freedom (6-DOF) measurements including three components of rotational motions recorded by a sensitive rotation-rate sensor (model R-1, made by eentec) and three components of translational motions recorded by a traditional seismometer (STS-2) at the NACB station in Taiwan. The consistent observations in waveforms of rotational motions and translational motions in sections of Rayleigh and Love waves are presented in reference to the analytical solution for these waves in a half space of Poisson solid. We show that additional information (e.g., Rayleigh wave phase velocity, shear wave velocity of the surface layer) might be exploited from six degree-of-freedom recordings of teleseismic events at only one station. We also find significant errors in the translational records of these teleseismic surface waves due to the sensitivity of inertial translation sensors (seismometers) to rotational motions. The result suggests that the effects of such errors need to be counted in surface wave inversions commonly used to derive earthquake source parameters and Earth structure.

  9. STS-1 operational flight profile. Volume 5: Descent cycle 3. Appendix D: GRTLS six degree of freedom Monte Carlo dispersion analysis

    NASA Technical Reports Server (NTRS)

    Montez, M. N.

    1980-01-01

    The results of a six degree of freedom (6-DOF) nonlinear Monte Carlo dispersion analysis for the latest glide return to landing site (GRTLS) abort trajectory for the Space Transportation System 1 Flight are presented. For this GRTLS, the number two main engine fails at 262.5 seconds ground elapsed time. Fifty randomly selected simulations, initialized at external tank separation, are analyzed. The initial covariance matrix is a 20 x 20 matrix and includes navigation errors and dispersions in position and velocity, time, accelerometer bias, and inertial platform misalinements. In all 50 samples, speedbrake, rudder, elevon, and body flap hinge moments are acceptable. Transitions to autoland begin before 9,000 feet and there are no tailscrapes. Navigation derived dynamic pressure accuracies exceed the flight control system constraints above Mach 2.5. Three out of 50 landings exceeded tire specification limit speed of 222 knots. Pilot manual landings are expected to reduce landing speed by landing farther downrange.

  10. A new RISE-based adaptive control of PKMs: design, stability analysis and experiments

    NASA Astrophysics Data System (ADS)

    Bennehar, M.; Chemori, A.; Bouri, M.; Jenni, L. F.; Pierrot, F.

    2018-03-01

    This paper deals with the development of a new adaptive control scheme for parallel kinematic manipulators (PKMs) based on Rrbust integral of the sign of the error (RISE) control theory. Original RISE control law is only based on state feedback and does not take advantage of the modelled dynamics of the manipulator. Consequently, the overall performance of the resulting closed-loop system may be poor compared to modern advanced model-based control strategies. We propose in this work to extend RISE by including the nonlinear dynamics of the PKM in the control loop to improve its overall performance. More precisely, we augment original RISE control scheme with a model-based adaptive control term to account for the inherent nonlinearities in the closed-loop system. To demonstrate the relevance of the proposed controller, real-time experiments are conducted on the Delta robot, a three-degree-of-freedom (3-DOF) PKM.

  11. Design of a wearable cable-driven upper limb exoskeleton based on epicyclic gear trains structure.

    PubMed

    Xiao, Feiyun; Gao, Yongsheng; Wang, Yong; Zhu, Yanhe; Zhao, Jie

    2017-07-20

    Many countries, including Japan, Italy, and China are experiencing demographic shifts as their populations age. Some basic activities of daily living (ADLs) are difficult for elderly people to complete independently due to declines in motor function. In this paper, a 6-DOF wearable cable-driven upper limb exoskeleton (CABexo) based on epicyclic gear trains structure is proposed. The main structure of the exoskeleton system is composed of three epicyclic gear train sections. This new exoskeleton has a parallel mechanical structure to the traditional serial structure, but is stiffer and has a stronger carrying capacity. The traditional gear transmission structure is replaced with a cable transmission system, which is quieter, and has higher accuracy and smoother transmission. The static workspace of the exoskeleton is large enough to meet the demand of assisting aged and disabled individuals in completing most of their activities of daily living (ADLs).

  12. Stereo-hologram in discrete depth of field (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Lee, Kwanghoon; Park, Min-Chul

    2017-05-01

    In holographic space, continuous object space can be divided as several discrete spaces satisfied each of same depth of field (DoF). In the environment of wearable device using holography, specially, this concept can be applied to macroscopy filed in contrast of the field of microscopy. Since the former has not need to high depth resolution because perceiving power of eye in human visual system, it can distinguish clearly among the objects in depth space, has lower than optical power of microscopic field. Therefore continuous but discrete depth of field (DDoF) for whole object space can present the number of planes included sampled space considered its DoF. Each DoF plane has to consider the occlusion among the object's areas in its region to show the occluded phenomenon inducing by the visual axis around the eye field of view. It makes natural scene in recognition process even though the combined discontinuous DoF regions are altered to the continuous object space. Thus DDoF pull out the advantages such as saving consuming time of the calculation process making the hologram and the reconstruction. This approach deals mainly the properties of several factors required in stereo hologram HMD such as stereoscopic DoF according to the convergence, least number of DDoFs planes in normal visual circumstance (within to 10,000mm), the efficiency of saving time for taking whole holographic process under the our method compared to the existing. Consequently this approach would be applied directly to the stereo-hologram HMD field to embody a real-time holographic imaging.

  13. Dual-element transducer with phase-inversion for wide depth of field in high-frequency ultrasound imaging.

    PubMed

    Jeong, Jong Seob

    2014-08-05

    In high frequency ultrasound imaging (HFUI), the quality of focusing is deeply related to the length of the depth of field (DOF). In this paper, a phase-inversion technique implemented by a dual-element transducer is proposed to enlarge the DOF. The performance of the proposed method was numerically demonstrated by using the ultrasound simulation program called Field-II. A simulated dual-element transducer was composed of a disc- and an annular-type elements, and its aperture was concavely shaped to have a confocal point at 6 mm. The area of each element was identical in order to provide same intensity at the focal point. The outer diameters of the inner and the outer elements were 2.1 mm and 3 mm, respectively. The center frequency of each element was 40 MHz and the f-number (focal depth/aperture size) was two. When two input signals with 0° and 180° phases were applied to inner and outer elements simultaneously, a multi-focal zone was generated in the axial direction. The total -6 dB DOF, i.e., sum of two -6 dB DOFs in the near and far field lobes, was 40% longer than that of the conventional single element transducer. The signal to noise ratio (SNR) was increased by about two times, especially in the far field. The point and cyst phantom simulation were conducted and their results were identical to that of the beam pattern simulation. Thus, the proposed scheme may be a potential method to improve the DOF and SNR in HFUI.

  14. An affordable compact humanoid robot for Autism Spectrum Disorder interventions in children.

    PubMed

    Dickstein-Fischer, Laurie; Alexander, Elizabeth; Yan, Xiaoan; Su, Hao; Harrington, Kevin; Fischer, Gregory S

    2011-01-01

    Autism Spectrum Disorder impacts an ever-increasing number of children. The disorder is marked by social functioning that is characterized by impairment in the use of nonverbal behaviors, failure to develop appropriate peer relationships and lack of social and emotional exchanges. Providing early intervention through the modality of play therapy has been effective in improving behavioral and social outcomes for children with autism. Interacting with humanoid robots that provide simple emotional response and interaction has been shown to improve the communication skills of autistic children. In particular, early intervention and continuous care provide significantly better outcomes. Currently, there are no robots capable of meeting these requirements that are both low-cost and available to families of autistic children for in-home use. This paper proposes the piloting the use of robotics as an improved diagnostic and early intervention tool for autistic children that is affordable, non-threatening, durable, and capable of interacting with an autistic child. This robot has the ability to track the child with its 3 degree of freedom (DOF) eyes and 3-DOF head, open and close its 1-DOF beak and 1-DOF each eyelids, raise its 1-DOF each wings, play sound, and record sound. These attributes will give it the ability to be used for the diagnosis and treatment of autism. As part of this project, the robot and the electronic and control software have been developed, and integrating semi-autonomous interaction, teleoperation from a remote healthcare provider and initiating trials with children in a local clinic are in progress.

  15. Change of a motor synergy for dampening hand vibration depending on a task difficulty.

    PubMed

    Togo, Shunta; Kagawa, Takahiro; Uno, Yoji

    2014-10-01

    The present study investigated the relationship between the number of usable degrees of freedom (DOFs) and joint coordination during a human-dampening hand vibration task. Participants stood on a platform generating an anterior-posterior directional oscillation and held a water-filled cup. Their usable DOFs were changed under the following conditions of limb constraint: (1) no constraint; (2) ankle constrained; and (3) ankle-knee constrained. Kinematic whole-body data were recorded using a three-dimensional position measurement system. The jerk of each body part was evaluated as an index of oscillation intensity. To quantify joint coordination, an uncontrolled manifold (UCM) analysis was applied and the variance of joints related to hand jerk divided into two components: a UCM component that did not affect hand jerk and an orthogonal (ORT) component that directly affected hand jerk. The results showed that hand jerk when the task used a cup filled with water was significantly smaller than when a cup containing stones was used, regardless of limb constraint condition. Thus, participants dampened their hand vibration utilizing usable joint DOFs. According to UCM analysis, increasing the oscillation velocity and the decrease in usable DOFs by the limb constraints led to an increase of total variance of the joints and the UCM component, indicating that a synergy-dampening hand vibration was enhanced. These results show that the variance of usable joint DOFs is more fitted to the UCM subspace when the joints are varied by increasing the velocity and limb constraints and suggest that humans adopt enhanced synergies to achieve more difficult tasks.

  16. Digital compensation techniques for the effects of time lag in closed-loop simulation using the 6 DOF motion system

    NASA Technical Reports Server (NTRS)

    Brown, R.

    1982-01-01

    Efforts are continued to develop digital filter compensation schemes for the correction of momentum gains observed in the closed loop simulation of the docking of two satellites using the 6 DOF motion system. Several filters that work well for small delays ( .100ms) and a non-preloaded probe are discussed.

  17. Performance analysis of two-degree of freedom fractional order PID controllers for robotic manipulator with payload.

    PubMed

    Sharma, Richa; Gaur, Prerna; Mittal, A P

    2015-09-01

    The robotic manipulators are multi-input multi-output (MIMO), coupled and highly nonlinear systems. The presence of external disturbances and time-varying parameters adversely affects the performance of these systems. Therefore, the controller designed for these systems should effectively deal with such complexities, and it is an intriguing task for control engineers. This paper presents two-degree of freedom fractional order proportional-integral-derivative (2-DOF FOPID) controller scheme for a two-link planar rigid robotic manipulator with payload for trajectory tracking task. The tuning of all controller parameters is done using cuckoo search algorithm (CSA). The performance of proposed 2-DOF FOPID controllers is compared with those of their integer order designs, i.e., 2-DOF PID controllers, and with the traditional PID controllers. In order to show effectiveness of proposed scheme, the robustness testing is carried out for model uncertainties, payload variations with time, external disturbance and random noise. Numerical simulation results indicate that the 2-DOF FOPID controllers are superior to their integer order counterparts and the traditional PID controllers. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.

  18. 6DOF Testing of the SLS Inertial Navigation Unit

    NASA Technical Reports Server (NTRS)

    Geohagan, Kevin W.; Bernard, William P.; Oliver, T. Emerson; Strickland, Dennis J.; Leggett, Jared O.

    2018-01-01

    The Navigation System on the NASA Space Launch System (SLS) Block 1 vehicle performs initial alignment of the Inertial Navigation System (INS) navigation frame through gyrocompass alignment (GCA). In lieu of direct testing of GCA accuracy in support of requirement verification, the SLS Navigation Team proposed and conducted an engineering test to, among other things, validate the GCA performance and overall behavior of the SLS INS model through comparison with test data. This paper will detail dynamic hardware testing of the SLS INS, conducted by the SLS Navigation Team at Marshall Space Flight Center's 6DOF Table Facility, in support of GCA performance characterization and INS model validation. A 6-DOF motion platform was used to produce 6DOF pad twist and sway dynamics while a simulated SLS flight computer communicated with the INS. Tests conducted include an evaluation of GCA algorithm robustness to increasingly dynamic pad environments, an examination of GCA algorithm stability and accuracy over long durations, and a long-duration static test to gather enough data for Allan Variance analysis. Test setup, execution, and data analysis will be discussed, including analysis performed in support of SLS INS model validation.

  19. A multiple degree of freedom electromechanical Helmholtz resonator.

    PubMed

    Liu, Fei; Horowitz, Stephen; Nishida, Toshikazu; Cattafesta, Louis; Sheplak, Mark

    2007-07-01

    The development of a tunable, multiple degree of freedom (MDOF) electromechanical Helmholtz resonator (EMHR) is presented. An EMHR consists of an orifice, backing cavity, and a compliant piezoelectric composite diaphragm. Electromechanical tuning of the acoustic impedance is achieved via passive electrical networks shunted across the piezoceramic. For resistive and capacitive loads, the EMHR is a 2DOF system possessing one acoustic and one mechanical DOF. When inductive ladder networks are employed, multiple electrical DOF are added. The dynamics of the multi-energy domain system are modeled using lumped elements and are represented in an equivalent electrical circuit, which is used to analyze the tunable acoustic input impedance of the EMHR. The two-microphone method is used to measure the acoustic impedance of two EMHR designs with a variety of resistive, capacitive, and inductive shunts. For the first design, the data demonstrate that the tuning range of the second resonant frequency for an EMHR with non-inductive shunts is limited by short- and open-circuit conditions, while an inductive shunt results in a 3DOF system possessing an enhanced tuning range. The second design achieves stronger coupling between the Helmholtz resonator and the piezoelectric backplate, and both resonant frequencies can be tuned with different non-inductive loads.

  20. Analyzing Aeroelastic Stability of a Tilt-Rotor Aircraft

    NASA Technical Reports Server (NTRS)

    Kvaternil, Raymond G.

    2006-01-01

    Proprotor Aeroelastic Stability Analysis, now at version 4.5 (PASTA 4.5), is a FORTRAN computer program for analyzing the aeroelastic stability of a tiltrotor aircraft in the airplane mode of flight. The program employs a 10-degree- of-freedom (DOF), discrete-coordinate, linear mathematical model of a rotor with three or more blades and its drive system coupled to a 10-DOF modal model of an airframe. The user can select which DOFs are included in the analysis. Quasi-steady strip-theory aerodynamics is employed for the aerodynamic loads on the blades, a quasi-steady representation is employed for the aerodynamic loads acting on the vibrational modes of the airframe, and a stability-derivative approach is used for the aerodynamics associated with the rigid-body DOFs of the airframe. Blade parameters that vary with the blade collective pitch can be obtained by interpolation from a user-defined table. Stability is determined by examining the eigenvalues that are obtained by solving the coupled equations of motions as a matrix eigenvalue problem. Notwithstanding the relative simplicity of its mathematical foundation, PASTA 4.5 and its predecessors have played key roles in a number of engineering investigations over the years.

  1. Automated optimal coordination of multiple-DOF neuromuscular actions in feedforward neuroprostheses.

    PubMed

    Lujan, J Luis; Crago, Patrick E

    2009-01-01

    This paper describes a new method for designing feedforward controllers for multiple-muscle, multiple-DOF, motor system neural prostheses. The design process is based on experimental measurement of the forward input/output properties of the neuromechanical system and numerical optimization of stimulation patterns to meet muscle coactivation criteria, thus resolving the muscle redundancy (i.e., overcontrol) and the coupled DOF problems inherent in neuromechanical systems. We designed feedforward controllers to control the isometric forces at the tip of the thumb in two directions during stimulation of three thumb muscles as a model system. We tested the method experimentally in ten able-bodied individuals and one patient with spinal cord injury. Good control of isometric force in both DOFs was observed, with rms errors less than 10% of the force range in seven experiments and statistically significant correlations between the actual and target forces in all ten experiments. Systematic bias and slope errors were observed in a few experiments, likely due to the neuromuscular fatigue. Overall, the tests demonstrated the ability of a general design approach to satisfy both control and coactivation criteria in multiple-muscle, multiple-axis neuromechanical systems, which is applicable to a wide range of neuromechanical systems and stimulation electrodes.

  2. Direct adaptive robust tracking control for 6 DOF industrial robot with enhanced accuracy.

    PubMed

    Yin, Xiuxing; Pan, Li

    2018-01-01

    A direct adaptive robust tracking control is proposed for trajectory tracking of 6 DOF industrial robot in the presence of parametric uncertainties, external disturbances and uncertain nonlinearities. The controller is designed based on the dynamic characteristics in the working space of the end-effector of the 6 DOF robot. The controller includes robust control term and model compensation term that is developed directly based on the input reference or desired motion trajectory. A projection-type parametric adaptation law is also designed to compensate for parametric estimation errors for the adaptive robust control. The feasibility and effectiveness of the proposed direct adaptive robust control law and the associated projection-type parametric adaptation law have been comparatively evaluated based on two 6 DOF industrial robots. The test results demonstrate that the proposed control can be employed to better maintain the desired trajectory tracking even in the presence of large parametric uncertainties and external disturbances as compared with PD controller and nonlinear controller. The parametric estimates also eventually converge to the real values along with the convergence of tracking errors, which further validate the effectiveness of the proposed parametric adaption law. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.

  3. Design and Evaluation of an Actuated Exoskeleton for Examining Motor Control in Stroke Thumb

    PubMed Central

    Wang, Furui; Jones, Christopher L.; Shastri, Milind; Qian, Kai; Kamper, Derek G.; Sarkar, Nilanjan

    2016-01-01

    Chronic hand impairment is common following stroke. This paper presents an actuated thumb exoskeleton (ATX) to facilitate research in examining motor control and hand rehabilitation. The ATX presented in this work aims to provide independent bi-directional actuation in each of the 5 degrees-of-freedom (DOF) of the thumb using a novel flexible shaft based mechanism that has 5 active DOF and 3 passive DOF. A prototype has been built and experiments have been conducted to measure the allowable workspace at the thumb and evaluate the kinematic and kinetic performance of the ATX. The experimental results show that the ATX is able to provide individual actuation at all 5 thumb joints with high joint velocity and torque capacities. Further improvement and future work are discussed. PMID:27672232

  4. Adaptive control of space-based robot manipulators

    NASA Technical Reports Server (NTRS)

    Walker, Michael W.; Wee, Liang-Boon

    1991-01-01

    A control method is presented that achieves globally stable trajectory tracking in the presence of uncertainties in the inertial parameters of the system. The 15-DOF system dynamics are divided into two components: a 9-DOF invertible portion and 6-DOF noninvertible portion. A controller is then designed to achieve trajectory tracking of the invertible portion of the system, which consists of the manipulator-joint positions and the orientation of the base. The motion of the noninvertible portion is bounded but otherwise unspecified. This portion of the system consists of the position of the robot's base and the position of the reaction wheels. A simulation is presented to demonstrate the effectiveness of the controller. A quadratic polynomial is used to generate the desired trajectory to illustrate the trajectory-tracking capability of the controller.

  5. Robust design of a 2-DOF GMV controller: a direct self-tuning and fuzzy scheduling approach.

    PubMed

    Silveira, Antonio S; Rodríguez, Jaime E N; Coelho, Antonio A R

    2012-01-01

    This paper presents a study on self-tuning control strategies with generalized minimum variance control in a fixed two degree of freedom structure-or simply GMV2DOF-within two adaptive perspectives. One, from the process model point of view, using a recursive least squares estimator algorithm for direct self-tuning design, and another, using a Mamdani fuzzy GMV2DOF parameters scheduling technique based on analytical and physical interpretations from robustness analysis of the system. Both strategies are assessed by simulation and real plants experimentation environments composed of a damped pendulum and an under development wind tunnel from the Department of Automation and Systems of the Federal University of Santa Catarina. Copyright © 2011 ISA. Published by Elsevier Ltd. All rights reserved.

  6. Spotting and tracking good biometrics with the human visual system

    NASA Astrophysics Data System (ADS)

    Szu, Harold; Jenkins, Jeffrey; Hsu, Charles

    2011-06-01

    We mathematically model the mammalian Visual System's (VS) capability of spotting objects. How can a hawk see a tiny running rabbit from miles above ground? How could that rabbit see the approaching hawk? This predatorprey interaction draws parallels with spotting a familiar person in a crowd. We assume that mammal eyes use peripheral vision to perceive unexpected changes from our memory, and then use our central vision (fovea) to pay attention. The difference between an image and our memory of that image is usually small, mathematically known as a 'sparse representation'. The VS communicates with the brain using a finite reservoir of neurotransmittents, which produces an on-center and thus off-surround Hubel/Wiesel Mexican hat receptive field. This is the basis of our model. This change detection mechanism could drive our attention, allowing us to hit a curveball. If we are about to hit a baseball, what information extracted by our HVS tells us where to swing? Physical human features such as faces, irises, and fingerprints have been successfully used for identification (Biometrics) for decades, recently including voice and walking style for identification from further away. Biologically, humans must use a change detection strategy to achieve an ordered sparseness and use a sigmoid threshold for noisy measurements in our Hetero-Associative Memory [HAM] classifier for fault tolerant recall. Human biometrics is dynamic, and therefore involves more than just the surface, requiring a 3 dimensional measurement (i.e. Daugman/Gabor iris features). Such a measurement can be achieved using the partial coherence of a laser's reflection from a 3-D biometric surface, creating more degrees of freedom (d.o.f.) to meet the Army's challenge of distant Biometrics. Thus, one might be able to increase the standoff loss of less distinguished degrees of freedom (DOF).

  7. Mathematical model of unmanned aerial vehicle used for endurance autonomous monitoring

    NASA Astrophysics Data System (ADS)

    Chelaru, Teodor-Viorel; Chelaru, Adrian

    2014-12-01

    The paper purpose is to present some aspects regarding the control system of unmanned aerial vehicle - UAV, used to local observations, surveillance and monitoring interest area. The calculus methodology allows a numerical simulation of UAV evolution in bad atmospheric conditions by using nonlinear model, as well as a linear one for obtaining guidance command. The UAV model which will be presented has six DOF (degrees of freedom), and autonomous control system. This theoretical development allows us to build stability matrix, command matrix and control matrix and finally to analyse the stability of autonomous UAV flight. A robust guidance system, based on uncoupled state will be evaluated for different fly conditions and the results will be presented. The flight parameters and guidance will be analysed.

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chelaru, Teodor-Viorel, E-mail: teodor.chelaru@upb.ro; Chelaru, Adrian, E-mail: achelaru@incas.ro

    The paper purpose is to present some aspects regarding the control system of unmanned aerial vehicle - UAV, used to local observations, surveillance and monitoring interest area. The calculus methodology allows a numerical simulation of UAV evolution in bad atmospheric conditions by using nonlinear model, as well as a linear one for obtaining guidance command. The UAV model which will be presented has six DOF (degrees of freedom), and autonomous control system. This theoretical development allows us to build stability matrix, command matrix and control matrix and finally to analyse the stability of autonomous UAV flight. A robust guidance system,more » based on uncoupled state will be evaluated for different fly conditions and the results will be presented. The flight parameters and guidance will be analysed.« less

  9. A cable-driven parallel manipulator with force sensing capabilities for high-accuracy tissue endomicroscopy.

    PubMed

    Miyashita, Kiyoteru; Oude Vrielink, Timo; Mylonas, George

    2018-05-01

    Endomicroscopy (EM) provides high resolution, non-invasive histological tissue information and can be used for scanning of large areas of tissue to assess cancerous and pre-cancerous lesions and their margins. However, current robotic solutions do not provide the accuracy and force sensitivity required to perform safe and accurate tissue scanning. A new surgical instrument has been developed that uses a cable-driven parallel mechanism (CPDM) to manipulate an EM probe. End-effector forces are determined by measuring the tensions in each cable. As a result, the instrument allows to accurately apply a contact force on a tissue, while at the same time offering high resolution and highly repeatable probe movement. 0.2 and 0.6 N force sensitivities were found for 1 and 2 DoF image acquisition methods, respectively. A back-stepping technique can be used when a higher force sensitivity is required for the acquisition of high quality tissue images. This method was successful in acquiring images on ex vivo liver tissue. The proposed approach offers high force sensitivity and precise control, which is essential for robotic EM. The technical benefits of the current system can also be used for other surgical robotic applications, including safe autonomous control, haptic feedback and palpation.

  10. Composite Material Testing Data Reduction to Adjust for the Systematic 6-DOF Testing Machine Aberrations

    Treesearch

    Athanasios lliopoulos; John G. Michopoulos; John G. C. Hermanson

    2012-01-01

    This paper describes a data reduction methodology for eliminating the systematic aberrations introduced by the unwanted behavior of a multiaxial testing machine, into the massive amounts of experimental data collected from testing of composite material coupons. The machine in reference is a custom made 6-DoF system called NRL66.3 and developed at the NAval...

  11. Thermal Actuation Based 3-DoF Non-Resonant Microgyroscope Using MetalMUMPs

    PubMed Central

    Shakoor, Rana Iqtidar; Bazaz, Shafaat Ahmed; Kraft, Michael; Lai, Yongjun; Masood ul Hassan, Muhammad

    2009-01-01

    High force, large displacement and low voltage consumption are a primary concern for microgyroscopes. The chevron-shaped thermal actuators are unique in terms of high force generation combined with the large displacements at a low operating voltage in comparison with traditional electrostatic actuators. A Nickel based 3-DoF micromachined gyroscope comprising 2-DoF drive mode and 1-DoF sense mode oscillator utilizing the chevron-shaped thermal actuators is presented here. Analytical derivations and finite element simulations are carried out to predict the performance of the proposed device using the thermo-physical properties of electroplated nickel. The device sensitivity is improved by utilizing the dynamical amplification of the oscillation in 2-DoF drive mode using an active-passive mass configuration. A comprehensive theoretical description, dynamics and mechanical design considerations of the proposed gyroscopes model are discussed in detail. Parametric optimization of gyroscope, its prototype modeling and fabrication using MetalMUMPs has also been investigated. Dynamic transient simulation results predicted that the sense mass of the proposed device achieved a drive displacement of 4.1μm when a sinusoidal voltage of 0.5V is applied at 1.77 kHz exhibiting a mechanical sensitivity of 1.7μm /°/s in vacuum. The wide bandwidth frequency response of the 2-DoF drive mode oscillator consists of two resonant peaks and a flat region of 2.11 kHz between the peaks defining the operational frequency region. The sense mode resonant frequency can lie anywhere within this region and therefore the amplitude of the response is insensitive to structural parameter variations, enhancing device robustness against such variations. The proposed device has a size of 2.2 × 2.6 mm2, almost one third in comparison with existing M-DoF vibratory gyroscope with an estimated power consumption of 0.26 Watts. These predicted results illustrate that the chevron-shaped thermal actuator has a large voltage-stroke ratio shifting the paradigm in MEMS gyroscope design from the traditional interdigitated comb drive electrostatic actuator. These actuators have low damping compared to electrostatic comb drive actuators which may result in high quality factor microgyroscopes operating at atmospheric pressure. PMID:22574020

  12. High-frequency ultrasonic imaging of the anterior segment using an annular array transducer.

    PubMed

    Silverman, Ronald H; Ketterling, Jeffrey A; Coleman, D Jackson

    2007-04-01

    Very high-frequency ultrasound (VHFU; >35 megahertz [MHz]) allows imaging of anterior segment structures of the eye with a resolution of less than 40 microm. The low focal ratio of VHFU transducers, however, results in a depth of field (DOF) of less than 1 mm. The aim was to develop a high-frequency annular array transducer for ocular imaging with improved DOF, sensitivity, and resolution compared with conventional transducers. Experimental study. Cadaver eyes, ex vivo cow eyes, in vivo rabbit eyes. A spherically curved annular array ultrasound transducer was fabricated. The array consisted of 5 concentric rings of equal area, had an overall aperture of 6 mm, and a geometric focus of 12 mm. The nominal center frequency of all array elements was 40 MHz. An experimental system was designed in which a single array element was pulsed and echo data were recorded from all elements. By sequentially pulsing each element, echo data were acquired for all 25 transmit-and-receive annuli combinations. The echo data then were focused synthetically and composite images were produced. Transducer operation was tested by scanning a test object consisting of a series of 25-microm diameter wires spaced at increasing range from the transducer. Imaging capabilities of the annular array were demonstrated in ex vivo bovine, in vivo rabbit, and human cadaver eyes. Depth of field, resolution, and sensitivity. The wire scans verified the operation of the array and demonstrated a 6.0-mm DOF, compared with the 1.0-mm DOF of a conventional single-element transducer of comparable frequency, aperture, and focal length. B-mode images of ex vivo bovine, in vivo rabbit, and cadaver eyes showed that although the single-element transducer had high sensitivity and resolution within 1 to 2 mm of its focus, the array with synthetic focusing maintained this quality over a 6-mm DOF. An annular array for high-resolution ocular imaging has been demonstrated. This technology offers improved DOF, sensitivity, and lateral resolution compared with single-element fixed focus transducers currently used for VHFU imaging of the eye.

  13. Knee joint kinematics and kinetics during the hop and cut after soft tissue artifact suppression: Time to reconsider ACL injury mechanisms?

    PubMed

    Smale, Kenneth B; Potvin, Brigitte M; Shourijeh, Mohammad S; Benoit, Daniel L

    2017-09-06

    The recent development of a soft tissue artifact (STA) suppression method allows us to re-evaluate the tibiofemoral kinematics currently linked to non-contact knee injuries. The purpose of this study was therefore to evaluate knee joint kinematics and kinetics in six degrees of freedom (DoF) during the loading phases of a jump lunge and side cut using this in silico method. Thirty-five healthy adults completed these movements and their surface marker trajectories were then scaled and processed with OpenSim's inverse kinematics (IK) and inverse dynamics tools. Knee flexion angle-dependent kinematic constraints defined based on previous bone pin (BP) marker trajectories were then applied to the OpenSim model during IK and these constrained results were then processed with the standard inverse dynamics tool. Significant differences for all hip, knee, and ankle DoF were observed after STA suppression for both the jump lunge and side cut. Using clinically relevant effect size estimates, we conclude that STA contamination had led to misclassifications in hip transverse plane angles, knee frontal and transverse plane angles, medial/lateral and distractive/compressive knee translations, and knee frontal plane moments between the NoBP and the BP IK solutions. Our results have substantial clinical implications since past research has used joint kinematics and kinetics contaminated by STA to identify risk factors for musculoskeletal injuries. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Object oriented design (OOD) in real-time hardware-in-the-loop (HWIL) simulations

    NASA Astrophysics Data System (ADS)

    Morris, Joe; Richard, Henri; Lowman, Alan; Youngren, Rob

    2006-05-01

    Using Object Oriented Design (OOD) concepts in AMRDEC's Hardware-in-the Loop (HWIL) real-time simulations allows the user to interchange parts of the simulation to meet test requirements. A large-scale three-spectral band simulator connected via a high speed reflective memory ring for time-critical data transfers to PC controllers connected by non real-time Ethernet protocols is used to separate software objects from logical entities close to their respective controlled hardware. Each standalone object does its own dynamic initialization, real-time processing, and end of run processing; therefore it can be easily maintained and updated. A Resource Allocation Program (RAP) is also utilized along with a device table to allocate, organize, and document the communication protocol between the software and hardware components. A GUI display program lists all allocations and deallocations of HWIL memory and hardware resources. This interactive program is also used to clean up defunct allocations of dead processes. Three examples are presented using the OOD and RAP concepts. The first is the control of an ACUTRONICS built three-axis flight table using the same control for calibration and real-time functions. The second is the transportability of a six-degree-of-freedom (6-DOF) simulation from an Onyx residence to a Linux-PC. The third is the replacement of the 6-DOF simulation with a replay program to drive the facility with archived run data for demonstration or analysis purposes.

  15. A Digital Control Algorithm for Magnetic Suspension Systems

    NASA Technical Reports Server (NTRS)

    Britton, Thomas C.

    1996-01-01

    An ongoing program exists to investigate and develop magnetic suspension technologies and modelling techniques at NASA Langley Research Center. Presently, there is a laboratory-scale large air-gap suspension system capable of five degree-of-freedom (DOF) control that is operational and a six DOF system that is under development. Those systems levitate a cylindrical element containing a permanent magnet core above a planar array of electromagnets, which are used for levitation and control purposes. In order to evaluate various control approaches with those systems, the Generic Real-Time State-Space Controller (GRTSSC) software package was developed. That control software package allows the user to implement multiple control methods and allows for varied input/output commands. The development of the control algorithm is presented. The desired functionality of the software is discussed, including the ability to inject noise on sensor inputs and/or actuator outputs. Various limitations, common issues, and trade-offs are discussed including data format precision; the drawbacks of using either Direct Memory Access (DMA), interrupts, or program control techniques for data acquisition; and platform dependent concerns related to the portability of the software, such as memory addressing formats. Efforts to minimize overall controller loop-rate and a comparison of achievable controller sample rates are discussed. The implementation of a modular code structure is presented. The format for the controller input data file and the noise information file is presented. Controller input vector information is available for post-processing by mathematical analysis software such as MATLAB1.

  16. Intuitive wireless control of a robotic arm for people living with an upper body disability.

    PubMed

    Fall, C L; Turgeon, P; Campeau-Lecours, A; Maheu, V; Boukadoum, M; Roy, S; Massicotte, D; Gosselin, C; Gosselin, B

    2015-08-01

    Assistive Technologies (ATs) also called extrinsic enablers are useful tools for people living with various disabilities. The key points when designing such useful devices not only concern their intended goal, but also the most suitable human-machine interface (HMI) that should be provided to users. This paper describes the design of a highly intuitive wireless controller for people living with upper body disabilities with a residual or complete control of their neck and their shoulders. Tested with JACO, a six-degree-of-freedom (6-DOF) assistive robotic arm with 3 flexible fingers on its end-effector, the system described in this article is made of low-cost commercial off-the-shelf components and allows a full emulation of JACO's standard controller, a 3 axis joystick with 7 user buttons. To do so, three nine-degree-of-freedom (9-DOF) inertial measurement units (IMUs) are connected to a microcontroller and help measuring the user's head and shoulders position, using a complementary filter approach. The results are then transmitted to a base-station via a 2.4-GHz low-power wireless transceiver and interpreted by the control algorithm running on a PC host. A dedicated software interface allows the user to quickly calibrate the controller, and translates the information into suitable commands for JACO. The proposed controller is thoroughly described, from the electronic design to implemented algorithms and user interfaces. Its performance and future improvements are discussed as well.

  17. Mixed semiclassical-classical propagators for the Wigner phase space representation

    NASA Astrophysics Data System (ADS)

    Koda, Shin-ichi

    2016-04-01

    We formulate mixed semiclassical-classical (SC-Cl) propagators by adding a further approximation to the phase-space SC propagators, which have been formulated in our previous paper [S. Koda, J. Chem. Phys. 143, 244110 (2015)]. We first show that the stationary phase approximation over the operation of the phase-space van Vleck propagator on initial distribution functions results in the classical mechanical time propagation. Then, after dividing the degrees of freedom (DOFs) of the total system into the semiclassical DOFs and the classical DOFs, the SC-Cl van Vleck propagator and the SC-Cl Herman-Kluk (HK) propagator are derived by performing the stationary phase approximation only with respect to the classical DOFs. These SC-Cl propagators are naturally decomposed to products of the phase-space SC propagators and the classical mechanical propagators when the system does not have any interaction between the semiclassical and the classical DOFs. In addition, we also numerically compare the original phase-space HK (full HK) propagator and the SC-Cl HK propagator in terms of accuracy and efficiency to find that the accuracy of the SC-Cl HK propagator can be comparable to that of the full HK propagator although the latter is more accurate than the former in general. On the other hand, we confirm that the convergence speed of the SC-Cl HK propagator is faster than that of the full HK propagator. The present numerical tests indicate that the SC-Cl HK propagator can be more accurate than the full HK propagator when they use a same and finite number of classical trajectories due to the balance of the accuracy and the efficiency.

  18. Mixed semiclassical-classical propagators for the Wigner phase space representation.

    PubMed

    Koda, Shin-Ichi

    2016-04-21

    We formulate mixed semiclassical-classical (SC-Cl) propagators by adding a further approximation to the phase-space SC propagators, which have been formulated in our previous paper [S. Koda, J. Chem. Phys. 143, 244110 (2015)]. We first show that the stationary phase approximation over the operation of the phase-space van Vleck propagator on initial distribution functions results in the classical mechanical time propagation. Then, after dividing the degrees of freedom (DOFs) of the total system into the semiclassical DOFs and the classical DOFs, the SC-Cl van Vleck propagator and the SC-Cl Herman-Kluk (HK) propagator are derived by performing the stationary phase approximation only with respect to the classical DOFs. These SC-Cl propagators are naturally decomposed to products of the phase-space SC propagators and the classical mechanical propagators when the system does not have any interaction between the semiclassical and the classical DOFs. In addition, we also numerically compare the original phase-space HK (full HK) propagator and the SC-Cl HK propagator in terms of accuracy and efficiency to find that the accuracy of the SC-Cl HK propagator can be comparable to that of the full HK propagator although the latter is more accurate than the former in general. On the other hand, we confirm that the convergence speed of the SC-Cl HK propagator is faster than that of the full HK propagator. The present numerical tests indicate that the SC-Cl HK propagator can be more accurate than the full HK propagator when they use a same and finite number of classical trajectories due to the balance of the accuracy and the efficiency.

  19. On-Board Imaging Validation of Optically Guided Stereotactic Radiosurgery Positioning System for Conventionally Fractionated Radiotherapy for Paranasal Sinus and Skull Base Cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxim, Peter G.; Loo, Billy W.; Murphy, James D.

    2011-11-15

    Purpose: To evaluate the positioning accuracy of an optical positioning system for stereotactic radiosurgery in a pilot experience of optically guided, conventionally fractionated, radiotherapy for paranasal sinus and skull base tumors. Methods and Materials: Before each daily radiotherapy session, the positioning of 28 patients was set up using an optical positioning system. After this initial setup, the patients underwent standard on-board imaging that included daily orthogonal kilovoltage images and weekly cone beam computed tomography scans. Daily translational shifts were made after comparing the on-board images with the treatment planning computed tomography scans. These daily translational shifts represented the daily positionalmore » error in the optical tracking system and were recorded during the treatment course. For 13 patients treated with smaller fields, a three-degree of freedom (3DOF) head positioner was used for more accurate setup. Results: The mean positional error for the optically guided system in patients with and without the 3DOF head positioner was 1.4 {+-} 1.1 mm and 3.9 {+-} 1.6 mm, respectively (p <.0001). The mean positional error drifted 0.11 mm/wk upward during the treatment course for patients using the 3DOF head positioner (p = .057). No positional drift was observed in the patients without the 3DOF head positioner. Conclusion: Our initial clinical experience with optically guided head-and-neck fractionated radiotherapy was promising and demonstrated clinical feasibility. The optically guided setup was especially useful when used in conjunction with the 3DOF head positioner and when it was recalibrated to the shifts using the weekly portal images.« less

  20. Multi-sensor calibration of low-cost magnetic, angular rate and gravity systems.

    PubMed

    Lüken, Markus; Misgeld, Berno J E; Rüschen, Daniel; Leonhardt, Steffen

    2015-10-13

    We present a new calibration procedure for low-cost nine degrees-of-freedom (9DOF) magnetic, angular rate and gravity (MARG) sensor systems, which relies on a calibration cube, a reference table and a body sensor network (BSN). The 9DOF MARG sensor is part of our recently-developed "Integrated Posture and Activity Network by Medit Aachen" (IPANEMA) BSN. The advantage of this new approach is the use of the calibration cube, which allows for easy integration of two sensor nodes of the IPANEMA BSN. One 9DOF MARG sensor node is thereby used for calibration; the second 9DOF MARG sensor node is used for reference measurements. A novel algorithm uses these measurements to further improve the performance of the calibration procedure by processing arbitrarily-executed motions. In addition, the calibration routine can be used in an alignment procedure to minimize errors in the orientation between the 9DOF MARG sensor system and a motion capture inertial reference system. A two-stage experimental study is conducted to underline the performance of our calibration procedure. In both stages of the proposed calibration procedure, the BSN data, as well as reference tracking data are recorded. In the first stage, the mean values of all sensor outputs are determined as the absolute measurement offset to minimize integration errors in the derived movement model of the corresponding body segment. The second stage deals with the dynamic characteristics of the measurement system where the dynamic deviation of the sensor output compared to a reference system is Sensors 2015, 15 25920 corrected. In practical validation experiments, this procedure showed promising results with a maximum RMS error of 3.89°.

  1. Statistical Sensor Fusion of a 9-DOF Mems Imu for Indoor Navigation

    NASA Astrophysics Data System (ADS)

    Chow, J. C. K.

    2017-09-01

    Sensor fusion of a MEMS IMU with a magnetometer is a popular system design, because such 9-DoF (degrees of freedom) systems are capable of achieving drift-free 3D orientation tracking. However, these systems are often vulnerable to ambient magnetic distortions and lack useful position information; in the absence of external position aiding (e.g. satellite/ultra-wideband positioning systems) the dead-reckoned position accuracy from a 9-DoF MEMS IMU deteriorates rapidly due to unmodelled errors. Positioning information is valuable in many satellite-denied geomatics applications (e.g. indoor navigation, location-based services, etc.). This paper proposes an improved 9-DoF IMU indoor pose tracking method using batch optimization. By adopting a robust in-situ user self-calibration approach to model the systematic errors of the accelerometer, gyroscope, and magnetometer simultaneously in a tightly-coupled post-processed least-squares framework, the accuracy of the estimated trajectory from a 9-DoF MEMS IMU can be improved. Through a combination of relative magnetic measurement updates and a robust weight function, the method is able to tolerate a high level of magnetic distortions. The proposed auto-calibration method was tested in-use under various heterogeneous magnetic field conditions to mimic a person walking with the sensor in their pocket, a person checking their phone, and a person walking with a smartwatch. In these experiments, the presented algorithm improved the in-situ dead-reckoning orientation accuracy by 79.8-89.5 % and the dead-reckoned positioning accuracy by 72.9-92.8 %, thus reducing the relative positioning error from metre-level to decimetre-level after ten seconds of integration, without making assumptions about the user's dynamics.

  2. Wavefront coding for fast, high-resolution light-sheet microscopy (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Olarte, Omar E.; Licea-Rodriguez, Jacob; Loza-Alvarez, Pablo

    2017-02-01

    Some biological experiments demand the observation of dynamics processes in 3D with high spatiotemporal resolution. The use of wavefront coding to extend the depth-of-field (DOF) of the collection arm of a light-sheet microscope is an interesting alternative for fast 3D imaging. Under this scheme, the 3D features of the sample are captured at high volumetric rates while the light sheet is swept rapidly within the extended DOF. The DOF is extended by coding the pupil function of the imaging lens by using a custom-designed phase mask. A posterior restoration step is required to decode the information of the captured images based on the applied phase mask [1]. This hybrid optical-digital approach is known as wavefront coding (WFC). Previously, we have demonstrated this method for performing fast 3D imaging of biological samples at medium resolution [2]. In this work, we present the extension of this approach for high-resolution microscopes. Under these conditions, the effective DOF of a standard high NA objective is of a few micrometers. Here we demonstrate that by the use of WFC, we can extend the DOF more than one order of magnitude keeping the high-resolution imaging. This is demonstrated for two designed phase masks using Zebrafish and C. elegans samples. [1] Olarte, O.E., Andilla, J., Artigas, D., and Loza-Alvarez, P., "Decoupled Illumination-Detection Microscopy. Selected Optics in Year 2105," in Optics and Photonics news 26, p. 41 (2015). [2] Olarte, O.E., Andilla, J., Artigas, D., and Loza-Alvarez, P., "Decoupled illumination detection in light sheet microscopy for fast volumetric imaging," Optica 2(8), 702 (2015).

  3. Comparison and Analysis of ISO/IEEE 11073, IHE PCD-01, and HL7 FHIR Messages for Personal Health Devices

    PubMed Central

    Do, Hyoungho

    2018-01-01

    Objectives Increasing use of medical devices outside of healthcare facilities inevitably requires connectivity and interoperability between medical devices and healthcare information systems. To this end, standards have been developed and used to provide interoperability between personal health devices (PHDs) and external systems. ISO/IEEE 11073 standards and IHE PCD-01 standard messages have been used the most in the exchange of observation data of health devices. Recently, transmitting observation data using the HL7 FHIR standard has been devised in the name of DoF (Devices on FHIR) and adopted very fast. We compare and analyze these standards and suggest that which standard will work best at the different environments of device usage. Methods We generated each message/resource of the three standards for observed vital signs from blood pressure monitor and thermometer. Then, the size, the contents, and the exchange processes of these messages are compared and analyzed. Results ISO/IEEE 11073 standard message has the smallest data size, but it has no ability to contain the key information, patient information. On the other hand, PCD-01 messages and FHIR standards have the fields for patient information. HL7 DoF standards provide reusing of information unit known as resource, and it is relatively easy to parse DoF messages since it uses widely known XML and JSON. Conclusions ISO/IEEE 11073 standards are suitable for devices having very small computing power. IHE PCD-01 and HL7 DoF messages can be used for the devices that need to be connected to hospital information systems that require patient information. When information reuse is frequent, DoF is advantageous over PCD-01. PMID:29503752

  4. Comparison and Analysis of ISO/IEEE 11073, IHE PCD-01, and HL7 FHIR Messages for Personal Health Devices.

    PubMed

    Lee, Sungkee; Do, Hyoungho

    2018-01-01

    Increasing use of medical devices outside of healthcare facilities inevitably requires connectivity and interoperability between medical devices and healthcare information systems. To this end, standards have been developed and used to provide interoperability between personal health devices (PHDs) and external systems. ISO/IEEE 11073 standards and IHE PCD-01 standard messages have been used the most in the exchange of observation data of health devices. Recently, transmitting observation data using the HL7 FHIR standard has been devised in the name of DoF (Devices on FHIR) and adopted very fast. We compare and analyze these standards and suggest that which standard will work best at the different environments of device usage. We generated each message/resource of the three standards for observed vital signs from blood pressure monitor and thermometer. Then, the size, the contents, and the exchange processes of these messages are compared and analyzed. ISO/IEEE 11073 standard message has the smallest data size, but it has no ability to contain the key information, patient information. On the other hand, PCD-01 messages and FHIR standards have the fields for patient information. HL7 DoF standards provide reusing of information unit known as resource, and it is relatively easy to parse DoF messages since it uses widely known XML and JSON. ISO/IEEE 11073 standards are suitable for devices having very small computing power. IHE PCD-01 and HL7 DoF messages can be used for the devices that need to be connected to hospital information systems that require patient information. When information reuse is frequent, DoF is advantageous over PCD-01.

  5. Multi-Sensor Calibration of Low-Cost Magnetic, Angular Rate and Gravity Systems

    PubMed Central

    Lüken, Markus; Misgeld, Berno J.E.; Rüschen, Daniel; Leonhardt, Steffen

    2015-01-01

    We present a new calibration procedure for low-cost nine degrees-of-freedom (9DOF) magnetic, angular rate and gravity (MARG) sensor systems, which relies on a calibration cube, a reference table and a body sensor network (BSN). The 9DOF MARG sensor is part of our recently-developed “Integrated Posture and Activity Network by Medit Aachen” (IPANEMA) BSN. The advantage of this new approach is the use of the calibration cube, which allows for easy integration of two sensor nodes of the IPANEMA BSN. One 9DOF MARG sensor node is thereby used for calibration; the second 9DOF MARG sensor node is used for reference measurements. A novel algorithm uses these measurements to further improve the performance of the calibration procedure by processing arbitrarily-executed motions. In addition, the calibration routine can be used in an alignment procedure to minimize errors in the orientation between the 9DOF MARG sensor system and a motion capture inertial reference system. A two-stage experimental study is conducted to underline the performance of our calibration procedure. In both stages of the proposed calibration procedure, the BSN data, as well as reference tracking data are recorded. In the first stage, the mean values of all sensor outputs are determined as the absolute measurement offset to minimize integration errors in the derived movement model of the corresponding body segment. The second stage deals with the dynamic characteristics of the measurement system where the dynamic deviation of the sensor output compared to a reference system is corrected. In practical validation experiments, this procedure showed promising results with a maximum RMS error of 3.89°. PMID:26473873

  6. SU-E-J-46: Evaluation of the Accuracy of a Six Degree of Freedom Robotic Couch Using ConeBeam CT Images of the Isocal Phantom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Q; Driewer, J; Wang, S

    Purpose The accuracy of Varian PerfectPitch six degree of freedom (DOF) robotic couch was examined using Varian Isocal phantom and cone-beam CT (CBCT) system. Methods CBCT images of the Isocal phantom were taken at different pitch and roll angles. The pitch and roll angles were varied from 357 to 3 degrees in one degree increments by input from service console, generating a total of 49 combinations with couch angle (yaw) zero. The center positions of the 16 tungsten carbide BBs contained in the Isocal were determined with in-house image processing software. Expected BBs positions at different rotation angles were determinedmore » mathematically by applying a combined translation/rotation operator to BB positions at zero pitch and roll values. A least square method was used to minimize the difference between the expected BB positions and their measured positions. In this way rotation angles were obtained and compared with input values from the console. Results A total of 49 CBCT images with voxel sizes 0.51 mm × 0.51 mm × 1 mm were used in analysis. Among the 49 calculations, the maximum rotation angle differences were 0.1 degree, 0.15 degree, and 0.09 degree, for pitch, roll, and couch rotation, respectively. The mean ± standard-deviation angle differences were 0.028±0.001 degree, −0.043±0.003 degree, and −0.009±0.001 degree, for pitch, roll, and couch rotation, respectively. The maximum isocenter shifts were 0.3 mm, 0.5 mm, 0.4 mm in x, y, z direction respectively following IEC6127 convention. The mean isocenter shifts were 0.07±0.02 mm, −0.05±0.06 mm, and −0.12±0.02 mm in x, y and z directions. Conclusion The accuracy of the Varian PerfectPitch six DOF couch was studied with CBCTs of the Isocal phantom. The rotational errors were less than 0.15 degree and isocenter shifts were less than 0.5 mm in any direction. This accuracy is sufficient for stereotactic radiotherapy clinical applications.« less

  7. Position versus force control: using the 2-DOF robotic ankle trainer to assess ankle's motor control.

    PubMed

    Farjadian, Amir B; Nabian, Mohsen; Hartman, Amber; Corsino, Johnathan; Mavroidis, Constantinos; Holden, Maureen K

    2014-01-01

    An estimated of 2,000,000 acute ankle sprains occur annually in the United States. Furthermore, ankle disabilities are caused by neurological impairments such as traumatic brain injury, cerebral palsy and stroke. The virtually interfaced robotic ankle and balance trainer (vi-RABT) was introduced as a cost-effective platform-based rehabilitation robot to improve overall ankle/balance strength, mobility and control. The system is equipped with 2 degrees of freedom (2-DOF) controlled actuation along with complete means of angle and torque measurement mechanisms. Vi-RABT was used to assess ankle strength, flexibility and motor control in healthy human subjects, while playing interactive virtual reality games on the screen. The results suggest that in the task with 2-DOF, subjects have better control over ankle's position vs. force.

  8. Reducing Visual Discomfort with HMDs Using Dynamic Depth of Field.

    PubMed

    Carnegie, Kieran; Rhee, Taehyun

    2015-01-01

    Although head-mounted displays (HMDs) are ideal devices for personal viewing of immersive stereoscopic content, exposure to VR applications on them results in significant discomfort for the majority of people, with symptoms including eye fatigue, headaches, nausea, and sweating. A conflict between accommodation and vergence depth cues on stereoscopic displays is a significant cause of visual discomfort. This article describes the results of an evaluation used to judge the effectiveness of dynamic depth-of-field (DoF) blur in an effort to reduce discomfort caused by exposure to stereoscopic content on HMDs. Using a commercial game engine implementation, study participants report a reduction of visual discomfort on a simulator sickness questionnaire when DoF blurring is enabled. The study participants reported a decrease in symptom severity caused by HMD exposure, indicating that dynamic DoF can effectively reduce visual discomfort.

  9. Modeling and simulation of a 2-DOF bidirectional electrothermal microactuator

    NASA Astrophysics Data System (ADS)

    Topaloglu, N.; Elbuken, C.; Nieva, P. M.; Yavuz, M.; Huissoon, J. P.

    2008-03-01

    In this paper we present the modeling and simulation of a 2 degree-of-freedom (DOF) bidirectional electrothermal actuator. The four arm microactuator was designed to move in both the horizontal and vertical axes. By tailoring the geometrical parameters of the design, the in-plane and out-of-plane motions were decoupled, resulting in enhanced mobility in both directions. The motion of the actuator was modeled analytically using an electro-thermo-mechanical analysis. To validate the analytical model, finite element simulations were performed using ANSYS. The microactuators were fabricated using PolyMUMPS process and experimental results show good agreement with both the analytical model and the simulations. We demonstrated that the 2-DOF bidirectional electrothermal actuator can achieve 3.7 μm in-plane and 13.3 μm out-of-plane deflections with an input voltage of 10 V.

  10. Optical Coherency Matrix Tomography

    DTIC Science & Technology

    2015-10-19

    multiple DoFs, such a treatment necessitates introducing the notion of ‘classical entanglement ’10,19–25. In quantum mechanics, states associated with...corresponding concept of classical entanglement indi- cates the non-separability of the beam into uncoupled DoFs. After the initial suggestion by Spreeuw19, a...substantial body of work has accumulated in the past five years in which classical entanglement is exploited in solving long-standing problems in

  11. Improved olefinic fat suppression in skeletal muscle DTI using a magnitude-based dixon method.

    PubMed

    Burakiewicz, Jedrzej; Hooijmans, Melissa T; Webb, Andrew G; Verschuuren, Jan J G M; Niks, Erik H; Kan, Hermien E

    2018-01-01

    To develop a method of suppressing the multi-resonance fat signal in diffusion-weighted imaging of skeletal muscle. This is particularly important when imaging patients with muscular dystrophies, a group of diseases which cause gradual replacement of muscle tissue by fat. The signal from the olefinic fat peak at 5.3 ppm can significantly confound diffusion-tensor imaging measurements. Dixon olefinic fat suppression (DOFS), a magnitude-based chemical-shift-based method of suppressing the olefinic peak, is proposed. It is verified in vivo by performing diffusion tensor imaging (DTI)-based quantification in the lower leg of seven healthy volunteers, and compared to two previously described fat-suppression techniques in regions with and without fat contamination. In the region without fat contamination, DOFS produces similar results to existing techniques, whereas in muscle contaminated by subcutaneous fat signal moved due to the chemical shift artefact, it consistently showed significantly higher (P = 0.018) mean diffusivity (MD). Because fat presence lowers MD, this suggests improved fat suppression. DOFS offers superior fat suppression and enhances quantitative measurements in the muscle in the presence of fat. DOFS is an alternative to spectral olefinic fat suppression. Magn Reson Med 79:152-159, 2018. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.

  12. VisNAV 100: a robust, compact imaging sensor for enabling autonomous air-to-air refueling of aircraft and unmanned aerial vehicles

    NASA Astrophysics Data System (ADS)

    Katake, Anup; Choi, Heeyoul

    2010-01-01

    To enable autonomous air-to-refueling of manned and unmanned vehicles a robust high speed relative navigation sensor capable of proving high accuracy 3DOF information in diverse operating conditions is required. To help address this problem, StarVision Technologies Inc. has been developing a compact, high update rate (100Hz), wide field-of-view (90deg) direction and range estimation imaging sensor called VisNAV 100. The sensor is fully autonomous requiring no communication from the tanker aircraft and contains high reliability embedded avionics to provide range, azimuth, elevation (3 degrees of freedom solution 3DOF) and closing speed relative to the tanker aircraft. The sensor is capable of providing 3DOF with an error of 1% in range and 0.1deg in azimuth/elevation up to a range of 30m and 1 deg error in direction for ranges up to 200m at 100Hz update rates. In this paper we will discuss the algorithms that were developed in-house to enable robust beacon pattern detection, outlier rejection and 3DOF estimation in adverse conditions and present the results of several outdoor tests. Results from the long range single beacon detection tests will also be discussed.

  13. Control devices and steering strategies in pathway surgery.

    PubMed

    Fan, Chunman; Jelínek, Filip; Dodou, Dimitra; Breedveld, Paul

    2015-02-01

    For pathway surgery, that is, minimally invasive procedures carried out transluminally or through instrument-created pathways, handheld maneuverable instruments are being developed. As the accompanying control interfaces of such instruments have not been optimized for intuitive manipulation, we investigated the effect of control mode (1DoF or 2DoF), and control device (joystick or handgrip) on human performance in a navigation task. The experiments were conducted using the Endo-PaC (Endoscopic-Path Controller), a simulator that emulates the shaft and handle of a maneuverable instrument, combined with custom-developed software animating pathway surgical scenarios. Participants were asked to guide a virtual instrument without collisions toward a target located at the end of a virtual curved tunnel. The performance was assessed in terms of task completion time, path length traveled by the virtual instrument, motion smoothness, collision metrics, subjective workload, and personal preference. The results indicate that 2DoF control leads to faster task completion and fewer collisions with the tunnel wall combined with a strong subjective preference compared with 1DoF control. Handgrip control appeared to be more intuitive to master than joystick control. However, the participants experienced greater physical demand and had longer path lengths with handgrip than joystick control. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Through the big bang: Continuing Einstein's equations beyond a cosmological singularity

    NASA Astrophysics Data System (ADS)

    Koslowski, Tim A.; Mercati, Flavio; Sloan, David

    2018-03-01

    All measurements are comparisons. The only physically accessible degrees of freedom (DOFs) are dimensionless ratios. The objective description of the universe as a whole thus predicts only how these ratios change collectively as one of them is changed. Here we develop a description for classical Bianchi IX cosmology implementing these relational principles. The objective evolution decouples from the volume and its expansion degree of freedom. We use the relational description to investigate both vacuum dominated and quiescent Bianchi IX cosmologies. In the vacuum dominated case the relational dynamical system predicts an infinite amount of change of the relational DOFs, in accordance with the well known chaotic behaviour of Bianchi IX. In the quiescent case the relational dynamical system evolves uniquely though the point where the decoupled scale DOFs predict the big bang/crunch. This is a non-trivial prediction of the relational description; the big bang/crunch is not the end of physics - it is instead a regular point of the relational evolution. Describing our solutions as spacetimes that satisfy Einstein's equations, we find that the relational dynamical system predicts two singular solutions of GR that are connected at the hypersurface of the singularity such that relational DOFs are continuous and the orientation of the spatial frame is inverted.

  15. 24 DOF EMG controlled hybrid actuated prosthetic hand.

    PubMed

    Atasoy, A; Kaya, E; Toptas, E; Kuchimov, S; Kaplanoglu, E; Ozkan, M

    2016-08-01

    A complete mechanical design concept of an electromyogram (EMG) controlled hybrid prosthetic hand, with 24 degree of freedom (DOF) anthropomorphic structure is presented. Brushless DC motors along with Shape Memory Alloy (SMA) actuators are used to achieve dexterous functionality. An 8 channel EMG is used for detecting 7 basic hand gestures for control purposes. The prosthetic hand will be integrated with the Neural Network (NNE) based controller in the next phase of the study.

  16. Theoretical Manual for Analysis of Arch Dams

    DTIC Science & Technology

    1993-07-01

    eight nodes lying on the midsurface , half-way between the corresponding surface nodes (Pawsey 1970). Each node on the midsurface has five DOF’s, three...translations in the global directions, and two rotations about two axes perpendicular to the midsurface normal (Figure 5-4). The sixth DOF, associated...Figure 5-3). The coordinates of any point within the element are described in terms of the midsurface coordinates and a vector connecting the two upper

  17. Approaching Free Fall on Two Degrees of Freedom: Simultaneous Measurement of Residual Force and Torque on a Double Torsion Pendulum.

    PubMed

    Bassan, M; Cavalleri, A; De Laurentis, M; De Marchi, F; De Rosa, R; Di Fiore, L; Dolesi, R; Finetti, N; Garufi, F; Grado, A; Hueller, M; Marconi, L; Milano, L; Pucacco, G; Stanga, R; Visco, M; Vitale, S; Weber, W J

    2016-02-05

    A torsion pendulum with 2 soft degrees of freedom (DOFs), realized by off-axis cascading two torsion fibers, has been built and operated. This instrument helps characterize the geodesic motion of a test mass for LISA Pathfinder or any other free-fall space mission, providing information on cross talk and other effects that cannot be detected when monitoring a single DOF. We show that it is possible to simultaneously measure both the residual force and the residual torque acting on a quasifree test mass. As an example of the investigations that a double pendulum allows, we report the measurement of the force-to-torque cross talk, i.e., the amount of actuation signal, produced by applying a force on the suspended test mass, that leaks into the rotational DOF, detected by measuring the corresponding (unwanted) torque.

  18. Nonlinear dynamics and health monitoring of 6-DOF breathing cracked Jeffcott rotor

    NASA Astrophysics Data System (ADS)

    Zhao, Jie; DeSmidt, Hans; Yao, Wei

    2015-04-01

    Jeffcott rotor is employed to study the nonlinear vibration characteristics of breathing cracked rotor system and explore the possibility of further damage identification. This paper is an extension work of prior study based on 4 degree-of-freedom Jeffcott rotor system. With consideration of disk tilting and gyroscopic effect, 6-dof EOM is derived and the crack model is established using SERR (strain energy release rate) in facture mechanics. Same as the prior work, the damaged stiffness matrix is updated by computing the instant crack closure line through Zero Stress Intensity Factor method. The breathing crack area is taken as a variable to analyze the breathing behavior in terms of eccentricity phase and shaft speed. Furthermore, the coupled vibration among lateral, torsional and longitudinal d.o.f is studied under torsional/axial excitation. The final part demonstrates the possibility of using vibration signal of damaged system for the crack diagnosis and health monitoring.

  19. Dynamic test/analysis correlation using reduced analytical models

    NASA Technical Reports Server (NTRS)

    Mcgowan, Paul E.; Angelucci, A. Filippo; Javeed, Mehzad

    1992-01-01

    Test/analysis correlation is an important aspect of the verification of analysis models which are used to predict on-orbit response characteristics of large space structures. This paper presents results of a study using reduced analysis models for performing dynamic test/analysis correlation. The reduced test-analysis model (TAM) has the same number and orientation of DOF as the test measurements. Two reduction methods, static (Guyan) reduction and the Improved Reduced System (IRS) reduction, are applied to the test/analysis correlation of a laboratory truss structure. Simulated test results and modal test data are used to examine the performance of each method. It is shown that selection of DOF to be retained in the TAM is critical when large structural masses are involved. In addition, the use of modal test results may provide difficulties in TAM accuracy even if a large number of DOF are retained in the TAM.

  20. Hyperentanglement concentration for polarization-spatial-time-bin hyperentangled photon systems with linear optics

    NASA Astrophysics Data System (ADS)

    Wang, Hong; Ren, Bao-Cang; Alzahrani, Faris; Hobiny, Aatef; Deng, Fu-Guo

    2017-10-01

    Hyperentanglement has significant applications in quantum information processing. Here we present an efficient hyperentanglement concentration protocol (hyper-ECP) for partially hyperentangled Bell states simultaneously entangled in polarization, spatial-mode and time-bin degrees of freedom (DOFs) with the parameter-splitting method, where the parameters of the partially hyperentangled Bell states are known to the remote parties. In this hyper-ECP, only one remote party is required to perform some local operations on the three DOFs of a photon, only the linear optical elements are considered, and the success probability can achieve the maximal value. Our hyper-ECP can be easily generalized to concentrate the N-photon partially hyperentangled Greenberger-Horne-Zeilinger states with known parameters, where the multiple DOFs have largely improved the channel capacity of long-distance quantum communication. All of these make our hyper-ECP more practical and useful in high-capacity long-distance quantum communication.

  1. Implementation of Kane's Method for a Spacecraft Composed of Multiple Rigid Bodies

    NASA Technical Reports Server (NTRS)

    Stoneking, Eric T.

    2013-01-01

    Equations of motion are derived for a general spacecraft composed of rigid bodies connected via rotary (spherical or gimballed) joints in a tree topology. Several supporting concepts are developed in depth. Basis dyads aid in the transition from basis-free vector equations to component-wise equations. Joint partials allow abstraction of 1-DOF, 2-DOF, 3-DOF gimballed and spherical rotational joints to a common notation. The basic building block consisting of an "inner" body and an "outer" body connected by a joint enables efficient organization of arbitrary tree structures. Kane's equation is recast in a form which facilitates systematic assembly of large systems of equations, and exposes a relationship of Kane's equation to Newton and Euler's equations which is obscured by the usual presentation. The resulting system of dynamic equations is of minimum dimension, and is suitable for numerical solution by computer. Implementation is ·discussed, and illustrative simulation results are presented.

  2. Origami structures with a critical transition to bistability arising from hidden degrees of freedom

    NASA Astrophysics Data System (ADS)

    Silverberg, Jesse L.; Na, Jun-Hee; Evans, Arthur A.; Liu, Bin; Hull, Thomas C.; Santangelo, Christian D.; Lang, Robert J.; Hayward, Ryan C.; Cohen, Itai

    2015-04-01

    Origami is used beyond purely aesthetic pursuits to design responsive and customizable mechanical metamaterials. However, a generalized physical understanding of origami remains elusive, owing to the challenge of determining whether local kinematic constraints are globally compatible and to an incomplete understanding of how the folded sheet’s material properties contribute to the overall mechanical response. Here, we show that the traditional square twist, whose crease pattern has zero degrees of freedom (DOF) and therefore should not be foldable, can nevertheless be folded by accessing bending deformations that are not explicit in the crease pattern. These hidden bending DOF are separated from the crease DOF by an energy gap that gives rise to a geometrically driven critical bifurcation between mono- and bistability. Noting its potential utility for fabricating mechanical switches, we use a temperature-responsive polymer-gel version of the square twist to demonstrate hysteretic folding dynamics at the sub-millimetre scale.

  3. Adaptive DOF for plenoptic cameras

    NASA Astrophysics Data System (ADS)

    Oberdörster, Alexander; Lensch, Hendrik P. A.

    2013-03-01

    Plenoptic cameras promise to provide arbitrary re-focusing through a scene after the capture. In practice, however, the refocusing range is limited by the depth of field (DOF) of the plenoptic camera. For the focused plenoptic camera, this range is given by the range of object distances for which the microimages are in focus. We propose a technique of recording light fields with an adaptive depth of focus. Between multiple exposures { or multiple recordings of the light field { the distance between the microlens array (MLA) and the image sensor is adjusted. The depth and quality of focus is chosen by changing the number of exposures and the spacing of the MLA movements. In contrast to traditional cameras, extending the DOF does not necessarily lead to an all-in-focus image. Instead, the refocus range is extended. There is full creative control about the focus depth; images with shallow or selective focus can be generated.

  4. Operation analysis of a Chebyshev-Pantograph leg mechanism for a single DOF biped robot

    NASA Astrophysics Data System (ADS)

    Liang, Conghui; Ceccarelli, Marco; Takeda, Yukio

    2012-12-01

    In this paper, operation analysis of a Chebyshev-Pantograph leg mechanism is presented for a single degree of freedom (DOF) biped robot. The proposed leg mechanism is composed of a Chebyshev four-bar linkage and a pantograph mechanism. In contrast to general fully actuated anthropomorphic leg mechanisms, the proposed leg mechanism has peculiar features like compactness, low-cost, and easy-operation. Kinematic equations of the proposed leg mechanism are formulated for a computer oriented simulation. Simulation results show the operation performance of the proposed leg mechanism with suitable characteristics. A parametric study has been carried out to evaluate the operation performance as function of design parameters. A prototype of a single DOF biped robot equipped with two proposed leg mechanisms has been built at LARM (Laboratory of Robotics and Mechatronics). Experimental test shows practical feasible walking ability of the prototype, as well as drawbacks are discussed for the mechanical design.

  5. An efficient approach for inverse kinematics and redundancy resolution scheme of hyper-redundant manipulators

    NASA Astrophysics Data System (ADS)

    Chembuly, V. V. M. J. Satish; Voruganti, Hari Kumar

    2018-04-01

    Hyper redundant manipulators have a large number of degrees of freedom (DOF) than the required to perform a given task. Additional DOF of manipulators provide the flexibility to work in highly cluttered environment and in constrained workspaces. Inverse kinematics (IK) of hyper-redundant manipulators is complicated due to large number of DOF and these manipulators have multiple IK solutions. The redundancy gives a choice of selecting best solution out of multiple solutions based on certain criteria such as obstacle avoidance, singularity avoidance, joint limit avoidance and joint torque minimization. This paper focuses on IK solution and redundancy resolution of hyper-redundant manipulator using classical optimization approach. Joint positions are computed by optimizing various criteria for a serial hyper redundant manipulators while traversing different paths in the workspace. Several cases are addressed using this scheme to obtain the inverse kinematic solution while optimizing the criteria like obstacle avoidance, joint limit avoidance.

  6. Selection of noisy measurement locations for error reduction in static parameter identification

    NASA Astrophysics Data System (ADS)

    Sanayei, Masoud; Onipede, Oladipo; Babu, Suresh R.

    1992-09-01

    An incomplete set of noisy static force and displacement measurements is used for parameter identification of structures at the element level. Measurement location and the level of accuracy in the measured data can drastically affect the accuracy of the identified parameters. A heuristic method is presented to select a limited number of degrees of freedom (DOF) to perform a successful parameter identification and to reduce the impact of measurement errors on the identified parameters. This pretest simulation uses an error sensitivity analysis to determine the effect of measurement errors on the parameter estimates. The selected DOF can be used for nondestructive testing and health monitoring of structures. Two numerical examples, one for a truss and one for a frame, are presented to demonstrate that using the measurements at the selected subset of DOF can limit the error in the parameter estimates.

  7. Exploring the Free Energy Landscape of Solutes Embedded in Lipid Bilayers.

    PubMed

    Jämbeck, Joakim P M; Lyubartsev, Alexander P

    2013-06-06

    Free energy calculations are vital for our understanding of biological processes on an atomistic scale and can offer insight to various mechanisms. However, in some cases, degrees of freedom (DOFs) orthogonal to the reaction coordinate have high energy barriers and/or long equilibration times, which prohibit proper sampling. Here we identify these orthogonal DOFs when studying the transfer of a solute from water to a model membrane. Important DOFs are identified in bulk liquids of different dielectric nature with metadynamics simulations and are used as reaction coordinates for the translocation process, resulting in two- and three-dimensional space of reaction coordinates. The results are in good agreement with experiments and elucidate the pitfalls of using one-dimensional reaction coordinates. The calculations performed here offer the most detailed free energy landscape of solutes embedded in lipid bilayers to date and show that free energy calculations can be used to study complex membrane translocation phenomena.

  8. Mathematical model and stability analysis of fluttering and autorotation of an articulated plate into a flow

    NASA Astrophysics Data System (ADS)

    Rostami, Ali Bakhshandeh; Fernandes, Antonio Carlos

    2018-03-01

    This paper is dedicated to develop a mathematical model that can simulate nonlinear phenomena of a hinged plate which places into the fluid flow (1 DOF). These phenomena are fluttering (oscillation motion), autorotation (continuous rotation) and chaotic motion (combination of fluttering and autorotation). Two mathematical models are developed for 1 DOF problem using two eminent mathematical models which had been proposed for falling plates (3 DOF). The procedures of developing these models are elaborated and then these results are compared to experimental data. The best model in the simulation of the phenomena is chosen for stability and bifurcation analysis. Based on these analyses, this model shows a transcritical bifurcation and as a result, the stability diagram and threshold are presented. Moreover, an analytical expression is given for finding the boundary of bifurcation from the fluttering to the autorotation.

  9. Six Parallel Policy Changes in Higher Education in California and the Soviet Union in the 1980's.

    ERIC Educational Resources Information Center

    Heckman, Dale M.

    This paper discusses the fact that, in the same decade and despite obvious differences, two separate and distinctive systems of higher education (those of California and the Soviet Union) have been urged by their respective policy making bodies, to make major changes in at least six parallel ways; the paper investigates reasons for this timing and…

  10. Mid-Lift-to-Drag Ratio Rigid Vehicle Control System Design and Simulation for Human Mars Entry

    NASA Technical Reports Server (NTRS)

    Johnson, Breanna J.; Cerimele, Christopher J.; Stachowiak, Susan J.; Sostaric, Ronald R.; Matz, Daniel A.; Lu, Ping

    2018-01-01

    The Mid-Lift-to-Drag Ratio Rigid Vehicle (MRV) is a proposed candidate in the NASA Evolvable Mars Campaign's (EMC) Pathfinder Entry, Descent, and Landing (EDL) architecture study. The purpose of the study is to design a mission and vehicle capable of transporting a 20mt payload to the surface of Mars. The MRV is unique in its rigid, asymmetrical lifting-body shape which enables a higher lift-to-drag ratio (L/D) than the typical robotic Mars entry capsule vehicles that carry much less mass. This paper presents the formulation and six-degree-of-freedom (6DOF) performance of the MRV's control system, which uses both aerosurfaces and a propulsive reaction control system (RCS) to affect longitudinal and lateral directional behavior.

  11. Evaluation of a six-DOF electrodynamic shaker system.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gregory, Danny Lynn; Smallwood, David Ora

    2009-03-01

    The paper describes the preliminary evaluation of a 6 degree of freedom electrodynamic shaker system. The 8 by 8 inch (20.3 cm) table is driven by 12 electrodynamic shakers producing motion in all 6 rigid body modes. A small electrodynamic shaker system suitable for small component testing is described. The principal purpose of the system is to demonstrate the technology. The shaker is driven by 12 electrodynamic shakers each with a force capability of about 50 lbs (220 N). The system was developed through an informal cooperative agreement between Sandia National Laboratories, Team Corp. and Spectral Dynamics Corporation. Sandia providedmore » the laboratory space and some development funds. Team provided the mechanical system, and Spectral Dynamics provided the control system. Spectral Dynamics was chosen to provide the control system partly because of their experience in MIMO control and partly because Sandia already had part of the system in house. The shaker system was conceived and manufactured by TEAM Corp. Figure 1 shows the overall system. The vibration table, electrodynamic shakers, hydraulic pumps, and amplifiers are all housed in a single cabinet. Figure 2 is a drawing showing how the electrodynamic shakers are coupled to the table. The shakers are coupled to the table through a hydraulic spherical pad bearing providing 5 degrees of freedom and one stiff degree of freedom. The pad bearing must be preloaded with a static force as they are unable to provide any tension forces. The horizontal bearings are preloaded with steel springs. The drawing shows a spring providing the vertical preload. This was changed in the final design. The vertical preload is provided by multiple strands of an O-ring material as shown in Figure 4. Four shakers provide excitation in each of the three orthogonal axes. The specifications of the shaker are outlined in Table 1. Four shakers provide inputs in each of the three orthogonal directions. By choosing the phase relationships between the shakers all six rigid body modes (three translation, and three rotations) can be excited. The system is over determined. There are more shakers than degrees of freedom. This provided an interesting control problem. The problem was approached using the input-output transformation matrices provided in the Spectral control system. Twelve accelerometers were selected for the control accelerometers (a tri-axial accelerometer at each corner of the table (see Figure 5). Figure 6 shows the nomenclature used to identify the shakers and control accelerometers. A fifth tri-axial accelerometer was placed at the center of the table, but it was not used for control. Thus we had 12 control accelerometers and 12 shakers to control a 6-dof shaker. The 12 control channels were reduced to a 6-dof control using a simple input transformation matrix. The control was defined by a 6x6 spectral density matrix. The six outputs in the control variable coordinates were transformed to twelve physical drive signals using another simple output transformation matrix. It was assumed that the accelerometers and shakers were well matched such that the transformation matrices were independent of frequency and could be deduced from rigid body considerations. The input/output transformations are shown in Equations 1 and 2.« less

  12. Improved single- and multi-contact life-time testing of dental restorative materials using key characteristics of the human masticatory system and a force/position-controlled robotic dental wear simulator.

    PubMed

    Raabe, D; Harrison, A; Ireland, A; Alemzadeh, K; Sandy, J; Dogramadzi, S; Melhuish, C; Burgess, S

    2012-03-01

    This paper presents a new in vitro wear simulator based on spatial parallel kinematics and a biologically inspired implicit force/position hybrid controller to replicate chewing movements and dental wear formations on dental components, such as crowns, bridges or a full set of teeth. The human mandible, guided by passive structures such as posterior teeth and the two temporomandibular joints, moves with up to 6 degrees of freedom (DOF) in Cartesian space. The currently available wear simulators lack the ability to perform these chewing movements. In many cases, their lack of sufficient DOF enables them only to replicate the sliding motion of a single occlusal contact point by neglecting rotational movements and the motion along one Cartesian axis. The motion and forces of more than one occlusal contact points cannot accurately be replicated by these instruments. Furthermore, the majority of wear simulators are unable to control simultaneously the main wear-affecting parameters, considering abrasive mechanical wear, which are the occlusal sliding motion and bite forces in the constraint contact phase of the human chewing cycle. It has been shown that such discrepancies between the true in vivo and the simulated in vitro condition influence the outcome and the quality of wear studies. This can be improved by implementing biological features of the human masticatory system such as tooth compliance realized through the passive action of the periodontal ligament and active bite force control realized though the central nervous system using feedback from periodontal preceptors. The simulator described in this paper can be used for single- and multi-occlusal contact testing due to its kinematics and ability to exactly replicate human translational and rotational mandibular movements with up to 6 DOF without neglecting movements along or around the three Cartesian axes. Recorded human mandibular motion and occlusal force data are the reference inputs of the simulator. Experimental studies of wear using this simulator demonstrate that integrating the biological feature of combined force/position hybrid control in dental material testing improves the linearity and reduces the variability of results. In addition, it has been shown that present biaxially operated dental wear simulators are likely to provide misleading results in comparative in vitro/in vivo one-contact studies due to neglecting the occlusal sliding motion in one plane which could introduce an error of up to 49% since occlusal sliding motion D and volumetric wear loss V(loss) are proportional.

  13. Development of a 6DOF robotic motion phantom for radiation therapy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Belcher, Andrew H.; Liu, Xinmin; Grelewicz, Zachary

    Purpose: The use of medical technology capable of tracking patient motion or positioning patients along 6 degree-of-freedom (6DOF) has steadily increased in the field of radiation therapy. However, due to the complex nature of tracking and performing 6DOF motion, it is critical that such technology is properly verified to be operating within specifications in order to ensure patient safety. In this study, a robotic motion phantom is presented that can be programmed to perform highly accurate motion along any X (left–right), Y (superior–inferior), Z (anterior–posterior), pitch (around X), roll (around Y), and yaw (around Z) axes. In addition, highly synchronizedmore » motion along all axes can be performed in order to simulate the dynamic motion of a tumor in 6D. The accuracy and reproducibility of this 6D motion were characterized. Methods: An in-house designed and built 6D robotic motion phantom was constructed following the Stewart–Gough parallel kinematics platform archetype. The device was controlled using an inverse kinematics formulation, and precise movements in all 6 degrees-of-freedom (X, Y, Z, pitch, roll, and yaw) were performed, both simultaneously and separately for each degree-of-freedom. Additionally, previously recorded 6D cranial and prostate motions were effectively executed. The robotic phantom movements were verified using a 15 fps 6D infrared marker tracking system and the measured trajectories were compared quantitatively to the intended input trajectories. The workspace, maximum 6D velocity, backlash, and weight load capabilities of the system were also established. Results: Evaluation of the 6D platform demonstrated translational root mean square error (RMSE) values of 0.14, 0.22, and 0.08 mm over 20 mm in X and Y and 10 mm in Z, respectively, and rotational RMSE values of 0.16°, 0.06°, and 0.08° over 10° of pitch, roll, and yaw, respectively. The robotic stage also effectively performed controlled 6D motions, as well as reproduced cranial trajectories over 15 min, with a maximal RMSE of 0.04 mm translationally and 0.04° rotationally, and a prostate trajectory over 2 min, with a maximal RMSE of 0.06 mm translationally and 0.04° rotationally. Conclusions: This 6D robotic phantom has proven to be accurate under clinical standards and capable of reproducing tumor motion in 6D. Such functionality makes the robotic phantom usable for either quality assurance or research purposes.« less

  14. Ground and flight test results of a total main rotor isolation system

    NASA Technical Reports Server (NTRS)

    Halwes, Dennis R.

    1987-01-01

    A six degree-of-freedom (DOF) isolation system using six LIVE units has been installed under an Army/NASA contract on a Bell 206LM helicopter. This system has been named the Total Rotor Isolation System, or TRIS. To determine the effectiveness of TRIS in reducing helicopter vibration, a flight verification study was conducted at Bell's Flight Research Center in Arlington, Texas. The flight test data indicate that the 4/rev vibration level at the pilot's seat were suppressed below the 0.04g level throughout the transition envelope. Flight tests indicate over 95% suppression of vibration level from the rotor hub to the pilot's seat. The TRIS installation was designed with a decoupled control system and has shown a significant improvement in aircraft flying qualities, such that it permitted the trimmed aircraft to be flown hands-off for a significant period of time, over 90 seconds. The TRIS flight test program has demonstrated a system that greatly reduces vibration levels of a current-generation helicopter, while significantly improving the flying qualities to a point where stability augmentation is no longer a requirement.

  15. Controller Requirements for Uncoupled Aircraft Motion. Volume 2.

    DTIC Science & Technology

    1984-09-01

    allow efficient irplementation of the 6-DOF control capability. Thr effort was divided Into two phases. Phase I consisted of def~nInR exi.ting data on...implementation of the 6-DOF control capability. The effort was divided into two phases. Phase I consisted of defining existing data on the design of cockpit...Vehicles. The propose-] criteria are described in Volume I of this report. S The effort was divided into two phases. Phase I consisted of defining

  16. SPACESUIT DONNING AND DOFFING - ZERO-G TRAINING - DON PETERSON - STS-6

    NASA Image and Video Library

    1982-07-14

    Spacesuit Donning and Doffing in Zero-G Training for Don Peterson of the STS-6 Crew with Astronaut Jerry Ross assisting; and, apparatus for testing the JSC Mechanically-Induced Settling Technology (MIST) Experiment. The training is being held aboard the KC-135 to simulate weightlessness. He is being assisted to don the lower torso of the Extravehicular Mobility Unit (EMU) by an ILC Technician. 1. ASTRONAUT ROSS, JERRY L. - ZERO-G SUITING 2. SHUTTLE - EXPERIMENTS (MIST)

  17. Workflow Optimization for Tuning Prostheses with High Input Channel

    DTIC Science & Technology

    2017-10-01

    of Specific Aim 1 by driving a commercially available two DoF wrist and single DoF hand. The high -level control system will provide analog signals...AWARD NUMBER: W81XWH-16-1-0767 TITLE: Workflow Optimization for Tuning Prostheses with High Input Channel PRINCIPAL INVESTIGATOR: Daniel Merrill...Unlimited The views, opinions and/or findings contained in this report are those of the author(s) and should not be construed as an official Department

  18. NASA MSFC hardware in the loop simulations of automatic rendezvous and capture systems

    NASA Technical Reports Server (NTRS)

    Tobbe, Patrick A.; Naumann, Charles B.; Sutton, William; Bryan, Thomas C.

    1991-01-01

    Two complementary hardware-in-the-loop simulation facilities for automatic rendezvous and capture systems at MSFC are described. One, the Flight Robotics Laboratory, uses an 8 DOF overhead manipulator with a work volume of 160 by 40 by 23 feet to evaluate automatic rendezvous algorithms and range/rate sensing systems. The other, the Space Station/Station Operations Mechanism Test Bed, uses a 6 DOF hydraulic table to perform docking and berthing dynamics simulations.

  19. Design and Realization of a Three Degrees of Freedom Displacement Measurement System Composed of Hall Sensors Based on Magnetic Field Fitting by an Elliptic Function

    PubMed Central

    Zhao, Bo; Wang, Lei; Tan, Jiu-Bin

    2015-01-01

    This paper presents the design and realization of a three degrees of freedom (DOFs) displacement measurement system composed of Hall sensors, which is built for the XYθz displacement measurement of the short stroke stage of the reticle stage of lithography. The measurement system consists of three pairs of permanent magnets mounted on the same plane on the short stroke stage along the Y, Y, X directions, and three single axis Hall sensors correspondingly mounted on the frame of the reticle stage. The emphasis is placed on the decoupling and magnetic field fitting of the three DOFs measurement system. The model of the measurement system is illustrated, and the XY positions and θZ rotation of the short stroke stage can be obtained by decoupling the sensor outputs. A magnetic field fitting by an elliptic function-based compensation method is proposed. The practical field intensity of a permanent magnet at a certain plane height can be substituted for the output voltage of a Hall sensors, which can be expressed by the elliptic function through experimental data as the crucial issue to calculate the three DOFs displacement. Experimental results of the Hall sensor displacement measurement system are presented to validate the proposed three DOFs measurement system. PMID:26370993

  20. An algebraic multigrid method for Q2-Q1 mixed discretizations of the Navier-Stokes equations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Prokopenko, Andrey; Tuminaro, Raymond S.

    Algebraic multigrid (AMG) preconditioners are considered for discretized systems of partial differential equations (PDEs) where unknowns associated with different physical quantities are not necessarily co-located at mesh points. Speci cally, we investigate a Q 2-Q 1 mixed finite element discretization of the incompressible Navier-Stokes equations where the number of velocity nodes is much greater than the number of pressure nodes. Consequently, some velocity degrees-of-freedom (dofs) are defined at spatial locations where there are no corresponding pressure dofs. Thus, AMG approaches lever- aging this co-located structure are not applicable. This paper instead proposes an automatic AMG coarsening that mimics certain pressure/velocitymore » dof relationships of the Q 2-Q 1 discretization. The main idea is to first automatically define coarse pressures in a somewhat standard AMG fashion and then to carefully (but automatically) choose coarse velocity unknowns so that the spatial location relationship between pressure and velocity dofs resembles that on the nest grid. To define coefficients within the inter-grid transfers, an energy minimization AMG (EMIN-AMG) is utilized. EMIN-AMG is not tied to specific coarsening schemes and grid transfer sparsity patterns, and so it is applicable to the proposed coarsening. Numerical results highlighting solver performance are given on Stokes and incompressible Navier-Stokes problems.« less

  1. Force sensing micro-forceps with integrated fiber Bragg grating for vitreoretinal surgery

    NASA Astrophysics Data System (ADS)

    He, Xingchi; Balicki, Marcin A.; Kang, Jin U.; Gehlbach, Peter L.; Handa, James T.; Taylor, Russell H.; Iordachita, Iulian I.

    2012-01-01

    Vitreoretinal surgery is a technically demanding ophthalmologic discipline. One of the main technical challenges in vitreoretinal surgery is the lack of force sensing since the surgical maneuvers fall below the human sensory threshold. Previously, a 2-degree-of-freedom (DOF) force sensing instrument with a surgical pick was developed and tested. However, a more commonly used instrument for vitreoretinal surgery is the forceps, with which a surgeon can easily grasp and delaminate the scar tissue. We have designed, fabricated and calibrated a novel 20-gauge (Ga) microsurgical instrument with a 2-DOF force sensing forceps. Three fiber Bragg grating (FBG) sensors are integrated into the customized AlconTM forceps tip. The redundant sensor configuration provides good compensation for temperature-related drift. The calibration data show that the tool can provide a force resolution of 0.25 mN. In order to test the functionality and performance, the forceps was evaluated in inner shell membrane peeling experiments with chicken embryos as well as in in-vivo rabbit experiments. The instrument has demonstrated the capability of being applied in the clinical environment, with consistent force measurements. The force exerted in inner shell membrane peeling is from 6.07 to 34.65 mN. The development of the 2-DOF force sensing micro-forceps has shown that the fabrication process is feasible and reliable, and it can be used to develop a future 3-DOF force sensing tool.

  2. A Novel Noncircular MUSIC Algorithm Based on the Concept of the Difference and Sum Coarray.

    PubMed

    Chen, Zhenhong; Ding, Yingtao; Ren, Shiwei; Chen, Zhiming

    2018-01-25

    In this paper, we propose a vectorized noncircular MUSIC (VNCM) algorithm based on the concept of the coarray, which can construct the difference and sum (diff-sum) coarray, for direction finding of the noncircular (NC) quasi-stationary sources. Utilizing both the NC property and the concept of the Khatri-Rao product, the proposed method can be applied to not only the ULA but also sparse arrays. In addition, we utilize the quasi-stationary characteristic instead of the spatial smoothing method to solve the coherent issue generated by the Khatri-Rao product operation so that the available degree of freedom (DOF) of the constructed virtual array will not be reduced by half. Compared with the traditional NC virtual array obtained in the NC MUSIC method, the diff-sum coarray achieves a higher number of DOFs as it comprises both the difference set and the sum set. Due to the complementarity between the difference set and the sum set for the coprime array, we choose the coprime array with multiperiod subarrays (CAMpS) as the array model and summarize the properties of the corresponding diff-sum coarray. Furthermore, we develop a diff-sum coprime array with multiperiod subarrays (DsCAMpS) whose diff-sum coarray has a higher DOF. Simulation results validate the effectiveness of the proposed method and the high DOF of the diff-sum coarray.

  3. Design of a Lightweight Soft Robotic Arm Using Pneumatic Artificial Muscles and Inflatable Sleeves.

    PubMed

    Ohta, Preston; Valle, Luis; King, Jonathan; Low, Kevin; Yi, Jaehyun; Atkeson, Christopher G; Park, Yong-Lae

    2018-04-01

    As robots begin to interact with humans and operate in human environments, safety becomes a major concern. Conventional robots, although reliable and consistent, can cause injury to anyone within its range of motion. Soft robotics, wherein systems are made to be soft and mechanically compliant, are thus a promising alternative due to their lightweight nature and ability to cushion impacts, but current designs often sacrifice accuracy and usefulness for safety. We, therefore, have developed a bioinspired robotic arm combining elements of rigid and soft robotics such that it exhibits the positive qualities of both, namely compliance and accuracy, while maintaining a low weight. This article describes the design of a robotic arm-wrist-hand system with seven degrees of freedom (DOFs). The shoulder and elbow each has two DOFs for two perpendicular rotational motions on each joint, and the hand has two DOFs for wrist rotations and one DOF for a grasp motion. The arm is pneumatically powered using custom-built McKibben type pneumatic artificial muscles, which are inflated and deflated using binary and proportional valves. The wrist and hand motions are actuated through servomotors. In addition to the actuators, the arm is equipped with a potentiometer in each joint for detecting joint angle changes. Simulation and experimental results for closed-loop position control are also presented in the article.

  4. A Novel Noncircular MUSIC Algorithm Based on the Concept of the Difference and Sum Coarray

    PubMed Central

    Chen, Zhenhong; Ding, Yingtao; Chen, Zhiming

    2018-01-01

    In this paper, we propose a vectorized noncircular MUSIC (VNCM) algorithm based on the concept of the coarray, which can construct the difference and sum (diff–sum) coarray, for direction finding of the noncircular (NC) quasi-stationary sources. Utilizing both the NC property and the concept of the Khatri–Rao product, the proposed method can be applied to not only the ULA but also sparse arrays. In addition, we utilize the quasi-stationary characteristic instead of the spatial smoothing method to solve the coherent issue generated by the Khatri–Rao product operation so that the available degree of freedom (DOF) of the constructed virtual array will not be reduced by half. Compared with the traditional NC virtual array obtained in the NC MUSIC method, the diff–sum coarray achieves a higher number of DOFs as it comprises both the difference set and the sum set. Due to the complementarity between the difference set and the sum set for the coprime array, we choose the coprime array with multiperiod subarrays (CAMpS) as the array model and summarize the properties of the corresponding diff–sum coarray. Furthermore, we develop a diff–sum coprime array with multiperiod subarrays (DsCAMpS) whose diff–sum coarray has a higher DOF. Simulation results validate the effectiveness of the proposed method and the high DOF of the diff–sum coarray. PMID:29370138

  5. Design and development an insect-inspired humanoid gripper that is structurally sound, yet very flexible

    NASA Astrophysics Data System (ADS)

    Hajjaj, S.; Pun, N.

    2013-06-01

    One of the biggest challenges in mechanical robotics design is the balance between structural integrity and flexibility. An industrial robotic gripper could be technically advanced, however it contains only 1 Degree of Freedom (DOF). If one is to add more DOFs the design would become complex. On the other hand, the human wrist and fingers contain 23 DOFs, and is very lightweight and highly flexible. Robotics are becoming more and more part of our social life, they are more and more being incorporated in social, medical, and personal application. Therefore, for such robots to be effective, they need to mimic human performance, both in performance as well as in mechanical design. In this work, a Humanoid Gripper is designed and built to mimic a simplified version of a human wrist and fingers. This is attempted by mimicking insect and human designs of grippes. The main challenge was to insure that the gripper is structurally sound, but at the same time flexible and lightweight. A combination of light weight material and a unique design of finger actuators were applied. The gripper is controlled by a PARALLAX servo controller 28823 (PSCI), which mounted on the assembly itself. At the end, a 6 DOF humanoid gripper made of lightweight material, similar in size to the human arm, and is able to carry a weight of 1 Kg has been designed and built.

  6. Effects of uniformities of deposition of respirable particles on filters on determining their quartz contents by using the direct on-filter X-ray diffraction (DOF XRD) method.

    PubMed

    Chen, Ching-Hwa; Tsaia, Perng-Jy; Lai, Chane-Yu; Peng, Ya-Lian; Soo, Jhy-Charm; Chen, Cheng-Yao; Shih, Tung-Sheng

    2010-04-15

    In this study, field samplings were conducted in three workplaces of a foundry plant, including the molding, demolding, and bead blasting, respectively. Three respirable aerosol samplers (including a 25-mm aluminum cyclone, nylon cyclone, and IOSH cyclone) were used side-by-side to collect samples from each selected workplace. For each collected sample, the uniformity of the deposition of respirable dusts on the filter was measured and its free silica content was determined by both the DOF XRD method and NIOSH 7500 XRD method (i.e., the reference method). A same trend in measured uniformities can be found in all selected workplaces: 25-mm aluminum cyclone>nylon cyclone>IOSH cyclone. Even for samples collected by the sampler with the highest uniformity (i.e., 25-mm aluminum cyclone), the use of the DOF XRD method would lead to the measured free silica concentrations 1.15-2.89 times in magnitude higher than that of the reference method. A new filter holder should be developed with the minimum uniformity comparable to that of NIOSH 7500 XRD method (=0.78) in the future. The use of conversion factors for correcting quartz concentrations obtained from the DOF XRD method based on the measured uniformities could be suitable for the foundry industry at this stage. 2009 Elsevier B.V. All rights reserved.

  7. Finite element structural redesign by large admissible perturbations

    NASA Technical Reports Server (NTRS)

    Bernitsas, Michael M.; Beyko, E.; Rim, C. W.; Alzahabi, B.

    1991-01-01

    In structural redesign, two structural states are involved; the baseline (known) State S1 with unacceptable performance, and the objective (unknown) State S2 with given performance specifications. The difference between the two states in performance and design variables may be as high as 100 percent or more depending on the scale of the structure. A Perturbation Approach to Redesign (PAR) is presented to relate any two structural states S1 and S2 that are modeled by the same finite element model and represented by different values of the design variables. General perturbation equations are derived expressing implicitly the natural frequencies, dynamic modes, static deflections, static stresses, Euler buckling loads, and buckling modes of the objective S2 in terms of its performance specifications, and S1 data and Finite Element Analysis (FEA) results. Large Admissible Perturbation (LEAP) algorithms are implemented in code RESTRUCT to define the objective S2 incrementally without trial and error by postprocessing FEA results of S1 with no additional FEAs. Systematic numerical applications in redesign of a 10 element 48 degree of freedom (dof) beam, a 104 element 192 dof offshore tower, a 64 element 216 dof plate, and a 144 element 896 dof cylindrical shell show the accuracy, efficiency, and potential of PAR to find an objective state that may differ 100 percent from the baseline design.

  8. A coaxially focused multi-mode beam for optical coherence tomography imaging with extended depth of focus (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Yin, Biwei; Liang, Chia-Pin; Vuong, Barry; Tearney, Guillermo J.

    2017-02-01

    Conventional OCT images, obtained using a focused Gaussian beam have a lateral resolution of approximately 30 μm and a depth of focus (DOF) of 2-3 mm, defined as the confocal parameter (twice of Gaussian beam Rayleigh range). Improvement of lateral resolution without sacrificing imaging range requires techniques that can extend the DOF. Previously, we described a self-imaging wavefront division optical system that provided an estimated one order of magnitude DOF extension. In this study, we further investigate the properties of the coaxially focused multi-mode (CAFM) beam created by this self-imaging wavefront division optical system and demonstrate its feasibility for real-time biological tissue imaging. Gaussian beam and CAFM beam fiber optic probes with similar numerical apertures (objective NA≈0.5) were fabricated, providing lateral resolutions of approximately 2 μm. Rigorous lateral resolution characterization over depth was performed for both probes. The CAFM beam probe was found to be able to provide a DOF that was approximately one order of magnitude greater than that of Gaussian beam probe. By incorporating the CAFM beam fiber optic probe into a μOCT system with 1.5 μm axial resolution, we were able to acquire cross-sectional images of swine small intestine ex vivo, enabling the visualization of subcellular structures, providing high quality OCT images over more than a 300 μm depth range.

  9. A new continuous sliding mode control approach with actuator saturation for control of 2-DOF helicopter system.

    PubMed

    Sadala, S P; Patre, B M

    2018-03-01

    The 2-degree of freedom (DOF) helicopter system is a typical higher-order, multi-variable, nonlinear and strong coupled control system. The helicopter dynamics also includes parametric uncertainties and is subject to unknown external disturbances. Such complicated system requires designing a sophisticated control algorithm that can handle these difficulties. This paper presents a new robust control algorithm which is a combination of two continuous control techniques, composite nonlinear feedback (CNF) and super-twisting control (STC) methods. In the existing integral sliding mode (ISM) based CNF control law, the discontinuous term exhibits chattering which is not desirable for many practical applications. As the continuity of well known STC reduces chattering in the system, the proposed strategy is beneficial over the current ISM based CNF control law which has a discontinuous term. Two controllers with integral sliding surface are designed to control the position of the pitch and the yaw angles of the 2- DOF helicopter. The adequacy of this specific combination has been exhibited through general analysis, simulation and experimental results of 2-DOF helicopter setup. The acquired results demonstrate the good execution of the proposed controller regarding stabilization, following reference input without overshoot against actuator saturation and robustness concerning to the limited matched disturbances. Copyright © 2018 ISA. Published by Elsevier Ltd. All rights reserved.

  10. All-fiber probe for optical coherence tomography with an extended depth of focus by a high-efficient fiber-based filter

    NASA Astrophysics Data System (ADS)

    Qiu, Jianrong; Shen, Yi; Shangguan, Ziwei; Bao, Wen; Yang, Shanshan; Li, Peng; Ding, Zhihua

    2018-04-01

    Although methods have been proposed to maintain high transverse resolution over an increased depth range, it is not straightforward to scale down the bulk-optic solutions to minimized probes of optical coherence tomography (OCT). In this paper, we propose a high-efficient fiber-based filter in an all-fiber OCT probe to realize an extended depth of focus (DOF) while maintaining a high transverse resolution. Mode interference in the probe is exploited to modulate the complex field with controllable radial distribution. The principle of DOF extension by the fiber-based filter is theoretically analyzed. Numerical simulations are conducted to evaluate the performances of the designed probes. A DOF extension ratio of 2.6 over conventional Gaussian beam is obtainable in one proposed probe under a focused beam diameter of 4 . 6 μm. Coupling efficiencies of internal interfaces of the proposed probe are below -40 dB except the last probe-air interface, which can also be depressed to be -44 dB after minor modification in lengths for the filter. Length tolerance of the proposed probe is determined to be - 28 / + 20 μm, which is readily satisfied in fabrication. With the merits of extended-DOF, high-resolution, high-efficiency and easy-fabrication, the proposed probe is promising in endoscopic applications.

  11. A realistic bi-hemispheric model of the cerebellum uncovers the purpose of the abundant granule cells during motor control.

    PubMed

    Pinzon-Morales, Ruben-Dario; Hirata, Yutaka

    2015-01-01

    The cerebellar granule cells (GCs) have been proposed to perform lossless, adaptive spatio-temporal coding of incoming sensory/motor information required by downstream cerebellar circuits to support motor learning, motor coordination, and cognition. Here we use a physio-anatomically inspired bi-hemispheric cerebellar neuronal network (biCNN) to selectively enable/disable the output of GCs and evaluate the behavioral and neural consequences during three different control scenarios. The control scenarios are a simple direct current motor (1 degree of freedom: DOF), an unstable two-wheel balancing robot (2 DOFs), and a simulation model of a quadcopter (6 DOFs). Results showed that adequate control was maintained with a relatively small number of GCs (< 200) in all the control scenarios. However, the minimum number of GCs required to successfully govern each control plant increased with their complexity (i.e., DOFs). It was also shown that increasing the number of GCs resulted in higher robustness against changes in the initialization parameters of the biCNN model (i.e., synaptic connections and synaptic weights). Therefore, we suggest that the abundant GCs in the cerebellar cortex provide the computational power during the large repertoire of motor activities and motor plants the cerebellum is involved with, and bring robustness against changes in the cerebellar microcircuit (e.g., neuronal connections).

  12. An algebraic multigrid method for Q2-Q1 mixed discretizations of the Navier-Stokes equations

    DOE PAGES

    Prokopenko, Andrey; Tuminaro, Raymond S.

    2016-07-01

    Algebraic multigrid (AMG) preconditioners are considered for discretized systems of partial differential equations (PDEs) where unknowns associated with different physical quantities are not necessarily co-located at mesh points. Speci cally, we investigate a Q 2-Q 1 mixed finite element discretization of the incompressible Navier-Stokes equations where the number of velocity nodes is much greater than the number of pressure nodes. Consequently, some velocity degrees-of-freedom (dofs) are defined at spatial locations where there are no corresponding pressure dofs. Thus, AMG approaches lever- aging this co-located structure are not applicable. This paper instead proposes an automatic AMG coarsening that mimics certain pressure/velocitymore » dof relationships of the Q 2-Q 1 discretization. The main idea is to first automatically define coarse pressures in a somewhat standard AMG fashion and then to carefully (but automatically) choose coarse velocity unknowns so that the spatial location relationship between pressure and velocity dofs resembles that on the nest grid. To define coefficients within the inter-grid transfers, an energy minimization AMG (EMIN-AMG) is utilized. EMIN-AMG is not tied to specific coarsening schemes and grid transfer sparsity patterns, and so it is applicable to the proposed coarsening. Numerical results highlighting solver performance are given on Stokes and incompressible Navier-Stokes problems.« less

  13. The Dosimetric Importance of Six Degree of Freedom Couch End to End Quality Assurance for SRS/SBRT Treatments when Comparing Intensity Modulated Radiation Therapy to Volumetric Modulated Arc Therapy

    NASA Astrophysics Data System (ADS)

    Ulizio, Vincent Michael

    With the advancement of technology there is an increasing ability for lesions to be treated with higher radiation doses each fraction. This also allows for low fractionated treatments. Because the patient is receiving a higher dose of radiation per fraction and because of the fast dose falloff in these targets there must be extreme accuracy in the delivery. The 6 DOF couch allows for extra rotational corrections and for a more accurate set-up. The movement of the couch needs to be verified to be accurate and because of this, end to end quality assurance tests for the couch have been made. After the set-up is known to be accurate then different treatment techniques can be studied. SBRT of the Spine has a very fast dose falloff near the spinal cord and was typically treated with IMRT. Treatment plans generated using this technique tend to have streaks of low dose radiation, so VMAT is being studied to determine if this treatment technique can reduce the low dose radiation volume as well as improve OAR sparing. For the 6 DOF couch QA, graph paper is placed on the anterior and right lateral sides of the VisionRT OSMS Cube Phantom. Each rotational shift is then applied individually, with a 3 degree shift in the positive and negative directions for pitch and roll. A mark is drawn on the paper to record each shift. A CBCT is then taken of the Cube and known shifts are applied and then an additional CBCT is taken to return the Cube to isocenter. The original IMRT plans for SBRT of the Spine are evaluated and then a plan is made utilizing VMAT. These plans are then compared for low dose radiation, OAR sparing, and conformity. If the original IMRT plan is determined to be an inferior treatment to what is acceptable, then this will be re-planned and compared to the VMAT plan. The 6 DOF couch QA tests have proven to be accurate and reproducible. The average deviations in the 3 degree and -3 degree pitch and roll directions were 0.197, 0.068, 0.091, and 0.110 degrees, respectively. The average CBCT shift errors all came out less than 0.05 cm in translational directions and less than 0.05 degrees in all rotational directions. The VMAT plans had similar OAR sparing, target coverage, and conformity. In all cases the 50% isodose volume was lower for the VMAT plans. All of the tests for the 6 DOF couch are accurate and good to use in our monthly tests. VMAT has shown to be better than IMRT for Spine SBRT and should be used in all cases, when treating the Spine.

  14. Robust distributed control of spacecraft formation flying with adaptive network topology

    NASA Astrophysics Data System (ADS)

    Shasti, Behrouz; Alasty, Aria; Assadian, Nima

    2017-07-01

    In this study, the distributed six degree-of-freedom (6-DOF) coordinated control of spacecraft formation flying in low earth orbit (LEO) has been investigated. For this purpose, an accurate coupled translational and attitude relative dynamics model of the spacecraft with respect to the reference orbit (virtual leader) is presented by considering the most effective perturbation acceleration forces on LEO satellites, i.e. the second zonal harmonic and the atmospheric drag. Subsequently, the 6-DOF coordinated control of spacecraft in formation is studied. During the mission, the spacecraft communicate with each other through a switching network topology in which the weights of its graph Laplacian matrix change adaptively based on a distance-based connectivity function between neighboring agents. Because some of the dynamical system parameters such as spacecraft masses and moments of inertia may vary with time, an adaptive law is developed to estimate the parameter values during the mission. Furthermore, for the case that there is no knowledge of the unknown and time-varying parameters of the system, a robust controller has been developed. It is proved that the stability of the closed-loop system coupled with adaptation in network topology structure and optimality and robustness in control is guaranteed by the robust contraction analysis as an incremental stability method for multiple synchronized systems. The simulation results show the effectiveness of each control method in the presence of uncertainties and parameter variations. The adaptive and robust controllers show their superiority in reducing the state error integral as well as decreasing the control effort and settling time.

  15. Validation of a Custom Instrumented Retainer Form Factor for Measuring Linear and Angular Head Impact Kinematics.

    PubMed

    Miller, Logan E; Kuo, Calvin; Wu, Lyndia C; Urban, Jillian E; Camarillo, David B; Stitzel, Joel D

    2018-05-01

    Head impact exposure in popular contact sports is not well understood, especially in the youth population, despite recent advances in impact-sensing technology which has allowed widespread collection of real-time head impact data. Previous studies indicate that a custom-instrumented mouthpiece is a superior method for collecting accurate head acceleration data. The objective of this study was to evaluate the efficacy of mounting a sensor device inside an acrylic retainer form factor to measure six-degrees-of-freedom (6DOF) head kinematic response. This study compares 6DOF mouthpiece kinematics at the head center of gravity (CG) to kinematics measured by an anthropomorphic test device (ATD). This study found that when instrumentation is mounted in the rigid retainer form factor, there is good coupling with the upper dentition and highly accurate kinematic results compared to the ATD. Peak head kinematics were correlated with r2 > 0.98 for both rotational velocity and linear acceleration and r2 = 0.93 for rotational acceleration. These results indicate that a rigid retainer-based form factor is an accurate and promising method of collecting head impact data. This device can be used to study head impacts in helmeted contact sports such as football, hockey, and lacrosse as well as nonhelmeted sports such as soccer and basketball. Understanding the magnitude and frequency of impacts sustained in various sports using an accurate head impact sensor, such as the one presented in this study, will improve our understanding of head impact exposure and sports-related concussion.

  16. Recovering a full dimensional quantum rate constant from a reduced dimensionality calculation: Application to the OH+CO{r_arrow}H+CO{sub 2} reaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dzegilenko, F.N.; Bowman, J.M.

    1996-08-01

    Two reduced dimensionality theories are used to calculate the thermal rate constant for the OH+CO{r_arrow}H+CO{sub 2} reaction. The standard theory employs energy-shift approximations to extract the full six degree-of-freedom quantum rate constant for this reaction from the previous two degree-of-freedom (2-DOF) quantum calculations of Hernandez and Clary [M.I. Hernandez and D.C. Clary, J. Chem. Phys. {bold 101}, 2779 (1994)]. Three extra bending modes and one extra {open_quote}{open_quote}spectator{close_quote}{close_quote} CO stretch mode are treated adiabatically in the harmonic fashion. The parameters of the exit channel transition state are used to evaluate the frequencies of those additional modes. A new reduced dimensionality theorymore » is also applied to this reaction. This theory explicitly addresses the finding from the 2-DOF calculations that the reaction proceeds mainly via complex formation. A J-shifting approximation has been used to take into account the initial states with non-zero values of total angular momentum in both reduced dimensionality theories. Cumulative reaction probabilities and thermal rate constants are calculated and compared with the previous quasiclassical and reduced dimensionality quantum calculations and with experiment. The rate constant from the new reduced dimensionality theory is between a factor of 5 and 100 times smaller than the statistical transition state theory result, and is in much better agreement with experiment. {copyright} {ital 1996 American Institute of Physics.}« less

  17. Vortex-induced vibrations of two cylinders in tandem arrangement in the proximity–wake interference region

    PubMed Central

    BORAZJANI, IMAN; SOTIROPOULOS, FOTIS

    2009-01-01

    We investigate numerically vortex-induced vibrations (VIV) of two identical two-dimensional elastically mounted cylinders in tandem in the proximity–wake interference regime at Reynolds number Re = 200 for systems having both one (transverse vibrations) and two (transverse and in-line) degrees of freedom (1-DOF and 2-DOF, respectively). For the 1-DOF system the computed results are in good qualitative agreement with available experiments at higher Reynolds numbers. Similar to these experiments our simulations reveal: (1) larger amplitudes of motion and a wider lock-in region for the tandem arrangement when compared with an isolated cylinder; (2) that at low reduced velocities the vibration amplitude of the front cylinder exceeds that of the rear cylinder; and (3) that above a threshold reduced velocity, large-amplitude VIV are excited for the rear cylinder with amplitudes significantly larger than those of the front cylinder. By analysing the simulated flow patterns we identify the VIV excitation mechanisms that lead to such complex responses and elucidate the near-wake vorticity dynamics and vortex-shedding modes excited in each case. We show that at low reduced velocities vortex shedding provides the initial excitation mechanism, which gives rise to a vertical separation between the two cylinders. When this vertical separation exceeds one cylinder diameter, however, a significant portion of the incoming flow is able to pass through the gap between the two cylinders and the gap-flow mechanism starts to dominate the VIV dynamics. The gap flow is able to periodically force either the top or the bottom shear layer of the front cylinder into the gap region, setting off a series of very complex vortex-to-vortex and vortex-to-cylinder interactions, which induces pressure gradients that result in a large oscillatory force in phase with the vortex shedding and lead to the experimentally observed larger vibration amplitudes. When the vortex shedding is the dominant mechanism the front cylinder vibration amplitude is larger than that of the rear cylinder. The reversing of this trend above a threshold reduced velocity is associated with the onset of the gap flow. The important role of the gap flow is further illustrated via a series of simulations for the 2-DOF system. We show that when the gap-flow mechanism is triggered, the 2-DOF system can develop and sustain large VIV amplitudes comparable to those observed in the corresponding (same reduced velocity) 1-DOF system. For sufficiently high reduced velocities, however, the two cylinders in the 2-DOF system approach each other, thus significantly reducing the size of the gap region. In such cases the gap flow is entirely eliminated, and the two cylinders vibrate together as a single body with vibration amplitudes up to 50% lower than the amplitudes of the corresponding 1-DOF in which the gap flow is active. Three-dimensional simulations are also carried out to examine the adequacy of two-dimensional simulations for describing the dynamic response of the tandem system at Re = 200. It is shown that even though the wake transitions to a weakly three-dimensional state when the gap flow is active, the three-dimensional modes are too weak to affect the dynamic response of the system, which is found to be identical to that obtained from the two-dimensional computations. PMID:19693281

  18. Membrane triangles with corner drilling freedoms. II - The ANDES element

    NASA Technical Reports Server (NTRS)

    Felippa, Carlos A.; Militello, Carmelo

    1992-01-01

    This is the second article in a three-part series on the construction of 3-node, 9-dof membrane elements with normal-to-its-plane rotational freedoms (the so-called drilling freedoms) using parametrized variational principles. In this part, one such element is derived within the context of the assumed natural deviatoric strain (ANDES) formulation. The higher-order strains are obtained by constructing three parallel-to-sides pure-bending modes from which natural strains are obtained at the corner points and interpolated over the element. To attain rank sufficiency, an additional higher-order 'torsional' mode, corresponding to equal hierarchical rotations at each corner with all other motions precluded, is incorporated. The resulting formulation has five free parameters. When these parameters are optimized against pure bending by energy balance methods, the resulting element is found to coalesce with the optimal EFF element derived in Part I. Numerical integration as a strain filtering device is found to play a key role in this achievement.

  19. Development of 3 DOF manipulator using ER fluid clutches for reduction of collision force

    NASA Astrophysics Data System (ADS)

    Boku, Kazuhiko; Nakamura, Taro

    2009-02-01

    .With robots and users more commonly sharing space such as in the fields of medicine and home automation, the possibility of a physical collision has increased, even though many robots use actuators with high-ratio gear trains to minimize the effects of impact. We developed a 3-DOF manipulator having a smart flexible joint using an ER fluid and a sensor-equipped pneumatic cushion. Results of position control and collision experiments using the manipulator demonstrated its effectiveness.

  20. Inertial-space disturbance rejection for robotic manipulators

    NASA Technical Reports Server (NTRS)

    Holt, Kevin

    1992-01-01

    The disturbance rejection control problem for a 6-DOF (degree of freedom) PUMA manipulator mounted on a 3-DOF platform is investigated. A control algorithm is designed to track the desired position and attitude of the end-effector in inertial space, subject to unknown disturbances in the platform axes. Conditions for the stability of the closed-loop system are derived. The performance of the controller is compared for step, sinusoidal, and random disturbances in the platform rotational axis and in the neighborhood of kinematic singularities.

  1. High resolution axicon-based endoscopic FD OCT imaging with a large depth range

    NASA Astrophysics Data System (ADS)

    Lee, Kye-Sung; Hurley, William; Deegan, John; Dean, Scott; Rolland, Jannick P.

    2010-02-01

    Endoscopic imaging in tubular structures, such as the tracheobronchial tree, could benefit from imaging optics with an extended depth of focus (DOF). This optics could accommodate for varying sizes of tubular structures across patients and along the tree within a single patient. In the paper, we demonstrate an extended DOF without sacrificing resolution showing rotational images in biological tubular samples with 2.5 μm axial resolution, 10 ìm lateral resolution, and > 4 mm depth range using a custom designed probe.

  2. Modeling of the 6DOF Missile Dynamics using the NED Axes System

    DTIC Science & Technology

    1997-08-01

    representer le corps du missile, l’autodirecteur ainsi que Ia ligne missile-but. Le systeme d’axes le plus couramment utilise dans le domaine de la ...simulation de missiles tactiques ainsi que dans la librairie de composantes de modele de simulation du CRDV est le systeme d’axes NED, qui utilise l’axe x...RESEARCH ESTABLISHMENT CENTRE DE RECHERCHES POUR LA DEFENSE VALCARTIER,QuEBEC DREV- N-9703 MODELING OF THE 6DOF MISSILE DYNAMICS USING THE NED AXES

  3. Bandit: Technologies for Proximity Operations of Teams of Sub-10Kg Spacecraft

    DTIC Science & Technology

    2007-10-16

    and adding a dedicated overhead camera system. As will be explained below, the forced-air system did not work and the existing system has proven too...erratic to justify the expense of the camera system. 6DOF Software Simulator. The existing Java-based graphical 6DOF simulator was to be improved for...proposed camera system for a nonfunctional table. The C-9 final report is enclosed. ["Prf flj ,er Figure 1. Forced-air table schematic Figure 2

  4. The JAU-JPL anthropomorphic telerobot

    NASA Technical Reports Server (NTRS)

    Jau, Bruno M.

    1989-01-01

    Work in progress on the new anthropomorphic telerobot is described. The initial robot configuration consists of a seven DOF arm and a sixteen DOF hand, having three fingers and a thumb. The robot has active compliance, enabling subsequent dual arm manipulations. To control the rather complex configuration of this robot, an exoskeleton master arm harness and a glove controller were built. The controller will be used for teleoperational tasks and as a research tool to efficiently teach the computer controller advanced manipulation techniques.

  5. On DSS Implementation in the Dynamic Model of the Digital Oil field

    NASA Astrophysics Data System (ADS)

    Korovin, Iakov S.; Khisamutdinov, Maksim V.; Kalyaev, Anatoly I.

    2018-02-01

    Decision support systems (DSS), especially based on the artificial intelligence (AI) techniques are been widely applied in different domains nowadays. In the paper we depict an approach of implementing DSS in to Digital Oil Field (DOF) dynamic model structure in order to reduce the human factor influence, considering the automation of all production processes to be the DOF model clue element. As the basic tool of data handling we propose the hybrid application on artificial neural networks and evolutional algorithms.

  6. Numerical Estimation of Balanced and Falling States for Constrained Legged Systems

    NASA Astrophysics Data System (ADS)

    Mummolo, Carlotta; Mangialardi, Luigi; Kim, Joo H.

    2017-08-01

    Instability and risk of fall during standing and walking are common challenges for biped robots. While existing criteria from state-space dynamical systems approach or ground reference points are useful in some applications, complete system models and constraints have not been taken into account for prediction and indication of fall for general legged robots. In this study, a general numerical framework that estimates the balanced and falling states of legged systems is introduced. The overall approach is based on the integration of joint-space and Cartesian-space dynamics of a legged system model. The full-body constrained joint-space dynamics includes the contact forces and moments term due to current foot (or feet) support and another term due to altered contact configuration. According to the refined notions of balanced, falling, and fallen, the system parameters, physical constraints, and initial/final/boundary conditions for balancing are incorporated into constrained nonlinear optimization problems to solve for the velocity extrema (representing the maximum perturbation allowed to maintain balance without changing contacts) in the Cartesian space at each center-of-mass (COM) position within its workspace. The iterative algorithm constructs the stability boundary as a COM state-space partition between balanced and falling states. Inclusion in the resulting six-dimensional manifold is a necessary condition for a state of the given system to be balanced under the given contact configuration, while exclusion is a sufficient condition for falling. The framework is used to analyze the balance stability of example systems with various degrees of complexities. The manifold for a 1-degree-of-freedom (DOF) legged system is consistent with the experimental and simulation results in the existing studies for specific controller designs. The results for a 2-DOF system demonstrate the dependency of the COM state-space partition upon joint-space configuration (elbow-up vs. elbow-down). For both 1- and 2-DOF systems, the results are validated in simulation environments. Finally, the manifold for a biped walking robot is constructed and illustrated against its single-support walking trajectories. The manifold identified by the proposed framework for any given legged system can be evaluated beforehand as a system property and serves as a map for either a specified state or a specific controller's performance.

  7. Estimation of continuous multi-DOF finger joint kinematics from surface EMG using a multi-output Gaussian Process.

    PubMed

    Ngeo, Jimson; Tamei, Tomoya; Shibata, Tomohiro

    2014-01-01

    Surface electromyographic (EMG) signals have often been used in estimating upper and lower limb dynamics and kinematics for the purpose of controlling robotic devices such as robot prosthesis and finger exoskeletons. However, in estimating multiple and a high number of degrees-of-freedom (DOF) kinematics from EMG, output DOFs are usually estimated independently. In this study, we estimate finger joint kinematics from EMG signals using a multi-output convolved Gaussian Process (Multi-output Full GP) that considers dependencies between outputs. We show that estimation of finger joints from muscle activation inputs can be improved by using a regression model that considers inherent coupling or correlation within the hand and finger joints. We also provide a comparison of estimation performance between different regression methods, such as Artificial Neural Networks (ANN) which is used by many of the related studies. We show that using a multi-output GP gives improved estimation compared to multi-output ANN and even dedicated or independent regression models.

  8. Integrated Chassis Control of Active Front Steering and Yaw Stability Control Based on Improved Inverse Nyquist Array Method

    PubMed Central

    2014-01-01

    An integrated chassis control (ICC) system with active front steering (AFS) and yaw stability control (YSC) is introduced in this paper. The proposed ICC algorithm uses the improved Inverse Nyquist Array (INA) method based on a 2-degree-of-freedom (DOF) planar vehicle reference model to decouple the plant dynamics under different frequency bands, and the change of velocity and cornering stiffness were considered to calculate the analytical solution in the precompensator design so that the INA based algorithm runs well and fast on the nonlinear vehicle system. The stability of the system is guaranteed by dynamic compensator together with a proposed PI feedback controller. After the response analysis of the system on frequency domain and time domain, simulations under step steering maneuver were carried out using a 2-DOF vehicle model and a 14-DOF vehicle model by Matlab/Simulink. The results show that the system is decoupled and the vehicle handling and stability performance are significantly improved by the proposed method. PMID:24782676

  9. Simulation on measurement of five-DOF motion errors of high precision spindle with cylindrical capacitive sensor

    NASA Astrophysics Data System (ADS)

    Zhang, Min; Wang, Wen; Xiang, Kui; Lu, Keqing; Fan, Zongwei

    2015-02-01

    This paper describes a novel cylindrical capacitive sensor (CCS) to measure the spindle five degree-of-freedom (DOF) motion errors. The operating principle and mathematical models of the CCS are presented. Using Ansoft Maxwell software to calculate the different capacitances in different configurations, structural parameters of end face electrode are then investigated. Radial, axial and tilt motions are also simulated by making comparisons with the given displacements and the simulation values respectively. It could be found that the proposed CCS has a high accuracy for measuring radial motion error when the average eccentricity is about 15 μm. Besides, the maximum relative error of axial displacement is 1.3% when the axial motion is within [0.7, 1.3] mm, and the maximum relative error of the tilt displacement is 1.6% as rotor tilts around a single axis within [-0.6, 0.6]°. Finally, the feasibility of the CCS for measuring five DOF motion errors is verified through simulation and analysis.

  10. Integrated chassis control of active front steering and yaw stability control based on improved inverse nyquist array method.

    PubMed

    Zhu, Bing; Chen, Yizhou; Zhao, Jian

    2014-01-01

    An integrated chassis control (ICC) system with active front steering (AFS) and yaw stability control (YSC) is introduced in this paper. The proposed ICC algorithm uses the improved Inverse Nyquist Array (INA) method based on a 2-degree-of-freedom (DOF) planar vehicle reference model to decouple the plant dynamics under different frequency bands, and the change of velocity and cornering stiffness were considered to calculate the analytical solution in the precompensator design so that the INA based algorithm runs well and fast on the nonlinear vehicle system. The stability of the system is guaranteed by dynamic compensator together with a proposed PI feedback controller. After the response analysis of the system on frequency domain and time domain, simulations under step steering maneuver were carried out using a 2-DOF vehicle model and a 14-DOF vehicle model by Matlab/Simulink. The results show that the system is decoupled and the vehicle handling and stability performance are significantly improved by the proposed method.

  11. Fuzzy logic control of telerobot manipulators

    NASA Technical Reports Server (NTRS)

    Franke, Ernest A.; Nedungadi, Ashok

    1992-01-01

    Telerobot systems for advanced applications will require manipulators with redundant 'degrees of freedom' (DOF) that are capable of adapting manipulator configurations to avoid obstacles while achieving the user specified goal. Conventional methods for control of manipulators (based on solution of the inverse kinematics) cannot be easily extended to these situations. Fuzzy logic control offers a possible solution to these needs. A current research program at SRI developed a fuzzy logic controller for a redundant, 4 DOF, planar manipulator. The manipulator end point trajectory can be specified by either a computer program (robot mode) or by manual input (teleoperator). The approach used expresses end-point error and the location of manipulator joints as fuzzy variables. Joint motions are determined by a fuzzy rule set without requiring solution of the inverse kinematics. Additional rules for sensor data, obstacle avoidance and preferred manipulator configuration, e.g., 'righty' or 'lefty', are easily accommodated. The procedure used to generate the fuzzy rules can be extended to higher DOF systems.

  12. Degree-of-Freedom Strengthened Cascade Array for DOD-DOA Estimation in MIMO Array Systems.

    PubMed

    Yao, Bobin; Dong, Zhi; Zhang, Weile; Wang, Wei; Wu, Qisheng

    2018-05-14

    In spatial spectrum estimation, difference co-array can provide extra degrees-of-freedom (DOFs) for promoting parameter identifiability and parameter estimation accuracy. For the sake of acquiring as more DOFs as possible with a given number of physical sensors, we herein design a novel sensor array geometry named cascade array. This structure is generated by systematically connecting a uniform linear array (ULA) and a non-uniform linear array, and can provide more DOFs than some exist array structures but less than the upper-bound indicated by minimum redundant array (MRA). We further apply this cascade array into multiple input multiple output (MIMO) array systems, and propose a novel joint direction of departure (DOD) and direction of arrival (DOA) estimation algorithm, which is based on a reduced-dimensional weighted subspace fitting technique. The algorithm is angle auto-paired and computationally efficient. Theoretical analysis and numerical simulations prove the advantages and effectiveness of the proposed array structure and the related algorithm.

  13. Influence of the model's degree of freedom on human body dynamics identification.

    PubMed

    Maita, Daichi; Venture, Gentiane

    2013-01-01

    In fields of sports and rehabilitation, opportunities of using motion analysis of the human body have dramatically increased. To analyze the motion dynamics, a number of subject specific parameters and measurements are required. For example the contact forces measurement and the inertial parameters of each segment of the human body are necessary to compute the joint torques. In this study, in order to perform accurate dynamic analysis we propose to identify the inertial parameters of the human body and to evaluate the influence of the model's number of degrees of freedom (DoF) on the results. We use a method to estimate the inertial parameters without torque sensor, using generalized coordinates of the base link, joint angles and external forces information. We consider a 34DoF model, a 58DoF model, as well as the case when the human is manipulating a tool (here a tennis racket). We compare the obtained in results in terms of contact force estimation.

  14. [Mechatronic in functional endoscopic sinus surgery. First experiences with the daVinci Telemanipulatory System].

    PubMed

    Strauss, G; Winkler, D; Jacobs, S; Trantakis, C; Dietz, A; Bootz, F; Meixensberger, J; Falk, V

    2005-07-01

    This study examines the advantages and disadvantages of a commercial telemanipulator system (daVinci, Intuitive Surgical, USA) with computer-guided instruments in functional endoscopic sinus surgery (FESS). We performed five different surgical FESS steps on 14 anatomical preparation and compared them with conventional FESS. A total of 140 procedures were examined taking into account the following parameters: degrees of freedom (DOF), duration , learning curve, force feedback, human-machine-interface. Telemanipulatory instruments have more DOF available then conventional instrumentation in FESS. The average time consumed by configuration of the telemanipulator is around 9+/-2 min. Missing force feedback is evaluated mainly as a disadvantage of the telemanipulator. Scaling was evaluated as helpful. The ergonomic concept seems to be better than the conventional solution. Computer guided instruments showed better results for the available DOF of the instruments. The human-machine-interface is more adaptable and variable then in conventional instrumentation. Motion scaling and indexing are characteristics of the telemanipulator concept which are helpful for FESS in our study.

  15. Endocavity Ultrasound Probe Manipulators

    PubMed Central

    Stoianovici, Dan; Kim, Chunwoo; Schäfer, Felix; Huang, Chien-Ming; Zuo, Yihe; Petrisor, Doru; Han, Misop

    2014-01-01

    We developed two similar structure manipulators for medical endocavity ultrasound probes with 3 and 4 degrees of freedom (DoF). These robots allow scanning with ultrasound for 3-D imaging and enable robot-assisted image-guided procedures. Both robots use remote center of motion kinematics, characteristic of medical robots. The 4-DoF robot provides unrestricted manipulation of the endocavity probe. With the 3-DoF robot the insertion motion of the probe must be adjusted manually, but the device is simpler and may also be used to manipulate external-body probes. The robots enabled a novel surgical approach of using intraoperative image-based navigation during robot-assisted laparoscopic prostatectomy (RALP), performed with concurrent use of two robotic systems (Tandem, T-RALP). Thus far, a clinical trial for evaluation of safety and feasibility has been performed successfully on 46 patients. This paper describes the architecture and design of the robots, the two prototypes, control features related to safety, preclinical experiments, and the T-RALP procedure. PMID:24795525

  16. Diffraction-Limited Plenoptic Imaging with Correlated Light

    NASA Astrophysics Data System (ADS)

    Pepe, Francesco V.; Di Lena, Francesco; Mazzilli, Aldo; Edrei, Eitan; Garuccio, Augusto; Scarcelli, Giuliano; D'Angelo, Milena

    2017-12-01

    Traditional optical imaging faces an unavoidable trade-off between resolution and depth of field (DOF). To increase resolution, high numerical apertures (NAs) are needed, but the associated large angular uncertainty results in a limited range of depths that can be put in sharp focus. Plenoptic imaging was introduced a few years ago to remedy this trade-off. To this aim, plenoptic imaging reconstructs the path of light rays from the lens to the sensor. However, the improvement offered by standard plenoptic imaging is practical and not fundamental: The increased DOF leads to a proportional reduction of the resolution well above the diffraction limit imposed by the lens NA. In this Letter, we demonstrate that correlation measurements enable pushing plenoptic imaging to its fundamental limits of both resolution and DOF. Namely, we demonstrate maintaining the imaging resolution at the diffraction limit while increasing the depth of field by a factor of 7. Our results represent the theoretical and experimental basis for the effective development of promising applications of plenoptic imaging.

  17. Diffraction-Limited Plenoptic Imaging with Correlated Light.

    PubMed

    Pepe, Francesco V; Di Lena, Francesco; Mazzilli, Aldo; Edrei, Eitan; Garuccio, Augusto; Scarcelli, Giuliano; D'Angelo, Milena

    2017-12-15

    Traditional optical imaging faces an unavoidable trade-off between resolution and depth of field (DOF). To increase resolution, high numerical apertures (NAs) are needed, but the associated large angular uncertainty results in a limited range of depths that can be put in sharp focus. Plenoptic imaging was introduced a few years ago to remedy this trade-off. To this aim, plenoptic imaging reconstructs the path of light rays from the lens to the sensor. However, the improvement offered by standard plenoptic imaging is practical and not fundamental: The increased DOF leads to a proportional reduction of the resolution well above the diffraction limit imposed by the lens NA. In this Letter, we demonstrate that correlation measurements enable pushing plenoptic imaging to its fundamental limits of both resolution and DOF. Namely, we demonstrate maintaining the imaging resolution at the diffraction limit while increasing the depth of field by a factor of 7. Our results represent the theoretical and experimental basis for the effective development of promising applications of plenoptic imaging.

  18. A novel sensor for two-degree-of-freedom motion measurement of linear nanopositioning stage using knife edge displacement sensing technique

    NASA Astrophysics Data System (ADS)

    Zolfaghari, Abolfazl; Jeon, Seongkyul; Stepanick, Christopher K.; Lee, ChaBum

    2017-06-01

    This paper presents a novel method for measuring two-degree-of-freedom (DOF) motion of flexure-based nanopositioning systems based on optical knife-edge sensing (OKES) technology, which utilizes the interference of two superimposed waves: a geometrical wave from the primary source of light and a boundary diffraction wave from the secondary source. This technique allows for two-DOF motion measurement of the linear and pitch motions of nanopositioning systems. Two capacitive sensors (CSs) are used for a baseline comparison with the proposed sensor by simultaneously measuring the motions of the nanopositioning system. The experimental results show that the proposed sensor closely agrees with the fundamental linear motion of the CS. However, the two-DOF OKES technology was shown to be approximately three times more sensitive to the pitch motion than the CS. The discrepancy in the two sensor outputs is discussed in terms of measuring principle, linearity, bandwidth, control effectiveness, and resolution.

  19. Hand rehabilitation after stroke using a wearable, high DOF, spring powered exoskeleton.

    PubMed

    Tianyao Chen; Lum, Peter S

    2016-08-01

    Stroke patients often have inappropriate finger flexor activation and finger extensor weakness, which makes it difficult to open their affected hand for functional grasp. The goal was to develop a passive, lightweight, wearable device to enable improved hand function during performance of activities of daily living. The device, HandSOME II, assists with opening the patient's hand using 11 elastic actuators that apply extension torques to finger and thumb joints. Device design and initial testing are described. A novel mechanical design applies forces orthogonal to the finger segments despite the fact that all of the device DOFs are not aligned with human joint DOF. In initial testing with seven stroke subjects with impaired hand function, use of HandSOME II significantly increased maximum extension angles and range of motion in all of the index finger joints (P<;0.05). HandSOME II allows performance of all the grip patterns used in daily activities and can be used as part of home-based therapy programs.

  20. Asynchronous steady-state visual evoked potential based BCI control of a 2-DoF artificial upper limb.

    PubMed

    Horki, Petar; Neuper, Christa; Pfurtscheller, Gert; Müller-Putz, Gernot

    2010-12-01

    A brain-computer interface (BCI) provides a direct connection between the human brain and a computer. One type of BCI can be realized using steady-state visual evoked potentials (SSVEPs), resulting from repetitive stimulation. The aim of this study was the realization of an asynchronous SSVEP-BCI, based on canonical correlation analysis, suitable for the control of a 2-degrees of freedom (DoF) hand and elbow neuroprosthesis. To determine whether this BCI is suitable for the control of 2-DoF neuroprosthetic devices, online experiments with a virtual and a robotic limb feedback were conducted with eight healthy subjects and one tetraplegic patient. All participants were able to control the artificial limbs with the BCI. In the online experiments, the positive predictive value (PPV) varied between 69% and 83% and the false negative rate (FNR) varied between 1% and 17%. The spinal cord injured patient achieved PPV and FNR values within one standard deviation of the mean for all healthy subjects.

  1. Active fault tolerant control based on interval type-2 fuzzy sliding mode controller and non linear adaptive observer for 3-DOF laboratory helicopter.

    PubMed

    Zeghlache, Samir; Benslimane, Tarak; Bouguerra, Abderrahmen

    2017-11-01

    In this paper, a robust controller for a three degree of freedom (3 DOF) helicopter control is proposed in presence of actuator and sensor faults. For this purpose, Interval type-2 fuzzy logic control approach (IT2FLC) and sliding mode control (SMC) technique are used to design a controller, named active fault tolerant interval type-2 Fuzzy Sliding mode controller (AFTIT2FSMC) based on non-linear adaptive observer to estimate and detect the system faults for each subsystem of the 3-DOF helicopter. The proposed control scheme allows avoiding difficult modeling, attenuating the chattering effect of the SMC, reducing the rules number of the fuzzy controller. Exponential stability of the closed loop is guaranteed by using the Lyapunov method. The simulation results show that the AFTIT2FSMC can greatly alleviate the chattering effect, providing good tracking performance, even in presence of actuator and sensor faults. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.

  2. Robust source and mask optimization compensating for mask topography effects in computational lithography.

    PubMed

    Li, Jia; Lam, Edmund Y

    2014-04-21

    Mask topography effects need to be taken into consideration for a more accurate solution of source mask optimization (SMO) in advanced optical lithography. However, rigorous 3D mask models generally involve intensive computation and conventional SMO fails to manipulate the mask-induced undesired phase errors that degrade the usable depth of focus (uDOF) and process yield. In this work, an optimization approach incorporating pupil wavefront aberrations into SMO procedure is developed as an alternative to maximize the uDOF. We first design the pupil wavefront function by adding primary and secondary spherical aberrations through the coefficients of the Zernike polynomials, and then apply the conjugate gradient method to achieve an optimal source-mask pair under the condition of aberrated pupil. We also use a statistical model to determine the Zernike coefficients for the phase control and adjustment. Rigorous simulations of thick masks show that this approach provides compensation for mask topography effects by improving the pattern fidelity and increasing uDOF.

  3. A numerical and experimental study on optimal design of multi-DOF viscoelastic supports for passive vibration control in rotating machinery

    NASA Astrophysics Data System (ADS)

    Ribeiro, Eduardo Afonso; Lopes, Eduardo Márcio de Oliveira; Bavastri, Carlos Alberto

    2017-12-01

    Viscoelastic materials have played an important role in passive vibration control. Nevertheless, the use of such materials in supports of rotating machines, aiming at controlling vibration, is more recent, mainly when these supports present additional complexities like multiple degrees of freedom and require accurate models to predict the dynamic behavior of viscoelastic materials working in a broad band of frequencies and temperatures. Previously, the authors propose a methodology for an optimal design of viscoelastic supports (VES) for vibration suppression in rotordynamics, which improves the dynamic prediction accuracy, the speed calculation, and the modeling of VES as complex structures. However, a comprehensive numerical study of the dynamics of rotor-VES systems, regarding the types and combinations of translational and rotational degrees of freedom (DOFs), accompanied by the corresponding experimental validation, is still lacking. This paper presents such a study considering different types and combinations of DOFs in addition to the simulation of their number of additional masses/inertias, as well as the kind and association of the applied viscoelastic materials (VEMs). The results - regarding unbalance frequency response, transmissibility and displacement due to static loads - lead to: 1) considering VES as complex structures which allow improving the efficacy in passive vibration control; 2) acknowledging the best configuration concerning DOFs and VEM choice and association for a practical application concerning passive vibration control and load resistance. The specific outcomes of the conducted experimental validation attest the accuracy of the proposed methodology.

  4. Design of a 7-DOF slave robot integrated with a magneto-rheological haptic master

    NASA Astrophysics Data System (ADS)

    Hwang, Yong-Hoon; Cha, Seung-Woo; Kang, Seok-Rae; Choi, Seung-Bok

    2017-04-01

    In this study, a 7-DOF slave robot integrated with the haptic master is designed and its dynamic motion is controlled. The haptic master is made using a controllable magneto-rheological (MR) clutch and brake and it provides the surgeon with a sense of touch by using both kinetic and kinesthetic information. Due to the size constraint of the slave robot, a wire actuating is adopted to make the desired motion of the end-effector which has 3-DOF instead of a conventional direct-driven motor. Another motions of the link parts that have 4-DOF use direct-driven motor. In total system, for working as a haptic device, the haptic master need to receive the information of repulsive forces applied on the slave robot. Therefore, repulsive forces on the end-effector are sensed by using three uniaxial torque transducer inserted in the wire actuating system and another repulsive forces applied on link part are sensed by using 6-axis transducer that is able to sense forces and torques. Using another 6-axis transducer, verify the reliability of force information on final end of slave robot. Lastly, integrated with a MR haptic master, psycho-physical test is conducted by different operators who can feel the different repulsive force or torque generated from the haptic master which is equivalent to the force or torque occurred on the end-effector to demonstrate the effectiveness of the proposed system.

  5. PETER: A Hardware Simulator for the Test Mass-GRS System of LISA Pathfinder

    NASA Astrophysics Data System (ADS)

    Marconi, L.; Stanga, R.; Bassan, M.; De Marchi, F.; Pucacco, G.; Visco, M.; Di Fiore, L.; De Rosa, R.; Garufi, F.

    2013-01-01

    Each LISA PathFinder test mass (TM) will be sensitive to forces along all its 6 Degrees of Freedom (DoFs). Extensive ground testing is required in order to evaluate the influence of cross-talks from the read-out and actuator channels. In the INFN laboratory of Firenze we have developed a facility for a good representation of the free fall conditions of the TM on flight. A hollow replica of a TM hanging from a double torsion pendulum can move inside a Gravitational Reference Sensor (GRS) with quasi free fall condition on two Dofs, in the frequency band (0.1 ÷ 100)mHz. On both DoFs, the target residual accelerations (yet to be achieved) at the low end frequency range are ≤ 3 × 10-13ms-2, limited by the thermal noise of the fibres. At higher frequencies, the sensitivity is limited by the readout noise of the readout, a replica of the flight electronics. After a long commissioning, we are now in operating conditions, and can carry out a series of experiments to better qualify the interaction between TM and GRS. In this paper we will show some significant qualification measurements and a first scientific measurements, i.e. the measurement and compensation of the DC bias in the GRS using two independent channels, as well as a measurement of the residual acceleration of the translational DoF, with the feedback loop closed on the rotational one, and viceversa.

  6. Bistable energy harvesting enhancement with an auxiliary linear oscillator

    NASA Astrophysics Data System (ADS)

    Harne, R. L.; Thota, M.; Wang, K. W.

    2013-12-01

    Recent work has indicated that linear vibrational energy harvesters with an appended degree-of-freedom (DOF) may be advantageous for introducing new dynamic forms to extend the operational bandwidth. Given the additional interest in bistable harvester designs, which exhibit a propitious snap through effect from one stable state to the other, it is a logical extension to explore the influence of an added DOF to a bistable system. However, bistable snap through is not a resonant phenomenon, which tempers the presumption that the dynamics induced by an additional DOF on bistable designs would inherently be beneficial as for linear systems. This paper presents two analytical formulations to assess the fundamental and superharmonic steady-state dynamics of an excited bistable energy harvester to which is attached an auxiliary linear oscillator. From an energy harvesting perspective, the model predicts that the additional linear DOF uniformly amplifies the bistable harvester response magnitude and generated power for excitation frequencies less than the attachment’s resonance while improved power density spans a bandwidth below this frequency. Analyses predict bandwidths having co-existent responses composed of a unique proportion of fundamental and superharmonic dynamics. Experiments validate key analytical predictions and observe the ability for the coupled system to develop an advantageous multi-harmonic interwell response when the initial conditions are insufficient for continuous high-energy orbit at the excitation frequency. Overall, the addition of an auxiliary linear oscillator to a bistable harvester is found to be an effective means of enhancing the energy harvesting performance and robustness.

  7. Development of a grating-based interferometer for six-degree-of-freedom displacement and angle measurements.

    PubMed

    Hsieh, Hung-Lin; Pan, Ssu-Wen

    2015-02-09

    A grating-based interferometer for 6-DOF displacement and angle measurement is proposed in this study. The proposed interferometer is composed of three identical detection parts sharing the same light source. Each detection part utilizes three techniques: heterodyne, grating shearing, and Michelson interferometries. Displacement information in the three perpendicular directions (X, Y, Z) can be sensed simultaneously by each detection part. Furthermore, angle information (θX, θY, θZ) can be obtained by comparing the displacement measurement results between two corresponding detection parts. The feasibility and performance of the proposed grating-based interferometer are evaluated in displacement and angle measurement experiments. In comparison with the internal capacitance sensor built into the commercial piezo-stage, the measurement resolutions of the displacement and angle of our proposed interferometer are about 2 nm and 0.05 μrad.

  8. Fault tolerant control based on interval type-2 fuzzy sliding mode controller for coaxial trirotor aircraft.

    PubMed

    Zeghlache, Samir; Kara, Kamel; Saigaa, Djamel

    2015-11-01

    In this paper, a robust controller for a Six Degrees of Freedom (6 DOF) coaxial trirotor helicopter control is proposed in presence of defects in the system. A control strategy based on the coupling of the interval type-2 fuzzy logic control and sliding mode control technique are used to design a controller. The main purpose of this work is to eliminate the chattering phenomenon and guaranteeing the stability and the robustness of the system. In order to achieve this goal, interval type-2 fuzzy logic control has been used to generate the discontinuous control signal. The simulation results have shown that the proposed control strategy can greatly alleviate the chattering effect, and perform good reference tracking in presence of defects in the system. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.

  9. Energetic particle diffusion coefficients upstream of quasi-parallel interplanetary shocks

    NASA Technical Reports Server (NTRS)

    Tan, L. C.; Mason, G. M.; Gloeckler, G.; Ipavich, F. M.

    1989-01-01

    The properties of about 30 to 130-keV/e protons and alpha particles upstream of six quasi-parallel interplanetary shocks that passed by the ISEE 3 spacecraft during 1978-1979 were analyzed, and the values for the upstream energegic particle diffusion coefficient, kappa, in these six events were deduced for a number of energies and upstream positions. These observations were compared with predictions of Lee's (1983) theory of shock acceleration. It was found that the observations verified the prediction of the A/Q dependence (where A and Q are the particle atomic mass and ionization state, respectively) of kappa for alpha and proton particles upstream of the quasi-parallel shocks.

  10. Module Six: Parallel Circuits; Basic Electricity and Electronics Individualized Learning System.

    ERIC Educational Resources Information Center

    Bureau of Naval Personnel, Washington, DC.

    In this module the student will learn the rules that govern the characteristics of parallel circuits; the relationships between voltage, current, resistance and power; and the results of common troubles in parallel circuits. The module is divided into four lessons: rules of voltage and current, rules for resistance and power, variational analysis,…

  11. Deterministic implementations of single-photon multi-qubit Deutsch-Jozsa algorithms with linear optics

    NASA Astrophysics Data System (ADS)

    Wei, Hai-Rui; Liu, Ji-Zhen

    2017-02-01

    It is very important to seek an efficient and robust quantum algorithm demanding less quantum resources. We propose one-photon three-qubit original and refined Deutsch-Jozsa algorithms with polarization and two linear momentums degrees of freedom (DOFs). Our schemes are constructed by solely using linear optics. Compared to the traditional ones with one DOF, our schemes are more economic and robust because the necessary photons are reduced from three to one. Our linear-optic schemes are working in a determinate way, and they are feasible with current experimental technology.

  12. Deterministic implementations of single-photon multi-qubit Deutsch–Jozsa algorithms with linear optics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wei, Hai-Rui, E-mail: hrwei@ustb.edu.cn; Liu, Ji-Zhen

    2017-02-15

    It is very important to seek an efficient and robust quantum algorithm demanding less quantum resources. We propose one-photon three-qubit original and refined Deutsch–Jozsa algorithms with polarization and two linear momentums degrees of freedom (DOFs). Our schemes are constructed by solely using linear optics. Compared to the traditional ones with one DOF, our schemes are more economic and robust because the necessary photons are reduced from three to one. Our linear-optic schemes are working in a determinate way, and they are feasible with current experimental technology.

  13. Looped back fiber mode for reduction of false alarm in leak detection using distributed optical fiber sensor.

    PubMed

    Chelliah, Pandian; Murgesan, Kasinathan; Samvel, Sosamma; Chelamchala, Babu Rao; Tammana, Jayakumar; Nagarajan, Murali; Raj, Baldev

    2010-07-10

    Optical-fiber-based sensors have inherent advantages, such as immunity to electromagnetic interference, compared to the conventional sensors. Distributed optical fiber sensor (DOFS) systems, such as Raman and Brillouin distributed temperature sensors are used for leak detection. The inherent noise of fiber-based systems leads to occasional false alarms. In this paper, a methodology is proposed to overcome this. This uses a looped back fiber mode in DOFS and voting logic is employed to considerably reduce the false alarm rate.

  14. Achievable degrees of freedom of MIMO two-way relay interference channel with delayed CSIT

    NASA Astrophysics Data System (ADS)

    Li, Qingyun; Wu, Gang; Li, Shaoqian

    2016-10-01

    In this paper, assuming each node has delayed channel state information at the transmitter (CSIT), we investigate the achievable degrees of freedom (DOF) of MIMO two-way relay interference channel in frequency division duplex (FDD) systems, where there are K user pairs (i.e., 2K users) and each user in a user pair exchanges messages with the other user in the same user pair simultaneously via an intermediate relay. We propose a two-stage transmission scheme and derive the closed-form expressions for its achievable DOF.

  15. Automated Re-Entry System using FNPEG

    NASA Technical Reports Server (NTRS)

    Johnson, Wyatt R.; Lu, Ping; Stachowiak, Susan J.

    2017-01-01

    This paper discusses the implementation and simulated performance of the FNPEG (Fully Numerical Predictor-corrector Entry Guidance) algorithm into GNC FSW (Guidance, Navigation, and Control Flight Software) for use in an autonomous re-entry vehicle. A few modifications to FNPEG are discussed that result in computational savings -- a change to the state propagator, and a modification to cross-range lateral logic. Finally, some Monte Carlo results are presented using a representative vehicle in both a high-fidelity 6-DOF (degree-of-freedom) sim as well as in a 3-DOF sim for independent validation.

  16. Study on a novel panel support concept for radio telescopes with active surface

    NASA Astrophysics Data System (ADS)

    Yang, Dehua; Zhou, Guohua; Okoh, Daniel; Li, Guoping; Cheng, Jingquan

    2010-07-01

    Generally, panels of radio telescopes are mainly shaped in trapezoid and each is supported/positioned by four adjustors beneath its vertexes. Such configuration of panel supporting system is essentially hyper-static, and the panel is overconstrained from a kinematic point of view. When the panel is to be adjusted and/or actuated, it will suffer stress from its adjusters and hence its shape is to be distorted. This situation is not desirable for high precision panels, such as glass based panels especially used for sub-millimeter and shorter wavelength telescopes with active optics/active panel technology. This paper began with a general overview of panel patterns and panel supports of existing radio telescopes. Thereby, we proposed a preferable master-slave active surface concept for triangular and/or hexagonal panel pattern. In addition, we carry out panel error sensitivity analysis for all the 6 degrees of freedom (DOF) of a panel to identify what DOFs are most sensitive for an active surface. And afterwards, based on the error sensitivity analysis, we suggested an innovative parallel-series concept hexapod well fitted for an active panel to correct for all of its 6 rigid errors. A demonstration active surface using the master-slave concept and the hexapod manifested a great save in cost, where only 486 precision actuators are needed for 438 panels, which is 37% of those actuators needed by classic segmented mirror active optics. Further, we put forward a swaying-arm based design concept for the related connecting joints between panels, which ensures that all the panels attached on to it free from over-constraints when they are positioned and/or actuated. Principle and performance of the swaying-arm connecting mechanism are elaborated before a practical cablemesh based prototype active surface is presented with comprehensive finite element analysis and simulation.

  17. Multileg Heat-Pipe Evaporator

    NASA Technical Reports Server (NTRS)

    Alario, J. P.; Haslett, R. A.

    1986-01-01

    Parallel pipes provide high heat flow from small heat exchanger. Six parallel heat pipes extract heat from overlying heat exchanger, forming evaporator. Vapor channel in pipe contains wick that extends into screen tube in liquid channel. Rods in each channel hold wick and screen tube in place. Evaporator compact rather than extended and more compatible with existing heat-exchanger geometries. Prototype six-pipe evaporator only 0.3 m wide and 0.71 m long. With ammonia as working fluid, transports heat to finned condenser at rate of 1,200 W.

  18. Evaluate depth of field limits of fixed focus lens arrangements in thermal infrared

    NASA Astrophysics Data System (ADS)

    Schuster, Norbert

    2016-05-01

    More and more modern thermal imaging systems use uncooled detectors. High volume applications work with detectors that have a reduced pixel count (typically between 200x150 and 640x480). This reduces the usefulness of modern image treatment procedures such as wave front coding. On the other hand, uncooled detectors demand lenses with fast fnumbers, near f/1.0, which reduces the expected Depth of Field (DoF). What are the limits on resolution if the target changes distance to the camera system? The desire to implement lens arrangements without a focusing mechanism demands a deeper quantification of the DoF problem. A new approach avoids the classic "accepted image blur circle" and quantifies the expected DoF by the Through Focus MTF of the lens. This function is defined for a certain spatial frequency that provides a straightforward relation to the pixel pitch of imaging device. A certain minimum MTF-level is necessary so that the complete thermal imaging system can realize its basic functions, such as recognition or detection of specified targets. Very often, this technical tradeoff is approved with a certain lens. But what is the impact of changing the lens for one with a different focal length? Narrow field lenses, which give more details of targets in longer distances, tighten the DoF problem. A first orientation is given by the hyperfocal distance. It depends in a square relation on the focal length and in a linear relation on the through focus MTF of the lens. The analysis of these relations shows the contradicting requirements between higher thermal and spatial resolution, faster f-number and desired DoF. Furthermore, the hyperfocal distance defines the DoF-borders. Their relation between is such as the first order imaging formulas. A calculation methodology will be presented to transfer DoF-results from an approved combination lens and camera to another lens in combination with the initial camera. Necessary input for this prediction is the accepted DoF of the initial combination and the through focus MTFs of both lenses. The accepted DoF of the initial combination defines an application and camera related MTF-level, which must be provided also by the new lens. Examples are provided. The formula of the Diffraction-Limited-Through-Focus-MTF (DLTF) quantifies the physical limit and works without any ray trace. This relation respects the pixel pitch, the waveband and the aperture based f-number, but is independent of detector size. The DLTF has a steeper slope than the ray traced Through-Focus-MTF; its maximum is the diffraction limit. The DLTF predicts the DoF-relations quite precisely. Differences to ray trace results are discussed. Last calculations with modern detectors show that a static chosen MTF-level doesn't reflect the reality for the DoFproblem. The MTF-level to respect depends on application, pixel pitch, IR-camera and image treatment. A value of 0.250 at the detector Nyquist frequency seems to be a reasonable starting point for uncooled FPAs with 17μm pixel pitch.

  19. Analyzing and designing object-oriented missile simulations with concurrency

    NASA Astrophysics Data System (ADS)

    Randorf, Jeffrey Allen

    2000-11-01

    A software object model for the six degree-of-freedom missile modeling domain is presented. As a precursor, a domain analysis of the missile modeling domain was started, based on the Feature-Oriented Domain Analysis (FODA) technique described by the Software Engineering Institute (SEI). It was subsequently determined the FODA methodology is functionally equivalent to the Object Modeling Technique. The analysis used legacy software documentation and code from the ENDOSIM, KDEC, and TFrames 6-DOF modeling tools, including other technical literature. The SEI Object Connection Architecture (OCA) was the template for designing the object model. Three variants of the OCA were considered---a reference structure, a recursive structure, and a reference structure with augmentation for flight vehicle modeling. The reference OCA design option was chosen for maintaining simplicity while not compromising the expressive power of the OMT model. The missile architecture was then analyzed for potential areas of concurrent computing. It was shown how protected objects could be used for data passing between OCA object managers, allowing concurrent access without changing the OCA reference design intent or structure. The implementation language was the 1995 release of Ada. OCA software components were shown how to be expressed as Ada child packages. While acceleration of several low level and other high operations level are possible on proper hardware, there was a 33% degradation of 4th order Runge-Kutta integrator performance of two simultaneous ordinary differential equations using Ada tasking on a single processor machine. The Defense Department's High Level Architecture was introduced and explained in context with the OCA. It was shown the HLA and OCA were not mutually exclusive architectures, but complimentary. HLA was shown as an interoperability solution, with the OCA as an architectural vehicle for software reuse. Further directions for implementing a 6-DOF missile modeling environment are discussed.

  20. Robust patella motion tracking using intensity-based 2D-3D registration on dynamic bi-plane fluoroscopy: towards quantitative assessment in MPFL reconstruction surgery

    NASA Astrophysics Data System (ADS)

    Otake, Yoshito; Esnault, Matthieu; Grupp, Robert; Kosugi, Shinichi; Sato, Yoshinobu

    2016-03-01

    The determination of in vivo motion of multiple-bones using dynamic fluoroscopic images and computed tomography (CT) is useful for post-operative assessment of orthopaedic surgeries such as medial patellofemoral ligament reconstruction. We propose a robust method to measure the 3D motion of multiple rigid objects with high accuracy using a series of bi-plane fluoroscopic images and a multi-resolution, intensity-based, 2D-3D registration. A Covariance Matrix Adaptation Evolution Strategy (CMA-ES) optimizer was used with a gradient correlation similarity metric. Four approaches to register three rigid objects (femur, tibia-fibula and patella) were implemented: 1) an individual bone approach registering one bone at a time, each with optimization of a six degrees of freedom (6DOF) parameter, 2) a sequential approach registering one bone at a time but using the previous bone results as the background in DRR generation, 3) a simultaneous approach registering all the bones together (18DOF) and 4) a combination of the sequential and the simultaneous approaches. These approaches were compared in experiments using simulated images generated from the CT of a healthy volunteer and measured fluoroscopic images. Over the 120 simulated frames of motion, the simultaneous approach showed improved registration accuracy compared to the individual approach: with less than 0.68mm root-mean-square error (RMSE) for translation and less than 1.12° RMSE for rotation. A robustness evaluation was conducted with 45 trials of a randomly perturbed initialization showed that the sequential approach improved robustness significantly (74% success rate) compared to the individual bone approach (34% success) for patella registration (femur and tibia-fibula registration had a 100% success rate with each approach).

  1. High-Frequency Ultrasonic Imaging of the Anterior Segment Using an Annular Array Transducer

    PubMed Central

    Silverman, Ronald H.; Ketterling, Jeffrey A.; Coleman, D. Jackson

    2006-01-01

    Objective Very-high-frequency (>35 MHz) ultrasound (VHFU) allows imaging of anterior segment structures of the eye with a resolution of less than 40-μm. The low focal ratio of VHFU transducers, however, results in a depth-of-field (DOF) of less than 1-mm. Our aim was to develop a high-frequency annular array transducer for ocular imaging with improved DOF, sensitivity and resolution compared to conventional transducers. Design Experimental Study Participants Cadaver eyes, ex vivo cow eyes, in vivo rabbit eyes. Methods A spherically curved annular array ultrasound transducer was fabricated. The array consisted of five concentric rings of equal area, had an overall aperture of 6 mm and a geometric focus of 12 mm. The nominal center frequency of all array elements was 40 MHz. An experimental system was designed in which a single array element was pulsed and echo data recorded from all elements. By sequentially pulsing each element, echo data were acquired for all 25 transmit/receive annuli combinations. The echo data were then synthetically focused and composite images produced. Transducer operation was tested by scanning a test object consisting of a series of 25-μm diameter wires spaced at increasing range from the transducer. Imaging capabilities of the annular array were demonstrated in ex vivo bovine, in vivo rabbit and human cadaver eyes. Main Outcome Measures Depth of field, resolution and sensitivity. Results The wire scans verified the operation of the array and demonstrated a 6.0 mm DOF compared to the 1.0 mm DOF of a conventional single-element transducer of comparable frequency, aperture and focal length. B-mode images of ex vivo bovine, in vivo rabbit and cadaver eyes showed that while the single-element transducer had high sensitivity and resolution within 1–2 mm of its focus, the array with synthetic focusing maintained this quality over a 6 mm DOF. Conclusion An annular array for high-resolution ocular imaging has been demonstrated. This technology offers improved depth-of-field, sensitivity and lateral resolution compared to single-element fixed focus transducers currently used for VHFU imaging of the eye. PMID:17141314

  2. SU-F-T-347: An Absolute Dose-Volume Constraint Based Deterministic Optimization Framework for Multi-Co60 Source Focused Radiotherapy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liang, B; Liu, B; Li, Y

    2016-06-15

    Purpose: Treatment plan optimization in multi-Co60 source focused radiotherapy with multiple isocenters is challenging, because dose distribution is normalized to maximum dose during optimization and evaluation. The objective functions are traditionally defined based on relative dosimetric distribution. This study presents an alternative absolute dose-volume constraint (ADC) based deterministic optimization framework (ADC-DOF). Methods: The initial isocenters are placed on the eroded target surface. Collimator size is chosen based on the area of 2D contour on corresponding axial slice. The isocenter spacing is determined by adjacent collimator sizes. The weights are optimized by minimizing the deviation from ADCs using the steepest descentmore » technique. An iterative procedure is developed to reduce the number of isocenters, where the isocenter with lowest weight is removed without affecting plan quality. The ADC-DOF is compared with the genetic algorithm (GA) using the same arbitrary shaped target (254cc), with a 15mm margin ring structure representing normal tissues. Results: For ADC-DOF, the ADCs imposed on target and ring are (D100>10Gy, D50,10, 0<12Gy, 15Gy and 20Gy) and (D40<10Gy). The resulting D100, 50, 10, 0 and D40 are (9.9Gy, 12.0Gy, 14.1Gy and 16.2Gy) and (10.2Gy). The objectives of GA are to maximize 50% isodose target coverage (TC) while minimize the dose delivered to the ring structure, which results in 97% TC and 47.2% average dose in ring structure. For ADC-DOF (GA) techniques, 20 out of 38 (10 out of 12) initial isocenters are used in the final plan, and the computation time is 8.7s (412.2s) on an i5 computer. Conclusion: We have developed a new optimization technique using ADC and deterministic optimization. Compared with GA, ADC-DOF uses more isocenters but is faster and more robust, and achieves a better conformity. For future work, we will focus on developing a more effective mechanism for initial isocenter determination.« less

  3. Integrating Human Factors into Crew Exploration Vehicle Design

    NASA Technical Reports Server (NTRS)

    Whitmore, Mihriban; Baggerman, Susan; Campbell, paul

    2007-01-01

    With NASA's new Vision for Exploration to send humans beyond Earth orbit, it is critical to consider the human as a system that demands early and continuous user involvement, and an iterative prototype/test/redesign process. Addressing human-system interface issues early on can be very cost effective even cost reducing when performed early in the design and development cycle. To achieve this goal within Crew Exploration Vehicle (CEV) Project Office, human engineering (HE) team is formed. Key tasks are to apply HE requirements and guidelines to hardware/software, and provide HE design, analysis and evaluation of crew interfaces. Initial activities included many practice-orientated evaluations using low-fidelity CEV mock-ups. What follows is a description of such evaluations that focused on a HE requirement regarding Net Habitable Volume (NHV). NHV is defined as the total remaining pressurized volume available to on-orbit crew after accounting for the loss of volume due to deployed hardware and structural inefficiencies which decrease functional volume. The goal of the NHV evaluations was to develop requirements providing sufficient CEV NHV for crewmembers to live and perform tasks in support of mission goals. Efforts included development of a standard NHV calculation method using computer models and physical mockups, and crew/ stakeholder evaluations. Nine stakeholders and ten crewmembers participated in the unsuited evaluations. Six crewmembers also participated in a suited evaluation. The mock-up was outfitted with volumetric representation of sub-systems such as seats, and stowage bags. Thirteen scenarios were developed to represent mission/crew tasks and considered to be primary volume drivers (e.g., suit donning) for the CEV. Unsuited evaluations included a structured walkthrough of these tasks. Suited evaluations included timed donning of the existing launch and entry suit to simulate a contingency scenario followed by doffing/ stowing of the suits. All mockup evaluations were videotaped. Structured questionnaires were used to document user interface issues and volume impacts of layout configuration. Computer model and physical measures of the NHV agreed within 1 percent. This included measurement of the gross habitable volume, subtraction of intrusive volumes, and other non-habitable spaces. Calculation method developed was validated as a standard means of measuring NHV, and was recommended as a verification method for the NHV requirements. Evaluations confirmed that there was adequate volume for unsuited scenarios and suit donning/ doffing activity. Seats, suit design stowage and waste hygiene system noted to be critical volume drivers. The low-fidelity mock-up evaluations along with human modeling analysis generated discussions that will lead to high-level systems requirements and human-centered design decisions. This approach allowed HE requirements and operational concepts to evolve in parallel with engineering system concepts and design requirements. As the CEV design matures, these evaluations will continue and help with design decisions, and assessment, verification and validation of HE requirements.

  4. A Sub-Millimetric 3-DOF Force Sensing Instrument with Integrated Fiber Bragg Grating for Retinal Microsurgery

    PubMed Central

    He, Xingchi; Handa, James; Gehlbach, Peter; Taylor, Russell; Iordachita, Iulian

    2013-01-01

    Vitreoretinal surgery requires very fine motor control to perform precise manipulation of the delicate tissue in the interior of the eye. Besides physiological hand tremor, fatigue, poor kinesthetic feedback, and patient movement, the absence of force sensing is one of the main technical challenges. Previous two degrees of freedom (DOF) force sensing instruments have demonstrated robust force measuring performance. The main design challenge is to incorporate high sensitivity axial force sensing. This paper reports the development of a sub-millimetric 3-DOF force sensing pick instrument based on fiber Bragg grating (FBG) sensors. The configuration of the four FBG sensors is arranged to maximize the decoupling between axial and transverse force sensing. A super-elastic nitinol flexure is designed to achieve high axial force sensitivity. An automated calibration system was developed for repeatability testing, calibration, and validation. Experimental results demonstrate a FBG sensor repeatability of 1.3 pm. The linear model for calculating the transverse forces provides an accurate global estimate. While the linear model for axial force is only locally accurate within a conical region with a 30° vertex angle, a second-order polynomial model can provide a useful global estimate for axial force. Combining the linear model for transverse forces and nonlinear model for axial force, the 3-DOF force sensing instrument can provide sub-millinewton resolution for axial force and a quarter millinewton for transverse forces. Validation with random samples show the force sensor can provide consistent and accurate measurement of three dimensional forces. PMID:24108455

  5. Performance assessment of a programmable five degrees-of-freedom motion platform for quality assurance of motion management techniques in radiotherapy.

    PubMed

    Huang, Chen-Yu; Keall, Paul; Rice, Adam; Colvill, Emma; Ng, Jin Aun; Booth, Jeremy T

    2017-09-01

    Inter-fraction and intra-fraction motion management methods are increasingly applied clinically and require the development of advanced motion platforms to facilitate testing and quality assurance program development. The aim of this study was to assess the performance of a 5 degrees-of-freedom (DoF) programmable motion platform HexaMotion (ScandiDos, Uppsala, Sweden) towards clinically observed tumor motion range, velocity, acceleration and the accuracy requirements of SABR prescribed in AAPM Task Group 142. Performance specifications for the motion platform were derived from literature regarding the motion characteristics of prostate and lung tumor targets required for real time motion management. The performance of the programmable motion platform was evaluated against (1) maximum range, velocity and acceleration (5 DoF), (2) static position accuracy (5 DoF) and (3) dynamic position accuracy using patient-derived prostate and lung tumor motion traces (3 DoF). Translational motion accuracy was compared against electromagnetic transponder measurements. Rotation was benchmarked with a digital inclinometer. The static accuracy and reproducibility for translation and rotation was <0.1 mm or <0.1°, respectively. The accuracy of reproducing dynamic patient motion was <0.3 mm. The motion platform's range met the need to reproduce clinically relevant translation and rotation ranges and its accuracy met the TG 142 requirements for SABR. The range, velocity and acceleration of the motion platform are sufficient to reproduce lung and prostate tumor motion for motion management. Programmable motion platforms are valuable tools in the investigation, quality assurance and commissioning of motion management systems in radiation oncology.

  6. Performance evaluation of nonlinear energy harvesting with magnetically coupled dual beams

    NASA Astrophysics Data System (ADS)

    Lan, Chunbo; Tang, Lihua; Qin, Weiyang

    2017-04-01

    To enhance the output power and broaden the operation bandwidth of vibration energy harvesters (VEH), nonlinear two degree-of-freedom (DOF) energy harvesters have attracted wide attention recently. In this paper, we investigate the performance of a nonlinear VEH with magnetically coupled dual beams and compare it with the typical Duffing-type VEH to find the advantages and drawbacks of this nonlinear 2-DOF VEH. First, based on the lumped parameter model, the characteristics of potential energy shapes and static equilibriums are analyzed. It is noted that the dual beam configuration is much easy to be transformed from a mono-stable state into a bi-stable state when the repulsive magnet force increases. Based on the equilibrium positions and different kinds of nonlinearities, four nonlinearity regimes are determined. Second, the performance of 1-DOF and 2-DOF configurations are compared respectively in these four nonlinearity regimes by simulating the forward sweep responses of these two nonlinear VEHs under different acceleration levels. Several meaningful conclusions are obtained. First, the main alternative to enlarge the operation bandwidth for dual-beam configuration is chaotic oscillation, in which two beams jump between two stable positions chaotically. However, the large-amplitude periodic oscillations, such as inter-well oscillation, cannot take place in both piezoelectric and parasitic beams at the same time. Generally speaking, both of the magnetically coupled dual-beam energy harvester and Duffingtype energy harvester, have their own advantages and disadvantages, while given a large enough base excitation, the maximum voltages of these two systems are almost the same in all these four regimes.

  7. Exoskeletal meal assistance system (EMAS II) for progressive muscle dystrophy patient.

    PubMed

    Hasegawa, Yasuhisa; Oura, Saori

    2011-01-01

    This paper introduces a 4-DOFs exoskeletal meal assistance system (EMAS II) for progressive muscle dystrophy patient. It is generally better for the patient to use his/her hands by himself in daily life because active works maintain level of residual functions, health and initiative of him/her. The EMAS II that has a new joystick-type user interface device and three-DOFs on a shoulder part is enhanced for an easier operation and more comfortable support on eating, as the succeeding model of the previous system that has two-DOFs on a shoulder. In order to control the 4-DOFs system by the simple user interface device, the EMAS II simulates upper limb motion patterns of a healthy person. The motion patterns are modeled by extracting correlations between the height of a user's wrist joint and that of the user's elbow joint at the table. Moreover, the EMAS II automatically brings user's hand up to his/her mouth or back to a table when he/she pushes a preset switch on the interface device. Therefore a user has only to control a position of his/her wrist to pick or scoop foods and then flip the switch to start automatic mode, while a height of the elbow joint is automatically controlled by the EMAS II itself. The results of experiments, where a healthy subject regarded as a muscle dystrophy patient eats a meal with EMAS II, show that the subject finished her meal in a natural way in 18 minutes 40 seconds which was within a recommended time of 30 minutes. © 2011 IEEE

  8. Six-degree-of-freedom guidance and control-entry analysis of the HL-20

    NASA Technical Reports Server (NTRS)

    Powell, Richard W.

    1993-01-01

    The ability of the HL-20 lifting body to fly has been evaluated for an automated entry from atmospheric interface to landing. This evaluation was required to demonstrate that not only successful touchdown conditions would be possible for this low lift-to-drag-ratio vehicle, but also the vehicle would not exceed its design dynamic pressure limit of 400 psf during entry. This dynamic pressure constraint limit, coupled with limited available pitch-control authority at low supersonic speeds, restricts the available maneuvering capability for the HL-20 to acquire the runway. One result of this analysis was that this restrictive maneuvering capability does not allow the use of a model-following atmospheric entry-guidance algorithm, such as that used by the Space Shuttle, but instead requires a more adaptable guidance algorithm. Therefore, for this analysis, a predictor-corrector guidance algorithm was developed that would provide successful touchdown conditions while not violating the dynamic pressure constraint. A flight-control system was designed and incorporated, along with the predictor-corrector guidance algorithm, into a six-DOF simulation. which showed that the HL-20 remained controllable and could reach the landing site and execute a successful landing under all off-nominal conditions simulated.

  9. Research on the parallel load sharing principle of a novel self-decoupled piezoelectric six-dimensional force sensor.

    PubMed

    Li, Ying-Jun; Yang, Cong; Wang, Gui-Cong; Zhang, Hui; Cui, Huan-Yong; Zhang, Yong-Liang

    2017-09-01

    This paper presents a novel integrated piezoelectric six-dimensional force sensor which can realize dynamic measurement of multi-dimensional space load. Firstly, the composition of the sensor, the spatial layout of force-sensitive components, and measurement principle are analyzed and designed. There is no interference of piezoelectric six-dimensional force sensor in theoretical analysis. Based on the principle of actual work and deformation compatibility coherence, this paper deduces the parallel load sharing principle of the piezoelectric six-dimensional force sensor. The main effect factors which affect the load sharing ratio are obtained. The finite element model of the piezoelectric six-dimensional force sensor is established. In order to verify the load sharing principle of the sensor, a load sharing test device of piezoelectric force sensor is designed and fabricated. The load sharing experimental platform is set up. The experimental results are in accordance with the theoretical analysis and simulation results. The experiments show that the multi-dimensional and heavy force measurement can be realized by the parallel arrangement of the load sharing ring and the force sensitive element in the novel integrated piezoelectric six-dimensional force sensor. The ideal load sharing effect of the sensor can be achieved by appropriate size parameters. This paper has an important guide for the design of the force measuring device according to the load sharing mode. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.

  10. A shuttle and space station manipulator system for assembly, docking, maintenance cargo handling and spacecraft retrieval (preliminary design). Volume 1: Management summary

    NASA Technical Reports Server (NTRS)

    1972-01-01

    A preliminary design is established for a general purpose manipulator system which can be used interchangeably on the shuttle and station and can be transferred back and forth between them. Control of the manipulator is accomplished by hard wiring from internal control stations in the shuttle or station. A variety of shuttle and station manipulator operations are considered including servicing the Large Space Telescope; however, emphasis is placed on unloading modules from the shuttle and assembling the space station. Simulation studies on foveal stereoscopic viewing and manipulator supervisory computer control have been accomplished to investigate the feasibility of their use in the manipulator system. The basic manipulator system consists of a single 18.3 m long, 7 degree of freedom (DOF), electrically acutated main boom with an auxiliary 3 DOF electrically actuated, extendible 18.3 m maximum length, lighting, and viewing boom. A 3 DOF orientor assembly is located at the tip of the viewing boom to provide camera pan, tilt, and roll.

  11. Comparing vegetation types and anthropic disturbance levels in the Atlantic forest: how do Pentatomoidea (Hemiptera: Heteroptera) assemblages respond?

    PubMed

    Bianchi, F M; Mendonça, M S; Campos, L A

    2014-12-01

    The Atlantic Forest (AF) is considered the most fragmented and endangered Brazilian biome. The diversity of phytophagous insects increases after disturbances in forests, and it was hypothesized the Pentatomidae can furnish ecologically reliable information in terms of diversity in response to the changes occurring in AF. Our aim was to quantify the response of assemblages of Pentatomoidea to gradient of human disturbance in two vegetation types of the AF-dense ombrophilous forest (DOF) and mixed ombrophilous forest (MOF). Twelve transects were grouped into environmental classes, namely open, intermediate, and closed. Overall, 1,017 pentatomoids were sampled, representing 64 species. The open environment was more abundant than closed environment, though it is expected that Pentatomoidea respond with increasing abundance when under light or moderate disturbance. The MOF was more abundant than DOF, and the composition differed between both of them. Given the differences in composition between MOF and DOF, abiotic variables are important factors acting as environmental filters for Pentatomoidea, not just directly on the insects, but probably also on the nutritional support of their host plants.

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Hailong; Vibration Control Lab, School of Electrical and Automation Engineering, Nanjing Normal University, Nanjing 210042; Zhang, Ning

    Magneto-rheological (MR) damper possesses inherent hysteretic characteristics. We investigate the resulting nonlinear behaviors of a two degree-of-freedom (2-DoF) MR vibration isolation system under harmonic external excitation. A MR damper is identified by employing the modified Bouc-wen hysteresis model. By numerical simulation, we characterize the nonlinear dynamic evolution of period-doubling, saddle node bifurcating and inverse period-doubling using bifurcation diagrams of variations in frequency with a fixed amplitude of the harmonic excitation. The strength of chaos is determined by the Lyapunov exponent (LE) spectrum. Semi-physical experiment on the 2-DoF MR vibration isolation system is proposed. We trace the time history and phasemore » trajectory under certain values of frequency of the harmonic excitation to verify the nonlinear dynamical evolution of period-doubling bifurcations to chaos. The largest LEs computed with the experimental data are also presented, confirming the chaotic motion in the experiment. We validate the chaotic motion caused by the hysteresis of the MR damper, and show the transitions between distinct regimes of stable motion and chaotic motion of the 2-DoF MR vibration isolation system for variations in frequency of external excitation.« less

  13. An Improved Adaptive Received Beamforming for Nested Frequency Offset and Nested Array FDA-MIMO Radar.

    PubMed

    Cheng, Sibei; Zhang, Qingjun; Bian, Mingming; Hao, Xinhong

    2018-02-08

    For the conventional FDA-MIMO (frequency diversity array multiple-input-multiple-output) Radar with uniform frequency offset and uniform linear array, the DOFs (degrees of freedom) of the adaptive beamformer are limited by the number of elements. A better performance-for example, a better suppression for strong interferences and a more desirable trade-off between the main lobe and side lobe-can be achieved with a greater number of DOFs. In order to obtain larger DOFs, this paper researches the signal model of the FDA-MIMO Radar with nested frequency offset and nested array, then proposes an improved adaptive beamforming method that uses the augmented matrix instead of the covariance matrix to calculate the optimum weight vectors and can be used to improve the output performances of FDA-MIMO Radar with the same element number or reduce the element number while maintain the approximate output performances such as the received beampattern, the main lobe width, side lobe depths and the output SINR (signal-to-interference-noise ratio). The effectiveness of the proposed scheme is verified by simulations.

  14. An Improved Adaptive Received Beamforming for Nested Frequency Offset and Nested Array FDA-MIMO Radar

    PubMed Central

    Cheng, Sibei; Zhang, Qingjun; Bian, Mingming; Hao, Xinhong

    2018-01-01

    For the conventional FDA-MIMO (frequency diversity array multiple-input-multiple-output) Radar with uniform frequency offset and uniform linear array, the DOFs (degrees of freedom) of the adaptive beamformer are limited by the number of elements. A better performance—for example, a better suppression for strong interferences and a more desirable trade-off between the main lobe and side lobe—can be achieved with a greater number of DOFs. In order to obtain larger DOFs, this paper researches the signal model of the FDA-MIMO Radar with nested frequency offset and nested array, then proposes an improved adaptive beamforming method that uses the augmented matrix instead of the covariance matrix to calculate the optimum weight vectors and can be used to improve the output performances of FDA-MIMO Radar with the same element number or reduce the element number while maintain the approximate output performances such as the received beampattern, the main lobe width, side lobe depths and the output SINR (signal-to-interference-noise ratio). The effectiveness of the proposed scheme is verified by simulations. PMID:29419814

  15. Torque Measurement of 3-DOF Haptic Master Operated by Controllable Electrorheological Fluid

    NASA Astrophysics Data System (ADS)

    Oh, Jong-Seok; Choi, Seung-Bok; Lee, Yang-Sub

    2015-02-01

    This work presents a torque measurement method of 3-degree-of-freedom (3-DOF) haptic master featuring controllable electrorheological (ER) fluid. In order to reflect the sense of an organ for a surgeon, the ER haptic master which can generate the repulsive torque of an organ is utilized as a remote controller for a surgery robot. Since accurate representation of organ feeling is essential for the success of the robot-assisted surgery, it is indispensable to develop a proper torque measurement method of 3-DOF ER haptic master. After describing the structural configuration of the haptic master, the torque models of ER spherical joint are mathematically derived based on the Bingham model of ER fluid. A new type of haptic device which has pitching, rolling, and yawing motions is then designed and manufactured using a spherical joint mechanism. Subsequently, the field-dependent parameters of the Bingham model are identified and generating repulsive torque according to applied electric field is measured. In addition, in order to verify the effectiveness of the proposed torque model, a comparative work between simulated and measured torques is undertaken.

  16. Transversely polarized sub-diffraction optical needle with ultra-long depth of focus

    NASA Astrophysics Data System (ADS)

    Guan, Jian; Lin, Jie; Chen, Chen; Ma, Yuan; Tan, Jiubin; Jin, Peng

    2017-12-01

    We generated purely transversely polarized sub-diffraction optical needles with ultra-long depth of focus (DOF) by focusing azimuthally polarized (AP) beams that were modulated by a vortex 0-2 π phase plate and binary phase diffraction optical elements (DOEs). The concentric belts' radii of the DOEs were optimized by a hybrid genetic particle swarm optimization (HGPSO) algorithm. For the focusing system with the numerical aperture (NA) of 0.95, an optical needle with the full width at half maximum (FWHM) of 0.40 λ and the DOF of 6.23 λ was generated. Similar optical needles were also generated by binary phase DOEs with different belts. The results demonstrated that the binary phase DOEs could achieve smaller FWHMs and longer DOFs simultaneously. The generated needles were circularly polarized on the z-axis and there were no longitudinally polarized components in the focal fields. The radius fabrication errors of a DOE have little effect on the optical needle produced by itself. The generated optical needles can be applied to the fields of photolithography, high-density optical data storage, microscope imaging and particle trapping.

  17. Robust spin-valley polarization in commensurate Mo S2 /graphene heterostructures

    NASA Astrophysics Data System (ADS)

    Du, Luojun; Zhang, Qian; Gong, Benchao; Liao, Mengzhou; Zhu, Jianqi; Yu, Hua; He, Rui; Liu, Kai; Yang, Rong; Shi, Dongxia; Gu, Lin; Yan, Feng; Zhang, Guangyu; Zhang, Qingming

    2018-03-01

    The investigation and control of quantum degrees of freedom (DoFs) of carriers lie at the heart of condensed-matter physics and next-generation electronics/optoelectronics. van der Waals heterostructures stacked from distinct two-dimensional (2D) crystals offer an unprecedented platform for combining the superior properties of individual 2D materials and manipulating spin, layer, and valley DoFs. Mo S2 /graphene heterostructures, harboring prominent spin-transport properties of graphene, giant spin-orbit coupling, and spin-valley polarization of Mo S2 , are predicted as a perfect venue for optospintronics. Here, we report the epitaxial growth of commensurate Mo S2 on graphene with high quality by chemical vapor deposition, and demonstrate robust temperature-independent spin-valley polarization at off-resonant excitation. We further show that the helicity of B exciton is larger than that of A exciton, allowing the manipulation of spin bits in the commensurate heterostructures by both optical helicity and wavelength. Our results open a window for controlling spin DoF by light and pave a way for taking spin qubits as information carriers in the next-generation valley-controlled optospintronics.

  18. Developing a 3-DOF Compliant Perching Arm for a Free-Flying Robot on the International Space Station

    NASA Technical Reports Server (NTRS)

    Park, In-Won; Smith, Marion F.; Sanchez, Hugo S.; Wong, Sze Wun; Piacenza, Pedro; Ciocarlie, Matei

    2017-01-01

    This paper presents the design and control of the 3-DOF compliant perching arm for the free-flying Astrobee robots that will operate inside the International Space Station (ISS). The robots are intended to serve as a flexible platform for future guest scientists to use for zero-gravity robotics research - thus, the arm is designed to support manipulation research. It provides a 1-DOF underactuated tendon-driven gripper capable of enveloping a range of objects of different shapes and sizes. Co-located RGB camera and LIDAR sensors provide perception. The Astrobee robots will be capable of grasping each other in flight, to simulate orbital capture scenarios. The arm's end-effector module is swappable on-orbit, allowing guest scientists to add upgraded grippers, or even additional arm degrees of freedom. The design of the arm balances research capabilities with Astrobee's operational need to perch on ISS handrails to reduce power consumption. Basic arm functioning and grip strength were evaluated using an integrated Astrobee prototype riding on a low-friction air bearing.

  19. Dynamic modeling and hierarchical compound control of a novel 2-DOF flexible parallel manipulator with multiple actuation modes

    NASA Astrophysics Data System (ADS)

    Liang, Dong; Song, Yimin; Sun, Tao; Jin, Xueying

    2018-03-01

    This paper addresses the problem of rigid-flexible coupling dynamic modeling and active control of a novel flexible parallel manipulator (PM) with multiple actuation modes. Firstly, based on the flexible multi-body dynamics theory, the rigid-flexible coupling dynamic model (RFDM) of system is developed by virtue of the augmented Lagrangian multipliers approach. For completeness, the mathematical models of permanent magnet synchronous motor (PMSM) and piezoelectric transducer (PZT) are further established and integrated with the RFDM of mechanical system to formulate the electromechanical coupling dynamic model (ECDM). To achieve the trajectory tracking and vibration suppression, a hierarchical compound control strategy is presented. Within this control strategy, the proportional-differential (PD) feedback controller is employed to realize the trajectory tracking of end-effector, while the strain and strain rate feedback (SSRF) controller is developed to restrain the vibration of the flexible links using PZT. Furthermore, the stability of the control algorithm is demonstrated based on the Lyapunov stability theory. Finally, two simulation case studies are performed to illustrate the effectiveness of the proposed approach. The results indicate that, under the redundant actuation mode, the hierarchical compound control strategy can guarantee the flexible PM achieves singularity-free motion and vibration attenuation within task workspace simultaneously. The systematic methodology proposed in this study can be conveniently extended for the dynamic modeling and efficient controller design of other flexible PMs, especially the emerging ones with multiple actuation modes.

  20. Enhancing depth of focus in tilted microfluidics channels by digital holography.

    PubMed

    Matrecano, Marcella; Paturzo, Melania; Finizio, Andrea; Ferraro, Pietro

    2013-03-15

    In this Letter we propose a method to enhance the limited depth of field (DOF) in optical imaging systems, through digital holography. The proposed approach is based on the introduction of a cubic phase plate into the diffraction integral, analogous to what occurs in white-light imaging systems. By this approach we show that it is possible to improve the DOF and to recover the extended focus image of a tilted object in a single reconstruction step. Moreover, we demonstrate the possibility of obtaining well-focused biological cells flowing into a tilted microfluidic channel.

  1. Through-focus optical characteristics of monofocal and bifocal soft contact lenses across the peripheral visual field.

    PubMed

    Ji, Qiuzhi; Yoo, Young-Sik; Alam, Hira; Yoon, Geunyoung

    2018-05-01

    To characterise the impact of monofocal soft contact lens (SCL) and bifocal SCLs on refractive error, depth of focus (DoF) and orientation of blur in the peripheral visual field. Monofocal and two bifocal SCLs, Acuvue Bifocal (AVB, Johnson & Johnson) and Misight Dual Focus (DF, CooperVision) with +2.0 D add power were modelled using a ray tracing program (ZEMAX) based on their power maps. These SCLs were placed onto the anterior corneal surface of the simulated Atchison myopic eye model to correct for -3.0 D spherical refractive error at the fovea. To quantify through-focus retinal image quality, defocus from -3.5 D to 1.5 D in 0.5 D steps was induced at each horizontal eccentricity from 0 to 40° in 10° steps. Wavefront aberrations were computed for each visual eccentricity and defocus. The retinal images were simulated using a custom software program developed in Matlab (The MathWorks) by convolving the point spread function calculated from the aberration with a reference image. The convolved images were spatially filtered to match the spatial resolution limit of each peripheral eccentricity. Retinal image quality was then quantified by the 2-D cross-correlation between the filtered convolved retinal images and the reference image. Peripheral defocus, DoF and orientation of blur were also estimated. In comparison with the monofocal SCL, the bifocal SCLs degraded retinal image quality while DoF was increased at fovea. From 10 to 20°, a relatively small amount of myopic shift (less than 0.3 D) was induced by bifocal SCLs compared with monofocal. DoF was also increased with bifocal SCLs at peripheral vision of 10 and 20°. The trend of myopic shift became less consistent at larger eccentricity, where at 30° DF showed a 0.75 D myopic shift while AVB showed a 0.2 D hyperopic shift and both AVB and DF exhibited large relative hyperopic defocus at 40°. The anisotropy in orientation of blur was found to increase and change its direction through focus beyond central vision. This trend was found to be less dominant with bifocal SCLs compared to monofocal SCL. Bifocal SCLs have a relatively small impact on myopic shift in peripheral refractive error while DoF is increased significantly. We hypothetically suggest that a mechanism underlying myopia control with these bifocal or multifocal contact lenses is an increase in DoF and a decrease in anisotropy of peripheral optical blur. © 2018 The Authors Ophthalmic & Physiological Optics © 2018 The College of Optometrists.

  2. Robot-aided therapy on the upper limb of subacute and chronic stroke patients: a biomechanical approach.

    PubMed

    Mazzoleni, S; Filippi, M; Carrozza, M C; Posteraro, F; Puzzolante, L; Falchi, E

    2011-01-01

    The goal of this study is to propose a methodology for evaluating recovery mechanisms in subacute and chronic post-stroke patients after a robot-aided upper-limb therapy, using a set of biomechanical parameters. Fifty-six post-stroke subjects, thirteen subacute and forty-three chronic patients participated in the study. A 2 dof robotic system, implementing an "assist-as-needed" control strategy, was used. Biomechanical parameters related (i) to the speed measured at the robot's end-effector and (ii) to the movement's smoothness were computed. Outcome clinical measures show a decrease in motor impairment after the treatment both in chronic and subacute patients. All the biomechanical parameters show an improvement between admission and discharge. Our results show that the robot-aided training can contribute to reduce the motor impairment in both subacute and chronic patients and identify neurophysiological mechanisms underlying the different stages of motor recovery. © 2011 IEEE

  3. A new six-degree-of-freedom force-reflecting hand controller for space telerobotics

    NASA Technical Reports Server (NTRS)

    Mcaffee, Douglas; Snow, Edward; Townsend, William; Robinson, Lee; Hanson, Joe

    1990-01-01

    A new 6 degree of freedom universal Force Reflecting Hand Controller (FRHC) was designed for use as the man-machine interface in teleoperated and telerobotic flight systems. The features of this new design include highly intuitive operation, excellent kinesthetic feedback, high fidelity force/torque feedback, a kinematically simple structure, mechanically decoupled motion in all 6 DOF, good back-drivability, and zero backlash. In addition, the new design has a much larger work envelope, smaller stowage volume, greater stiffness and responsiveness, and better overlap of the human operator's range of motion than do previous designs. The utility and basic operation of a new, flight prototype FRHC called the Model X is briefly discussed. The design heritage, general design goals, and design implementation of this advanced new generation of FRHCs are presented, followed by a discussion of basic features and the results of initial testing.

  4. New Terfenol-D actuator design with applications to multiple DOF active vibration control

    NASA Astrophysics Data System (ADS)

    Haynes, Leonard S.; Geng, Zheng J.; Teter, Joseph P.

    1993-09-01

    A linear actuator system for multi-dimensional structure control using the magnetostrictive material Terfenol-D has been designed, built, and tested by the Intelligent Automation, Inc. The actuator assembly incorporates an instrumented Terfenol-D rod, an excitation coil to provide the magnetic field, a permanent magnet assembly to provide a magnetic bias field, and a mechanical preload mechanism. The prototype of the actuator is 2.0 inches in diameter and 8 inches long, and provides a peak-to-peak stroke of 0.01 inches. A linear model was also established to characterize the behavior of the actuator for small motion. Based on the prototype of the actuator, we have performed a study of a six degree-of-freedom active vibration isolation system using a Stewart Platform in a new configuration. IAI's final system is intended for precision control of a wide range of space-based structures as well as earth- base systems.

  5. Gain scheduled linear quadratic control for quadcopter

    NASA Astrophysics Data System (ADS)

    Okasha, M.; Shah, J.; Fauzi, W.; Hanouf, Z.

    2017-12-01

    This study exploits the dynamics and control of quadcopters using Linear Quadratic Regulator (LQR) control approach. The quadcopter’s mathematical model is derived using the Newton-Euler method. It is a highly manoeuvrable, nonlinear, coupled with six degrees of freedom (DOF) model, which includes aerodynamics and detailed gyroscopic moments that are often ignored in many literatures. The linearized model is obtained and characterized by the heading angle (i.e. yaw angle) of the quadcopter. The adopted control approach utilizes LQR method to track several reference trajectories including circle and helix curves with significant variation in the yaw angle. The controller is modified to overcome difficulties related to the continuous changes in the operating points and eliminate chattering and discontinuity that is observed in the control input signal. Numerical non-linear simulations are performed using MATLAB and Simulink to illustrate to accuracy and effectiveness of the proposed controller.

  6. Design of teleoperation system with a force-reflecting real-time simulator

    NASA Technical Reports Server (NTRS)

    Hirata, Mitsunori; Sato, Yuichi; Nagashima, Fumio; Maruyama, Tsugito

    1994-01-01

    We developed a force-reflecting teleoperation system that uses a real-time graphic simulator. This system eliminates the effects of communication time delays in remote robot manipulation. The simulator provides the operator with predictive display and feedback of computed contact forces through a six-degree of freedom (6-DOF) master arm on a real-time basis. With this system, peg-in-hole tasks involving round-trip communication time delays of up to a few seconds were performed at three support levels: a real image alone, a predictive display with a real image, and a real-time graphic simulator with computed-contact-force reflection and a predictive display. The experimental results indicate the best teleoperation efficiency was achieved by using the force-reflecting simulator with two images. The shortest work time, lowest sensor maximum, and a 100 percent success rate were obtained. These results demonstrate the effectiveness of simulated-force-reflecting teleoperation efficiency.

  7. Slice-selective RF pulses for in vivo B1+ inhomogeneity mitigation at 7 tesla using parallel RF excitation with a 16-element coil.

    PubMed

    Setsompop, Kawin; Alagappan, Vijayanand; Gagoski, Borjan; Witzel, Thomas; Polimeni, Jonathan; Potthast, Andreas; Hebrank, Franz; Fontius, Ulrich; Schmitt, Franz; Wald, Lawrence L; Adalsteinsson, Elfar

    2008-12-01

    Slice-selective RF waveforms that mitigate severe B1+ inhomogeneity at 7 Tesla using parallel excitation were designed and validated in a water phantom and human studies on six subjects using a 16-element degenerate stripline array coil driven with a butler matrix to utilize the eight most favorable birdcage modes. The parallel RF waveform design applied magnitude least-squares (MLS) criteria with an optimized k-space excitation trajectory to significantly improve profile uniformity compared to conventional least-squares (LS) designs. Parallel excitation RF pulses designed to excite a uniform in-plane flip angle (FA) with slice selection in the z-direction were demonstrated and compared with conventional sinc-pulse excitation and RF shimming. In all cases, the parallel RF excitation significantly mitigated the effects of inhomogeneous B1+ on the excitation FA. The optimized parallel RF pulses for human B1+ mitigation were only 67% longer than a conventional sinc-based excitation, but significantly outperformed RF shimming. For example the standard deviations (SDs) of the in-plane FA (averaged over six human studies) were 16.7% for conventional sinc excitation, 13.3% for RF shimming, and 7.6% for parallel excitation. This work demonstrates that excitations with parallel RF systems can provide slice selection with spatially uniform FAs at high field strengths with only a small pulse-duration penalty. (c) 2008 Wiley-Liss, Inc.

  8. Lithographic qualification of high-transmission mask blank for 10nm node and beyond

    NASA Astrophysics Data System (ADS)

    Xu, Yongan; Faure, Tom; Viswanathan, Ramya; Lobb, Granger; Wistrom, Richard; Burns, Sean; Hu, Lin; Graur, Ioana; Bleiman, Ben; Fischer, Dan; Mignot, Yann; Sakamoto, Yoshifumi; Toda, Yusuke; Bolton, John; Bailey, Todd; Felix, Nelson; Arnold, John; Colburn, Matthew

    2016-04-01

    In this paper, we discuss the lithographic qualification of high transmission (High T) mask for Via and contact hole applications in 10nm node and beyond. First, the simulated MEEF and depth of focus (DoF) data are compared between the 6% and High T attnPSM masks with the transmission of High T mask blank varying from 12% to 20%. The 12% High T blank shows significantly better MEEF and larger DoF than those of 6% attnPSM mask blank, which are consistent with our wafer data. However, the simulations show no obvious advantage in MEEF and DoF when the blank transmittance is larger than 12%. From our wafer data, it has been seen that the common process window from High T mask is 40nm bigger than that from the 6% attnPSM mask. In the elongated bar structure with smaller aspect ratio, 1.26, the 12% High T mask shows significantly less develop CD pull back in the major direction. Compared to the High T mask, the optimized new illumination condition for 6% attnPSM shows limited improvement in MEEF and the DoF through pitch. In addition, by using the High T mask blank, we have also investigated the SRAF printing, side lobe printing and the resist profile through cross sections, and no patterning risk has been found for manufacturing. As part of this work new 12% High T mask blank materials and processes were developed, and a brief overview of key mask technology development results have been shared. Overall, it is concluded that the High T mask, 12% transmission, provides the most robust and extendable lithographic solution for 10nm node and beyond.

  9. The opercular mouth-opening mechanism of largemouth bass functions as a 3D four-bar linkage with three degrees of freedom.

    PubMed

    Olsen, Aaron M; Camp, Ariel L; Brainerd, Elizabeth L

    2017-12-15

    The planar, one degree of freedom (1-DoF) four-bar linkage is an important model for understanding the function, performance and evolution of numerous biomechanical systems. One such system is the opercular mechanism in fishes, which is thought to function like a four-bar linkage to depress the lower jaw. While anatomical and behavioral observations suggest some form of mechanical coupling, previous attempts to model the opercular mechanism as a planar four-bar have consistently produced poor model fits relative to observed kinematics. Using newly developed, open source mechanism fitting software, we fitted multiple three-dimensional (3D) four-bar models with varying DoF to in vivo kinematics in largemouth bass to test whether the opercular mechanism functions instead as a 3D four-bar with one or more DoF. We examined link position error, link rotation error and the ratio of output to input link rotation to identify a best-fit model at two different levels of variation: for each feeding strike and across all strikes from the same individual. A 3D, 3-DoF four-bar linkage was the best-fit model for the opercular mechanism, achieving link rotational errors of less than 5%. We also found that the opercular mechanism moves with multiple degrees of freedom at the level of each strike and across multiple strikes. These results suggest that active motor control may be needed to direct the force input to the mechanism by the axial muscles and achieve a particular mouth-opening trajectory. Our results also expand the versatility of four-bar models in simulating biomechanical systems and extend their utility beyond planar or single-DoF systems. © 2017. Published by The Company of Biologists Ltd.

  10. Use of ultraviolet-fluorescence-based simulation in evaluation of personal protective equipment worn for first assessment and care of a patient with suspected high-consequence infectious disease.

    PubMed

    Hall, S; Poller, B; Bailey, C; Gregory, S; Clark, R; Roberts, P; Tunbridge, A; Poran, V; Evans, C; Crook, B

    2018-06-01

    Variations currently exist across the UK in the choice of personal protective equipment (PPE) used by healthcare workers when caring for patients with suspected high-consequence infectious diseases (HCIDs). To test the protection afforded to healthcare workers by current PPE ensembles during assessment of a suspected HCID case, and to provide an evidence base to justify proposal of a unified PPE ensemble for healthcare workers across the UK. One 'basic level' (enhanced precautions) PPE ensemble and five 'suspected case' PPE ensembles were evaluated in volunteer trials using 'Violet'; an ultraviolet-fluorescence-based simulation exercise to visualize exposure/contamination events. Contamination was photographed and mapped. There were 147 post-simulation and 31 post-doffing contamination events, from a maximum of 980, when evaluating the basic level of PPE. Therefore, this PPE ensemble did not afford adequate protection, primarily due to direct contamination of exposed areas of the skin. For the five suspected case ensembles, 1584 post-simulation contamination events were recorded, from a maximum of 5110. Twelve post-doffing contamination events were also observed (face, two events; neck, one event; forearm, one event; lower legs, eight events). All suspected case PPE ensembles either had post-doffing contamination events or other significant disadvantages to their use. This identified the need to design a unified PPE ensemble and doffing procedure, incorporating the most protective PPE considered for each body area. This work has been presented to, and reviewed by, key stakeholders to decide on a proposed unified ensemble, subject to further evaluation. Crown Copyright © 2018. Published by Elsevier Ltd. All rights reserved.

  11. Modified Monovision With Spherical Aberration to Improve Presbyopic Through-Focus Visual Performance

    PubMed Central

    Zheleznyak, Len; Sabesan, Ramkumar; Oh, Je-Sun; MacRae, Scott; Yoon, Geunyoung

    2013-01-01

    Purpose. To investigate the impact on visual performance of modifying monovision with monocularly induced spherical aberration (SA) to increase depth of focus (DoF), thereby enhancing binocular through-focus visual performance. Methods. A binocular adaptive optics (AO) vision simulator was used to correct both eyes' native aberrations and induce traditional (TMV) and modified (MMV) monovision corrections. TMV was simulated with 1.5 diopters (D) of anisometropia (dominant eye at distance, nondominant eye at near). Zernike primary SA was induced in the nondominant eye in MMV. A total of four MMV conditions were tested with various amounts of SA (±0.2 and ±0.4 μm) and fixed anisometropia (1.5 D). Monocular and binocular visual acuity (VA) and contrast sensitivity (CS) at 10 cyc/deg and binocular summation were measured through-focus in three cyclopledged subjects with 4-mm pupils. Results. MMV with positive SA had a larger benefit for intermediate distances (1.5 lines at 1.0 D) than with negative SA, compared with TMV. Negative SA had a stronger benefit in VA at near. DoF of all MMV conditions was 3.5 ± 0.5 D (mean) as compared with TMV (2.7 ± 0.3 D). Through-focus CS at 10 cyc/deg was significantly reduced with MMV as compared to TMV only at intermediate object distances, however was unaffected at distance. Binocular summation was absent at all object distances except 0.5 D, where it improved in MMV by 19% over TMV. Conclusions. Modified monovision with SA improves through-focus VA and DoF as compared with traditional monovision. Binocular summation also increased as interocular similarity of image quality increased due to extended monocular DoF. PMID:23557742

  12. Sensor fusion and computer vision for context-aware control of a multi degree-of-freedom prosthesis

    NASA Astrophysics Data System (ADS)

    Markovic, Marko; Dosen, Strahinja; Popovic, Dejan; Graimann, Bernhard; Farina, Dario

    2015-12-01

    Objective. Myoelectric activity volitionally generated by the user is often used for controlling hand prostheses in order to replicate the synergistic actions of muscles in healthy humans during grasping. Muscle synergies in healthy humans are based on the integration of visual perception, heuristics and proprioception. Here, we demonstrate how sensor fusion that combines artificial vision and proprioceptive information with the high-level processing characteristics of biological systems can be effectively used in transradial prosthesis control. Approach. We developed a novel context- and user-aware prosthesis (CASP) controller integrating computer vision and inertial sensing with myoelectric activity in order to achieve semi-autonomous and reactive control of a prosthetic hand. The presented method semi-automatically provides simultaneous and proportional control of multiple degrees-of-freedom (DOFs), thus decreasing overall physical effort while retaining full user control. The system was compared against the major commercial state-of-the art myoelectric control system in ten able-bodied and one amputee subject. All subjects used transradial prosthesis with an active wrist to grasp objects typically associated with activities of daily living. Main results. The CASP significantly outperformed the myoelectric interface when controlling all of the prosthesis DOF. However, when tested with less complex prosthetic system (smaller number of DOF), the CASP was slower but resulted with reaching motions that contained less compensatory movements. Another important finding is that the CASP system required minimal user adaptation and training. Significance. The CASP constitutes a substantial improvement for the control of multi-DOF prostheses. The application of the CASP will have a significant impact when translated to real-life scenarious, particularly with respect to improving the usability and acceptance of highly complex systems (e.g., full prosthetic arms) by amputees.

  13. Acquiring neural signals for developing a perception and cognition model

    NASA Astrophysics Data System (ADS)

    Li, Wei; Li, Yunyi; Chen, Genshe; Shen, Dan; Blasch, Erik; Pham, Khanh; Lynch, Robert

    2012-06-01

    The understanding of how humans process information, determine salience, and combine seemingly unrelated information is essential to automated processing of large amounts of information that is partially relevant, or of unknown relevance. Recent neurological science research in human perception, and in information science regarding contextbased modeling, provides us with a theoretical basis for using a bottom-up approach for automating the management of large amounts of information in ways directly useful for human operators. However, integration of human intelligence into a game theoretic framework for dynamic and adaptive decision support needs a perception and cognition model. For the purpose of cognitive modeling, we present a brain-computer-interface (BCI) based humanoid robot system to acquire brainwaves during human mental activities of imagining a humanoid robot-walking behavior. We use the neural signals to investigate relationships between complex humanoid robot behaviors and human mental activities for developing the perception and cognition model. The BCI system consists of a data acquisition unit with an electroencephalograph (EEG), a humanoid robot, and a charge couple CCD camera. An EEG electrode cup acquires brainwaves from the skin surface on scalp. The humanoid robot has 20 degrees of freedom (DOFs); 12 DOFs located on hips, knees, and ankles for humanoid robot walking, 6 DOFs on shoulders and arms for arms motion, and 2 DOFs for head yaw and pitch motion. The CCD camera takes video clips of the human subject's hand postures to identify mental activities that are correlated to the robot-walking behaviors. We use the neural signals to investigate relationships between complex humanoid robot behaviors and human mental activities for developing the perception and cognition model.

  14. Hybrid Imaging for Extended Depth of Field Microscopy

    NASA Astrophysics Data System (ADS)

    Zahreddine, Ramzi Nicholas

    An inverse relationship exists in optical systems between the depth of field (DOF) and the minimum resolvable feature size. This trade-off is especially detrimental in high numerical aperture microscopy systems where resolution is pushed to the diffraction limit resulting in a DOF on the order of 500 nm. Many biological structures and processes of interest span over micron scales resulting in significant blurring during imaging. This thesis explores a two-step computational imaging technique known as hybrid imaging to create extended DOF (EDF) microscopy systems with minimal sacrifice in resolution. In the first step a mask is inserted at the pupil plane of the microscope to create a focus invariant system over 10 times the traditional DOF, albeit with reduced contrast. In the second step the contrast is restored via deconvolution. Several EDF pupil masks from the literature are quantitatively compared in the context of biological microscopy. From this analysis a new mask is proposed, the incoherently partitioned pupil with binary phase modulation (IPP-BPM), that combines the most advantageous properties from the literature. Total variation regularized deconvolution models are derived for the various noise conditions and detectors commonly used in biological microscopy. State of the art algorithms for efficiently solving the deconvolution problem are analyzed for speed, accuracy, and ease of use. The IPP-BPM mask is compared with the literature and shown to have the highest signal-to-noise ratio and lowest mean square error post-processing. A prototype of the IPP-BPM mask is fabricated using a combination of 3D femtosecond glass etching and standard lithography techniques. The mask is compared against theory and demonstrated in biological imaging applications.

  15. Sensor fusion and computer vision for context-aware control of a multi degree-of-freedom prosthesis.

    PubMed

    Markovic, Marko; Dosen, Strahinja; Popovic, Dejan; Graimann, Bernhard; Farina, Dario

    2015-12-01

    Myoelectric activity volitionally generated by the user is often used for controlling hand prostheses in order to replicate the synergistic actions of muscles in healthy humans during grasping. Muscle synergies in healthy humans are based on the integration of visual perception, heuristics and proprioception. Here, we demonstrate how sensor fusion that combines artificial vision and proprioceptive information with the high-level processing characteristics of biological systems can be effectively used in transradial prosthesis control. We developed a novel context- and user-aware prosthesis (CASP) controller integrating computer vision and inertial sensing with myoelectric activity in order to achieve semi-autonomous and reactive control of a prosthetic hand. The presented method semi-automatically provides simultaneous and proportional control of multiple degrees-of-freedom (DOFs), thus decreasing overall physical effort while retaining full user control. The system was compared against the major commercial state-of-the art myoelectric control system in ten able-bodied and one amputee subject. All subjects used transradial prosthesis with an active wrist to grasp objects typically associated with activities of daily living. The CASP significantly outperformed the myoelectric interface when controlling all of the prosthesis DOF. However, when tested with less complex prosthetic system (smaller number of DOF), the CASP was slower but resulted with reaching motions that contained less compensatory movements. Another important finding is that the CASP system required minimal user adaptation and training. The CASP constitutes a substantial improvement for the control of multi-DOF prostheses. The application of the CASP will have a significant impact when translated to real-life scenarious, particularly with respect to improving the usability and acceptance of highly complex systems (e.g., full prosthetic arms) by amputees.

  16. Design and real-time control of a robotic system for fracture manipulation.

    PubMed

    Dagnino, G; Georgilas, I; Tarassoli, P; Atkins, R; Dogramadzi, S

    2015-08-01

    This paper presents the design, development and control of a new robotic system for fracture manipulation. The objective is to improve the precision, ergonomics and safety of the traditional surgical procedure to treat joint fractures. The achievements toward this direction are here reported and include the design, the real-time control architecture and the evaluation of a new robotic manipulator system. The robotic manipulator is a 6-DOF parallel robot with the struts developed as linear actuators. The control architecture is also described here. The high-level controller implements a host-target structure composed by a host computer (PC), a real-time controller, and an FPGA. A graphical user interface was designed allowing the surgeon to comfortably automate and monitor the robotic system. The real-time controller guarantees the determinism of the control algorithms adding an extra level of safety for the robotic automation. The system's positioning accuracy and repeatability have been demonstrated showing a maximum positioning RMSE of 1.18 ± 1.14mm (translations) and 1.85 ± 1.54° (rotations).

  17. Development master arm of 2-DOF planar parallel manipulator for In-Vitro Fertilization

    NASA Astrophysics Data System (ADS)

    Thamrongaphichartkul, Kitti; Vongbunyong, Supachai; Nuntakarn, Lalana

    2018-01-01

    Micromanipulator is a mechanical device used for manipulating miniature objects in the order of micron. It is widely used in In-Vitro Fertilization (IVF) in which sperms will be held in a micro-needle and penetrate to an oocyte for fertilization. IVF needs to be performed by high skill embryologists to control the movement of the needle accurately due to the lack of tactile perception of the user. Haptic device is a device that can transmit and simulate position, velocity and force in order to enhance interaction between the user and system. However, commercially available haptic devices have unnecessary degrees of freedom and limited workspace which are inappropriate for IVF process. This paper focuses on development of a haptic device for using in IVF process. It will be used as a master arm for the master-slave system for IVF process in order to enhance the ability of users to control the micromanipulator. As a result, the embryologist is able to carry out the IVF process more effectively with having tactile perception.

  18. The contact condition influence on stability and energy efficiency of quadruped robot

    NASA Astrophysics Data System (ADS)

    Lei, Jingtao; Wang, Tianmiao; Gao, Feng

    2008-10-01

    Quadruped robot has attribute of serial and parallel manipulator with multi-loop mechanism, with more DOF of each leg and intermittent contact with ground during walking, the trot gait of quadruped robot belongs to dynamic waking, compared to the crawl gait, the walking speed is higher, but the robot becomes unstable, it is difficult to keep dynamically stable walking. In this paper, we mainly analyze the condition for the quadruped robot to realize dynamically stable walking, establish centroid orbit equation based on ZMP (Zero Moment Point) stability theory, on the other hand , we study contact impact and friction influence on stability and energy efficiency. Because of the periodic contact between foots and ground, the contact impact and friction are considered to establish spring-damp nonlinear dynamics model. Robot need to be controlled to meet ZMP stability condition and contact constraint condition. Based on the virtual prototyping model, we study control algorithm considering contact condition, the contact compensator and friction compensator are adopted. The contact force and the influence of different contact conditions on the energy efficiency during whole gait cycle are obtained.

  19. Size Effect of Ground Patterns on FM-Band Cross-Talks between Two Parallel Signal Traces of Printed Circuit Boards for Vehicles

    NASA Astrophysics Data System (ADS)

    Iida, Michihira; Maeno, Tsuyoshi; Wang, Jianqing; Fujiwara, Osamu

    Electromagnetic disturbances in vehicle-mounted radios are mainly caused by conducted noise currents flowing through wiring-harnesses from vehicle-mounted printed circuit boards (PCBs) with common slitting ground patterns. To suppress these kinds of noise currents, we previously measured them for simple two-layer PCBs with two parallel signal traces and slitting or non-slitting ground patterns, and then investigated by the FDTD simulation the reduction characteristics of the FM-band cross-talk noise levels between two parallel signal traces on six simple PCB models having different slitting ground or different divided ground patterns parallel to the traces. As a result, we found that the contributory factor for the FM-band cross-talk reduction is the reduction of mutual inductance between the two parallel traces, and also the noise currents from PCBs can rather be suppressed even if the size of the return ground becomes small. In this study, to investigate this finding, we further simulated the frequency characteristics of cross-talk reduction for additional six simple PCB models with different dividing dimensions ground patterns parallel to the traces, which revealed an interesting phenomenon that cross-talk reduction characteristics do not always decrease with increasing the width between the divided ground patterns.

  20. SU-E-T-234: Daily Quality Assurance for a Six Degrees of Freedom Couch Using a Novel Phantom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Woods, K; Woollard, J; Ayan, A

    2015-06-15

    Purpose: To test the accuracy and reproducibility of both translational and rotational movements for a couch with six degrees of freedom (6DoF) using a novel phantom design Methods: An end-to-end test was carried out using two different phantoms. A 6 cm3 cube with a central fiducial BB (WL-QA Sun Nuclear) and a custom fabricated rectangular prism (31 cm x 8 cm x 8 cm), placed on a baseplate with known angular offsets for pitch, roll and yaw with a central fiducial BB and unique surface structures for registration purposes, were used. The end-to-end test included an initial CT simulation formore » a reference study, setup to an offset mark on each phantom, registration of the reference CT to the acquired cone-beam CT, and final Winston-Lutz delivery at four cardinal gantry angles. Results for both translational and rotational movements were recorded and compared for both phantoms. Results: Translational and rotational measurements were performed with a PerfectPitch (Varian) couch for 10 trials for both phantoms. Distinct translational shifts were [−5.372±0.384mm, −10.183±0.137mm, 14.028±0.155mm] for the cube and [7.520±0.159mm, −9.117±0.101mm, 16.273±0.115mm] for the prototype phantom for lateral, longitudinal, and vertical shifts, respectively. Distinct rotational adjustments were [1.121±0.102o, −1.067±0.235o, −2.662±0.380o] for the cube and [2.534±0.059o, 1.994±0.025o, 2.094±0.076o] for the prototype for pitch, roll, and yaw, respectively. Winston-Lutz test results performed after 6DoF couch correction from each cardinal gantry angle ranged from 0.26–0.72mm for the cube and 0.55–0.86mm for the prototype. Conclusion: The prototype phantom is more precise for both translational and rotational adjustments compared to a commercial phantom. The design of the prototype phantom allows for a more discernible visual confirmation of correct translational and rotational adjustments with the prototype phantom. Winston-Lutz results are more accurate for the commercial phantom but are still within tolerance for the prototype phantom.« less

Top