Eight-Channel Continuous Timer

NASA Technical Reports Server (NTRS)

Cole, Steven

2004-01-01

A custom laboratory electronic timer circuit measures the durations of successive cycles of nominally highly stable input clock signals in as many as eight channels, for the purpose of statistically quantifying the small instabilities of these signals. The measurement data generated by this timer are sent to a personal computer running software that integrates the measurements to form a phase residual for each channel and uses the phase residuals to compute Allan variances for each channel. (The Allan variance is a standard statistical measure of instability of a clock signal.) Like other laboratory clock-cycle-measuring circuits, this timer utilizes an externally generated reference clock signal having a known frequency (100 MHz) much higher than the frequencies of the input clock signals (between 100 and 120 Hz). It counts the number of reference-clock cycles that occur between successive rising edges of each input clock signal of interest, thereby affording a measurement of the input clock-signal period to within the duration (10 ns) of one reference clock cycle. Unlike typical prior laboratory clock-cycle-measuring circuits, this timer does not skip some cycles of the input clock signals. The non-cycle-skipping feature is an important advantage because in applications that involve integration of measurements over long times for characterizing nominally highly stable clock signals, skipping cycles can degrade accuracy. The timer includes a field-programmable gate array that functions as a 20-bit counter running at the reference clock rate of 100 MHz. The timer also includes eight 20-bit latching circuits - one for each channel - at the output terminals of the counter. Each transition of an input signal from low to high causes the corresponding latching circuit to latch the count at that instant. Each such transition also sets a status flip-flop circuit to indicate the presence of the latched count. A microcontroller reads the values of all eight status flipflops and then reads the latched count for each channel for which the flip-flop indicates the presence of a count. Reading the count for each channel automatically causes the flipflop of that channel to be reset. The microcontroller places the counts in time order, identifies the channel number for each count, and transmits these data to the personal computer.

Bioenergy | National Agricultural Library

Science.gov Websites

Skip to main content Home National Agricultural Library United States Department of Agriculture Ag , graphs), Agricultural Products html Data from: Comparative farm-gate life cycle assessment of oilseed registered trademark of Dries Buytaert. NAL Home | USDA.gov | Agricultural Research Service | Plain Language

Improved moving window cross-spectral analysis for resolving large temporal seismic velocity changes in permafrost

DOE PAGES

James, S. R.; Knox, H. A.; Abbott, R. E.; ...

2017-04-13

Cross correlations of seismic noise can potentially record large changes in subsurface velocity due to permafrost dynamics and be valuable for long-term Arctic monitoring. We applied seismic interferometry, using moving window cross-spectral analysis (MWCS), to 2 years of ambient noise data recorded in central Alaska to investigate whether seismic noise could be used to quantify relative velocity changes due to seasonal active-layer dynamics. The large velocity changes (>75%) between frozen and thawed soil caused prevalent cycle-skipping which made the method unusable in this setting. We developed an improved MWCS procedure which uses a moving reference to measure daily velocity variationsmore » that are then accumulated to recover the full seasonal change. This approach reduced cycle-skipping and recovered a seasonal trend that corresponded well with the timing of active-layer freeze and thaw. Lastly, this improvement opens the possibility of measuring large velocity changes by using MWCS and permafrost monitoring by using ambient noise.« less

A Computer Model of a Phase Lock Loop

NASA Technical Reports Server (NTRS)

Shelton, Ralph Paul

1973-01-01

A computer model is reported of a PLL (phase-lock loop), preceded by a bandpass filter, which is valid when the bandwidth of the bandpass filter is of the same order of magnitude as the natural frequency of the PLL. New results for the PLL natural frequency equal to the bandpass filter bandwidth are presented for a second order PLL operating with carrier plus noise as the input. However, it is shown that extensions to higher order loops, and to the case of a modulated carrier are straightforward. The new results presented give the cycle skipping rate of the PLL as a function of the input carrier to noise ratio when the PLL natural frequency is equal to the bandpass filter bandwidth. Preliminary results showing the variation of the output noise power and cycle skipping rates of the PLL as a function of the loop damping ratio for the PLL natural frequency equal to the bandpass filter bandwidth are also included.

Rice cyclophilin OsCYP18-2 is translocated to the nucleus by an interaction with SKIP and enhances drought tolerance in rice and Arabidopsis.

PubMed

Lee, Sang Sook; Park, Hyun Ji; Yoon, Dae Hwa; Kim, Beom-Gi; Ahn, Jun Cheul; Luan, Sheng; Cho, Hye Sun

2015-10-01

Cyclophilin 18-2 (CYP18-2) genes, homologues of human peptidyl-prolyl isomerase-like 1 (PPiL1), are conserved across multicellular organisms and Schizosaccharomyces pombe. Although PPiL1 is known to interact with ski-interacting protein (SKIP), a transcriptional co-regulator and spliceosomal component, there have been no functional analyses of PPiL1 homologues in plants. Rice cyclophilin 18-2 (OsCYP18-2) bound directly to amino acids 56-95 of OsSKIP and its binding was independent of cyclosporin A, a cyclophilin-binding drug. Moreover, OsCYP18-2 exhibited PPIase activity regardless of its interaction with OsSKIP. Therefore, the binding site for OsCYP18-2's interaction with SKIP was distinct from the PPIase active site. OsCYP18-2's interaction with SKIP full-length protein enabled OsCYP18-2's translocation from the cytoplasm into the nucleus and AtSKIP interacted in planta with both AtCYP18-2 and OsCYP18-2. Drought and salt stress induced similar expression of OsCYP18-2 and OsSKIP. Overexpression of OsCYP18-2 in transgenic rice and Arabidopsis thaliana plants enhanced drought tolerance and altered expression and pre-mRNA splicing patterns of stress-related genes in Arabidopsis under drought conditions. Furthermore, OsCYP18-2 caused transcriptional activation with/without OsSKIP in the GAL4 system of yeast; thus the OsSKIP-OsCYP18-2 interaction has an important role in the transcriptional and post-transcriptional regulation of stress-related genes and increases tolerance to drought stress. © 2015 John Wiley & Sons Ltd.

The climate system as a ticking clock

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kerr, R.A.

1990-09-14

Climate researchers are picking up a more or less regular 2-year beat to the global climate system - one that seems to be heard from every quarter. The most recently discovered example of this climatic ticking - and perhaps the most intriguing - comes from the very core of El Nino. Researchers have found that some aspects of this cycle of alternating warm and relatively cold waters along the equatorial Pacific have a tendency to repeat every 2 years. The overlying winds pulsate at the same pace, as do the globe-girdling effects of the El Nino cycle, from winter warmthmore » in Alaska to heavy rains in Peru and drought in Australia. The climatic ticking in the tropical Pacific is hardly as reliable as the changing of the seasons. Sometimes it is muted, and occasionally it skips a beat. But some researchers nevertheless see hope of using it in the prediction of El Nino and its global effects. In any case, climate researchers are eager to determine what makes El Nino tick. The answer could be an underlying pacemaker of this crucial atmospheric cycle.« less

Life Cycle Assessment | National Agricultural Library

Science.gov Websites

Skip to main content Home National Agricultural Library United States Department of Agriculture Ag ; Livestock (3) Apply Animals & Livestock filter Agricultural Products (1) Apply Agricultural Products filter agricultural equipment (1) Apply agricultural equipment filter agricultural machinery (1) Apply

[Hyperammonemia type II as an example of urea cycle disorder].

PubMed

Hawrot-Kawecka, Anna M; Kawecki, Grzegorz P; Duława, Jan

2006-01-01

Ornithine transcarbamylase deficiency is the most common inherited urea cycle disorder. Its clinical manifestations as lethargy, vomites, coma and cerebral edema are the effect of the higher concentration of the ammonia in plasma. Hyperammonemia, caused by mutation in ornithine transcarbamylase gene, is often considered as a reason of coma by pediatricians but skipped by internist, although it is the third reason of hepatic coma in adults. This article is the recapitulation of published studies and their implication on everyday clinical practice.

29 CFR 1926.702 - Requirements for equipment and tools.

Code of Federal Regulations, 2010 CFR

2010-07-01

..., DEPARTMENT OF LABOR (CONTINUED) SAFETY AND HEALTH REGULATIONS FOR CONSTRUCTION Concrete and Masonry... the ejection system is not to be operated. (b) Concrete mixers. Concrete mixers with one cubic yard... the skip of materials; and (2) Guardrails installed on each side of the skip. (c) Power concrete...

Immortalized Muscle Cell Model to Test the Exon Skipping Efficacy for Duchenne Muscular Dystrophy

PubMed Central

Nguyen, Quynh

2017-01-01

Duchenne muscular dystrophy (DMD) is a lethal genetic disorder that most commonly results from mutations disrupting the reading frame of the dystrophin (DMD) gene. Among the therapeutic approaches employed, exon skipping using antisense oligonucleotides (AOs) is one of the most promising strategies. This strategy aims to restore the reading frame, thus producing a truncated, yet functioning dystrophin protein. In 2016, the Food and Drug Administration (FDA) conditionally approved the first AO-based drug, eteplirsen (Exondys 51), developed for DMD exon 51 skipping. An accurate and reproducible method to quantify exon skipping efficacy is essential for evaluating the therapeutic potential of different AOs sequences. However, previous in vitro screening studies have been hampered by the limited proliferative capacity and insufficient amounts of dystrophin expressed by primary muscle cell lines that have been the main system used to evaluate AOs sequences. In this paper, we illustrate the challenges associated with primary muscle cell lines and describe a novel approach that utilizes immortalized cell lines to quantitatively evaluate the exon skipping efficacy in in vitro studies. PMID:29035327

A Comparison of Two Skip Entry Guidance Algorithms

NASA Technical Reports Server (NTRS)

Rea, Jeremy R.; Putnam, Zachary R.

2007-01-01

The Orion capsule vehicle will have a Lift-to-Drag ratio (L/D) of 0.3-0.35. For an Apollo-like direct entry into the Earth's atmosphere from a lunar return trajectory, this L/D will give the vehicle a maximum range of about 2500 nm and a maximum crossrange of 216 nm. In order to y longer ranges, the vehicle lift must be used to loft the trajectory such that the aerodynamic forces are decreased. A Skip-Trajectory results if the vehicle leaves the sensible atmosphere and a second entry occurs downrange of the atmospheric exit point. The Orion capsule is required to have landing site access (either on land or in water) inside the Continental United States (CONUS) for lunar returns anytime during the lunar month. This requirement means the vehicle must be capable of flying ranges of at least 5500 nm. For the L/D of the vehicle, this is only possible with the use of a guided Skip-Trajectory. A skip entry guidance algorithm is necessary to achieve this requirement. Two skip entry guidance algorithms have been developed: the Numerical Skip Entry Guidance (NSEG) algorithm was developed at NASA/JSC and PredGuid was developed at Draper Laboratory. A comparison of these two algorithms will be presented in this paper. Each algorithm has been implemented in a high-fidelity, 6 degree-of-freedom simulation called the Advanced NASA Technology Architecture for Exploration Studies (ANTARES). NASA and Draper engineers have completed several monte carlo analyses in order to compare the performance of each algorithm in various stress states. Each algorithm has been tested for entry-to-target ranges to include direct entries and skip entries of varying length. Dispersions have been included on the initial entry interface state, vehicle mass properties, vehicle aerodynamics, atmosphere, and Reaction Control System (RCS). Performance criteria include miss distance to the target, RCS fuel usage, maximum g-loads and heat rates for the first and second entry, total heat load, and control system saturation. The comparison of the performance criteria has led to a down select and guidance merger that will take the best ideas from each algorithm to create one skip entry guidance algorithm for the Orion vehicle.

Performance enhancing water skipping: successive free surface impacts of elastic spheres

NASA Astrophysics Data System (ADS)

Hurd, Randy; Truscott, Tadd; Belden, Jesse

2014-11-01

From naval gunners skipping cannonballs to children skipping stones, physicists have long been enamored with the repeated ricochet of objects on the water surface. Elastic spheres, such as the toy Waboba ball, make water skipping more accessible to the masses by expanding the range of impact parameters over which objects can be skipped. For example, it is not difficult to achieve more than twenty skips with such spheres, where skipping a stone twenty times is very difficult. In this talk we discuss the dynamics of water skipping elastic spheres over several successive skips. High-speed video captured using a unique experimental setup reveals how dynamics change with each skip as a result of lost kinetic energy. We place these observations in the context of previous work on single oblique impacts to identify material vibration modes that are excited during ricochet. The material modes excited with each successive impact are seen to decay from high-energy modes to low energy modes until water entry finally occurs. A model for estimating skipping outcome from initial conditions is proposed.

Skipping of Chinese characters does not rely on word-based processing.

PubMed

Lin, Nan; Angele, Bernhard; Hua, Huimin; Shen, Wei; Zhou, Junyi; Li, Xingshan

2018-02-01

Previous eye-movement studies have indicated that people tend to skip extremely high-frequency words in sentence reading, such as "the" in English and "/de" in Chinese. Two alternative hypotheses have been proposed to explain how this frequent skipping happens in Chinese reading: one assumes that skipping happens when the preview has been fully identified at the word level (word-based skipping); the other assumes that skipping happens whenever the preview character is easy to identify regardless of whether lexical processing has been completed or not (character-based skipping). Using the gaze-contingent display change paradigm, we examined the two hypotheses by substituting the preview of the third character of a four-character Chinese word with the high-frequency Chinese character "/de", which should disrupt the ongoing word-level processing. The character-based skipping hypothesis predicts that this manipulation will enhance the skipping probability of the target character (i.e., the third character of the target word), because the character "/de" has much higher character frequency than the original character. The word-based skipping hypothesis instead predicts a reduction of the skipping probability of the target character because the presence of the character "/de" is lexically infelicitous at word level. The results supported the character-based skipping hypothesis, indicating that in Chinese reading the decision of skipping a character can be made before integrating it into a word.

A composite step conjugate gradients squared algorithm for solving nonsymmetric linear systems

NASA Astrophysics Data System (ADS)

Chan, Tony; Szeto, Tedd

1994-03-01

We propose a new and more stable variant of the CGS method [27] for solving nonsymmetric linear systems. The method is based on squaring the Composite Step BCG method, introduced recently by Bank and Chan [1,2], which itself is a stabilized variant of BCG in that it skips over steps for which the BCG iterate is not defined and causes one kind of breakdown in BCG. By doing this, we obtain a method (Composite Step CGS or CSCGS) which not only handles the breakdowns described above, but does so with the advantages of CGS, namely, no multiplications by the transpose matrix and a faster convergence rate than BCG. Our strategy for deciding whether to skip a step does not involve any machine dependent parameters and is designed to skip near breakdowns as well as produce smoother iterates. Numerical experiments show that the new method does produce improved performance over CGS on practical problems.

Water Bouncing Balls: how material stiffness affects water entry

NASA Astrophysics Data System (ADS)

Truscott, Tadd

2014-03-01

It is well known that one can skip a stone across the water surface, but less well known that a ball can also be skipped on water. Even though 17th century ship gunners were aware that cannonballs could be skipped on the water surface, they did not know that using elastic spheres rather than rigid ones could greatly improve skipping performance (yet would have made for more peaceful volleys). The water bouncing ball (Waboba®) is an elastic ball used in a game of aquatic keep away in which players pass the ball by skipping it along the water surface. The ball skips easily along the surface creating a sense that breaking the world record for number of skips could easily be achieved (51 rock skips Russell Byers 2007). We investigate the physics of skipping elastic balls to elucidate the mechanisms by which they bounce off of the water. High-speed video reveals that, upon impact with the water, the balls create a cavity and deform significantly due to the extreme elasticity; the flattened spheres resemble skipping stones. With an increased wetted surface area, a large hydrodynamic lift force is generated causing the ball to launch back into the air. Unlike stone skipping, the elasticity of the ball plays an important roll in determining the success of the skip. Through experimentation, we demonstrate that the deformation timescale during impact must be longer than the collision time in order to achieve a successful skip. Further, several material deformation modes can be excited upon free surface impact. The effect of impact velocity and angle on the two governing timescales and material wave modes are also experimentally investigated. Scaling for the deformation and collision times are derived and used to establish criteria for skipping in terms of relevant physical parameters.

Potential Association between Breakfast Skipping and Concomitant Late-Night-Dinner Eating with Metabolic Syndrome and Proteinuria in the Japanese Population.

PubMed

Kutsuma, Ayano; Nakajima, Kei; Suwa, Kaname

2014-01-01

Skipping breakfast is considered to be an unhealthy eating habit linked to predispositions to obesity and type 2 diabetes. Because eating dinner late at night can elicit subsequent breakfast skipping, we investigated if skipping breakfast concomitant with late-night-dinner eating (LNDE) was associated with metabolic syndrome (MetS) and proteinuria in the general Japanese population. We examined self-reported habitual breakfast skipping and LNDE, MetS (modified ATP-III criteria), and proteinuria in a cross-sectional study of 60,800 Japanese adults aged 20-75 years. A total of 14,068 subjects (23.1%) skipped breakfast, of whom approximately half (52.8%) skipped breakfast alone (without LNDE). The percentages of subjects who skipped breakfast showed a J-shaped relationship with body mass index (BMI). Multivariate logistic regression analysis showed that skipping breakfast concomitant with LNDE (n = 6,645) was significantly associated with MetS and proteinuria, even after adjusting for relevant confounders (odds ratio (95% CI), 1.17 (1.08-1.28), P = 0.0003, and 1.37 (1.24-1.52), P < 0.0001, resp.). Skipping breakfast alone and LNDE alone were not associated with MetS and proteinuria, respectively. In conclusion, habitual breakfast skipping concomitant with LNDE may represent poorer eating behavior than skipping breakfast alone, associated with MetS, asymptomatic proteinuria, obesity, and low body weight in the general Japanese population.

Reading skill and word skipping: Implications for visual and linguistic accounts of word skipping.

PubMed

Eskenazi, Michael A; Folk, Jocelyn R

2015-11-01

We investigated whether high-skill readers skip more words than low-skill readers as a result of parafoveal processing differences based on reading skill. We manipulated foveal load and word length, two variables that strongly influence word skipping, and measured reading skill using the Nelson-Denny Reading Test. We found that reading skill did not influence the probability of skipping five-letter words, but low-skill readers were less likely to skip three-letter words when foveal load was high. Thus, reading skill is likely to influence word skipping when the amount of information in the parafovea falls within the word identification span. We interpret the data in the context of visual-based (extended optimal viewing position model) and linguistic based (E-Z Reader model) accounts of word skipping. The models make different predictions about how and why a word and skipped; however, the data indicate that both models should take into account the fact that different factors influence skipping rates for high- and low-skill readers. (c) 2015 APA, all rights reserved).

Correlates of meal skipping in young adults: a systematic review.

PubMed

Pendergast, Felicity J; Livingstone, Katherine M; Worsley, Anthony; McNaughton, Sarah A

2016-12-01

Meal skipping rates may be highest during young adulthood, a period of transition and development. Although these dietary behaviours may increase future risk of chronic disease, limited research has investigated correlates of meal skipping in young adults. A systematic literature search was conducted to identify studies that investigated correlates of meal skipping behaviours in young adults (aged 18-30 years). EBSCO host, MEDLINE Complete, Global Health, Scopus, EMBASE, Web of Science and Informit platforms were searched for eligible articles. Correlates were defined as any factor that was either associated with meal skipping or was self-reported by the participant to have an influence on meal skipping. Randomised controlled trials, prospective cohort studies, case-control studies, nested case-control studies, cross-sectional studies, and longitudinal studies were eligible for inclusion. Three-hundred and thirty-one articles were identified, 141 full-text articles assessed for eligibility, resulting in 35 included studies. Multiple methodological and reporting weaknesses were apparent in the reviewed studies with 28 of the 35 studies scoring a negative rating in the risk of bias assessment. Meal skipping (any meal), defined as the skipping of any meal throughout the day, was reported in 12 studies with prevalence ranging between 5 and 83%. The remaining 25 studies identified specific meals and their skipping rates, with breakfast the most frequently skipped meal 14-88% compared to lunch 8-57% and dinner 4-57%. Lack of time was consistently reported as an important correlate of meal skipping, compared with correlates such as cost and weight control, while sex was the most commonly reported associated correlate. Breakfast skipping was more common among men while lunch or dinner skipping being more common among women. This review is the first to examine potential correlates of meal skipping in young adults. Future research would benefit from stronger design and reporting strategies, using a standardised approach for measuring and defining meal skipping.

Personnel reliability impact on petrochemical facilities monitoring system's failure skipping probability

NASA Astrophysics Data System (ADS)

Kostyukov, V. N.; Naumenko, A. P.

2017-08-01

The paper dwells upon urgent issues of evaluating impact of actions conducted by complex technological systems operators on their safe operation considering application of condition monitoring systems for elements and sub-systems of petrochemical production facilities. The main task for the research is to distinguish factors and criteria of monitoring system properties description, which would allow to evaluate impact of errors made by personnel on operation of real-time condition monitoring and diagnostic systems for machinery of petrochemical facilities, and find and objective criteria for monitoring system class, considering a human factor. On the basis of real-time condition monitoring concepts of sudden failure skipping risk, static and dynamic error, monitoring systems, one may solve a task of evaluation of impact that personnel's qualification has on monitoring system operation in terms of error in personnel or operators' actions while receiving information from monitoring systems and operating a technological system. Operator is considered as a part of the technological system. Although, personnel's behavior is usually a combination of the following parameters: input signal - information perceiving, reaction - decision making, response - decision implementing. Based on several researches on behavior of nuclear powers station operators in USA, Italy and other countries, as well as on researches conducted by Russian scientists, required data on operator's reliability were selected for analysis of operator's behavior at technological facilities diagnostics and monitoring systems. The calculations revealed that for the monitoring system selected as an example, the failure skipping risk for the set values of static (less than 0.01) and dynamic (less than 0.001) errors considering all related factors of data on reliability of information perception, decision-making, and reaction fulfilled is 0.037, in case when all the facilities and error probability are under control - not more than 0.027. In case when only pump and compressor units are under control, the failure skipping risk is not more than 0.022, when the probability of error in operator's action is not more than 0.011. The work output shows that on the basis of the researches results an assessment of operators' reliability can be made in terms of almost any kind of production, but considering only technological capabilities, since operators' psychological and general training considerable vary in different production industries. Using latest technologies of engineering psychology and design of data support systems, situation assessment systems, decision-making and responding system, as well as achievement in condition monitoring in various production industries one can evaluate hazardous condition skipping risk probability considering static, dynamic errors and human factor.

Tethered satellite system dynamics and control review panel and related activities, phase 3

NASA Technical Reports Server (NTRS)

1991-01-01

Two major tests of the Tethered Satellite System (TSS) engineering and flight units were conducted to demonstrate the functionality of the hardware and software. Deficiencies in the hardware/software integration tests (HSIT) led to a recommendation for more testing to be performed. Selected problem areas of tether dynamics were analyzed, including verification of the severity of skip rope oscillations, verification or comparison runs to explore dynamic phenomena observed in other simulations, and data generation runs to explore the performance of the time domain and frequency domain skip rope observers.

Social Inequalities in Young Children’s Meal Skipping Behaviors: The Generation R Study

PubMed Central

Wijtzes, Anne I.; Jansen, Wilma; Jaddoe, Vincent W. V.; Franco, Oscar H.; Hofman, Albert; van Lenthe, Frank J.; Raat, Hein

2015-01-01

Background Regular meal consumption is considered an important aspect of a healthy diet. While ample evidence shows social inequalities in breakfast skipping among adolescents, little is known about social inequalities in breakfast skipping and skipping of other meals among young school-aged children. Such information is crucial in targeting interventions aimed to promote a healthy diet in children. Methods We examined data from 4704 ethnically diverse children participating in the Generation R Study, a population-based prospective cohort study in Rotterdam, the Netherlands. Information on family socioeconomic position (SEP), ethnic background, and meal skipping behaviors was assessed by parent-reported questionnaire when the child was 6 years old. Multiple logistic regression analyses were performed to assess the associations of family SEP (educational level, household income, employment status, family composition) and ethnic background with meal skipping behaviors, using high SEP children and native Dutch children as reference groups. Results Meal skipping prevalence ranged from 3% (dinner) to 11% (lunch). The prevalence of meal skipping was higher among low SEP children and ethnic minority children. Maternal educational level was independently associated with breakfast skipping ([low maternal educational level] OR: 2.21; 95% CI: 1.24,3.94). Paternal educational level was independently associated with lunch skipping ([low paternal educational level] OR: 1.53; 95% CI: 1.06,2.20) and dinner skipping ([mid-high paternal educational level] OR: 0.39; 95% CI: 0.20,0.76). Household income was independently associated with breakfast skipping ([low income] OR: 2.43, 95% CI: 1.40,4.22) and dinner skipping ([low income] OR: 2.44; 95% CI: 1.22,4.91). In general, ethnic minority children were more likely to skip breakfast, lunch, and dinner compared with native Dutch children. Adjustment for family SEP attenuated the associations of ethnic minority background with meal skipping behaviors considerably. Conclusion Low SEP children and ethnic minority children are at an increased risk of breakfast, lunch, and dinner skipping compared with high SEP children and native Dutch children, respectively. Given these inequalities, interventions aimed to promote regular meal consumption, breakfast consumption in particular, should target children from low socioeconomic groups and ethnic minority children. More qualitative research to investigate the pathways underlying social inequalities in children’s meal skipping behaviors is warranted. PMID:26225757

Social Inequalities in Young Children's Meal Skipping Behaviors: The Generation R Study.

PubMed

Wijtzes, Anne I; Jansen, Wilma; Jaddoe, Vincent W V; Franco, Oscar H; Hofman, Albert; van Lenthe, Frank J; Raat, Hein

2015-01-01

Regular meal consumption is considered an important aspect of a healthy diet. While ample evidence shows social inequalities in breakfast skipping among adolescents, little is known about social inequalities in breakfast skipping and skipping of other meals among young school-aged children. Such information is crucial in targeting interventions aimed to promote a healthy diet in children. We examined data from 4704 ethnically diverse children participating in the Generation R Study, a population-based prospective cohort study in Rotterdam, the Netherlands. Information on family socioeconomic position (SEP), ethnic background, and meal skipping behaviors was assessed by parent-reported questionnaire when the child was 6 years old. Multiple logistic regression analyses were performed to assess the associations of family SEP (educational level, household income, employment status, family composition) and ethnic background with meal skipping behaviors, using high SEP children and native Dutch children as reference groups. Meal skipping prevalence ranged from 3% (dinner) to 11% (lunch). The prevalence of meal skipping was higher among low SEP children and ethnic minority children. Maternal educational level was independently associated with breakfast skipping ([low maternal educational level] OR: 2.21; 95% CI: 1.24,3.94). Paternal educational level was independently associated with lunch skipping ([low paternal educational level] OR: 1.53; 95% CI: 1.06,2.20) and dinner skipping ([mid-high paternal educational level] OR: 0.39; 95% CI: 0.20,0.76). Household income was independently associated with breakfast skipping ([low income] OR: 2.43, 95% CI: 1.40,4.22) and dinner skipping ([low income] OR: 2.44; 95% CI: 1.22,4.91). In general, ethnic minority children were more likely to skip breakfast, lunch, and dinner compared with native Dutch children. Adjustment for family SEP attenuated the associations of ethnic minority background with meal skipping behaviors considerably. Low SEP children and ethnic minority children are at an increased risk of breakfast, lunch, and dinner skipping compared with high SEP children and native Dutch children, respectively. Given these inequalities, interventions aimed to promote regular meal consumption, breakfast consumption in particular, should target children from low socioeconomic groups and ethnic minority children. More qualitative research to investigate the pathways underlying social inequalities in children's meal skipping behaviors is warranted.

Plant WEE1 kinase is cell cycle regulated and removed at mitosis via the 26S proteasome machinery

PubMed Central

Cook, Gemma S.; Grønlund, Anne Lentz; Siciliano, Ilario; Spadafora, Natasha; Amini, Maryam; Herbert, Robert J.; Bitonti, M. Beatrice; Graumann, Katja; Francis, Dennis; Rogers, Hilary J.

2013-01-01

In yeasts and animals, premature entry into mitosis is prevented by the inhibitory phosphorylation of cyclin-dependent kinase (CDK) by WEE1 kinase, and, at mitosis, WEE1 protein is removed through the action of the 26S proteasome. Although in higher plants WEE1 function has been confirmed in the DNA replication checkpoint, Arabidopsis wee1 insertion mutants grow normally, and a role for the protein in the G2/M transition during an unperturbed plant cell cycle is yet to be confirmed. Here data are presented showing that the inhibitory effect of WEE1 on CDK activity in tobacco BY-2 cell cultures is cell cycle regulated independently of the DNA replication checkpoint: it is high during S-phase but drops as cells traverse G2 and enter mitosis. To investigate this mechanism further, a yeast two-hybrid screen was undertaken to identify proteins interacting with Arabidopsis WEE1. Three F-box proteins and a subunit of the proteasome complex were identified, and bimolecular fluorescence complementation confirmed an interaction between AtWEE1 and the F-box protein SKP1 INTERACTING PARTNER 1 (SKIP1). Furthermore, the AtWEE1–green fluorescent protein (GFP) signal in Arabidopsis primary roots treated with the proteasome inhibitor MG132 was significantly increased compared with mock-treated controls. Expression of AtWEE1–YFPC (C-terminal portion of yellow fluorescent protein) or AtWEE1 per se in tobacco BY-2 cells resulted in a premature increase in the mitotic index compared with controls, whereas co-expression of AtSKIP1–YFPN negated this effect. These data support a role for WEE1 in a normal plant cell cycle and its removal at mitosis via the 26S proteasome. PMID:23536609

Potential Association between Breakfast Skipping and Concomitant Late-Night-Dinner Eating with Metabolic Syndrome and Proteinuria in the Japanese Population

PubMed Central

Kutsuma, Ayano; Suwa, Kaname

2014-01-01

Skipping breakfast is considered to be an unhealthy eating habit linked to predispositions to obesity and type 2 diabetes. Because eating dinner late at night can elicit subsequent breakfast skipping, we investigated if skipping breakfast concomitant with late-night-dinner eating (LNDE) was associated with metabolic syndrome (MetS) and proteinuria in the general Japanese population. We examined self-reported habitual breakfast skipping and LNDE, MetS (modified ATP-III criteria), and proteinuria in a cross-sectional study of 60,800 Japanese adults aged 20–75 years. A total of 14,068 subjects (23.1%) skipped breakfast, of whom approximately half (52.8%) skipped breakfast alone (without LNDE). The percentages of subjects who skipped breakfast showed a J-shaped relationship with body mass index (BMI). Multivariate logistic regression analysis showed that skipping breakfast concomitant with LNDE (n = 6,645) was significantly associated with MetS and proteinuria, even after adjusting for relevant confounders (odds ratio (95% CI), 1.17 (1.08–1.28), P = 0.0003, and 1.37 (1.24–1.52), P < 0.0001, resp.). Skipping breakfast alone and LNDE alone were not associated with MetS and proteinuria, respectively. In conclusion, habitual breakfast skipping concomitant with LNDE may represent poorer eating behavior than skipping breakfast alone, associated with MetS, asymptomatic proteinuria, obesity, and low body weight in the general Japanese population. PMID:24982814

Television viewing, computer game play and book reading during meals are predictors of meal skipping in a cross-sectional sample of 12-, 14- and 16-year-olds.

PubMed

Custers, Kathleen; Van den Bulck, Jan

2010-04-01

To examine whether television viewing, computer game playing or book reading during meals predicts meal skipping with the aim of watching television, playing computer games or reading books (media meal skipping). A cross-sectional study was conducted using a standardized self-administered questionnaire. Analyses were controlled for age, gender and BMI. Data were obtained from a random sample of adolescents in Flanders, Belgium. Seven hundred and ten participants aged 12, 14 and 16 years. Of the participants, 11.8 % skipped meals to watch television, 10.5 % skipped meals to play computer games and 8.2 % skipped meals to read books. Compared with those who did not use these media during meals, the risk of skipping meals in order to watch television was significantly higher for those children who watched television during meals (2.9 times higher in those who watched television during at least one meal a day). The risk of skipping meals for computer game playing was 9.5 times higher in those who played computer games weekly or more while eating, and the risk of meal skipping in order to read books was 22.9 times higher in those who read books during meals less than weekly. The more meals the respondents ate with the entire family, the less likely they were to skip meals to watch television. The use of media during meals predicts meal skipping for using that same medium. Family meals appear to be inversely related to meal skipping for television viewing.

Assessment of the feasibility of exon 45–55 multiexon skipping for duchenne muscular dystrophy

PubMed Central

van Vliet, Laura; de Winter, Christa L; van Deutekom, Judith CT; van Ommen, Gert-Jan B; Aartsma-Rus, Annemieke

2008-01-01

Background The specific skipping of an exon, induced by antisense oligonucleotides (AON) during splicing, has shown to be a promising therapeutic approach for Duchenne muscular dystrophy (DMD) patients. As different mutations require skipping of different exons, this approach is mutation dependent. The skipping of an entire stretch of exons (e.g. exons 45 to 55) has recently been suggested as an approach applicable to larger groups of patients. However, this multiexon skipping approach is technically challenging. The levels of intended multiexon skips are typically low and highly variable, and may be dependent on the order of intron removal. We hypothesized that the splicing order might favor the induction of multiexon 45–55 skipping. Methods We here tested the feasibility of inducing multiexon 45–55 in control and patient muscle cell cultures using various AON cocktails. Results In all experiments, the exon 45–55 skip frequencies were minimal and comparable to those observed in untreated cells. Conclusion We conclude that current state of the art does not sufficiently support clinical development of multiexon skipping for DMD. PMID:19046429

Photos

Science.gov Websites

Skip to Content Skip to Search Skip to Utility Navigation Skip to Top Navigation Los Alamos National Laboratory Search Site submit About Mission Business Newsroom Publications Los Alamos National Innovation Research Capabilities Deploying Innovation Technology Opportunities Innovation in New Mexico Los

Newsroom

Science.gov Websites

Skip to Content Skip to Search Skip to Utility Navigation Skip to Top Navigation Los Alamos National Laboratory Search Site submit About Mission Business Newsroom Publications Los Alamos National Innovation Research Capabilities Deploying Innovation Technology Opportunities Innovation in New Mexico Los

Maternal and best friends' influences on meal-skipping behaviours.

PubMed

Pearson, Natalie; Williams, Lauren; Crawford, David; Ball, Kylie

2012-09-01

Skipping meals is particularly common during adolescence and can have a detrimental effect on multiple aspects of adolescent health. Understanding the correlates of meal-skipping behaviours is important for the design of nutrition interventions. The present study examined maternal and best friends' influences on adolescent meal-skipping behaviours. Frequency of skipping breakfast, lunch and dinner was assessed using a Web-based survey completed by 3001 adolescent boys and girls from years 7 and 9 of secondary schools in Victoria, Australia. Perceived best friend and maternal meal skipping, modelling of healthy eating (eating healthy food, limiting junk food, eating fruit and vegetables) and weight watching were assessed. Best friend and maternal factors were differentially associated with meal-skipping behaviours. For example, boys and girls who perceived that their best friend often skipped meals were more likely to skip lunch (OR = 2·01, 95 % CI 1·33, 3·04 and OR = 1·93, 95 % CI 1·41, 2·65; P < 0·001). Boys and girls who perceived that their mother often skipped meals were more likely to skip breakfast (OR = 1·48, 95 % CI 1·01, 2·15; P < 0·05 and OR = 1·93, 95 % CI 1·42, 2·59; P < 0·001) and lunch (OR = 2·05, 95 % CI 1·35, 3·12 and OR = 2·02, 95 % CI 1·43, 2·86; P < 0·001). Educating adolescents on how to assess and interpret unhealthy eating behaviours that they observe from significant others may be one nutrition promotion strategy to reduce meal-skipping behaviour. The involvement of mothers may be particularly important in such efforts. Encouraging a peer subculture that promotes regular consumption of meals and educates adolescents on the detrimental impact of meal-skipping behaviour on health may also offer a promising nutrition promotion strategy.

CINT - Center for Integrated Nanotechnologies

Science.gov Websites

Skip to Content Skip to Search Skip to Utility Navigation Skip to Top Navigation Search Site submit Facilities Discovery Platform Integration Lab User Facilities LUMOS Research Science Thrusts Integration Challenges Accepted User Proposals Data Management Becoming a User Call for Proposals Proposal Guidelines

A protocol of rope skipping exercise for primary school children: A pilot test

NASA Astrophysics Data System (ADS)

Radzi, A. N. M.; Rambely, A. S.; Chellapan, K.

2014-06-01

This paper aims to investigate the methods and sample used in rope skipping as an exercise approach. A systematic literature review was approached in identifying skipping performance in the related researches. The methods were compared to determine the best methodological approach for the targeted skipping based research measure. A pilot test was performed among seven students below 12 years old. As the outcome of the review, a skipping protocol design has been proposed for 10 years old primary school students. The proposed protocol design is to be submitted to PPUKM Ethical Committee for approval prior to its implementation in investigation memory enhancement in relation to designed skipping activities.

The effect of high- and low-frequency previews and sentential fit on word skipping during reading

PubMed Central

Angele, Bernhard; Laishley, Abby; Rayner, Keith; Liversedge, Simon P.

2014-01-01

In a previous gaze-contingent boundary experiment, Angele and Rayner (2012) found that readers are likely to skip a word that appears to be the definite article the even when syntactic constraints do not allow for articles to occur in that position. In the present study, we investigated whether the word frequency of the preview of a three-letter target word influences a reader’s decision to fixate or skip that word. We found that the word frequency rather than the felicitousness (syntactic fit) of the preview affected how often the upcoming word was skipped. These results indicate that visual information about the upcoming word trumps information from the sentence context when it comes to making a skipping decision. Skipping parafoveal instances of the therefore may simply be an extreme case of skipping high-frequency words. PMID:24707791

The Relation between Breakfast Skipping and School Performance in Adolescents

ERIC Educational Resources Information Center

Boschloo, Annemarie; Ouwehand, Carolijn; Dekker, Sanne; Lee, Nikki; de Groot, Renate; Krabbendam, Lydia; Jolles, Jelle

2012-01-01

Breakfast skipping is common in adolescents, but research on the effects of breakfast skipping on school performance is scarce. This current cross-sectional survey study of 605 adolescents aged 11-18 years investigated whether adolescents who habitually skip breakfast have lower end-of-term grades than adolescents who eat breakfast daily.…

Is snack consumption associated with meal skipping in children and adolescents? The CASPIAN-IV study.

PubMed

Kelishadi, Roya; Mozafarian, Nafiseh; Qorbani, Mostafa; Motlagh, Mohammad Esmaeil; Safiri, Saeid; Ardalan, Gelayol; Keikhah, Mojtaba; Rezaei, Fatemeh; Heshmat, Ramin

2017-06-01

The present inquiry set to assess the relationship between snack consumption and meal skipping in Iranian children and adolescents. Overall, 14,880 students, aged 6-18 years, were selected via multistage cluster sampling method from rural and urban areas of 30 provinces of Iran. A validated questionnaire of food behaviors including questions on snacks consumption and taking/skipping meals was completed. Consuming and skipping meals and their related factors were reported in both crude and adjusted models. Overall, 13,486 students with a mean age of 12.47 ± 3.36 years completed the study (90.6% participation rate). Among them, 32.08, 8.89, and 10.90% skipped breakfast, lunch, and dinner, respectively. Compared to their counterpart groups, the frequency of meal skipping was higher in girls, urban inhabitants, and students in higher school grades (P < 0.05). Snack consumption was associated with an increased odds ratio of meal skipping in many types of snack groups. Meal skipping and snack consumption were frequent among Iranian children and adolescents. Evidence based interventions are proposed to improve the students' eating habits.

MET Exon 14 Skipping Mutations in Lung Adenocarcinoma: Clinicopathologic Implications and Prognostic Values.

PubMed

Lee, Geun Dong; Lee, Seung Eun; Oh, Doo-Yi; Yu, Dan-Bi; Jeong, Hae Min; Kim, Jooseok; Hong, Sungyoul; Jung, Hun Soon; Oh, Ensel; Song, Ji-Young; Lee, Mi-Sook; Kim, Mingi; Jung, Kyungsoo; Kim, Jhingook; Shin, Young Kee; Choi, Yoon-La; Kim, Hyeong Ryul

2017-08-01

Response to mesenchymal-epithelial transition (MET) inhibitors in NSCLC with mesenchymal-epithelial transition gene (MET) exon 14 skipping (METex14) has fueled molecular screening efforts and the search for optimal therapies. However, further work is needed to refine the clinicopathologic and prognostic implications of METex14 skipping. Among 795 East Asian patients who underwent a surgical procedure for NSCLC, we screened 45 patients with quintuple-negative (EGFR-negative/KRAS-negative/anaplastic lymphoma kinase gene [ALK]-negative/ROS1-negative/ret proto-oncogene [RET]-negative) lung adenocarcinomas by using reverse-transcriptase polymerase chain reaction and found 17 patients (37.8%) with METex14 skipping. We also investigated the effect of small interfering RNA (siRNA) targeting skipping junction in cells with METex14 skipping. The median age of the 17 patients was 73 years. The acinar subtype was predominant (52.9%), followed by the solid subtype (35.3%). MET immunohistochemistry demonstrated 100% sensitivity and 70.4% specificity. Multivariate analyses showed that patients with METex14 skipping had a higher recurrence rate than those with ALK fusion (versus METex14 skipping) (hazard ratio = 0.283, 95% confidence interval: 0.119-0.670) in stage I to IIIA disease; however, the differences in overall survival were not significant after adjustment for pathologic stage (p = 0.669). Meanwhile, siRNA decreased MET-driven signaling pathways in Hs746T cells, and combined treatment with siRNA and crizotinib inhibited cell proliferation in crizotinib-resistant H596 cells. The prevalence of METex14 skipping was quite high in East Asian patients without other driver mutations in lung adenocarcinomas. METex14 skipping was associated with old age, the acinar or solid histologic subtype, and high MET immunohistochemical expression. The prognosis of patients with METex14 skipping was similar to that of patients with major driver mutations. siRNA targeting the junction of METex14 skipping could inhibit MET-driven signaling pathways in cells with METex14 skipping. Copyright © 2017 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

PubMed

Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

2018-05-24

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

Children's Perceptions of Parental Attitude Affecting Breakfast Skipping in Primary Sixth-Grade Students

ERIC Educational Resources Information Center

Cheng, Tereza Sy; Tse, Lap Ah; Yu, Ignatius Tak-Sun; Griffiths, Sian

2008-01-01

Background: Breakfast skipping is an international public health concern. This study investigated the prevalence of breakfast skipping among primary sixth-grade students in Hong Kong and the impact of students' perceptions of parental attitudes on breakfast skipping. Methods: A total of 426 students aged 10-14 years in 4 local schools participated…

Metabolic and Cardiorespiratory Responses of Young Women to Skipping and Jogging.

ERIC Educational Resources Information Center

Allen, T. Earl; And Others

1987-01-01

Nine 18- to 29-year-old females were studied while jogging and skipping at treadmill speeds of 4.0, 4.8, and 5.4 miles per hour. Comparison of metabolic demand, musculoskeletal stress, and perceived exertion indicated skipping imposed significantly greater metabolic demands and caused higher heart rates than jogging. Skipping was also rated more…

Spire, an actin nucleation factor, regulates cell division during Drosophila heart development.

PubMed

Xu, Peng; Johnson, Tamara L; Stoller-Conrad, Jessica R; Schulz, Robert A

2012-01-01

The Drosophila dorsal vessel is a beneficial model system for studying the regulation of early heart development. Spire (Spir), an actin-nucleation factor, regulates actin dynamics in many developmental processes, such as cell shape determination, intracellular transport, and locomotion. Through protein expression pattern analysis, we demonstrate that the absence of spir function affects cell division in Myocyte enhancer factor 2-, Tinman (Tin)-, Even-skipped- and Seven up (Svp)-positive heart cells. In addition, genetic interaction analysis shows that spir functionally interacts with Dorsocross, tin, and pannier to properly specify the cardiac fate. Furthermore, through visualization of double heterozygous embryos, we determines that spir cooperates with CycA for heart cell specification and division. Finally, when comparing the spir mutant phenotype with that of a CycA mutant, the results suggest that most Svp-positive progenitors in spir mutant embryos cannot undergo full cell division at cell cycle 15, and that Tin-positive progenitors are arrested at cell cycle 16 as double-nucleated cells. We conclude that Spir plays a crucial role in controlling dorsal vessel formation and has a function in cell division during heart tube morphogenesis.

Reading Skill and Word Skipping: Implications for Visual and Linguistic Accounts of Word Skipping

ERIC Educational Resources Information Center

Eskenazi, Michael A.; Folk, Jocelyn R.

2015-01-01

We investigated whether high-skill readers skip more words than low-skill readers as a result of parafoveal processing differences based on reading skill. We manipulated foveal load and word length, two variables that strongly influence word skipping, and measured reading skill using the Nelson-Denny Reading Test. We found that reading skill did…

Risk of mental health problems in adolescents skipping meals: The Korean National Health and Nutrition Examination Survey 2010 to 2012.

PubMed

Lee, Gyungjoo; Han, Kyungdo; Kim, Hyunju

Adolescents frequently skip meals, doing so even more than once per day. This is associated with more mental health problems. This study identified mental health problems' associations with skipping meals and the frequency thereof among adolescents. This cross-sectional population-based study used a data set of 1,413 adolescents from the 2010 to 2012 Korean National Health and Nutrition Examination Survey. Hierarchical multivariable logistic regression was conducted to determine the risk of mental health problems, including stress, depressive mood, and suicidal ideation in relation to skipping meals and the frequency thereof per day. Breakfast skipping significantly increased the risks of stress and depressive mood. Stress, depressive mood, and suicidal ideation were significantly prevalent as the daily frequency of skipping meals increased. Specific strategies should be developed at government or school level to decrease the frequency of skipping meals per day, associated with serious mental health problems in adolescents. Copyright © 2017 Elsevier Inc. All rights reserved.

Skipping breakfast and 5‐year changes in body mass index and waist circumference in Japanese men and women

PubMed Central

Yoshita, K.; Nakamura, K.; Miura, K.; Takamura, T.; Nagasawa, S.Y.; Morikawa, Y.; Kido, T.; Naruse, Y.; Nogawa, K.; Suwazono, Y.; Sasaki, S.; Ishizaki, M.; Nakagawa, H.

2017-01-01

Summary Objective This study investigated the relationship between frequency of skipping breakfast and annual changes in body mass index (BMI) and waist circumference (WC). Methods The participants were 4,430 factory employees. BMI and WC were measured repeatedly at annual medical examinations over a 5‐year period. The association between frequency of skipping breakfast at the baseline examination and annual changes in anthropometric indices was evaluated using the generalized estimating equation method. Results The mean (standard deviation) BMI was 23.3 (3.0) kg m−2 for men and 21.9 (3.6) kg m−2 for women; and the mean WC was 82.6 (8.7) cm for men and 77.8 (9.8) cm for women. During the follow‐up period, mean BMI increased by 0.2 kg m−2 for men and women, and mean WC increased by 1.1 cm for men and 1.0 cm for women. The annual change in the BMI of men who skipped breakfast four to six times per week was 0.061 kg m−2 higher, and that of those who skipped breakfast seven times per week was 0.046 kg m−2 higher, compared with those who did not skip breakfast. Annual changes in the WC of male participants who skipped breakfast seven times per week was 0.248 cm higher than that of those who did not skip breakfast. Skipping breakfast was not associated with changes in BMI or WC in women. Conclusions Skipping breakfast was closely associated with annual changes in BMI and WC among men, and eating breakfast more than four times per week may prevent the excessive body weight gain associated with skipping breakfast. PMID:28702211

Water Surface Impact and Ricochet of Deformable Elastomeric Spheres

NASA Astrophysics Data System (ADS)

Hurd, Randy C.

Soft and deformable silicone rubber spheres ricochet from a water surface when rigid spheres and disks (or skipping stones) cannot. This dissertation investigates why these objects are able to skip so successfully. High speed cameras allow us to see that these unique spheres deform significantly as they impact the water surface, flattening into pancake-like shapes with greater area. Though the water entry behavior of deformable spheres deviates from that of rigid spheres, our research shows that if this deformation is accounted for, their behavior can be predicted from previously established methods. Soft spheres skip more easily because they deform significantly when impacting the water surface. We present a diagram which enables the prediction of a ricochet from sphere impact conditions such as speed and angle. Experiments and mathematical representations of the sphere skipping both show that these deformable spheres skip more readily because deformation momentarily increases sphere area and produces an attack angle with the water which is favorable to skipping. Predictions from our mathematical representation of sphere skipping agree strongly with observations from experiments. Even when a sphere was allowed to skip multiple times in the laboratory, the mathematical predictions show good agreement with measured impact conditions through subsequent skipping events. While studying multiple impact events in an outdoor setting, we discovered a previously unidentified means of skipping, which is unique to deformable spheres. This new skipping occurs when a relatively soft sphere first hits the water at a high speed and low impact angle and the sphere begins to rotate very quickly. This quick rotation causes the sphere to stretch into a shape similar to an American football and maintain this shape while it spins. The sphere is observed to move nearly parallel with the water surface with the tips of this "football" dipping into the water as it rotates and the sides passing just over the surface. This sequence of rapid impact events give the impression that the sphere is walking across the water surface.

Breakfast skipping is associated with cyberbullying and school bullying victimization. A school-based cross-sectional study.

PubMed

Sampasa-Kanyinga, Hugues; Roumeliotis, Paul; Farrow, Claire V; Shi, Yuanfeng F

2014-08-01

Breakfast skipping is a health concern that has well-known negative consequences physically and psychologically. It is therefore important to understand why children skip breakfast. The purpose of this study was to establish whether the experience of bullying and cyberbullying impacts upon breakfast skipping and to further evaluate whether the inability for youths to cope with bullying victimization affects their mental health (depression), and in turn predicts breakfast skipping. Data were obtained from the Eastern Ontario 2011 Youth Risk Behaviour Survey, a cross-sectional regional school-based survey of middle and high school students (11-20 years old) across the five counties of Eastern Ontario, Canada (N = 3035). Self-reported data about children's experiences of bullying victimization, breakfast eating habits, socio-economical status, depression, and other risk behaviours were analysed. Approximately half of the participants (50.4%) reported not eating breakfast on a regular basis: 26.3% and 24.1% reported often (usually eat breakfast three times or more per week) and frequent (usually eat breakfast twice a week or less) breakfast skipping behaviour, respectively. Victims of both cyberbullying and school bullying presented greater likelihood of often (adjusted relative risk ratio (RR) = 1.55; 95% confidence interval (CI) = 1.17-2.06) and frequent (RR = 1.97; 95% CI = 1.28-3.03) breakfast skipping. Mediation analysis further showed that depression fully mediated the relationship between school bullying victimization and frequent breakfast skipping. Moreover, depression partially mediated the associations between both cyberbullying and school bullying with frequent breakfast skipping. These findings highlight the potential interrelationships between cyberbullying, school bullying and depression in predicting unhealthy breakfast skipping behaviour in children. Copyright © 2014 Elsevier Ltd. All rights reserved.

MET exon 14 skipping defines a unique molecular class of non-small cell lung cancer.

PubMed

Zheng, Difan; Wang, Rui; Ye, Ting; Yu, Su; Hu, Haichuan; Shen, Xuxia; Li, Yuan; Ji, Hongbin; Sun, Yihua; Chen, Haiquan

2016-07-05

Recurrent MET exon 14 splicing has been revealed in lung cancers and is a promising therapeutic target. Because we have limited knowledge about the natural history of MET mutant tumors, the current study was aiming to determine the clinical and pathological characteristics in non-small cell lung cancers (NSCLC). Twenty-three patients (1.3%) were positive for MET exon 14 skipping. Patients with MET exon 14 skipping displayed unique characteristics: female, non-smokers, earlier pathology stage and older age. MET exon 14 skipping indicated an early event as other drivers in lung cancer, while MET copy number gain was more likely a late event in lung cancer. Overall survival (OS) of patients harboring MET exon 14 skipping was longer than patients with KRAS mutation. Almost four-fifths of the lung tumors with MET exon 14 skipping had EGFR and/or HER2 gene copy number gains. EGFR inhibitor showed moderate antitumor activity in treatment of a patient harboring MET exon 14 skipping. From October 2007 to June 2013, we screened 1770 patients with NSCLC and correlated MET status with clinical pathologic characteristics and mutations in EGFR, KRAS, BRAF, HER2, and ALK. Quantitative Real-Time PCR was used to detect MET gene copy number gain. Immunohistochemistry (IHC) was also performed to screen MET exon 14 skipping. Clinicopathological characteristics and survival information were analyzed. MET exon 14 skipping was detected in 1.3% (23/1770) of the Chinese patients with NSCLC. MET exon 14 skipping defined a new molecular subset of NSCLC with identifiable clinical characteristics. The therapeutic EGFR inhibitors might be an alternative treatment for patients with MET mutant NSCLC.

Associations between perceived friends' support of healthy eating and meal skipping in adolescence.

PubMed

Rosenrauch, Sharon; Ball, Kylie; Lamb, Karen E

2017-12-01

Meal skipping is a relatively common behaviour during adolescence. As peer influence increases during adolescence, friendship groups may play a role in determining eating patterns such as meal skipping. The current study examined cross-sectional and longitudinal associations between perceived friends' support of healthy eating and breakfast and lunch skipping among adolescents. Survey of intrapersonal, social and environmental factors that may influence eating patterns at baseline (2004/05) and follow-up (2006/07). Thirty-seven secondary schools in Victoria, Australia. Sample of 1785 students aged 12-15 years at baseline. Adolescents who reported that their friends sometimes or often ate healthy foods with them were less likely (adjusted OR; 95 % CI) to skip breakfast (sometimes: 0·71; 0·57, 0·90; often: 0·54; 0·38, 0·76) or lunch (sometimes: 0·61; 0·41, 0·89; often: 0·59; 0·37, 0·94) at baseline than those who reported their friends never or rarely displayed this behaviour. Although this variable was associated with lunch skipping at follow-up, there was no evidence of an association with breakfast skipping at follow-up. There was no evidence of an association between perceived encouragement of healthy eating, and an inconsistent relationship between perceived discouragement of junk food consumption, and meal skipping. Friends eating healthy foods together may serve to reduce meal skipping during early adolescence, possibly due to the influence of directly observable behaviour and shared beliefs held by those in the same friendship group. Verbal encouragement or discouragement from friends may be less impactful an influence on meal skipping (than directly observable behaviours) in adolescents.

The combined unhealthy behaviors of breakfast skipping and smoking are associated with the prevalence of diabetes mellitus.

PubMed

Nishiyama, Midori; Muto, Takashi; Minakawa, Toshihiro; Shibata, Toshie

2009-08-01

Skipping breakfast has been considered a representative unhealthy behavior, but there is little information about the combined effects of breakfast skipping and other unhealthy health habits, especially smoking. First this cross-sectional study investigated unhealthy behaviors among breakfast skippers, and then examined the impact of the combined association of skipping breakfast and smoking on health. A total of 1,200 adults living in one Japanese community were sent questionnaires to elicit data on age, gender, breakfast-eating frequency, and other lifestyle habits. A total 603 of people returned their questionnaires (response rate: 50.3%), and 493 (230 men and 263 women) questionnaires were considered appropriate for analysis. Smoking rate in men (mean age, 53.7 years) and women (mean age, 50.4 years) was 41.3%, and 9.5%, respectively. Skipping breakfast was more prevalent in people under age 50 years (p < 0.001), and was related to other unhealthy behaviors. Binary logistic regression identified current smoking as the most significant factor related to breakfast skipping (3.10, 95%CI 1.50-6.39). Other factors included, age younger than 50 years (3.04, 95%CI 1.31-7.06) and poor sleeping quality (2.06, 95%CI 1.00-4.25). After examining the combined impact of skipping breakfast and smoking, the highest odds ratio for a diagnosis of diabetes mellitus was found among those who smoked and skipped breakfast (4.68, 95% CI: 1.46-15.05). Moreover, skipping breakfast among non-smokers showed a high association with perceived stress (2.83, 95% CI: 1.05-7.61). In conclusion, the combined unhealthy behaviors of skipping breakfast and smoking are associated with the prevalence of diabetes mellitus.

Word skipping: effects of word length, predictability, spelling and reading skill.

PubMed

Slattery, Timothy J; Yates, Mark

2017-08-31

Readers eyes often skip over words as they read. Skipping rates are largely determined by word length; short words are skipped more than long words. However, the predictability of a word in context also impacts skipping rates. Rayner, Slattery, Drieghe and Liversedge (2011) reported an effect of predictability on word skipping for even long words (10-13 characters) that extend beyond the word identification span. Recent research suggests that better readers and spellers have an enhanced perceptual span (Veldre & Andrews, 2014). We explored whether reading and spelling skill interact with word length and predictability to impact word skipping rates in a large sample (N=92) of average and poor adult readers. Participants read the items from Rayner et al. (2011) while their eye movements were recorded. Spelling skill (zSpell) was assessed using the dictation and recognition tasks developed by Sally Andrews and colleagues. Reading skill (zRead) was assessed from reading speed (words per minute) and accuracy of three 120 word passages each with 10 comprehension questions. We fit linear mixed models to the target gaze duration data and generalized linear mixed models to the target word skipping data. Target word gaze durations were significantly predicted by zRead while, the skipping likelihoods were significantly predicted by zSpell. Additionally, for gaze durations, zRead significantly interacted with word predictability as better readers relied less on context to support word processing. These effects are discussed in relation to the lexical quality hypothesis and eye movement models of reading.

Effects of systemic multiexon skipping with peptide-conjugated morpholinos in the heart of a dog model of Duchenne muscular dystrophy

PubMed Central

Echigoya, Yusuke; Nakamura, Akinori; Nagata, Tetsuya; Urasawa, Nobuyuki; Trieu, Nhu; Panesar, Dharminder; Kuraoka, Mutsuki; Moulton, Hong M.; Saito, Takashi; Aoki, Yoshitsugu; Iversen, Patrick; Sazani, Peter; Kole, Ryszard; Maruyama, Rika; Partridge, Terry; Takeda, Shin’ichi; Yokota, Toshifumi

2017-01-01

Duchenne muscular dystrophy (DMD) is a lethal genetic disorder caused by an absence of the dystrophin protein in bodywide muscles, including the heart. Cardiomyopathy is a leading cause of death in DMD. Exon skipping via synthetic phosphorodiamidate morpholino oligomers (PMOs) represents one of the most promising therapeutic options, yet PMOs have shown very little efficacy in cardiac muscle. To increase therapeutic potency in cardiac muscle, we tested a next-generation morpholino: arginine-rich, cell-penetrating peptide-conjugated PMOs (PPMOs) in the canine X-linked muscular dystrophy in Japan (CXMDJ) dog model of DMD. A PPMO cocktail designed to skip dystrophin exons 6 and 8 was injected intramuscularly, intracoronarily, or intravenously into CXMDJ dogs. Intravenous injections with PPMOs restored dystrophin expression in the myocardium and cardiac Purkinje fibers, as well as skeletal muscles. Vacuole degeneration of cardiac Purkinje fibers, as seen in DMD patients, was ameliorated in PPMO-treated dogs. Although symptoms and functions in skeletal muscle were not ameliorated by i.v. treatment, electrocardiogram abnormalities (increased Q-amplitude and Q/R ratio) were improved in CXMDJ dogs after intracoronary or i.v. administration. No obvious evidence of toxicity was found in blood tests throughout the monitoring period of one or four systemic treatments with the PPMO cocktail (12 mg/kg/injection). The present study reports the rescue of dystrophin expression and recovery of the conduction system in the heart of dystrophic dogs by PPMO-mediated multiexon skipping. We demonstrate that rescued dystrophin expression in the Purkinje fibers leads to the improvement/prevention of cardiac conduction abnormalities in the dystrophic heart. PMID:28373570

Effects of systemic multiexon skipping with peptide-conjugated morpholinos in the heart of a dog model of Duchenne muscular dystrophy.

PubMed

Echigoya, Yusuke; Nakamura, Akinori; Nagata, Tetsuya; Urasawa, Nobuyuki; Lim, Kenji Rowel Q; Trieu, Nhu; Panesar, Dharminder; Kuraoka, Mutsuki; Moulton, Hong M; Saito, Takashi; Aoki, Yoshitsugu; Iversen, Patrick; Sazani, Peter; Kole, Ryszard; Maruyama, Rika; Partridge, Terry; Takeda, Shin'ichi; Yokota, Toshifumi

2017-04-18

Duchenne muscular dystrophy (DMD) is a lethal genetic disorder caused by an absence of the dystrophin protein in bodywide muscles, including the heart. Cardiomyopathy is a leading cause of death in DMD. Exon skipping via synthetic phosphorodiamidate morpholino oligomers (PMOs) represents one of the most promising therapeutic options, yet PMOs have shown very little efficacy in cardiac muscle. To increase therapeutic potency in cardiac muscle, we tested a next-generation morpholino: arginine-rich, cell-penetrating peptide-conjugated PMOs (PPMOs) in the canine X-linked muscular dystrophy in Japan (CXMD J ) dog model of DMD. A PPMO cocktail designed to skip dystrophin exons 6 and 8 was injected intramuscularly, intracoronarily, or intravenously into CXMD J dogs. Intravenous injections with PPMOs restored dystrophin expression in the myocardium and cardiac Purkinje fibers, as well as skeletal muscles. Vacuole degeneration of cardiac Purkinje fibers, as seen in DMD patients, was ameliorated in PPMO-treated dogs. Although symptoms and functions in skeletal muscle were not ameliorated by i.v. treatment, electrocardiogram abnormalities (increased Q-amplitude and Q/R ratio) were improved in CXMD J dogs after intracoronary or i.v. administration. No obvious evidence of toxicity was found in blood tests throughout the monitoring period of one or four systemic treatments with the PPMO cocktail (12 mg/kg/injection). The present study reports the rescue of dystrophin expression and recovery of the conduction system in the heart of dystrophic dogs by PPMO-mediated multiexon skipping. We demonstrate that rescued dystrophin expression in the Purkinje fibers leads to the improvement/prevention of cardiac conduction abnormalities in the dystrophic heart.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Procarione, J.A.

This research concerns the development of two models - a mine and a haulage shaft for ventilation studies. The model mine for instructional study of pressures and quantities was designed and built of 12-inch diameter furnace duct. It consists of a north and south sections in the hallway ceiling space in the third floor of the W.C. Browning Building. A fan section, consisting of three fans in Room 314, is attached to it. Both fan and duct sections may be operated singly, in parallel, and in series with each other. A blowing or exhausting mode allows a total of thirty-twomore » combinations. Through a system of air flow measurement stations, solenoid valves, and relays, pressures and velocities may be determined with a micromanometer or a pressure transducer whose output is processed by a computer. A control panel, made up of switches, permits the selection of the various fan-duct combinations and measurements. The 120 foot model shaft is for the study of shock losses when two skips are moving in an airflow within its confines. Air is directed from a fan downward through the 10 inch diameter aluminum shaft installed inside the former rubbish chute of the Browning Building. For data collection from which shock losses may be determined, sixteen strategically located measuring stations connect to pressure transducers. Voltage outputs from the transducers are sampled and processed by the computer in Room 314. In addition to the pressure readings, the skip speed and the air temperature in the model are also recorded by the computer system for later use in data reduction. Provisions are made for changing skip sizes and speeds as well as shaft wall roughness. With one skip size and speed and with smooth shaft walls, data was collected and processed to prove proper operation of the complete system.« less

Efficient exon skipping of SGCG mutations mediated by phosphorodiamidate morpholino oligomers.

PubMed

Wyatt, Eugene J; Demonbreun, Alexis R; Kim, Ellis Y; Puckelwartz, Megan J; Vo, Andy H; Dellefave-Castillo, Lisa M; Gao, Quan Q; Vainzof, Mariz; Pavanello, Rita C M; Zatz, Mayana; McNally, Elizabeth M

2018-05-03

Exon skipping uses chemically modified antisense oligonucleotides to modulate RNA splicing. Therapeutically, exon skipping can bypass mutations and restore reading frame disruption by generating internally truncated, functional proteins to rescue the loss of native gene expression. Limb-girdle muscular dystrophy type 2C is caused by autosomal recessive mutations in the SGCG gene, which encodes the dystrophin-associated protein γ-sarcoglycan. The most common SGCG mutations disrupt the transcript reading frame abrogating γ-sarcoglycan protein expression. In order to treat most SGCG gene mutations, it is necessary to skip 4 exons in order to restore the SGCG transcript reading frame, creating an internally truncated protein referred to as Mini-Gamma. Using direct reprogramming of human cells with MyoD, myogenic cells were tested with 2 antisense oligonucleotide chemistries, 2'-O-methyl phosphorothioate oligonucleotides and vivo-phosphorodiamidate morpholino oligomers, to induce exon skipping. Treatment with vivo-phosphorodiamidate morpholino oligomers demonstrated efficient skipping of the targeted exons and corrected the mutant reading frame, resulting in the expression of a functional Mini-Gamma protein. Antisense-induced exon skipping of SGCG occurred in normal cells and those with multiple distinct SGCG mutations, including the most common 521ΔT mutation. These findings demonstrate a multiexon-skipping strategy applicable to the majority of limb-girdle muscular dystrophy 2C patients.

Skip residues modulate the structural properties of the myosin rod and guide thick filament assembly

DOE PAGES

Taylor, Keenan C.; Buvoli, Massimo; Korkmaz, Elif Nihal; ...

2015-07-06

The rod of sarcomeric myosins directs thick filament assembly and is characterized by the insertion of four skip residues that introduce discontinuities in the coiled-coil heptad repeats. We report in this paper that the regions surrounding the first three skip residues share high structural similarity despite their low sequence homology. Near each of these skip residues, the coiled-coil transitions to a nonclose-packed structure inducing local relaxation of the superhelical pitch. Moreover, molecular dynamics suggest that these distorted regions can assume different conformationally stable states. In contrast, the last skip residue region constitutes a true molecular hinge, providing C-terminal rod flexibility.more » Assembly of myosin with mutated skip residues in cardiomyocytes shows that the functional importance of each skip residue is associated with rod position and reveals the unique role of the molecular hinge in promoting myosin antiparallel packing. By defining the biophysical properties of the rod, the structures and molecular dynamic calculations presented here provide insight into thick filament formation, and highlight the structural differences occurring between the coiled-coils of myosin and the stereotypical tropomyosin. Finally, in addition to extending our knowledge into the conformational and biological properties of coiled-coil discontinuities, the molecular characterization of the four myosin skip residues also provides a guide to modeling the effects of rod mutations causing cardiac and skeletal myopathies.« less

Mathematical modeling for optimizing skip-stop rail transit operation strategy using genetic algorithm.

DOT National Transportation Integrated Search

2012-03-01

"With skip-stop rail transit operation, transit agencies can reduce their operating costs and fleet size, : and passengers can experience reduced in-transit travel times without extra track and technological : improvement. However, since skip-stop op...

Gait biomechanics of skipping are substantially different than those of running.

PubMed

McDonnell, Jessica; Willson, John D; Zwetsloot, Kevin A; Houmard, Joseph; DeVita, Paul

2017-11-07

The inherit injury risk associated with high-impact exercises calls for alternative ways to achieve the benefits of aerobic exercise while minimizing excessive stresses to body tissues. Skipping presents such an alternative, incorporating double support, flight, and single support phases. We used ground reaction forces (GRFs), lower extremity joint torques and powers to compare skipping and running in 20 healthy adults. The two consecutive skipping steps on each limb differed significantly from each other, and from running. Running had the longest step length, the highest peak vertical GRF, peak knee extensor torque, and peak knee negative and positive power and negative and positive work. Skipping had the greater cadence, peak horizontal GRF, peak hip and ankle extensor torques, peak ankle negative power and work, and peak ankle positive power. The second vs first skipping step had the shorter step length, higher cadence, peak horizontal GRF, peak ankle extensor torque, and peak ankle negative power, negative work, and positive power and positive work. The first skipping step utilized predominately net negative joint work (eccentric muscle action) while the second utilized predominately net positive joint work (concentric muscle action). The skipping data further highlight the persistence of net negative work performed at the knee and net positive work performed at the ankle across locomotion gaits. Evidence of step segregation was seen in distribution of the braking and propelling impulses and net work produced across the hip, knee, and ankle joints. Skipping was substantially different than running and was temporally and spatially asymmetrical with successive foot falls partitioned into a dominant function, either braking or propelling whereas running had a single, repeated step in which both braking and propelling actions were performed equally. Copyright © 2017 Elsevier Ltd. All rights reserved.

The relationship between breakfast skipping, chronotype, and glycemic control in type 2 diabetes.

PubMed

Reutrakul, Sirimon; Hood, Megan M; Crowley, Stephanie J; Morgan, Mary K; Teodori, Marsha; Knutson, Kristen L

2014-02-01

Breakfast skipping is associated with obesity and an increased risk of type 2 diabetes. Later chronotypes, individuals who have a preference for later bed and wake times, often skip breakfast. The aim of the study was to explore the relationships among breakfast skipping, chronotype, and glycemic control in type 2 diabetes patients. We collected sleep timing and 24-h dietary recall from 194 non-shift-working type 2 diabetes patients who were being followed in outpatient clinics. Mid-sleep time on free days (MSF) was used as an indicator of chronotype. Hemoglobin A1C (HbA1C) values were obtained from medical records. Hierarchical linear regression analyses controlling for demographic, sleep, and dietary variables were computed to determine whether breakfast skipping was associated with HbA1C. Additional regression analyses were performed to test if this association was mediated by chronotype. There were 22 participants (11.3%) who self-reported missing breakfast. Breakfast skippers had significantly higher HbA1C levels, higher body mass indices (BMI), and later MSF than breakfast eaters. Breakfast skipping was significantly associated with higher HbA1C values (B = 0.108, p = 0.01), even after adjusting for age, sex, race, BMI, number of diabetes complications, insulin use, depressive symptoms, perceived sleep debt, and percentage of daily caloric intake at dinner. The relationship between breakfast skipping and HbA1C was partially mediated by chronotype. In summary, breakfast skipping is associated with a later chronotype. Later chronotype and breakfast skipping both contribute to poorer glycemic control, as indicated by higher HbA1C levels. Future studies are needed to confirm these findings and determine whether behavioral interventions targeting breakfast eating or sleep timing may improve glycemic control in patients with type 2 diabetes.

Nanoparticle Delivery of Antisense Oligonucleotides and Their Application in the Exon Skipping Strategy for Duchenne Muscular Dystrophy

PubMed Central

Falzarano, Maria Sofia; Passarelli, Chiara

2014-01-01

Antisense therapy is a powerful tool for inducing post-transcriptional modifications and thereby regulating target genes associated with disease. There are several classes of antisense oligonucleotides (AONs) with therapeutic use, such as double-stranded RNAs (interfering RNAs, utilized for gene silencing, and single-stranded AONs with various chemistries, which are useful for antisense targeting of micro-RNAs and mRNAs. In particular, the use of AONs for exon skipping, by targeting pre-mRNA, is proving to be a highly promising therapy for some genetic disorders like Duchenne muscular dystrophy and spinal muscular atrophy. However, AONs are unable to cross the plasma membrane unaided, and several other obstacles still remain to be overcome, in particular their instability due to their nuclease sensitivity and their lack of tissue specificity. Various drug delivery systems have been explored to improve the bioavailability of nucleic acids, and nanoparticles (NPs) have been suggested as potential vectors for DNA/RNA. This review describes the recent progress in AON conjugation with natural and synthetic delivery systems, and provides an overview of the efficacy of NP-AON complexes as an exon-skipping treatment for Duchenne muscular dystrophy. PMID:24506782

Thrombopoietin-induced Polyploidization of Bone Marrow Megakaryocytes Is Due to a Unique Regulatory Mechanism in Late Mitosis

PubMed Central

Nagata, Yuka; Muro, Yoshinao; Todokoro, Kazuo

1997-01-01

Megakaryocytes undergo a unique differentiation program, becoming polyploid through repeated cycles of DNA synthesis without concomitant cell division. However, the mechanism underlying this polyploidization remains totally unknown. It has been postulated that polyploidization is due to a skipping of mitosis after each round of DNA replication. We carried out immunohistochemical studies on mouse bone marrow megakaryocytes during thrombopoietin- induced polyploidization and found that during this process megakaryocytes indeed enter mitosis and progress through normal prophase, prometaphase, metaphase, and up to anaphase A, but not to anaphase B, telophase, or cytokinesis. It was clearly observed that multiple spindle poles were formed as the polyploid megakaryocytes entered mitosis; the nuclear membrane broke down during prophase; the sister chromatids were aligned on a multifaced plate, and the centrosomes were symmetrically located on either side of each face of the plate at metaphase; and a set of sister chromatids moved into the multiple centrosomes during anaphase A. We further noted that the pair of spindle poles in anaphase were located in close proximity to each other, probably because of the lack of outward movement of spindle poles during anaphase B. Thus, the reassembling nuclear envelope may enclose all the sister chromatids in a single nucleus at anaphase and then skip telophase and cytokinesis. These observations clearly indicate that polyploidization of megakaryocytes is not simply due to a skipping of mitosis, and that the megakaryocytes must have a unique regulatory mechanism in anaphase, e.g., factors regulating anaphase such as microtubule motor proteins might be involved in this polyploidization process. PMID:9334347

78 FR 42819 - Proposed Collection; Comment Request for Form 709

Federal Register 2010, 2011, 2012, 2013, 2014

2013-07-17

... 709, United States Gift (and Generation-Skipping Transfer) Tax Return. DATES: Written comments should....gov . SUPPLEMENTARY INFORMATION: Title: United States Gift (and Generation-Skipping Transfer) Tax... transfers subject to the gift and generation-skipping transfer taxes and to compute these taxes. The IRS...

75 FR 38179 - Proposed Collection; Comment Request for Form 709

Federal Register 2010, 2011, 2012, 2013, 2014

2010-07-01

... 709, United States Gift (and Generation-Skipping Transfer) Tax Return. DATES: Written comments should....gov . SUPPLEMENTARY INFORMATION: Title: United States Gift (and Generation-Skipping Transfer) Tax... transfers subject to the gift and generation-skipping transfer taxes and to compute these taxes. The IRS...

78 FR 46688 - Proposed Collection; Comment Request for Form 706

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-01

... 706, United States Estate (and Generation-Skipping Transfer) Tax Return. DATES: Written comments... INFORMATION: Title: United States Estate (and Generation-Skipping Transfer) Tax Return. OMB Number: 1545-0015... imposed by Internal Revenue Code section 2001 and the Federal generation-skipping transfer (GST) tax...

Eye movements and word skipping during reading: Effects of word length and predictability

PubMed Central

Rayner, Keith; Slattery, Timothy J.; Drieghe, Denis; Liversedge, Simon P.

2012-01-01

The extent to which target words were predictable from prior context was varied: half of the target words were predictable and the other half were unpredictable. In addition, the length of the target word varied: the target words were short (4–6 letters), medium (7–9 letters), or long (10–12 letters). Length and predictability both yielded strong effects on the probability of skipping the target words and on the amount of time readers fixated the target words (when they were not skipped). However, there was no interaction in any of the measures examined for either skipping or fixation time. The results demonstrate that word predictability (due to contextual constraint) and word length have strong and independent influences on word skipping and fixation durations. Furthermore, since the long words extended beyond the word identification span, the data indicate that skipping can occur on the basis of partial information in relation to word identity. PMID:21463086

Optimum Orbit Plane Change Using a Skip Reentry Trajectory for the Space Shuttle Orbiter.

DTIC Science & Technology

1978-12-01

by the hat symbol, " , and i,j,k represent unit vectors for the YW frame. The angular velocity of the earth is constant and denoted by w. Thus V re is...the equations of motion can be found. In component form the equations are: (6M/r3)x + 4 (Cos - sn ) vst 1 mm Msv 3 b1 bm y - (uM/r3)y + L (coso...plane change, due to the skip reentry maneuver is determined by comparing the states of the system before and after the maneuver. The angular momentum

26 CFR 26.2612-1 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-04-01

... GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2612-1 Definitions. (a... person. Only one direct skip occurs when a single transfer of property skips two or more generations. See... termination is a taxable termination with respect to the distributed property. (3) Simultaneous terminations...

26 CFR 26.2612-1 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-04-01

... GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2612-1 Definitions. (a... person. Only one direct skip occurs when a single transfer of property skips two or more generations. See... termination is a taxable termination with respect to the distributed property. (3) Simultaneous terminations...

The Timing of Grade Skipping

ERIC Educational Resources Information Center

Kuo, Yi-Lung; Lohman, David F.

2011-01-01

The purposes of this study were to investigate the following: (a) the impact of sex, ethnicity, socioeconomic status, and family income on the likelihood of whole-grade skipping between kindergarten and Grade 7 and (b) the effects of grade skipping during elementary or middle school on students' academic achievement in high school. The authors…

1999 Survey of Active Duty Personnel: Administration, Datasets, and Codebook. Appendix G: Frequency and Percentage Distributions for Variables in the Survey Analysis Files.

DTIC Science & Technology

2000-12-01

A SKIP FLAG INDICATING THE RESULT OF CHECKING THE RESPONSE ON THE PARENT (SCREENING) ITEM AGAINST THE RESPONSE(S) ON THE ITEMS WITHIN THE SKIP...RESPONSE ON THE PARENT (SCREENING) ITEM AGAINST THE RESPONSE(S) ON THE ITEMS WITHIN THE SKIP PATTERN. SEE TABLE D-5, NOTE 2, IN APPENDIX D. G-52...RESULT OF CHECKING THE RESPONSE ON THE PARENT (SCREENING) ITEM AGAINST THE RESPONSE(S) ON THE ITEMS WITHIN THE SKIP PATTERN. SEE TABLE D-5

Reengineering a transmembrane protein to treat muscular dystrophy using exon skipping.

PubMed

Gao, Quan Q; Wyatt, Eugene; Goldstein, Jeff A; LoPresti, Peter; Castillo, Lisa M; Gazda, Alec; Petrossian, Natalie; Earley, Judy U; Hadhazy, Michele; Barefield, David Y; Demonbreun, Alexis R; Bönnemann, Carsten; Wolf, Matthew; McNally, Elizabeth M

2015-11-02

Exon skipping uses antisense oligonucleotides as a treatment for genetic diseases. The antisense oligonucleotides used for exon skipping are designed to bypass premature stop codons in the target RNA and restore reading frame disruption. Exon skipping is currently being tested in humans with dystrophin gene mutations who have Duchenne muscular dystrophy. For Duchenne muscular dystrophy, the rationale for exon skipping derived from observations in patients with naturally occurring dystrophin gene mutations that generated internally deleted but partially functional dystrophin proteins. We have now expanded the potential for exon skipping by testing whether an internal, in-frame truncation of a transmembrane protein γ-sarcoglycan is functional. We generated an internally truncated γ-sarcoglycan protein that we have termed Mini-Gamma by deleting a large portion of the extracellular domain. Mini-Gamma provided functional and pathological benefits to correct the loss of γ-sarcoglycan in a Drosophila model, in heterologous cell expression studies, and in transgenic mice lacking γ-sarcoglycan. We generated a cellular model of human muscle disease and showed that multiple exon skipping could be induced in RNA that encodes a mutant human γ-sarcoglycan. Since Mini-Gamma represents removal of 4 of the 7 coding exons in γ-sarcoglycan, this approach provides a viable strategy to treat the majority of patients with γ-sarcoglycan gene mutations.

Reengineering a transmembrane protein to treat muscular dystrophy using exon skipping

PubMed Central

Gao, Quan Q.; Wyatt, Eugene; Goldstein, Jeff A.; LoPresti, Peter; Castillo, Lisa M.; Gazda, Alec; Petrossian, Natalie; Earley, Judy U.; Hadhazy, Michele; Barefield, David Y.; Demonbreun, Alexis R.; Bönnemann, Carsten; Wolf, Matthew; McNally, Elizabeth M.

2015-01-01

Exon skipping uses antisense oligonucleotides as a treatment for genetic diseases. The antisense oligonucleotides used for exon skipping are designed to bypass premature stop codons in the target RNA and restore reading frame disruption. Exon skipping is currently being tested in humans with dystrophin gene mutations who have Duchenne muscular dystrophy. For Duchenne muscular dystrophy, the rationale for exon skipping derived from observations in patients with naturally occurring dystrophin gene mutations that generated internally deleted but partially functional dystrophin proteins. We have now expanded the potential for exon skipping by testing whether an internal, in-frame truncation of a transmembrane protein γ-sarcoglycan is functional. We generated an internally truncated γ-sarcoglycan protein that we have termed Mini-Gamma by deleting a large portion of the extracellular domain. Mini-Gamma provided functional and pathological benefits to correct the loss of γ-sarcoglycan in a Drosophila model, in heterologous cell expression studies, and in transgenic mice lacking γ-sarcoglycan. We generated a cellular model of human muscle disease and showed that multiple exon skipping could be induced in RNA that encodes a mutant human γ-sarcoglycan. Since Mini-Gamma represents removal of 4 of the 7 coding exons in γ-sarcoglycan, this approach provides a viable strategy to treat the majority of patients with γ-sarcoglycan gene mutations. PMID:26457733

SKIPing With Head Start Teachers: Influence of T-SKIP on Object-Control Skills.

PubMed

Brian, Ali; Goodway, Jacqueline D; Logan, Jessica A; Sutherland, Sue

2017-12-01

Children from disadvantaged settings are at risk for delays in their object-control (OC) skills. Fundamental motor skill interventions, such as the Successful Kinesthetic Instruction for Preschoolers (SKIP) Program, are highly successful when led by motor development experts. However, few preschools employ such experts. This study examined the extent to which Head Start teachers delivering an 8-week teacher-led SKIP (T-SKIP) intervention elicited learning of OC skills for Head Start children. Head Start teachers (n = 5) delivered T-SKIP for 8 weeks (450 min). Control teachers (n = 5) implemented the typical standard of practice, or well-equipped free play. All children (N = 122) were pretested and posttested on the OC Skill subscale of the Test of Gross Motor Development-2. Descriptive analyses at pretest identified 81% of the children were developmentally delayed in OC skills (below the 30th percentile). A 2-level hierarchical linear model demonstrated the effectiveness of T-SKIP with significant differences (β = 4.70), t(8) = 7.02, p < .001, η2 = .56, between T-SKIP children (n = 63) and control children (n = 59) at posttest. Head Start teachers who delivered T-SKIP could bring about positive changes in children's OC skills, thereby remediating the initial developmental delays presented. Control children remained delayed in their OC skills in spite of daily well-equipped free play, giving rise to concerns about their future motor competence and physical activity levels.

Forecasting fluctuating outbreaks in seasonally driven epidemics

NASA Astrophysics Data System (ADS)

Stone, Lewi

2009-03-01

Seasonality is a driving force that has major impact on the spatio-temporal dynamics of natural systems and their populations. This is especially true for the transmission of common infectious diseases such as influenza, measles, chickenpox, and pertussis. Here we gain new insights into the nonlinear dynamics of recurrent diseases through the analysis of the classical seasonally forced SIR epidemic model. Despite many efforts over the last decades, it has been difficult to gain general analytical insights because of the complex synchronization effects that can evolve between the external forcing and the model's natural oscillations. The analysis advanced here attempts to make progress in this direction by focusing on the dynamics of ``skips'' where we identify and predict years in which the epidemic is absent rather than outbreak years. Skipping events are intrinsic to the forced SIR model when parameterised in the chaotic regime. In fact, it is difficult if not impossible to locate realistic chaotic parameter regimes in which outbreaks occur regularly each year. This contrasts with the well known Rossler oscillator whose outbreaks recur regularly but whose amplitude vary chaotically in time (Uniform Phase Chaotic Amplitude oscillations). The goal of the present study is to develop a ``language of skips'' that makes it possible to predict under what conditions the next outbreak is likely to occur, and how many ``skips'' might be expected after any given outbreak. We identify a new threshold effect and give clear analytical conditions that allow accurate predictions. Moreover, the time of occurrence (i.e., phase) of an outbreak proves to be a useful new parameter that carries important epidemiological information. In forced systems, seasonal changes can prevent late-initiating outbreaks (i.e., having high phase) from running to completion. These principles yield forecasting tools that should have relevance for the study of newly emerging and reemerging diseases.

26 CFR 26.2632-1 - Allocation of GST exemption.

Code of Federal Regulations, 2011 CFR

2011-04-01

... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2632... United States Gift (and Generation-Skipping Transfer) Tax Return (Form 709) the transfer and the extent... generation-skipping potential, the initial allocation under paragraph (b)(4)(ii)(A)(1)(i) of this section is...

26 CFR 26.2632-1 - Allocation of GST exemption.

Code of Federal Regulations, 2014 CFR

2014-04-01

... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2632... United States Gift (and Generation-Skipping Transfer) Tax Return (Form 709) the transfer and the extent... generation-skipping potential, the initial allocation under paragraph (b)(4)(ii)(A)(1)(i) of this section is...

26 CFR 26.2632-1 - Allocation of GST exemption.

Code of Federal Regulations, 2013 CFR

2013-04-01

... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2632... United States Gift (and Generation-Skipping Transfer) Tax Return (Form 709) the transfer and the extent... generation-skipping potential, the initial allocation under paragraph (b)(4)(ii)(A)(1)(i) of this section is...

26 CFR 26.2632-1 - Allocation of GST exemption.

Code of Federal Regulations, 2012 CFR

2012-04-01

... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2632... United States Gift (and Generation-Skipping Transfer) Tax Return (Form 709) the transfer and the extent... generation-skipping potential, the initial allocation under paragraph (b)(4)(ii)(A)(1)(i) of this section is...

26 CFR 26.2653-1 - Taxation of multiple skips.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 26 Internal Revenue 14 2010-04-01 2010-04-01 false Taxation of multiple skips. 26.2653-1 Section 26.2653-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE...-1 Taxation of multiple skips. (a) General rule. If property is held in trust immediately after a GST...

26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 26 Internal Revenue 14 2011-04-01 2010-04-01 true Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 26 Internal Revenue 14 2010-04-01 2010-04-01 false Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 26 Internal Revenue 14 2013-04-01 2013-04-01 false Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 26 Internal Revenue 14 2014-04-01 2013-04-01 true Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 26 Internal Revenue 14 2012-04-01 2012-04-01 false Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

26 CFR 26.2653-1 - Taxation of multiple skips.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 26 Internal Revenue 14 2011-04-01 2010-04-01 true Taxation of multiple skips. 26.2653-1 Section 26.2653-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND... Taxation of multiple skips. (a) General rule. If property is held in trust immediately after a GST, solely...

One Way to Design a Valence-Skip Compound.

PubMed

Hase, I; Yanagisawa, T; Kawashima, K

2017-12-01

Valence-skip compound is a good candidate with high T c and low anisotropy because it has a large attractive interaction at the site of valence-skip atom. However, it is not easy to synthesize such compound because of (i) the instability of the skipping valence state, (ii) the competing charge order, and (iii) that formal valence may not be true in some compounds. In the present study, we show several examples of the valence-skip compounds and discuss how we can design them by first principles calculations. Furthermore, we calculated the electronic structure of a promising candidate of valence skipping compound RbTlCl 3 from first principles. We confirmed that the charge-density wave (CDW) is formed in this compound, and the Tl atoms in two crystallographic different sites take the valence Tl 1+ and Tl 3+ . Structure optimization study reveals that this CDW is stable at the ambient pressure, while this CDW gap can be collapsed when we apply pressure with several gigapascals. In this metallic phase, we can expect a large charge fluctuation and a large electron-phonon interaction.

Is breakfast skipping associated with physical activity among U.S. adolescents? A cross-sectional study of adolescents aged 12-19 years, National Health and Nutrition Examination Survey (NHANES).

PubMed

Lyerly, Jordan E; Huber, Larissa R; Warren-Findlow, Jan; Racine, Elizabeth F; Dmochowski, Jacek

2014-04-01

To examine the association between breakfast skipping and physical activity among US adolescents aged 12-19 years. A cross-sectional study of nationally representative 2007-2008 National Health and Nutrition Examination Survey (NHANES) data. Breakfast skipping was assessed by two 24 h dietary recalls. Physical activity was self-reported by participants and classified based on meeting national recommendations for physical activity for the appropriate age group. Multiple logistic regression analysis was used to model the association between breakfast skipping and physical activity while controlling for confounders. A total of 936 adolescents aged 12-19 years in the USA. After adjusting for family income, there was no association between breakfast skipping and meeting physical activity guidelines for age among adolescents aged 12-19 years (OR = 0.95, 95% CI 0.56, 1.32). Findings from the study differ from previous research findings on breakfast skipping and physical activity. Therefore, further research that uses large, nationally representative US samples and national recommended guidelines for physical activity is needed.

Breakfast Skipping, Extreme Commutes, and the Sex Composition at Birth.

PubMed

Mazumder, Bhashkar; Seeskin, Zachary

2015-01-01

A growing body of literature has shown that environmental exposures in the period around conception can affect the sex ratio at birth through selective attrition that favors the survival of female conceptuses. Glucose availability is considered a key indicator of the fetal environment, and its absence as a result of meal skipping may inhibit male survival. We hypothesize that breakfast skipping during pregnancy may lead to a reduction in the fraction of male births. Using time use data from the United States we show that women with commute times of 90 minutes or longer are 20 percentage points more likely to skip breakfast. Using U.S. census data we show that women with commute times of 90 minutes or longer are 1.2 percentage points less likely to have a male child under the age of 2. Under some assumptions, this implies that routinely skipping breakfast around the time of conception leads to a 6 percentage point reduction in the probability of a male child. Skipping breakfast during pregnancy may therefore constitute a poor environment for fetal health more generally.

The influence of the metastasis pattern of mediastinal lymph nodes on the postoperative radiotherapy’s efficacy for the IIIA-pN2 non-small-cell lung cancer: a retrospective analysis of 220 patients

PubMed Central

Zhang, Baozhong; Zhao, Lujun; Yuan, Zhiyong; Pang, Qingsong; Wang, Ping

2016-01-01

Objective The use of postoperative radiotherapy (PORT) remains controversial for Stage IIIA-N2 non-small-cell lung cancer (NSCLC) patients, a possible reason is that IIIA-pN2 NSCLC diseases are a heterogeneous group with different clinicopathologic features. The aim of this research was to prove whether the mediastinal lymph nodes’ (LNs) skipping status could indicate the necessity of the PORT for the pN2 NSCLC patients. Methods The skip metastasis was defined as pN0N2 (no N1 LN involved), and nonskip metastasis was pN1N2 (one or more N1 LNs involved). Patients were divided into two groups: LNs nonskip and LNs skip, and postoperative chemoradiotherapy (POCRT) and postoperative chemotherapy. Then, the LN nonskip and LN skip groups were further divided into subgroups: POCRT and point of care testing (POCT) for subgroup analysis. Results There were 220 cases included in the analysis, and 43 of them received PORT. On univariate analysis, the median 3-year progression-free survival (PFS) was, respectively, 16 months (27.7%) for the LN skip group and 11 months (15.3%) for the LN nonskip group (P=0.001). The median 3-year overall survival (OS) was, respectively, 35 months (47.0%) for the LN skip group and 27 months (38.7%) for the LN nonskip group (P=0.025). The median 3-year local recurrence-free survival (LRFS) was, respectively, 25 months (41.0%) for the LN skip group and19 months (29.9%) for the LN nonskip group (P=0.014). The median 3-year distant metastasis-free survival (DMFS) was, respectively, 22 months (32.5%) for the LN skip group and 15 months (20.4%) for the LN nonskip group (P=0.013). The median 3-year PFS was, respectively, 17 months (25.6%) for the POCRT group and 12 months (18.6%) for the POCT group (P=0.037). Although the POCRT group showed better OS, LRFS, and DMFS than the POCT group, the results showed no statistical significance. In subgroup analysis, there was no statistical significance in the Kaplan–Meier analysis between subgroups, but it showed that POCRT resulted in better PFS, OS, and DMFS in both LN skip and LN nonskip subgroups; this advantage was more obvious in the LN skip subgroup. Conclusion The LN skip status is closely related to the survival of the IIIA-N2 NSCLC disease, and the LN skip patients may get more benefit in PFS and LRFS than the LN nonskip patients from PORT. PMID:27785064

Quantitative Antisense Screening and Optimization for Exon 51 Skipping in Duchenne Muscular Dystrophy.

PubMed

Echigoya, Yusuke; Lim, Kenji Rowel Q; Trieu, Nhu; Bao, Bo; Miskew Nichols, Bailey; Vila, Maria Candida; Novak, James S; Hara, Yuko; Lee, Joshua; Touznik, Aleksander; Mamchaoui, Kamel; Aoki, Yoshitsugu; Takeda, Shin'ichi; Nagaraju, Kanneboyina; Mouly, Vincent; Maruyama, Rika; Duddy, William; Yokota, Toshifumi

2017-11-01

Duchenne muscular dystrophy (DMD), the most common lethal genetic disorder, is caused by mutations in the dystrophin (DMD) gene. Exon skipping is a therapeutic approach that uses antisense oligonucleotides (AOs) to modulate splicing and restore the reading frame, leading to truncated, yet functional protein expression. In 2016, the US Food and Drug Administration (FDA) conditionally approved the first phosphorodiamidate morpholino oligomer (morpholino)-based AO drug, eteplirsen, developed for DMD exon 51 skipping. Eteplirsen remains controversial with insufficient evidence of its therapeutic effect in patients. We recently developed an in silico tool to design antisense morpholino sequences for exon skipping. Here, we designed morpholino AOs targeting DMD exon 51 using the in silico tool and quantitatively evaluated the effects in immortalized DMD muscle cells in vitro. To our surprise, most of the newly designed morpholinos induced exon 51 skipping more efficiently compared with the eteplirsen sequence. The efficacy of exon 51 skipping and rescue of dystrophin protein expression were increased by up to more than 12-fold and 7-fold, respectively, compared with the eteplirsen sequence. Significant in vivo efficacy of the most effective morpholino, determined in vitro, was confirmed in mice carrying the human DMD gene. These findings underscore the importance of AO sequence optimization for exon skipping. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

26 CFR 26.2663-2 - Application of chapter 13 to transfers by nonresidents not citizens of the United States.

Code of Federal Regulations, 2012 CFR

2012-04-01

... SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX... generation-skipping trust. Of the property transferred to the trust, property having a value of $200 is... exemption to the trust on a timely filed United States Gift (and Generation-Skipping Transfer) Tax Return...

26 CFR 26.2663-2 - Application of chapter 13 to transfers by nonresidents not citizens of the United States.

Code of Federal Regulations, 2013 CFR

2013-04-01

... SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX... generation-skipping trust. Of the property transferred to the trust, property having a value of $200 is... exemption to the trust on a timely filed United States Gift (and Generation-Skipping Transfer) Tax Return...

26 CFR 26.2663-2 - Application of chapter 13 to transfers by nonresidents not citizens of the United States.

Code of Federal Regulations, 2014 CFR

2014-04-01

... SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX... generation-skipping trust. Of the property transferred to the trust, property having a value of $200 is... exemption to the trust on a timely filed United States Gift (and Generation-Skipping Transfer) Tax Return...

26 CFR 26.2663-2 - Application of chapter 13 to transfers by nonresidents not citizens of the United States.

Code of Federal Regulations, 2011 CFR

2011-04-01

... SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX... generation-skipping trust. Of the property transferred to the trust, property having a value of $200 is... exemption to the trust on a timely filed United States Gift (and Generation-Skipping Transfer) Tax Return...

26 CFR 26.2611-1 - Generation-skipping transfer defined.

Code of Federal Regulations, 2010 CFR

2010-04-01

... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2611... either a direct skip, a taxable distribution, or a taxable termination. See § 26.2612-1 for the definition of these terms. The determination as to whether an event is a GST is made by reference to the most...

7 CFR 42.123 - Flow diagram for skip lot sampling and inspection.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 7 Agriculture 2 2014-01-01 2014-01-01 false Flow diagram for skip lot sampling and inspection. 42.123 Section 42.123 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING... Procedures § 42.123 Flow diagram for skip lot sampling and inspection. EC02SE91.000 Notes: 1. Only normal...

7 CFR 42.123 - Flow diagram for skip lot sampling and inspection.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 7 Agriculture 2 2011-01-01 2011-01-01 false Flow diagram for skip lot sampling and inspection. 42.123 Section 42.123 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING... Procedures § 42.123 Flow diagram for skip lot sampling and inspection. EC02SE91.000 Notes: 1. Only normal...

7 CFR 42.123 - Flow diagram for skip lot sampling and inspection.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 7 Agriculture 2 2013-01-01 2013-01-01 false Flow diagram for skip lot sampling and inspection. 42.123 Section 42.123 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING... Procedures § 42.123 Flow diagram for skip lot sampling and inspection. EC02SE91.000 Notes: 1. Only normal...

7 CFR 42.123 - Flow diagram for skip lot sampling and inspection.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 7 Agriculture 2 2012-01-01 2012-01-01 false Flow diagram for skip lot sampling and inspection. 42.123 Section 42.123 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING... Procedures § 42.123 Flow diagram for skip lot sampling and inspection. EC02SE91.000 Notes: 1. Only normal...

The Stratospheric Kinetic Inductance Polarimeter (SKIP)

NASA Astrophysics Data System (ADS)

Flanigan, Daniel; Ade, P.; Araujo, D.; Bradford, K. J.; Chapman, D.; Che, G.; Day, P.; Didier, J.; Doyle, S.; Eriksen, H.; Groppi, C. E.; Hillbrand, S. N.; Johnson, B.; Jones, G.; Limon, M.; Mauskopf, P.; McCarrick, H.; Miller, A. D.; Mroczkowski, T.; Reichborn-Kjennerud, B.; Smiley, B.; Sobrin, J.; Wehus, I. K.; Zmuidzinas, J.

2014-01-01

We discuss the Stratospheric Kinetic Inductance Polarimeter (SKIP). SKIP is a proposed balloon-borne experiment designed to study the cosmic microwave background, the cosmic infrared background, and Galactic dust emission by observing 1100 square degrees of sky in the Northern Hemisphere with launches from Kiruna, Sweden. The instrument contains 2317 single-polarization, horn-coupled, aluminum lumped-element kinetic inductance detectors (LEKIDs), which will be maintained at 100 mK by an adiabatic demagnetization refrigerator. The polarimeter will operate in two configurations, one sensitive to a spectral band centered on 150 GHz and the other sensitive to 260 and 350 GHz bands. The detector readout system is based on the ROACH-1 board, and the detectors will be biased below 300 MHz. The detector array is fed by an F/2.4 crossed-Dragone telescope with a 500 mm aperture yielding a 15 arcminute full-width half-maximum beam at 150 GHz. To minimize detector loading and maximize sensitivity, the entire optical system will be cooled to 1 K. Linearly polarized sky signals will be modulated with a metal-mesh half-wave plate that is mounted at the telescope aperture and is rotated on a superconducting magnetic bearing. The observation program consists of two or more five-day flights, and 150 GHz observations are planned to begin in 2017.

Sweets, snacking habits, and skipping meals in children and adolescents on intensive insulin treatment.

PubMed

Øverby, N C; Margeirsdottir, H D; Brunborg, C; Dahl-Jørgensen, K; Andersen, L F

2008-08-01

To examine the association between skipping meals and snacking events and dietary and clinical characteristics in children and adolescents using modern insulin treatment. Dietary intake was recorded for 4 d in food diaries in 655 young diabetic patients. Number of meals and snacking events was recorded in a separated questionnaire, while clinical data were obtained from case record forms. Skipping meals refer to consuming a main meal (e.g., breakfast) five times a week or less. Modern insulin treatment may favor a more flexible lifestyle. This study shows that there are fewer young diabetic patients who skip meals than non-diabetic controls (p < 0.001) even when using modern intensified insulin treatment. However, skipping meals among young diabetic patients was associated with negative characteristics such as having suboptimal hemoglobin A1c (HbA1c) (OR 4.7, p = 0.02), higher low-density lipoprotein (LDL) cholesterol levels (OR 4.0, p < 0.001), watching more TV (OR 3.6, p < 0.001), being overweight (OR 2.8, p = 0.03), as well as having a higher intake of added sugar (OR 2.1, p = 0.01) and lower intake of fiber (OR 0.2, p = 0.04) compared with those not skipping meals. Having more than two snacking events during the day was associated with higher HbA1c, higher intake of added sugar and sweets, and spending more hours in front of the TV or personal computer. In general, fewer children and adolescents with type 1 diabetes skip meals compared with healthy peers. Those who skip meals and have more snacking events have poorer glycemic control and less healthy dietary and leisure habits.

Manned geosynchronous mission requirements and systems analysis study. Volume 1: Executive summary

NASA Technical Reports Server (NTRS)

Boyland, R. E.; Sherman, S. W.; Morfin, H. W.

1979-01-01

The crew capsule of the MOTV was studied with emphasis on crew accommodations, crew capsule functional requirements, subsystem interface definition between crew module and propulsion module, and man rating requirements. Competing mission modes were studied covering a wide range of propulsion concepts. These included one stage, one and one half stage, and two stage concepts using either the standard STS or an augmented STS. Several deorbit concepts were considered, including all propulsive modes, direct re-entry, and aeromaneuvering skip in skip out in the upper reaches of Earth's atmosphere. A five year plan covering costs, schedules, and critical technology issues is discussed.

Elastic spheres can walk on water.

PubMed

Belden, Jesse; Hurd, Randy C; Jandron, Michael A; Bower, Allan F; Truscott, Tadd T

2016-02-04

Incited by public fascination and engineering application, water-skipping of rigid stones and spheres has received considerable study. While these objects can be coaxed to ricochet, elastic spheres demonstrate superior water-skipping ability, but little is known about the effect of large material compliance on water impact physics. Here we show that upon water impact, very compliant spheres naturally assume a disk-like geometry and dynamic orientation that are favourable for water-skipping. Experiments and numerical modelling reveal that the initial spherical shape evolves as elastic waves propagate through the material. We find that the skipping dynamics are governed by the wave propagation speed and by the ratio of material shear modulus to hydrodynamic pressure. With these insights, we explain why softer spheres skip more easily than stiffer ones. Our results advance understanding of fluid-elastic body interaction during water impact, which could benefit inflatable craft modelling and, more playfully, design of elastic aquatic toys.

Elastic spheres can walk on water

PubMed Central

Belden, Jesse; Hurd, Randy C.; Jandron, Michael A.; Bower, Allan F.; Truscott, Tadd T.

2016-01-01

Incited by public fascination and engineering application, water-skipping of rigid stones and spheres has received considerable study. While these objects can be coaxed to ricochet, elastic spheres demonstrate superior water-skipping ability, but little is known about the effect of large material compliance on water impact physics. Here we show that upon water impact, very compliant spheres naturally assume a disk-like geometry and dynamic orientation that are favourable for water-skipping. Experiments and numerical modelling reveal that the initial spherical shape evolves as elastic waves propagate through the material. We find that the skipping dynamics are governed by the wave propagation speed and by the ratio of material shear modulus to hydrodynamic pressure. With these insights, we explain why softer spheres skip more easily than stiffer ones. Our results advance understanding of fluid-elastic body interaction during water impact, which could benefit inflatable craft modelling and, more playfully, design of elastic aquatic toys. PMID:26842860

Federal Emergency Management Agency

MedlinePlus

... Preparedness Goal National Preparedness System Blog Careers FEMA Earthquake Contacts Center for Faith-Based & Neighborhood Partnerships Grant ... hazard categories including riverine flood, hurricane surge, wind, earthquake, and Wildland-Urban Interface Fire. Skip footer content. ...

40 CFR 61.243-2 - Alternative standards for valves in VHAP service-skip period leak detection and repair.

Code of Federal Regulations, 2010 CFR

2010-07-01

... VHAP service-skip period leak detection and repair. 61.243-2 Section 61.243-2 Protection of Environment... AIR POLLUTANTS National Emission Standard for Equipment Leaks (Fugitive Emission Sources) § 61.243-2 Alternative standards for valves in VHAP service—skip period leak detection and repair. (a)(1) An owner or...

40 CFR 264.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2010 CFR

2010-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 264.1062 Section... Emission Standards for Equipment Leaks § 264.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or operator subject to...

40 CFR 264.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2011 CFR

2011-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 264.1062 Section... Emission Standards for Equipment Leaks § 264.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or operator subject to...

40 CFR 265.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2014 CFR

2014-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 265.1062 Section... FACILITIES Air Emission Standards for Equipment Leaks § 265.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or...

40 CFR 264.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2012 CFR

2012-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 264.1062 Section... Emission Standards for Equipment Leaks § 264.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or operator subject to...

40 CFR 265.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2011 CFR

2011-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 265.1062 Section... FACILITIES Air Emission Standards for Equipment Leaks § 265.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or...

40 CFR 265.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2010 CFR

2010-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 265.1062 Section... FACILITIES Air Emission Standards for Equipment Leaks § 265.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or...

40 CFR 264.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2013 CFR

2013-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 264.1062 Section... Emission Standards for Equipment Leaks § 264.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or operator subject to...

40 CFR 265.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2013 CFR

2013-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 265.1062 Section... FACILITIES Air Emission Standards for Equipment Leaks § 265.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or...

40 CFR 265.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2012 CFR

2012-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 265.1062 Section... FACILITIES Air Emission Standards for Equipment Leaks § 265.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or...

40 CFR 264.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2014 CFR

2014-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 264.1062 Section... Emission Standards for Equipment Leaks § 264.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or operator subject to...

Water walking - an evolution of water surface skipping

NASA Astrophysics Data System (ADS)

Hurd, Randy; Belden, Jesse; Jandron, Michael; Bower, Allan; Holekamp, Sean; Truscott, Tadd

2017-11-01

Previous work has shown that elastomeric spheres skip more easily than disk-shaped stones. This is due to increased lift stemming from sphere deformation, which provides an increased cross-sectional area and favorable attack angle upon impact. We extend lift models developed for individual impacts to long-range multiple impact events and compare the estimates to experimental results, which show good agreement. Additionally, a surprising new mode of skipping is observed that resembles water-walking, wherein a quickly rotating sphere produces small successive impacts allowing it to move parallel to the water surface. The dynamics of this new multiple skip behavior are rationalized analytically and tested experimentally.

Antisense-mediated exon skipping: A versatile tool with therapeutic and research applications

PubMed Central

Aartsma-Rus, Annemieke; van Ommen, Gert-Jan B.

2007-01-01

Antisense-mediated modulation of splicing is one of the few fields where antisense oligonucleotides (AONs) have been able to live up to their expectations. In this approach, AONs are implemented to restore cryptic splicing, to change levels of alternatively spliced genes, or, in case of Duchenne muscular dystrophy (DMD), to skip an exon in order to restore a disrupted reading frame. The latter allows the generation of internally deleted, but largely functional, dystrophin proteins and would convert a severe DMD into a milder Becker muscular dystrophy phenotype. In fact, exon skipping is currently one of the most promising therapeutic tools for DMD, and a successful first-in-man trial has recently been completed. In this review the applicability of exon skipping for DMD and other diseases is described. For DMD AONs have been designed for numerous exons, which has given us insight into their mode of action, splicing in general, and splicing of the DMD gene in particular. In addition, retrospective analysis resulted in guidelines for AON design for DMD and most likely other genes as well. This knowledge allows us to optimize therapeutic exon skipping, but also opens up a range of other applications for the exon skipping approach. PMID:17684229

New scene change control scheme based on pseudoskipped picture

NASA Astrophysics Data System (ADS)

Lee, Youngsun; Lee, Jinwhan; Chang, Hyunsik; Nam, Jae Y.

1997-01-01

A new scene change control scheme which improves the video coding performance for sequences that have many scene changed pictures is proposed in this paper. The scene changed pictures except intra-coded picture usually need more bits than normal pictures in order to maintain constant picture quality. The major idea of this paper is how to obtain extra bits which are needed to encode scene changed pictures. We encode a B picture which is located before a scene changed picture like a skipped picture. We call such a B picture as a pseudo-skipped picture. By generating the pseudo-skipped picture like a skipped picture. We call such a B picture as a pseudo-skipped picture. By generating the pseudo-skipped picture, we can save some bits and they are added to the originally allocated target bits to encode the scene changed picture. The simulation results show that the proposed algorithm improves encoding performance about 0.5 to approximately 2.0 dB of PSNR compared to MPEG-2 TM5 rate controls scheme. In addition, the suggested algorithm is compatible with MPEG-2 video syntax and the picture repetition is not recognizable.

Performance Analysis of Stop-Skipping Scheduling Plans in Rail Transit under Time-Dependent Demand

PubMed Central

Cao, Zhichao; Yuan, Zhenzhou; Zhang, Silin

2016-01-01

Stop-skipping is a key method for alleviating congestion in rail transit, where schedules are sometimes difficult to implement. Several mechanisms have been proposed and analyzed in the literature, but very few performance comparisons are available. This study formulated train choice behavior estimation into the model considering passengers’ perception. If a passenger’s train path can be identified, this information would be useful for improving the stop-skipping schedule service. Multi-performance is a key characteristic of our proposed five stop-skipping schedules, but quantified analysis can be used to illustrate the different effects of well-known deterministic and stochastic forms. Problems in the novel category of forms were justified in the context of a single line rather than transit network. We analyzed four deterministic forms based on the well-known A/B stop-skipping operating strategy. A stochastic form was innovatively modeled as a binary integer programming problem. We present a performance analysis of our proposed model to demonstrate that stop-skipping can feasibly be used to improve the service of passengers and enhance the elasticity of train operations under demand variations along with an explicit parametric discussion. PMID:27420087

Performance Analysis of Stop-Skipping Scheduling Plans in Rail Transit under Time-Dependent Demand.

PubMed

Cao, Zhichao; Yuan, Zhenzhou; Zhang, Silin

2016-07-13

Stop-skipping is a key method for alleviating congestion in rail transit, where schedules are sometimes difficult to implement. Several mechanisms have been proposed and analyzed in the literature, but very few performance comparisons are available. This study formulated train choice behavior estimation into the model considering passengers' perception. If a passenger's train path can be identified, this information would be useful for improving the stop-skipping schedule service. Multi-performance is a key characteristic of our proposed five stop-skipping schedules, but quantified analysis can be used to illustrate the different effects of well-known deterministic and stochastic forms. Problems in the novel category of forms were justified in the context of a single line rather than transit network. We analyzed four deterministic forms based on the well-known A/B stop-skipping operating strategy. A stochastic form was innovatively modeled as a binary integer programming problem. We present a performance analysis of our proposed model to demonstrate that stop-skipping can feasibly be used to improve the service of passengers and enhance the elasticity of train operations under demand variations along with an explicit parametric discussion.

Breakfast skipping as a risk correlate of overweight and obesity in school-going ethnic Fijian adolescent girls

PubMed Central

Thompson-McCormick, Jonas J; Thomas, Jennifer J; Bainivualiku, Asenaca; Khan, A Nisha; Becker, Anne E

2013-01-01

The prevalence of overweight and obesity has increased globally, and population data suggest that it is also increasing among ethnic Fijian youth. Among numerous behavioural changes contributing to overweight in youth residing in nations undergoing rapid economic and social change, meal skipping has not been examined as a potential risk factor. The study objectives were to assess the prevalence of overweight, obesity, and breakfast skipping and examine their cross-sectional association in a community sample of school-going ethnic Fijian adolescent girls (n=523). We measured height and weight, and assessed dietary patterns, eating pathology, dimensions of acculturation, and other socio-demographic and cultural data by self-report. We observed a high prevalence of both overweight (41%, including 15% who were obese) and breakfast skipping (68%). In addition, in multivariable analyses unadjusted for eating pathology, we found that more frequent breakfast skipping was associated with greater odds of overweight (odds ratio (OR)=1.15, confidence interval (CI)=1.06, 1.26, p<0.01) and obesity (OR=1.18, CI=1.05, 1.33, p<0.01). Regression models adjusting for eating pathology attenuated this relation so that it was non-significant, but demonstrated that greater eating pathology was associated with greater odds of both overweight and obesity. Future research is necessary to clarify the relation among breakfast skipping, eating pathology, and overweight in ethnic Fijian girls, and to identify whether breakfast skipping may be a modifiable risk factor for overweight in this population. PMID:20805082

Relationship between Breakfast Skipping and Obesity among Elderly: Cross-Sectional Analysis of the HEIJO-KYO Study.

PubMed

Otaki, N; Obayashi, K; Saeki, K; Kitagawa, M; Tone, N; Kurumatani, N

2017-01-01

Breakfast skipping is reported to be associated with obesity in children and younger populations; however, few studies report the association among elderly. The purpose of this study was to investigate the relationships between breakfast skipping and obesity prevalence among elderly. Cross-sectional study. Community-dwelling elderly in Nara, Japan. 1052 elderly participants (mean age: 71.6 years). Obesity and breakfast skipping were defined as body mass index of ≥25 kg/m2 and skipping breakfast one or more times per week, respectively. Two hundred and seventy-two participants (25.9%) were classified as obese and forty-one (3.9%) were as breakfast skippers. Obesity prevalence was significantly higher in breakfast skippers than in breakfast eaters (43.9% vs. 25.1%, P = 0.007). In multivariable logistic regression analysis adjusted for potential confounders (age, sex and alcohol consumption), breakfast skippers showed significantly higher odds ratio (OR) for obesity than breakfast eaters (OR, 2.23; 95% confidence interval, 1.17-4.27; P = 0.015), which continued to be significant after further adjustment for socioeconomic status. In addition, breakfast skippers showed significantly lower daily potassium (P <0.001) and dietary fibre intakes (P = 0.001) and lower subjective physical activity (P = 0.035) than breakfast eaters. Breakfast skipping was significantly associated with obesity among elderly. Poor diet quality and physical inactivity may be potential intermediators underlying the association between breakfast skipping and obesity.

Predictive simulation of gait at low gravity reveals skipping as the preferred locomotion strategy

PubMed Central

Ackermann, Marko; van den Bogert, Antonie J.

2012-01-01

The investigation of gait strategies at low gravity environments gained momentum recently as manned missions to the Moon and to Mars are reconsidered. Although reports by astronauts of the Apollo missions indicate alternative gait strategies might be favored on the Moon, computational simulations and experimental investigations have been almost exclusively limited to the study of either walking or running, the locomotion modes preferred under Earth's gravity. In order to investigate the gait strategies likely to be favored at low gravity a series of predictive, computational simulations of gait are performed using a physiological model of the musculoskeletal system, without assuming any particular type of gait. A computationally efficient optimization strategy is utilized allowing for multiple simulations. The results reveal skipping as more efficient and less fatiguing than walking or running and suggest the existence of a walk-skip rather than a walk-run transition at low gravity. The results are expected to serve as a background to the design of experimental investigations of gait under simulated low gravity. PMID:22365845

Predictive simulation of gait at low gravity reveals skipping as the preferred locomotion strategy.

PubMed

Ackermann, Marko; van den Bogert, Antonie J

2012-04-30

The investigation of gait strategies at low gravity environments gained momentum recently as manned missions to the Moon and to Mars are reconsidered. Although reports by astronauts of the Apollo missions indicate alternative gait strategies might be favored on the Moon, computational simulations and experimental investigations have been almost exclusively limited to the study of either walking or running, the locomotion modes preferred under Earth's gravity. In order to investigate the gait strategies likely to be favored at low gravity a series of predictive, computational simulations of gait are performed using a physiological model of the musculoskeletal system, without assuming any particular type of gait. A computationally efficient optimization strategy is utilized allowing for multiple simulations. The results reveal skipping as more efficient and less fatiguing than walking or running and suggest the existence of a walk-skip rather than a walk-run transition at low gravity. The results are expected to serve as a background to the design of experimental investigations of gait under simulated low gravity. Copyright © 2012 Elsevier Ltd. All rights reserved.

Cosmic Origins Spectrograph: On-Orbit Performance of Target Acquisitions

NASA Astrophysics Data System (ADS)

Penton, Steven V.

2010-07-01

COS is a slit-less spectrograph with a very small aperture (R=1.2500). To achieve the desired wavelength accuracies, HST+COS must center the target to within 0.100 of the center of the aperture for the FUV channel, and 0.0400 for NUV. During SMOV and early Cycle 17 we fine-tuned the COS target acquisition (TA) procedures to exceed this accuracy for all three COS TA modes; NUV imaging, NUV spectroscopic, and FUV spectroscopic. In Cycle 17, we also adjusted the COSto- FGS offsets in the SIAF file. This allows us to recommend skipping the time consuming ACQ/SEARCH in cases where the target coordinates are well known. Here we will compare the on-orbit performance of all COS TA modes in terms of centering accuracy, efficiency, and required signal-to-noise (S/N).

The relationship of breakfast skipping and type of breakfast consumption with nutrient intake and weight status in children and adolescents: the National Health and Nutrition Examination Survey 1999-2006

USDA-ARS?s Scientific Manuscript database

National data comparing nutrient intakes and anthropometric measures in children and adolescents in the United States who skip breakfast or consume different types of breakfasts are limited. The objective was to examine the relationship between breakfast skipping and type of breakfast consumed with ...

Skip trajectory flight of a ramjet-powered hypersonic vehicle

NASA Astrophysics Data System (ADS)

Fomin, V. M.; Aulchenko, S. M.; Zvegintsev, V. I.

2010-07-01

Possible skip trajectories of a flying vehicle with a periodically actuated ramjet are numerically simulated. An optimal choice of ramjet actuation areas and duration is demonstrated to ensure the maximum flight range with a given amount of the fuel. The main advantage of skip trajectories is found to be a significant (by an order of magnitude) decrease in thermal loads on the flying vehicle.

Modulating Calcium Signals to Boost AON Exon Skipping for DMD

DTIC Science & Technology

2016-10-01

RNA Seq analysis to identify mechanisms of activity and specificity in order to guide discovery of second-generation skipping drugs or combinations...with greater activity. 15. SUBJECT TERMS Exon skipping, Dantrolene, Calcium, Duchenne, Dytrophy, Dystrophin, anti-sense-oligonucleatide, DMD, RNA ...for a subset of very rare mutations. Finally, we hypothesize that by combining chemical genomics with RNA Seq analysis we can begin to identify

An examination of the role of feeding regimens in regulating metabolism during the broiler breeder grower period. 1. Hepatic lipid metabolism.

PubMed

de Beer, M; Rosebrough, R W; Russell, B A; Poch, S M; Richards, M P; Coon, C N

2007-08-01

A trial was conducted to determine the effects of feeding regimens on hepatic lipid metabolism in 16-wk-old broiler breeder pullets. A flock of 350 Cobb 500 breeder pullets was divided into 2 at 4 wk of age and fed either every day (ED) or skip-a-day (SKIP) from 4 to 16 wk of age. Total feed intake did not differ between the 2 groups. At 112 d, 52 randomly selected ED-fed pullets, and 76 SKIP-fed pullets were individually caged and fed a 74-g (ED) or 148-g (SKIP) meal. Four pullets from each group were killed at intervals after feeding and livers were collected, weighed, and snap-frozen for determination of lipogenic gene expression. Total RNA was isolated from livers using Trizol reagent and then quantitatively measured by noting the optical density 260:280 ratio and qualitatively measured by gel electrophoresis. The expression of certain regulatory genes in metabolism [acetyl coenzyme A carboxylase; fatty acid synthase; malic enzyme (MAE); isocitrate dehydrogenase (ICDH); and aspartate aminotransferase (AAT)] were determined by real-time reverse-transcription PCR. Remaining liver portions were analyzed for enzyme activity of MAE, ICDH, and AAT as well as glycogen and lipid contents. Liver weight was higher in SKIP than in ED birds. Feeding caused dramatic increases in liver weight, glycogen, and lipids of SKIP birds. Expression of acetyl coenzyme A carboxylase, FAS, and MAE genes were increased in SKIP birds 12 and 24 h after feeding, with the increases in MAE expression from 0 to 24 h after feeding being of the greatest magnitude. In contrast, SKIP decreased ICDH and AAT gene expression, which parallels findings noted in fasting-refeeding experiments conducted with much younger birds. Skip-a-day feeding resulted in far greater changes in gene expression compared with ED, which was indicative of the inconsistent supply of nutrients in such regimens. Enzyme activity of MAE, ICDH, and AAT was reflective of noted changes in gene expression. In summary, the feeding regimen greatly affected hepatic gene expression in breeder pullets.

Media use as a reason for meal skipping and fast eating in secondary school children.

PubMed

Van den Bulck, J; Eggermont, S

2006-04-01

This study examined self-reported meal skipping and eating faster than usual with the goal of watching television or playing computer games. Respondents reported their media use and indicated how often they skipped a meal to watch a favourite television programme or to play a computer game, and how often they ate faster than usual in order to watch television or play a computer game. Respondents were 2546 adolescents of 13 (first year of secondary school) and 16 years (fourth year of secondary school) of age. About one respondent in 10 skipped at least one meal every week for either television viewing or computer game playing. Weekly meal skipping for television viewing occurs more regularly in boys and first-year students, but particularly in teenagers who view 5 h or more daily (15% of the sample). The category of teenagers who play computer games four times a week or more (25.3% of the sample) is at increased risk of meal skipping; those who play more than four times a week are 10 times more likely weekly to skip a meal. A quarter of the adolescents eat faster at least once a week to be able to watch television or play a computer game. Regardless of gender and school year, teenagers' risk of eating faster progressively increases with their use of the media. Those who watch 4 h or more daily are about seven times more likely to skip a meal for television and those who play computer games at least four times a week are nine times more likely weekly to skip a meal. Unhealthy eating habits can be a side effect of heavy or excessive media use. Teenagers' use of television or game computers during nonworking or out-of-school hours partly displaces the amount of time that needs to be spent at meals. Practitioners and educators may try to encourage or restore a pattern of healthful meal consumption habits by reducing the amount of media use, and by supporting parental rule-making regarding children's eating habits and media use.

Multi-Level Adaptive Techniques (MLAT) for singular-perturbation problems

NASA Technical Reports Server (NTRS)

Brandt, A.

1978-01-01

The multilevel (multigrid) adaptive technique, a general strategy of solving continuous problems by cycling between coarser and finer levels of discretization is described. It provides very fast general solvers, together with adaptive, nearly optimal discretization schemes. In the process, boundary layers are automatically either resolved or skipped, depending on a control function which expresses the computational goal. The global error decreases exponentially as a function of the overall computational work, in a uniform rate independent of the magnitude of the singular-perturbation terms. The key is high-order uniformly stable difference equations, and uniformly smoothing relaxation schemes.

AKDNR - DNR Business Reporting System (DBRS)

Science.gov Websites

Skip to content State of Alaska myAlaska My Government Resident Business in Alaska Visiting Alaska Resources > IRM GPU > Main Menu DNR Business Reporting System (DBRS) The DNR Business Reporting System (DBRS) allows users to generate reports from the DNR Business databases and maps. The reports offered

Cycle-to-cycle IMEP fluctuations in a stoichiometrically-fueled S. I. engine at low speed and load

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sztenderowicz, M.L.; Heywood, J.B.

1990-01-01

In a previous experimental investigation of the effects of residual gas nonuniformity on S.I. engine combustion variability, it was found that eliminating residual gas nonuniformity by skip firing has no detectable impact on the flame development process, but nonetheless caused IMEP fluctuations to drop by about half under very light load conditions. This paper reports that under further investigation, it has been determined that the observed IMEP fluctuations, particularly for optimally-phased cycles, are controlled by cyclic variations in the amount of fuel burning per cycle. Real-time sampling of the hydrocarbon concentration in the exhaust port has shown that the variationmore » in fuel burned per cycle is not primarily due to variations in combustion completeness, and must therefore be attributed to variations in the amount of fuel trapped within the cylinder prior to combustion. Several mechanisms for this variation were identified, all of which are plausible but none of which are likely to dominate: variations in fuel quantity left in the cylinder from the previous cycle; variations in the fluid dynamics of the intake process; fresh charge displacement due to variations in residual gas temperature; variations in leakage through valves; and fluctuations in crevice effects and blow-by.« less

Optimized P2A for reporter gene insertion into Nipah virus results in efficient ribosomal skipping and wild-type lethality.

PubMed

Park, Arnold; Yun, Tatyana; Hill, Terence E; Ikegami, Tetsuro; Juelich, Terry L; Smith, Jennifer K; Zhang, Lihong; Freiberg, Alexander N; Lee, Benhur

2016-04-01

Incorporation of reporter genes within virus genomes is an indispensable tool for interrogation of virus biology and pathogenesis. In previous work, we incorporated a fluorophore into a viral ORF by attaching it to the viral gene via a P2A ribosomal skipping sequence. This recombinant Nipah virus, however, was attenuated in vitro relative to WT virus. In this work, we determined that inefficient ribosomal skipping was a major contributing factor to this attenuation. Inserting a GSG linker before the P2A sequence resulted in essentially complete skipping, significantly improved growth in vitro, and WT lethality in vivo. To the best of our knowledge, this represents the first time a recombinant virus of Mononegavirales with integration of a reporter into a viral ORF has been compared with the WT virus in vivo. Incorporating the GSG linker for improved skipping efficiency whenever functionally important is a critical consideration for recombinant virus design.

A Large Scale Code Resolution Service Network in the Internet of Things

PubMed Central

Yu, Haining; Zhang, Hongli; Fang, Binxing; Yu, Xiangzhan

2012-01-01

In the Internet of Things a code resolution service provides a discovery mechanism for a requester to obtain the information resources associated with a particular product code immediately. In large scale application scenarios a code resolution service faces some serious issues involving heterogeneity, big data and data ownership. A code resolution service network is required to address these issues. Firstly, a list of requirements for the network architecture and code resolution services is proposed. Secondly, in order to eliminate code resolution conflicts and code resolution overloads, a code structure is presented to create a uniform namespace for code resolution records. Thirdly, we propose a loosely coupled distributed network consisting of heterogeneous, independent; collaborating code resolution services and a SkipNet based code resolution service named SkipNet-OCRS, which not only inherits DHT's advantages, but also supports administrative control and autonomy. For the external behaviors of SkipNet-OCRS, a novel external behavior mode named QRRA mode is proposed to enhance security and reduce requester complexity. For the internal behaviors of SkipNet-OCRS, an improved query algorithm is proposed to increase query efficiency. It is analyzed that integrating SkipNet-OCRS into our resolution service network can meet our proposed requirements. Finally, simulation experiments verify the excellent performance of SkipNet-OCRS. PMID:23202207

A large scale code resolution service network in the Internet of Things.

PubMed

Yu, Haining; Zhang, Hongli; Fang, Binxing; Yu, Xiangzhan

2012-11-07

In the Internet of Things a code resolution service provides a discovery mechanism for a requester to obtain the information resources associated with a particular product code immediately. In large scale application scenarios a code resolution service faces some serious issues involving heterogeneity, big data and data ownership. A code resolution service network is required to address these issues. Firstly, a list of requirements for the network architecture and code resolution services is proposed. Secondly, in order to eliminate code resolution conflicts and code resolution overloads, a code structure is presented to create a uniform namespace for code resolution records. Thirdly, we propose a loosely coupled distributed network consisting of heterogeneous, independent; collaborating code resolution services and a SkipNet based code resolution service named SkipNet-OCRS, which not only inherits DHT’s advantages, but also supports administrative control and autonomy. For the external behaviors of SkipNet-OCRS, a novel external behavior mode named QRRA mode is proposed to enhance security and reduce requester complexity. For the internal behaviors of SkipNet-OCRS, an improved query algorithm is proposed to increase query efficiency. It is analyzed that integrating SkipNet-OCRS into our resolution service network can meet our proposed requirements. Finally, simulation experiments verify the excellent performance of SkipNet-OCRS.

Skipped words and fixated words are processed differently during reading.

PubMed

Eskenazi, Michael A; Folk, Jocelyn R

2015-04-01

The purpose of this study was to investigate whether words are processed differently when they are fixated during silent reading than when they are skipped. According to a serial processing model of eye movement control (e.g., EZ Reader) skipped words are fully processed (Reichle, Rayner, Pollatsek, Behavioral and Brain Sciences, 26(04):445-476, 2003), whereas in a parallel processing model (e.g., SWIFT) skipped words do not need to be fully processed (Engbert, Nuthmann, Richter, Kliegl, Psychological Review, 112(4):777-813, 2005). Participants read 34 sentences with target words embedded in them while their eye movements were recorded. All target words were three-letter, low-frequency, and unpredictable nouns. After the reading session, participants completed a repetition priming lexical decision task with the target words from the reading session included as the repetition prime targets, with presentation of those same words during the reading task acting as the prime. When participants skipped a word during the reading session, their reaction times on the lexical decision task were significantly longer (M = 656.42 ms) than when they fixated the word (M = 614.43 ms). This result provides evidence that skipped words are sometimes not processed to the same degree as fixated words during reading.

Microcomputer-Assisted Flow-Through ASV System.

DTIC Science & Technology

1979-09-01

89 03 A ADCA #$03 0037 7A 0300 D DEC SAVz1 0042 26 F6 003A DN! THOULP 0044 39 XITBIN RTS * XDTF BCDBIN 19 or iko. 302 SCUE j CD To BINARY CONVERSION...TIMFLG 0006 BD 0330 A SKIP75 JSR CLOCK GET TINE AND DIPLAY 0009 B6 0300 A LDAA P5BC CHECK IF "GO" PUSHED OOOC 2B 02 0013 BMI SKIP75 YES- RTS 000E 20 F6 ...405 RESET STACK PT 0003 B7 0002 D STAA TP 0006 F7 0083 D STAB TP+1 0009 B6 0018 D LDAA IPHI CALCULATE (IP-IV) FOR OSOC F6 0319 D LDAB IPLO CD 000F FO

Factors associated with skipping breakfast among Inner Mongolia medical students in China.

PubMed

Sun, Juan; Yi, He; Liu, Zhiyue; Wu, Yan; Bian, Jiang; Wu, Yanyan; Eshita, Yuki; Li, Gaimei; Zhang, Qing; Yang, Ying

2013-01-17

Few studies on the breakfast consumption habits of medical students in China have been carried out. The aim of the present study was to determine the prevalence of skipping breakfast and factors associated with skipping breakfast among medical students in Inner Mongolia of China, and to assist in the design of interventions to improve breakfast consumption habits of medical college students in this region. From December 2010 to January 2011 a cross-sectional survey was conducted among medical students in the Inner Mongolia Medical College using a self-administered questionnaire. The prevalence of skipping breakfast in relation to lifestyle habits was described and factors associated with breakfast consumption were identified using multiple logistic regression analysis. The overall prevalence of skipping breakfast was 41.7% and 23.5% for males and females, respectively. The Faculty of Medicine Information Management had the highest breakfast skipping prevalence. Logistic regression models found that the main factors associated with breakfast consumption habits among medical students were gender, class years of education, monthly expenses, faculty, appetite, sleeping quality, and the learning process; monthly expenses, sleeping quality, and the learning process showed a dose-dependent relationship. Breakfast consumption was associated with many factors, most importantly monthly expenses, sleeping quality and the learning process. The prevalence of skipping breakfast is significantly higher compared recently reported figures for medical students in western countries and other areas of China. Improvement of breakfast education should be considered for students in which higher monthly expenses, poor sleeping quality, or a laborious learning process have been identified.

Measuring the misfit between seismograms using an optimal transport distance: application to full waveform inversion

NASA Astrophysics Data System (ADS)

Métivier, L.; Brossier, R.; Mérigot, Q.; Oudet, E.; Virieux, J.

2016-04-01

Full waveform inversion using the conventional L2 distance to measure the misfit between seismograms is known to suffer from cycle skipping. An alternative strategy is proposed in this study, based on a measure of the misfit computed with an optimal transport distance. This measure allows to account for the lateral coherency of events within the seismograms, instead of considering each seismic trace independently, as is done generally in full waveform inversion. The computation of this optimal transport distance relies on a particular mathematical formulation allowing for the non-conservation of the total energy between seismograms. The numerical solution of the optimal transport problem is performed using proximal splitting techniques. Three synthetic case studies are investigated using this strategy: the Marmousi 2 model, the BP 2004 salt model, and the Chevron 2014 benchmark data. The results emphasize interesting properties of the optimal transport distance. The associated misfit function is less prone to cycle skipping. A workflow is designed to reconstruct accurately the salt structures in the BP 2004 model, starting from an initial model containing no information about these structures. A high-resolution P-wave velocity estimation is built from the Chevron 2014 benchmark data, following a frequency continuation strategy. This estimation explains accurately the data. Using the same workflow, full waveform inversion based on the L2 distance converges towards a local minimum. These results yield encouraging perspectives regarding the use of the optimal transport distance for full waveform inversion: the sensitivity to the accuracy of the initial model is reduced, the reconstruction of complex salt structure is made possible, the method is robust to noise, and the interpretation of seismic data dominated by reflections is enhanced.

Wavelet-based multiscale adjoint waveform-difference tomography using body and surface waves

NASA Astrophysics Data System (ADS)

Yuan, Y. O.; Simons, F. J.; Bozdag, E.

2014-12-01

We present a multi-scale scheme for full elastic waveform-difference inversion. Using a wavelet transform proves to be a key factor to mitigate cycle-skipping effects. We start with coarse representations of the seismogram to correct a large-scale background model, and subsequently explain the residuals in the fine scales of the seismogram to map the heterogeneities with great complexity. We have previously applied the multi-scale approach successfully to body waves generated in a standard model from the exploration industry: a modified two-dimensional elastic Marmousi model. With this model we explored the optimal choice of wavelet family, number of vanishing moments and decomposition depth. For this presentation we explore the sensitivity of surface waves in waveform-difference tomography. The incorporation of surface waves is rife with cycle-skipping problems compared to the inversions considering body waves only. We implemented an envelope-based objective function probed via a multi-scale wavelet analysis to measure the distance between predicted and target surface-wave waveforms in a synthetic model of heterogeneous near-surface structure. Our proposed method successfully purges the local minima present in the waveform-difference misfit surface. An elastic shallow model with 100~m in depth is used to test the surface-wave inversion scheme. We also analyzed the sensitivities of surface waves and body waves in full waveform inversions, as well as the effects of incorrect density information on elastic parameter inversions. Based on those numerical experiments, we ultimately formalized a flexible scheme to consider both body and surface waves in adjoint tomography. While our early examples are constructed from exploration-style settings, our procedure will be very valuable for the study of global network data.

Precursor processes of human self-initiated action.

PubMed

Khalighinejad, Nima; Schurger, Aaron; Desantis, Andrea; Zmigrod, Leor; Haggard, Patrick

2018-01-15

A gradual buildup of electrical potential over motor areas precedes self-initiated movements. Recently, such "readiness potentials" (RPs) were attributed to stochastic fluctuations in neural activity. We developed a new experimental paradigm that operationalized self-initiated actions as endogenous 'skip' responses while waiting for target stimuli in a perceptual decision task. We compared these to a block of trials where participants could not choose when to skip, but were instead instructed to skip. Frequency and timing of motor action were therefore balanced across blocks, so that conditions differed only in how the timing of skip decisions was generated. We reasoned that across-trial variability of EEG could carry as much information about the source of skip decisions as the mean RP. EEG variability decreased more markedly prior to self-initiated compared to externally-triggered skip actions. This convergence suggests a consistent preparatory process prior to self-initiated action. A leaky stochastic accumulator model could reproduce this convergence given the additional assumption of a systematic decrease in input noise prior to self-initiated actions. Our results may provide a novel neurophysiological perspective on the topical debate regarding whether self-initiated actions arise from a deterministic neurocognitive process, or from neural stochasticity. We suggest that the key precursor of self-initiated action may manifest as a reduction in neural noise. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Effect of innovative building design on physical activity.

PubMed

Nicoll, Gayle; Zimring, Craig

2009-01-01

Stair climbing can be a low-cost and relatively accessible way to add everyday physical activity, but many building stairwells are inaccessible or unpleasant and elevators are far more convenient. This study explores the use of and attitude toward stairs in an innovative office building where the main elevators for able-bodied users stop only at every third floor ("skip-stop" elevators). These users are expected to walk up or down nearby stairs that have been made open and appealing ("skip-stop" stairs). The study takes advantage of a natural experiment. Some workers' offices were clustered around the skip-stop elevator and the stairs, whereas others had access to a traditional elevator core, that is, an elevator that stopped at each floor with nearby fire exit stairs. Stair use on the open skip-stop stairs and enclosed fire stairs was measured using infrared monitors and card-reader activity logs. An online survey of employees (N=299, a 17.4% response rate) gathered information on stair use and attitudes and behaviors toward physical activity; interviews with key personnel identified major implementation issues. The skip-stop stair was used 33 times more than the enclosed stair of the traditional elevator core, with 72% of survey participants reporting daily stair use. Although implementation issues related to organizational objectives, costs, security, barrier-free accessibility, and building codes exist, the skip-stop feature offers a successful strategy for increasing stair use in workplaces.

Fire Safety

MedlinePlus

... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... able to reliably rescue themselves. Know What to Do in a Fire Test any closed doors with ...

Precession and circularization of elliptical space-tether motion

NASA Technical Reports Server (NTRS)

Chapel, Jim D.; Grosserode, Patrick

1993-01-01

In this paper, we present a simplified analytic model for predicting motion of long space tethers. The perturbation model developed here addresses skip rope motion, where each end of the tether is held in place and the middle of the tether swings with a motion similar to that of a child's skip rope. If the motion of the tether midpoint is elliptical rather than circular, precession of the ellipse complicates the procedures required to damp this motion. The simplified analytic model developed in this paper parametrically predicts the precession of elliptical skip rope motion. Furthermore, the model shows that elliptic skip rope motion will circularize when damping is present in the longitudinal direction. Compared with high-fidelity simulation results, this simplified model provides excellent predictions of these phenomena.

Analytic Guidance for the First Entry in a Skip Atmospheric Entry

NASA Technical Reports Server (NTRS)

Garcia-Llama, Eduardo

2007-01-01

This paper presents an analytic method to generate a reference drag trajectory for the first entry portion of a skip atmospheric entry. The drag reference, expressed as a polynomial function of the velocity, will meet the conditions necessary to fit the requirements of the complete entry phase. The generic method proposed to generate the drag reference profile is further simplified by thinking of the drag and the velocity as density and cumulative distribution functions respectively. With this notion it will be shown that the reference drag profile can be obtained by solving a linear algebraic system of equations. The resulting drag profile is flown using the feedback linearization method of differential geometric control as guidance law with the error dynamics of a second order homogeneous equation in the form of a damped oscillator. This approach was first proposed as a revisited version of the Space Shuttle Orbiter entry guidance. However, this paper will show that it can be used to fly the first entry in a skip entry trajectory. In doing so, the gains in the error dynamics will be changed at a certain point along the trajectory to improve the tracking performance.

Improving Family Communications

MedlinePlus

... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... do the same. More Tips To Improve Communication Do Give clear, age-appropriate directions such as, "When ...

Sleep Apnea Detection

MedlinePlus

... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... the night Sleepiness during the day Difficulty paying attention Behavior problems If you notice any of these ...

Histone hyperacetylation and exon skipping: a calcium-mediated dynamic regulation in cardiomyocytes

PubMed Central

Sharma, Alok; Nguyen, Hieu; Cai, Lu; Lou, Hua

2015-01-01

In contrast to cell type-specific pre-mRNA alternative splicing, mechanisms controlling activity-dependent alternative splicing is under-studied and not well understood. In a recent study, we conducted a comprehensive analysis of calcium-mediated mechanism that regulates alternative exon skipping in mouse cardiomyocytes. Our results reveal a strong link between histone hyperacetylation and skipping of cassette exons, and provide support to the kinetic coupling model of the epigenetic regulation of alternative splicing at the chromatin level. PMID:26325491

What Is a Neonatologist?

MedlinePlus

... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... care during your pregnancy. What Kind of Training Do Neonatologists Have? Neonatologists are medical doctors who have ...

What Is a Pediatric Endocrinologist?

MedlinePlus

... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... and the teen years. What Kind of Training Do Pediatric Endocrinologists Have? Pediatric endocrinologists are medical doctors ...

What Is a Pediatric Urologist?

MedlinePlus

... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... to treat your child. What Kind of Training Do Pediatric Urologists Have? Pediatric urologists are medical doctors ...

Emotional Development: 1 Year Olds

MedlinePlus

... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... her regain her composure is to give her attention and reassurance when she needs it. Snapping at ...

What Is a Pediatric Infectious Diseases Specialist?

MedlinePlus

... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... through the teen years. What Kind of Training Do Pediatric Infectious Diseases Specialists Have? Pediatric infectious diseases ...

How to Keep Your Sleeping Baby Safe

MedlinePlus

... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... any of the recommendations listed. What You Can Do: Recommendations for Infant Sleep Safety Until their first ...

What Is a Pediatric Critical Care Specialist?

MedlinePlus

... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... offered in the PICU. What Kind of Training Do Pediatric Critical Care Specialists Have? Pediatric critical care ...

Skipping meals and alcohol consumption. The regulation of energy intake and expenditure among weight loss participants.

PubMed

Carels, Robert A; Young, Kathleen M; Coit, Carissa; Clayton, Anna Marie; Spencer, Alexis; Wagner, Marissa

2008-11-01

Research suggests that specific eating patterns (e.g., eating breakfast) may be related to favorable weight status. This investigation examined the relationship between eating patterns (i.e., skipping meals; consuming alcohol) and weight loss treatment outcomes (weight loss, energy intake, energy expenditure, and duration of exercise). Fifty-four overweight or obese adults (BMI> or =27 kg/m(2)) participated in a self-help or therapist-assisted weight loss program. Daily energy intake from breakfast, lunch, dinner, and alcoholic beverages, total daily energy intake, total daily energy expenditure, physical activity, and weekly weight loss were assessed. On days that breakfast or dinner was skipped, or alcoholic beverages were not consumed, less total daily energy was consumed compared to days that breakfast, dinner, or alcoholic beverages were consumed. On days that breakfast or alcohol was consumed, daily energy expenditure (breakfast only) and duration of exercise were higher compared to days that breakfast or alcohol was not consumed. Individuals who skipped dinner or lunch more often had lower energy expenditure and exercise duration than individuals who skipped dinner or lunch less often. Individuals who consumed alcohol more often had high daily energy expenditure than individuals who consumed alcohol less often. Skipping meals or consuming alcoholic beverages was not associated with weekly weight loss. In this investigation, weight loss program participants may have compensated for excess energy intake from alcoholic beverages and meals with greater daily energy expenditure and longer exercise duration.

Skimming and Skipping Stones

ERIC Educational Resources Information Center

Humble, Steve

2007-01-01

This article presents an example of skimming and skipping stone motion in mathematical terms available to students studying A-level mathematics. The theory developed in the article postulates a possible mathematical model that is verified by experimental results.

What is the Best Way to Treat Diarrhea?

MedlinePlus

... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... starts making normal amounts of urine again. Reminder–Do's and Don'ts Do Watch for signs of ...

Safety for Your Child: Birth to 6 Months

MedlinePlus

... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... seat, will behave better, so you can pay attention to your driving. Make your newborn’s first ride ...

Catalyst-free synthesis of skipped dienes from phosphorus ylides, allylic carbonates, and aldehydes via a one-pot SN2' allylation-Wittig strategy.

PubMed

Xu, Silong; Zhu, Shaoying; Shang, Jian; Zhang, Junjie; Tang, Yuhai; Dou, Jianwei

2014-04-18

A catalyst-free allylic alkylation of stabilized phosphorus ylides with allylic carbonates via a regioselective SN2' process is presented. Subsequent one-pot Wittig reaction with both aliphatic and aromatic aldehydes as well as ketenes provides structurally diverse skipped dienes (1,4-dienes) in generally high yields and moderate to excellent stereoselectivity with flexible substituent patterns. This one-pot SN2' allylation-Wittig strategy constitutes a convenient and efficient synthetic method for highly functionalized skipped dienes from readily available starting materials.

A novel integrated cropping system for efficient grain production, improved soil quality, and enhanced beneficial arthropod communities

USDA-ARS?s Scientific Manuscript database

The solar corridor crop system (SCCS) is designed for improved crop productivity by using broad strips (corridors or skip rows) that promote highly efficient use of solar radiation and ambient carbon dioxide by C-4 plants including corn. Field trials in 2013 and 2014 showed that yields of selected c...

Climate Forecast System

Science.gov Websites

Skip Navigation Links www.nws.noaa.gov NOAA logo - Click to go to the NOAA home page National Weather Service NWS logo - Click to go to the NWS home page Climate Forecast System Home News Organization Search : Go Search Go CFS Home CFS version 2 News Documentation Downloads Reanalysis CFSv2 at CPC CFS

Fast-food outlets and grocery stores near school and adolescents' eating habits and overweight in Finland.

PubMed

Virtanen, Marianna; Kivimäki, Hanne; Ervasti, Jenni; Oksanen, Tuula; Pentti, Jaana; Kouvonen, Anne; Halonen, Jaana I; Kivimäki, Mika; Vahtera, Jussi

2015-08-01

Environmental factors may affect adolescents' eating habits and thereby body weight. However, the contribution of school neighbourhood environment is poorly understood. This study examined the association between proximity of a fast-food outlet or grocery store to school and adolescents' eating habits and overweight. Participants were 23 182 adolescents (mean age 15 years) who responded to a classroom survey in 181 lower secondary schools in Finland (2008-09). School location was linked to data on distance from school to the nearest fast-food outlet or grocery store (≤100 m, 101-500 m, >500 m) using global positioning system-coordinate databases. Outcomes were irregular eating habits (skipping breakfast, skipping free school lunch, skipping free school-provided snacks and not having family dinners), the accumulation of these habits and overweight, including obesity (body mass index ≥ 25 kg/m(2)). Thirteen percentage of the participants were overweight. Having a fast-food outlet or grocery store near school was associated with skipping often breakfast and free school lunch, and the accumulation of irregular eating habits. The proximity of a fast-food outlet or grocery store was associated with a 1.25-fold (95% confidence interval 1.03-1.52) risk of overweight among adolescent with a low socioeconomic status but not among those with higher socioeconomic status. This association was partly (12%) explained by the accumulation of irregular eating habits. Among adolescents from low socioeconomic background, the presence of fast-food retailers near schools is associated with accumulation of irregular eating habits and greater overweight. These findings suggest that obesogenic school neighbourhoods may contribute to social inequalities in overweight. © The Author 2015. Published by Oxford University Press on behalf of the European Public Health Association. All rights reserved.

TDRS-L Tribute Decal to Arthur "Skip" Mackey, Jr.

NASA Image and Video Library

2014-01-22

CAPE CANAVERAL, Fla. – This memorial message was added to the Atlas V rocket for NASA's Tracking and Data Relay Satellite, or TDRS-L, spacecraft being prepared for launch from Cape Canaveral Air Force Station's Launch Complex 41. Arthur J. "Skip" Mackey Jr. was the “Voice of NASA” during the 1960s, 1970s and early 1980s for flight commentary after liftoff for expendable vehicles launched from Cape Canaveral. Mackey served as branch chief for Telemetry and Communications at Hangar AE in the agency’s Expendable Launch Vehicle Program and then the Launch Services Program for 39 years. He died in Fort Lauderdale, Fla., on Nov. 19, 2013. The TDRS-L spacecraft is the second of three new satellites designed to ensure vital operational continuity for NASA by expanding the lifespan of the Tracking and Data Relay Satellite System TDRSS fleet, which consists of eight satellites in geosynchronous orbit. The spacecraft provide tracking, telemetry, command and high bandwidth data return services for numerous science and human exploration missions orbiting Earth. These include NASA's Hubble Space Telescope and the International Space Station. TDRS-L has a high-performance solar panel designed for more spacecraft power to meet the growing S-band communications requirements. TDRSS is one of NASA Space Communication and Navigation’s SCaN three networks providing space communications to NASA’s missions. For more information more about TDRS-L, visit: http://www.nasa.gov/tdrs To learn more about SCaN, visit: www.nasa.gov/scan For more on "Skip" Mackey go to: http://www.nasa.gov/content/skip-mackey-remembered-by-colleagues-as-voice-of-nasa/ Image credit: United Launch Alliance

In Silico Screening Based on Predictive Algorithms as a Design Tool for Exon Skipping Oligonucleotides in Duchenne Muscular Dystrophy

PubMed Central

Echigoya, Yusuke; Mouly, Vincent; Garcia, Luis; Yokota, Toshifumi; Duddy, William

2015-01-01

The use of antisense ‘splice-switching’ oligonucleotides to induce exon skipping represents a potential therapeutic approach to various human genetic diseases. It has achieved greatest maturity in exon skipping of the dystrophin transcript in Duchenne muscular dystrophy (DMD), for which several clinical trials are completed or ongoing, and a large body of data exists describing tested oligonucleotides and their efficacy. The rational design of an exon skipping oligonucleotide involves the choice of an antisense sequence, usually between 15 and 32 nucleotides, targeting the exon that is to be skipped. Although parameters describing the target site can be computationally estimated and several have been identified to correlate with efficacy, methods to predict efficacy are limited. Here, an in silico pre-screening approach is proposed, based on predictive statistical modelling. Previous DMD data were compiled together and, for each oligonucleotide, some 60 descriptors were considered. Statistical modelling approaches were applied to derive algorithms that predict exon skipping for a given target site. We confirmed (1) the binding energetics of the oligonucleotide to the RNA, and (2) the distance in bases of the target site from the splice acceptor site, as the two most predictive parameters, and we included these and several other parameters (while discounting many) into an in silico screening process, based on their capacity to predict high or low efficacy in either phosphorodiamidate morpholino oligomers (89% correctly predicted) and/or 2’O Methyl RNA oligonucleotides (76% correctly predicted). Predictions correlated strongly with in vitro testing for sixteen de novo PMO sequences targeting various positions on DMD exons 44 (R2 0.89) and 53 (R2 0.89), one of which represents a potential novel candidate for clinical trials. We provide these algorithms together with a computational tool that facilitates screening to predict exon skipping efficacy at each position of a target exon. PMID:25816009

In vivo effects on intron retention and exon skipping by the U2AF large subunit and SF1/BBP in the nematode Caenorhabditis elegans

PubMed Central

Ma, Long; Tan, Zhiping; Teng, Yanling; Hoersch, Sebastian; Horvitz, H. Robert

2011-01-01

The in vivo analysis of the roles of splicing factors in regulating alternative splicing in animals remains a challenge. Using a microarray-based screen, we identified a Caenorhabditis elegans gene, tos-1, that exhibited three of the four major types of alternative splicing: intron retention, exon skipping, and, in the presence of U2AF large subunit mutations, the use of alternative 3′ splice sites. Mutations in the splicing factors U2AF large subunit and SF1/BBP altered the splicing of tos-1. 3′ splice sites of the retained intron or before the skipped exon regulate the splicing pattern of tos-1. Our study provides in vivo evidence that intron retention and exon skipping can be regulated largely by the identities of 3′ splice sites. PMID:22033331

Power inverter implementing phase skipping control

DOEpatents

Somani, Utsav; Amirahmadi, Ahmadreza; Jourdan, Charles; Batarseh, Issa

2016-10-18

A power inverter includes a DC/AC inverter having first, second and third phase circuitry coupled to receive power from a power source. A controller is coupled to a driver for each of the first, second and third phase circuitry (control input drivers). The controller includes an associated memory storing a phase skipping control algorithm, wherein the controller is coupled to receive updating information including a power level generated by the power source. The drivers are coupled to control inputs of the first, second and third phase circuitry, where the drivers are configured for receiving phase skipping control signals from the controller and outputting mode selection signals configured to dynamically select an operating mode for the DC/AC inverter from a Normal Control operation and a Phase Skipping Control operation which have different power injection patterns through the first, second and third phase circuitry depending upon the power level.

RNAV STAR Procedural Adherence

NASA Technical Reports Server (NTRS)

Stewart, Michael J.; Matthews, Bryan L.

2017-01-01

In this exploratory archival study we mined the performance of 24 major US airports area navigation standard terminal arrival routes (RNAV STARs) over the preceding three years. Overlaying radar track data on top of RNAV STAR routes provided a comparison between aircraft flight paths and the waypoint positions and altitude restrictions. NASA Ames Supercomputing resources were utilized to perform the data mining and processing. We investigated STARs by lateral transition path (full-lateral), vertical restrictions (full-lateral/full-vertical), and skipped waypoints (skips). In addition, we graphed altitudes and their frequencies of occurrence for altitude restrictions. Full-lateral compliance was generally greater than Full-lateral/full-vertical, but the delta between the rates was not always consistent. Full-lateral/full-vertical usage medians of the 2016 procedures ranged from 0 in KDEN (Denver) to 21 in KMEM (Memphis). Waypoint skips ranged from 0 to nearly 100 for specific waypoints. Altitudes restrictions were sometimes missed by systemic amounts in 1000 ft. increments from the restriction, creating multi-modal distributions. Other times, altitude misses looked to be more normally distributed around the restriction. This work is a preliminary investigation into the objective performance of instrument procedures and provides a framework to track how procedural concepts and design intervention function. In addition, this tool may aid in providing acceptability metrics as well as risk assessment information.

Do Vaccines Cause Autism? Is it OK to Skip Certain Vaccines? Get the facts

MedlinePlus

... Lifestyle Infant and toddler health Do vaccines cause autism? Is it OK to skip certain vaccines? Get ... their potentially serious complications. Vaccines do not cause autism. Despite much controversy on the topic, researchers haven' ...

Quick Guide to Health Literacy and Older Adults

MedlinePlus

... starter tips Resources Additional Resources Cultural Competence Health Literacy Older Adults Plain Language Visual Impairment Web sites Content last updated: October 30, 2007 skip to navigation | skip to content ACCESSIBILITY | FREEDOM OF INFORMATION ACT | PRIVACY POLICY | CONTACT US Office of Disease ...

Atmospheric guidance law for planar skip trajectories

NASA Technical Reports Server (NTRS)

Mease, K. D.; Mccreary, F. A.

1985-01-01

The applicability of an approximate, closed-form, analytical solution to the equations of motion, as a basis for a deterministic guidance law for controlling the in-plane motion during a skip trajectory, is investigated. The derivation of the solution by the method of matched asymptotic expansions is discussed. Specific issues that arise in the application of the solution to skip trajectories are addressed. Based on the solution, an explicit formula for the approximate energy loss due to an atmospheric pass is derived. A guidance strategy is proposed that illustrates the use of the approximate solution. A numerical example shows encouraging performance.

System-Level Experimentation: Executive Summary and Annotated Brief

DTIC Science & Technology

2006-07-01

both friendlies and adversaries – to define their own capabilities, unfettered by doctrinal or cultural limitations and bounded only by the laws of...Gen Eric Nelson, USAF (Ret) Independent Consultant (Systems, Software) Dr. Brad Parkinson Stanford University (GPS, Sensors, Systems) Mr. Skip Saunders...RCO* – rapid fielding for high priority needs SLE is focused on understanding the future - unknown needs A8’ s Future Game – analysis of future

Thousands of exon skipping events differentiate among splicing patterns in sixteen human tissues.

PubMed

Florea, Liliana; Song, Li; Salzberg, Steven L

2013-01-01

Alternative splicing is widely recognized for its roles in regulating genes and creating gene diversity. However, despite many efforts, the repertoire of gene splicing variation is still incompletely characterized, even in humans. Here we describe a new computational system, ASprofile, and its application to RNA-seq data from Illumina's Human Body Map project (>2.5 billion reads).  Using the system, we identified putative alternative splicing events in 16 different human tissues, which provide a dynamic picture of splicing variation across the tissues. We detected 26,989 potential exon skipping events representing differences in splicing patterns among the tissues. A large proportion of the events (>60%) were novel, involving new exons (~3000), new introns (~16000), or both. When tracing these events across the sixteen tissues, only a small number (4-7%) appeared to be differentially expressed ('switched') between two tissues, while 30-45% showed little variation, and the remaining 50-65% were not present in one or both tissues compared.  Novel exon skipping events appeared to be slightly less variable than known events, but were more tissue-specific. Our study represents the first effort to build a comprehensive catalog of alternative splicing in normal human tissues from RNA-seq data, while providing insights into the role of alternative splicing in shaping tissue transcriptome differences. The catalog of events and the ASprofile software are freely available from the Zenodo repository ( http://zenodo.org/record/7068; doi: 10.5281/zenodo.7068) and from our web site http://ccb.jhu.edu/software/ASprofile.

Preparation for Retrievals from Sellafield Legacy Ponds Installation of the Gantry Refurbishment System

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ellison, M.

2008-07-01

Retrieval of sludge and fuel from the First Generation Magnox Fuel Storage Pond, and its safe long term storage is one of the NDA's top priorities in the UK clean up programme. The plant is currently undergoing a series of major modifications in preparation for the retrievals operations. The most visible example of these modifications is the Gantry Refurbishment System (GRS), a major work platform which has recently been lifted onto the pond long travel girders used by the Skip Handler. This paper describes the design, manufacture, works test, and site installation of this major piece of equipment. The installationmore » lift, involving the use of an 800Te crane was one of the largest lifts undertaken at Sellafield. The GRS is a mobile platform structure which is designed to be pushed or pulled along the long travel girders by the Skip Handler. Its principle function is to provide a safe and shielded working platform from which to undertake refurbishment of the Skip Handler long travel girders and support structure. The potential hazards and consequences resulting from the modification were fully understood and controls were put in place to ensure that the risk of carrying out the work was as low as reasonably practicable. The work was authorised by the NII, Sellafield Nuclear Safety Committee and an independent readiness review panel. Despite less than perfect weather in the run up to the lift, the GRS was successfully and safely lifted onto the pond on 18 October 2006, the culmination of three years of planning, engineering and construction. (authors)« less

7 CFR 42.123 - Flow diagram for skip lot sampling and inspection.

Code of Federal Regulations, 2010 CFR

2010-01-01

....123 Section 42.123 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE COMMODITY STANDARDS AND STANDARD CONTAINER REGULATIONS STANDARDS FOR CONDITION OF FOOD CONTAINERS Skip Lot Sampling and Inspection...

75 FR 32989 - Proposed Collection; Comment Request for Form 706

Federal Register 2010, 2011, 2012, 2013, 2014

2010-06-10

... [email protected] . SUPPLEMENTARY INFORMATION: Title: United States Estate (and Generation-Skipping... proposed and/or continuing information collections, as required by the Paperwork Reduction Act of 1995... 706, United States Estate (and Generation-Skipping Transfer) Tax Return. DATES: Written comments...

Longitudinal effect of eteplirsen versus historical control on ambulation in Duchenne muscular dystrophy

PubMed Central

Goemans, Nathalie; Lowes, Linda P.; Alfano, Lindsay N.; Berry, Katherine; Shao, James; Kaye, Edward M.; Mercuri, Eugenio; Hamid, Hoda Abdel; Byrne, Barry J.; Connolly, Anne M.; Dracker, Robert A.; Matthew Frank, L.; Heydemann, Peter T.; O'Brien, Kevin C.; Sparks, Susan E.; Specht, Linda A.; Rodino‐Klapac, Louise; Sahenk, Zarife; Al‐Zaidy, Samiah; Cripe, Linda H.; Lewis, Sarah; M, Pane; E, Mazzone; S, Messina; GL, Vita; Bertini, D Amico A; Casimiro, Berardinelli A; Y, Torrente; F, Magri; GP, Comi; G, Baranello; T, Mongini; A, Pini; R, Battini; E, Pegoraro; C, Bruno; L, Politano; S, Previtali

2016-01-01

Objective To continue evaluation of the long‐term efficacy and safety of eteplirsen, a phosphorodiamidate morpholino oligomer designed to skip DMD exon 51 in patients with Duchenne muscular dystrophy (DMD). Three‐year progression of eteplirsen‐treated patients was compared to matched historical controls (HC). Methods Ambulatory DMD patients who were ≥7 years old and amenable to exon 51 skipping were randomized to eteplirsen (30/50mg/kg) or placebo for 24 weeks. Thereafter, all received eteplirsen on an open‐label basis. The primary functional assessment in this study was the 6‐Minute Walk Test (6MWT). Respiratory muscle function was assessed by pulmonary function testing (PFT). Longitudinal natural history data were used for comparative analysis of 6MWT performance at baseline and months 12, 24, and 36. Patients were matched to the eteplirsen group based on age, corticosteroid use, and genotype. Results At 36 months, eteplirsen‐treated patients (n = 12) demonstrated a statistically significant advantage of 151m (p < 0.01) on 6MWT and experienced a lower incidence of loss of ambulation in comparison to matched HC (n = 13) amenable to exon 51 skipping. PFT results remained relatively stable in eteplirsen‐treated patients. Eteplirsen was well tolerated. Analysis of HC confirmed the previously observed change in disease trajectory at age 7 years, and more severe progression was observed in patients with mutations amenable to exon skipping than in those not amenable. The subset of patients amenable to exon 51 skipping showed a more severe disease course than those amenable to any exon skipping. Interpretation Over 3 years of follow‐up, eteplirsen‐treated patients showed a slower rate of decline in ambulation assessed by 6MWT compared to untreated matched HC. Ann Neurol 2016;79:257–271 PMID:26573217

Sexual divergence in microtubule function: the novel intranasal microtubule targeting SKIP normalizes axonal transport and enhances memory.

PubMed

Amram, N; Hacohen-Kleiman, G; Sragovich, S; Malishkevich, A; Katz, J; Touloumi, O; Lagoudaki, R; Grigoriadis, N C; Giladi, E; Yeheskel, A; Pasmanik-Chor, M; Jouroukhin, Y; Gozes, I

2016-10-01

Activity-dependent neuroprotective protein (ADNP), essential for brain formation, is a frequent autism spectrum disorder (ASD)-mutated gene. ADNP associates with microtubule end-binding proteins (EBs) through its SxIP motif, to regulate dendritic spine formation and brain plasticity. Here, we reveal SKIP, a novel four-amino-acid peptide representing an EB-binding site, as a replacement therapy in an outbred Adnp-deficient mouse model. We discovered, for the first time, axonal transport deficits in Adnp(+/-) mice (measured by manganese-enhanced magnetic resonance imaging), with significant male-female differences. RNA sequencing evaluations showed major age, sex and genotype differences. Function enrichment and focus on major gene expression changes further implicated channel/transporter function and the cytoskeleton. In particular, a significant maturation change (1 month-five months) was observed in beta1 tubulin (Tubb1) mRNA, only in Adnp(+/+) males, and sex-dependent increase in calcium channel mRNA (Cacna1e) in Adnp(+/+) males compared with females. At the protein level, the Adnp(+/-) mice exhibited impaired hippocampal expression of the calcium channel (voltage-dependent calcium channel, Cacnb1) as well as other key ASD-linked genes including the serotonin transporter (Slc6a4), and the autophagy regulator, BECN1 (Beclin1), in a sex-dependent manner. Intranasal SKIP treatment normalized social memory in 8- to 9-month-old Adnp(+/-)-treated mice to placebo-control levels, while protecting axonal transport and ameliorating changes in ASD-like gene expression. The control, all d-amino analog D-SKIP, did not mimic SKIP activity. SKIP presents a novel prototype for potential ASD drug development, a prevalent unmet medical need.

Do older adults use the Method of Loci? Results from the ACTIVE Study

PubMed Central

Gross, Alden L.; Brandt, Jason; Bandeen-Roche, Karen; Carlson, Michelle C.; Stuart, Elizabeth A.; Marsiske, Michael; Rebok, George W.

2013-01-01

Background The method of loci (MoL) is a complex visuospatial mnemonic strategy. Previous research suggests older adults could potentially benefit from using the MoL, but that it is too attentionally demanding for them to use in practice. We evaluated the hypotheses that training can increase the use of MoL, and that MoL use is associated with better memory. Methods We analyzed skip patterns on response forms for the Auditory Verbal Learning Test (AVLT) in the Advanced Cognitive Training for Independent and Vital Elderly (ACTIVE, n=1,401) trial using 5 years of longitudinal follow-up. Results At baseline, 2% of participants skipped spaces. Fewer than 2% of control participants skipped spaces at any visit across 5 years, but 25% of memory-trained participants, taught the MoL, did so. Participants who skipped spaces used more serial clustering, a hallmark of the MoL (p<0.001). Trained participants who skipped spaces showed greater memory improvement after training than memory-trained participants who did not skip spaces (Cohen's d=0.84, P=0.007), and did not differ in the subsequent rate of long-term memory decline through up to 5 years of follow-up. Conclusion Despite being attentionally demanding, this study suggests that after training, the MoL is used by up to 25% of older adults, and that its use is associated with immediate memory improvement that was sustained through the course of follow-up. Findings are consistent with the notion that older adults balance complexity with novelty in strategy selection, and that changes in strategies used following memory training result in observable qualitative and quantitative differences in memory performance. PMID:24625044

7 CFR 42.141 - Obtaining Operating Characteristic (OC) curve information for skip lot sampling and inspection.

Code of Federal Regulations, 2010 CFR

2010-01-01

..., and read the new Percent of Lots Expected to be Accepted, Pas, which results when using these skip lot... point, proceed vertically to the curve and then horizontally to the left to the vertical axis. From this...

7 CFR 42.141 - Obtaining Operating Characteristic (OC) curve information for skip lot sampling and inspection.

Code of Federal Regulations, 2011 CFR

2011-01-01

..., and read the new Percent of Lots Expected to be Accepted, Pas, which results when using these skip lot... point, proceed vertically to the curve and then horizontally to the left to the vertical axis. From this...

Development of Exon Skipping Therapies for Duchenne Muscular Dystrophy: A Critical Review and a Perspective on the Outstanding Issues

PubMed Central

Aartsma-Rus, Annemieke; Straub, Volker; Hemmings, Robert; Haas, Manuel; Schlosser-Weber, Gabriele; Stoyanova-Beninska, Violeta; Mercuri, Eugenio; Muntoni, Francesco; Sepodes, Bruno; Vroom, Elizabeth

2017-01-01

Duchenne muscular dystrophy (DMD) is a rare, severe, progressive muscle-wasting disease leading to disability and premature death. Patients lack the muscle membrane-stabilizing protein dystrophin. Antisense oligonucleotide (AON)-mediated exon skipping is a therapeutic approach that aims to induce production of partially functional dystrophins. Recently, an AON targeting exon 51 became the first of its class to be approved by the United States regulators [Food and Drug Administration (FDA)] for the treatment of DMD. A unique aspect of the exon-skipping approach for DMD is that, depending on the size and location of the mutation, different exons need to be skipped. This challenge raises a number of questions regarding the development and regulatory approval of those individual compounds. In this study, we present a perspective on those questions, following a European stakeholder meeting involving academics, regulators, and representatives from industry and patient organizations, and in the light of the most recent scientific and regulatory experience. PMID:28796573

Genetic variation affecting exon skipping contributes to brain structural atrophy in Alzheimer's disease.

PubMed

Lee, Younghee; Han, Seonggyun; Kim, Dongwook; Kim, Dokyoon; Horgousluoglu, Emrin; Risacher, Shannon L; Saykin, Andrew J; Nho, Kwangsik

2018-01-01

Genetic variation in cis-regulatory elements related to splicing machinery and splicing regulatory elements (SREs) results in exon skipping and undesired protein products. We developed a splicing decision model to identify actionable loci among common SNPs for gene regulation. The splicing decision model identified SNPs affecting exon skipping by analyzing sequence-driven alternative splicing (AS) models and by scanning the genome for the regions with putative SRE motifs. We used non-Hispanic Caucasians with neuroimaging, and fluid biomarkers for Alzheimer's disease (AD) and identified 17,088 common exonic SNPs affecting exon skipping. GWAS identified one SNP (rs1140317) in HLA-DQB1 as significantly associated with entorhinal cortical thickness, AD neuroimaging biomarker, after controlling for multiple testing. Further analysis revealed that rs1140317 was significantly associated with brain amyloid-f deposition (PET and CSF). HLA-DQB1 is an essential immune gene and may regulate AS, thereby contributing to AD pathology. SRE may hold potential as novel therapeutic targets for AD.

An all digital phase locked loop for synchronization of a sinusoidal signal embedded in white Gaussian noise

NASA Technical Reports Server (NTRS)

Reddy, C. P.; Gupta, S. C.

1973-01-01

An all digital phase locked loop which tracks the phase of the incoming sinusoidal signal once per carrier cycle is proposed. The different elements and their functions and the phase lock operation are explained in detail. The nonlinear difference equations which govern the operation of the digital loop when the incoming signal is embedded in white Gaussian noise are derived, and a suitable model is specified. The performance of the digital loop is considered for the synchronization of a sinusoidal signal. For this, the noise term is suitably modelled which allows specification of the output probabilities for the two level quantizer in the loop at any given phase error. The loop filter considered increases the probability of proper phase correction. The phase error states in modulo two-pi forms a finite state Markov chain which enables the calculation of steady state probabilities, RMS phase error, transient response and mean time for cycle skipping.

Teaching Machines and Programmed Instruction.

ERIC Educational Resources Information Center

Kay, Harry; And Others

The various devices used in programed instruction range from the simple linear programed book to branching and skip branching programs, adaptive teaching machines, and even complex computer based systems. In order to provide a background for the would-be programer, the essential principles of each of these devices is outlined. Different ideas of…

Isoform-specific functions of Mud/NuMA mediate binucleation of Drosophila male accessory gland cells.

PubMed

Taniguchi, Kiichiro; Kokuryo, Akihiko; Imano, Takao; Minami, Ryunosuke; Nakagoshi, Hideki; Adachi-Yamada, Takashi

2014-12-20

In standard cell division, the cells undergo karyokinesis and then cytokinesis. Some cells, however, such as cardiomyocytes and hepatocytes, can produce binucleate cells by going through mitosis without cytokinesis. This cytokinesis skipping is thought to be due to the inhibition of cytokinesis machinery such as the central spindle or the contractile ring, but the mechanisms regulating it are unclear. We investigated them by characterizing the binucleation event during development of the Drosophila male accessory gland, in which all cells are binucleate. The accessory gland cells arrested the cell cycle at 50 hours after puparium formation (APF) and in the middle of the pupal stage stopped proliferating for 5 hours. They then restarted the cell cycle and at 55 hours APF entered the M-phase synchronously. At this stage, accessory gland cells binucleated by mitosis without cytokinesis. Binucleating cells displayed the standard karyokinesis progression but also showed unusual features such as a non-round shape, spindle orientation along the apico-basal axis, and poor assembly of the central spindle. Mud, a Drosophila homolog of NuMA, regulated the processes responsible for these three features, the classical isoform Mud(PBD) and the two newly characterized isoforms Mud(L) and Mud(S) regulated them differently: Mud(L) repressed cell rounding, Mud(PBD) and Mud(S) oriented the spindle along the apico-basal axis, and Mud(S) and Mud(L) repressed central spindle assembly. Importantly, overexpression of Mud(S) induced binucleation even in standard proliferating cells such as those in imaginal discs. We characterized the binucleation in the Drosophila male accessory gland and examined mechanisms that regulated unusual morphologies of binucleating cells. We demonstrated that Mud, a microtubule binding protein regulating spindle orientation, was involved in this binucleation. We suggest that atypical functions exerted by three structurally different isoforms of Mud regulate cell rounding, spindle orientation and central spindle assembly in binucleation. We also propose that Mud(S) is a key regulator triggering cytokinesis skipping in binucleation processes.

7 CFR 42.121 - Sampling and inspection procedures.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 7 Agriculture 2 2011-01-01 2011-01-01 false Sampling and inspection procedures. 42.121 Section 42... REGULATIONS STANDARDS FOR CONDITION OF FOOD CONTAINERS Skip Lot Sampling and Inspection Procedures § 42.121 Sampling and inspection procedures. (a) Following skip lot procedure authorization, inspect every lot...

7 CFR 42.121 - Sampling and inspection procedures.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 2 2010-01-01 2010-01-01 false Sampling and inspection procedures. 42.121 Section 42... REGULATIONS STANDARDS FOR CONDITION OF FOOD CONTAINERS Skip Lot Sampling and Inspection Procedures § 42.121 Sampling and inspection procedures. (a) Following skip lot procedure authorization, inspect every lot...

Immunization: Department of Health

Science.gov Websites

State of Rhode Island: Department of Health State of Rhode Island: Department of Health Rhode Island Department of Health State of Rhode Island Department of Health Skip to content | Skip to Health & Wellness Food, Water & Environment Birth, Death & Marriage Records Laboratory

Tuberculosis: Department of Health

Science.gov Websites

State of Rhode Island: Department of Health State of Rhode Island: Department of Health Rhode Island Department of Health State of Rhode Island Department of Health Skip to content | Skip to Health & Wellness Food, Water & Environment Birth, Death & Marriage Records Laboratory

78 FR 10001 - Proposed Collection; Comment Request for Form 706-GS(D)

Federal Register 2010, 2011, 2012, 2013, 2014

2013-02-12

... Form 706-GS(D), Generation-Skipping Transfer Tax Return for Distributions. DATES: Written comments should be received on or before April 15, 2013 to be assured of consideration. ADDRESSES: Direct all... [email protected] . SUPPLEMENTARY INFORMATION: Title: Generation-Skipping Transfer Tax Return for...

Skipping Syntactically Illegal "the" Previews: The Role of Predictability

ERIC Educational Resources Information Center

Abbott, Matthew J.; Angele, Bernhard; Ahn, Y. Danbi; Rayner, Keith

2015-01-01

Readers tend to skip words, particularly when they are short, frequent, or predictable. Angele and Rayner (2013) recently reported that readers are often unable to detect syntactic anomalies in parafoveal vision. In the present study, we manipulated target word predictability to assess whether contextual constraint modulates…

Therapeutic NOTCH3 cysteine correction in CADASIL using exon skipping: in vitro proof of concept.

PubMed

Rutten, Julie W; Dauwerse, Hans G; Peters, Dorien J M; Goldfarb, Andrew; Venselaar, Hanka; Haffner, Christof; van Ommen, Gert-Jan B; Aartsma-Rus, Annemieke M; Lesnik Oberstein, Saskia A J

2016-04-01

Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy, or CADASIL, is a hereditary cerebral small vessel disease caused by characteristic cysteine altering missense mutations in the NOTCH3 gene. NOTCH3 mutations in CADASIL result in an uneven number of cysteine residues in one of the 34 epidermal growth factor like-repeat (EGFr) domains of the NOTCH3 protein. The consequence of an unpaired cysteine residue in an EGFr domain is an increased multimerization tendency of mutant NOTCH3, leading to toxic accumulation of the protein in the (cerebro)vasculature, and ultimately reduced cerebral blood flow, recurrent stroke and vascular dementia. There is no therapy to delay or alleviate symptoms in CADASIL. We hypothesized that exclusion of the mutant EGFr domain from NOTCH3 would abolish the detrimental effect of the unpaired cysteine and thus prevent toxic NOTCH3 accumulation and the negative cascade of events leading to CADASIL. To accomplish this NOTCH3 cysteine correction by EGFr domain exclusion, we used pre-mRNA antisense-mediated skipping of specific NOTCH3 exons. Selection of these exons was achieved using in silico studies and based on the criterion that skipping of a particular exon or exon pair would modulate the protein in such a way that the mutant EGFr domain is eliminated, without otherwise corrupting NOTCH3 structure and function. Remarkably, we found that this strategy closely mimics evolutionary events, where the elimination and fusion of NOTCH EGFr domains led to the generation of four functional NOTCH homologues. We modelled a selection of exon skip strategies using cDNA constructs and show that the skip proteins retain normal protein processing, can bind ligand and be activated by ligand. We then determined the technical feasibility of targeted NOTCH3 exon skipping, by designing antisense oligonucleotides targeting exons 2-3, 4-5 and 6, which together harbour the majority of distinct CADASIL-causing mutations. Transfection of these antisense oligonucleotides into CADASIL patient-derived cerebral vascular smooth muscle cells resulted in successful exon skipping, without abrogating NOTCH3 signalling. Combined, these data provide proof of concept for this novel application of exon skipping, and are a first step towards the development of a rational therapeutic approach applicable to up to 94% of CADASIL-causing mutations. © The Author (2016). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

An Empirical Methodology for Engineering Human Systems Integration

DTIC Science & Technology

2009-12-01

scanning critical information and selectively skipping what is not important for the immediate task. This learned skill is called a proper “cross check...ability to recover from errors. Efficiency: the level of productivity that can be achieved once learning has occurred. 162 Learnability: the...use, to legacy systems. Knowing what design issues have plagued past operators can guide the generation of requirements to address the identified

Effect of skipping breakfast on subsequent energy intake.

PubMed

Levitsky, David A; Pacanowski, Carly R

2013-07-02

The objective was to examine the effect of consuming breakfast on subsequent energy intake. Participants who habitually ate breakfast and those who skipped breakfast were recruited for two studies. Using a randomized crossover design, the first study examined the effect of having participants consume either (a) no breakfast, (b) a high carbohydrate breakfast (335 kcals), or (c) a high fiber breakfast (360 kcals) on three occasions and measured ad libitum intake at lunch. The second study again used a randomized crossover design but with a larger, normal carbohydrate breakfast consumed ad libtum. Intake averaged 624 kcals and subsequent food intake was measured throughout the day. Participants ate only foods served from the Cornell Human Metabolic Research Unit where all foods were weighed before and after consumption. In the first study, neither eating breakfast nor the kind of breakfast consumed had an effect on the amount consumed at lunch despite a reduction in hunger ratings. In the second study, intake at lunch as well as hunger ratings were significantly increased after skipping breakfast (by 144 kcal), leaving a net caloric deficit of 408 kcal by the end of the day. These data are consistent with published literature demonstrating that skipping a meal does not result in accurate energy compensation at subsequent meals and suggests that skipping breakfast may be an effective means to reduce daily energy intake in some adults. Copyright © 2013 Elsevier Inc. All rights reserved.

26 CFR 26.2653-1 - Taxation of multiple skips.

Code of Federal Regulations, 2013 CFR

2013-04-01

... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2653... thereafter deemed to occupy the generation immediately above the highest generation of any person holding an... immediately after the GST, the transferor is treated as occupying the generation above the highest generation...

26 CFR 26.2653-1 - Taxation of multiple skips.

Code of Federal Regulations, 2012 CFR

2012-04-01

... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2653... thereafter deemed to occupy the generation immediately above the highest generation of any person holding an... immediately after the GST, the transferor is treated as occupying the generation above the highest generation...

26 CFR 26.2653-1 - Taxation of multiple skips.

Code of Federal Regulations, 2014 CFR

2014-04-01

... GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2653-1... deemed to occupy the generation immediately above the highest generation of any person holding an... immediately after the GST, the transferor is treated as occupying the generation above the highest generation...

Quiz Today: Should I Skip Class?

ERIC Educational Resources Information Center

Zizler, Peter

2013-01-01

How does selective assessment, wherein one counts only the best "k" out of "n" quizzes set, impact grade inflation? Based on our analysis, a specific quantitative answer can be given to a student who plans to skip a quiz, depending, of course, on the student's quiz writing consistency or inconsistency.

26 CFR 26.2642-5 - Finality of inclusion ratio.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 26 Internal Revenue 14 2014-04-01 2013-04-01 true Finality of inclusion ratio. 26.2642-5 Section...-5 Finality of inclusion ratio. (a) Direct skips. The inclusion ratio applicable to a direct skip...) Other GSTs. With respect to taxable distributions and taxable terminations, the inclusion ratio for a...

26 CFR 26.2642-5 - Finality of inclusion ratio.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 26 Internal Revenue 14 2012-04-01 2012-04-01 false Finality of inclusion ratio. 26.2642-5 Section...-5 Finality of inclusion ratio. (a) Direct skips. The inclusion ratio applicable to a direct skip...) Other GSTs. With respect to taxable distributions and taxable terminations, the inclusion ratio for a...

26 CFR 26.2642-5 - Finality of inclusion ratio.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 26 Internal Revenue 14 2013-04-01 2013-04-01 false Finality of inclusion ratio. 26.2642-5 Section...-5 Finality of inclusion ratio. (a) Direct skips. The inclusion ratio applicable to a direct skip...) Other GSTs. With respect to taxable distributions and taxable terminations, the inclusion ratio for a...

26 CFR 25.2518-1 - Qualified disclaimers of property; in general.

Code of Federal Regulations, 2010 CFR

2010-04-01

...-2, for purposes of the Federal estate, gift, and generation-skipping transfer tax provisions, the... estate, gift, and generation-skipping transfer tax provisions, the disclaimer is disregarded and the... State Y on June 17, 1978. G and H are beneficiaries under the will. The will provides that any...

75 FR 36480 - Proposed Collection; Comment Request for Regulation Project

Federal Register 2010, 2011, 2012, 2013, 2014

2010-06-25

... required by the Paperwork Reduction Act of 1995, Public Law 104-13 (44 U.S.C. 3506(c)(2)(A)). Currently..., Qualified Severance of a Trust for Generation-Skipping Transfer (GST) Tax Purposes. DATES: Written [email protected] . SUPPLEMENTARY INFORMATION: Title: Qualified Severance of a Trust for Generation-Skipping...

75 FR 38869 - Proposed Collection; Comment Request for Regulation Project

Federal Register 2010, 2011, 2012, 2013, 2014

2010-07-06

...-73-88 (TD 8644), Generation-Skipping Transfer Tax (Sec. Sec. 26.2601-1, 26.2632- 1, 26.2642-1, 26... or before September 7, 2010 to be assured of consideration. ADDRESSES: Direct all written comments to... [email protected] . SUPPLEMENTARY INFORMATION: Title: Generation-Skipping Transfer Tax. OMB...

26 CFR 26.2642-5 - Finality of inclusion ratio.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 26 Internal Revenue 14 2010-04-01 2010-04-01 false Finality of inclusion ratio. 26.2642-5 Section...-5 Finality of inclusion ratio. (a) Direct skips. The inclusion ratio applicable to a direct skip...) Other GSTs. With respect to taxable distributions and taxable terminations, the inclusion ratio for a...

26 CFR 26.2642-5 - Finality of inclusion ratio.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 26 Internal Revenue 14 2011-04-01 2010-04-01 true Finality of inclusion ratio. 26.2642-5 Section...-5 Finality of inclusion ratio. (a) Direct skips. The inclusion ratio applicable to a direct skip...) Other GSTs. With respect to taxable distributions and taxable terminations, the inclusion ratio for a...

75 FR 38874 - Proposed Collection; Comment Request for Form 706-NA

Federal Register 2010, 2011, 2012, 2013, 2014

2010-07-06

... INFORMATION: Title: United States Estate (and Generation-Skipping Transfer) Tax Return, Estate of nonresident... Form 706-NA, United States Estate (and Generation-Skipping Transfer) Tax Return, Estate of nonresident not a citizen of the United States. DATES: Written comments should be received on or before September...

Double air-fuel ratio sensor system having double-skip function

DOE Office of Scientific and Technical Information (OSTI.GOV)

Katsuno, T.

1988-01-26

A method for controlling the air-fuel ratio in an internal combustion engine is described having a catalyst converter for removing pollutants in the exhaust gas thereof, and upstream-side and downstream-side air-fuel ratio sensors disposed upstream and downstream, respectively, of the catalyst converter for detecting a concentration of a specific component in an exhaust gas, comprising the steps of: comparing the output of the upstream-side air-fuel ratio sensor with a first predetermined value; gradually changing a first air-fuel ratio correction amount in accordance with a result of the comparison of the output of the upstream-side air-fuel ratio sensor with the predeterminedmore » value; shifting the first air-fuel ratio correction amount by a first skip amount during a predetermined time period after the result of the comparison of the upstream-side air-fuel ratio sensor is changed; shifting the first air-fuel ratio correction amount by a second skip amount smaller than the first skip amount after the predetermined time period has passed; comparing the output of the downstream-side air-fuel ratio with a second predetermined value, calculating a second air-fuel ratio correction amount in accordance with the comparison result of the output of the downstream-side air-fuel ratio sensor with the second predetermined value; and adjusting the actual air-fuel ratio in accordance with the first and second air-fuel ratio correction amounts; wherein the gradually-changing step comprises the steps of: gradually decreasing the first air-fuel ratio correction amount when the output of the upstream-side air-fuel sensor is on the rich side with respect to the first predetermined value; and gradually increasing the first air-fuel ratio correction amount when the output of the upstream-side air-fuel sensor is on the lean side with respect to the first predetermined value.« less

Context Dependent Effects of Chimeric Peptide Morpholino Conjugates Contribute to Dystrophin Exon-skipping Efficiency.

PubMed

Yin, Haifang; Boisguerin, Prisca; Moulton, Hong M; Betts, Corinne; Seow, Yiqi; Boutilier, Jordan; Wang, Qingsong; Walsh, Anthony; Lebleu, Bernard; Wood, Matthew Ja

2013-09-24

We have recently reported that cell-penetrating peptides (CPPs) and novel chimeric peptides containing CPP (referred as B peptide) and muscle-targeting peptide (referred as MSP) motifs significantly improve the systemic exon-skipping activity of morpholino phosphorodiamidate oligomers (PMOs) in dystrophin-deficient mdx mice. In the present study, the general mechanistic significance of the chimeric peptide configuration on the activity and tissue uptake of peptide conjugated PMOs in vivo was investigated. Four additional chimeric peptide-PMO conjugates including newly identified peptide 9 (B-9-PMO and 9-B-PMO) and control peptide 3 (B-3-PMO and 3-B-PMO) were tested in mdx mice. Immunohistochemical staining, RT-PCR and western blot results indicated that B-9-PMO induced significantly higher level of exon skipping and dystrophin restoration than its counterpart (9-B-PMO), further corroborating the notion that the activity of chimeric peptide-PMO conjugates is dependent on relative position of the tissue-targeting peptide motif within the chimeric peptide with respect to PMOs. Subsequent mechanistic studies showed that enhanced cellular uptake of B-MSP-PMO into muscle cells leads to increased exon-skipping activity in comparison with MSP-B-PMO. Surprisingly, further evidence showed that the uptake of chimeric peptide-PMO conjugates of both orientations (B-MSP-PMO and MSP-B-PMO) was ATP- and temperature-dependent and also partially mediated by heparan sulfate proteoglycans (HSPG), indicating that endocytosis is likely the main uptake pathway for both chimeric peptide-PMO conjugates. Collectively, our data demonstrate that peptide orientation in chimeric peptides is an important parameter that determines cellular uptake and activity when conjugated directly to oligonucleotides. These observations provide insight into the design of improved cell targeting compounds for future therapeutics studies.Molecular Therapy-Nucleic Acids (2013) 2, e124; doi:10.1038/mtna.2013.51; published online 24 September 2013.

How You Can Take Medicine Safely | NIH MedlinePlus the Magazine

MedlinePlus

... your prescription to a different one that will work better for you. Use a memory aid to take your medicines on time. Some people use mealtime or bedtime as a reminder to take their medicine. Other people ... Find a system that works for you. Do not skip doses of medication ...

National Agricultural Library | United States Department of Agriculture

Science.gov Websites

Skip to main content Home National Agricultural Library United States Department of Agriculture Ag is a data access system maintained by the US Department of Agriculture's (USDA) National Agricultural websites. The Ag Data Commons provides access to a wide variety of open data relevant to agricultural

Southwest U.S. Imagery (GOES-WEST) - Satellite Services Division / Office

Science.gov Websites

of Satellite Data Processing and Distribution Skip Navigation Link NESDIS banner image and link Information Service Home Page Default Office of Satellite and Product Operations banner image and link to OSPO Color -- Sea/Lake Ice -- Sea Surface Height -- Sea Surface Temperatures -- Tropical Systems Product List

[The validity of the sentinel node concept in gastrointestinal cancers].

PubMed

Kitagawa, Y; Fujii, H; Mukai, M; Ando, N; Kubota, T; Ikeda, T; Ohgami, M; Watanabe, M; Otani, Y; Ozawa, S; Hasegawa, H; Furukawa, T; Nakahara, T; Kubo, A; Kumai, K; Kitajima, M

2000-03-01

Although the sentinel node concept has been validated and clinically applied to breast cancer and malignant melanoma, its clinical significance in other solid tumors has not been thoroughly investigated. With regard to gastrointestinal (GI) cancers in particular, our surgeons have been cautious because of the high frequency of skip metastasis and the complicated lymphatic system in the GI tract. We would like to emphasize that so-called skip metastasis has been defined according to anatomic classification of regional lymph nodes and that the lymphatic drainage route must be patient or lesion specific. To test the validity and feasibility of this concept in GI cancers, we have established a radio-guided intraoperative sentinel node navigation system using preoperative endoscopic submucosal injection of radioactive tracer followed by intra-operative gamma-probing. In 131 patients with GI cancers (esophagus: 22, stomach: 71, colorectum: 38), the detection rate of sentinel nades was 91% and overall diagnostic accuracy of lymph node metastasis by sentinel node status was 97%. Initial results suggest further investigation of this procedure as an accurate staging and a minimally invasive approach to early GI cancers.

Breakfast Blitz: An Innovative Nutrition Education Program

ERIC Educational Resources Information Center

Towery, Pamela C.; Nix, Elizabeth S.; Norman, Bilinda

2014-01-01

Childhood overweight and obesity are major problems in the United States, with important consequences for our nation's health and economy. Breakfast is considered the most important meal of the day, yet children, adolescents, and adults skip breakfast on a routine basis. This habit of breakfast skipping is related to weight gain, higher body…

The Influence of Mathematical Ability and Morning Nutrition on Mental Arithmetic in Preadolescents: An ERP study.

USDA-ARS?s Scientific Manuscript database

The effects of eating or skipping breakfast on ERP correlates of mental arithmetic were studied in preadolescents differing in experience (age) and mathematical skills. Participants, randomly assigned to treatment [eat (B) or skip (SB) breakfast (each, n = 41)], were sub-grouped by age [8.8 yrs (B: ...

Examining Predictors of Breakfast Skipping and Breakfast Program Use among Secondary School Students in the Compass Study

ERIC Educational Resources Information Center

Godin, Katelyn M.; Patte, Karen A.; Leatherdale, Scott T.

2018-01-01

Background: Many Canadian schools offer breakfast programs; however, students' engagement in these programs is low, while breakfast skipping is highly prevalent among youth. This study examined whether the availability of breakfast programs supports adolescents' regular breakfast eating, and identified characteristics of breakfast skippers who are…

SKIPing with Head Start Teachers: Influence of T-SKIP on Object-Control Skills

ERIC Educational Resources Information Center

Brian, Ali; Goodway, Jacqueline D.; Logan, Jessica A.; Sutherland, Sue

2017-01-01

Purpose: Children from disadvantaged settings are at risk for delays in their object-control (OC) skills. Fundamental motor skill interventions, such as the Successful Kinesthetic Instruction for Preschoolers (SKIP) Program, are highly successful when led by motor development experts. However, few preschools employ such experts. This study…

Skip-row Planting Patterns Stabilize Corn Grain Yields in the Central Great Plains

USDA-ARS?s Scientific Manuscript database

The highly variable climate of the Central Great Plains makes dryland corn (Zea mays) production a risky enterprise. Twenty-three field trials were conducted across the Central Great Plains from 2004 through 2006 to quantify the effect of various skip-row planting patterns and plant populations on g...

Helping Struggling Students: The Impact of Three Instructional Interventions on College Students' Exam Scores and Exam-Skipping Behavior

ERIC Educational Resources Information Center

Thomas, Nichole Gibbs; Thomas, Antonio Lamar

2018-01-01

Whether instructional-communication feedback sent to struggling students and succeeding students following course exams would significantly increase their exam scores and significantly decrease their exam-skipping behavior relative to students in the control group was investigated. An experimenter-blind study utilizing feedback and the…

Skipping on uneven ground: trailing leg adjustments simplify control and enhance robustness.

PubMed

Müller, Roy; Andrada, Emanuel

2018-01-01

It is known that humans intentionally choose skipping in special situations, e.g. when descending stairs or when moving in environments with lower gravity than on Earth. Although those situations involve uneven locomotion, the dynamics of human skipping on uneven ground have not yet been addressed. To find the reasons that may motivate this gait, we combined experimental data on humans with numerical simulations on a bipedal spring-loaded inverted pendulum model (BSLIP). To drive the model, the following parameters were estimated from nine subjects skipping across a single drop in ground level: leg lengths at touchdown, leg stiffness of both legs, aperture angle between legs, trailing leg angle at touchdown (leg landing first after flight phase), and trailing leg retraction speed. We found that leg adjustments in humans occur mostly in the trailing leg (low to moderate leg retraction during swing phase, reduced trailing leg stiffness, and flatter trailing leg angle at lowered touchdown). When transferring these leg adjustments to the BSLIP model, the capacity of the model to cope with sudden-drop perturbations increased.

Pulse-coupled mixed-mode oscillators: Cluster states and extreme noise sensitivity

NASA Astrophysics Data System (ADS)

Karamchandani, Avinash J.; Graham, James N.; Riecke, Hermann

2018-04-01

Motivated by rhythms in the olfactory system of the brain, we investigate the synchronization of all-to-all pulse-coupled neuronal oscillators exhibiting various types of mixed-mode oscillations (MMOs) composed of sub-threshold oscillations (STOs) and action potentials ("spikes"). We focus particularly on the impact of the delay in the interaction. In the weak-coupling regime, we reduce the system to a Kuramoto-type equation with non-sinusoidal phase coupling and the associated Fokker-Planck equation. Its linear stability analysis identifies the appearance of various cluster states. Their type depends sensitively on the delay and the width of the pulses. Interestingly, long delays do not imply slow population rhythms, and the number of emerging clusters only loosely depends on the number of STOs. Direct simulations of the oscillator equations reveal that for quantitative agreement of the weak-coupling theory the coupling strength and the noise have to be extremely small. Even moderate noise leads to significant skipping of STO cycles, which can enhance the diffusion coefficient in the Fokker-Planck equation by two orders of magnitude. Introducing an effective diffusion coefficient extends the range of agreement significantly. Numerical simulations of the Fokker-Planck equation reveal bistability and solutions with oscillatory order parameters that result from nonlinear mode interactions. These are confirmed in simulations of the full spiking model.

Effects of social determinants on food choice and skipping meals among Turkish adolescents.

PubMed

Soyer, Meral Turk; Ergin, Isil; Gursoy, Safak Taner

2008-01-01

To present data that contributes to understanding factors that influence food choice and skipping meals in adolescents. A cross sectional study is carried in selected high schools in Bornova. Study sample compromises of 527 students chosen randomly by class from a population of 2410 first year in high school students. Self-administered questionnaires containing sociodemographic determinants, self reported weight and height, food choices and meal patterns were used. A psychosocial factor that affects almost all of the students is the "taste and sensory perception of food". The second noticable factor is the "health and nutritious value of food". The time conserved and the convenience in the preparation of food is one of the lifestyle factors that affect more than half of the students. The cost of the food was also found to have an effect. Among the third group of factors categorized as "media", the leading factor is advertisement, effective in one third of the students. Among boys and girls, there was no statistical difference in the type of meal skipped. Living in Izmir for more than 10 years compared to less than ten years, being in a nuclear family to extended family, and belonging to the "owner" social class to "wage laborer" class also do not statistically differ with regard to skipping meals. However, the mother's and father's education level and having a working mother are associated with skipping meals. These results provide important evidence to support opportunities to positively influence the adoption of healthful eating.

Identification of a novel exonic mutation at -13 from 5' splice site causing exon skipping in a girl with mitochondrial acetoacetyl-coenzyme A thiolase deficiency.

PubMed Central

Fukao, T; Yamaguchi, S; Wakazono, A; Orii, T; Hoganson, G; Hashimoto, T

1994-01-01

We identified a novel exonic mutation which causes exon skipping in the mitochondrial acetoacetyl-CoA thiolase (T2) gene from a girl with T2 deficiency (GK07). GK07 is a compound heterozygote; the maternal allele has a novel G to T transversion at position 1136 causing Gly379 to Val substitution (G379V) of the T2 precursor. In case of in vivo expression analysis, cells transfected with this mutant cDNA showed no evidence of restored T2 activity. The paternal allele was associated with exon 8 skipping at the cDNA level. At the gene level, a C to T transition causing Gln272 to termination codon (Q272STOP) was identified within exon 8, 13 bp from the 5' splice site of intron 8 in the paternal allele. The mRNA with Q272STOP could not be detected in GK07 fibroblasts, presumably because pre-mRNA with Q272STOP was unstable because of the premature termination. In vivo splicing experiments revealed that the exonic mutation caused partial skipping of exon 8. This substitution was thought to alter the secondary structure of T2 pre-mRNA around exon 8 and thus impede normal splicing. The role of exon sequences in the splicing mechanism is indicated by the exon skipping which occurred with an exonic mutation. Images PMID:7907600

HnRNP C, YB-1 and hnRNP L coordinately enhance skipping of human MUSK exon 10 to generate a Wnt-insensitive MuSK isoform

PubMed Central

Nasrin, Farhana; Rahman, Mohammad Alinoor; Masuda, Akio; Ohe, Kenji; Takeda, Jun-ichi; Ohno, Kinji

2014-01-01

Muscle specific receptor tyrosine kinase (MuSK) is an essential postsynaptic transmembrane molecule that mediates clustering of acetylcholine receptors (AChR). MUSK exon 10 is alternatively skipped in human, but not in mouse. Skipping of this exon disrupts a cysteine-rich region (Fz-CRD), which is essential for Wnt-mediated AChR clustering. To investigate the underlying mechanisms of alternative splicing, we exploited block-scanning mutagenesis with human minigene and identified a 20-nucleotide block that contained exonic splicing silencers. Using RNA-affinity purification, mass spectrometry, and Western blotting, we identified that hnRNP C, YB-1 and hnRNP L are bound to MUSK exon 10. siRNA-mediated knockdown and cDNA overexpression confirmed the additive, as well as the independent, splicing suppressing effects of hnRNP C, YB-1 and hnRNP L. Antibody-mediated in vitro protein depletion and scanning mutagenesis additionally revealed that binding of hnRNP C to RNA subsequently promotes binding of YB-1 and hnRNP L to the immediate downstream sites and enhances exon skipping. Simultaneous tethering of two splicing trans-factors to the target confirmed the cooperative effect of YB-1 and hnRNP L on hnRNP C-mediated exon skipping. Search for a similar motif in the human genome revealed nine alternative exons that were individually or coordinately regulated by hnRNP C and YB-1. PMID:25354590

Health, behavioral, cognitive, and social correlates of breakfast skipping among women living in socioeconomically disadvantaged neighborhoods.

PubMed

Smith, Kylie J; McNaughton, Sarah A; Cleland, Verity J; Crawford, David; Ball, Kylie

2013-11-01

Breakfast skipping is a potentially modifiable behavior that has negative effects on health and is socioeconomically patterned. This study aimed to examine the intrapersonal (health, behavioral, and cognitive) and social factors associated with breakfast skipping. Nonpregnant women (n = 4123) aged 18-45 y from socioeconomically disadvantaged neighborhoods throughout Victoria, Australia, completed a postal questionnaire. Sociodemographic characteristics, diet, physical activity, sedentary behaviors, and cognitive and social factors were assessed by self-report. Breakfast skipping was defined in 2 ways: 1) "rarely/never" eating breakfast (n = 498) and 2) eating breakfast ≤2 d/wk (includes those who rarely/never ate breakfast; n = 865). Poisson regression was used to calculate prevalence ratios and linear trends, adjusting for covariates. The P values for linear trends are reported below. Compared with breakfast consumers, women who reported rarely/never eating breakfast tended to have poorer self-rated health (P-trend < 0.001), be current smokers (P-trend < 0.001), pay less attention to health (P-trend < 0.001), not prioritize their own healthy eating when busy looking after their family (P-trend < 0.001), have less nutrition knowledge (P-trend < 0.001), and a lower proportion were trying to control their weight (P-trend < 0.020). When breakfast skipping was defined as eating breakfast ≤2 d/wk, additional associations were found for having lower leisure-time physical activity (P-trend = 0.012) and less self-efficacy for eating a healthy diet (P-trend < 0.043). In conclusion, a range of intrapersonal and social factors were significantly associated with breakfast skipping among women living in socioeconomically disadvantaged areas. Acknowledging the cross-sectional design and need for causal confirmation, programs that aim to promote breakfast consumption in this population group should consider targeting family-related barriers to healthy eating and nutrition knowledge.

Cwf16p Associating with the Nineteen Complex Ensures Ordered Exon Joining in Constitutive Pre-mRNA Splicing in Fission Yeast

PubMed Central

Sasaki-Haraguchi, Noriko; Ikuyama, Takeshi; Yoshii, Shogo; Takeuchi-Andoh, Tomoko; Frendewey, David; Tani, Tokio

2015-01-01

Exons are ligated in an ordered manner without the skipping of exons in the constitutive splicing of pre-mRNAs with multiple introns. To identify factors ensuring ordered exon joining in constitutive pre-mRNA splicing, we previously screened for exon skipping mutants in Schizosaccharomyces pombe using a reporter plasmid, and characterized three exon skipping mutants named ods1 (ordered splicing 1), ods2, and ods3, the responsible genes of which encode Prp2/U2AF59, U2AF23, and SF1, respectively. They form an SF1-U2AF59-U2AF23 complex involved in recognition of the branch and 3′ splice sites in pre-mRNA. In the present study, we identified a fourth ods mutant, ods4, which was isolated in an exon-skipping screen. The ods4 + gene encodes Cwf16p, which interacts with the NineTeen Complex (NTC), a complex thought to be involved in the first catalytic step of the splicing reaction. We isolated two multi-copy suppressors for the ods4-1 mutation, Srp2p, an SR protein essential for pre-mRNA splicing, and Tif213p, a translation initiation factor, in S. pombe. The overexpression of Srp2p suppressed the exon-skipping phenotype of all ods mutants, whereas Tif213p suppressed only ods4-1, which has a mutation in the translational start codon of the cwf16 gene. We also showed that the decrease in the transcriptional elongation rate induced by drug treatment suppressed exon skipping in ods4-1. We propose that Cwf16p/NTC participates in the early recognition of the branch and 3′ splice sites and cooperates with the SF1-U2AF59-U2AF23 complex to maintain ordered exon joining. PMID:26302002

Chronic Stress Is Associated with Indicators of Diet Quality in Habitual Breakfast Skippers.

PubMed

Widaman, Adrianne M; Witbracht, Megan G; Forester, Shavawn M; Laugero, Kevin D; Keim, Nancy L

2016-11-01

Previous studies suggest skipping breakfast is associated with lower diet quality, but possible reasons underlying this relationship are not clear. Our aim was to determine the relationship between chronic stress and variations in diet quality in the context of breakfast eating or breakfast skipping. Based on morning eating habits, 40 breakfast eaters and 35 breakfast skippers participated in a cross-sectional study. Diet assessment was based on unannounced 24-hour recalls. Women, ages 18 to 45 years, with a body mass index (calculated as kg/m 2 ) <40 were recruited in the greater Sacramento, CA, area between 2009 and 2013. Only women who consistently ate or skipped breakfast were enrolled. Compliance with the 2010 Dietary Guidelines for Americans was measured using the Healthy Eating Index 2010 (HEI-2010). Stress and executive function were evaluated with validated questionnaires and a computer-based task, respectively. Diet characteristics of breakfast eating and breakfast skipping were evaluated as nutrient densities (amounts per 1,000 kcal) and compared using a one-way analysis of covariance, with body mass index as covariate. Diet and stress variable associations were assessed using Pearson correlations. Despite no observed differences in daily energy intake between breakfast skipping and breakfast eating, overall diet quality (P=0.001), whole grains (P=0.002), fruit (P=0.002), empty calories (P=0.050), fiber (P=0.001), calcium (P=0.001), potassium (P=0.033), and folate (P=0.013) intakes were higher in breakfast eating. In the evening, breakfast skipping consumed more added sugars (P=0.012) and saturated fat (P=0.006). In breakfast skipping, reported stress was associated with empty calories (r=-0.39; P=0.027) and evening intake of added sugars (r=0.501; P=0.005). These relationships were not observed in breakfast eating. Breakfast skippers were less likely to meet the Dietary Guidelines for Americans and consumed more empty calories at night. Chronic stress was related to evening eating choices and overall empty calories in the diet of breakfast skippers, whereas breakfast eaters' dietary intake did not appear to be affected by chronic stress. Copyright © 2016 Academy of Nutrition and Dietetics. Published by Elsevier Inc. All rights reserved.

Pedometer Accuracy in Elementary School Children while Walking, Skipping, Galloping, and Sliding

ERIC Educational Resources Information Center

Smith, John Damien; Schroeder, Cynthia Ann

2010-01-01

The purpose of this study was to examine the accuracy of the SW-701 (Yamax Corporation, Tokyo, Japan) and NL-800 (New-Lifestyles, Inc., Lee's Summit, Missouri, USA) pedometer in fifth-grade students while walking, skipping, galloping, sliding, and hopping. Counts registered by both pedometer models were significantly lower than actual counts while…

The Relationships of Balance and Bilateral Coordination to Skipping in Kindergarten Children.

ERIC Educational Resources Information Center

Hockersmith, Mary R.; Folsom-Meek, Sherry L.

The purpose of this study was to examine the relationship of balance and bilateral coordination to the fundamental locomotor pattern of skipping in 5- and 6-year old children. Subjects were kindergarten students (N=30) who were attending an elementary school in the suburban Kansas City area. The investigators used items from the…

Effect of skip row planting configuration on grain sorghum water use

USDA-ARS?s Scientific Manuscript database

Grain sorghum (Sorghum bicolor L. [Moench]) is grown as a dryland crop in the semi-arid Central Great Plains. Growing the crop in a skip row configuration has been proposed as a means of delaying water use during the vegetative stage such that more water will be available to be used during the more ...

75 FR 5866 - Proposed Collection; Comment Request for Form 4768

Federal Register 2010, 2011, 2012, 2013, 2014

2010-02-04

...: Application for Extension of Time To File a Return and/or Pay U.S. Estate (and Generation-Skipping Transfer... 4768, Application for Extension of Time To File a Return and/or Pay U.S. Estate (and Generation-Skipping Transfer) Taxes. DATES: Written comments should be received on or before April 5, 2010 to be...

Development and evaluation of an attractive self-marking ovitrap to measure dispersal and determine skip oviposition in Aedes albopictus(Diptera:Culicidae) field populations

USDA-ARS?s Scientific Manuscript database

Aedes albopictus (Skuse) is a container-breeding mosquito of public health importance. Its oviposition behavior has been assessed in outdoor conditions, but only with laboratory-reared specimens. We used an attractive self-marking oviposition device to assess Ae. albopictus skip oviposition behavi...

Modeling Skipped and Not-Reached Items Using IRTrees

ERIC Educational Resources Information Center

Debeer, Dries; Janssen, Rianne; De Boeck, Paul

2017-01-01

When dealing with missing responses, two types of omissions can be discerned: items can be skipped or not reached by the test taker. When the occurrence of these omissions is related to the proficiency process the missingness is nonignorable. The purpose of this article is to present a tree-based IRT framework for modeling responses and omissions…

Cell cycle G2/M arrest through an S phase-dependent mechanism by HIV-1 viral protein R.

PubMed

Li, Ge; Park, Hyeon U; Liang, Dong; Zhao, Richard Y

2010-07-07

Cell cycle G2 arrest induced by HIV-1 Vpr is thought to benefit viral proliferation by providing an optimized cellular environment for viral replication and by skipping host immune responses. Even though Vpr-induced G2 arrest has been studied extensively, how Vpr triggers G2 arrest remains elusive. To examine this initiation event, we measured the Vpr effect over a single cell cycle. We found that even though Vpr stops the cell cycle at the G2/M phase, but the initiation event actually occurs in the S phase of the cell cycle. Specifically, Vpr triggers activation of Chk1 through Ser345 phosphorylation in an S phase-dependent manner. The S phase-dependent requirement of Chk1-Ser345 phosphorylation by Vpr was confirmed by siRNA gene silencing and site-directed mutagenesis. Moreover, downregulation of DNA replication licensing factors Cdt1 by siRNA significantly reduced Vpr-induced Chk1-Ser345 phosphorylation and G2 arrest. Even though hydroxyurea (HU) and ultraviolet light (UV) also induce Chk1-Ser345 phosphorylation in S phase under the same conditions, neither HU nor UV-treated cells were able to pass through S phase, whereas vpr-expressing cells completed S phase and stopped at the G2/M boundary. Furthermore, unlike HU/UV, Vpr promotes Chk1- and proteasome-mediated protein degradations of Cdc25B/C for G2 induction; in contrast, Vpr had little or no effect on Cdc25A protein degradation normally mediated by HU/UV. These data suggest that Vpr induces cell cycle G2 arrest through a unique molecular mechanism that regulates host cell cycle regulation in an S-phase dependent fashion.

Image Processing In Laser-Beam-Steering Subsystem

NASA Technical Reports Server (NTRS)

Lesh, James R.; Ansari, Homayoon; Chen, Chien-Chung; Russell, Donald W.

1996-01-01

Conceptual design of image-processing circuitry developed for proposed tracking apparatus described in "Beam-Steering Subsystem For Laser Communication" (NPO-19069). In proposed system, desired frame rate achieved by "windowed" readout scheme in which only pixels containing and surrounding two spots read out and others skipped without being read. Image data processed rapidly and efficiently to achieve high frequency response.

Presentations - Twelker, Evan and others, 2014 | Alaska Division of

Science.gov Websites

magmatic Ni-Cu-Co-PGE system in the Talkeetna Mountains, central Alaska (poster): Society of Economic Geological & Geophysical Surveys Skip to content State of Alaska myAlaska My Government Resident Business in Alaska Visiting Alaska State Employees DGGS State of Alaska search Alaska Division of

Feeling 'too fat' rather than being 'too fat' increases unhealthy eating habits among adolescents - even in boys.

PubMed

van Vliet, Jolanda S; Gustafsson, Per A; Nelson, Nina

2016-01-01

Adolescence is a period of gender-specific physical changes, during which eating habits develop. To better understand what factors determine unhealthy eating habits such as dieting to lose weight, skipping meals, and consumption of unhealthy foods, we studied how physical measurements and body perception relate to eating habits in boys and girls, before and during adolescence. For this cross-sectional study, we obtained data from both written questionnaires and physical measurements of height, weight, and waist circumference (WC). Dieting to lose weight and skipping breakfast were more common among adolescents than among younger boys and girls (p<0.05). The strongest risk factor for dieting in both boys and girls was perception of overweight, which persisted after adjusting for age and for being overweight (p<0.01). Another independent risk factor for dieting behaviour was overweight, as defined by body mass index (BMI) among boys (p<0.01) and WC among girls (p<0.05). In both boys and girls, skipping breakfast was associated with both a more negative body perception and higher BMI (p<0.05). Skipping breakfast was also associated with age- and gender-specific unhealthy eating habits such as skipping other meals, lower consumption of fruits and vegetables, and higher consumption of sweets and sugary drinks (p<0.05). Body perception among adolescents is an important factor relating to unhealthy eating habits, not only in girls, but even in boys. Focus on body perception and eating breakfast daily is crucial for the development of healthy food consumption behaviours during adolescence and tracking into adulthood.

Word Skipping During Sentence Reading: Effects of Lexicality on Parafoveal Processing

PubMed Central

Choi, Wonil; Gordon, Peter C.

2013-01-01

Two experiments examined how lexical status affects the targeting of saccades during reading by using the boundary technique to vary independently the content of a letter string when seen in parafoveal preview and when directly fixated. Experiment 1 measured the skipping rate for a target word embedded in a sentence under three parafoveal preview conditions: full preview (e.g. brain-brain), pseudohomophone preview (e.g. brane-brain), and orthographic nonword control preview (e.g. brant-brain); in the first condition the preview string was always an English word while in the second and third conditions it was always a nonword. Experiment 2 investigated three conditions where the preview string was always a word: full preview (e.g. beach-beach), homophone preview (e.g. beech-beach), and orthographic control preview (e.g. bench-beach). None of the letter string manipulations used to create the preview conditions in the experiments disrupted sub-lexical orthographic or phonological patterns. In Experiment 1 higher skipping rates were observed for the full (lexical) preview condition, which consisted of a word, compared to the nonword preview conditions (pseudohomophone and orthographic-control). In contrast Experiment 2 showed no difference in skipping rates across the three types of lexical preview conditions (full, homophone and orthographic control), though preview type did influence reading times. This pattern indicates that skipping depends not only on the presence of disrupted sub-lexical patterns of orthography or phonology but is also critically dependent on processes that are sensitive to the lexical status of letter strings in the parafovea. PMID:24170376

Oxidative Stress Triggers Body-Wide Skipping of Multiple Exons of the Spinal Muscular Atrophy Gene

PubMed Central

Seo, Joonbae; Singh, Natalia N.; Ottesen, Eric W.; Sivanesan, Senthilkumar; Shishimorova, Maria; Singh, Ravindra N.

2016-01-01

Humans carry two nearly identical copies of Survival Motor Neuron gene: SMN1 and SMN2. Loss of SMN1 leads to spinal muscular atrophy (SMA), the most frequent genetic cause of infant mortality. While SMN2 cannot compensate for the loss of SMN1 due to predominant skipping of exon 7, correction of SMN2 exon 7 splicing holds the promise of a cure for SMA. Previously, we used cell-based models coupled with a multi-exon-skipping detection assay (MESDA) to demonstrate the vulnerability of SMN2 exons to aberrant splicing under the conditions of oxidative stress (OS). Here we employ a transgenic mouse model and MESDA to examine the OS-induced splicing regulation of SMN2 exons. We induced OS using paraquat that is known to trigger production of reactive oxygen species and cause mitochondrial dysfunction. We show an overwhelming co-skipping of SMN2 exon 5 and exon 7 under OS in all tissues except testis. We also show that OS increases skipping of SMN2 exon 3 in all tissues except testis. We uncover several new SMN2 splice isoforms expressed at elevated levels under the conditions of OS. We analyze cis-elements and transacting factors to demonstrate the diversity of mechanisms for splicing misregulation under OS. Our results of proteome analysis reveal downregulation of hnRNP H as one of the potential consequences of OS in brain. Our findings suggest SMN2 as a sensor of OS with implications to SMA and other diseases impacted by low levels of SMN protein. PMID:27111068

Clinical characterisation of Becker muscular dystrophy patients predicts favourable outcome in exon-skipping therapy.

PubMed

van den Bergen, J C; Schade van Westrum, S M; Dekker, L; van der Kooi, A J; de Visser, M; Wokke, B H A; Straathof, C S; Hulsker, M A; Aartsma-Rus, A; Verschuuren, J J; Ginjaar, H B

2014-01-01

Duchenne and Becker muscular dystrophy (DMD/BMD) are both caused by mutations in the DMD gene. Out-of-frame mutations in DMD lead to absence of the dystrophin protein, while in-frame BMD mutations cause production of internally deleted dystrophin. Clinically, patients with DMD loose ambulance around the age of 12, need ventilatory support at their late teens and die in their third or fourth decade due to pulmonary or cardiac failure. BMD has a more variable disease course. The disease course of patients with BMD with specific mutations could be very informative to predict the outcome of the exon-skipping therapy, aiming to restore the reading-frame in patients with DMD. Patients with BMD with a mutation equalling a DMD mutation after successful exon skipping were selected from the Dutch Dystrophinopathy Database. Information about disease course was gathered through a standardised questionnaire. Cardiac data were collected from medical correspondence and a previous study on cardiac function in BMD. Forty-eight patients were included, representing 11 different mutations. Median age of patients was 43 years (range 6-67). Nine patients were wheelchair users (26-56 years). Dilated cardiomyopathy was present in 7/36 patients. Only one patient used ventilatory support. Three patients had died at the age of 45, 50 and 76 years, respectively. This study provides mutation specific data on the course of disease in patients with BMD. It shows that the disease course of patients with BMD, with a mutation equalling a 'skipped' DMD mutation is relatively mild. This finding strongly supports the potential benefit of exon skipping in patients with DMD.

New architecture for dynamic frame-skipping transcoder.

PubMed

Fung, Kai-Tat; Chan, Yui-Lam; Siu, Wan-Chi

2002-01-01

Transcoding is a key technique for reducing the bit rate of a previously compressed video signal. A high transcoding ratio may result in an unacceptable picture quality when the full frame rate of the incoming video bitstream is used. Frame skipping is often used as an efficient scheme to allocate more bits to the representative frames, so that an acceptable quality for each frame can be maintained. However, the skipped frame must be decompressed completely, which might act as a reference frame to nonskipped frames for reconstruction. The newly quantized discrete cosine transform (DCT) coefficients of the prediction errors need to be re-computed for the nonskipped frame with reference to the previous nonskipped frame; this can create undesirable complexity as well as introduce re-encoding errors. In this paper, we propose new algorithms and a novel architecture for frame-rate reduction to improve picture quality and to reduce complexity. The proposed architecture is mainly performed on the DCT domain to achieve a transcoder with low complexity. With the direct addition of DCT coefficients and an error compensation feedback loop, re-encoding errors are reduced significantly. Furthermore, we propose a frame-rate control scheme which can dynamically adjust the number of skipped frames according to the incoming motion vectors and re-encoding errors due to transcoding such that the decoded sequence can have a smooth motion as well as better transcoded pictures. Experimental results show that, as compared to the conventional transcoder, the new architecture for frame-skipping transcoder is more robust, produces fewer requantization errors, and has reduced computational complexity.

Poly(ester amine) Composed of Polyethylenimine and Pluronic Enhance Delivery of Antisense Oligonucleotides In Vitro and in Dystrophic mdx Mice

PubMed Central

Wang, Mingxing; Wu, Bo; Tucker, Jason D; Bollinger, Lauren E; Lu, Peijuan; Lu, Qilong

2016-01-01

A series of poly(esteramine)s (PEAs) constructed from low molecular weight polyethyleneimine (LPEI) and Pluronic were evaluated for the delivery of antisense oligonuclotides (AOs), 2′-O-methyl phosphorothioate RNA (2′-OMePS) and phosphorodiamidate morpholino oligomer (PMO) in cell culture and dystrophic mdx mice. Improved exon-skipping efficiency of both 2′-OMePS and PMO was observed in the C2C12E50 cell line with all PEA polymers compared with PEI 25k or LF-2k. The degree of efficiency was found in the order of PEA 01, PEA 04 > PEA 05 > others. The in vivo study in mdx mice demonstrated enhanced exon-skipping of 2′-OMePS with the order of PEA 06 > PEA 04, PEA 07 > PEA 03 > PEA 01 > others, and much higher than PEI 25k formulated 2′-OMePS. Exon-skipping efficiency of PMO in formulation with the PEAs were significantly enhanced in the order of PEA 02 > PEA 10 > PEA 01, PEA 03 > PEA 05, PEA 07, PEA 08 > others, with PEA 02 reaching fourfold of Endo-porter formulated PMO. PEAs improve PMO delivery more effectively than 2′-OMePS delivery in vivo, and the systemic delivery evaluation further highlight the efficiency of PEA for PMO delivery in all skeletal muscle. The results suggest that the flexibility of PEA polymers could be explored for delivery of different AO chemistries, especially for antisense therapy. PMID:27483024

Nonparametric Multiple Imputation for Questionnaires with Individual Skip Patterns and Constraints: The Case of Income Imputation in The National Educational Panel Study

ERIC Educational Resources Information Center

Aßmann, Christian; Würbach, Ariane; Goßmann, Solange; Geissler, Ferdinand; Bela, Anika

2017-01-01

Large-scale surveys typically exhibit data structures characterized by rich mutual dependencies between surveyed variables and individual-specific skip patterns. Despite high efforts in fieldwork and questionnaire design, missing values inevitably occur. One approach for handling missing values is to provide multiply imputed data sets, thus…

School Breakfast-Club Program Changes and Youth Eating Breakfast during the School Week in the COMPASS Study

ERIC Educational Resources Information Center

Leatherdale, Scott T.; Stefanczyk, Jennifer M.; Kirkpatrick, Sharon I.

2016-01-01

Background: Despite the importance of breakfast consumption, breakfast skipping is common among Canadian youth. This study examines how changes to school-based breakfast programs are associated with breakfast-skipping behavior. Methods: Using school-level longitudinal data from Year 1 (Y[subscript 1]: 2012-2013) and Year 2 (Y[subscript 2]:…

Do breakfast skipping and breakfast type affect energy intake, nutrient intake, nutrient adequacy, and diet quality in young adults? NHANES 1999-2002

USDA-ARS?s Scientific Manuscript database

The objective of this study was to assess the impact of breakfast skipping and type of breakfast consumed on energy/nutrient intake, nutrient adequacy, and diet quality using a cross-sectional design. The setting was The National Health and Nutrition Examination Survey (NHANES), 1999-2002. The sub...

The relationship of breakfast skipping and type of breakfast consumed with overweight/obesity, abdominal obesity, other cardiometabolic risk factors and the metabolic syndrome in young adults. NHANES 1999-2006

USDA-ARS?s Scientific Manuscript database

The goal of this study was to examine the association between breakfast skipping and type of breakfast consumed with overweight /obesity, abdominal obesity, other cardiometabolic risk factors and the metabolic syndrome. Three breakfast groups were identified (breakfast skippers, ready-to-eat-cereal ...

Variation in Student Skipping: A Study of Six High Schools. Final Report.

ERIC Educational Resources Information Center

Duckworth, Kenneth; deJung, John

Data were obtained from six high schools in the Northwest during 1984 and 1985 to determine the variation in students' reports of the frequency with which they skip school and cut classes. The study was guided by the advice of school administrators and a theoretical model of the influences or levels of participation in work organizations. Evidence…

The Indirect Effect of Alcohol Use on GPA in First-Semester College Students: The Mediating Role of Academic Effort

ERIC Educational Resources Information Center

Conway, James M.; DiPlacido, Joanne

2015-01-01

This study focused on first-semester college students, investigating (a) indirect effects of aggregate alcohol use on grade point average (GPA) through academic effort (skipping class and time on schoolwork) and (b) daily effects of alcohol use on reduced effort. Eighty students reported daily alcohol use and academic effort (skipping class and…

Cal OES Internet Home Cal OES Home

Science.gov Websites

Sign In You may be trying to access this site from a secured browser on the server. Please enable scripts and reload this page. Turn on more accessible mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn on Animations image of CA.gov logo image of Cal OES

Translational and regulatory challenges for exon skipping therapies.

PubMed

Aartsma-Rus, Annemieke; Ferlini, Alessandra; Goemans, Nathalie; Pasmooij, Anna M G; Wells, Dominic J; Bushby, Katerine; Vroom, Elizabeth; Balabanov, Pavel

2014-10-01

Several translational challenges are currently impeding the therapeutic development of antisense-mediated exon skipping approaches for rare diseases. Some of these are inherent to developing therapies for rare diseases, such as small patient numbers and limited information on natural history and interpretation of appropriate clinical outcome measures. Others are inherent to the antisense oligonucleotide (AON)-mediated exon skipping approach, which employs small modified DNA or RNA molecules to manipulate the splicing process. This is a new approach and only limited information is available on long-term safety and toxicity for most AON chemistries. Furthermore, AONs often act in a mutation-specific manner, in which case multiple AONs have to be developed for a single disease. A workshop focusing on preclinical development, trial design, outcome measures, and different forms of marketing authorization was organized by the regulatory models and biochemical outcome measures working groups of Cooperation of Science and Technology Action: "Networking towards clinical application of antisense-mediated exon skipping for rare diseases." The workshop included participants from patient organizations, academia, and members of staff from the European Medicine Agency and Medicine Evaluation Board (the Netherlands). This statement article contains the key outcomes of this meeting.

Ecological and economical efficiency of monitoring systems for oil and gas production on the shelf

NASA Astrophysics Data System (ADS)

Kurakin, A. L.; Lobkovsky, L. I.

2014-02-01

Requirements for signals' reliability of monitoring systems (with respect to the errors of the 1st and 2nd kinds, i.e., false alarms and skipping of danger) are deduced from the ratio of expenditures of different kinds (of exploitation expenses and losses due to accidents). The expressions obtained in the research may be used for economic foundations (and optimization) of specifications for monitoring systems. In cases when optimal parameters are not available, the sufficient condition of monitoring systems economical efficiency is presented.

Investigation of impact of post-metallization annealing on reliability of 65 nm NOR floating-gate flash memories

NASA Astrophysics Data System (ADS)

Chiu, Shengfen; Xu, Yue; Ji, Xiaoli; Yan, Feng

2016-12-01

This paper investigates the impact of post-metallization annealing (PMA) in pure nitrogen ambient on the reliability of 65 nm NOR-type floating-gate flash memory devices. The experimental results show that, with PMA process, the cycling performance of flash cells, especially for the erasing speed is obviously degraded compared to that without PMA. It is found that the bulk oxide traps and tunnel oxide/Si interface traps are significantly increased with PMA treatment. The water/moisture residues left in the interlayer dielectric layers diffuse to tunnel oxide during PMA process is considered to be responsible for these traps generation, which further enhances the degradation of erase performance. Skipping PMA treatment is proposed to suppress the water diffusion effect on erase performance degradation of flash cells.

Deep learning meets ontologies: experiments to anchor the cardiovascular disease ontology in the biomedical literature.

PubMed

Arguello Casteleiro, Mercedes; Demetriou, George; Read, Warren; Fernandez Prieto, Maria Jesus; Maroto, Nava; Maseda Fernandez, Diego; Nenadic, Goran; Klein, Julie; Keane, John; Stevens, Robert

2018-04-12

Automatic identification of term variants or acceptable alternative free-text terms for gene and protein names from the millions of biomedical publications is a challenging task. Ontologies, such as the Cardiovascular Disease Ontology (CVDO), capture domain knowledge in a computational form and can provide context for gene/protein names as written in the literature. This study investigates: 1) if word embeddings from Deep Learning algorithms can provide a list of term variants for a given gene/protein of interest; and 2) if biological knowledge from the CVDO can improve such a list without modifying the word embeddings created. We have manually annotated 105 gene/protein names from 25 PubMed titles/abstracts and mapped them to 79 unique UniProtKB entries corresponding to gene and protein classes from the CVDO. Using more than 14 M PubMed articles (titles and available abstracts), word embeddings were generated with CBOW and Skip-gram. We setup two experiments for a synonym detection task, each with four raters, and 3672 pairs of terms (target term and candidate term) from the word embeddings created. For Experiment I, the target terms for 64 UniProtKB entries were those that appear in the titles/abstracts; Experiment II involves 63 UniProtKB entries and the target terms are a combination of terms from PubMed titles/abstracts with terms (i.e. increased context) from the CVDO protein class expressions and labels. In Experiment I, Skip-gram finds term variants (full and/or partial) for 89% of the 64 UniProtKB entries, while CBOW finds term variants for 67%. In Experiment II (with the aid of the CVDO), Skip-gram finds term variants for 95% of the 63 UniProtKB entries, while CBOW finds term variants for 78%. Combining the results of both experiments, Skip-gram finds term variants for 97% of the 79 UniProtKB entries, while CBOW finds term variants for 81%. This study shows performance improvements for both CBOW and Skip-gram on a gene/protein synonym detection task by adding knowledge formalised in the CVDO and without modifying the word embeddings created. Hence, the CVDO supplies context that is effective in inducing term variability for both CBOW and Skip-gram while reducing ambiguity. Skip-gram outperforms CBOW and finds more pertinent term variants for gene/protein names annotated from the scientific literature.

Effect of Bearing Defects

DTIC Science & Technology

1974-12-01

defect types were tested at various levels: Comet- Tail, Dig-Nick, Dirt Brinell, Grind-Skip Lines, Impingement, Orange Peel , Pit, Scratch and "Liney...Shallow irregular indentation of surface. <.0015 max. dim. -(<.0008)*’ Otange Peel Pebbly appearance of raceway surface. Small ** Comet Tail Pit...scratch; dig-nick; impingement; grind-skip lines; and orange peel . The data obtained indicated that these defects in most cases, affected bearing

40 CFR 60.483-2a - Alternative standards for valves-skip period leak detection and repair.

Code of Federal Regulations, 2012 CFR

2012-07-01

.../vapor and light liquid service. (4) If the percent of valves leaking is greater than 2.0, the owner or... Industry for Which Construction, Reconstruction, or Modification Commenced After November 7, 2006 § 60.483... percent of valves leaking equal to or less than 2.0, an owner or operator may begin to skip 1 of the...

40 CFR 60.483-2a - Alternative standards for valves-skip period leak detection and repair.

Code of Federal Regulations, 2014 CFR

2014-07-01

.../vapor and light liquid service. (4) If the percent of valves leaking is greater than 2.0, the owner or... Industry for Which Construction, Reconstruction, or Modification Commenced After November 7, 2006 § 60.483... percent of valves leaking equal to or less than 2.0, an owner or operator may begin to skip 1 of the...

40 CFR 60.483-2a - Alternative standards for valves-skip period leak detection and repair.

Code of Federal Regulations, 2011 CFR

2011-07-01

.../vapor and light liquid service. (4) If the percent of valves leaking is greater than 2.0, the owner or... Industry for Which Construction, Reconstruction, or Modification Commenced After November 7, 2006 § 60.483... percent of valves leaking equal to or less than 2.0, an owner or operator may begin to skip 1 of the...

40 CFR 60.483-2a - Alternative standards for valves-skip period leak detection and repair.

Code of Federal Regulations, 2013 CFR

2013-07-01

.../vapor and light liquid service. (4) If the percent of valves leaking is greater than 2.0, the owner or... Industry for Which Construction, Reconstruction, or Modification Commenced After November 7, 2006 § 60.483... percent of valves leaking equal to or less than 2.0, an owner or operator may begin to skip 1 of the...

40 CFR 60.483-2a - Alternative standards for valves-skip period leak detection and repair.

Code of Federal Regulations, 2010 CFR

2010-07-01

.../vapor and light liquid service. (4) If the percent of valves leaking is greater than 2.0, the owner or... Industry for Which Construction, Reconstruction, or Modification Commenced After November 7, 2006 § 60.483... percent of valves leaking equal to or less than 2.0, an owner or operator may begin to skip 1 of the...

The Effect of High- and Low-Frequency Previews and Sentential Fit on Word Skipping during Reading

ERIC Educational Resources Information Center

Angele, Bernhard; Laishley, Abby E.; Rayner, Keith; Liversedge, Simon P.

2014-01-01

In a previous gaze-contingent boundary experiment, Angele and Rayner (2013) found that readers are likely to skip a word that appears to be the definite article "the" even when syntactic constraints do not allow for articles to occur in that position. In the present study, we investigated whether the word frequency of the preview of a…

Dystrophin quantification and clinical correlations in Becker muscular dystrophy: implications for clinical trials.

PubMed

Anthony, Karen; Cirak, Sebahattin; Torelli, Silvia; Tasca, Giorgio; Feng, Lucy; Arechavala-Gomeza, Virginia; Armaroli, Annarita; Guglieri, Michela; Straathof, Chiara S; Verschuuren, Jan J; Aartsma-Rus, Annemieke; Helderman-van den Enden, Paula; Bushby, Katherine; Straub, Volker; Sewry, Caroline; Ferlini, Alessandra; Ricci, Enzo; Morgan, Jennifer E; Muntoni, Francesco

2011-12-01

Duchenne muscular dystrophy is caused by mutations in the DMD gene that disrupt the open reading frame and prevent the full translation of its protein product, dystrophin. Restoration of the open reading frame and dystrophin production can be achieved by exon skipping using antisense oligonucleotides targeted to splicing elements. This approach aims to transform the Duchenne muscular dystrophy phenotype to that of the milder disorder, Becker muscular dystrophy, typically caused by in-frame dystrophin deletions that allow the production of an internally deleted but partially functional dystrophin. There is ongoing debate regarding the functional properties of the different internally deleted dystrophins produced by exon skipping for different mutations; more insight would be valuable to improve and better predict the outcome of exon skipping clinical trials. To this end, we have characterized the clinical phenotype of 17 patients with Becker muscular dystrophy harbouring in-frame deletions relevant to on-going or planned exon skipping clinical trials for Duchenne muscular dystrophy and correlated it to the levels of dystrophin, and dystrophin-associated protein expression. The cohort of 17 patients, selected exclusively on the basis of their genotype, included 4 asymptomatic, 12 mild and 1 severe patient. All patients had dystrophin levels of >40% of control and significantly higher dystrophin (P = 0.013), β-dystroglycan (P = 0.025) and neuronal nitric oxide synthase (P = 0.034) expression was observed in asymptomatic individuals versus symptomatic patients with Becker muscular dystrophy. Furthermore, grouping the patients by deletion, patients with Becker muscular dystrophy with deletions with an end-point of exon 51 (the skipping of which could rescue the largest group of Duchenne muscular dystrophy deletions) showed significantly higher dystrophin levels (P = 0.034) than those with deletions ending with exon 53. This is the first quantitative study on both dystrophin and dystrophin-associated protein expression in patients with Becker muscular dystrophy with deletions relevant for on-going exon skipping trials in Duchenne muscular dystrophy. Taken together, our results indicate that all varieties of internally deleted dystrophin assessed in this study have the functional capability to provide a substantial clinical benefit to patients with Duchenne muscular dystrophy.

Dystrophin quantification and clinical correlations in Becker muscular dystrophy: implications for clinical trials

PubMed Central

Anthony, Karen; Cirak, Sebahattin; Torelli, Silvia; Tasca, Giorgio; Feng, Lucy; Arechavala-Gomeza, Virginia; Armaroli, Annarita; Guglieri, Michela; Straathof, Chiara S.; Verschuuren, Jan J.; Aartsma-Rus, Annemieke; Helderman-van den Enden, Paula; Bushby, Katherine; Straub, Volker; Sewry, Caroline; Ferlini, Alessandra; Ricci, Enzo; Morgan, Jennifer E.

2011-01-01

Duchenne muscular dystrophy is caused by mutations in the DMD gene that disrupt the open reading frame and prevent the full translation of its protein product, dystrophin. Restoration of the open reading frame and dystrophin production can be achieved by exon skipping using antisense oligonucleotides targeted to splicing elements. This approach aims to transform the Duchenne muscular dystrophy phenotype to that of the milder disorder, Becker muscular dystrophy, typically caused by in-frame dystrophin deletions that allow the production of an internally deleted but partially functional dystrophin. There is ongoing debate regarding the functional properties of the different internally deleted dystrophins produced by exon skipping for different mutations; more insight would be valuable to improve and better predict the outcome of exon skipping clinical trials. To this end, we have characterized the clinical phenotype of 17 patients with Becker muscular dystrophy harbouring in-frame deletions relevant to on-going or planned exon skipping clinical trials for Duchenne muscular dystrophy and correlated it to the levels of dystrophin, and dystrophin-associated protein expression. The cohort of 17 patients, selected exclusively on the basis of their genotype, included 4 asymptomatic, 12 mild and 1 severe patient. All patients had dystrophin levels of >40% of control and significantly higher dystrophin (P = 0.013), β-dystroglycan (P = 0.025) and neuronal nitric oxide synthase (P = 0.034) expression was observed in asymptomatic individuals versus symptomatic patients with Becker muscular dystrophy. Furthermore, grouping the patients by deletion, patients with Becker muscular dystrophy with deletions with an end-point of exon 51 (the skipping of which could rescue the largest group of Duchenne muscular dystrophy deletions) showed significantly higher dystrophin levels (P = 0.034) than those with deletions ending with exon 53. This is the first quantitative study on both dystrophin and dystrophin-associated protein expression in patients with Becker muscular dystrophy with deletions relevant for on-going exon skipping trials in Duchenne muscular dystrophy. Taken together, our results indicate that all varieties of internally deleted dystrophin assessed in this study have the functional capability to provide a substantial clinical benefit to patients with Duchenne muscular dystrophy. PMID:22102647

Restoring Dystrophin Expression in Duchenne Muscular Dystrophy Muscle

PubMed Central

Hoffman, Eric P.; Bronson, Abby; Levin, Arthur A.; Takeda, Shin'ichi; Yokota, Toshifumi; Baudy, Andreas R.; Connor, Edward M.

2011-01-01

The identification of the Duchenne muscular dystrophy gene and protein in the late 1980s led to high hopes of rapid translation to molecular therapeutics. These hopes were fueled by early reports of delivering new functional genes to dystrophic muscle in mouse models using gene therapy and stem cell transplantation. However, significant barriers have thwarted translation of these approaches to true therapies, including insufficient therapeutic material (eg, cells and viral vectors), challenges in systemic delivery, and immunological hurdles. An alternative approach is to repair the patient's own gene. Two innovative small-molecule approaches have emerged as front-line molecular therapeutics: exon skipping and stop codon read through. Both approaches are in human clinical trials and aim to coax dystrophin protein production from otherwise inactive mutant genes. In the clinically severe dog model of Duchenne muscular dystrophy, the exon-skipping approach recently improved multiple functional outcomes. We discuss the status of these two methods aimed at inducing de novo dystrophin production from mutant genes and review implications for other disorders. PMID:21703390

PMO Delivery System Using Bubble Liposomes and Ultrasound Exposure for Duchenne Muscular Dystrophy Treatment.

PubMed

Negishi, Yoichi; Ishii, Yuko; Nirasawa, Kei; Sasaki, Eri; Endo-Takahashi, Yoko; Suzuki, Ryo; Maruyama, Kazuo

2018-01-01

Duchenne muscular dystrophy (DMD) is a genetic disorder characterized by progressive muscle degeneration, caused by nonsense or frameshift mutations in the dystrophin (DMD) gene. Antisense oligonucleotides can be used to induce specific exon skipping; recently, a phosphorodiamidate morpholino oligomer (PMO) has been approved for clinical use in DMD. However, an efficient PMO delivery strategy is required to improve the therapeutic efficacy in DMD patients. We previously developed polyethylene glycol (PEG)-modified liposomes containing ultrasound contrast gas, "Bubble liposomes" (BLs), and found that the combination of BLs with ultrasound exposure is a useful gene delivery tool. Here, we describe an efficient PMO delivery strategy using the combination of BLs and ultrasound exposure to treat muscles in a DMD mouse model (mdx). This ultrasound-mediated BL technique can increase the PMO-mediated exon-skipping efficiency, leading to significantly increased dystrophin expression. Thus, the combination of BLs and ultrasound exposure may be a feasible PMO delivery method to improve therapeutic efficacy and reduce the PMO dosage for DMD treatment.

Abuse and diversion of buprenorphine sublingual tablets and film.

PubMed

Lavonas, Eric J; Severtson, S Geoffrey; Martinez, Erin M; Bucher-Bartelson, Becki; Le Lait, Marie-Claire; Green, Jody L; Murrelle, Lenn E; Cicero, Theodore J; Kurtz, Steven P; Rosenblum, Andrew; Surratt, Hilary L; Dart, Richard C

2014-07-01

Buprenorphine abuse is common worldwide. Rates of abuse and diversion of three sublingual buprenorphine formulations (single ingredient tablets; naloxone combination tablets and film) were compared. Data were obtained from the Researched Abuse, Diversion, and Addiction-Related Surveillance (RADARS) System Poison Center, Drug Diversion, Opioid Treatment (OTP), Survey of Key Informants' Patients (SKIP), and College Survey Programs through December 2012. To control for drug availability, event ratios (rates) were calculated quarterly, based on the number of patients filling prescriptions for each formulation ("unique recipients of a dispensed drug," URDD) and averaged and compared using negative binomial regression. Abuse rates in the OTP, SKIP, and College Survey Programs were greatest for single ingredient tablets, and abuse rates in the Poison Center Program and illicit diversion rates were greatest for the combination tablets. Combination film rates were significantly less than rates for either tablet formulation in all programs. No geographic pattern could be discerned. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Fuzzy physical programming for Space Manoeuvre Vehicles trajectory optimization based on hp-adaptive pseudospectral method

NASA Astrophysics Data System (ADS)

Chai, Runqi; Savvaris, Al; Tsourdos, Antonios

2016-06-01

In this paper, a fuzzy physical programming (FPP) method has been introduced for solving multi-objective Space Manoeuvre Vehicles (SMV) skip trajectory optimization problem based on hp-adaptive pseudospectral methods. The dynamic model of SMV is elaborated and then, by employing hp-adaptive pseudospectral methods, the problem has been transformed to nonlinear programming (NLP) problem. According to the mission requirements, the solutions were calculated for each single-objective scenario. To get a compromised solution for each target, the fuzzy physical programming (FPP) model is proposed. The preference function is established with considering the fuzzy factor of the system such that a proper compromised trajectory can be acquired. In addition, the NSGA-II is tested to obtain the Pareto-optimal solution set and verify the Pareto optimality of the FPP solution. Simulation results indicate that the proposed method is effective and feasible in terms of dealing with the multi-objective skip trajectory optimization for the SMV.

Coordination of Word Recognition and Oculomotor Control During Reading: The Role of Implicit Lexical Decisions

PubMed Central

Choi, Wonil; Gordon, Peter C.

2013-01-01

The coordination of word-recognition and oculomotor processes during reading was evaluated in two eye-tracking experiments that examined how word skipping, where a word is not fixated during first-pass reading, is affected by the lexical status of a letter string in the parafovea and ease of recognizing that string. Ease of lexical recognition was manipulated through target-word frequency (Experiment 1) and through repetition priming between prime-target pairs embedded in a sentence (Experiment 2). Using the gaze-contingent boundary technique the target word appeared in the parafovea either with full preview or with transposed-letter (TL) preview. The TL preview strings were nonwords in Experiment 1 (e.g., bilnk created from the target blink), but were words in Experiment 2 (e.g., sacred created from the target scared). Experiment 1 showed greater skipping for high-frequency than low-frequency target words in the full preview condition but not in the TL preview (nonword) condition. Experiment 2 showed greater skipping for target words that repeated an earlier prime word than for those that did not, with this repetition priming occurring both with preview of the full target and with preview of the target’s TL neighbor word. However, time to progress from the word after the target was greater following skips of the TL preview word, whose meaning was anomalous in the sentence context, than following skips of the full preview word whose meaning fit sensibly into the sentence context. Together, the results support the idea that coordination between word-recognition and oculomotor processes occurs at the level of implicit lexical decisions. PMID:23106372

Ultrasonic multi-skip tomography for pipe inspection

NASA Astrophysics Data System (ADS)

Volker, Arno; Vos, Rik; Hunter, Alan; Lorenz, Maarten

2012-05-01

The inspection of wall loss corrosion is difficult at pipe support locations due to limited accessibility. However, the recently developed ultrasonic Multi-Skip screening technique is suitable for this problem. The method employs ultrasonic transducers in a pitch-catch geometry positioned on opposite sides of the pipe support. Shear waves are transmitted in the axial direction within the pipe wall, reflecting multiple times between the inner and outer surfaces before reaching the receivers. Along this path, the signals accumulate information on the integral wall thickness (e.g., via variations in travel time). The method is very sensitive in detecting the presence of wall loss, but it is difficult to quantify both the extent and depth of the loss. If the extent is unknown, then only a conservative estimate of the depth can be made due to the cumulative nature of the travel time variations. Multi-Skip tomography is an extension of Multi-Skip screening and has shown promise as a complimentary follow-up inspection technique. In recent work, we have developed the technique and demonstrated its use for reconstructing high-resolution estimates of pipe wall thickness profiles. The method operates via a model-based full wave field inversion; this consists of a forward model for predicting the measured wave field and an iterative process that compares the predicted and measured wave fields and minimizes the differences with respect to the model parameters (i.e., the wall thickness profile). This paper presents our recent developments in Multi-Skip tomographic inversion, focusing on the initial localization of corrosion regions for efficient parameterization of the surface profile model and utilization of the signal phase information for improving resolution.

Dispelling the myth of "smart drugs": cannabis and alcohol use problems predict nonmedical use of prescription stimulants for studying.

PubMed

Arria, Amelia M; Wilcox, Holly C; Caldeira, Kimberly M; Vincent, Kathryn B; Garnier-Dykstra, Laura M; O'Grady, Kevin E

2013-03-01

This study tested the hypothesis that college students' substance use problems would predict increases in skipping classes and declining academic performance, and that nonmedical use of prescription stimulants (NPS) for studying would occur in association with this decline. A cohort of 984 students in the College Life Study at a large public university in the US participated in a longitudinal prospective study. Interviewers assessed NPS; Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV) cannabis and alcohol use disorders; and frequency of skipping class. Semester grade point average (GPA) was obtained from the university. Control variables were race, sex, family income, high school GPA, and self-reported attention deficit hyperactivity disorder diagnosis. Longitudinal growth curve modeling of four annual data waves estimated the associations among the rates of change of cannabis use disorder, percentage of classes skipped, and semester GPA. The associations between these trajectories and NPS for studying were then evaluated. A second structural model substituted alcohol use disorder for cannabis use disorder. More than one-third (38%) reported NPS for studying at least once by Year 4. Increases in skipping class were associated with both alcohol and cannabis use disorder, which were associated with declining GPA. The hypothesized relationships between these trajectories and NPS for studying were confirmed. These longitudinal findings suggest that escalation of substance use problems during college is related to increases in skipping class and to declining academic performance. NPS for studying is associated with academic difficulties. Although additional research is needed to investigate causal pathways, these results suggest that nonmedical users of prescription stimulants could benefit from a comprehensive drug and alcohol assessment to possibly mitigate future academic declines. Copyright © 2012 Elsevier Ltd. All rights reserved.

Basal exon skipping and nonsense-associated altered splicing allows bypassing complete CEP290 loss-of-function in individuals with unusually mild retinal disease.

PubMed

Barny, Iris; Perrault, Isabelle; Michel, Christel; Soussan, Mickael; Goudin, Nicolas; Rio, Marlène; Thomas, Sophie; Attié-Bitach, Tania; Hamel, Christian; Dollfus, Hélène; Kaplan, Josseline; Rozet, Jean-Michel; Gerard, Xavier

2018-05-16

CEP290 mutations cause a spectrum of ciliopathies from Leber congenital amaurosis type 10 (LCA10) to embryo-lethal Meckel syndrome (MKS). Using panel-based molecular diagnosis testing for inherited retinal diseases, we identified two individuals with some preserved vision despite biallelism for presumably truncating CEP290 mutations. The first one carried a homozygous 1 base-pair deletion in exon 17, introducing a premature termination codon (PTC) in exon 18 (c.1666del; p.Ile556Phefs*17). mRNA analysis revealed a basal exon skipping (BES) of exon 18, providing mutant cells with the ability to escape protein truncation, while disrupting the reading frame in controls. The second individual harbored compound heterozygous nonsense mutations in exon 8 (c.508A>T, p.Lys170*) and exon 32 (c.4090G>T, p.Glu1364*), respectively. Some CEP290 lacking exon 8 were detected in mutant fibroblasts but not in controls whereas some skipping of exon 32 occurred in both lines, but with higher amplitude in the mutant. Considering that the deletion of either exon maintains the reading frame in either line, skipping in mutant cells likely involves nonsense-associated altered splicing (NAS) alone (exon 8), or with BES (exon 32). Skipping of PTC-containing exons in mutant cells allowed production of CEP290 isoforms with preserved ability to assemble into a high molecular weight complex and to interact efficiently with proteins important for cilia formation and intraflagellar trafficking. In contrast, studying LCA10 and MKS fibroblasts we show moderate to severe cilia alterations, providing support for a correlation between disease severity and the ability of cells to express shortened, yet functional, CEP290 isoforms.

Antisense oligonucleotide-induced alternative splicing of the APOB mRNA generates a novel isoform of APOB.

PubMed

Khoo, Bernard; Roca, Xavier; Chew, Shern L; Krainer, Adrian R

2007-01-17

Apolipoprotein B (APOB) is an integral part of the LDL, VLDL, IDL, Lp(a) and chylomicron lipoprotein particles. The APOB pre-mRNA consists of 29 constitutively-spliced exons. APOB exists as two natural isoforms: the full-length APOB100 isoform, assembled into LDL, VLDL, IDL and Lp(a) and secreted by the liver in humans; and the C-terminally truncated APOB48, assembled into chylomicrons and secreted by the intestine in humans. Down-regulation of APOB100 is a potential therapy to lower circulating LDL and cholesterol levels. We investigated the ability of 2'O-methyl RNA antisense oligonucleotides (ASOs) to induce the skipping of exon 27 in endogenous APOB mRNA in HepG2 cells. These ASOs are directed towards the 5' and 3' splice-sites of exon 27, the branch-point sequence (BPS) of intron 26-27 and several predicted exonic splicing enhancers within exon 27. ASOs targeting either the 5' or 3' splice-site, in combination with the BPS, are the most effective. The splicing of other alternatively spliced genes are not influenced by these ASOs, suggesting that the effects seen are not due to non-specific changes in alternative splicing. The skip 27 mRNA is translated into a truncated isoform, APOB87SKIP27. The induction of APOB87SKIP27 expression in vivo should lead to decreased LDL and cholesterol levels, by analogy to patients with hypobetalipoproteinemia. As intestinal APOB mRNA editing and APOB48 expression rely on sequences within exon 26, exon 27 skipping should not affect APOB48 expression unlike other methods of down-regulating APOB100 expression which also down-regulate APOB48.

Orion Entry Handling Qualities Assessments

NASA Technical Reports Server (NTRS)

Bihari, B.; Tiggers, M.; Strahan, A.; Gonzalez, R.; Sullivan, K.; Stephens, J. P.; Hart, J.; Law, H., III; Bilimoria, K.; Bailey, R.

2011-01-01

The Orion Command Module (CM) is a capsule designed to bring crew back from the International Space Station (ISS), the moon and beyond. The atmospheric entry portion of the flight is deigned to be flown in autopilot mode for nominal situations. However, there exists the possibility for the crew to take over manual control in off-nominal situations. In these instances, the spacecraft must meet specific handling qualities criteria. To address these criteria two separate assessments of the Orion CM s entry Handling Qualities (HQ) were conducted at NASA s Johnson Space Center (JSC) using the Cooper-Harper scale (Cooper & Harper, 1969). These assessments were conducted in the summers of 2008 and 2010 using the Advanced NASA Technology Architecture for Exploration Studies (ANTARES) six degree of freedom, high fidelity Guidance, Navigation, and Control (GN&C) simulation. This paper will address the specifics of the handling qualities criteria, the vehicle configuration, the scenarios flown, the simulation background and setup, crew interfaces and displays, piloting techniques, ratings and crew comments, pre- and post-fight briefings, lessons learned and changes made to improve the overall system performance. The data collection tools, methods, data reduction and output reports will also be discussed. The objective of the 2008 entry HQ assessment was to evaluate the handling qualities of the CM during a lunar skip return. A lunar skip entry case was selected because it was considered the most demanding of all bank control scenarios. Even though skip entry is not planned to be flown manually, it was hypothesized that if a pilot could fly the harder skip entry case, then they could also fly a simpler loads managed or ballistic (constant bank rate command) entry scenario. In addition, with the evaluation set-up of multiple tasks within the entry case, handling qualities ratings collected in the evaluation could be used to assess other scenarios such as the constant bank angle maintenance case. The 2008 entry assessment was divided into two sections (see Figure 1). Entry I was the first, high speed portion of a lunar return and Entry II was the second, lower speed portion of a lunar return, which is similar (but not identical) to a typical ISS return.

Analytic Development of a Reference Profile for the First Entry in a Skip Atmospheric Entry

NASA Technical Reports Server (NTRS)

Garcia-Llama, Eduardo

2010-01-01

This note shows that a feasible reference drag profile for the first entry portion of a skip entry can be generated as a polynomial expression of the velocity. The coefficients of that polynomial are found through the resolution of a system composed of m + 1 equations, where m is the degree of the drag polynomial. It has been shown that a minimum of five equations (m = 4) are required to establish the range and the initial and final conditions on velocity and flight path angle. It has been shown that at least one constraint on the trajectory can be imposed through the addition of one extra equation in the system, which must be accompanied by the increase in the degree of the drag polynomial. In order to simplify the resolution of the system of equations, the drag was considered as being a probability density function of the velocity, with the velocity as a distribution function of the drag. Combining this notion with the introduction of empirically derived constants, it has been shown that the system of equations required to generate the drag profile can be successfully reduced to a system of linear algebraic equations. For completeness, the resulting drag profiles have been flown using the feedback linearization method of differential geometric control as a guidance law with the error dynamics of a second order homogeneous equation in the form of a damped oscillator. Satisfactory results were achieved when the gains in the error dynamics were changed at a certain point along the trajectory that is dependent on the velocity and the curvature of the drag as a function of the velocity. Future work should study the capacity to update the drag profile in flight when dispersions are introduced. Also, future studies should attempt to link the first entry, as presented and controlled in this note, with a more standard control concept for the second entry, such as the Apollo entry guidance, to try to assess the overall skip entry performance. A guidance law that includes an integral feedback term, as is the case in the actual Space Shuttle entry guidance and as is proposed in Ref 29, could be tried in future studies to assess whether its use results in an improvement of the tracking performance, and to evaluate the design needs when determining the control gains.

Influence of Skip Patterns on Item Non-Response in a Substance Use Survey of 7th to 12th Grade Students

ERIC Educational Resources Information Center

Ding, Kele; Olds, R. Scott; Thombs, Dennis L.

2009-01-01

This retrospective case study assessed the influence of item non-response error on subsequent response to questionnaire items assessing adolescent alcohol and marijuana use. Post-hoc analyses were conducted on survey results obtained from 4,371 7th to 12th grade students in Ohio in 2005. A skip pattern design in a conventional questionnaire…

Simultaneous Production of Anabaenopeptins and Namalides by the Cyanobacterium Nostoc sp. CENA543.

PubMed

Shishido, Tânia K; Jokela, Jouni; Fewer, David P; Wahlsten, Matti; Fiore, Marli F; Sivonen, Kaarina

2017-11-17

Anabaenopeptins are a diverse group of cyclic peptides, which contain an unusual ureido linkage. Namalides are shorter structural homologues of anabaenopeptins, which also contain an ureido linkage. The biosynthetic origins of namalides are unknown despite a strong resemblance to anabaenopeptins. Here, we show the cyanobacterium Nostoc sp. CENA543 strain producing new (nostamide B-E (2, 4, 5, and 6)) and known variants of anabaenopeptins (schizopeptin 791 (1) and anabaenopeptin 807 (3)). Surprisingly, Nostoc sp. CENA543 also produced namalide B (8) and the new namalides D (7), E (9), and F (10) in similar amounts to anabaenopeptins. Analysis of the complete Nostoc sp. CENA543 genome sequence indicates that both anabaenopeptins and namalides are produced by the same biosynthetic pathway through module skipping during biosynthesis. This unique process involves the skipping of two modules present in different nonribosomal peptide synthetases during the namalide biosynthesis. This skipping is an efficient mechanism since both anabaenopeptins and namalides are synthesized in similar amounts by Nostoc sp. CENA543. Consequently, gene skipping may be used to increase and possibly broaden the chemical diversity of related peptides produced by a single biosynthetic gene cluster. Genome mining demonstrated that the anabaenopeptin gene clusters are widespread in cyanobacteria and can also be found in tectomicrobia bacteria.

Distinct subsets of Eve-positive pericardial cells stabilise cardiac outflow and contribute to Hox gene-triggered heart morphogenesis in Drosophila.

PubMed

Zmojdzian, Monika; de Joussineau, Svetlana; Da Ponte, Jean Philippe; Jagla, Krzysztof

2018-01-17

The Drosophila heart, composed of discrete subsets of cardioblasts and pericardial cells, undergoes Hox-triggered anterior-posterior morphogenesis, leading to a functional subdivision into heart proper and aorta, with its most anterior part forming a funnel-shaped cardiac outflow. Cardioblasts differentiate into Tin-positive 'working myocytes' and Svp-expressing ostial cells. However, developmental fates and functions of heart-associated pericardial cells remain elusive. Here, we show that the pericardial cells that express the transcription factor Even Skipped adopt distinct fates along the anterior-posterior axis. Among them, the most anterior Antp-Ubx-AbdA - negative cells form a novel cardiac outflow component we call the outflow hanging structure, whereas the Antp-expressing cells differentiate into wing heart precursors. Interestingly, Hox gene expression in the Even Skipped-positive cells not only underlies their antero-posterior diversification, but also influences heart morphogenesis in a non-cell-autonomous way. In brief, we identify a new cardiac outflow component derived from a subset of Even Skipped-expressing cells that stabilises the anterior heart tip, and demonstrate non-cell-autonomous effects of Hox gene expression in the Even Skipped-positive cells on heart morphogenesis. © 2018. Published by The Company of Biologists Ltd.

Intron self-complementarity enforces exon inclusion in a yeast pre-mRNA

PubMed Central

Howe, Kenneth James; Ares, Manuel

1997-01-01

Skipping of internal exons during removal of introns from pre-mRNA must be avoided for proper expression of most eukaryotic genes. Despite significant understanding of the mechanics of intron removal, mechanisms that ensure inclusion of internal exons in multi-intron pre-mRNAs remain mysterious. Using a natural two-intron yeast gene, we have identified distinct RNA–RNA complementarities within each intron that prevent exon skipping and ensure inclusion of internal exons. We show that these complementarities are positioned to act as intron identity elements, bringing together only the appropriate 5′ splice sites and branchpoints. Destroying either intron self-complementarity allows exon skipping to occur, and restoring the complementarity using compensatory mutations rescues exon inclusion, indicating that the elements act through formation of RNA secondary structure. Introducing new pairing potential between regions near the 5′ splice site of intron 1 and the branchpoint of intron 2 dramatically enhances exon skipping. Similar elements identified in single intron yeast genes contribute to splicing efficiency. Our results illustrate how intron secondary structure serves to coordinate splice site pairing and enforce exon inclusion. We suggest that similar elements in vertebrate genes could assist in the splicing of very large introns and in the evolution of alternative splicing. PMID:9356473

Regenerative (Regen) ECLSS Operations Water Balance

NASA Technical Reports Server (NTRS)

Tobias, Barry

2010-01-01

In November 2008, the Water Regenerative System racks were launched aboard Space Shuttle flight, STS-126 (ULF2) and installed and activated on the International Space Station (ISS). These racks, consisting of the Water Processor Assembly (WPA) and Urine Processor Assembly (UPA), completed the installation of the Regenerative (Regen) ECLSS systems which includes the Oxygen Generator Assembly (OGA) that was launched 2 years prior. With the onset of active water management on the US segment of the ISS, a new operational concept was required, that of "water balance." Even more recently, in 2010 the Sabatier system came online which converts H2 and CO2 into water and methane. The Regen ECLSS systems accept condensation from the atmosphere, urine from crew, and processes that fluid via various means into potable water which is used for crew drinking, building up skip-cycle water inventory, and water for electrolysis to produce oxygen. Specification rates of crew urine output, condensate output, O2 requirements, toilet flush water and drinking needs are well documented and used as a general plan when Regen ECLSS came online. Spec rates are useful in long term planning, however, daily or weekly rates are dependent on a number of variables. The constantly changing rates created a new challenge for the ECLSS flight controllers, who are responsible for operating the ECLSS systems onboard ISS. This paper will review the various inputs to rate changes and inputs to planning events, including but not limited to; crew personnel makeup, Regen ECLSS system operability, vehicle traffic, water containment availability, and Carbon Dioxide Removal Assembly (CDRA) capability. Along with the inputs that change the various rates, the paper will review the different systems, their constraints and finally the operational means by which flight controllers manage this new challenge of "water balance."

AirLand Battle-Future--A Hop, Skip, or Jump?

DTIC Science & Technology

1990-12-15

degradations to accuracy. Certain families of munitions will become smart and others will become brilliant in terms of their capability to kill a target... WORK UNIT ELEMENT NO. NO. NO. ACCESSION NO. 11. TITLE (Include Security Classification) AirLand Battle Future--A Hop, Skip, or Jump? 12. PERSONAL AUTHOR...leve.. Military tactics have traditionally been, first and foremost, a contest of wills . Any battle, past, present, or future will reveal that moral

Dynamics of Leading-strand Lesion Skipping by the Replisome

PubMed Central

Yeeles, Joseph T.P.; Marians, Kenneth J.

2013-01-01

SUMMARY The E. coli replisome stalls transiently when it encounters a lesion in the leading-strand template, skipping over the damage by reinitiating replication at a new primer synthesized downstream by the primase. We report here that template unwinding and lagging-strand synthesis continue downstream of the lesion at a reduced rate after replisome stalling, that one replisome is capable of skipping multiple lesions, and that the rate limiting steps of replication restart involve the synthesis and activation of the new primer downstream. We also find little support for the concept that polymerase uncoupling, where extensive lagging-strand synthesis proceeds downstream in the absence of leading-strand synthesis, involves physical separation of the leading-strand polymerase from the replisome. Instead, our data indicate that extensive uncoupled replication likely results from a failure of the leading-strand polymerase still associated with the DNA helicase and the lagging-strand polymerase that are proceeding downstream to reinitiate synthesis. PMID:24268579

Evaluation of genetic and metabolic role of SKIP11 in Arabidopsis thaliana

NASA Astrophysics Data System (ADS)

Hassan, Muhammad Naeem ul; Ismail, Ismanizan

2015-09-01

Most of the regulatory proteins are degraded by 26S proteasome complex, only when they are tagged by Ubiquitin. A complex of four proteins, SKP1-Cullin-Ring box-F box (SCF) catalyses the final step to link the Ubiquitin tag with the target proteins. SCF complex interacts with the target proteins through F-box proteins, which confer the overall substrate specificity to the complex. F-box proteins, one of the largest family of proteins in plants have an N-terminal F-box domain and variable C-terminal domains, like leucine-rich repeat, WD-40 repeat and the kelch-repeat domains. In this study, we analysed the role of SKIP11, a kelch containing F-box protein (KFB) from Arabidopsis thaliana, by using reverse genetics strategy. The results show that SKIP11 is involved in the down-regulation of oxylipin pathway, possibly through the degradation of enzymes or/ and the regulatory factors of the pathway.

Accountability: The Most Underappreciated Aspect of Command

DTIC Science & Technology

2012-02-15

1994). Webster, John. "Air Force Hush Job Skips Accountability." The Spokesman-Review. May 25, 1995. http://www.spokesman.com/stories/1995/may/25...air-force- hush -job-skips- accountability/ (accessed December 9, 2011). Wynne, Michael W., Secretary of the Air Force. "Resignation Letter." June 6...used against you in a trial by court-martial except…for perjury, false swearing, or for a false official statement.” 79 John Webster, “Air Force Hush

Effectiveness and Acceptability of Nutrient Solutions in Enhancing Fluid Intake in the Heat

DTIC Science & Technology

1988-11-18

water Placebo - colored, flavored, artificially sweetened solution TEST BEVERAGE - NBC Nutrient Solution Water Other fluids 2.5% fructose...Q) •H fa ACCEPTABILITY OF TEST BEVERAGES control (no natural or artificial sweetener added) with subjects exercised at 400 watts in a climatic...ever drunk beverages with "Nutrasweet" Sweetener in them? ) Yes )No (skip to question 27) |Don’t know (skip to question 27) Page 4 196 o 5590

Defeating Hard and Deeply Buried Targets in 2035

DTIC Science & Technology

2012-02-15

Hafnium Carbide 12.2 33 722 120 3000 Tantalum 16.4 24 680 113 3017 Tantalum Carbide 14.3 28 746 124 3880 Tungsten 19.3 21 550 92 3422 Tungsten ...lethality. Concepts for employing the weapon included “vertical delivery with the bomb detonated at or just outside portal, skip bomb with short fuse (first...or second contact), skip bomb with long fuse (penetrate door, maximize distance down adits [underground facility entrances or passages]), and

An examination of the demographic predictors of adolescent breakfast consumption, content, and context

PubMed Central

2014-01-01

Background Breakfast consumption is important to health; however, adolescents often skip breakfast, and an increased understanding of the breakfast consumption patterns of adolescents is needed. The purpose of this study was to identify the predictors of breakfast eating, including the content and context, in an adolescent sample from Australia and England. Methods Four-hundred and eighty-one students completed an online questionnaire measuring breakfast skipping, and breakfast content (what was eaten) and context (who they ate with, involvement in preparation). Logistic regression was conducted to investigate the predictors of skipping breakfast, breakfast context, and consumption of the ten most commonly consumed foods. Chi-square analyses were used to examine differences in breakfast content according to context. Results Most students (88%) had consumed breakfast on the day of the survey; breakfast skipping was more common in England (18%) than in Australia (8%). Country, gender, socioeconomic status, and body mass index (BMI) were all predictors of breakfast content and context. Whether adolescents ate with others and/or were involved in breakfast preparation predicted the content of breakfast consumed. Conclusions This study provides a comprehensive examination of the factors underlying breakfast consumption (content and context) and has important implications for the development of evidence-based interventions to improve rates of breakfast consumption and the quality of food consumed amongst adolescents. PMID:24645936

Analysis of the functional consequences of targeted exon deletion in COL7A1 reveals prospects for dystrophic epidermolysis bullosa therapy

PubMed Central

Bornert, Olivier; Kühl, Tobias; Bremer, Jeroen; van den Akker, Peter C; Pasmooij, Anna MG; Nyström, Alexander

2016-01-01

Genetically evoked deficiency of collagen VII causes dystrophic epidermolysis bullosa (DEB)—a debilitating disease characterized by chronic skin fragility and progressive fibrosis. Removal of exons carrying frame-disrupting mutations can reinstate protein expression in genetic diseases. The therapeutic potential of this approach is critically dependent on gene, protein, and disease intrinsic factors. Naturally occurring exon skipping in COL7A1, translating collagen VII, suggests that skipping of exons containing disease-causing mutations may be feasible for the treatment of DEB. However, despite a primarily in-frame arrangement of exons in the COL7A1 gene, no general conclusion of the aptitude of exon skipping for DEB can be drawn, since regulation of collagen VII functionality is complex involving folding, intra- and intermolecular interactions. To directly address this, we deleted two conceptually important exons located at both ends of COL7A1, exon 13, containing recurrent mutations, and exon 105, predicted to impact folding. The resulting recombinantly expressed proteins showed conserved functionality in biochemical and in vitro assays. Injected into DEB mice, the proteins promoted skin stability. By demonstrating functionality of internally deleted collagen VII variants, our study provides support of targeted exon deletion or skipping as a potential therapy to treat a large number of individuals with DEB. PMID:27157667

Academic performance, educational aspiration and birth outcomes among adolescent mothers: a national longitudinal study

PubMed Central

2014-01-01

Background Maternal educational attainment has been associated with birth outcomes among adult mothers. However, limited research explores whether academic performance and educational aspiration influence birth outcomes among adolescent mothers. Methods Data from Waves I and IV of the National Longitudinal Study of Adolescent Health (Add Health) were used. Adolescent girls whose first pregnancy occurred after Wave I, during their adolescence, and ended with a singleton live birth were included. Adolescents’ grade point average (GPA), experience of ever skipping a grade and ever repeating a grade, and their aspiration to attend college were examined as predictors of birth outcomes (birthweight and gestational age; n = 763). Univariate statistics, bivariate analyses and multivariable models were run stratified on race using survey procedures. Results Among Black adolescents, those who ever skipped a grade had higher offspring’s birthweight. Among non-Black adolescents, ever skipping a grade and higher educational aspiration were associated with higher offspring’s birthweight; ever skipping a grade was also associated with higher gestational age. GPA was not statistically significantly associated with either birth outcome. The addition of smoking during pregnancy and prenatal care visit into the multivariable models did not change these associations. Conclusions Some indicators of higher academic performance and aspiration are associated with better birth outcomes among adolescents. Investing in improving educational opportunities may improve birth outcomes among teenage mothers. PMID:24422664

Scaling of echolocation call parameters in bats.

PubMed

Jones, G

1999-12-01

I investigated the scaling of echolocation call parameters (frequency, duration and repetition rate) in bats in a functional context. Low-duty-cycle bats operate with search phase cycles of usually less than 20 %. They process echoes in the time domain and are therefore intolerant of pulse-echo overlap. High-duty-cycle (>30 %) species use Doppler shift compensation, and they separate pulse and echo in the frequency domain. Call frequency scales negatively with body mass in at least five bat families. Pulse duration scales positively with mass in low-duty-cycle quasi-constant-frequency (QCF) species because the large aerial-hawking species that emit these signals fly fast in open habitats. They therefore detect distant targets and experience pulse-echo overlap later than do smaller bats. Pulse duration also scales positively with mass in the Hipposideridae, which show at least partial Doppler shift compensation. Pulse repetition rate corresponds closely with wingbeat frequency in QCF bat species that fly relatively slowly. Larger, fast-flying species often skip pulses when detecting distant targets. There is probably a trade-off between call intensity and repetition rate because 'whispering' bats (and hipposiderids) produce several calls per predicted wingbeat and because batches of calls are emitted per wingbeat during terminal buzzes. Severe atmospheric attenuation at high frequencies limits the range of high-frequency calls. Low-duty-cycle bats that call at high frequencies must therefore use short pulses to avoid pulse-echo overlap. Rhinolophids escape this constraint by Doppler shift compensation and, importantly, can exploit advantages associated with the emission of both high-frequency and long-duration calls. Low frequencies are unsuited for the detection of small prey, and low repetition rates may limit prey detection rates. Echolocation parameters may therefore constrain maximum body size in aerial-hawking bats.

Spacecraft Demand Tasking and Skip Entry Responsive Maneuvers

DTIC Science & Technology

2011-06-01

Introduction General Issue Growing in prominence within the policy decisions of the U.S. Department of Defense, the term “responsive space ” represents a...shift from a solution-oriented to a capabilities-oriented approach to space acquisition and space system design, in which the performance of a new...by the development of spacecraft and launch vehicles, an aspect of the responsive space initiative that has garnered increased attention within the

Potential applications of skip SMV with thrust engine

NASA Astrophysics Data System (ADS)

Wang, Weilin; Savvaris, Al

2016-11-01

This paper investigates the potential applications of Space Maneuver Vehicles (SMV) with skip trajectory. Due to soaring space operations over the past decades, the risk of space debris has considerably increased such as collision risks with space asset, human property on ground and even aviation. Many active debris removal methods have been investigated and in this paper, a debris remediation method is first proposed based on skip SMV. The key point is to perform controlled re-entry. These vehicles are expected to achieve a trans-atmospheric maneuver with thrust engine. If debris is released at altitude below 80 km, debris could be captured by the atmosphere drag force and re-entry interface prediction accuracy is improved. Moreover if the debris is released in a cargo at a much lower altitude, this technique protects high value space asset from break up by the atmosphere and improves landing accuracy. To demonstrate the feasibility of this concept, the present paper presents the simulation results for two specific mission profiles: (1) descent to predetermined altitude; (2) descent to predetermined point (altitude, longitude and latitude). The evolutionary collocation method is adopted for skip trajectory optimization due to its global optimality and high-accuracy. This method is actually a two-step optimization approach based on the heuristic algorithm and the collocation method. The optimal-control problem is transformed into a nonlinear programming problem (NLP) which can be efficiently and accurately solved by the sequential quadratic programming (SQP) procedure. However, such a method is sensitive to initial values. To reduce the sensitivity problem, genetic algorithm (GA) is adopted to refine the grids and provide near optimum initial values. By comparing the simulation data from different scenarios, it is found that skip SMV is feasible in active debris removal and the evolutionary collocation method gives a truthful re-entry trajectory that satisfies the path and boundary constraints.

Effects of broiler breeder management on pullet body weight and carcass uniformity.

PubMed

Zuidhof, M J; Holm, D E; Renema, R A; Jalal, M A; Robinson, F E

2015-06-01

An experiment was conducted to study the effect of broiler breeder feeding management practices on pullet performance, BW uniformity, and carcass traits during rearing (to 22 wk of age). At 3 wk of age, 1,200 Ross 308 breeder pullets were assigned to one of 5 treatments: 1) control: standard mash diet, fed daily; 2) high fiber: mash diet containing 25% lower nutrient density, fed daily; 3) scatter: standard diet in pellet form scattered on litter, fed daily; 4) skip-a-day: standard mash diet, fed on alternate days; or 5) grading: standard mash diet, fed daily (birds sorted into low, average, and high BW groups every 4 wk). Birds on the high fiber treatment consumed more feed (P<0.0001) and had the highest feed conversion ratio (FCR; P<0.004) but the lowest ME to gain and CP to gain ratios (P≤0.002). Skip-a-day treatment pullets consumed more ME and CP than birds in any other treatment (P<0.001). Grading yielded the highest BW uniformity at 22 wk of age (CV=6.2%), while control and high fiber treatment groups were least uniform (CV>15%; P<0.0001). Skip-a-day feed restriction produced birds with the significantly lowest breast muscle and highest liver weight compared to all other treatments (P<0.05). Variation in shank length, chest width, and breast muscle was lowest in the grading treatment, whereas the CV for fat pad and liver was lowest in the skip-a-day treatment. In this trial, broiler breeder target BW profiles were achieved using combinations of quantitative and qualitative feed restriction, or preemptive management practices. Qualitative diet dilution and skip-a-day management did little to increase flock uniformity relative to the control during the most intense period of feed restriction (7 to 19 wk). Scatter feeding increased flock uniformity to a small degree, whereas grading yielded the highest increase in BW and carcass trait uniformity. © 2015 Poultry Science Association Inc.

Intron-mediated alternative splicing of Arabidopsis P5CS1 and its association with natural variation in proline and climate adaptation

PubMed Central

Kesari, Ravi; Lasky, Jesse R.; Villamor, Joji Grace; Des Marais, David L.; Chen, Ying-Jiun C.; Liu, Tzu-Wen; Juenger, Thomas E.; Verslues, Paul E.

2012-01-01

Drought-induced proline accumulation is widely observed in plants but its regulation and adaptive value are not as well understood. Proline accumulation of the Arabidopsis accession Shakdara (Sha) was threefold less than that of Landsberg erecta (Ler) and quantitative trait loci mapping identified a reduced function allele of the proline synthesis enzyme Δ1-pyrroline-5-carboxylate synthetase1 (P5CS1) as a basis for the lower proline of Sha. Sha P5CS1 had additional TA repeats in intron 2 and a G-to-T transversion in intron 3 that were sufficient to promote alternative splicing and production of a nonfunctional transcript lacking exon 3 (exon 3-skip P5CS1). In Sha, and additional accessions with the same intron polymorphisms, the nonfunctional exon 3-skip P5CS1 splice variant constituted as much as half of the total P5CS1 transcript. In a larger panel of Arabidopsis accessions, low water potential-induced proline accumulation varied by 10-fold and variable production of exon 3-skip P5CS1 among accessions was an important, but not the sole, factor underlying variation in proline accumulation. Population genetic analyses suggest that P5CS1 may have evolved under positive selection, and more extensive correlation of exon 3-skip P5CS1 production than proline abundance with climate conditions of natural accessions also suggest a role of P5CS1 in local adaptation to the environment. These data identify a unique source of alternative splicing in plants, demonstrate a role of exon 3-skip P5CS1 in natural variation of proline metabolism, and suggest an association of P5CS1 and its alternative splicing with environmental adaptation. PMID:22615385

Comparable clinical and radiological outcomes between skipped-level and all-level plating for open-door laminoplasty.

PubMed

Cheung, Jason Pui Yin; Cheung, Prudence Wing Hang; Cheung, Amy Yim Ling; Lui, Darren; Cheung, Kenneth M C

2018-06-01

To compare the clinical and radiological outcomes between skipped-level and all-level plating for cervical laminoplasty. Patients with cervical spondylotic myelopathy (CSM) treated by open-door laminoplasty with minimum 2-year postoperative follow-up were included. All patients had opening from C3-6 or C3-7 and were divided into skipped-level or all-level plating groups. Japanese Orthopaedic Association (JOA) scores and canal measurements were obtained preoperatively, immediate (within 1 week) postoperatively, and at 2, 6 weeks, 3, 6 and 12 months postoperatively. Paired t test was used for comparative analysis. Receiver operating characteristic analysis was used to determine the canal expansion cutoff for spring-back closure. A total of 74 subjects were included with mean age of 66.1 ± 11.3 years at surgery. Of these, 32 underwent skipped-level plating and 42 underwent all-level plating. No significant differences were noted between the two groups at baseline and follow-up. Spring-back closure was observed in up to 50% of the non-plated levels within 3 months postoperatively. The cutoff for developing spring-back closure was 7 mm canal expansion for C3-6. No differences were observed in JOA scores and recovery rates between the two groups. None of the patients with spring-back required reoperation. There were no significant differences between skipped-level and all-level plating in terms of JOA or recovery rate, and canal diameter differences. This has tremendous impact on saving costs in CSM management as up to two plates per patient undergoing a standard C3-6 laminoplasty may be omitted instead of four plates to every level to achieve similar clinical and radiological outcomes. III. These slides can be retrieved under Electronic Supplementary Material.

The addition of a protein-rich breakfast and its effects on acute appetite control and food intake in 'breakfast-skipping' adolescents.

PubMed

Leidy, H J; Racki, E M

2010-07-01

Breakfast skipping (BS) is closely associated with overeating (in the evening), weight gain and obesity. It is unclear whether the addition of breakfast, with emphasis on dietary protein, leads to better appetite and energy intake regulation in adolescents. The purpose of the study was to examine the impact of addition of a normal-protein (PN) breakfast vs protein-rich (PR) breakfast on appetite and food intake in 'breakfast-skipping' adolescents. A total of 13 adolescents (age 14.3+/-0.3 years; body mass index percentile 79+/-4 percentile; skipped breakfast 5+/-1 x per week) randomly completed 3 testing days that included a PN (18+/-1 g protein), PR (48+/-2 g protein) or BS. Breakfast was 24% of estimated daily energy needs. Appetite, satiety and hormonal responses were collected over 5 h followed by an ad libitum lunch and 24-h food intake assessments. Perceived appetite was not different following PN vs BS; PR led to greater reductions vs BS (P<0.01) and PN (P<0.001). Fullness was greater following both breakfast meals vs BS (P<0.01) but was not different between meals. Ghrelin was not different among treatments. Greater PYY concentrations were observed following both breakfast meals vs BS (P<0.01) but was not different between meals. Lunch energy intake was not different following PN vs BS; PR led to fewer kcal consumed vs BS (P<0.01) and PN (P<0.005). Daily food intake was not different among treatments. Breakfast led to increased satiety through increased fullness and PYY concentrations in 'breakfast skipping' adolescents. A breakfast rich in dietary protein provides additional benefits through reductions in appetite and energy intake. These findings suggest that the addition of a protein-rich breakfast might be an effective strategy to improve appetite control in young people.

A Duchenne Muscular Dystrophy Gene Hot Spot Mutation in Dystrophin-Deficient Cavalier King Charles Spaniels Is Amenable to Exon 51 Skipping

PubMed Central

Walmsley, Gemma L.; Arechavala-Gomeza, Virginia; Fernandez-Fuente, Marta; Burke, Margaret M.; Nagel, Nicole; Holder, Angela; Stanley, Rachael; Chandler, Kate; Marks, Stanley L.; Muntoni, Francesco; Shelton, G. Diane; Piercy, Richard J.

2010-01-01

Background Duchenne muscular dystrophy (DMD), which afflicts 1 in 3500 boys, is one of the most common genetic disorders of children. This fatal degenerative condition is caused by an absence or deficiency of dystrophin in striated muscle. Most affected patients have inherited or spontaneous deletions in the dystrophin gene that disrupt the reading frame resulting in unstable truncated products. For these patients, restoration of the reading frame via antisense oligonucleotide-mediated exon skipping is a promising therapeutic approach. The major DMD deletion “hot spot” is found between exons 45 and 53, and skipping exon 51 in particular is predicted to ameliorate the dystrophic phenotype in the greatest number of patients. Currently the mdx mouse is the most widely used animal model of DMD, although its mild phenotype limits its suitability in clinical trials. The Golden Retriever muscular dystrophy (GRMD) model has a severe phenotype, but due to its large size, is expensive to use. Both these models have mutations in regions of the dystrophin gene distant from the commonly mutated DMD “hot spot”. Methodology/Principal Findings Here we describe the severe phenotype, histopathological findings, and molecular analysis of Cavalier King Charles Spaniels with dystrophin-deficient muscular dystrophy (CKCS-MD). The dogs harbour a missense mutation in the 5′ donor splice site of exon 50 that results in deletion of exon 50 in mRNA transcripts and a predicted premature truncation of the translated protein. Antisense oligonucleotide-mediated skipping of exon 51 in cultured myoblasts from an affected dog restored the reading frame and protein expression. Conclusions/Significance Given the small size of the breed, the amiable temperament and the nature of the mutation, we propose that CKCS-MD is a valuable new model for clinical trials of antisense oligonucleotide-induced exon skipping and other therapeutic approaches for DMD. PMID:20072625

Associations between the use of social networking sites and unhealthy eating behaviours and excess body weight in adolescents.

PubMed

Sampasa-Kanyinga, Hugues; Chaput, Jean-Philippe; Hamilton, Hayley A

2015-12-14

Unhealthy eating behaviour and excess body weight have been related to sedentary behaviour, particularly screen time, in adolescents; however, little is known about their associations with the use of social networking sites (SNS). We investigated the associations between time spent using SNS and unhealthy eating behaviours (including breakfast skipping, consumption of sugar-sweetened beverages (SSB) and energy drinks) and body weight in adolescents. Data on 9858 students (mean age: 15·2 (SD 1·9) years) in grades 7 through 12 were derived from the 2013 cycle of the Ontario Student Drug Use and Health Survey--a cross-sectional school-based survey of middle and high school students. The majority (81·5%) of students reported daily use of SNS and an additional 10·7% reported using them on an irregular basis. Multivariate logistic regression analyses revealed that the use of SNS was associated with increased odds of skipping breakfast (P trend<0·01) and consuming SSB (P trend<0·01) and energy drinks (P trend<0·01) in a dose-response manner with adjustments for age, sex, ethnicity, socio-economic status, tobacco, alcohol and cannabis use as well as BMI. However, there was no evidence of a significant association between use of SNS and BMI before or after adjusting for all the covariates and unhealthy eating behaviours. In conclusion, our results suggest associations between the use of SNS and unhealthy eating behaviours among youth. Given the popularity of SNS, more efforts are needed to better understand the impact of social networks on eating behaviours and risk of excess weight.

Fast DCNN based on FWT, intelligent dropout and layer skipping for image retrieval.

PubMed

ElAdel, Asma; Zaied, Mourad; Amar, Chokri Ben

2017-11-01

Deep Convolutional Neural Network (DCNN) can be marked as a powerful tool for object and image classification and retrieval. However, the training stage of such networks is highly consuming in terms of storage space and time. Also, the optimization is still a challenging subject. In this paper, we propose a fast DCNN based on Fast Wavelet Transform (FWT), intelligent dropout and layer skipping. The proposed approach led to improve the image retrieval accuracy as well as the searching time. This was possible thanks to three key advantages: First, the rapid way to compute the features using FWT. Second, the proposed intelligent dropout method is based on whether or not a unit is efficiently and not randomly selected. Third, it is possible to classify the image using efficient units of earlier layer(s) and skipping all the subsequent hidden layers directly to the output layer. Our experiments were performed on CIFAR-10 and MNIST datasets and the obtained results are very promising. Copyright © 2017 Elsevier Ltd. All rights reserved.

Dynamic ASXL1 Exon Skipping and Alternative Circular Splicing in Single Human Cells

PubMed Central

Natarajan, Sivaraman; Carter, Robert; Brown, Patrick O.

2016-01-01

Circular RNAs comprise a poorly understood new class of noncoding RNA. In this study, we used a combination of targeted deletion, high-resolution splicing detection, and single-cell sequencing to deeply probe ASXL1 circular splicing. We found that efficient circular splicing required the canonical transcriptional start site and inverted AluSx elements. Sequencing-based interrogation of isoforms after ASXL1 overexpression identified promiscuous linear splicing between all exons, with the two most abundant non-canonical linear products skipping the exons that produced the circular isoforms. Single-cell sequencing revealed a strong preference for either the linear or circular ASXL1 isoforms in each cell, and found the predominant exon skipping product is frequently co-expressed with its reciprocal circular isoform. Finally, absolute quantification of ASXL1 isoforms confirmed our findings and suggests that standard methods overestimate circRNA abundance. Taken together, these data reveal a dynamic new view of circRNA genesis, providing additional framework for studying their roles in cellular biology. PMID:27736885

Analogy motor learning by young children: a study of rope skipping.

PubMed

Tse, Andy C Y; Fong, Shirley S M; Wong, Thomson W L; Masters, Rich

2017-03-01

Research in psychology suggests that provision of an instruction by analogy can enhance acquisition and understanding of knowledge. Limited research has been conducted to test this proposition in motor learning by children. The purpose of the present study was to examine the feasibility of analogy instructions in motor skill acquisition by children. Thirty-two children were randomly assigned to one of the two instruction protocols: analogy and explicit instruction protocols for a two-week rope skipping training. Each participant completed a pretest (Lesson 1), three practice sessions (Lesson 2-4), a posttest and a secondary task test (Lesson 5). Children in the analogy protocol displayed better rope skip performance than those in the explicit instruction protocol (p < .001). Moreover, a cognitive secondary task test indicated that children in the analogy protocol performed more effectively, whereas children in the explicit protocol displayed decrements in performance. Analogy learning may aid children to acquire complex motor skills, and have potential benefits related to reduced cognitive processing requirements.

Adaptive and Nonadaptive Training Technology for Small Unmanned Aerial System Employment

DTIC Science & Technology

2012-02-01

to the pretest . They also completed questionnaires on their opinions of the training experience. Findings: The posttest results were inconclusive...until the posttest . For example, for the Pretest condition, lucky correct guesses on the pretest would allow the student to skip relevant didactic...gains by comparing performance on a pretest with that of a posttest . If we used the authentic flow, students in the nonadaptive condition would have to

Visco-acoustic wave-equation traveltime inversion and its sensitivity to attenuation errors

NASA Astrophysics Data System (ADS)

Yu, Han; Chen, Yuqing; Hanafy, Sherif M.; Huang, Jiangping

2018-04-01

A visco-acoustic wave-equation traveltime inversion method is presented that inverts for the shallow subsurface velocity distribution. Similar to the classical wave equation traveltime inversion, this method finds the velocity model that minimizes the squared sum of the traveltime residuals. Even though, wave-equation traveltime inversion can partly avoid the cycle skipping problem, a good initial velocity model is required for the inversion to converge to a reasonable tomogram with different attenuation profiles. When Q model is far away from the real model, the final tomogram is very sensitive to the starting velocity model. Nevertheless, a minor or moderate perturbation of the Q model from the true one does not strongly affect the inversion if the low wavenumber information of the initial velocity model is mostly correct. These claims are validated with numerical tests on both the synthetic and field data sets.

The Association between Breakfast Skipping and Body Weight, Nutrient Intake, and Metabolic Measures among Participants with Metabolic Syndrome

PubMed Central

Zhang, Lijuan; Cordeiro, Lorraine S.; Liu, Jinghua; Ma, Yunsheng

2017-01-01

The effect of skipping breakfast on health, especially in adults, remains a controversial topic. A secondary data analysis was conducted to examine associations between breakfast eating patterns and weight loss, nutrient intake, and metabolic parameters among participants with metabolic syndrome (MetS) (n = 240). Three randomly selected 24-h dietary recalls were collected from each participant at baseline and at the one-year visit. Skipped breakfast was seen in 32.9% at baseline and in 17.4% at the one-year visit, respectively. At baseline, after adjustment for demographics and physical activity, participants who ate breakfast had a higher thiamin, niacin, and folate intake than did breakfast skippers (p < 0.05); other selected parameters including body weight, dietary quality scores, nutrient intake, and metabolic parameters showed no significant differences between the two groups (p ≥ 0.05). From baseline to one year, after adjustment for covariates, mean fat intake increased by 2.7% (95% confidence intervals (CI): −1.0, 6.5%) of total energy in breakfast skippers in comparison to the 1.2% decrease observed in breakfast eaters (95% CI: −3.4, 1.1%) (p = 0.02). Mean changes in other selected parameters showed no significant differences between breakfast skippers and eaters (p > 0.05). This study did not support the hypothesis that skipping breakfast has impact on body weight, nutrient intakes, and selected metabolic measures in participants with MetS. PMID:28420112

Fishing-induced changes in adult length are mediated by skipped-spawning.

PubMed

Wang, Hui-Yu; Chen, Ying-Shiuan; Hsu, Chien-Chung; Shen, Sheng-Feng

2017-01-01

Elucidating fishing effects on fish population dynamics is a critical step toward sustainable fisheries management. Despite previous studies that have suggested age or size truncation in exploited fish populations, other aspects of fishing effects on population demography, e.g., via altering life histories and density, have received less attention. Here, we investigated the fishing effects altering adult demography via shifting reproductive trade-offs in the iconic, overexploited, Pacific bluefin tuna Thunnus orientalis. We found that, contrary to our expectation, mean lengths of catch increased over time in longline fisheries. On the other hand, mean catch lengths for purse seine fisheries did not show such increasing trends. We hypothesized that the size-dependent energetic cost of the spawning migration and elevated fishing mortality on the spawning grounds potentially drive size-dependent skipped spawning for adult tuna, mediating the observed changes in the catch lengths. Using eco-genetic individual-based modeling, we demonstrated that fishing-induced evolution of skipped spawning and size truncation interacted to shape the observed temporal changes in mean catch lengths for tuna. Skipped spawning of the small adults led to increased mean catch lengths for the longline fisheries, while truncation of small adults by the purse seines could offset such a pattern. Our results highlight the eco-evolutionary dynamics of fishing effects on population demography and caution against using demographic traits as a basis for fisheries management of the Pacific bluefin tuna as well as other migratory species. © 2016 by the Ecological Society of America.

Ameliorating pathogenesis by removing an exon containing a missense mutation: a potential exon-skipping therapy for laminopathies.

PubMed

Scharner, J; Figeac, N; Ellis, J A; Zammit, P S

2015-06-01

Exon skipping, as a therapy to restore a reading frame or switch protein isoforms, is under clinical trial. We hypothesised that removing an in-frame exon containing a mutation could also improve pathogenic phenotypes. Our model is laminopathies: incurable tissue-specific degenerative diseases associated with LMNA mutations. LMNA encodes A-type lamins, that together with B-type lamins, form the nuclear lamina. Lamins contain an alpha-helical central rod domain composed of multiple heptad repeats. Eliminating LMNA exon 3 or 5 removes six heptad repeats, so shortens, but should not otherwise significantly alter, the alpha-helix. Human Lamin A or Lamin C with a deletion corresponding to amino acids encoded by exon 5 (Lamin A/C-Δ5) localised normally in murine lmna-null cells, rescuing both nuclear shape and endogenous Lamin B1/emerin distribution. However, Lamin A carrying pathogenic mutations in exon 3 or 5, or Lamin A/C-Δ3, did not. Furthermore, Lamin A/C-Δ5 was not deleterious to wild-type cells, unlike the other Lamin A mutants including Lamin A/C-Δ3. Thus Lamin A/C-Δ5 function as effectively as wild-type Lamin A/C and better than mutant versions. Antisense oligonucleotides skipped LMNA exon 5 in human cells, demonstrating the possibility of treating certain laminopathies with this approach. This proof-of-concept is the first to report the therapeutic potential of exon skipping for diseases arising from missense mutations.

Tradeoffs between physical captures and PIT tag antenna array detections: A case study for the Lower Colorado River Basin population of humpback chub (Gila cypha)

USGS Publications Warehouse

Pearson, Kristen Nicole; Kendall, William L.; Winkelman, Dana L.; Persons, William R.

2016-01-01

A key component of many monitoring programs for special status species involves capture and handling of individuals as part of capture-recapture efforts for tracking population health and demography. Minimizing negative impacts from sampling, such as through reduced handling, aids prevention of negative impacts on species from monitoring efforts. Using simulation analyses, we found that long-term population monitoring techniques, requiring physical capture (i.e. hoop-net sampling), can be reduced and supplemented with passive detections (i.e. PIT tag antenna array detections) without negatively affecting estimates of adult humpback chub (HBC; Gila cypha) survival (S) and skipped spawning probabilities (γ' = spawner transitions to a skipped spawner, γ′ = skipped spawner remains a skipped spawner). Based on our findings of the array’s in situ detection efficiency (0.42), estimability of such demographic parameters would improve over hoop-netting alone. In addition, the array provides insight into HBC population dynamics and movement patterns outside of traditional sampling periods. However, given current timing of sampling efforts, spawner abundance estimates were negatively biased when hoop-netting was reduced, suggesting not all spawning HBC are present during the current sampling events. Despite this, our findings demonstrate that PIT tag antenna arrays, even with moderate potential detectability, may allow for reduced handling of special status species while also offering potentially more efficient monitoring strategies, especially if ideal timing of sampling can be determined.

Skipping Strategy (SS) for Initial Population of Job-Shop Scheduling Problem

NASA Astrophysics Data System (ADS)

Abdolrazzagh-Nezhad, M.; Nababan, E. B.; Sarim, H. M.

2018-03-01

Initial population in job-shop scheduling problem (JSSP) is an essential step to obtain near optimal solution. Techniques used to solve JSSP are computationally demanding. Skipping strategy (SS) is employed to acquire initial population after sequence of job on machine and sequence of operations (expressed in Plates-jobs and mPlates-jobs) are determined. The proposed technique is applied to benchmark datasets and the results are compared to that of other initialization techniques. It is shown that the initial population obtained from the SS approach could generate optimal solution.

Parental functional health literacy relates to skip pattern questionnaire error and to child oral health.

PubMed

Garrett, Gail M; Citi, Alicia M; Gansky, Stuart A

2012-05-01

The study's purpose was to determine if parental dental functional health literacy related to child oral health. A secondary aim was to assess if errors in completing the questionnaire related to FHL and child oral health. Parents of pediatric clinic children (N = 101) completed questionnaires and dental caries indices were recorded. Higher FHL was negatively correlated with worse child caries (r = -0.23), but not subjective oral health. Mean FHL seemed to differ by skip pattern (p = 0.087), indicating it may be a potential FHL proxy.

Proceedings of the Workshop on the Assessment of Crew Workload Measurement Methods, Techniques and Procedures. Volume 2. Library References.

DTIC Science & Technology

1987-06-01

OHIO 45433-6553 0. % NOTICE When Government drawings, specifications, or other data are used for any purpose other than in connection with a definitely...have formulated or in any way supplied the said drawings, specifications, or other data , is not to be regarded by implication, or otherwise in any...Formal Review 2= Informal Review 3= No Reviewer C. Quality of Data (If not 1-3 QUIT) 1= Experiment(s) 2= Case Study(s) 3= Theory/Review (Skip to F.) (Skip

P-Tether-Mediated, Iterative SN2'-Cuprate Alkylation Strategy to Skipped Polyol Stereotetrads: Utility of an Oxidative "Function Switch" with Phosphite-Borane Tethers.

PubMed

Markley, Jana L; Hanson, Paul R

2017-05-19

The development of a P-tether-mediated, iterative S N 2'-cuprate alkylation protocol for the formation of 1,3-skipped polyol stereotetrads is reported. This two-directional synthetic strategy builds molecular complexity from simple, readily prepared C 2 -symmetric dienediols and unites the chemistry of both temporary phosphite-borane tethers and temporary phosphate tethers-through an oxidative "function switch" of the P-tether itself-to generate intermediates that were previously inaccessible via either method alone.

Full-waveform inversion of surface waves in exploration geophysics

NASA Astrophysics Data System (ADS)

Borisov, D.; Gao, F.; Williamson, P.; Tromp, J.

2017-12-01

Full-waveform inversion (FWI) is a data fitting approach to estimate high-resolution properties of the Earth from seismic data by minimizing the misfit between observed and calculated seismograms. In land seismics, the source on the ground generates high-amplitude surface waves, which generally represent most of the energy recorded by ground sensors. Although surface waves are widely used in global seismology and engineering studies, they are typically treated as noise within the seismic exploration community since they mask deeper reflections from the intervals of exploration interest. This is mainly due to the fact that surface waves decay exponentially with depth and for a typical frequency range (≈[5-50] Hz) sample only the very shallow part of the subsurface, but also because they are much more sensitive to S-wave than P-wave velocities. In this study, we invert surface waves in the hope of using them as additional information for updating the near surface. In a heterogeneous medium, the main challenge of surface wave inversion is associated with their dispersive character, which makes it difficult to define a starting model for conventional FWI which can avoid cycle-skipping. The standard approach to dealing with this is by inverting the dispersion curves in the Fourier (f-k) domain to generate locally 1-D models, typically for the shear wavespeeds only. However this requires that the near-surface zone be more or less horizontally invariant over a sufficient distance for the spatial Fourier transform to be applicable. In regions with significant topography, such as foothills, this is not the case, so we revert to the time-space domain, but aim to minimize the differences of envelopes in the early stages of the inversion to resolve the cycle-skipping issue. Once the model is good enough, we revert to the classic waveform-difference inversion. We first present a few synthetic examples. We show that classical FWI might be trapped in a local minimum even for relatively simple scenario, while FWI with envelopes is stable and can converge using an inaccurate starting model. We also perform resolution analysis using a checkerboard test. We then present a field example. The final shear wavespeed model is compared to the results from the inversion of dispersion curves.

Breakfast habits among school children in selected communities in the eastern region of Ghana.

PubMed

Intiful, F D; Lartey, A

2014-06-01

Breakfast is considered the most important meal of the day, yet many people skip breakfast. Studies indicate that school age children who regularly skip breakfast are not likely to concentrate in class, thus affecting school performance. This study determined the breakfast habits and nutrient contributions of the breakfast meal to the days' nutrient intake. A cross sectional study was conducted among school children (n=359) between the ages of 6-19 years in Manya Krobo in the Eastern Region of Ghana. Questionnaires were used to collect information on background characteristics and breakfast consumption habits. The 24-hour dietary recall method was used to obtain information on the children's food intake. T-test was used to compare differences between means of variables of breakfast consumers and skippers. About 85.5% of the children had breakfast on the day of interview. More boys (87.8%) consumed breakfast compared to the girls (83.1%). For those who skipped breakfast, lack of food at home or lack of no money (36.5%) was the main reason. Breakfast consumers had significantly higher energy and nutrient intakes than those who skipped breakfast (energy 2259 verses 1360 kcal, p-0.039; vitamin A 1534 verses 662 ug/RE, p=0.001; iron 22.9 verses 13.9 mg, p=0.017, zinc 9.9 verses 5.6 mg, p=0.034). The breakfast meal contributed between 32-41% of the day's energy intake, and between 30-47% of micronutrient intake. Encouraging breakfast consumption among school children is a way to ensure that they meet their daily nutrient and energy intakes.

Meal pattern among Norwegian primary-school children and longitudinal associations between meal skipping and weight status.

PubMed

Stea, Tonje H; Vik, Frøydis N; Bere, Elling; Svendsen, Martin V; Oellingrath, Inger M

2015-02-01

To investigate meal pattern longitudinally and explore whether meal skipping was associated with overweight among Norwegian children and adolescents. Longitudinal study. Children's meal frequencies were reported by their parents using a retrospective FFQ. Weight and height were measured by public health nurses. Descriptive data comparing 4th and 7th grade were analysed by paired-sample t tests for continuous variables and χ 2 tests for categorical variables. Odds ratio estimates, including confidence intervals, with BMI category (normal/overweight) as the dependent variable, were determined through logistic regression analyses. Primary schools, Telemark County, Norway. A cohort of 428 Norwegian boys and girls; 4th graders in 2007, 7th graders in 2010. The number of children eating four main meals per day (regular meal frequency) decreased from 4th grade (47 %) to 7th grade (38 %; P = 0·001). Those who ate regular meals in 4th grade but not in 7th grade had higher odds (OR = 3·1; 95 % CI 1·1, 9·0) of being overweight in 7th grade after adjusting for gender, maternal education and physical activity, but the odds ratio was not statistically significant after adjusting for overweight in 4th grade (OR = 2·8; 95 % CI 0·7, 11·6). The present study showed significant increases in overall meal skipping among children between 4th and 7th grade. The results indicate an association between overweight and meal skipping, but additional prospective and longitudinal analyses and intervention trials are warranted to confirm this relationship.

A compatible exon-exon junction database for the identification of exon skipping events using tandem mass spectrum data.

PubMed

Mo, Fan; Hong, Xu; Gao, Feng; Du, Lin; Wang, Jun; Omenn, Gilbert S; Lin, Biaoyang

2008-12-16

Alternative splicing is an important gene regulation mechanism. It is estimated that about 74% of multi-exon human genes have alternative splicing. High throughput tandem (MS/MS) mass spectrometry provides valuable information for rapidly identifying potentially novel alternatively-spliced protein products from experimental datasets. However, the ability to identify alternative splicing events through tandem mass spectrometry depends on the database against which the spectra are searched. We wrote scripts in perl, Bioperl, mysql and Ensembl API and built a theoretical exon-exon junction protein database to account for all possible combinations of exons for a gene while keeping the frame of translation (i.e., keeping only in-phase exon-exon combinations) from the Ensembl Core Database. Using our liver cancer MS/MS dataset, we identified a total of 488 non-redundant peptides that represent putative exon skipping events. Our exon-exon junction database provides the scientific community with an efficient means to identify novel alternatively spliced (exon skipping) protein isoforms using mass spectrometry data. This database will be useful in annotating genome structures using rapidly accumulating proteomics data.

Lariat sequencing in a unicellular yeast identifies regulated alternative splicing of exons that are evolutionarily conserved with humans.

PubMed

Awan, Ali R; Manfredo, Amanda; Pleiss, Jeffrey A

2013-07-30

Alternative splicing is a potent regulator of gene expression that vastly increases proteomic diversity in multicellular eukaryotes and is associated with organismal complexity. Although alternative splicing is widespread in vertebrates, little is known about the evolutionary origins of this process, in part because of the absence of phylogenetically conserved events that cross major eukaryotic clades. Here we describe a lariat-sequencing approach, which offers high sensitivity for detecting splicing events, and its application to the unicellular fungus, Schizosaccharomyces pombe, an organism that shares many of the hallmarks of alternative splicing in mammalian systems but for which no previous examples of exon-skipping had been demonstrated. Over 200 previously unannotated splicing events were identified, including examples of regulated alternative splicing. Remarkably, an evolutionary analysis of four of the exons identified here as subject to skipping in S. pombe reveals high sequence conservation and perfect length conservation with their homologs in scores of plants, animals, and fungi. Moreover, alternative splicing of two of these exons have been documented in multiple vertebrate organisms, making these the first demonstrations of identical alternative-splicing patterns in species that are separated by over 1 billion y of evolution.

Single-cut genome editing restores dystrophin expression in a new mouse model of muscular dystrophy

PubMed Central

Amoasii, Leonela; Long, Chengzu; Li, Hui; Mireault, Alex A.; Shelton, John M.; Sanchez-Ortiz, Efrain; McAnally, John R.; Bhattacharyya, Samadrita; Schmidt, Florian; Grimm, Dirk; Hauschka, Stephen D.; Bassel-Duby, Rhonda; Olson, Eric N.

2017-01-01

Duchenne muscular dystrophy (DMD) is a severe, progressive muscle disease caused by mutations in the dystrophin gene. The majority of DMD mutations are deletions that prematurely terminate the dystrophin protein. Deletions of exon 50 of the dystrophin gene are among the most common single exon deletions causing DMD. Such mutations can be corrected by skipping exon 51, thereby restoring the dystrophin reading frame. Using clustered regularly interspaced short palindromic repeats/CRISPR-associated 9 (CRISPR/Cas9), we generated a DMD mouse model by deleting exon 50. These ΔEx50 mice displayed severe muscle dysfunction, which was corrected by systemic delivery of adeno-associated virus encoding CRISPR/Cas9 genome editing components. We optimized the method for dystrophin reading frame correction using a single guide RNA that created reframing mutations and allowed skipping of exon 51. In conjunction with muscle-specific expression of Cas9, this approach restored up to 90% of dystrophin protein expression throughout skeletal muscles and the heart of ΔEx50 mice. This method of permanently bypassing DMD mutations using a single cut in genomic DNA represents a step toward clinical correction of DMD mutations and potentially those of other neuromuscular disorders. PMID:29187645

Subsurface-channeling-like energy loss structure of the skipping motion on an ionic crystal.

PubMed

Villette, J; Borisov, A G; Khemliche, H; Momeni, A; Roncin, P

2000-10-09

The skipping motion of Ne+ ions in grazing scattering from the LiF(001) surface is studied for velocity below 0.1 a.u. with a time-of-flight technique. It is demonstrated that suppression of electronic excitation and dominance of optical phonon excitation in the projectile stopping results in an odd 1,3,5,... progression of the energy loss peaks, a feature usually ascribed to subsurface channeling. The experimental findings are well reproduced by parameter-free model calculations where thermal vibrations are the dominant cause for the ion trapping and detrapping.

Parental Functional Health Literacy Relates to Skip Pattern Questionnaire Error and to Child Oral Health

PubMed Central

Garrett, Gail M.; Citi, Alicia M.; Gansky, Stuart A.

2012-01-01

The study's purpose was to determine if parental dental functional-health-literacy (FHL) related to child oral health; a secondary aim was to assess if errors in completing the questionnaire related to FHL and child oral health. Parents of pediatric clinic children (N=101) completed questionnaires; dental caries indices were recorded. Higher FHL was negatively correlated with worse child caries (r=-0.23), but not subjective oral health. Mean FHL seemed to differ by skip pattern (p=0.087), indicating it may be a potential FHL proxy. PMID:22685950

2005 Service Academies: Sexual Assault Survey: Administration, Datasets and Codebook

DTIC Science & Technology

2005-10-01

sex w/you-Uned 326 SB026SK* [26sk] Situation w/ greatest eff -Skip 204 SB027* 27. [27---] In which semester did this occur 205 SB027U* [27...Tab recode SB038CR: Commis Officer COC 669 SB038CU* [38c] Retal by officer in chain o c-Uned 370 SB038D* 38d. [38d] Retal by other academy...sex w/you 203 SB026SK [26sk] Situation w/ greatest eff -Skip 204 SB027 27. [27---] In which semester did this occur 205 SB028 28. [28---] Where

A Mobile Robot Sonar System with Obstacle Avoidance.

DTIC Science & Technology

1994-03-01

WITH OBSTACLE - AVOIDANCE __ by __ Patrick Gerard Byrne March 1994 Thesis Advisor : Yutaka Kanayama Approved for public release; distribution is...point p is on a line L whose normal has an orientation a and whose distance from the origin is r (Figure 5). This method has an advantage in expressing...sonar(FRONTR); Wine(&pl); while(hitl I >’- 100.0 11 hitl 1 - 0.0 ){ hitl I = sonar(FRONTR); I skipO; line(&p3); gat- robO (&posit 1); while(positl.x

ADAM: Acquisition Deployment and Maneuvering the Space Game

DTIC Science & Technology

1987-12-07

become more critical to the US and USSR, the possibility of a space conflict becomes more likely. There may come a time when it becomes iportant to...impossible to use the actual el nts modeled in the game. Wargames are also used when it would be too costly, either in tiw or dullU,, to use the real...particular system has coupleted the Development Osa, additional copies skip the Resard phase and go directly from Feasible to Develcpment. When a unit is

International Space Station Water Balance Operations

NASA Technical Reports Server (NTRS)

Tobias, Barry; Garr, John D., II; Erne, Meghan

2011-01-01

In November 2008, the Water Regenerative System racks were launched aboard Space Shuttle flight, STS-126 (ULF2) and installed and activated on the International Space Station (ISS). These racks, consisting of the Water Processor Assembly (WPA) and Urine Processor Assembly (UPA), completed the installation of the Regenerative (Regen) Environmental Control and Life Support Systems (ECLSS), which includes the Oxygen Generation Assembly (OGA) that was launched 2 years prior. With the onset of active water management on the US segment of the ISS, a new operational concept was required, that of water balance . In November of 2010, the Sabatier system, which converts H2 and CO2 into water and methane, was brought on line. The Regen ECLSS systems accept condensation from the atmosphere, urine from crew, and processes that fluid via various means into potable water, which is used for crew drinking, building up skip-cycle water inventory, and water for electrolysis to produce oxygen. Specification (spec) rates of crew urine output, condensate output, O2 requirements, toilet flush water, and drinking needs are well documented and used as the best guess planning rates when Regen ECLSS came online. Spec rates are useful in long term planning, however, daily or weekly rates are dependent upon a number of variables. The constantly changing rates created a new challenge for the ECLSS flight controllers, who are responsible for operating the ECLSS systems onboard ISS from Mission Control in Houston. This paper reviews the various inputs to water planning, rate changes, and dynamic events, including but not limited to: crew personnel makeup, Regen ECLSS system operability, vehicle traffic, water storage availability, and Carbon Dioxide Removal Assembly (CDRA), Sabatier, and OGA capability. Along with the inputs that change the various rates, the paper will review the different systems, their constraints, and finally the operational challenges and means by which flight controllers manage this new concept of "water balance."

Melanocortin-1 receptor, skin cancer and phenotypic characteristics (M-SKIP) project: study design and methods for pooling results of genetic epidemiological studies

PubMed Central

2012-01-01

Background For complex diseases like cancer, pooled-analysis of individual data represents a powerful tool to investigate the joint contribution of genetic, phenotypic and environmental factors to the development of a disease. Pooled-analysis of epidemiological studies has many advantages over meta-analysis, and preliminary results may be obtained faster and with lower costs than with prospective consortia. Design and methods Based on our experience with the study design of the Melanocortin-1 receptor (MC1R) gene, SKin cancer and Phenotypic characteristics (M-SKIP) project, we describe the most important steps in planning and conducting a pooled-analysis of genetic epidemiological studies. We then present the statistical analysis plan that we are going to apply, giving particular attention to methods of analysis recently proposed to account for between-study heterogeneity and to explore the joint contribution of genetic, phenotypic and environmental factors in the development of a disease. Within the M-SKIP project, data on 10,959 skin cancer cases and 14,785 controls from 31 international investigators were checked for quality and recoded for standardization. We first proposed to fit the aggregated data with random-effects logistic regression models. However, for the M-SKIP project, a two-stage analysis will be preferred to overcome the problem regarding the availability of different study covariates. The joint contribution of MC1R variants and phenotypic characteristics to skin cancer development will be studied via logic regression modeling. Discussion Methodological guidelines to correctly design and conduct pooled-analyses are needed to facilitate application of such methods, thus providing a better summary of the actual findings on specific fields. PMID:22862891

Endoscopic Skipping of the Terminal Ileum in Pediatric Crohn Disease.

PubMed

Mansuri, Ishrat; Fletcher, Joel G; Bruining, David H; Kolbe, Amy B; Fidler, Jeff L; Samuel, Sunil; Tung, Jeanne

2017-06-01

Pediatric small-bowel (SB) Crohn disease (CD) may be missed if the terminal ileum (TI) appears normal at endoscopy and SB imaging is not performed. We sought to estimate the prevalence and clinical characteristics of pediatric patients with CD and endoscopic skipping of the TI-that is, pediatric patients with active SB or upper gut inflammation and an endoscopically normal TI. This retrospective study included pediatric patients with CD who underwent both CT enterography (CTE) or MR enterography (MRE) and ileocolonoscopy within a 30-day period between July 2004 and April 2014. The physician global assessment was used as the reference standard for SB CD activity. Radiologists reviewed the CTE and MRE studies for inflammatory parameters; severity, length, and multifocality of SB inflammation; and the presence of penetrating complications. Of 170 patients who underwent ileal intubation, the TI was macroscopically normal or showed nonspecific inflammation in 73 patients (43%). Nearly half (36/73, 49%) of the patients with normal or nonspecific findings at ileocolonoscopy had radiologically active disease with a median length of SB involvement of 20 cm (range, 1 to > 100 cm). Seventeen (47%) of these patients had multifocal SB involvement and five (14%) had penetrating complications. Overall, endoscopic TI skipping was present in 43 (59%) patients with normal or nonspecific ileocolonoscopic findings: 20 with histologic inflammation (17 with positive imaging findings), 14 with inflammation at imaging only, and nine with proximal disease (upper gut, jejunum, or proximal ileum). There were no significant differences in the clinical parameters of the patients with and those without endoscopic TI skipping. Ileocolonoscopy may miss SB CD in pediatric patients that is due to isolated histologic, intramural, or proximal inflammation. Enterography is complementary to ileocolonoscopy in the evaluation of pediatric CD.

Meal skipping relates to food choice, understanding of nutrition labeling, and prevalence of obesity in Korean fifth grade children.

PubMed

Kim, Hye-Young; Lee, Na-Rae; Lee, Jung-Sug; Choi, Young-Sun; Kwak, Tong-Kyung; Chung, Hae Rang; Kwon, Sehyug; Choi, Youn-Ju; Lee, Soon-Kyu; Kang, Myung-Hee

2012-08-01

This study was performed to investigate the differences in food choice, nutrition labeling perceptions, and prevalence of obesity due to meal skipping in Korean elementary school children. A national survey was performed in 2010 to collect data on food intake frequency, understanding of nutrition labeling, and body mass index from 2,335 fifth grade students in 118 elementary schools selected from 16 metropolitan local governments by stratified cluster sampling. The data were analyzed using the SAS 9.1 and SUDAAN 10.0 packages. Students who consumed three meals for 6-7 days during the past week were classified into the regular meal eating (RM) group (n = 1,476) and those who did not were placed into the meal skipping (MS) group (n = 859). The daily intake frequency of fruits, vegetables, kimchi, and milk was significantly lower in the MS group compared to that in the RM group (P < 0.001), whereas the daily intake frequency of soft drinks and instant noodles (ramyeon) was significantly higher in the MS group than that in the RM group (P < 0.05). The MS group demonstrated a significantly lower degree of understanding with regard to nutrition labeling and high calorie foods containing low nutritional value than that in the RM group. The distribution of obesity based on the percentile criteria using the Korean growth chart was different between the MS and RM groups. The MS group (8.97%) had a higher percentage of obese subjects than that in the RM group (5.38%). In conclusion, meal skipping was related to poor food choice, low perception of nutrition labeling, and a high prevalence of obesity in Korean fifth grade children.

Meal skipping relates to food choice, understanding of nutrition labeling, and prevalence of obesity in Korean fifth grade children

PubMed Central

Kim, Hye-Young; Lee, Na-Rae; Lee, Jung-Sug; Choi, Young-Sun; Kwak, Tong-Kyung; Chung, Hae Rang; Kwon, Sehyug; Choi, Youn-Ju; Lee, Soon-Kyu

2012-01-01

This study was performed to investigate the differences in food choice, nutrition labeling perceptions, and prevalence of obesity due to meal skipping in Korean elementary school children. A national survey was performed in 2010 to collect data on food intake frequency, understanding of nutrition labeling, and body mass index from 2,335 fifth grade students in 118 elementary schools selected from 16 metropolitan local governments by stratified cluster sampling. The data were analyzed using the SAS 9.1 and SUDAAN 10.0 packages. Students who consumed three meals for 6-7 days during the past week were classified into the regular meal eating (RM) group (n = 1,476) and those who did not were placed into the meal skipping (MS) group (n = 859). The daily intake frequency of fruits, vegetables, kimchi, and milk was significantly lower in the MS group compared to that in the RM group (P < 0.001), whereas the daily intake frequency of soft drinks and instant noodles (ramyeon) was significantly higher in the MS group than that in the RM group (P < 0.05). The MS group demonstrated a significantly lower degree of understanding with regard to nutrition labeling and high calorie foods containing low nutritional value than that in the RM group. The distribution of obesity based on the percentile criteria using the Korean growth chart was different between the MS and RM groups. The MS group (8.97%) had a higher percentage of obese subjects than that in the RM group (5.38%). In conclusion, meal skipping was related to poor food choice, low perception of nutrition labeling, and a high prevalence of obesity in Korean fifth grade children. PMID:22977687

Breakfast skipping and breakfast type are associated with daily nutrient intakes and metabolic syndrome in Korean adults

PubMed Central

Chung, Sang-Jin; Lee, Yoonna; Lee, Seokhwa

2015-01-01

BACKGROUND/OBJECTIVES Emerging evidence shows that eating breakfast and breakfast types may be associated with health outcomes and dietary intakes in various populations. The aim of this study was to investigate the association between breakfast types in Korean adults with their daily nutrient intakes and health outcomes. SUBJECTS/METHODS A total of 11,801 20- to 64-year-old adults (age 42.9 ± 11.8 yrs [mean ± standard error of the mean]; male 41.1%, female 58.9%) in 2007-2009 Korean National Health and Nutrition Survey data were divided into 5 groups based on breakfast types in a 24-hr dietary recall: rice with 3 or more side dishes (Rice3+, 35.3%), rice with 0-2 side dishes (Rice0-2, 34.73%), noodles (1.56%), bread and cereal (6.56%), and breakfast skipping (21.63%). Daily nutrient intakes and the risk of metabolic syndrome were compared among five groups. RESULTS Compared with Korean Recommended Nutrient Intake levels, the breakfast-skipping group showed the lowest intake level in most nutrients, whereas the Rice3+ group showed the highest. Fat intake was higher in the bread and noodle groups than in the other groups. When compared with the Rice3+ group, the odds ratios for the risk of obesity and metabolic syndrome were increased in the breakfast skipping, Rice0-2, and noodle groups after controlling for confounding variables. CONCLUSIONS The rice-based breakfast group showed better nutritional status and health outcomes when eating with 3 or more side dishes. Nutrition education is needed to emphasize both the potential advantage of the rice-based, traditional Korean diet in terms of nutritional content and the importance of food diversity. PMID:26060541

Transtheoretical Model Based Exercise Counseling Combined with Music Skipping Rope Exercise on Childhood Obesity.

PubMed

Ham, Ok Kyung; Sung, Kyung Mi; Lee, Bo Gyeong; Choi, Hee Won; Im, Eun-Ok

2016-06-01

The purpose was to evaluate the effects of a transtheoretical model (TTM) based exercise counseling offered with music skipping rope exercise on components of the TTM (stages of change, decisional balance, and self-efficacy), body mass index, glucose, and lipid profile of overweight/obese children in Korea. This study used a nonequivalent pretest and posttest experimental study design. A total of 75 overweight/obese children participated in the study. Eight sessions of exercise counseling combined with music skipping rope exercise for 12 weeks were offered for children in the experimental group, while one session of exercise counseling with music skipping rope exercise for 12 weeks was offered for children in the control group. Outcomes were measured at baseline, and 6 months after the intervention. After the intervention, self-efficacy significantly improved among children in the experimental group (p = .049), while these children maintained their baseline BMI at 6-month follow-up (p > .05). Among children in the control group, BMI significantly increased (p < .05). Fasting blood sugar significantly increased for both groups after the intervention (p < .05). However, a greater increase was observed for the control group. Our study partially supports the hypothesis that a TTM-based exercise intervention is effective in maintaining BMI and improving self-efficacy of overweight/obese children. The TTM-based counseling combined with exercise classes has potential to control weight among overweight/obese children, while involvement of parents and children in the development of the theory-based intervention may generate further benefits regarding health and well-being of overweight/obese children. Copyright © 2016. Published by Elsevier B.V.

A Natural Light/Dark Cycle Regulation of Carbon-Nitrogen Metabolism and Gene Expression in Rice Shoots.

PubMed

Li, Haixing; Liang, Zhijun; Ding, Guangda; Shi, Lei; Xu, Fangsen; Cai, Hongmei

2016-01-01

Light and temperature are two particularly important environmental cues for plant survival. Carbon and nitrogen are two essential macronutrients required for plant growth and development, and cellular carbon and nitrogen metabolism must be tightly coordinated. In order to understand how the natural light/dark cycle regulates carbon and nitrogen metabolism in rice plants, we analyzed the photosynthesis, key carbon-nitrogen metabolites, and enzyme activities, and differentially expressed genes and miRNAs involved in the carbon and nitrogen metabolic pathway in rice shoots at the following times: 2:00, 6:00, 10:00, 14:00, 18:00, and 22:00. Our results indicated that more CO2 was fixed into carbohydrates by a high net photosynthetic rate, respiratory rate, and stomatal conductance in the daytime. Although high levels of the nitrate reductase activity, free ammonium and carbohydrates were exhibited in the daytime, the protein synthesis was not significantly facilitated by the light and temperature. In mRNA sequencing, the carbon and nitrogen metabolism-related differentially expressed genes were obtained, which could be divided into eight groups: photosynthesis, TCA cycle, sugar transport, sugar metabolism, nitrogen transport, nitrogen reduction, amino acid metabolism, and nitrogen regulation. Additionally, a total of 78,306 alternative splicing events have been identified, which primarily belong to alternative 5' donor sites, alternative 3' acceptor sites, intron retention, and exon skipping. In sRNA sequencing, four carbon and nitrogen metabolism-related miRNAs (osa-miR1440b, osa-miR2876-5p, osa-miR1877 and osa-miR5799) were determined to be regulated by natural light/dark cycle. The expression level analysis showed that the four carbon and nitrogen metabolism-related miRNAs negatively regulated their target genes. These results may provide a good strategy to study how natural light/dark cycle regulates carbon and nitrogen metabolism to ensure plant growth and development.

Genome-wide profiling of chemoradiation‑induced changes in alternative splicing in colon cancer cells.

PubMed

Xiong, Wei; Gao, Depei; Li, Yunfeng; Liu, Xin; Dai, Peiling; Qin, Jiyong; Wang, Guanshun; Li, Kangming; Bai, Han; Li, Wenhui

2016-10-01

Alternative splicing is a key mechanism that regulates protein diversity and has been found to be associated with colon cancer progression and metastasis. However, the function of alternative splicing in chemoradiation‑resistant colon cancer remains elusive. In this study, we constructed a chemoradiation‑resistant colon cancer cell line. Through RNA-sequencing of normal and chemoradiation‑resistant colon cancer cells (HCT116), we found 818 genes that were highly expressed in the normal HCT116 cells, whereas 285 genes were highly expressed in the chemoradiation-resistant HCT116 (RCR-HCT116) cells. Gene ontology (GO) analysis showed that genes that were highly expressed in the HCT116 cells were enriched in GO categories related to cell cycle and cell division, whereas genes that were highly expressed in the RCR-HCT116 cells were associated with regulation of system processes and response to wounding. Analysis of alternative splicing events revealed that exon skipping was significantly increased in the chemoradiation‑resistant colon cancer cells. Moreover, we identified 323 alternative splicing events in 293 genes that were significantly different between the two different HCT116 cell types. These alternative splicing‑related genes were clustered functionally into several groups related with DNA replication, such as deoxyribonucleotide metabolic/catabolic processes, response to DNA damage stimulus and helicase activity. These findings enriched our knowledge by elucidating the function of alternative splicing in chemoradiation-resistant colon cancer.

What evidence do we have to replace in-hospital implantable cardioverter defibrillator follow-up?

PubMed

Brugada, P

2006-01-01

Due to the increasing number of patients with an implantable cardioverter defibrillator (ICD), new options for ICD patient follow-up management are required. Patients with ICD indication according to the guidelines received an ICD with Home Monitoring technology. The devices enabled the transmission of the relevant episode, therapy, and system integrity data. Patients were followed for 12 months with routine controls every 3 months. The physician analyzed the Home Monitoring data before the routine follow-up visit (FU) and gave a forecast on the necessity of the pending FU, which was compared with the evaluation after the FU. Based on the derived forecast reliability, a patient management scheme was developed and its impact on patient safety was assessed retrospectively. A total of 271 patients were enrolled (40 f, mean age 62+/-12 years, mean LVEF 39+/-15%, 65% ischemic heart disease, 20% cardiomyopathy) and followed for 339+/-109 days. Of 908 pairs of Home Monitoring data and FU data evaluation, 129 there were false negative results for 92 patients. Safety concerns from false negative forecasts can be minimized with a patient management scheme containing the following elements: 1) never skip the first routine FU; 2) never skip a routine FU for a patient having already shown pacing threshold problems; 3) perform FU following hospitalizations; 4) perform FU following episode detection by the ICD; and 5) perform a routine FU if the patient reports symptoms. The retrospective analysis showed, that if the patients had been managed using this scheme, 503 of 1079 routine FU could have been skipped with only one safety concern, a three month delay in the detection of silent paroxysmal atrial fibrillation in one patient. Home Monitoring in ICD therapy over 12 months is feasible. The data transmitted relevantly contribute to a remarkable reduction of follow-up burden and enable the individualization of routine follow-up.

Exon skipping and gene transfer restore dystrophin expression in human induced pluripotent stem cells-cardiomyocytes harboring DMD mutations.

PubMed

Dick, Emily; Kalra, Spandan; Anderson, David; George, Vinoj; Ritso, Morten; Laval, Steven H; Barresi, Rita; Aartsma-Rus, Annemieke; Lochmüller, Hanns; Denning, Chris

2013-10-15

With an incidence of ∼1:3,500 to 5,000 in male children, Duchenne muscular dystrophy (DMD) is an X-linked disorder in which progressive muscle degeneration occurs and affected boys usually die in their twenties or thirties. Cardiac involvement occurs in 90% of patients and heart failure accounts for up to 40% of deaths. To enable new therapeutics such as gene therapy and exon skipping to be tested in human cardiomyocytes, we produced human induced pluripotent stem cells (hiPSC) from seven patients harboring mutations across the DMD gene. Mutations were retained during differentiation and analysis indicated the cardiomyocytes showed a dystrophic gene expression profile. Antisense oligonucleotide-mediated skipping of exon 51 restored dystrophin expression to ∼30% of normal levels in hiPSC-cardiomyocytes carrying exon 47-50 or 48-50 deletions. Alternatively, delivery of a dystrophin minigene to cardiomyocytes with a deletion in exon 35 or a point mutation in exon 70 allowed expression levels similar to those seen in healthy cells. This demonstrates that DMD hiPSC-cardiomyocytes provide a novel tool to evaluate whether new therapeutics can restore dystrophin expression in the heart.

Exon Skipping and Gene Transfer Restore Dystrophin Expression in Human Induced Pluripotent Stem Cells-Cardiomyocytes Harboring DMD Mutations

PubMed Central

Dick, Emily; Kalra, Spandan; Anderson, David; George, Vinoj; Ritso, Morten; Laval, Steven H.; Barresi, Rita; Aartsma-Rus, Annemieke; Lochmüller, Hanns

2013-01-01

With an incidence of ∼1:3,500 to 5,000 in male children, Duchenne muscular dystrophy (DMD) is an X-linked disorder in which progressive muscle degeneration occurs and affected boys usually die in their twenties or thirties. Cardiac involvement occurs in 90% of patients and heart failure accounts for up to 40% of deaths. To enable new therapeutics such as gene therapy and exon skipping to be tested in human cardiomyocytes, we produced human induced pluripotent stem cells (hiPSC) from seven patients harboring mutations across the DMD gene. Mutations were retained during differentiation and analysis indicated the cardiomyocytes showed a dystrophic gene expression profile. Antisense oligonucleotide-mediated skipping of exon 51 restored dystrophin expression to ∼30% of normal levels in hiPSC-cardiomyocytes carrying exon 47–50 or 48–50 deletions. Alternatively, delivery of a dystrophin minigene to cardiomyocytes with a deletion in exon 35 or a point mutation in exon 70 allowed expression levels similar to those seen in healthy cells. This demonstrates that DMD hiPSC-cardiomyocytes provide a novel tool to evaluate whether new therapeutics can restore dystrophin expression in the heart. PMID:23829870

Breakfast Skipping, Anxiety, Exercise, and Soda Consumption are Associated with Diet Quality in Mexican College Students.

PubMed

Hall, Laura; Tejada-Tayabas, Luz María; Monárrez-Espino, Joel

2017-01-01

ABSTEACT Despite the reported poor dietary habits and risk of weight gain in college students, they remain understudied in Mexico. Mexican college students are in a rapidly changing economic environment; a shift from a traditional, homemade cuisine to a diet more heavily influenced by an industrialized culture seems to be occurring, potentially affecting the quality of their dietary intake. A health and nutrition survey was conducted among 450 Mexican college students to study the relationship between sociodemographic factors and diet quality. Dietary data were used to build macro- and micronutrient scores, dichotomized as low and normal quality. Adjusted odds (OR [95% CI]) were computed to determine the probability of low dietary quality. Breakfast skipping (5.3 [1.2, 22.7]) and risk of anxiety (2.3 [1.3, 4.4]) were associated with a greater risk of low macronutrient quality, and caloric intake < 1,800 kcal (5.8 [3.5, 9.7]), breakfast skipping (3.7 [1.4, 10.3]), vigorous exercise ≤ 1 h/wk (2.6 [1.3, 5.2]), and soda consumption > 250 mL/d (2.0 [1.2, 3.3]) with low micronutrient quality.

A mechanism for exon skipping caused by nonsense or missense mutations in BRCA1 and other genes.

PubMed

Liu, H X; Cartegni, L; Zhang, M Q; Krainer, A R

2001-01-01

Point mutations can generate defective and sometimes harmful proteins. The nonsense-mediated mRNA decay (NMD) pathway minimizes the potential damage caused by nonsense mutations. In-frame nonsense codons located at a minimum distance upstream of the last exon-exon junction are recognized as premature termination codons (PTCs), targeting the mRNA for degradation. Some nonsense mutations cause skipping of one or more exons, presumably during pre-mRNA splicing in the nucleus; this phenomenon is termed nonsense-mediated altered splicing (NAS), and its underlying mechanism is unclear. By analyzing NAS in BRCA1, we show here that inappropriate exon skipping can be reproduced in vitro, and results from disruption of a splicing enhancer in the coding sequence. Enhancers can be disrupted by single nonsense, missense and translationally silent point mutations, without recognition of an open reading frame as such. These results argue against a nuclear reading-frame scanning mechanism for NAS. Coding-region single-nucleotide polymorphisms (cSNPs) within exonic splicing enhancers or silencers may affect the patterns or efficiency of mRNA splicing, which may in turn cause phenotypic variability and variable penetrance of mutations elsewhere in a gene.

Anticipating syntax during reading: Evidence from the boundary change paradigm.

PubMed

Brothers, Trevor; Traxler, Matthew J

2016-12-01

Previous evidence suggests that grammatical constraints have a rapid influence during language comprehension, particularly at the level of word categories (noun, verb, preposition). These findings are in conflict with a recent study from Angele, Laishley, Rayner, and Liversedge (2014), in which sentential fit had no early influence on word skipping rates during reading. In the present study, we used a gaze-contingent boundary change paradigm to manipulate the syntactic congruity of an upcoming noun or verb outside of participants' awareness. Across 3 experiments (total N = 148), we observed higher skipping rates for syntactically valid previews (The admiral would not confess . . .), when compared with violation previews (The admiral would not surgeon . . .). Readers were less likely to skip an ungrammatical continuation, even when that word was repeated within the same sentence (The admiral would not admiral . . .), suggesting that word-class constraints can take precedence over lexical repetition effects. To our knowledge, these results provide the first evidence for an influence of syntactic context during parafoveal word recognition. On the basis of the early time-course of this effect, we argue that readers can use grammatical constraints to generate syntactic expectations for upcoming words. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

Formally biorthogonal polynomials and a look-ahead Levinson algorithm for general Toeplitz systems

NASA Technical Reports Server (NTRS)

Freund, Roland W.; Zha, Hongyuan

1992-01-01

Systems of linear equations with Toeplitz coefficient matrices arise in many important applications. The classical Levinson algorithm computes solutions of Toeplitz systems with only O(n(sub 2)) arithmetic operations, as compared to O(n(sub 3)) operations that are needed for solving general linear systems. However, the Levinson algorithm in its original form requires that all leading principal submatrices are nonsingular. An extension of the Levinson algorithm to general Toeplitz systems is presented. The algorithm uses look-ahead to skip over exactly singular, as well as ill-conditioned leading submatrices, and, at the same time, it still fully exploits the Toeplitz structure. In our derivation of this algorithm, we make use of the intimate connection of Toeplitz matrices with formally biorthogonal polynomials.

Synchronization properties of networks of electrically coupled neurons in the presence of noise and heterogeneities.

PubMed

Ostojic, Srdjan; Brunel, Nicolas; Hakim, Vincent

2009-06-01

We investigate how synchrony can be generated or induced in networks of electrically coupled integrate-and-fire neurons subject to noisy and heterogeneous inputs. Using analytical tools, we find that in a network under constant external inputs, synchrony can appear via a Hopf bifurcation from the asynchronous state to an oscillatory state. In a homogeneous net work, in the oscillatory state all neurons fire in synchrony, while in a heterogeneous network synchrony is looser, many neurons skipping cycles of the oscillation. If the transmission of action potentials via the electrical synapses is effectively excitatory, the Hopf bifurcation is supercritical, while effectively inhibitory transmission due to pronounced hyperpolarization leads to a subcritical bifurcation. In the latter case, the network exhibits bistability between an asynchronous state and an oscillatory state where all the neurons fire in synchrony. Finally we show that for time-varying external inputs, electrical coupling enhances the synchronization in an asynchronous network via a resonance at the firing-rate frequency.

A miniature high-efficiency fully digital adaptive voltage scaling buck converter

NASA Astrophysics Data System (ADS)

Li, Hangbiao; Zhang, Bo; Luo, Ping; Zhen, Shaowei; Liao, Pengfei; He, Yajuan; Li, Zhaoji

2015-09-01

A miniature high-efficiency fully digital adaptive voltage scaling (AVS) buck converter is proposed in this paper. The pulse skip modulation with flexible duty cycle (FD-PSM) is used in the AVS controller, which simplifies the circuit architecture (<170 gates) and greatly saves the die area and the power consumption. The converter is implemented in a 0.13-μm one-poly-eight-metal (1P8 M) complementary metal oxide semiconductor process and the active on-chip area of the controller is only 0.003 mm2, which is much smaller. The measurement results show that when the operating frequency of the digital load scales dynamically from 25.6 MHz to 112.6 MHz, the supply voltage of which can be scaled adaptively from 0.84 V to 1.95 V. The controller dissipates only 17.2 μW, while the supply voltage of the load is 1 V and the operating frequency is 40 MHz.

PHOTOELECTRIC CONTROL FOR TAPE POSITIONING

DOEpatents

Woody, J.W. Jr.

1961-07-25

A control system is described for producing control impulses which may be used to start, stop, and position a magnetic tape with respect to a transducer, and to locate discrete areas on the tape. Means are provided for positive identification of data blocks, exact positioning of the tape under the magnetic head, drive in either direction, accurate skip-over of imperfect regions of the tape, stopping the tape if equipment malfunction results in a failure to detect the block-identifying signals, and starting and stopping those parts of the tape between of the tape drive clutches.

Data compression for satellite images

NASA Technical Reports Server (NTRS)

Chen, P. H.; Wintz, P. A.

1976-01-01

An efficient data compression system is presented for satellite pictures and two grey level pictures derived from satellite pictures. The compression techniques take advantages of the correlation between adjacent picture elements. Several source coding methods are investigated. Double delta coding is presented and shown to be the most efficient. Both predictive differential quantizing technique and double delta coding can be significantly improved by applying a background skipping technique. An extension code is constructed. This code requires very little storage space and operates efficiently. Simulation results are presented for various coding schemes and source codes.

The CCTC Quick-Reacting General War Gaming System (QUICK) Program Maintenance Manual. Volume 3. Weapon Allocation Subsystem

DTIC Science & Technology

1978-04-15

12. (Part 2 of 2) 70 B1 Calculate Revised I! Allocation Error [: Estimates For Each Attribute Category] Skip Change of tltipliers - No _ D-Do For All A...passing Onl to tilt next target , thlt current Value Of the target weight is revised . Altecr every two to four targets , the Laigrange multipliers art...delete a weapon, a new set of variables is delivered by WADOUT, and STALL uses this revised in- formation to decide whether more weapons should be added

Skipped Beats

MedlinePlus

... Certification (MOC) Scientific Sessions Certified Education Courses & Online Learning Co-Sponsored & Endorsed Events Educational Resources Career Resources Job Board Fellowships & Program Directors IBHRE Exam Jobs at ...

F-box protein FBXL2 targets cyclin D2 for ubiquitination and degradation to inhibit leukemic cell proliferation

PubMed Central

Chen, Bill B.; Glasser, Jennifer R.; Coon, Tiffany A.; Zou, Chunbin; Miller, Hannah L.; Fenton, Moon; McDyer, John F.; Boyiadzis, Michael

2012-01-01

Hematologic maligancies exhibit a growth advantage by up-regulation of components within the molecular apparatus involved in cell-cycle progression. The SCF (Skip-Cullin1-F-box protein) E3 ligase family provides homeostatic feedback control of cell division by mediating ubiquitination and degradation of cell-cycle proteins. By screening several previously undescribed E3 ligase components, we describe the behavior of a relatively new SCF subunit, termed FBXL2, that ubiquitinates and destabilizes cyclin D2 protein leading to G0 phase arrest and apoptosis in leukemic and B-lymphoblastoid cell lines. FBXL2 expression was strongly suppressed, and yet cyclin D2 protein levels were robustly expressed in acute myelogenous leukemia (AML) and acute lymphoblastic leukemia (ALL) patient samples. Depletion of endogenous FBXL2 stabilized cyclin D2 levels, whereas ectopically expressed FBXL2 decreased cyclin D2 lifespan. FBXL2 did not bind a phosphodegron within its substrate, which is typical of other F-box proteins, but uniquely targeted a calmodulin-binding signature within cyclin D2 to facilitate its polyubiquitination. Calmodulin competes with the F-box protein for access to this motif where it bound and protected cyclin D2 from FBXL2. Calmodulin reversed FBXL2-induced G0 phase arrest and attenuated FBXL2-induced apoptosis of lymphoblastoid cells. These results suggest an antiproliferative effect of SCFFBXL2 in lymphoproliferative malignancies. PMID:22323446

Kidney adysplasia and variable hydronephrosis, a new mutation affecting the odd-skipped related 1 gene in the mouse, causes variable defects in kidney development and hydronephrosis

PubMed Central

Davisson, Muriel T.; Cook, Susan A.; Akeson, Ellen C.; Liu, Don; Heffner, Caleb; Gudis, Polyxeni; Fairfield, Heather

2015-01-01

Many genes, including odd-skipped related 1 (Osr1), are involved in regulation of mammalian kidney development. We describe here a new recessive mutation (kidney adysplasia and variable hydronephrosis, kavh) in the mouse that leads to downregulation of Osr1 transcript, causing several kidney defects: agenesis, hypoplasia, and hydronephrosis with variable age of onset. The mutation is closely associated with a reciprocal translocation, T(12;17)4Rk, whose Chromosome 12 breakpoint is upstream from Osr1. The kavh/kavh mutant provides a model to study kidney development and test therapies for hydronephrosis. PMID:25834070

Kidney adysplasia and variable hydronephrosis, a new mutation affecting the odd-skipped related 1 gene in the mouse, causes variable defects in kidney development and hydronephrosis.

PubMed

Davisson, Muriel T; Cook, Susan A; Akeson, Ellen C; Liu, Don; Heffner, Caleb; Gudis, Polyxeni; Fairfield, Heather; Murray, Stephen A

2015-06-15

Many genes, including odd-skipped related 1 (Osr1), are involved in regulation of mammalian kidney development. We describe here a new recessive mutation (kidney adysplasia and variable hydronephrosis, kavh) in the mouse that leads to downregulation of Osr1 transcript, causing several kidney defects: agenesis, hypoplasia, and hydronephrosis with variable age of onset. The mutation is closely associated with a reciprocal translocation, T(12;17)4Rk, whose Chromosome 12 breakpoint is upstream from Osr1. The kavh/kavh mutant provides a model to study kidney development and test therapies for hydronephrosis. Copyright © 2015 the American Physiological Society.

On the relation among the solar activity, the quasi-biennial oscillation in the equatorial stratosphere and El Nino.

NASA Astrophysics Data System (ADS)

Gul, Zhennian

The possibility of a relation among Quasi-Biennial Oscillation (QBO) of zonal winds in the equatorial stratosphere, sunspot Wolf number and SST's in the eastern Pacific during the same interval are analyzed. The band filter and the wavelet method which are capable of finding local periods and amplitudes are used in the data processing. It is shown that the coherence estimates between the series of QBO in Wolf and in lower tropical stratosphere are of order of -0.6. A possible dynamical explanation for skip a beat of QBO linked El Nino suggested by Angel and Gray is presented. Solar activity is a hypothetical mechanism of this skip.

Computer aided field editing in the DHS context: the Turkey experiment.

PubMed

Cushing, J; Loaiza, E

1994-01-01

"In this study two types of field editing used during the Turkey Demographic and Health Survey are compared. These two types of editing are computer aided field editing and manual editing. It is known that manual editing by field editors is a tedious job in which errors especially on skip questions can be missed; however, with the aid of computers field editors could quickly find all occasions on which an interviewer incorrectly followed a skip instruction. At the end of the experiment it has been found...that the field editing done with the aid of a notebook computer was consistently better than that done in the standard manual manner." (SUMMARY IN TUR) excerpt

Scarlet Fever (For Parents)

MedlinePlus

[Skip to Content] for Parents Parents site Sitio para padres General Health Growth & Development Infections Diseases & Conditions Pregnancy & Baby Nutrition & Fitness Emotions & Behavior School & Family ...

Strep Throat (For Parents)

MedlinePlus

[Skip to Content] for Parents Parents site Sitio para padres General Health Growth & Development Infections Diseases & Conditions Pregnancy & Baby Nutrition & Fitness Emotions & Behavior School & Family ...

Simple adaptive control system design for a quadrotor with an internal PFC

NASA Astrophysics Data System (ADS)

Mizumoto, Ikuro; Nakamura, Takuto; Kumon, Makoto; Takagi, Taro

2014-12-01

The paper deals with an adaptive control system design problem for a four rotor helicopter or quadrotor. A simple adaptive control design scheme with a parallel feedforward compensator (PFC) in the internal loop of the considered quadrotor will be proposed based on the backstepping strategy. As is well known, the backstepping control strategy is one of the advanced control strategy for nonlinear systems. However, the control algorithm will become complex if the system has higher order relative degrees. We will show that one can skip some design steps of the backstepping method by introducing a PFC in the inner loop of the considered quadrotor, so that the structure of the obtained controller will be simplified and a high gain based adaptive feedback control system will be designed. The effectiveness of the proposed method will be confirmed through numerical simulations.

Accelerating non-contrast-enhanced MR angiography with inflow inversion recovery imaging by skipped phase encoding and edge deghosting (SPEED).

PubMed

Chang, Zheng; Xiang, Qing-San; Shen, Hao; Yin, Fang-Fang

2010-03-01

To accelerate non-contrast-enhanced MR angiography (MRA) with inflow inversion recovery (IFIR) with a fast imaging method, Skipped Phase Encoding and Edge Deghosting (SPEED). IFIR imaging uses a preparatory inversion pulse to reduce signals from static tissue, while leaving inflow arterial blood unaffected, resulting in sparse arterial vasculature on modest tissue background. By taking advantage of vascular sparsity, SPEED can be simplified with a single-layer model to achieve higher efficiency in both scan time reduction and image reconstruction. SPEED can also make use of information available in multiple coils for further acceleration. The techniques are demonstrated with a three-dimensional renal non-contrast-enhanced IFIR MRA study. Images are reconstructed by SPEED based on a single-layer model to achieve an undersampling factor of up to 2.5 using one skipped phase encoding direction. By making use of information available in multiple coils, SPEED can achieve an undersampling factor of up to 8.3 with four receiver coils. The reconstructed images generally have comparable quality as that of the reference images reconstructed from full k-space data. As demonstrated with a three-dimensional renal IFIR scan, SPEED based on a single-layer model is able to reduce scan time further and achieve higher computational efficiency than the original SPEED.

Basal exon skipping and genetic pleiotropy: A predictive model of disease pathogenesis.

PubMed

Drivas, Theodore G; Wojno, Adam P; Tucker, Budd A; Stone, Edwin M; Bennett, Jean

2015-06-10

Genetic pleiotropy, the phenomenon by which mutations in the same gene result in markedly different disease phenotypes, has proven difficult to explain with traditional models of disease pathogenesis. We have developed a model of pleiotropic disease that explains, through the process of basal exon skipping, how different mutations in the same gene can differentially affect protein production, with the total amount of protein produced correlating with disease severity. Mutations in the centrosomal protein of 290 kDa (CEP290) gene are associated with a spectrum of phenotypically distinct human diseases (the ciliopathies). Molecular biologic examination of CEP290 transcript and protein expression in cells from patients carrying CEP290 mutations, measured by quantitative polymerase chain reaction and Western blotting, correlated with disease severity and corroborated our model. We show that basal exon skipping may be the mechanism underlying the disease pleiotropy caused by CEP290 mutations. Applying our model to a different disease gene, CC2D2A (coiled-coil and C2 domains-containing protein 2A), we found that the same correlations held true. Our model explains the phenotypic diversity of two different inherited ciliopathies and may establish a new model for the pathogenesis of other pleiotropic human diseases. Copyright © 2015, American Association for the Advancement of Science.

Sleep variability and fatigue in adolescents: Associations with school-related features.

PubMed

Matos, M G; Gaspar, T; Tomé, G; Paiva, T

2016-10-01

This study aims to evaluate the influences of sleep duration and sleep variability (SleepV), upon adolescents' school-related situations. The Health Behaviour in School-Aged Children (HBSC) survey is based on a self-completed questionnaire. The participants were 3164 pupils (53.7% girls), attending the 8th and 10th grades, 14.9 years old, and were inquired about subjective sleep duration during the week and weekends, SleepV, fatigue, difficulties in sleep initiation, school achievement, feelings towards schools, pressure with school work and skipping classes. Multiple regression models used, as dependent variables: (a) school achievement, (b) disliking school, (c) pressure with school work and (d) skipping classes, using as independent variables, each of the remaining school-related variables, fatigue, total sleep duration and difficulties in sleep initiation. The average sleep duration in the week and during weekdays was lower than recommended for these age groups, and almost half of students had high SleepV between weekdays and weekends. A logistic model revealed that the absence of SleepV was associated with lower perception of school work pressure, less frequent skipping classes, more infrequent fatigue and more infrequent difficulties in sleep initiation. Poor sleep quality, SleepV and insufficient sleep duration affected negatively school-related variables. © 2015 International Union of Psychological Science.

Breakfast habits, nutritional status, body weight, and academic performance in children and adolescents.

PubMed

Rampersaud, Gail C; Pereira, Mark A; Girard, Beverly L; Adams, Judi; Metzl, Jordan D

2005-05-01

Breakfast has been labeled the most important meal of the day, but are there data to support this claim? We summarized the results of 47 studies examining the association of breakfast consumption with nutritional adequacy (nine studies), body weight (16 studies), and academic performance (22 studies) in children and adolescents. Breakfast skipping is highly prevalent in the United States and Europe (10% to 30%), depending on age group, population, and definition. Although the quality of breakfast was variable within and between studies, children who reported eating breakfast on a consistent basis tended to have superior nutritional profiles than their breakfast-skipping peers. Breakfast eaters generally consumed more daily calories yet were less likely to be overweight, although not all studies associated breakfast skipping with overweight. Evidence suggests that breakfast consumption may improve cognitive function related to memory, test grades, and school attendance. Breakfast as part of a healthful diet and lifestyle can positively impact children's health and well-being. Parents should be encouraged to provide breakfast for their children or explore the availability of a school breakfast program. We advocate consumption of a healthful breakfast on a daily basis consisting of a variety of foods, especially high-fiber and nutrient-rich whole grains, fruits, and dairy products.

Combination Antisense Treatment for Destructive Exon Skipping of Myostatin and Open Reading Frame Rescue of Dystrophin in Neonatal mdx Mice.

PubMed

Lu-Nguyen, Ngoc B; Jarmin, Susan A; Saleh, Amer F; Popplewell, Linda; Gait, Michael J; Dickson, George

2015-08-01

The fatal X-linked Duchenne muscular dystrophy (DMD), characterized by progressive muscle wasting and muscle weakness, is caused by mutations within the DMD gene. The use of antisense oligonucleotides (AOs) modulating pre-mRNA splicing to restore the disrupted dystrophin reading frame, subsequently generating a shortened but functional protein has emerged as a potential strategy in DMD treatment. AO therapy has recently been applied to induce out-of-frame exon skipping of myostatin pre-mRNA, knocking-down expression of myostatin protein, and such an approach is suggested to enhance muscle hypertrophy/hyperplasia and to reduce muscle necrosis. Within this study, we investigated dual exon skipping of dystrophin and myostatin pre-mRNAs using phosphorodiamidate morpholino oligomers conjugated with an arginine-rich peptide (B-PMOs). Intraperitoneal administration of B-PMOs was performed in neonatal mdx males on the day of birth, and at weeks 3 and 6. At week 9, we observed in treated mice (as compared to age-matched, saline-injected controls) normalization of muscle mass, a recovery in dystrophin expression, and a decrease in muscle necrosis, particularly in the diaphragm. Our data provide a proof of concept for antisense therapy combining dystrophin restoration and myostatin inhibition for the treatment of DMD.

Effects of word predictability and preview lexicality on eye movements during reading: A comparison between young and older adults.

PubMed

Choi, Wonil; Lowder, Matthew W; Ferreira, Fernanda; Swaab, Tamara Y; Henderson, John M

2017-05-01

Previous eye-tracking research has characterized older adults' reading patterns as "risky," arguing that compared to young adults, older adults skip more words, have longer saccades, and are more likely to regress to previous portions of the text. In the present eye-tracking study, we reexamined the claim that older adults adopt a risky reading strategy, utilizing the boundary paradigm to manipulate parafoveal preview and contextual predictability of a target word. Results showed that older adults had longer fixation durations compared to young adults; however, there were no age differences in skipping rates, saccade length, or proportion of regressions. In addition, readers showed higher skipping rates of the target word if the preview string was a word than if it was a nonword, regardless of age. Finally, the effect of predictability in reading times on the target word was larger for older adults than for young adults. These results suggest that older adults' reading strategies are not as risky as was previously claimed. Instead, we propose that older adults can effectively combine top-down information from the sentence context with bottom-up information from the parafovea to optimize their reading strategies. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

Hopping locomotion at different gravity: metabolism and mechanics in humans.

PubMed

Pavei, Gaspare; Minetti, Alberto E

2016-05-15

Previous literature on the effects of low gravity on the mechanics and energetics of human locomotion already dealt with walking, running, and skipping. The aim of the present study is to obtain a comprehensive view on that subject by including measurements of human hopping in simulated low gravity, a gait often adopted in many Apollo Missions and documented in NASA footage. Six subjects hopped at different speeds at terrestrial, Martian, and Lunar gravity on a treadmill while oxygen consumption and 3D body kinematic were sampled. Results clearly indicate that hopping is too metabolically expensive to be a sustainable locomotion on Earth but, similarly to skipping (and running), its economy greatly (more than ×10) increases at lower gravity. On the Moon, the metabolic cost of hopping becomes even lower than that of walking, skipping, and running, but the general finding is that gaits with very different economy on Earth share almost the same economy on the Moon. The mechanical reasons for such a decrease in cost are discussed in the paper. The present data, together with previous findings, will allow also to predict the aerobic traverse range/duration of astronauts when getting far from their base station on low gravity planets. Copyright © 2016 the American Physiological Society.

von Willebrand Disease (For Parents)

MedlinePlus

[Skip to Content] for Parents Parents site Sitio para padres General Health Growth & Development Infections Diseases & Conditions Pregnancy & Baby Nutrition & Fitness Emotions & Behavior School & Family ...

Skipping meals or carbohydrate-free meals in order to determine Basal insulin requirements in subjects with type 1 diabetes mellitus?

PubMed

Uthoff, H; Lehmann, R; Sprenger, M; Wiesli, P

2010-05-01

Basal insulin dose requirements in patients with type 1 diabetes may be derived from the course of glucose concentrations in the fasting state; i. e. by skipping meals. The present study examined whether fasting tests could be replaced by carbohydrate-free meals. 16 adult patients with type 1 diabetes (10 male) on intensive insulin therapy participated in this prospective intervention study. Mean age (+/-SD) was 44+/-12 years, BMI 24+/-3 kg/m (2), mean HbA1c was 7.5+/-0.6% and duration of diabetes 15+/-12 years. All participants skipped dinner and plasma glucose concentrations were hourly monitored from 7 p.m. to 11 p.m. This blood glucose profile was compared with three test meals given at 7 p.m. at day 2-4, consumed either in the hospital (meal 1) or at home (meal 2 and 3). No insulin injection (except to basal insulin) was allowed. Test meals consisted of 2.5 g carbohydrate, 32.4 g protein, 52.0 g fat (according to 612 kcal). During 16 fasting tests plasma glucose concentration remained stable between 7.2+/-2.4 mmol/l at 7 p.m. and 6.8+/-2.8 mmol/l at 11 p.m. (p=0.461). Following the intake of near carbohydrate-free meals (48 tests), plasma glucose concentrations rose within 4 h from 6.7+/-2.0 at 7 p.m. to 9.8+/-3.4 mmol/l at 11 p.m. (p<0.0001). The increase in plasma glucose concentrations was similar in all three different meals tested. Plasma glucose concentrations significantly increase in patients with type 1 diabetes following the intake of carbohydrate-free meals. Carbohydrate-free meal-tests cannot replace skipping meal tests to determine the basal insulin requirement in patients with type 1 diabetes.

Acute Effect of Upper and Lower Body Postactivation Exercises on Shot Put Performance.

PubMed

Kontou, Eleni I; Berberidou, Fani T; Pilianidis, Theophilos C; Mantzouranis, Nikolaos I; Methenitis, Spyridon K

2018-04-01

Kontou, EI, Berberidou, FT, Pilianidis, TC, Mantzouranis, NI, and Methenitis, SK. Acute effect of upper and lower body postactivation exercises on shot put performance. J Strength Cond Res 32(4): 970-982, 2018-The purpose of this study was to investigate the effect of different types of upper and lower' extremities exercises on acute increase of shot put performance, in moderate experienced throwers. Eight (n = 8) males and 9 (n = 9) female throwers participated in this study. Their bench press and squat maximum strength were measured while their shot put performance from power position was evaluated before and after 4 interventions: (a) plyometric push-ups (Plyo), (b) 6 s isometric push-ups (Iso), (c) 3 countermovement jumps (CMJs) and (d) 10 reps. of skipping (Skip). Interventions were performed in counterbalanced order with a 48-hour interval. Significant increase (p < 0.05) of shot put performances was observed after Plyo, Iso, and CMJ (range: 2.30 ± 1.82%-5.72 ± 4.32%). In addition, Iso induced the highest increase while Skip did not induce any improvement of throwing performance. The highest increases were recorded in men's performance after CMJ (5.72 ± 4.32%) while in women's performance after Iso (3.59 ± 2.7%). Javelin and discus throwers increase higher their performance after CMJs while shot putters after Iso. Significant correlations were found between training experience, maximum/relative strength, shot put performance and increase of throwing performance (%) after the interventions (r: 0.519-0.991, p < 0.05). Percentage increase of performance between Iso and Plyo have negative correlations (r: -0.569, p < 0.05) in contrast of those between Skip and CMJ (r: 0.710, p < 0.05). These results suggest that upper or lower body postactivation interventions may acutely increase the throwing performance. However, experience and strength are significant determinant of this increase.

Exon Skipping in the RET Gene Encodes Novel Isoforms That Differentially Regulate RET Protein Signal Transduction*

PubMed Central

Gabreski, Nicole A.; Vaghasia, Janki K.; Novakova, Silvia S.; McDonald, Neil Q.; Pierchala, Brian A.

2016-01-01

Rearranged during transfection (RET), a receptor tyrosine kinase that is activated by the glial cell line-derived neurotrophic factor family ligands (GFLs), plays a crucial role in the development and function of the nervous system and additionally is required for kidney development and spermatogenesis. RET encodes a transmembrane receptor that is 20 exons long and produces two known protein isoforms differing in C-terminal amino acid composition, referred to as RET9 and RET51. Studies of human pheochromocytomas identified two additional novel transcripts involving the skipping of exon 3 or exons 3, 4, and 5 and are referred to as RETΔE3 and RETΔE345, respectively. Here we report the presence of RetΔE3 and RetΔE345 in zebrafish, mice, and rats and show that these transcripts are dynamically expressed throughout development of the CNS, peripheral nervous system, and kidneys. We further explore the biochemical properties of these isoforms, demonstrating that, like full-length RET, RETΔE3 and RETΔE345 are trafficked to the cell surface, interact with all four GFRα co-receptors, and have the ability to heterodimerize with full-length RET. Signaling experiments indicate that RETΔE3 is phosphorylated in a similar manner to full-length RET. RETΔE345, in contrast, displays higher baseline autophosphorylation, specifically on the catalytic tyrosine, Tyr905, and also on one of the most important signaling residues, Tyr1062. These data provide the first evidence for a physiologic role of these isoforms in RET pathway function. PMID:27226544

DiGeorge Syndrome (DGS)

MedlinePlus

American Academy of Allergy Asthma & Immunology Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide Conditions Dictionary Just ...

Asthma, Allergies and Pregnancy

MedlinePlus

... Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide Conditions Dictionary Just for Kids Library School Tools Videos Virtual ...

Symptoms and Treatment of Depression

MedlinePlus Videos and Cool Tools

Skip to content Home Health Information Health Information Home Mental Health Information Statistics Consumer Health Publications Help for Mental Illnesses Clinical Trials Outreach Outreach Home Stakeholder Engagement ...

Development of the Young Brain

MedlinePlus Videos and Cool Tools

Skip to content Home Health Information Health Information Home Mental Health Information Statistics Consumer Health Publications Help for Mental Illnesses Clinical Trials Outreach Outreach Home Stakeholder Engagement ...

Learning about Familial Hypercholesterolemia

MedlinePlus

Skip to main content Learning About Familial Hypercholesterolemia Enter Search Term(s): Español Research Funding An Overview Bioinformatics Current Grants Education and Training Funding Extramural Research ...

Migraine

MedlinePlus

... Skipping meals or fasting also can trigger attacks. Food additives. The sweetener aspartame and the preservative monosodium glutamate (MSG), found in many foods, may trigger migraines. Drinks. Alcohol, especially wine, and ...

Energy conservation for pasteurizer apparatus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huling, J.K.

In the pasteurizing of beverages in closed containers, the containers arrive generally in a chilled state and are progressively raised in temperature approaching the pasteurizing temperature and, after being pasteurized for an appropriate time, are progressively cooled down. Apparatus of this type is provided with a source of chilled water which is available for use when skips occur in the supply of the containers, the chilled water being accumulated from the incoming containers and from common outside sources. The accumulated water in its chilled state saves substantial amounts of energy by eliminating mechanical or other means to produce the chillmore » effect, and such source of water is constantly available under control which senses the presence of a skip in the supply of containers.« less

Hydraulic hoisting and backfilling

NASA Astrophysics Data System (ADS)

Sauermann, H. B.

In a country such as South Africa, with its large deep level mining industry, improvements in mining and hoisting techniques could result in substantial savings. Hoisting techniques, for example, may be improved by the introduction of hydraulic hoisting. The following are some of the advantages of hydraulic hoisting as against conventional skip hoisting: (1) smaller shafts are required because the pipes to hoist the same quantity of ore hydraulically require less space in the shaft than does skip hoisting equipment; (2) the hoisting capacity of a mine can easily be increased without the necessity of sinking new shafts. Large savings in capital costs can thus be made; (3) fully automatic control is possible with hydraulic hoisting and therefore less manpower is required; and (4) health and safety conditions will be improved.

Optimizing graph-based patterns to extract biomedical events from the literature

PubMed Central

2015-01-01

In BioNLP-ST 2013 We participated in the BioNLP 2013 shared tasks on event extraction. Our extraction method is based on the search for an approximate subgraph isomorphism between key context dependencies of events and graphs of input sentences. Our system was able to address both the GENIA (GE) task focusing on 13 molecular biology related event types and the Cancer Genetics (CG) task targeting a challenging group of 40 cancer biology related event types with varying arguments concerning 18 kinds of biological entities. In addition to adapting our system to the two tasks, we also attempted to integrate semantics into the graph matching scheme using a distributional similarity model for more events, and evaluated the event extraction impact of using paths of all possible lengths as key context dependencies beyond using only the shortest paths in our system. We achieved a 46.38% F-score in the CG task (ranking 3rd) and a 48.93% F-score in the GE task (ranking 4th). After BioNLP-ST 2013 We explored three ways to further extend our event extraction system in our previously published work: (1) We allow non-essential nodes to be skipped, and incorporated a node skipping penalty into the subgraph distance function of our approximate subgraph matching algorithm. (2) Instead of assigning a unified subgraph distance threshold to all patterns of an event type, we learned a customized threshold for each pattern. (3) We implemented the well-known Empirical Risk Minimization (ERM) principle to optimize the event pattern set by balancing prediction errors on training data against regularization. When evaluated on the official GE task test data, these extensions help to improve the extraction precision from 62% to 65%. However, the overall F-score stays equivalent to the previous performance due to a 1% drop in recall. PMID:26551594

Effects of Anesthesia

MedlinePlus

Skip to content Menu Anesthesia 101 Pain Management Preparing for Surgery Stories Resources About Policymakers Media ASA Member Toolkit Anesthesia 101 Effects of Anesthesia Explore this page: Effects of Anesthesia ...

Personalizing the Approach to Childhood Asthma

MedlinePlus

American Academy of Allergy Asthma & Immunology Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide Conditions Dictionary Just ...

Drug Facts: Anabolic Steroids

MedlinePlus

Skip to main content En español Researchers Medical & Health Professionals Patients & ... Medicines Prescription Medicines Steroids (Anabolic) Synthetic Cannabinoids (K2/Spice) Synthetic Cathinones (Bath Salts) Tobacco/Nicotine ...

What about Breastfeeding?

MedlinePlus

... Fundraising Ideas Vehicle Donation Volunteer Efforts What about Breastfeeding? skip to submenu What We Do Cleft & Craniofacial Educational Materials What about Breastfeeding? To download the PDF version of this factsheet, ...

Salicylic acids

PubMed Central

Hayat, Shamsul; Irfan, Mohd; Wani, Arif; Nasser, Alyemeni; Ahmad, Aqil

2012-01-01

Salicylic acid is well known phytohormone, emerging recently as a new paradigm of an array of manifestations of growth regulators. The area unleashed yet encompassed the applied agriculture sector to find the roles to strengthen the crops against plethora of abiotic and biotic stresses. The skipped part of integrated picture, however, was the evolutionary insight of salicylic acid to either allow or discard the microbial invasion depending upon various internal factors of two interactants under the prevailing external conditions. The metabolic status that allows the host invasion either as pathogenesis or symbiosis with possible intermediary stages in close systems has been tried to underpin here. PMID:22301975

Cassini-Huygens Maneuver Experience: Ending the Prime Mission

NASA Technical Reports Server (NTRS)

Goodson, Troy D.; Ballard, Christopher G.; Gist, Emily M.; Hahn, Yungsun; Stumpf, Paul W.; Wagner, Sean V.; Williams, Powtawche N.

2008-01-01

The Cassini-Huygens spacecraft was launched in 1997 on a mission to observe Saturn and its many moons. After a seven-year cruise, it entered a Saturnian orbit for a four-year, prime mission. This paper highlights significant maneuver activities performed during the last year of the prime mission. Specifically, results of 42 recent maneuvers are presented. Many maneuvers have been skipped, saving fuel and flight team effort. The system has performed more accurately than the pre-launch expectations and requirements. This is in large part why the Cassini-Huygens spacecraft has been navigated with tremendous success during the prime mission.

Modeling the structure and operation of drug supply chains: The case of cocaine and heroin in Italy and Slovenia.

PubMed

Caulkins, Jonathan P; Disley, Emma; Tzvetkova, Marina; Pardal, Mafalda; Shah, Hemali; Zhang, Xiaoke

2016-05-01

Multiple layers of dealers connect international drug traffickers to users. The fundamental activity of these dealers is buying from higher-level dealers and re-selling in smaller quantities at the next lower market level. Each instance of this can be viewed as completing a drug dealing "cycle". This paper introduces an approach for combining isolated accounts of such cycles into a coherent model of the structure, span, and profitability of the various layers of the domestic supply chain for illegal drugs. The approach is illustrated by synthesizing data from interviews with 116 incarcerated dealers to elucidate the structure and operation of distribution networks for cocaine and heroin in Italy and Slovenia. Inmates' descriptions of cycles in the Italian cocaine market suggest fairly orderly networks, with reasonably well-defined market levels. The Italian heroin market appears to have more "level-jumpers" who skip a market level by making a larger number of sales per cycle, with each sale being of a considerably smaller weight. Slovenian data are sparser, but broadly consistent. Incorporating prices allows calculation of how much of the revenue from retail sales is retained by dealers at each market level. In the Italian cocaine market, both retail sellers and the international supply chain outside of Italy each appear to receive about 30-40% of what users spend, with the remaining 30% going to higher-level dealers operating in Italy (roughly 10% to those at the multi-kilo level and 20% to lower level wholesale dealers). Factoring in cycle frequencies permits rough estimation of the number of organizations at each market level per billion euros in retail sales, and of annual net revenues for organizations at each level. These analyses provide an approach to gaining insight into the structure and operation of the supply chain for illegal drugs. They also illustrate the value of two new graphical tools for describing illicit drug supply chains and hint at possible biases in how respondents describe their drug dealing activities. Copyright © 2016 Elsevier B.V. All rights reserved.

Simple adaptive control system design for a quadrotor with an internal PFC

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mizumoto, Ikuro; Nakamura, Takuto; Kumon, Makoto

2014-12-10

The paper deals with an adaptive control system design problem for a four rotor helicopter or quadrotor. A simple adaptive control design scheme with a parallel feedforward compensator (PFC) in the internal loop of the considered quadrotor will be proposed based on the backstepping strategy. As is well known, the backstepping control strategy is one of the advanced control strategy for nonlinear systems. However, the control algorithm will become complex if the system has higher order relative degrees. We will show that one can skip some design steps of the backstepping method by introducing a PFC in the inner loopmore » of the considered quadrotor, so that the structure of the obtained controller will be simplified and a high gain based adaptive feedback control system will be designed. The effectiveness of the proposed method will be confirmed through numerical simulations.« less

Thrombocytopenia

MedlinePlus

Skip to main content U.S. Department of Health & Human Services Health Topics Health Topics A-Z Clinical Trials Publications and Resources Health Education and Awareness The Science Science Home Blood Disorders and ...

User account | National Agricultural Library

Science.gov Websites

Skip to main content Home National Agricultural Library United States Department of Agriculture Ag | Agricultural Research Service | Plain Language | FOIA | Accessibility Statement | Information Quality | Privacy

Why Do I Fight with My Parents So Much?

MedlinePlus

[Skip to Content] for Parents Parents site Sitio para padres General Health Growth & Development Infections Diseases & Conditions Pregnancy & Baby Nutrition & Fitness Emotions & Behavior School & Family ...

About Face

MedlinePlus Videos and Cool Tools

Skip to Content Menu Closed (Tap to Open) Home Interviews Our Stories Search All Videos PTSD Basics PTSD Treatment What is AboutFace? Resources for Professionals Get Help Home Watch Interviews Our ...

Health Consequences of Drug Misuse

MedlinePlus

Skip to main content En español Researchers Medical & Health Professionals Patients & ... Medicines Prescription Medicines Steroids (Anabolic) Synthetic Cannabinoids (K2/Spice) Synthetic Cathinones (Bath Salts) Tobacco/Nicotine ...

Gene Variants Reduce Opioid Risks

MedlinePlus

Skip to main content En español Researchers Medical & Health Professionals Patients & ... Medicines Prescription Medicines Steroids (Anabolic) Synthetic Cannabinoids (K2/Spice) Synthetic Cathinones (Bath Salts) Tobacco/Nicotine ...

Cigarettes and Other Tobacco Products

MedlinePlus

Skip to main content En español Researchers Medical & Health Professionals Patients & ... Medicines Prescription Medicines Steroids (Anabolic) Synthetic Cannabinoids (K2/Spice) Synthetic Cathinones (Bath Salts) Tobacco/Nicotine ...

Drugs + HIV, Learn the Link

MedlinePlus

Skip to main content En español Researchers Medical & Health Professionals Patients & ... Medicines Prescription Medicines Steroids (Anabolic) Synthetic Cannabinoids (K2/Spice) Synthetic Cathinones (Bath Salts) Tobacco/Nicotine ...

Rescue of cardiomyopathy through U7snRNA-mediated exon skipping in Mybpc3-targeted knock-in mice.

PubMed

Gedicke-Hornung, Christina; Behrens-Gawlik, Verena; Reischmann, Silke; Geertz, Birgit; Stimpel, Doreen; Weinberger, Florian; Schlossarek, Saskia; Précigout, Guillaume; Braren, Ingke; Eschenhagen, Thomas; Mearini, Giulia; Lorain, Stéphanie; Voit, Thomas; Dreyfus, Patrick A; Garcia, Luis; Carrier, Lucie

2013-07-01

Exon skipping mediated by antisense oligoribonucleotides (AON) is a promising therapeutic approach for genetic disorders, but has not yet been evaluated for cardiac diseases. We investigated the feasibility and efficacy of viral-mediated AON transfer in a Mybpc3-targeted knock-in (KI) mouse model of hypertrophic cardiomyopathy (HCM). KI mice carry a homozygous G>A transition in exon 6, which results in three different aberrant mRNAs. We identified an alternative variant (Var-4) deleted of exons 5-6 in wild-type and KI mice. To enhance its expression and suppress aberrant mRNAs we designed AON-5 and AON-6 that mask splicing enhancer motifs in exons 5 and 6. AONs were inserted into modified U7 small nuclear RNA and packaged in adeno-associated virus (AAV-U7-AON-5+6). Transduction of cardiac myocytes or systemic administration of AAV-U7-AON-5+6 increased Var-4 mRNA/protein levels and reduced aberrant mRNAs. Injection of newborn KI mice abolished cardiac dysfunction and prevented left ventricular hypertrophy. Although the therapeutic effect was transient and therefore requires optimization to be maintained over an extended period, this proof-of-concept study paves the way towards a causal therapy of HCM. © 2013 The Authors. Published by John Wiley and Sons, Ltd on behalf of EMBO.

Two-Exon Skipping within MLPH Is Associated with Coat Color Dilution in Rabbits

PubMed Central

Lehner, Stefanie; Gähle, Marion; Dierks, Claudia; Stelter, Ricarda; Gerber, Jonathan; Brehm, Ralph; Distl, Ottmar

2013-01-01

Coat color dilution turns black coat color to blue and red color to cream and is a characteristic in many mammalian species. Matings among Netherland Dwarf, Loh, and Lionhead Dwarf rabbits over two generations gave evidence for a monogenic autosomal recessive inheritance of coat colour dilution. Histological analyses showed non-uniformly distributed, large, agglomerating melanin granules in the hair bulbs of coat color diluted rabbits. We sequenced the cDNA of MLPH in two dilute and one black rabbit for polymorphism detection. In both color diluted rabbits, skipping of exons 3 and 4 was present resulting in altered amino acids at p.QGL[37-39]QWA and a premature stop codon at p.K40*. Sequencing of genomic DNA revealed a c.111-5C>A splice acceptor mutation within the polypyrimidine tract of intron 2 within MLPH. This mutation presumably causes skipping of exons 3 and 4. In 14/15 dilute rabbits, the c.111-5C>A mutation was homozygous and in a further dilute rabbit, heterozygous and in combination with a homozygous frame shift mutation within exon 6 (c.585delG). In conclusion, our results demonstrated a colour dilution associated MLPH splice variant causing a strongly truncated protein (p.Q37QfsX4). An involvement of further MLPH-associated mutations needs further investigations. PMID:24376820

Breakfast skipping in prepubertal obese children: hormonal, metabolic and cognitive consequences.

PubMed

Maffeis, C; Fornari, E; Surano, M G; Comencini, E; Corradi, M; Tommasi, M; Fasan, I; Cortese, S

2012-03-01

Skipping breakfast influences cognitive performance. The aim of our study was to investigate the relationship between the variation of hormonal and metabolic postprandial parameters induced by breakfast consumption or fasting and cognitive performance in obese children. Cross-sectional study for repeated measures. Memory and attention assessment tests, hormones and nutrient oxidation were measured before and after consuming breakfast vs fasting in 10 prepubertal obese children. Fasting induced a significant (P<0.05) increase of the Overall Index of the Continuous Performance Test II (a global index of inattention) and the Test of Memory and Learning Word Selective Reminding (a test of verbal memory), whereas no changes were found after breakfast. Fasting was associated with a reduction of insulin and an increase in glucagon, with no changes in glucose. The increase in inattention was associated with a reduction of carbohydrate oxidation (ρ=-0.66, P<0.05). We found no difference in the area under the curve of peptide YY and glucagon-like peptide-1 after breakfast or fasting, whereas Ghrelin was significantly lower. No association between postprandial hormone variation and cognitive performance was found. Attention and visual memory performance in the morning were reduced when the children skipped breakfast. No association was found with hormones or metabolic changes, but we did find an association with a reduction of carbohydrate oxidation. Nevertheless, these preliminary findings need confirmation in larger sample size.

Effects of different modes of exercise on appetite and appetite-regulating hormones.

PubMed

Kawano, Hiroshi; Mineta, Mayuko; Asaka, Meiko; Miyashita, Masashi; Numao, Shigeharu; Gando, Yuko; Ando, Takafumi; Sakamoto, Shizuo; Higuchi, Mitsuru

2013-07-01

The present study determined the changes in appetite and appetite-regulating gut hormones during and following bouts of both rope skipping exercise (weight-bearing) and bicycle ergometer exercise (non-weight-bearing). After a 12-h fast, 15 young men (mean ± SD, age 24.4 ± 1.7 yrs, maximal oxygen uptake 47.0 ± 6.5 mL/kg/min) participated in three 160 min trials: (1) rope skipping exercise (295 ± 40 kcal, 3 sets × 10 min with 5-min interval, then rested for 120 min); (2) bicycle ergometer exercise (288 ± 36 kcal, 3 sets × 10 min with 5-min interval, then rested for 120 min); (3) control (rested for 160 min). Ratings of perceived hunger and acylated ghrelin were suppressed and total peptide YY (PYY) were increased during and immediately after exercise in both exercise trials, but glucagon liked peptide-1 was not changed. Furthermore, suppressed hunger during rope skipping exercise was greater than that during bicycle ergometer exercise, but there were no differences in acylated ghrelin and total PYY. These results indicate that weight-bearing exercise has a greater exercise-induced appetite suppressive effect compared with non-weight-bearing exercise, and both forms of exercise lowered acylated ghrelin and increased total PYY, but the changes did not differ significantly between exercise modes. Copyright © 2013 Elsevier Ltd. All rights reserved.

Ultrasonic multi-skip tomography for pipe inspection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Volker, Arno; Zon, Tim van

The inspection of wall loss corrosion is difficult at pipe supports due to limited accessibility. The recently developed ultrasonic Multi-Skip screening technique is suitable for this problem. The method employs ultrasonic transducers in a pitch-catch geometry positioned on opposite sides of the pipe support. Shear waves are transmitted in the axial direction within the pipe wall, reflecting multiple times between the inner and outer surfaces before reaching the receivers. Along this path, the signals accumulate information on the integral wall thickness (e.g., via variations in travel time). The method is very sensitive in detecting the presence of wall loss, butmore » it is difficult to quantify both the extent and depth of the loss. Multi-skip tomography has been developed to reconstruct the wall thickness profile along the axial direction of the pipe. The method uses model-based full wave field inversion; this consists of a forward model for predicting the measured wave field and an iterative process that compares the predicted and measured wave fields and minimizes the differences with respect to the model parameters (i.e., the wall thickness profile). Experimental results are very encouraging. Various defects (slot and flat bottom hole) are reconstructed using the tomographic inversion. The general shape and width are well recovered. The current sizing accuracy is in the order of 1 mm.« less

A Healthy Eating Identity is Associated with Healthier Food Choice Behaviors Among U.S. Army Soldiers.

PubMed

Jayne, Julianna M; Frongillo, Edward A; Torres-McGehee, Toni M; Emerson, Dawn M; Glover, Saundra H; Blake, Christine E

2018-04-04

Promoting healthy eating among Soldiers is a priority to the Army due to the link between nutrition and performance. The Army typically uses nutrition education to encourage Soldiers to make healthier food choices with low emphasis on other psychosocial determinants of food choice behaviors. Drill Sergeant Candidates (n = 575) completed surveys assessing nutrition knowledge, eating identity type, and food choice behaviors including fruit and vegetable intake, skipping meals, and eating out frequency. In multiple linear regression models using full-information maximum likelihood estimation while controlling for race/ethnicity, education, and marital status, we examined relationships between nutrition knowledge, a healthy eating identity, and Soldiers' food choice behaviors. The study was approved by the Department of Defense and University of South Carolina's Institutional Review Boards. A healthy eating identity was positively associated with greater fruit and vegetable consumption (p < 0.05), and negatively associated with skipping meals and eating out frequency (p < 0.05). Nutrition knowledge was negatively associated with skipping meals (p < 0.05). Findings suggest that fostering a healthy eating identity may be more effective for promoting healthy food choice behaviors than nutrition education alone. Determining if various points in a Soldier's career could be leveraged to influence a healthy eating identity and behaviors could be an important strategy to improve compliance with health promotion programs.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Asai, Hirohide; Hirano, Makito; Kiriyama, Takao

Intranuclear events due to mutations in the Parkin gene remain elusive in autosomal recessive juvenile parkinsonism (ARJP). We identified a mutant PARKIN protein in fibroblast cultures from a pair of siblings with ARJP who were homozygous for the exon 4-deleted Parkin gene. Disease was mild in one patient and debilitating in the other. The detected mutant, encoded by a transcript lacking exon 3 as well as exon 4, is an in-frame deletion that removes 121 aa, resulting in a 344-aa protein (PaDel3,4). Cell culture and transfection studies revealed negative correlations between expression levels of PaDel3,4 and those of cell cyclemore » proteins, including cyclin E, CDK2, ppRb, and E2F-1, and demonstrated that GFP-PaDel3,4 entered nucleus and ubiquitinated cyclin E as a part of SCF{sup hSel-10} ligase complex in the patient cells. In addition, nuclear localization signal-tagged PaDel3,4 expressed in the transfected patient cells most effectively ubiquitinated cyclin E and reduced DNA damage, protecting cells from oxidative stress. Antisense-oligonucleotide treatment promoted skipping of exon 3 and thus generated PaDel3,4, increasing cell survival. Collectively, we propose that naturally- and experimentally-induced exon skipping at least partly restores the mutant Parkin gene deficit, providing a molecular basis for the development of therapeutic exon skipping.« less

Impact of Breakfast Skipping and Breakfast Choice on the Nutrient Intake and Body Mass Index of Australian Children

PubMed Central

Fayet-Moore, Flavia; Kim, Jean; Sritharan, Nilani; Petocz, Peter

2016-01-01

Recent data on breakfast consumption among Australian children are limited. This study examined the impact of breakfast skipping and breakfast type (cereal or non-cereal) on nutrient intakes, likelihood of meeting nutrient targets and anthropometric measures. A secondary analysis of two 24-h recall data from the 2007 Australian National Children’s Nutrition and Physical Activity Survey was conducted (2–16 years; n = 4487) to identify (a) breakfast skippers and (b) breakfast consumers, with breakfast consumers further sub-divided into (i) non-cereal and (ii) cereal consumers. Only 4% skipped breakfast and 59% of skippers were 14–16 years. Breakfast consumers had significantly higher intakes of calcium and folate, and significantly lower intakes of total fat than breakfast skippers. Cereal consumers were more likely to meet targets and consume significantly higher fibre, calcium, iron, had significantly higher intakes of folate, total sugars and carbohydrate, and significantly lower intakes of total fat and sodium than non-cereal consumers. The prevalence of overweight was lower among breakfast consumers compared to skippers, and among cereal consumers compared to-cereal consumers (p < 0.001), while no significant differences were observed for mean body mass index (BMI), BMI z-score, waist circumference and physical activity level across the categories. Breakfast and particularly breakfast cereal consumption contributes important nutrients to children’s diets. PMID:27517957

Violence

MedlinePlus

... Illness & disability Drugs, alcohol & smoking Your feelings Relationships Bullying Safety Your future Environmental health Skip section navigation ( ... Robbery Using a weapon Sexual assault and rape Bullying Effects of youth violence top Every year, thousands ...

Learning about Autism

MedlinePlus

Skip to main content Learning About Autism Enter Search Term(s): Español Research Funding An Overview Bioinformatics Current Grants Education and Training Funding Extramural Research News Features Funding Divisions Funding ...

Impact of Food Allergy on Asthma in Children

MedlinePlus

American Academy of Allergy Asthma & Immunology Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide Conditions Dictionary Just ...

Simplifying Effective Treatment of Chronic Hives in Children

MedlinePlus

American Academy of Allergy Asthma & Immunology Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide Conditions Dictionary Just ...

Learning about Thalassemia

MedlinePlus

Skip to main content Learning About Thalassemia Enter Search Term(s): Español Research Funding An Overview Bioinformatics Current Grants Education and Training Funding Extramural Research News Features Funding Divisions Funding ...

DNA Microarray Technology

MedlinePlus

Skip to main content DNA Microarray Technology Enter Search Term(s): Español Research Funding An Overview Bioinformatics Current Grants Education and Training Funding Extramural Research News Features Funding Divisions Funding ...

SpaceX Dragon Parachute Test

NASA Image and Video Library

2018-03-04

SpaceX performed its fourteenth overall parachute test supporting Crew Dragon development. This most recent exercise was the first of several planned parachute system qualification tests ahead of the spacecraft’s first crewed flight and resulted in the successful touchdown of Crew Dragon’s parachute system. During this test, a C-130 aircraft transported the parachute test vehicle, designed to achieve the maximum speeds that Crew Dragon could experience on re-entry, over the Mojave Desert in Southern California and dropped the vehicle from an altitude of 25,000 feet. The test demonstrated an off-nominal situation, deploying only one of the two drogue chutes and intentionally skipping a reefing stage on one of the four main parachutes, proving a safe landing in such a contingency scenario.

Balancing Acts

MedlinePlus

... frames were skipping. It was disorienting," the Pittsburgh accountant recalls. The dizziness didn't go away. Finally ... treatment. "Happy to make a small contribution to public health," he agreed to participate in a clinical ...

Anesthesia Awareness (Waking Up) During Surgery

MedlinePlus

Skip to content Menu Anesthesia 101 Pain Management Preparing for Surgery Stories Resources About Policymakers Media ASA Member Toolkit Risks Anesthesia Awareness (Waking Up) During Surgery Explore this page: Anesthesia ...

Outpatient Surgery

MedlinePlus

Skip to content Menu Anesthesia 101 Pain Management Preparing for Surgery Stories Resources About Policymakers Media ASA Member Toolkit Preparation Outpatient Surgery Explore this page: Outpatient Surgery What types of anesthesia are available? How ...

What Is Narcolepsy?

MedlinePlus

Skip to main content U.S. Department of Health & Human Services Health Topics Health Topics A-Z Clinical Trials Publications and Resources Health Education and Awareness The Science Science Home Blood Disorders and ...

Botanical Dietary Supplements: Background Information

MedlinePlus

Skip navigation links U.S. Department of Health & Human Services HHS.gov National Institutes of Health NIH.gov Font Size Decrease Font Size Increase Font Size Strengthening Knowledge and Understanding of ...

Predicting Asthma in Preschool Children with Asthma-Like Symptoms

MedlinePlus

American Academy of Allergy Asthma & Immunology Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide Conditions Dictionary Just ...

The Science of Drug Use: Discussion Points

MedlinePlus

Skip to main content En español Researchers Medical & Health Professionals Patients & ... Medicines Prescription Medicines Steroids (Anabolic) Synthetic Cannabinoids (K2/Spice) Synthetic Cathinones (Bath Salts) Tobacco/Nicotine ...

Drug Use and Viral Infections (HIV, Hepatitis)

MedlinePlus

Skip to main content En español Researchers Medical & Health Professionals Patients & ... Medicines Prescription Medicines Steroids (Anabolic) Synthetic Cannabinoids (K2/Spice) Synthetic Cathinones (Bath Salts) Tobacco/Nicotine ...

Feeling Stressed

MedlinePlus

... Illness & disability Drugs, alcohol & smoking Your feelings Relationships Bullying Safety Your future Environmental health Skip section navigation ( ... weight Problems with friends or other relationships Being bullied Living in a dangerous neighborhood Peer pressure to ...

Exon 11 skipping of SCN10A coding for voltage-gated sodium channels in dorsal root ganglia

PubMed Central

Schirmeyer, Jana; Szafranski, Karol; Leipold, Enrico; Mawrin, Christian; Platzer, Matthias; Heinemann, Stefan H

2014-01-01

The voltage-gated sodium channel NaV1.8 (encoded by SCN10A) is predominantly expressed in dorsal root ganglia (DRG) and plays a critical role in pain perception. We analyzed SCN10A transcripts isolated from human DRGs using deep sequencing and found a novel splice variant lacking exon 11, which codes for 98 amino acids of the domain I/II linker. Quantitative PCR analysis revealed an abundance of this variant of up to 5–10% in human, while no such variants were detected in mouse or rat. Since no obvious functional differences between channels with and without the exon-11 sequence were detected, it is suggested that SCN10A exon 11 skipping in humans is a tolerated event. PMID:24763188

In-center hemodialysis attendance: patient perceptions of risks, barriers, and recommendations.

PubMed

Chenitz, Kara B; Fernando, Michael; Shea, Judy A

2014-04-01

Missed hemodialysis treatments lead to increased morbidity and mortality in the end-stage renal disease population. Little is known about why patients have difficulty attending their scheduled in-center dialysis treatments. Semistructured interviews with 15 adherent and 15 nonadherent hemodialysis patients were conducted to determine patients' attitudes about dialysis, health beliefs and risk perception regarding missed treatments, barriers and facilitators to hemodialysis attendance, and recommendations to improve the system to facilitate dialysis attendance. Average time on dialysis was 2.5 years for the nonadherent group and 7.3 years in the adherent group. In both groups, patients felt that dialysis is life-saving and a necessity. A substantial number of patients in both groups understood that missing hemodialysis treatments is dangerous and several patients could clearly communicate the risk of skipping. The most common barriers to hemodialysis were inadequate or unreliable transportation (mentioned in both groups) and a lack of motivation to get to dialysis or that dialysis is not a priority (typically mentioned by the nonadherent group). Facilitators to hemodialysis attendance included explanations from the health care team regarding the risk of skipping and relationships with other dialysis patients. Patient recommendations to improve dialysis attendance included continued education about the risk of poor attendance and more accessible transportation. Patients did not feel that home dialysis would improve adherence. Hemodialysis patients must adhere to a complex and burdensome regimen. Through the elucidation of barriers and facilitators to hemodialysis attendance and through specific patient recommendations, at least three interventions may be further investigated to improve hemodialysis attendance: Improvement of the transportation system, education and supportive encouragement from the health care team, and peer support mentorship. © 2014 International Society for Hemodialysis.

Indoor Air Quality

MedlinePlus

... policy . Skip to main content ABOUT US OUR INITIATIVES LUNG HEALTH & DISEASES SUPPORT & COMMUNITY STOP SMOKING GET ... Supporters Careers Contact Us Corporate Ethics Reporting OUR INITIATIVES LUNG FORCE Saved By The Scan Research Healthy ...

What Is Aplastic Anemia?

MedlinePlus

Skip to main content U.S. Department of Health & Human Services Health Topics Health Topics A-Z Clinical Trials Publications and Resources Health Education and Awareness The Science Science Home Blood Disorders and ...

What Causes POI?

MedlinePlus

Skip to main content US Department of Health and Human Services National Institutes of Health Directory Follow follow us on Facebook follow us on Twitter follow us on Pinterest follow us on YouTube ...

User account | National Agricultural Library

Science.gov Websites

Skip to main content Home National Agricultural Library United States Department of Agriculture Ag registered trademark of Dries Buytaert. NAL Home | USDA.gov | Agricultural Research Service | Plain Language

National Agricultural Library | United States Department of Agriculture

Science.gov Websites

Skip to main content Home National Agricultural Library United States Department of Agriculture Ag | USDA.gov | Agricultural Research Service | Plain Language | FOIA | Accessibility Statement | Information

Sleep Quiz

MedlinePlus

Skip Navigation Bar Home Current Issue Past Issues Sleep Quiz Past Issues / Summer 2007 Table of Contents ... on. Photo: iStock Take the National Center on Sleep Disorders Research Sleep Quiz TRUE OR FALSE ? _____1. ...

Vaccines Stop Illness

MedlinePlus

Skip Navigation Bar Home Current Issue Past Issues Vaccines Stop Illness Past Issues / Spring 2008 Table of ... meningitis won't infect, cripple, or kill children. Vaccine Safety In light of recent questions about vaccine ...

American Macular Degeneration Foundation

MedlinePlus

... 3) non-profit, publicly supported organization. Contributions are tax deductible to the extent allowed by law. Skip ... supported organization (Charity ID #04-3274007). Contributions are tax deductible to the extent allowed by law.

Digital rectal exam

MedlinePlus

Skip navigation U.S. National Library of Medicine The navigation menu has been collapsed. Menu ... exam URL of this page: //medlineplus.gov/ency/article/007069.htm Digital rectal exam To use the sharing features ...

Genetics, Disease Prevention and Treatment

MedlinePlus

Skip to main content FAQ About Genetics, Disease Prevention and Treatment Enter Search Term(s): Español Research Funding An Overview Bioinformatics Current Grants Education and Training Funding Extramural Research News ...

HIV Infection Accelerates Hepatitis C-Related Liver Fibrosis

MedlinePlus

Skip to main content En español Researchers Medical & Health Professionals Patients & ... Medicines Prescription Medicines Steroids (Anabolic) Synthetic Cannabinoids (K2/Spice) Synthetic Cathinones (Bath Salts) Tobacco/Nicotine ...

HIV Medication Adherence

MedlinePlus

... AIDS Drugs Clinical Trials Apps skip to content HIV Treatment Home Understanding HIV/AIDS Fact Sheets HIV ... 4 p.m. ET) Send us an email HIV Medication Adherence Last Reviewed: January 17, 2018 Key ...

Silicon Chemical Vapor Deposition Process Using a Half-Inch Silicon Wafer for Minimal Manufacturing System

NASA Astrophysics Data System (ADS)

Li, Ning; Habuka, Hitoshi; Ikeda, Shin-ichi; Hara, Shiro

A chemical vapor deposition reactor for producing thin silicon films was designed and developed for achieving a new electronic device production system, the Minimal Manufacturing, using a half-inch wafer. This system requires a rapid process by a small footprint reactor. This was designed and verified by employing the technical issues, such as (i) vertical gas flow, (ii) thermal operation using a highly concentrated infrared flux, and (iii) reactor cleaning by chlorine trifluoride gas. The combination of (i) and (ii) could achieve a low heating power and a fast cooling designed by the heat balance of the small wafer placed at a position outside of the reflector. The cleaning process could be rapid by (iii). The heating step could be skipped because chlorine trifluoride gas was reactive at any temperature higher than room temperature.

Asthma Patients in US Overuse Quick-Relief Inhalers, Underuse Control Medications

MedlinePlus

American Academy of Allergy Asthma & Immunology Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide Conditions Dictionary Just ...

Frequently Asked Questions about Genetic Counseling

MedlinePlus

Skip to main content FAQ About Genetic Counseling Enter Search Term(s): Español Research Funding An Overview Bioinformatics Current Grants Education and Training Funding Extramural Research News Features Funding Divisions ...

Frequently Asked Questions about Genetic Testing

MedlinePlus

Skip to main content FAQ About Genetic Testing Enter Search Term(s): Español Research Funding An Overview Bioinformatics Current Grants Education and Training Funding Extramural Research News Features Funding Divisions ...

HIV and Hepatitis C

MedlinePlus

... AIDS Drugs Clinical Trials Apps skip to content HIV and Opportunistic Infections, Coinfections, and Conditions Home Understanding ... 4 p.m. ET) Send us an email HIV and Hepatitis C Last Reviewed: June 25, 2018 ...

HIV Treatment: The Basics

MedlinePlus

... AIDS Drugs Clinical Trials Apps skip to content HIV Treatment Home Understanding HIV/AIDS Fact Sheets HIV ... 4 p.m. ET) Send us an email HIV Treatment: The Basics Last Reviewed: March 22, 2018 ...

HIV and Hepatitis B

MedlinePlus

... AIDS Drugs Clinical Trials Apps skip to content HIV and Opportunistic Infections, Coinfections, and Conditions Home Understanding ... 4 p.m. ET) Send us an email HIV and Hepatitis B Last Reviewed: July 24, 2017 ...

Effects of Victimization and Violence on Suicidal Ideation and Behaviors Among Sexual Minority and Heterosexual Adolescents

PubMed Central

Everett, Bethany G.; Heath, Ryan D.; Elsaesser, Caitlin E.; Neilands, Torsten B.

2016-01-01

Abstract Purpose: Sexual minority youth (SMY) are at higher risk for victimization and suicide than are heterosexual youth (HY). Relatively little research has examined which types of victimization are most closely linked to suicide, which is necessary to develop targeted prevention interventions. The present study was conducted to address this deficit. Methods: The data come from the 2011 Chicago Youth Risk Behavior Survey (n = 1,907). Structural equation modeling (SEM) in Mplus evaluated the direct, indirect, and total effects of sexual orientation on a latent indicator of suicidal ideation and behaviors via seven types of victimization. Four indicators of victimization were school-specific (e.g., harassment due to sexual orientation or gender identity (SO/GID), bullying, threatened or injured with a weapon, and skipping school due to safety concerns), and three indicators assessed other types of victimization (e.g., electronic bullying, intimate partner violence, and sexual abuse). Results: Thirteen percent of youth were classified as SMY. Significantly more SMY than HY reported suicidal ideation (27.95% vs. 13.64%), a suicide plan (22.78% vs. 12.36%), and at least one suicide attempt (29.92% vs. 12.43%) in the past year (all P < .001). A greater percentage of SMY reported SO/GID-related harassment, skipping school, electronic bullying, and sexual abuse. Sexual orientation was not directly related to suicidal ideation and behaviors in SEM. Rather, SMY's elevated risk of suicidality functioned indirectly through two forms of school-based victimization: being threatened or injured with a weapon (B = .19, SE = .09, P ≤ .05) and experiencing SO/GID-specific harassment (B = .40, SE = .15, P ≤ .01). There also was a trend for SMY to skip school as a strategy to reduce suicide risk. Conclusion: Although SMY experience higher rates of victimization than do HY, school-based victimization that involves weapons or is due to one's SO/GID appear to be the most deleterious. That SMY may skip school to reduce their risk of suicidal ideation and behaviors is problematic, and schools should be encouraged to enact and enforce policies that explicitly protect SMY from victimization. PMID:26789401

Breakfast Skipping is Positively Associated With Incidence of Type 2 Diabetes Mellitus: Evidence From the Aichi Workers’ Cohort Study

PubMed Central

Uemura, Mayu; Yatsuya, Hiroshi; Hilawe, Esayas Haregot; Li, Yuanying; Wang, Chaochen; Chiang, Chifa; Otsuka, Rei; Toyoshima, Hideaki; Tamakoshi, Koji; Aoyama, Atsuko

2015-01-01

Background Skipping breakfast has been suspected as a risk factor for type 2 diabetes (T2DM), but the associations are not entirely consistent across ethnicities or sexes, and the issue has not been adequately addressed in the Japanese population. Methods We followed 4631 participants (3600 men and 1031 women) in a work-site cohort of participants aged 35–66 years in 2002 through 2011 for T2DM development. Frequency of eating breakfast was self-reported and was subsequently dichotomized to breakfast skippers, who eat breakfast 3–5 times/week or less, and to eaters. Cox proportional hazards models were used to adjust for potential confounding factors, including dietary factors, smoking and other lifestyles, body mass index (BMI), and fasting blood glucose (FBG) at baseline. Results During 8.9 years of follow-up, 285 T2DM cases (231 men and 54 women) developed. Compared to participants who reported eating breakfast every day, maximally-adjusted hazard ratios and 95% confidence intervals (CI) of those with the frequency of almost every day and 3–5, 1–2, and 0 days/week were: 1.06 (95% CI, 0.73–1.53), 2.07 (95% CI, 1.20–3.56), 1.37 (95% CI, 0.82–2.29), and 2.12 (95% CI, 1.19–3.76), respectively. In a dichotomized analysis, breakfast skipping was positively associated with T2DM incidence (maximally-adjusted hazard ratio 1.73; 95% CI, 1.24–2.42). The positive associations were found in both men and women, current and non-current smokers, normal weight and overweight (BMI ≥25 kg/m2), and normal glycemic status and impaired fasting glycemic status (FBG 110 to <126 mg/dL) individuals at baseline (Ps for interaction all >0.05). Conclusions The present study in middle-aged Japanese men and women suggests that skipping breakfast may increase the risk of T2DM independent of lifestyles and baseline levels of BMI and FBG. PMID:25787236

Effects of Victimization and Violence on Suicidal Ideation and Behaviors Among Sexual Minority and Heterosexual Adolescents.

PubMed

Bouris, Alida; Everett, Bethany G; Heath, Ryan D; Elsaesser, Caitlin E; Neilands, Torsten B

2016-04-01

Sexual minority youth (SMY) are at higher risk for victimization and suicide than are heterosexual youth (HY). Relatively little research has examined which types of victimization are most closely linked to suicide, which is necessary to develop targeted prevention interventions. The present study was conducted to address this deficit. The data come from the 2011 Chicago Youth Risk Behavior Survey (n = 1,907). Structural equation modeling (SEM) in Mplus evaluated the direct, indirect, and total effects of sexual orientation on a latent indicator of suicidal ideation and behaviors via seven types of victimization. Four indicators of victimization were school-specific (e.g., harassment due to sexual orientation or gender identity (SO/GID), bullying, threatened or injured with a weapon, and skipping school due to safety concerns), and three indicators assessed other types of victimization (e.g., electronic bullying, intimate partner violence, and sexual abuse). Thirteen percent of youth were classified as SMY. Significantly more SMY than HY reported suicidal ideation (27.95% vs. 13.64%), a suicide plan (22.78% vs. 12.36%), and at least one suicide attempt (29.92% vs. 12.43%) in the past year (all P < .001). A greater percentage of SMY reported SO/GID-related harassment, skipping school, electronic bullying, and sexual abuse. Sexual orientation was not directly related to suicidal ideation and behaviors in SEM. Rather, SMY's elevated risk of suicidality functioned indirectly through two forms of school-based victimization: being threatened or injured with a weapon (B = .19, SE = .09, P ≤ .05) and experiencing SO/GID-specific harassment (B = .40, SE = .15, P ≤ .01). There also was a trend for SMY to skip school as a strategy to reduce suicide risk. Although SMY experience higher rates of victimization than do HY, school-based victimization that involves weapons or is due to one's SO/GID appear to be the most deleterious. That SMY may skip school to reduce their risk of suicidal ideation and behaviors is problematic, and schools should be encouraged to enact and enforce policies that explicitly protect SMY from victimization.

Beneficial effects of a higher-protein breakfast on the appetitive, hormonal, and neural signals controlling energy intake regulation in overweight/obese, “breakfast-skipping,” late-adolescent girls123

PubMed Central

Ortinau, Laura C; Douglas, Steve M; Hoertel, Heather A

2013-01-01

Background: Breakfast skipping is a common dietary habit practiced among adolescents and is strongly associated with obesity. Objective: The objective was to examine whether a high-protein (HP) compared with a normal-protein (NP) breakfast leads to daily improvements in appetite, satiety, food motivation and reward, and evening snacking in overweight or obese breakfast-skipping girls. Design: A randomized crossover design was incorporated in which 20 girls [mean ± SEM age: 19 ± 1 y; body mass index (in kg/m2): 28.6 ± 0.7] consumed 350-kcal NP (13 g protein) cereal-based breakfasts, consumed 350-kcal HP egg- and beef-rich (35 g protein) breakfasts, or continued breakfast skipping (BS) for 6 d. On day 7, a 10-h testing day was completed that included appetite and satiety questionnaires, blood sampling, predinner food cue–stimulated functional magnetic resonance imaging brain scans, ad libitum dinner, and evening snacking. Results: The consumption of breakfast reduced daily hunger compared with BS with no differences between meals. Breakfast increased daily fullness compared with BS, with the HP breakfast eliciting greater increases than did the NP breakfast. HP, but not NP, reduced daily ghrelin and increased daily peptide YY concentrations compared with BS. Both meals reduced predinner amygdala, hippocampal, and midfrontal corticolimbic activation compared with BS. HP led to additional reductions in hippocampal and parahippocampal activation compared with NP. HP, but not NP, reduced evening snacking of high-fat foods compared with BS. Conclusions: Breakfast led to beneficial alterations in the appetitive, hormonal, and neural signals that control food intake regulation. Only the HP breakfast led to further alterations in these signals and reduced evening snacking compared with BS, although no differences in daily energy intake were observed. These data suggest that the addition of breakfast, particularly one rich in protein, might be a useful strategy to improve satiety, reduce food motivation and reward, and improve diet quality in overweight or obese teenage girls. This trial was registered at clinicaltrials.gov as NCT01192100. PMID:23446906

Eating patterns and leisure-time exercise among active duty military personnel: comparison to the Healthy People objectives.

PubMed

Smith, Tracey J; Dotson, Laura E; Young, Andrew J; White, Alan; Hadden, Louise; Bathalon, Gaston P; Funderburk, LesLee; Marriott, Bernadette P

2013-07-01

To assess whether active duty military personnel meet Healthy People 2010 objectives for physical activity and fruit, vegetable, and whole-grain intake; the relationship of select demographic characteristics, lifestyle factors (eg, smoking), and eating patterns (eg, frequency and location of meals) on achieving diet and exercise-related Healthy People 2010 objectives; and the relationship of eating patterns to self-reported weight gain. Secondary data from 15,747 participants in the 2005 Department of Defense Health Related Behaviors Survey was analyzed. More than 57% of respondents met the Healthy People 2010 guidelines for moderate or vigorous leisure exercise but only 3% reported eating fruit (once), vegetables (3 times), and whole grains (3 times) daily. Individuals who reported gaining weight during the previous year were more likely to skip breakfast and eat at, or from, a restaurant ≥2 times per week compared with those who did not gain weight (P<0.001). Regression analysis indicated that women were more likely to eat fruits (odds ratio [OR] 1.25) and vegetables (OR 1.20) and less likely than men to eat whole grains (OR 0.76) or engage in moderate or vigorous exercise (OR 0.71). Military personnel who skipped breakfast ≥2 times per week (OR 0.45) or ate at a restaurant/takeout food (OR 0.54) ≥2 times per week were significantly less likely to meet Healthy People 2010 guidelines for food intake (defined as achieving a daily intake of one or more fruits, three or more vegetables, and three or more servings of whole grains) and exercise (OR 0.88 and 0.82, respectively). Although the majority of military personnel met guidelines for physical activity, their intake of fruits, vegetables, and whole grains was suboptimal. Skipping breakfast and eating at, or from, restaurants were risk factors for poor nutrient intake and associated with weight gain. These data suggest that skipping breakfast and eating out deter achieving Healthy People 2010 objectives and provide targets for military programs to promote achieving these objectives. Copyright © 2013 Academy of Nutrition and Dietetics. Published by Elsevier Inc. All rights reserved.

NASA CEV Reference Entry GN&C System and Analysis

NASA Technical Reports Server (NTRS)

Munday, S.; Madsen, C.; Broome, J.; Gay, R.; Tigges, M.; Strahan, A.

2007-01-01

As part of its overall objectives, the Orion spacecraft will be required to perform entry and Earth landing functions for Low Earth Orbit (LEO) and Lunar missions. Both of these entry scenarios will begin with separation of the Service Module (SM), making them unique from other Orion mission phases in that only the Command Module (CM) portion of the Crew Exploration Vehicle (CEV) will be involved, requiring a CM specific Guidance, Navigation and Control (GN&C) system. Also common to these mission scenarios will be the need for GN&C to safely return crew (or cargo) to earth within the dynamic thermal and structural constraints of entry and within acceptable accelerations on the crew, utilizing the limited aerodynamic performance of the CM capsule. The lunar return mission could additionally require an initial atmospheric entry designed to support a precision skip and second entry, all to maximize downrange performance and ensure landing in the United States. This paper describes the Entry GN&C reference design, developed by the NASA-led team, that supports these entry scenarios and that was used to validate the Orion System requirements. Description of the reference design will include an overview of the GN&C functions, avionics, and effectors and will relate these to the specific design drivers of the entry scenarios, as well as the desire for commonality in vehicle systems to support the different missions. The discussion will also include the requirement for an Emergency Entry capability beyond that of the nominal performance of the multi-string GNC system, intended to return the crew to the earth in a survivable but unguided manner. Finally, various analyses will be discussed, including those completed to support validation efforts of the current CEV requirements, along with those on-going and planned with the intention to further refine the requirements and to support design development work in conjunction with the prime contractor. Some of these ongoing analyses will include work to size effectors (jets) and fuel budgets, to refine skip entry concepts, to characterize navigation performance and uncertainties, to provide for SM disposal offshore and to identify requirements to support target site selection.

eBenefits: My Gateway to Benefits Information

MedlinePlus

... of the Department of Veterans Affairs and the Department of Defense A Service of the Department of Veterans Affairs and the Department of Defense Log in Register Skip Navigation Main Menu Apply ...

Anaphylaxis

MedlinePlus

... Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide ... Expert Search Search AAAAI Breadcrumb navigation Home ▸ Conditions & Treatments ▸ Allergies ▸ Anaphylaxis ... Anaphylaxis Overview Symptoms & Diagnosis Treatment & Management ...

Fire Ant Allergy

MedlinePlus

... Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide ... your condition and determine the best form of treatment. Allergy shots (immunotherapy) may be effective long-term treatment ...

Working Parents

MedlinePlus

... Ribbon Commands Skip to main content Turn off Animations Turn on Animations Our Sponsors Log in | Register Menu Log in | ... or go to the gym. Do some recreational reading. While family time is important and certain chores ...

Pediatric Ophthalmologist

MedlinePlus

... Ribbon Commands Skip to main content Turn off Animations Turn on Animations Our Sponsors Log in | Register Menu Log in | ... with a vision screening exam or has difficulty reading or learning, or needs surgery or medical treatment ...

Finding Reliable Health Information Online

MedlinePlus

Skip to main content Finding Reliable Health Information Online Enter Search Term(s): Español Research Funding An Overview Bioinformatics Current Grants Education and Training Funding Extramural Research News Features Funding Divisions Funding ...

Patient's Guide to Arrhythmogenic Right Ventricular Dysplasia/Cardiomyopathy

MedlinePlus

Skip to main content American Heart Association Science Volunteer Warning Signs Search for this keyword Search Advanced Search Donate Home About this Journal Editorial Board General Statistics Circulation Doodle Doodle Gallery ...

Aplastic Anemia and Myelodysplastic Syndromes

MedlinePlus

Skip to main content U.S. Department of Health and Human Services Follow us: Search Menu Search for Information from NIDDK Entire Site Research & Funding Health Information About NIDDK News Search Research & Funding Current ...

3/29/2018: Making Data Machine-Readable Webinar | National Agricultural

Science.gov Websites

Library Skip to main content Home National Agricultural Library United States Department of | USDA.gov | Agricultural Research Service | Plain Language | FOIA | Accessibility Statement | Information

HIV Medicines and Side Effects

MedlinePlus

... Apps skip to content Side Effects of HIV Medicines Home Understanding HIV/AIDS Fact Sheets HIV Medicines ... p.m. ET) Send us an email HIV Medicines and Side Effects Last Reviewed: October 9, 2017 ...

ARC-1973-A73-9044-2

NASA Image and Video Library

1973-11-21

Pioneer 10; Mission to Jupiter Project Manager Charlie Hall (center) leads the Pioneer staff through his efficient (and infamous) stand-up meeting (also shown (L-foreground) Skip Nunamaker and (R-foreground) Richard Fimmel

Guidelines for Better Heart Health

MedlinePlus

Skip Navigation Bar Home Current Issue Past Issues Guidelines for Better Heart Health Past Issues / Winter 2007 ... women either had or did not have CVD. Guidelines at a Glance: Prevention should be tailored to ...

26 CFR 20.2053-6 - Deduction for taxes.

Code of Federal Regulations, 2011 CFR

2011-04-01

... (3) effect distribution. Excise taxes incurred in distributing property of the estate in kind are.... If D's estate had claimed a deduction of $50x on D's United States Estate (and Generation-Skipping...

26 CFR 20.2053-6 - Deduction for taxes.

Code of Federal Regulations, 2012 CFR

2012-04-01

... (3) effect distribution. Excise taxes incurred in distributing property of the estate in kind are.... If D's estate had claimed a deduction of $50x on D's United States Estate (and Generation-Skipping...

26 CFR 20.2053-6 - Deduction for taxes.

Code of Federal Regulations, 2013 CFR

2013-04-01

... (3) effect distribution. Excise taxes incurred in distributing property of the estate in kind are.... If D's estate had claimed a deduction of $50x on D's United States Estate (and Generation-Skipping...

26 CFR 20.2053-6 - Deduction for taxes.

Code of Federal Regulations, 2014 CFR

2014-04-01

... (3) effect distribution. Excise taxes incurred in distributing property of the estate in kind are.... If D's estate had claimed a deduction of $50x on D's United States Estate (and Generation-Skipping...

Allergy-Friendly Gardening

MedlinePlus

... Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide ... Expert Search Search AAAAI Breadcrumb navigation Home ▸ Conditions & Treatments ▸ ... Library ▸ Allergy-friendly gardening Share | Allergy-Friendly Gardening ...

Rhinitis Overview

MedlinePlus

... Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide ... Expert Search Search AAAAI Breadcrumb navigation Home ▸ Conditions & Treatments ▸ Allergies ▸ Rhinitis Share | Rhinitis (Hay Fever) Overview Symptoms & Diagnosis ...

ACHP | News

Science.gov Websites

Search skip specific nav links Home arrow News Internal Revenue Service Wins Chairman's Award for Federal Redstone Castle WASHINGTON, DC-The Internal Revenue Service (IRS) received the Advisory Council on Historic

Friend or Foe?

MedlinePlus

... Ribbon Commands Skip to main content Turn off Animations Turn on Animations Our Sponsors Log in | Register Menu Log in | ... best in him, rather than the worst. By reading up on the subject, discussing it with my ...

Disruptive Behavior Disorders

MedlinePlus

... Ribbon Commands Skip to main content Turn off Animations Turn on Animations Our Sponsors Log in | Register Menu Log in | ... greater chance of experiencing learning disabilities such as reading disorders and verbal impairment. But what distinguishes children ...

Deployment and Children

MedlinePlus

... Ribbon Commands Skip to main content Turn off Animations Turn on Animations Our Sponsors Log in | Register Menu Log in | ... to talk with teenagers about what they’re reading in the newspaper, discussing in school, or seeing ...

Health Screenings at School

MedlinePlus

... Ribbon Commands Skip to main content Turn off Animations Turn on Animations Our Sponsors Log in | Register Menu Log in | ... others develop later. A child who has difficulty reading the blackboard may not know that she is ...

Stresses of Single Parenting

MedlinePlus

... Ribbon Commands Skip to main content Turn off Animations Turn on Animations Our Sponsors Log in | Register Menu Log in | ... to enjoy your children. Spend quiet time playing, reading, working on arts-and-crafts projects, or just ...

Importance of Family Routines

MedlinePlus

... Ribbon Commands Skip to main content Turn off Animations Turn on Animations Our Sponsors Log in | Register Menu Log in | ... child to sleep. These rituals can include storytelling, reading aloud, conversation, and songs. Try to avoid exciting ...

Preparing for Twins

MedlinePlus

... Ribbon Commands Skip to main content Turn off Animations Turn on Animations Our Sponsors Log in | Register Menu Log in | ... challenges with twins. He also can suggest helpful reading material or refer you to organizations that help ...

Parkinson's Disease: The Newest Advances

MedlinePlus

Skip Navigation Bar Home Current Issue Past Issues Parkinson's Disease: The Newest Advances Past Issues / Summer 2006 Table ... number of genes that cause or contribute to Parkinson's disease (PD), as well as potential environmental risk factors. ...

Health Effects of Ozone and Particle Pollution

MedlinePlus

... policy . Skip to main content ABOUT US OUR INITIATIVES LUNG HEALTH & DISEASES SUPPORT & COMMUNITY STOP SMOKING GET ... Supporters Careers Contact Us Corporate Ethics Reporting OUR INITIATIVES LUNG FORCE Saved By The Scan Research Healthy ...

National Institute of Dental and Craniofacial Research

MedlinePlus

... In Skip to Main Content National Institute of Dental and Craniofacial Research (NIDCR) Improving the Nation's Oral ... Researchers NIDCR Strategic Plan The National Institute of Dental and Craniofacial Research remains committed to improving the ...

ACHP | News | ACHP Spring Business Meeting May 5

Science.gov Websites

Search skip specific nav links Home arrow News arrow ACHP Chairman Wayne Donaldson Celebrates with LA Preserve America Neighborhoods ACHP Chairman Wayne Donaldson Celebrates with LA Preserve America

4/4/2018: The Ag Data Commons Metrics | National Agricultural Library

Science.gov Websites

Skip to main content Home National Agricultural Library United States Department of Agriculture Ag | Agricultural Research Service | Plain Language | FOIA | Accessibility Statement | Information Quality | Privacy

National Agricultural Library | United States Department of Agriculture

Science.gov Websites

Skip to main content Home National Agricultural Library United States Department of Agriculture Ag Policy Drupal is a registered trademark of Dries Buytaert. NAL Home | USDA.gov | Agricultural Research

Measuring Physical Activity Intensity

MedlinePlus Videos and Cool Tools

... Skip directly to site content Start of Search Controls Search Form Controls Cancel Submit Search the CDC CDC A-Z ... V W X Y Z # Start of Search Controls Search Form Controls Search The CDC Cancel Submit ...

ACHP | ACHP Native American Program: Guidance for Federal Agencies

Science.gov Websites

Working with Section 106 Federal, State, & Tribal Programs Training & Education Publications Search skip specific nav links Home arrow Working with Section 106 arrow ACHP Native American Program

76 FR 4686 - Product Cancellation Order for Certain Pesticide Registrations

Federal Register 2010, 2011, 2012, 2013, 2014

2011-01-26

... Duty Bird Paradichlorobenze Guard. ne. 002517-00049 Sergeant's Pump Soap Bioallethrin MGK for Dogs. 264 Phenothrin. 002517-00059 Sergeant's Skip-Flea MGK 264 Soap (with D- Phenothrin. Phenothrin). 002517-00067...

Combating HIV/AIDS | NIH MedlinePlus the Magazine

MedlinePlus

Skip to main content NIH MedlinePlus the Magazine NIH MedlinePlus Salud Download the Current Issue PDF [3.1 mb] Trusted Health Information from the National Institutes of Health Home Current Issue ...

Why You Shouldn't Use Cotton Swabs to Clean Your Ears

MedlinePlus

Skip to main Content U.S. Department of Health & Human Services National Institutes of Health National Institute on Deafness and Other Communication Disorders You are here Home > Have You Heard? > ...

15 CFR 732.1 - Steps overview.

Code of Federal Regulations, 2012 CFR

2012-01-01

..., Iran, North Korea, and Syria. For these countries, you may skip Steps 7 through 11 and go directly to...., Cuba, Iran, North Korea and Syria), prohibited activities of U.S. persons in support of proliferation...

15 CFR 732.1 - Steps overview.

Code of Federal Regulations, 2013 CFR

2013-01-01

..., Iran, North Korea, and Syria. For these countries, you may skip Steps 7 through 11 and go directly to...., Cuba, Iran, North Korea and Syria), prohibited activities of U.S. persons in support of proliferation...

How Much Exercise Do I Need?

MedlinePlus

... Aerobic activities include walking fast, jogging, swimming, and biking Exercise at a moderate intensity. One way to ... skipping, playing on the playground, playing basketball, and biking Also, try to get each of these at ...

12. Exterior detail view of roof structure at eave, showing ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

12. Exterior detail view of roof structure at eave, showing exposed rafter tails, skip sheathing and gutter - American Railway Express Company Freight Building, 1060 Northeast Division Street, Bend, Deschutes County, OR

What is a Therapeutic HIV Vaccine?

MedlinePlus

... AIDS Drugs Clinical Trials Apps skip to content HIV Overview Home Understanding HIV/AIDS Fact Sheets What ... Send us an email What is a Therapeutic HIV Vaccine? Last Reviewed: August 16, 2017 Key Points ...

HIV, AIDS, and the Future

MedlinePlus

Skip Navigation Bar Home Current Issue Past Issues HIV / AIDS HIV, AIDS, and the Future Past Issues / Summer 2009 ... turn Javascript on. Photo: The NAMES Project Foundation HIV and AIDS are a global catastrophe. While advances ...