Personalizing the Approach to Childhood Asthma

MedlinePlus

American Academy of Allergy Asthma & Immunology Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide Conditions Dictionary Just ...

Violence

MedlinePlus

... Illness & disability Drugs, alcohol & smoking Your feelings Relationships Bullying Safety Your future Environmental health Skip section navigation ( ... Robbery Using a weapon Sexual assault and rape Bullying Effects of youth violence top Every year, thousands ...

Impact of Food Allergy on Asthma in Children

MedlinePlus

American Academy of Allergy Asthma & Immunology Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide Conditions Dictionary Just ...

Simplifying Effective Treatment of Chronic Hives in Children

MedlinePlus

American Academy of Allergy Asthma & Immunology Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide Conditions Dictionary Just ...

7 CFR 42.141 - Obtaining Operating Characteristic (OC) curve information for skip lot sampling and inspection.

Code of Federal Regulations, 2010 CFR

2010-01-01

..., and read the new Percent of Lots Expected to be Accepted, Pas, which results when using these skip lot... point, proceed vertically to the curve and then horizontally to the left to the vertical axis. From this...

7 CFR 42.141 - Obtaining Operating Characteristic (OC) curve information for skip lot sampling and inspection.

Code of Federal Regulations, 2011 CFR

2011-01-01

..., and read the new Percent of Lots Expected to be Accepted, Pas, which results when using these skip lot... point, proceed vertically to the curve and then horizontally to the left to the vertical axis. From this...

Botanical Dietary Supplements: Background Information

MedlinePlus

Skip navigation links U.S. Department of Health & Human Services HHS.gov National Institutes of Health NIH.gov Font Size Decrease Font Size Increase Font Size Strengthening Knowledge and Understanding of ...

Predicting Asthma in Preschool Children with Asthma-Like Symptoms

MedlinePlus

American Academy of Allergy Asthma & Immunology Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide Conditions Dictionary Just ...

Feeling Stressed

MedlinePlus

... Illness & disability Drugs, alcohol & smoking Your feelings Relationships Bullying Safety Your future Environmental health Skip section navigation ( ... weight Problems with friends or other relationships Being bullied Living in a dangerous neighborhood Peer pressure to ...

Sleep Quiz

MedlinePlus

Skip Navigation Bar Home Current Issue Past Issues Sleep Quiz Past Issues / Summer 2007 Table of Contents ... on. Photo: iStock Take the National Center on Sleep Disorders Research Sleep Quiz TRUE OR FALSE ? _____1. ...

Vaccines Stop Illness

MedlinePlus

Skip Navigation Bar Home Current Issue Past Issues Vaccines Stop Illness Past Issues / Spring 2008 Table of ... meningitis won't infect, cripple, or kill children. Vaccine Safety In light of recent questions about vaccine ...

Asthma Patients in US Overuse Quick-Relief Inhalers, Underuse Control Medications

MedlinePlus

American Academy of Allergy Asthma & Immunology Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide Conditions Dictionary Just ...

eBenefits: My Gateway to Benefits Information

MedlinePlus

... of the Department of Veterans Affairs and the Department of Defense A Service of the Department of Veterans Affairs and the Department of Defense Log in Register Skip Navigation Main Menu Apply ...

Fire Ant Allergy

MedlinePlus

... Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide ... your condition and determine the best form of treatment. Allergy shots (immunotherapy) may be effective long-term treatment ...

Guidelines for Better Heart Health

MedlinePlus

Skip Navigation Bar Home Current Issue Past Issues Guidelines for Better Heart Health Past Issues / Winter 2007 ... women either had or did not have CVD. Guidelines at a Glance: Prevention should be tailored to ...

Parkinson's Disease: The Newest Advances

MedlinePlus

Skip Navigation Bar Home Current Issue Past Issues Parkinson's Disease: The Newest Advances Past Issues / Summer 2006 Table ... number of genes that cause or contribute to Parkinson's disease (PD), as well as potential environmental risk factors. ...

HIV, AIDS, and the Future

MedlinePlus

Skip Navigation Bar Home Current Issue Past Issues HIV / AIDS HIV, AIDS, and the Future Past Issues / Summer 2009 ... turn Javascript on. Photo: The NAMES Project Foundation HIV and AIDS are a global catastrophe. While advances ...

Department of Agriculture, Food Safety and Inspection Service

MedlinePlus

... FSIS Forms Administrative Forms Standard Forms Skip Navigation Web Content Viewer (JSR 286) Actions ${title} Loading... Information ... resources and information on Siluriformes fish, including catfish Web Content Viewer (JSR 286) Actions ${title} Loading... Information ...

Exposure to Cigarette Smoke Reduces Vitamin D3 in the Blood Stream and Respiratory Tract

MedlinePlus

American Academy of Allergy Asthma & Immunology Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide Conditions Dictionary Just ...

Heart Disease Affects Women of All Ages

MedlinePlus

Skip Navigation Bar Home Current Issue Past Issues Heart Disease Affects Women of All Ages Past Issues / Winter ... weeks of a heart attack. For Women with Heart Disease: About 6 million American women have coronary heart ...

Skin Diseases: Questions for Your Health Care Provider

MedlinePlus

Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Questions for Your Health Care Provider Past ... dermatitis worse? What are the most common irritants? Skin cancer What type of skin cancer do I ...

HIV / AIDS: Symptoms, Diagnosis, Prevention and Treatment

MedlinePlus

Skip Navigation Bar Home Current Issue Past Issues HIV / AIDS HIV / AIDS: Symptoms , Diagnosis, Prevention and Treatment Past Issues / ... Most people who have become recently infected with HIV will not have any symptoms. They may, however, ...

HIV / AIDS: An Unequal Burden

MedlinePlus

Skip Navigation Bar Home Current Issue Past Issues HIV / AIDS HIV / AIDS: An Unequal Burden Past Issues / Summer 2009 ... high-risk category, emphasizes Dr. Cargill. Photo: iStock HIV and Pregnancy Are there ways to help HIV- ...

Fruit Flies Help Human Sleep Research

MedlinePlus

Skip Navigation Bar Home Current Issue Past Issues Fruit Flies Help Human Sleep Research Past Issues / Summer 2007 ... courtesy of NIGMS Neuroscientist Chiara Cirelli uses experimental fruit flies to study sleep. Although it may be tough ...

CIDR

Science.gov Websites

CIDR Skip navigation Home About CIDR General Highlights Newsletter Staff Employment Opportunities Genotyping General Information Genome Wide Association Custom FFPE Sample Options Methylation Linkage Consortium Developed Mouse Whole Genome Sequencing General Information Whole Genome Whole Exome Custom

Orthopedic Health: Joint Health and Care: Prevention, Symptoms, Diagnosis & Treatment

MedlinePlus

Skip Navigation Bar Home Current Issue Past Issues Orthopedic Health Joint Health and Care: Prevention, Symptoms, Diagnosis & ... to recover more easily and have better outcomes. Research to Results NIAMS has embarked on several innovative ...

North American Society for Pediatric Gastroenterology, Hepatology and Nutrition

MedlinePlus

North American Society for Pediatric Gastroenterology, Hepatology and Nutrition Skip to Navigation NASPGHAN Annual Meeting and Postgraduate ... transition well. Moreover, Doc4me provides information about medications, nutrition and living with IBD. Please help us promote ...

Shift Colors

Science.gov Websites

Skip to main content Navigate Up This page location is: Navy Personnel Command Reference Library Command > Reference Library > Publications & News > Shift Colors Top Link Bar Navy Personnel Enlisted Support & Services Expand Support & Services Organization Expand Organization Reference

Allergic Bronchopulmonary Aspergillosis (ABPA)

MedlinePlus

... Menu Search Main navigation Skip to content Conditions & Treatments Allergies Asthma Primary Immunodeficiency Disease Related Conditions Drug Guide ... by health history, x-rays or CT scans, allergy skin testing and/or blood tests. Treatment & Management The fungus that causes a reaction is ...

New NIA Booklet By and For People With Early-Stage Alzheimer's Disease

MedlinePlus

Skip Navigation Bar Home Current Issue Past Issues New NIA Booklet By and For People With Early- ... help them cope? What Happens Next? is a new, free booklet developed by the earlystage support group ...

Videos | NOAA Gulf Spill Restoration

Science.gov Websites

Skip to main content Home Home Toggle navigation Search form Search Search the web Search NOAA Gulf Spill Restoration Search Home About Us Trustees Contact Us How We Restore Planning Damage Assessment

Skin Diseases: Cross-section of human skin

MedlinePlus

Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Cross-section of human skin Past Issues / Fall 2008 Table of Contents For ... Logical Images, Inc. I n the areas of skin health and skin diseases, the NIH's National Institute ...

Environmental Compliance | NOAA Gulf Spill Restoration

Science.gov Websites

Skip to main content Home Home Toggle navigation Search form Search Search the web Search NOAA Gulf Spill Restoration Search Home About Us Trustees Contact Us How We Restore Planning Damage Assessment

News | Argonne National Laboratory

Science.gov Websites

Skip to main content Argonne National Laboratory Toggle Navigation Toggle Search Home Learning solvers Home Learning Center Undergraduates Graduates Faculty Partners News & Events News & Events -4114 Contact Us Argonne Educational Programs is committed to providing a learning environment that

Facilities | Argonne National Laboratory

Science.gov Websites

Skip to main content Argonne National Laboratory Toggle Navigation Toggle Search Research Facilities Advanced Powertrain Research Facility Center for Transportation Research Distributed Energy Research Center Engine Research Facility Heat Transfer Laboratory Materials Engineering Research Facility

Safety | Argonne National Laboratory

Science.gov Websites

laboratory's ongoing effort to provide a safe and productive environment for employees, users, other site Skip to main content Argonne National Laboratory Toggle Navigation Toggle Search Energy Environment Careers Education Community Diversity Directory Energy Environment National Security User Facilities

The Nation's Top HIV/AIDS Researcher Discusses This Continuing Health Threat

MedlinePlus

Skip Navigation Bar Home Current Issue Past Issues HIV / AIDS The Nation's Top HIV/AIDS Researcher Discusses This Continuing Health Threat Past ... on. For more than 30 years, the NIH's HIV/AIDS research program has been led by Dr. ...

Increase Workshop | Argonne National Laboratory

Science.gov Websites

Skip to main content Argonne National Laboratory Toggle Navigation Toggle Search Home Learning solvers Home Learning Center Undergraduates Graduates Faculty Partners News & Events Faculty Visiting Us Argonne Educational Programs is committed to providing a learning environment that emphasizes the

Internship Opportunities | Argonne National Laboratory

Science.gov Websites

Skip to main content Argonne National Laboratory Toggle Navigation Toggle Search Home Learning -class research to tomorrow's STEM problem solvers Home Learning Center Undergraduates Graduates Faculty ) 252-4114 Contact Us Argonne Educational Programs is committed to providing a learning environment that

OTP Directory

Science.gov Websites

Skip Navigation medication-assisted treatment for substance use disorders Back to MAT home  • Opioid Treatment Program Directory Select to view the opioid treatment programs in a State - Select - All Substance Abuse Treatment Division of Pharmacologic Therapies 5600 Fishers Lane * Rockville, MD 20857 * 240

Emergency Preparedness & Recovery News Releases - PHE

Science.gov Websites

and reload this page. Skip over global navigation links U.S. Department of Health and Human Services Health Emergency - Leading a Nation Prepared Search Search PHE Home > Emergency Emergency Preparedness necesitan medicamentos HHS Acting Secretary Declares Public Health Emergency to Address National Opioid

Office of Diversity Management and Equal Opportunity

Science.gov Websites

Skip to main content (Press Enter). Toggle navigation Office of Diversity Management and Equal Opportunity Search Search ODMEO: Search Search ODMEO: Search Office of Diversity Management and Equal Opportunity Office of Diversity Management and Equal Opportunity Home About ODMEO Leadership Documents News

"Be Sickle Smart!" | NIH MedlinePlus the Magazine

MedlinePlus

Skip Navigation Bar Home Current Issue Past Issues For an enhanced version of this page please turn Javascript on. Special Section: Sickle Cell Disease "Be Sickle Smart! " Past Issues / Winter 2011 Table of Contents Singing star and former American Idol winner Ruben Studdard wrote the song," ...

Defense Human Resources Activity > PERSEREC

Science.gov Websites

Skip to main content (Press Enter). Toggle navigation Defense Human Resources Activity Search Search Defense Human Resources Activity: Search Search Defense Human Resources Activity: Search Defense Human Resources Activity U.S. Department of Defense Defense Human Resources Activity Overview

Solar Energy Development PEIS Information Center

Science.gov Websites

skip navigation Solar Energy Development Programmatic EIS Home About the EIS Public Involvement Solar Energy Solar Energy Zones Maps Documents secondary menu News Frequently Asked Questions Glossary E the Programmatic Environmental Impact Statement for Solar Energy Development in Six Southwestern

NNI Supplement to the President's 2013 Budget | Nano

Science.gov Websites

Skip main navigation Nano.gov Nanotechnology 101 What It Is and How It Works What is Nanotechnology What's So Special about the Nanoscale? NNI Accomplishments NNI Accomplishments Archive Nanotechnology Timeline Frequently Asked Questions Glossary Nanotechnology and You Benefits and Applications Networks and

Department of Defense Senior Intelligence Oversight Official

Science.gov Websites

Skip to main content (Press Enter). Toggle navigation Department of Defense Senior Intelligence Intelligence Oversight Official Department of Defense Senior Intelligence Oversight Official Home About DOD Defense Senior Intelligence Oversight Official Website Michael T. Mahar, DoD SIOO Click here for DoD SIOO

Defense Contract Management Agency

Science.gov Websites

, May 24. Click the photo above for more information. Members of the Defense Contract Management Agency for more information. Members of the Defense Contract Management Agency International Region conduct Skip to main content (Press Enter). Toggle navigation Defense Contract Management Agency Search

Data from: Solving the Robot-World Hand-Eye(s) Calibration Problem with

Science.gov Websites

Iterative Methods | National Agricultural Library Skip to main content Home National Agricultural Library United States Department of Agriculture Ag Data Commons Beta Toggle navigation Datasets . License U.S. Public Domain Funding Source(s) National Science Foundation IOS-1339211 Agricultural Research

Non-Lethal Weapons Program

Science.gov Websites

), 26th Marine Expeditionary Unit (MEU), practice non-lethal control techniques during a non-lethal Skip to main content (Press Enter). Toggle navigation Non-Lethal Weapons Program Search Search JNLWP: Search Search JNLWP: Search Non-Lethal Weapons Program U.S. Department of Defense Non-Lethal

Emergency Home - PHE

Science.gov Websites

and reload this page. Skip over global navigation links U.S. Department of Health and Human Services Health Emergency - Leading a Nation Prepared Search Search Right Box1 Content 2017 Hurricane Response and Deaf or Hard of Hearing For Public Health Communicators and the Media Tools for the Media and Public

Federal Public Health Actions - PHE

Science.gov Websites

and reload this page. Skip over global navigation links U.S. Department of Health and Human Services Health Emergency - Leading a Nation Prepared Search Search PHE Home > PHE Newsroom > Federal Public Health Actions Federal Public Health Actions Main Content April 20, 2018: Renewal of Determination that a

NCEP Quarterly Newsletter

Science.gov Websites

second (40-level, different physics/PBL) ARW member is added for all domains (except Guam). The two ARW Skip Navigation Links weather.gov NOAA logo - Click to go to the NOAA homepage National Weather Service NWS logo - Click to go to the NWS homepage National Centers for Environmental Prediction

U.S. Northern Command > Newsroom > Press Releases

Science.gov Websites

Skip to main content (Press Enter). Toggle navigation U.S. Northern Command Search Search USNORTHCOM: Search Search USNORTHCOM: Search U.S. Northern Command U.S. Northern Command Home Leadership , 2018 NORAD and USNORTHCOM to host change of command ceremony Nov. 30, 2017 United States, Mexico to

Department of the Navy For Policy

Science.gov Websites

Policy DEPARTMENT OF THE NAVY For Policy Search this site... Search Policy Security Skip navigation links Security Expand Security Deputy Under Secretary of the Navy (Policy) Roles and Responsibilities: - Policy Page Content Deputy Under Secretary of the Navy (Policy) Roles and Responsibilities: Enterprise OPM

Chief Information Officer > DoDSection508

Science.gov Websites

Skip to main content (Press Enter). Toggle navigation Chief Information Officer Search Search Chief Information Officer: Search Search Chief Information Officer: Search Chief Information Officer U.S. Department of Defense Chief Information Officer Home About DoD CIO Bios Organization DCIO C4&IIC DCIO IE

Biographies of Senior Defense Officials

Science.gov Websites

Skip to main content (Press Enter). Toggle navigation Chief Information Officer Search Search Chief Information Officer: Search Search Chief Information Officer: Search Chief Information Officer U.S. Department of Defense Chief Information Officer Home About DoD CIO Bios Organization DCIO C4&IIC DCIO IE

Chief Information Officer > Library

Science.gov Websites

Skip to main content (Press Enter). Toggle navigation Chief Information Officer Search Search Chief Information Officer: Search Search Chief Information Officer: Search Chief Information Officer U.S. Department of Defense Chief Information Officer Home About DoD CIO Bios Organization DCIO C4&IIC DCIO IE

Chief Information Officer > In the News

Science.gov Websites

Skip to main content (Press Enter). Toggle navigation Chief Information Officer Search Search Chief Information Officer: Search Search Chief Information Officer: Search Chief Information Officer U.S. Department of Defense Chief Information Officer Home About DoD CIO Bios Organization DCIO C4&IIC DCIO IE

Chief Information Officer > About DoD CIO

Science.gov Websites

Skip to main content (Press Enter). Toggle navigation Chief Information Officer Search Search Chief Information Officer: Search Search Chief Information Officer: Search Chief Information Officer U.S. Department of Defense Chief Information Officer Home About DoD CIO Bios Organization DCIO C4&IIC DCIO IE

Gulf Dolphins Slideshow | NOAA Gulf Spill Restoration

Science.gov Websites

Skip to main content Home Home Toggle navigation Search form Search Search the web Search NOAA Gulf Spill Restoration Search Home About Us Trustees Contact Us How We Restore Planning Damage Assessment Archive Home Gulf Dolphins Slideshow Gulf Dolphins Slideshow share Posted on March 23, 2012 | Assessment

MMAB Developmental Products

Science.gov Websites

Skip Navigation Links www.nws.noaa.gov NOAA logo - Click to go to the NOAA homepage National Weather Service NWS logo - Click to go to the NWS homepage Environmental Modeling Center Home News Organization Search Search Search by city or zip code. Press enter or select the go button to submit request

GOES West - Hawaii Water Vapor Imagery Loop (Flash) - Satellite Products

Science.gov Websites

and Services Division/Office of Satellite and Product Operations Skip Navigation Link NESDIS banner image and link to NESDIS link to the NOAA Home page Link to the National Environmental Satellite , Data, and Information Service Home Page Default Office of Satellite and Product Operations banner image

GOES West - Western Region WFO Satellite Imagery - Satellite Products and

Science.gov Websites

Services Division - Office of Satellite and Product Operations Skip Navigation Link NESDIS banner image and link to NESDIS link to the NOAA Home page Link to the National Environmental Satellite , Data, and Information Service Home Page Default Office of Satellite and Product Operations banner image

GOES West - Hawaii Visible Imagery Loop (Flash) - Satellite Products and

Science.gov Websites

Services Division/Office of Satellite and Product Operations Skip Navigation Link NESDIS banner image and link to NESDIS link to the NOAA Home page Link to the National Environmental Satellite, Data , and Information Service Home Page Default Office of Satellite and Product Operations banner image and

Gulf of Mexico Imagery - Satellite Products and Services Division/Office of

Science.gov Websites

Satellite and Product Operations Skip Navigation Link NESDIS banner image and link to NESDIS Home Page Default Office of Satellite and Product Operations banner image and link to OSPO DOC / NOAA Bleaching -- Ocean Color -- Sea/Lake Ice -- Sea Surface Height -- Sea Surface Temperatures -- Tropical

Southwest U.S. Imagery (GOES-WEST) - Satellite Services Division / Office

Science.gov Websites

of Satellite Data Processing and Distribution Skip Navigation Link NESDIS banner image and link Information Service Home Page Default Office of Satellite and Product Operations banner image and link to OSPO Color -- Sea/Lake Ice -- Sea Surface Height -- Sea Surface Temperatures -- Tropical Systems Product List

Tropical Pacific Imagery - Satellite Products and Services Division/Office

Science.gov Websites

of Satellite and Product Operations Skip Navigation Link NESDIS banner image and link to NESDIS Home Page Default Office of Satellite and Product Operations banner image and link to OSPO DOC / NOAA Bleaching -- Ocean Color -- Sea/Lake Ice -- Sea Surface Height -- Sea Surface Temperatures -- Tropical

Tropical West Pacific Imagery - Satellite Products and Services

Science.gov Websites

Division/Office of Satellite and Product Operations Skip Navigation Link NESDIS banner image Information Service Home Page Default Office of Satellite and Product Operations banner image and link to OSPO MIRS MSPPS Ocean -- Coral Bleaching -- Ocean Color -- Sea/Lake Ice -- Sea Surface Height -- Sea Surface

Tropical Atlantic Imagery - Satellite Products and Services Division/Office

Science.gov Websites

of Satellite and Product Operations Skip Navigation Link NESDIS banner image and link to NESDIS Home Page Default Office of Satellite and Product Operations banner image and link to OSPO DOC / NOAA Bleaching -- Ocean Color -- Sea/Lake Ice -- Sea Surface Height -- Sea Surface Temperatures -- Tropical

Efficient voxel navigation for proton therapy dose calculation in TOPAS and Geant4

NASA Astrophysics Data System (ADS)

Schümann, J.; Paganetti, H.; Shin, J.; Faddegon, B.; Perl, J.

2012-06-01

A key task within all Monte Carlo particle transport codes is ‘navigation’, the calculation to determine at each particle step what volume the particle may be leaving and what volume the particle may be entering. Navigation should be optimized to the specific geometry at hand. For patient dose calculation, this geometry generally involves voxelized computed tomography (CT) data. We investigated the efficiency of navigation algorithms on currently available voxel geometry parameterizations in the Monte Carlo simulation package Geant4: G4VPVParameterisation, G4VNestedParameterisation and G4PhantomParameterisation, the last with and without boundary skipping, a method where neighboring voxels with the same Hounsfield unit are combined into one larger voxel. A fourth parameterization approach (MGHParameterization), developed in-house before the latter two parameterizations became available in Geant4, was also included in this study. All simulations were performed using TOPAS, a tool for particle simulations layered on top of Geant4. Runtime comparisons were made on three distinct patient CT data sets: a head and neck, a liver and a prostate patient. We included an additional version of these three patients where all voxels, including the air voxels outside of the patient, were uniformly set to water in the runtime study. The G4VPVParameterisation offers two optimization options. One option has a 60-150 times slower simulation speed. The other is compatible in speed but requires 15-19 times more memory compared to the other parameterizations. We found the average CPU time used for the simulation relative to G4VNestedParameterisation to be 1.014 for G4PhantomParameterisation without boundary skipping and 1.015 for MGHParameterization. The average runtime ratio for G4PhantomParameterisation with and without boundary skipping for our heterogeneous data was equal to 0.97: 1. The calculated dose distributions agreed with the reference distribution for all but the G4PhantomParameterisation with boundary skipping for the head and neck patient. The maximum memory usage ranged from 0.8 to 1.8 GB depending on the CT volume independent of parameterizations, except for the 15-19 times greater memory usage with the G4VPVParameterisation when using the option with a higher simulation speed. The G4VNestedParameterisation was selected as the preferred choice for the patient geometries and treatment plans studied.

Even-Skipped(+) Interneurons Are Core Components of a Sensorimotor Circuit that Maintains Left-Right Symmetric Muscle Contraction Amplitude.

PubMed

Heckscher, Ellie S; Zarin, Aref Arzan; Faumont, Serge; Clark, Matthew Q; Manning, Laurina; Fushiki, Akira; Schneider-Mizell, Casey M; Fetter, Richard D; Truman, James W; Zwart, Maarten F; Landgraf, Matthias; Cardona, Albert; Lockery, Shawn R; Doe, Chris Q

2015-10-21

Bilaterally symmetric motor patterns--those in which left-right pairs of muscles contract synchronously and with equal amplitude (such as breathing, smiling, whisking, and locomotion)--are widespread throughout the animal kingdom. Yet, surprisingly little is known about the underlying neural circuits. We performed a thermogenetic screen to identify neurons required for bilaterally symmetric locomotion in Drosophila larvae and identified the evolutionarily conserved Even-skipped(+) interneurons (Eve/Evx). Activation or ablation of Eve(+) interneurons disrupted bilaterally symmetric muscle contraction amplitude, without affecting the timing of motor output. Eve(+) interneurons are not rhythmically active and thus function independently of the locomotor CPG. GCaMP6 calcium imaging of Eve(+) interneurons in freely moving larvae showed left-right asymmetric activation that correlated with larval behavior. TEM reconstruction of Eve(+) interneuron inputs and outputs showed that the Eve(+) interneurons are at the core of a sensorimotor circuit capable of detecting and modifying body wall muscle contraction. Copyright © 2015 Elsevier Inc. All rights reserved.

Even-skipped+ interneurons are core components of a sensorimotor circuit that maintains left-right symmetric muscle contraction amplitude

PubMed Central

Heckscher, Ellie S.; Zarin, Aref Arzan; Faumont, Serge; Clark, Matthew Q.; Manning, Laurina; Fushiki, Akira; Schneider-Mizel, Casey M.; Fetter, Richard D.; Truman, James W.; Zwart, Maarten F.; Landgraf, Matthias; Cardona, Albert; Lockery, Shawn R.; Doe, Chris Q.

2015-01-01

Summary Bilaterally symmetric motor patterns—those in which left-right pairs of muscles contract synchronously and with equal amplitude (such as breathing, smiling, whisking, locomotion)—are widespread throughout the animal kingdom. Yet surprisingly little is known about the underlying neural circuits. We performed a thermogenetic screen to identify neurons required for bilaterally symmetric locomotion in Drosophila larvae, and identified the evolutionarily-conserved Even-skipped+ interneurons (Eve/Evx). Activation or ablation of Eve+ interneurons disrupted bilaterally symmetric muscle contraction amplitude, without affecting the timing of motor output. Eve+ interneurons are not rhythmically active, and thus function independently of the locomotor CPG. GCaMP6 calcium imaging of Eve+ interneurons in freely-moving larvae showed left-right asymmetric activation that correlated with larval behavior. TEM reconstruction of Eve+ interneuron inputs and outputs showed that the Eve+ interneurons are at the core of a sensorimotor circuit capable of detecting and modifying body wall muscle contraction. PMID:26439528

Remote magnetic navigation to map and ablate left coronary cusp ventricular tachycardia.

PubMed

Burkhardt, J David; Saliba, Walid I; Schweikert, Robert A; Cummings, Jennifer; Natale, Andrea

2006-10-01

Premature ventricular contractions (PVCs) and ventricular tachycardia may arise from the coronary cusps. Navigation, mapping, and ablation in the coronary cusps can be challenging. Remote magnetic navigation may offer an alternative to conventional manually operated catheters. We report a case of left coronary cusp ventricular tachycardia ablation using remote magnetic navigation. Right ventricular outflow tract and coronary cusp mapping, and ablation of the left coronary cusp using a remote magnetic navigation and three-dimensional (3-D) mapping system was performed in a 28-year-old male with frequent, symptomatic PVCs and ventricular tachycardia. Successful ablation of left coronary cusp ventricular tachycardia was performed using remote magnetic navigation. Remote magnetic navigation may be used to map and ablate PVCs and ventricular tachycardia originating from the coronary cusps.

Kitchen Thermometers

MedlinePlus

... Administrative Forms Standard Forms Skip Navigation Z7_0Q0619C0JGR010IFST1G5B10H1 Web Content Viewer (JSR 286) Actions ${title} Loading... / Topics / ... and Thermometers / Kitchen Thermometers / Kitchen Thermometers Z7_0Q0619C0JGR010IFST1G5B10H3 Web Content Viewer (JSR 286) Actions ${title} Loading... Z7_ ...

Doppler Radar National Mosaic - NOAA's National Weather Service

Science.gov Websites

Skip Navigation Links weather.gov NOAA logo-Select to go to the NOAA homepage National Oceanic and Atmospheric Administration's Select to go to the NWS homepage National Weather Service Site Map News select the go button to submit request City, St Go Sign-up for Email Alerts RSS Feeds RSS Feeds Warnings

Chief Information Officer > About DoD CIO > Organization > DCIO R&A

Science.gov Websites

provide strategy, leadership, and guidance to create a unified information management and technology Skip to main content (Press Enter). Toggle navigation Chief Information Officer Search Search Chief Information Officer: Search Search Chief Information Officer: Search Chief Information Officer U.S. Department

Information Technology Exchange Program (ITEP) - U.S. Department of Defense

Science.gov Websites

Skip to main content (Press Enter). Toggle navigation Chief Information Officer Search Search Chief Information Officer: Search Search Chief Information Officer: Search Chief Information Officer U.S. Department of Defense Chief Information Officer Home About DoD CIO Bios Organization DCIO C4&IIC DCIO IE

Web and Internet-based Capabilities (IbC) Policies - U.S. Department of

Science.gov Websites

Defense Skip to main content (Press Enter). Toggle navigation Chief Information Officer Search Search Chief Information Officer: Search Search Chief Information Officer: Search Chief Information Officer U.S. Department of Defense Chief Information Officer Home About DoD CIO Bios Organization DCIO C4

Chief Information Officer > About DoD CIO > Organization > DCIO IE

Science.gov Websites

Skip to main content (Press Enter). Toggle navigation Chief Information Officer Search Search Chief Information Officer: Search Search Chief Information Officer: Search Chief Information Officer U.S. Department of Defense Chief Information Officer Home About DoD CIO Bios Organization DCIO C4&IIC DCIO IE

Learn More at Public Meetings | NOAA Gulf Spill Restoration

Science.gov Websites

Skip to main content Home Home Toggle navigation Search form Search Search the web Search NOAA Gulf Spill Restoration Search Home About Us Trustees Contact Us How We Restore Planning Damage Assessment Archive Home Learn More at Public Meetings Learn More at Public Meetings Get Involved in Restoring the

Forecasts - NOAA's National Weather Service

Science.gov Websites

select the go button to submit request City, St Go Sign-up for Email Alerts RSS Feeds RSS Feeds Warnings Skip Navigation Links weather.gov NOAA logo-Select to go to the NOAA homepage National Oceanic and Atmospheric Administration's Select to go to the NWS homepage National Weather Service Site Map News

Observations - NOAA's National Weather Service

Science.gov Websites

select the go button to submit request City, St Go Sign-up for Email Alerts RSS Feeds RSS Feeds Warnings Skip Navigation Links weather.gov NOAA logo-Select to go to the NOAA homepage National Oceanic and Atmospheric Administration's Select to go to the NWS homepage National Weather Service Site Map News

Warnings/Watches - NOAA's National Weather Service

Science.gov Websites

select the go button to submit request City, St Go Sign-up for Email Alerts RSS Feeds RSS Feeds Warnings Skip Navigation Links weather.gov NOAA logo-Select to go to the NOAA homepage National Oceanic and Atmospheric Administration's Select to go to the NWS homepage National Weather Service Site Map News

NOAA's National Hydrologic Assessment

Science.gov Websites

select the go button to submit request City, St Go Sign-up for Email Alerts RSS Feeds RSS Feeds Warnings Skip Navigation Links weather.gov NOAA logo-Select to go to the NOAA homepage National Oceanic and Atmospheric Administration's Select to go to the NWS homepage National Weather Service Site Map News

National Maps - Pacific - NOAA's National Weather Service

Science.gov Websites

select the go button to submit request City, St Go Sign-up for Email Alerts RSS Feeds RSS Feeds Warnings Skip Navigation Links weather.gov NOAA logo-Select to go to the NOAA homepage National Oceanic and Atmospheric Administration's Select to go to the NWS homepage National Weather Service Site Map News

Weather Education/Outreach - NOAA's National Weather Service

Science.gov Websites

select the go button to submit request City, St Go Sign-up for Email Alerts RSS Feeds RSS Feeds Warnings Skip Navigation Links weather.gov NOAA logo-Select to go to the NOAA homepage National Oceanic and Atmospheric Administration's Select to go to the NWS homepage National Weather Service Site Map News

Careers in Weather - NOAA's National Weather Service

Science.gov Websites

select the go button to submit request City, St Go Sign-up for Email Alerts RSS Feeds RSS Feeds Warnings Skip Navigation Links weather.gov NOAA logo-Select to go to the NOAA homepage National Oceanic and Atmospheric Administration's Select to go to the NWS homepage National Weather Service Site Map News

GOES West - Hawaii IR4 Imagery Loop (Flash) - Satellite Products and

Science.gov Websites

Services Division/Office of Satellite and Product Operations Skip Navigation Link NESDIS banner image and link to NESDIS link to the NOAA Home page Link to the National Environmental Satellite, Data , and Information Service Home Page Default Office of Satellite and Product Operations banner image and

Climate Forecast System

Science.gov Websites

Skip Navigation Links www.nws.noaa.gov NOAA logo - Click to go to the NOAA home page National Weather Service NWS logo - Click to go to the NWS home page Climate Forecast System Home News Organization Search : Go Search Go CFS Home CFS version 2 News Documentation Downloads Reanalysis CFSv2 at CPC CFS

About | DOE Data Explorer

Science.gov Websites

skip to main content DDE Toggle Navigation Home About DDE FAQs DOE Data ID Service Data ID Service Data ID Service Workshops Contact Us dataexplorer Search For Terms: + Advanced Search × Advanced /Simulations Figures/Plots Genome/Genetics Data Interactive Data Map(s) Multimedia Numeric Data Specialized Mix

GOES Composite - El Niño Support Imagery - Satellite Products and Services

Science.gov Websites

Division/Office of Satellite and Product Operations Skip Navigation Link NESDIS banner image Information Service Home Page Default Office of Satellite and Product Operations banner image and link to OSPO MIRS MSPPS Ocean -- Coral Bleaching -- Ocean Color -- Sea/Lake Ice -- Sea Surface Height -- Sea Surface

Data and Statistics on New York's Mining Resources - NYS Dept. of

Science.gov Websites

New York's Mining Resources Skip to main navigation Data and Statistics on New York's Mining Resources and review information about the regulated site. Materials Mined in New York- This site provides information on the various material mined in New York and the locations where they are extracted. Mined Land

Refrigeration and Food Safety

MedlinePlus

... Administrative Forms Standard Forms Skip Navigation Z7_0Q0619C0JGR010IFST1G5B10H1 Web Content Viewer (JSR 286) Actions ${title} Loading... / Topics / ... Food Safety / Refrigeration and Food Safety Z7_0Q0619C0JGR010IFST1G5B10H3 Web Content Viewer (JSR 286) Actions ${title} Loading... Z7_ ...

Bovine Spongiform Encephalopathy: Production and Inspection

MedlinePlus

... Administrative Forms Standard Forms Skip Navigation Z7_0Q0619C0JGR010IFST1G5B10H1 Web Content Viewer (JSR 286) Actions ${title} Loading... / Topics / ... FSIS Further Strengthens Protections Against BSE Z7_0Q0619C0JGR010IFST1G5B10H3 Web Content Viewer (JSR 286) Actions ${title} Loading... Z7_ ...

Food Safety Tips for College Students

MedlinePlus

... Administrative Forms Standard Forms Skip Navigation Z7_0Q0619C0JGR010IFST1G5B10H1 Web Content Viewer (JSR 286) Actions ${title} Loading... / Topics / ... Food Safety Tips for College Students Z7_0Q0619C0JGR010IFST1G5B10H3 Web Content Viewer (JSR 286) Actions ${title} Loading... Z7_ ...

Fires and Food Safety

MedlinePlus

... Administrative Forms Standard Forms Skip Navigation Z7_0Q0619C0JGR010IFST1G5B10H1 Web Content Viewer (JSR 286) Actions ${title} Loading... / Topics / ... Food Safety / Fires and Food Safety Z7_0Q0619C0JGR010IFST1G5B10H3 Web Content Viewer (JSR 286) Actions ${title} Loading... Z7_ ...

Safe Minimum Internal Temperature Chart

MedlinePlus

... Administrative Forms Standard Forms Skip Navigation Z7_0Q0619C0JGR010IFST1G5B10H1 Web Content Viewer (JSR 286) Actions ${title} Loading... / Topics / ... Chart / Safe Minimum Internal Temperature Chart Z7_0Q0619C0JGR010IFST1G5B10H3 Web Content Viewer (JSR 286) Actions ${title} Loading... Z7_ ...

Parasites and Foodborne Illness

MedlinePlus

... Administrative Forms Standard Forms Skip Navigation Z7_0Q0619C0JGR010IFST1G5B10H1 Web Content Viewer (JSR 286) Actions ${title} Loading... / Topics / ... and Disease / Parasites and Foodborne Illness Z7_0Q0619C0JGR010IFST1G5B10H3 Web Content Viewer (JSR 286) Actions ${title} Loading... Z7_ ...

Chief Information Officer > About DoD CIO > Organization > DCIO C4&IIC

Science.gov Websites

Skip to main content (Press Enter). Toggle navigation Chief Information Officer Search Search Chief Information Officer: Search Search Chief Information Officer: Search Chief Information Officer U.S. Department of Defense Chief Information Officer Home About DoD CIO Bios Organization DCIO C4&IIC DCIO IE

Mission Statement - NOAA's National Weather Service

Science.gov Websites

select the go button to submit request City, St Go Sign-up for Email Alerts RSS Feeds RSS Feeds Warnings data, forecasts and warnings for the protection of life and property and enhancement of the national Skip Navigation Links weather.gov NOAA logo-Select to go to the NOAA homepage National Oceanic and

National Maps - Alaska - NOAA's National Weather Service

Science.gov Websites

select the go button to submit request City, St Go Sign-up for Email Alerts RSS Feeds RSS Feeds Warnings current Forecast for Alaska is produced by the NWS Anchorage Forecast Office. It is updated daily Skip Navigation Links weather.gov NOAA logo-Select to go to the NOAA homepage National Oceanic and

Attention: Page has moved

Science.gov Websites

Skip Navigation Links www.nws.noaa.gov NOAA logo - Click to go to the NOAA home page National Weather Service NWS logo - Click to go to the NWS home page Climate Prediction Center Site Map News Organization Search All NWS Search Go CPC Search CPC search Go About Us Our Mission Who We Are Contact Us CPC

Freezing and Food Safety

MedlinePlus

... Administrative Forms Standard Forms Skip Navigation Z7_0Q0619C0JGR010IFST1G5B10H1 Web Content Viewer (JSR 286) Actions ${title} Loading... / Topics / ... Food Safety / Freezing and Food Safety Z7_0Q0619C0JGR010IFST1G5B10H3 Web Content Viewer (JSR 286) Actions ${title} Loading... Z7_ ...

Asymmetry of different brain structures in homing pigeons with and without navigational experience.

PubMed

Mehlhorn, Julia; Haastert, Burkhard; Rehkämper, Gerd

2010-07-01

Homing pigeons (Columba livia f.d.) are well-known for their homing abilities, and their brains seem to be functionally adapted to homing as exemplified, e.g. by their larger hippocampi and olfactory bulbs. Their hippocampus size is influenced by navigational experience, and, as in other birds, functional specialisation of the left and right hemispheres ('lateralisation') occurs in homing pigeons. To show in what way lateralisation is reflected in brain structure volume, and whether some lateralisation or asymmetry in homing pigeons is caused by experience, we compared brains of homing pigeons with and without navigational experience referring to this. Fourteen homing pigeons were raised under identical constraints. After fledging, seven of them were allowed to fly around the loft and participated successfully in races. The other seven stayed permanently in the loft and thus did not share the navigational experiences of the first group. After reaching sexual maturity, all individuals were killed and morphometric analyses were carried out to measure the volumes of five basic brain parts and eight telencephalic brain parts. Measurements of telencephalic brain parts and optic tectum were done separately for the left and right hemispheres. The comparison of left/right quotients of both groups reveal that pigeons with navigational experience show a smaller left mesopallium in comparison with the right mesopallium and pigeons without navigational experience a larger left mesopallium in comparison with the right one. Additionally, there are significant differences between left and right brain subdivisions within the two pigeon groups, namely a larger left hyperpallium apicale in both pigeon groups and a larger right nidopallium, left hippocampus and right optic tectum in pigeons with navigational experience. Pigeons without navigational experience did not show more significant differences between their left and right brain subdivisions. The results of our study confirm that the brain of homing pigeons is an example for mosaic evolution and indicates that lateralisation is correlated with individual life history (experience) and not exclusively based on heritable traits.

Chief Information Officer > DoDSection508 > Std_Stmt

Science.gov Websites

Skip to main content (Press Enter). Toggle navigation Chief Information Officer Search Search Chief Information Officer: Search Search Chief Information Officer: Search Chief Information Officer U.S. Department of Defense Chief Information Officer Home About DoD CIO Bios Organization DCIO C4&IIC DCIO IE

Chief Information Officer - U.S. Department of Defense

Science.gov Websites

Skip to main content (Press Enter). Toggle navigation Chief Information Officer Search Search Chief Information Officer: Search Search Chief Information Officer: Search Chief Information Officer U.S. Department of Defense Chief Information Officer Home About DoD CIO Bios Organization DCIO C4&IIC DCIO IE

Frozen, Fully-Cooked Products and Botulism--Food Safety Advisory

MedlinePlus

... Administrative Forms Standard Forms Skip Navigation Z7_0Q0619C0JGR010IFST1G5B10H1 Web Content Viewer (JSR 286) Actions ${title} Loading... / Topics / ... Frozen Fully-cooked Products and Botulism Z7_0Q0619C0JGR010IFST1G5B10H3 Web Content Viewer (JSR 286) Actions ${title} Loading... Z7_ ...

Natural Flavorings on Meat and Poultry Labels

MedlinePlus

... Administrative Forms Standard Forms Skip Navigation Z7_0Q0619C0JGR010IFST1G5B10H1 Web Content Viewer (JSR 286) Actions ${title} Loading... / Topics / ... Flavorings on Meat and Poultry Labels Z7_0Q0619C0JGR010IFST1G5B10H3 Web Content Viewer (JSR 286) Actions ${title} Loading... Z7_ ...

Climate Prediction Center - Global Tropical Hazards Assessment

Science.gov Websites

Skip Navigation Links www.nws.noaa.gov NOAA logo - Click to go to the NOAA home page National Weather Service NWS logo - Click to go to the NWS home page Climate Prediction Center Home Site Map News Organization Search Go Search the CPC Go Climate Outlooks Climate & Weather Link El Niño/La Niña MJO

Climate Prediction Center - Monitoring & Data: La Niña Seasonal Maps and

Science.gov Websites

Statistics Skip Navigation Links www.nws.noaa.gov NOAA logo - Click to go to the NOAA home page National Weather Service NWS logo - Click to go to the NWS home page Climate Prediction Center Home Site Map News Organization Search Go Search the CPC Go About Us Our Mission Who We Are Contact Us

NOAA's National Weather Service

Science.gov Websites

select the go button to submit request City, St Go Sign-up for Email Alerts RSS Feeds RSS Feeds Warnings prepares the Annual Flood Loss summary for the U.S. Army Corps of Engineers. 2014 2013 2012 2011 2010 2009 Skip Navigation Links weather.gov NOAA logo-Select to go to the NOAA homepage National Oceanic and

Initial experience with remote magnetic navigation for left ventricular lead placement.

PubMed

Mischke, Karl; Knackstedt, Christian; Schmid, Michael; Hatam, Nima; Becker, Michael; Spillner, Jan; Fache, Kerstin; Kelm, Malte; Schauerte, Patrick

2009-08-01

A novel magnetic navigation system allows remote steering of guidewires and catheters. This system may be used for left ventricular lead placement for cardiac resynchronization therapy (CRT). We sought to evaluate the feasibility and safety of magnetic guidewire navigation for CRT procedures. 123 consecutive patients underwent CRT implantation/revision procedures (including pacemaker upgrades in n=22 and left ventricular lead placement after dislocation in n=4 patients). Left ventricular lead placement in a coronary sinus side branch was performed either conventionally or using magnetic navigation. The magnetic navigation system (Niobe) consists of two permanent magnets creating a steerable magnetic field. Guidewires with integrated magnets align to the magnetic field and were used for over-the-wire implantation of pacemaker leads in the coronary sinus. Patients were assigned to conventional (n=93) or magnetic (n=30) navigation according to room availability. Venography of the coronary venous system was performed to select a target vessel for lead implantation. Guidewire access to the target vessel was achieved in 100% using magnetic navigation compared to 87% with the conventional approach (P < 0.05). Implantation success rates, total procedure and fluoroscopy times did not differ significantly between groups. No periprocedural death and no intraoperative device dysfunction occurred in either group.The magnetic guidewire ruptured in one patient. Left ventricular lead placement using magnetic guidewire navigation to engage the desired coronary sinus side branch can be successfully performed for CRT.

Chief Information Officer > About DoD CIO > Organization > DCIO CS

Science.gov Websites

Skip to main content (Press Enter). Toggle navigation Chief Information Officer Search Search Chief Information Officer: Search Search Chief Information Officer: Search Chief Information Officer U.S. Department of Defense Chief Information Officer Home About DoD CIO Bios Organization DCIO C4&IIC DCIO IE

Data on Oil, Gas and Other Wells in New York State - NYS Dept. of

Science.gov Websites

Site Cleanup Water Air Pesticides Oil & Gas Wells and Mining Regulatory Regulations Permits and ): Search DEC D E C banner Home » Energy and Climate » Oil and Gas » Data on Oil, Gas and Other Wells in New York State Skip to main navigation Data on Oil, Gas and Other Wells in New York State The

94. Photographic copy of historic photo, December 26, 1929 (original ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

94. Photographic copy of historic photo, December 26, 1929 (original print filed in Record Group 115, National Archives, Washington, D.C.). OWYHEE DAM-LOADING CAR FROM CABLEWAY SKIP. CABLEWAY CONTROL HOUSE IN UPPER RIGHT, PART OF UPPER COFFERDAM AT LEFT. - Owyhee Dam, Across Owyhee River, Nyssa, Malheur County, OR

Hitchhiking Robots: A Collaborative Approach for Efficient Multi-Robot Navigation in Indoor Environments

PubMed Central

Ravankar, Abhijeet; Ravankar, Ankit A.; Kobayashi, Yukinori; Emaru, Takanori

2017-01-01

Hitchhiking is a means of transportation gained by asking other people for a (free) ride. We developed a multi-robot system which is the first of its kind to incorporate hitchhiking in robotics, and discuss its advantages. Our method allows the hitchhiker robot to skip redundant computations in navigation like path planning, localization, obstacle avoidance, and map update by completely relying on the driver robot. This allows the hitchhiker robot, which performs only visual servoing, to save computation while navigating on the common path with the driver robot. The driver robot, in the proposed system performs all the heavy computations in navigation and updates the hitchhiker about the current localized positions and new obstacle positions in the map. The proposed system is robust to recover from ‘driver-lost’ scenario which occurs due to visual servoing failure. We demonstrate robot hitchhiking in real environments considering factors like service-time and task priority with different start and goal configurations of the driver and hitchhiker robots. We also discuss the admissible characteristics of the hitchhiker, when hitchhiking should be allowed and when not, through experimental results. PMID:28809803

Hitchhiking Robots: A Collaborative Approach for Efficient Multi-Robot Navigation in Indoor Environments.

PubMed

Ravankar, Abhijeet; Ravankar, Ankit A; Kobayashi, Yukinori; Emaru, Takanori

2017-08-15

Hitchhiking is a means of transportation gained by asking other people for a (free) ride. We developed a multi-robot system which is the first of its kind to incorporate hitchhiking in robotics, and discuss its advantages. Our method allows the hitchhiker robot to skip redundant computations in navigation like path planning, localization, obstacle avoidance, and map update by completely relying on the driver robot. This allows the hitchhiker robot, which performs only visual servoing, to save computation while navigating on the common path with the driver robot. The driver robot, in the proposed system performs all the heavy computations in navigation and updates the hitchhiker about the current localized positions and new obstacle positions in the map. The proposed system is robust to recover from `driver-lost' scenario which occurs due to visual servoing failure. We demonstrate robot hitchhiking in real environments considering factors like service-time and task priority with different start and goal configurations of the driver and hitchhiker robots. We also discuss the admissible characteristics of the hitchhiker, when hitchhiking should be allowed and when not, through experimental results.

RNAV STAR Procedural Adherence

NASA Technical Reports Server (NTRS)

Stewart, Michael J.; Matthews, Bryan L.

2017-01-01

In this exploratory archival study we mined the performance of 24 major US airports area navigation standard terminal arrival routes (RNAV STARs) over the preceding three years. Overlaying radar track data on top of RNAV STAR routes provided a comparison between aircraft flight paths and the waypoint positions and altitude restrictions. NASA Ames Supercomputing resources were utilized to perform the data mining and processing. We investigated STARs by lateral transition path (full-lateral), vertical restrictions (full-lateral/full-vertical), and skipped waypoints (skips). In addition, we graphed altitudes and their frequencies of occurrence for altitude restrictions. Full-lateral compliance was generally greater than Full-lateral/full-vertical, but the delta between the rates was not always consistent. Full-lateral/full-vertical usage medians of the 2016 procedures ranged from 0 in KDEN (Denver) to 21 in KMEM (Memphis). Waypoint skips ranged from 0 to nearly 100 for specific waypoints. Altitudes restrictions were sometimes missed by systemic amounts in 1000 ft. increments from the restriction, creating multi-modal distributions. Other times, altitude misses looked to be more normally distributed around the restriction. This work is a preliminary investigation into the objective performance of instrument procedures and provides a framework to track how procedural concepts and design intervention function. In addition, this tool may aid in providing acceptability metrics as well as risk assessment information.

Optimal configuration of respiratory navigator gating for the quantification of left ventricular strain using spiral cine displacement encoding with stimulated echoes (DENSE) MRI.

PubMed

Hamlet, Sean M; Haggerty, Christopher M; Suever, Jonathan D; Wehner, Gregory J; Andres, Kristin N; Powell, David K; Zhong, Xiaodong; Fornwalt, Brandon K

2017-03-01

To determine the optimal respiratory navigator gating configuration for the quantification of left ventricular strain using spiral cine displacement encoding with stimulated echoes (DENSE) MRI. Two-dimensional spiral cine DENSE was performed on a 3 Tesla MRI using two single-navigator configurations (retrospective, prospective) and a combined "dual-navigator" configuration in 10 healthy adults and 20 healthy children. The adults also underwent breathhold DENSE as a reference standard for comparisons. Peak left ventricular strains, signal-to-noise ratio (SNR), and navigator efficiency were compared. Subjects also underwent dual-navigator gating with and without visual feedback to determine the effect on navigator efficiency. There were no differences in circumferential, radial, and longitudinal strains between navigator-gated and breathhold DENSE (P = 0.09-0.95) (as confidence intervals, retrospective: [-1.0%-1.1%], [-7.4%-2.0%], [-1.0%-1.2%]; prospective: [-0.6%-2.7%], [-2.8%-8.3%], [-0.3%-2.9%]; dual: [-1.6%-0.5%], [-8.3%-3.2%], [-0.8%-1.9%], respectively). The dual configuration maintained SNR compared with breathhold acquisitions (16 versus 18, P = 0.06). SNR for the prospective configuration was lower than for the dual navigator in adults (P = 0.004) and children (P < 0.001). Navigator efficiency was higher (P < 0.001) for both retrospective (54%) and prospective (56%) configurations compared with the dual configuration (35%). Visual feedback improved the dual configuration navigator efficiency to 55% (P < 0.001). When quantifying left ventricular strains using spiral cine DENSE MRI, a dual navigator configuration results in the highest SNR in adults and children. In adults, a retrospective configuration has good navigator efficiency without a substantial drop in SNR. Prospective gating should be avoided because it has the lowest SNR. Visual feedback represents an effective option to maintain navigator efficiency while using a dual navigator configuration. 2 J. Magn. Reson. Imaging 2017;45:786-794. © 2016 International Society for Magnetic Resonance in Medicine.

Dynamic performance of an aero-assist spacecraft - AFE

NASA Technical Reports Server (NTRS)

Chang, Ho-Pen; French, Raymond A.

1992-01-01

Dynamic performance of the Aero-assist Flight Experiment (AFE) spacecraft was investigated using a high-fidelity 6-DOF simulation model. Baseline guidance logic, control logic, and a strapdown navigation system to be used on the AFE spacecraft are also modeled in the 6-DOF simulation. During the AFE mission, uncertainties in the environment and the spacecraft are described by an error space which includes both correlated and uncorrelated error sources. The principal error sources modeled in this study include navigation errors, initial state vector errors, atmospheric variations, aerodynamic uncertainties, center-of-gravity off-sets, and weight uncertainties. The impact of the perturbations on the spacecraft performance is investigated using Monte Carlo repetitive statistical techniques. During the Solid Rocket Motor (SRM) deorbit phase, a target flight path angle of -4.76 deg at entry interface (EI) offers very high probability of avoiding SRM casing skip-out from the atmosphere. Generally speaking, the baseline designs of the guidance, navigation, and control systems satisfy most of the science and mission requirements.

Optimal Configuration of Respiratory Navigator Gating for the Quantification of Left Ventricular Strain Using Spiral Cine Displacement Encoding with Stimulated Echoes (DENSE) MRI

PubMed Central

Hamlet, Sean M.; Haggerty, Christopher M.; Suever, Jonathan D.; Wehner, Gregory J.; Andres, Kristin N.; Powell, David K.; Fornwalt, Brandon K.

2016-01-01

Purpose To determine the optimal respiratory navigator gating configuration for the quantification of left ventricular strain using spiral cine displacement encoding with stimulated echoes (DENSE) MRI. Materials and Methods 2D spiral cine DENSE was performed on a 3T MRI using two single-navigator configurations (retrospective, prospective), and a combined “dual-navigator” configuration in 10 healthy adults and 20 healthy children. The adults also underwent breath-hold DENSE as a reference standard for comparisons. Peak left ventricular strains, signal-to-noise ratio (SNR) and navigator efficiency were compared. Subjects also underwent dual-navigator gating with and without visual feedback to determine the effect on navigator efficiency. Results There were no differences in circumferential, radial and longitudinal strains between navigator-gated and breath-hold DENSE (p=0.09–0.95) (as confidence intervals, retrospective: [−1.0%,1.1%],[−7.4%,2.0%],[−1.0%,1.2%]; prospective: [−0.6%,2.7%],[−2.8%,8.3%],[−0.3%,2.9%]; dual: [−1.6%,0.5%],[−8.3%,3.2%],[−0.8%,1.9%], respectively). The dual configuration maintained SNR compared to breath-hold acquisitions (16 vs. 18, p=0.06). SNR for the prospective configuration was lower than for the dual navigator in adults (p=0.004) and children (p<0.001). Navigator efficiency was higher (p<0.001) for both retrospective (54%) and prospective (56%) configurations compared to the dual configuration (35%). Visual feedback improved the dual configuration navigator efficiency to 55% (p<0.001). Conclusion When quantifying left ventricular strains using spiral cine DENSE MRI, a dual navigator configuration results in the highest SNR in adults and children. In adults, a retrospective configuration has good navigator efficiency without a substantial drop in SNR. Prospective gating should be avoided since it has the lowest SNR. Visual feedback represents an effective option to maintain navigator efficiency while using a dual navigator configuration. PMID:27458823

Remote magnetic navigation for accurate, real-time catheter positioning and ablation in cardiac electrophysiology procedures.

PubMed

Filgueiras-Rama, David; Estrada, Alejandro; Shachar, Josh; Castrejón, Sergio; Doiny, David; Ortega, Marta; Gang, Eli; Merino, José L

2013-04-21

New remote navigation systems have been developed to improve current limitations of conventional manually guided catheter ablation in complex cardiac substrates such as left atrial flutter. This protocol describes all the clinical and invasive interventional steps performed during a human electrophysiological study and ablation to assess the accuracy, safety and real-time navigation of the Catheter Guidance, Control and Imaging (CGCI) system. Patients who underwent ablation of a right or left atrium flutter substrate were included. Specifically, data from three left atrial flutter and two counterclockwise right atrial flutter procedures are shown in this report. One representative left atrial flutter procedure is shown in the movie. This system is based on eight coil-core electromagnets, which generate a dynamic magnetic field focused on the heart. Remote navigation by rapid changes (msec) in the magnetic field magnitude and a very flexible magnetized catheter allow real-time closed-loop integration and accurate, stable positioning and ablation of the arrhythmogenic substrate.

Remote Magnetic Navigation for Accurate, Real-time Catheter Positioning and Ablation in Cardiac Electrophysiology Procedures

PubMed Central

Filgueiras-Rama, David; Estrada, Alejandro; Shachar, Josh; Castrejón, Sergio; Doiny, David; Ortega, Marta; Gang, Eli; Merino, José L.

2013-01-01

New remote navigation systems have been developed to improve current limitations of conventional manually guided catheter ablation in complex cardiac substrates such as left atrial flutter. This protocol describes all the clinical and invasive interventional steps performed during a human electrophysiological study and ablation to assess the accuracy, safety and real-time navigation of the Catheter Guidance, Control and Imaging (CGCI) system. Patients who underwent ablation of a right or left atrium flutter substrate were included. Specifically, data from three left atrial flutter and two counterclockwise right atrial flutter procedures are shown in this report. One representative left atrial flutter procedure is shown in the movie. This system is based on eight coil-core electromagnets, which generate a dynamic magnetic field focused on the heart. Remote navigation by rapid changes (msec) in the magnetic field magnitude and a very flexible magnetized catheter allow real-time closed-loop integration and accurate, stable positioning and ablation of the arrhythmogenic substrate. PMID:23628883

Functional asymmetry of left and right avian piriform cortex in homing pigeons' navigation.

PubMed

Gagliardo, Anna; Odetti, Francesca; Ioalè, Paolo; Pecchia, Tommaso; Vallortigara, Giorgio

2005-07-01

It has been shown that homing pigeons rely on olfactory cues to navigate over unfamiliar areas and that any kind of olfactory impairment produces a dramatic reduction of navigational performance from unfamiliar sites. The avian piriform cortex is the main projection field of olfactory bulbs and it is supposed to process olfactory information; not surprisingly bilateral lesions to this telencephalic region disrupt homing pigeon navigation. In the present study, we attempted to assess whether the left and right piriform cortex are differentially involved in the use of the olfactory navigational map. Therefore, we released from unfamiliar locations pigeons subjected, when adult, to unilateral ablation of the piriform cortex. After being released, the pigeons lesioned to the right piriform cortex orientated similarly to the intact controls. On the contrary, the left lesioned birds were significantly more scattered than controls, showing a crucial role of the left piriform cortex in processing the olfactory cues needed for determining the direction of displacement. However, both lesioned groups were significantly slower than controls in flying back to the home loft, showing that the integrity of both sides of the piriform cortex is necessary to accomplish the whole homing process.

ACHP | Working Together to Build a More Inclusive Preservation Program

Science.gov Websites

Search skip specific nav links Home arrow Inclusiveness arrow Jay Vogt Interview Interview with Jay D Often times when we think about history, we think of people...who they are and what they accomplished people made and left behind, such as written records, objects, buildings, and structures...houses from

Lateralized hippocampal oscillations underlie distinct aspects of human spatial memory and navigation.

PubMed

Miller, Jonathan; Watrous, Andrew J; Tsitsiklis, Melina; Lee, Sang Ah; Sheth, Sameer A; Schevon, Catherine A; Smith, Elliot H; Sperling, Michael R; Sharan, Ashwini; Asadi-Pooya, Ali Akbar; Worrell, Gregory A; Meisenhelter, Stephen; Inman, Cory S; Davis, Kathryn A; Lega, Bradley; Wanda, Paul A; Das, Sandhitsu R; Stein, Joel M; Gorniak, Richard; Jacobs, Joshua

2018-06-21

The hippocampus plays a vital role in various aspects of cognition including both memory and spatial navigation. To understand electrophysiologically how the hippocampus supports these processes, we recorded intracranial electroencephalographic activity from 46 neurosurgical patients as they performed a spatial memory task. We measure signals from multiple brain regions, including both left and right hippocampi, and we use spectral analysis to identify oscillatory patterns related to memory encoding and navigation. We show that in the left but not right hippocampus, the amplitude of oscillations in the 1-3-Hz "low theta" band increases when viewing subsequently remembered object-location pairs. In contrast, in the right but not left hippocampus, low-theta activity increases during periods of navigation. The frequencies of these hippocampal signals are slower than task-related signals in the neocortex. These results suggest that the human brain includes multiple lateralized oscillatory networks that support different aspects of cognition.

Roles of the Wada Test and Functional Magnetic Resonance Imaging in Identifying the Language-dominant Hemisphere among Patients with Gliomas Located near Speech Areas.

PubMed

Ishikawa, Tatsuya; Muragaki, Yoshihiro; Maruyama, Takashi; Abe, Kayoko; Kawamata, Takakazu

2017-01-15

This study examined the accuracy of functional magnetic resonance imaging (fMRI) in identifying the language-dominant hemisphere and the situations in which the Wada test can be skipped among patients with gliomas located near speech areas. We examined 74 patients [48 men (64.9%); mean ± standard deviation age of 42.7 ± 13.6 years (range: 13 to 70 years); 71 right-handed, 2 left-handed, and 1 ambidextrous] with gliomas located near speech areas. All patients underwent the Wada test and fMRI, and 34 patients underwent awake surgery. The "last-and-first" task was administered during fMRI. The Wada test was successful in determining the language-dominant hemisphere in 73 patients (98.6%): left hemisphere in 68 patients (91.9%), right hemisphere in 4 patients (5.4%), and bilateral in 1 patient (1.4%). The dominant hemisphere for right-handed patients (n = 71) was the left hemisphere in 67 patients (94.3%), right hemisphere in 3 patients (4.2%), and undetectable in 1 patient (1.4%). The fMRI was successful in determining the language-dominant hemisphere in 53 patients (71.6%). The results of the Wada test and fMRI were inconsistent in 5 patients (8.6%), of which 3 (5.2%) exhibited dominance in opposite hemispheres. Furthermore, 2 of these 3 cases (2.7%) were contralateral false positive cases, whereby fMRI identified the right-hemisphere as language dominant for right-handed individuals with tumors in the left hemisphere. Based on these findings, we concluded that the Wada test can be skipped if language dominancy can be detected by fMRI.

[The validity of the sentinel node concept in gastrointestinal cancers].

PubMed

Kitagawa, Y; Fujii, H; Mukai, M; Ando, N; Kubota, T; Ikeda, T; Ohgami, M; Watanabe, M; Otani, Y; Ozawa, S; Hasegawa, H; Furukawa, T; Nakahara, T; Kubo, A; Kumai, K; Kitajima, M

2000-03-01

Although the sentinel node concept has been validated and clinically applied to breast cancer and malignant melanoma, its clinical significance in other solid tumors has not been thoroughly investigated. With regard to gastrointestinal (GI) cancers in particular, our surgeons have been cautious because of the high frequency of skip metastasis and the complicated lymphatic system in the GI tract. We would like to emphasize that so-called skip metastasis has been defined according to anatomic classification of regional lymph nodes and that the lymphatic drainage route must be patient or lesion specific. To test the validity and feasibility of this concept in GI cancers, we have established a radio-guided intraoperative sentinel node navigation system using preoperative endoscopic submucosal injection of radioactive tracer followed by intra-operative gamma-probing. In 131 patients with GI cancers (esophagus: 22, stomach: 71, colorectum: 38), the detection rate of sentinel nades was 91% and overall diagnostic accuracy of lymph node metastasis by sentinel node status was 97%. Initial results suggest further investigation of this procedure as an accurate staging and a minimally invasive approach to early GI cancers.

Cassini-Huygens Maneuver Experience: Ending the Prime Mission

NASA Technical Reports Server (NTRS)

Goodson, Troy D.; Ballard, Christopher G.; Gist, Emily M.; Hahn, Yungsun; Stumpf, Paul W.; Wagner, Sean V.; Williams, Powtawche N.

2008-01-01

The Cassini-Huygens spacecraft was launched in 1997 on a mission to observe Saturn and its many moons. After a seven-year cruise, it entered a Saturnian orbit for a four-year, prime mission. This paper highlights significant maneuver activities performed during the last year of the prime mission. Specifically, results of 42 recent maneuvers are presented. Many maneuvers have been skipped, saving fuel and flight team effort. The system has performed more accurately than the pre-launch expectations and requirements. This is in large part why the Cassini-Huygens spacecraft has been navigated with tremendous success during the prime mission.

Lymphatic mapping with fluorescence navigation using indocyanine green and axillary surgery in patients with primary breast cancer.

PubMed

Takeuchi, Megumi; Sugie, Tomoharu; Abdelazeem, Kassim; Kato, Hironori; Shinkura, Nobuhiko; Takada, Masahiro; Yamashiro, Hiroyasu; Ueno, Takayuki; Toi, Masakazu

2012-01-01

The indocyanine green fluorescence (ICGf) navigation method provides real-time lymphatic mapping and sentinel lymph node (SLN) visualization, which enables the removal of SLNs and their associated lymphatic networks. In this study, we investigated the features of the drainage pathways detected with the ICGf navigation system and the order of metastasis in axillary nodes. From April 2008 to February 2010, 145 patients with clinically node-negative breast cancer underwent SLN surgery with ICGf navigation. The video-recorded data from 79 patients were used for lymphatic mapping analysis. We analyzed 145 patients with clinically node-negative breast cancer who underwent SLN surgery with the ICGf navigation system. Fluorescence-positive SLNs were identified in 144 (99%) of 145 patients. Both single and multiple routes to the axilla were identified in 47% of cases using video-recorded lymphatic mapping data. An internal mammary route was detected in 6% of the cases. Skip metastasis to the second or third SLNs was observed in 6 of the 28 node-positive patients. We also examined the strategy of axillary surgery using the ICGf navigation system. We found that, based on the features of nodal involvement, 4-node resection could provide precise information on the nodal status. The ICGf navigation system may provide a different lymphatic mapping result than computed tomography lymphography in clinically node-negative breast cancer patients. Furthermore, it enables the identification of lymph nodes that do not accumulate indocyanine green or dye adjacent to the SLNs in the sequence of drainage. Knowledge of the order of nodal metastasis as revealed by the ICGf system may help to personalize the surgical treatment of axilla in SLN-positive cases, although additional studies are required. © 2012 Wiley Periodicals, Inc.

Utilization of two web-based continuing education courses evaluated by Markov chain model.

PubMed

Tian, Hao; Lin, Jin-Mann S; Reeves, William C

2012-01-01

To evaluate the web structure of two web-based continuing education courses, identify problems and assess the effects of web site modifications. Markov chain models were built from 2008 web usage data to evaluate the courses' web structure and navigation patterns. The web site was then modified to resolve identified design issues and the improvement in user activity over the subsequent 12 months was quantitatively evaluated. Web navigation paths were collected between 2008 and 2010. The probability of navigating from one web page to another was analyzed. The continuing education courses' sequential structure design was clearly reflected in the resulting actual web usage models, and none of the skip transitions provided was heavily used. The web navigation patterns of the two different continuing education courses were similar. Two possible design flaws were identified and fixed in only one of the two courses. Over the following 12 months, the drop-out rate in the modified course significantly decreased from 41% to 35%, but remained unchanged in the unmodified course. The web improvement effects were further verified via a second-order Markov chain model. The results imply that differences in web content have less impact than web structure design on how learners navigate through continuing education courses. Evaluation of user navigation can help identify web design flaws and guide modifications. This study showed that Markov chain models provide a valuable tool to evaluate web-based education courses. Both the results and techniques in this study would be very useful for public health education and research specialists.

Utilization of two web-based continuing education courses evaluated by Markov chain model

PubMed Central

Lin, Jin-Mann S; Reeves, William C

2011-01-01

Objectives To evaluate the web structure of two web-based continuing education courses, identify problems and assess the effects of web site modifications. Design Markov chain models were built from 2008 web usage data to evaluate the courses' web structure and navigation patterns. The web site was then modified to resolve identified design issues and the improvement in user activity over the subsequent 12 months was quantitatively evaluated. Measurements Web navigation paths were collected between 2008 and 2010. The probability of navigating from one web page to another was analyzed. Results The continuing education courses' sequential structure design was clearly reflected in the resulting actual web usage models, and none of the skip transitions provided was heavily used. The web navigation patterns of the two different continuing education courses were similar. Two possible design flaws were identified and fixed in only one of the two courses. Over the following 12 months, the drop-out rate in the modified course significantly decreased from 41% to 35%, but remained unchanged in the unmodified course. The web improvement effects were further verified via a second-order Markov chain model. Conclusions The results imply that differences in web content have less impact than web structure design on how learners navigate through continuing education courses. Evaluation of user navigation can help identify web design flaws and guide modifications. This study showed that Markov chain models provide a valuable tool to evaluate web-based education courses. Both the results and techniques in this study would be very useful for public health education and research specialists. PMID:21976027

Differences in navigation performance and postpartal striatal volume associated with pregnancy in humans.

PubMed

Lisofsky, Nina; Wiener, Jan; de Condappa, Olivier; Gallinat, Jürgen; Lindenberger, Ulman; Kühn, Simone

2016-10-01

Pregnancy is accompanied by prolonged exposure to high estrogen levels. Animal studies have shown that estrogen influences navigation strategies and, hence, affects navigation performance. High estrogen levels are related to increased use of hippocampal-based allocentric strategies and decreased use of striatal-based egocentric strategies. In humans, associations between hormonal shifts and navigation strategies are less well studied. This study compared 30 peripartal women (mean age 28years) to an age-matched control group on allocentric versus egocentric navigation performance (measured in the last month of pregnancy) and gray matter volume (measured within two months after delivery). None of the women had a previous pregnancy before study participation. Relative to controls, pregnant women performed less well in the egocentric condition of the navigation task, but not the allocentric condition. A whole-brain group comparison revealed smaller left striatal volume (putamen) in the peripartal women. Across the two groups, left striatal volume was associated with superior egocentric over allocentric performance. Limited by the cross-sectional study design, the findings are a first indication that human pregnancy might be accompanied by structural brain changes in navigation-related neural systems and concomitant changes in navigation strategy. Copyright © 2016 Elsevier Inc. All rights reserved.

Interaction Between Hippocampus and Cerebellum Crus I in Sequence-Based but not Place-Based Navigation

PubMed Central

Iglói, Kinga; Doeller, Christian F.; Paradis, Anne-Lise; Benchenane, Karim; Berthoz, Alain; Burgess, Neil; Rondi-Reig, Laure

2015-01-01

To examine the cerebellar contribution to human spatial navigation we used functional magnetic resonance imaging and virtual reality. Our findings show that the sensory-motor requirements of navigation induce activity in cerebellar lobules and cortical areas known to be involved in the motor loop and vestibular processing. By contrast, cognitive aspects of navigation mainly induce activity in a different cerebellar lobule (VIIA Crus I). Our results demonstrate a functional link between cerebellum and hippocampus in humans and identify specific functional circuits linking lobule VIIA Crus I of the cerebellum to medial parietal, medial prefrontal, and hippocampal cortices in nonmotor aspects of navigation. They further suggest that Crus I belongs to 2 nonmotor loops, involved in different strategies: place-based navigation is supported by coherent activity between left cerebellar lobule VIIA Crus I and medial parietal cortex along with right hippocampus activity, while sequence-based navigation is supported by coherent activity between right lobule VIIA Crus I, medial prefrontal cortex, and left hippocampus. These results highlight the prominent role of the human cerebellum in both motor and cognitive aspects of navigation, and specify the cortico-cerebellar circuits by which it acts depending on the requirements of the task. PMID:24947462

Left Panorama of Spirit's Landing Site

NASA Technical Reports Server (NTRS)

2004-01-01

Left Panorama of Spirit's Landing Site

This is a version of the first 3-D stereo image from the rover's navigation camera, showing only the view from the left stereo camera onboard the Mars Exploration Rover Spirit. The left and right camera images are combined to produce a 3-D image.

Risk factors for spatial memory impairment in patients with temporal lobe epilepsy.

PubMed

Amlerova, Jana; Laczo, Jan; Vlcek, Kamil; Javurkova, Alena; Andel, Ross; Marusic, Petr

2013-01-01

At present, the risk factors for world-centered (allocentric) navigation impairment in patients with temporal lobe epilepsy (TLE) are not known. There is some evidence on the importance of the right hippocampus but other clinical features have not been investigated yet. In this study, we used an experimental human equivalent to the Morris water maze to examine spatial navigation performance in patients with drug-refractory unilateral TLE. We included 47 left-hemisphere speech dominant patients (25 right sided; 22 left sided). The aim of our study was to identify clinical and demographic characteristics of TLE patients who performed poorly in allocentric spatial memory tests. Our results demonstrate that poor spatial navigation is significantly associated with younger age at epilepsy onset, longer disease duration, and lower intelligence level. Allocentric navigation in TLE patients was impaired irrespective of epilepsy lateralization. Good and poor navigators did not differ in their age, gender, or preoperative/postoperative status. This study provides evidence on risk factors that increase the likelihood of allocentric navigation impairment in TLE patients. The results indicate that not only temporal lobe dysfunction itself but also low general cognitive abilities may contribute to the navigation impairment. Copyright © 2012 Elsevier Inc. All rights reserved.

Objective Assessment Method for RNAV STAR Adherence

NASA Technical Reports Server (NTRS)

Stewart, Michael; Matthews, Bryan

2017-01-01

Flight crews and air traffic controllers have reported many safety concerns regarding area navigation standard terminal arrival routes (RNAV STARs). Specifically, optimized profile descents (OPDs). However, our information sources to quantify these issues are limited to subjective reporting and time consuming case-by-case investigations. This work is a preliminary study into the objective performance of instrument procedures and provides a framework to track procedural concepts and assess design specifications. We created a tool and analysis methods for gauging aircraft adherence as it relates to RNAV STARs. This information is vital for comprehensive understanding of how our air traffic behaves. In this study, we mined the performance of 24 major US airports over the preceding three years. Overlaying 4D radar track data onto RNAV STAR routes provided a comparison between aircraft flight paths and the waypoint positions and altitude restrictions. NASA Ames Supercomputing resources were utilized to perform the data mining and processing. We assessed STARs by lateral transition path (full-lateral), vertical restrictions (full-lateral/full-vertical), and skipped waypoints (skips). In addition, we graphed frequencies of aircraft altitudes relative to the altitude restrictions. Full-lateral adherence was always greater than Full-lateral/ full- vertical, as it is a subset, but the difference between the rates was not consistent. Full-lateral/full-vertical adherence medians of the 2016 procedures ranged from 0% in KDEN (Denver) to 21% in KMEM (Memphis). Waypoint skips ranged from 0% to nearly 100% for specific waypoints. Altitudes restrictions were sometimes missed by systematic amounts in 1,000 ft. increments from the restriction, creating multi-modal distributions. Other times, altitude misses looked to be more normally distributed around the restriction. This tool may aid in providing acceptability metrics as well as risk assessment information.

RNAV STAR Procedural Adherence

NASA Technical Reports Server (NTRS)

Matthews, Bryan L.; Stewart, Michael J.

2017-01-01

Flight crews and air traffic controllers have reported many safety concerns regarding area navigation standard terminal arrival routes (RNAV STARs). However, our information sources to quantify these issues are limited to subjective reporting and time consuming case-by-case investigations. This work is a preliminary study into the objective performance of instrument procedures and provides a framework to track procedural concepts and assess design functionality. We created a tool and analysis methods for gauging aircraft adherence as it relates to RNAV STARs. This information is vital for comprehensive understanding of how our air traffic behaves. In this exploratory archival study, we mined the performance of 24 major US airports over the preceding three years. Overlaying radar track data on top of RNAV STAR routes provided a comparison between aircraft flight paths and the waypoint positions and altitude restrictions. NASA Ames Supercomputing resources were utilized to perform the data mining and processing. We assessed STARs by lateral transition path (full-lateral), vertical restrictions (full-lateralfull-vertical), and skipped waypoints (skips). In addition, we graphed aircraft altitudes relative to the altitude restrictions and their occurrence rates. Full-lateral adherence was generally greater than Full-lateralfull-vertical, but the difference between the rates was not always consistent. Full-lateralfull-vertical adherence medians of the 2016 procedures ranged from 0 in KDEN (Denver) to 21 in KMEM (Memphis). Waypoint skips ranged from 0 to nearly 100 for specific waypoints. Altitudes restrictions were sometimes missed by systematic amounts in 1000 ft. increments from the restriction, creating multi-modal distributions. Other times, altitude misses looked to be more normally distributed around the restriction. This tool may aid in providing acceptability metrics as well as risk assessment information.

Orion Entry Handling Qualities Assessments

NASA Technical Reports Server (NTRS)

Bihari, B.; Tiggers, M.; Strahan, A.; Gonzalez, R.; Sullivan, K.; Stephens, J. P.; Hart, J.; Law, H., III; Bilimoria, K.; Bailey, R.

2011-01-01

The Orion Command Module (CM) is a capsule designed to bring crew back from the International Space Station (ISS), the moon and beyond. The atmospheric entry portion of the flight is deigned to be flown in autopilot mode for nominal situations. However, there exists the possibility for the crew to take over manual control in off-nominal situations. In these instances, the spacecraft must meet specific handling qualities criteria. To address these criteria two separate assessments of the Orion CM s entry Handling Qualities (HQ) were conducted at NASA s Johnson Space Center (JSC) using the Cooper-Harper scale (Cooper & Harper, 1969). These assessments were conducted in the summers of 2008 and 2010 using the Advanced NASA Technology Architecture for Exploration Studies (ANTARES) six degree of freedom, high fidelity Guidance, Navigation, and Control (GN&C) simulation. This paper will address the specifics of the handling qualities criteria, the vehicle configuration, the scenarios flown, the simulation background and setup, crew interfaces and displays, piloting techniques, ratings and crew comments, pre- and post-fight briefings, lessons learned and changes made to improve the overall system performance. The data collection tools, methods, data reduction and output reports will also be discussed. The objective of the 2008 entry HQ assessment was to evaluate the handling qualities of the CM during a lunar skip return. A lunar skip entry case was selected because it was considered the most demanding of all bank control scenarios. Even though skip entry is not planned to be flown manually, it was hypothesized that if a pilot could fly the harder skip entry case, then they could also fly a simpler loads managed or ballistic (constant bank rate command) entry scenario. In addition, with the evaluation set-up of multiple tasks within the entry case, handling qualities ratings collected in the evaluation could be used to assess other scenarios such as the constant bank angle maintenance case. The 2008 entry assessment was divided into two sections (see Figure 1). Entry I was the first, high speed portion of a lunar return and Entry II was the second, lower speed portion of a lunar return, which is similar (but not identical) to a typical ISS return.

Performance enhancing water skipping: successive free surface impacts of elastic spheres

NASA Astrophysics Data System (ADS)

Hurd, Randy; Truscott, Tadd; Belden, Jesse

2014-11-01

From naval gunners skipping cannonballs to children skipping stones, physicists have long been enamored with the repeated ricochet of objects on the water surface. Elastic spheres, such as the toy Waboba ball, make water skipping more accessible to the masses by expanding the range of impact parameters over which objects can be skipped. For example, it is not difficult to achieve more than twenty skips with such spheres, where skipping a stone twenty times is very difficult. In this talk we discuss the dynamics of water skipping elastic spheres over several successive skips. High-speed video captured using a unique experimental setup reveals how dynamics change with each skip as a result of lost kinetic energy. We place these observations in the context of previous work on single oblique impacts to identify material vibration modes that are excited during ricochet. The material modes excited with each successive impact are seen to decay from high-energy modes to low energy modes until water entry finally occurs. A model for estimating skipping outcome from initial conditions is proposed.

The controllability of the aeroassist flight experiment atmospheric skip trajectory

NASA Technical Reports Server (NTRS)

Wood, R.

1989-01-01

The Aeroassist Flight Experiment (AFE) will be the first vehicle to simulate a return from geosynchronous orbit, deplete energy during an aerobraking maneuver, and navigate back out of the atmosphere to a low earth orbit It will gather scientific data necessary for future Aeroasisted Orbitl Transfer Vehicles (AOTV's). Critical to mission success is the ability of the atmospheric guidance to accurately attain a targeted post-aeropass orbital apogee while nulling inclination errors and compensating for dispersions in state, aerodynamic, and atmospheric parameters. In typing to satisfy mission constraints, atmospheric entry-interface (EI) conditions, guidance gains, and trajectory. The results of the investigation are presented; emphasizing the adverse effects of dispersed atmospheres on trajectory controllability.

Skipping of Chinese characters does not rely on word-based processing.

PubMed

Lin, Nan; Angele, Bernhard; Hua, Huimin; Shen, Wei; Zhou, Junyi; Li, Xingshan

2018-02-01

Previous eye-movement studies have indicated that people tend to skip extremely high-frequency words in sentence reading, such as "the" in English and "/de" in Chinese. Two alternative hypotheses have been proposed to explain how this frequent skipping happens in Chinese reading: one assumes that skipping happens when the preview has been fully identified at the word level (word-based skipping); the other assumes that skipping happens whenever the preview character is easy to identify regardless of whether lexical processing has been completed or not (character-based skipping). Using the gaze-contingent display change paradigm, we examined the two hypotheses by substituting the preview of the third character of a four-character Chinese word with the high-frequency Chinese character "/de", which should disrupt the ongoing word-level processing. The character-based skipping hypothesis predicts that this manipulation will enhance the skipping probability of the target character (i.e., the third character of the target word), because the character "/de" has much higher character frequency than the original character. The word-based skipping hypothesis instead predicts a reduction of the skipping probability of the target character because the presence of the character "/de" is lexically infelicitous at word level. The results supported the character-based skipping hypothesis, indicating that in Chinese reading the decision of skipping a character can be made before integrating it into a word.

33 CFR 162.75 - All waterways tributary to the Gulf of Mexico (except the Mississippi River, its tributaries...

Code of Federal Regulations, 2011 CFR

2011-07-01

... times be left open to permit free and unobstructed navigation by all types of vessels and tows normally... exceeding these limits must request and receive permission from the COTP New Orleans prior to navigating the...

33 CFR 162.75 - All waterways tributary to the Gulf of Mexico (except the Mississippi River, its tributaries...

Code of Federal Regulations, 2010 CFR

2010-07-01

... times be left open to permit free and unobstructed navigation by all types of vessels and tows normally... exceeding these limits must request and receive permission from the COTP New Orleans prior to navigating the...

Water Bouncing Balls: how material stiffness affects water entry

NASA Astrophysics Data System (ADS)

Truscott, Tadd

2014-03-01

It is well known that one can skip a stone across the water surface, but less well known that a ball can also be skipped on water. Even though 17th century ship gunners were aware that cannonballs could be skipped on the water surface, they did not know that using elastic spheres rather than rigid ones could greatly improve skipping performance (yet would have made for more peaceful volleys). The water bouncing ball (Waboba®) is an elastic ball used in a game of aquatic keep away in which players pass the ball by skipping it along the water surface. The ball skips easily along the surface creating a sense that breaking the world record for number of skips could easily be achieved (51 rock skips Russell Byers 2007). We investigate the physics of skipping elastic balls to elucidate the mechanisms by which they bounce off of the water. High-speed video reveals that, upon impact with the water, the balls create a cavity and deform significantly due to the extreme elasticity; the flattened spheres resemble skipping stones. With an increased wetted surface area, a large hydrodynamic lift force is generated causing the ball to launch back into the air. Unlike stone skipping, the elasticity of the ball plays an important roll in determining the success of the skip. Through experimentation, we demonstrate that the deformation timescale during impact must be longer than the collision time in order to achieve a successful skip. Further, several material deformation modes can be excited upon free surface impact. The effect of impact velocity and angle on the two governing timescales and material wave modes are also experimentally investigated. Scaling for the deformation and collision times are derived and used to establish criteria for skipping in terms of relevant physical parameters.

Potential Association between Breakfast Skipping and Concomitant Late-Night-Dinner Eating with Metabolic Syndrome and Proteinuria in the Japanese Population.

PubMed

Kutsuma, Ayano; Nakajima, Kei; Suwa, Kaname

2014-01-01

Skipping breakfast is considered to be an unhealthy eating habit linked to predispositions to obesity and type 2 diabetes. Because eating dinner late at night can elicit subsequent breakfast skipping, we investigated if skipping breakfast concomitant with late-night-dinner eating (LNDE) was associated with metabolic syndrome (MetS) and proteinuria in the general Japanese population. We examined self-reported habitual breakfast skipping and LNDE, MetS (modified ATP-III criteria), and proteinuria in a cross-sectional study of 60,800 Japanese adults aged 20-75 years. A total of 14,068 subjects (23.1%) skipped breakfast, of whom approximately half (52.8%) skipped breakfast alone (without LNDE). The percentages of subjects who skipped breakfast showed a J-shaped relationship with body mass index (BMI). Multivariate logistic regression analysis showed that skipping breakfast concomitant with LNDE (n = 6,645) was significantly associated with MetS and proteinuria, even after adjusting for relevant confounders (odds ratio (95% CI), 1.17 (1.08-1.28), P = 0.0003, and 1.37 (1.24-1.52), P < 0.0001, resp.). Skipping breakfast alone and LNDE alone were not associated with MetS and proteinuria, respectively. In conclusion, habitual breakfast skipping concomitant with LNDE may represent poorer eating behavior than skipping breakfast alone, associated with MetS, asymptomatic proteinuria, obesity, and low body weight in the general Japanese population.

Reading skill and word skipping: Implications for visual and linguistic accounts of word skipping.

PubMed

Eskenazi, Michael A; Folk, Jocelyn R

2015-11-01

We investigated whether high-skill readers skip more words than low-skill readers as a result of parafoveal processing differences based on reading skill. We manipulated foveal load and word length, two variables that strongly influence word skipping, and measured reading skill using the Nelson-Denny Reading Test. We found that reading skill did not influence the probability of skipping five-letter words, but low-skill readers were less likely to skip three-letter words when foveal load was high. Thus, reading skill is likely to influence word skipping when the amount of information in the parafovea falls within the word identification span. We interpret the data in the context of visual-based (extended optimal viewing position model) and linguistic based (E-Z Reader model) accounts of word skipping. The models make different predictions about how and why a word and skipped; however, the data indicate that both models should take into account the fact that different factors influence skipping rates for high- and low-skill readers. (c) 2015 APA, all rights reserved).

Skipped Stage Modeling and Testing of the CPAS Main Parachutes

NASA Technical Reports Server (NTRS)

Varela, Jose G.; Ray, Eric S.

2013-01-01

The Capsule Parachute Assembly System (CPAS) has undergone the transition from modeling a skipped stage event using a simulation that treats a cluster of parachutes as a single composite canopy to the capability of simulating each parachute individually. This capability along with data obtained from skipped stage flight tests has been crucial in modeling the behavior of a skipping canopy as well as the crowding effect on non-skipping ("lagging") neighbors. For the finite mass inflation of CPAS Main parachutes, the cluster is assumed to inflate nominally through the nominal fill time, at which point the skipping parachute continues inflating. This sub-phase modeling method was used to reconstruct three flight tests involving skipped stages. Best fit inflation parameters were determined for both the skipping and lagging canopies.

Correlates of meal skipping in young adults: a systematic review.

PubMed

Pendergast, Felicity J; Livingstone, Katherine M; Worsley, Anthony; McNaughton, Sarah A

2016-12-01

Meal skipping rates may be highest during young adulthood, a period of transition and development. Although these dietary behaviours may increase future risk of chronic disease, limited research has investigated correlates of meal skipping in young adults. A systematic literature search was conducted to identify studies that investigated correlates of meal skipping behaviours in young adults (aged 18-30 years). EBSCO host, MEDLINE Complete, Global Health, Scopus, EMBASE, Web of Science and Informit platforms were searched for eligible articles. Correlates were defined as any factor that was either associated with meal skipping or was self-reported by the participant to have an influence on meal skipping. Randomised controlled trials, prospective cohort studies, case-control studies, nested case-control studies, cross-sectional studies, and longitudinal studies were eligible for inclusion. Three-hundred and thirty-one articles were identified, 141 full-text articles assessed for eligibility, resulting in 35 included studies. Multiple methodological and reporting weaknesses were apparent in the reviewed studies with 28 of the 35 studies scoring a negative rating in the risk of bias assessment. Meal skipping (any meal), defined as the skipping of any meal throughout the day, was reported in 12 studies with prevalence ranging between 5 and 83%. The remaining 25 studies identified specific meals and their skipping rates, with breakfast the most frequently skipped meal 14-88% compared to lunch 8-57% and dinner 4-57%. Lack of time was consistently reported as an important correlate of meal skipping, compared with correlates such as cost and weight control, while sex was the most commonly reported associated correlate. Breakfast skipping was more common among men while lunch or dinner skipping being more common among women. This review is the first to examine potential correlates of meal skipping in young adults. Future research would benefit from stronger design and reporting strategies, using a standardised approach for measuring and defining meal skipping.

Processing "the" in the Parafovea: Are Articles Skipped Automatically?

ERIC Educational Resources Information Center

Angele, Bernhard; Rayner, Keith

2013-01-01

One of the words that readers of English skip most often is the definite article "the". Most accounts of reading assume that in order for a reader to skip a word, it must have received some lexical processing. The definite article is skipped so regularly, however, that the oculomotor system might have learned to skip the letter string…

Social Inequalities in Young Children’s Meal Skipping Behaviors: The Generation R Study

PubMed Central

Wijtzes, Anne I.; Jansen, Wilma; Jaddoe, Vincent W. V.; Franco, Oscar H.; Hofman, Albert; van Lenthe, Frank J.; Raat, Hein

2015-01-01

Background Regular meal consumption is considered an important aspect of a healthy diet. While ample evidence shows social inequalities in breakfast skipping among adolescents, little is known about social inequalities in breakfast skipping and skipping of other meals among young school-aged children. Such information is crucial in targeting interventions aimed to promote a healthy diet in children. Methods We examined data from 4704 ethnically diverse children participating in the Generation R Study, a population-based prospective cohort study in Rotterdam, the Netherlands. Information on family socioeconomic position (SEP), ethnic background, and meal skipping behaviors was assessed by parent-reported questionnaire when the child was 6 years old. Multiple logistic regression analyses were performed to assess the associations of family SEP (educational level, household income, employment status, family composition) and ethnic background with meal skipping behaviors, using high SEP children and native Dutch children as reference groups. Results Meal skipping prevalence ranged from 3% (dinner) to 11% (lunch). The prevalence of meal skipping was higher among low SEP children and ethnic minority children. Maternal educational level was independently associated with breakfast skipping ([low maternal educational level] OR: 2.21; 95% CI: 1.24,3.94). Paternal educational level was independently associated with lunch skipping ([low paternal educational level] OR: 1.53; 95% CI: 1.06,2.20) and dinner skipping ([mid-high paternal educational level] OR: 0.39; 95% CI: 0.20,0.76). Household income was independently associated with breakfast skipping ([low income] OR: 2.43, 95% CI: 1.40,4.22) and dinner skipping ([low income] OR: 2.44; 95% CI: 1.22,4.91). In general, ethnic minority children were more likely to skip breakfast, lunch, and dinner compared with native Dutch children. Adjustment for family SEP attenuated the associations of ethnic minority background with meal skipping behaviors considerably. Conclusion Low SEP children and ethnic minority children are at an increased risk of breakfast, lunch, and dinner skipping compared with high SEP children and native Dutch children, respectively. Given these inequalities, interventions aimed to promote regular meal consumption, breakfast consumption in particular, should target children from low socioeconomic groups and ethnic minority children. More qualitative research to investigate the pathways underlying social inequalities in children’s meal skipping behaviors is warranted. PMID:26225757

Social Inequalities in Young Children's Meal Skipping Behaviors: The Generation R Study.

PubMed

Wijtzes, Anne I; Jansen, Wilma; Jaddoe, Vincent W V; Franco, Oscar H; Hofman, Albert; van Lenthe, Frank J; Raat, Hein

2015-01-01

Regular meal consumption is considered an important aspect of a healthy diet. While ample evidence shows social inequalities in breakfast skipping among adolescents, little is known about social inequalities in breakfast skipping and skipping of other meals among young school-aged children. Such information is crucial in targeting interventions aimed to promote a healthy diet in children. We examined data from 4704 ethnically diverse children participating in the Generation R Study, a population-based prospective cohort study in Rotterdam, the Netherlands. Information on family socioeconomic position (SEP), ethnic background, and meal skipping behaviors was assessed by parent-reported questionnaire when the child was 6 years old. Multiple logistic regression analyses were performed to assess the associations of family SEP (educational level, household income, employment status, family composition) and ethnic background with meal skipping behaviors, using high SEP children and native Dutch children as reference groups. Meal skipping prevalence ranged from 3% (dinner) to 11% (lunch). The prevalence of meal skipping was higher among low SEP children and ethnic minority children. Maternal educational level was independently associated with breakfast skipping ([low maternal educational level] OR: 2.21; 95% CI: 1.24,3.94). Paternal educational level was independently associated with lunch skipping ([low paternal educational level] OR: 1.53; 95% CI: 1.06,2.20) and dinner skipping ([mid-high paternal educational level] OR: 0.39; 95% CI: 0.20,0.76). Household income was independently associated with breakfast skipping ([low income] OR: 2.43, 95% CI: 1.40,4.22) and dinner skipping ([low income] OR: 2.44; 95% CI: 1.22,4.91). In general, ethnic minority children were more likely to skip breakfast, lunch, and dinner compared with native Dutch children. Adjustment for family SEP attenuated the associations of ethnic minority background with meal skipping behaviors considerably. Low SEP children and ethnic minority children are at an increased risk of breakfast, lunch, and dinner skipping compared with high SEP children and native Dutch children, respectively. Given these inequalities, interventions aimed to promote regular meal consumption, breakfast consumption in particular, should target children from low socioeconomic groups and ethnic minority children. More qualitative research to investigate the pathways underlying social inequalities in children's meal skipping behaviors is warranted.

Potential Association between Breakfast Skipping and Concomitant Late-Night-Dinner Eating with Metabolic Syndrome and Proteinuria in the Japanese Population

PubMed Central

Kutsuma, Ayano; Suwa, Kaname

2014-01-01

Skipping breakfast is considered to be an unhealthy eating habit linked to predispositions to obesity and type 2 diabetes. Because eating dinner late at night can elicit subsequent breakfast skipping, we investigated if skipping breakfast concomitant with late-night-dinner eating (LNDE) was associated with metabolic syndrome (MetS) and proteinuria in the general Japanese population. We examined self-reported habitual breakfast skipping and LNDE, MetS (modified ATP-III criteria), and proteinuria in a cross-sectional study of 60,800 Japanese adults aged 20–75 years. A total of 14,068 subjects (23.1%) skipped breakfast, of whom approximately half (52.8%) skipped breakfast alone (without LNDE). The percentages of subjects who skipped breakfast showed a J-shaped relationship with body mass index (BMI). Multivariate logistic regression analysis showed that skipping breakfast concomitant with LNDE (n = 6,645) was significantly associated with MetS and proteinuria, even after adjusting for relevant confounders (odds ratio (95% CI), 1.17 (1.08–1.28), P = 0.0003, and 1.37 (1.24–1.52), P < 0.0001, resp.). Skipping breakfast alone and LNDE alone were not associated with MetS and proteinuria, respectively. In conclusion, habitual breakfast skipping concomitant with LNDE may represent poorer eating behavior than skipping breakfast alone, associated with MetS, asymptomatic proteinuria, obesity, and low body weight in the general Japanese population. PMID:24982814

Television viewing, computer game play and book reading during meals are predictors of meal skipping in a cross-sectional sample of 12-, 14- and 16-year-olds.

PubMed

Custers, Kathleen; Van den Bulck, Jan

2010-04-01

To examine whether television viewing, computer game playing or book reading during meals predicts meal skipping with the aim of watching television, playing computer games or reading books (media meal skipping). A cross-sectional study was conducted using a standardized self-administered questionnaire. Analyses were controlled for age, gender and BMI. Data were obtained from a random sample of adolescents in Flanders, Belgium. Seven hundred and ten participants aged 12, 14 and 16 years. Of the participants, 11.8 % skipped meals to watch television, 10.5 % skipped meals to play computer games and 8.2 % skipped meals to read books. Compared with those who did not use these media during meals, the risk of skipping meals in order to watch television was significantly higher for those children who watched television during meals (2.9 times higher in those who watched television during at least one meal a day). The risk of skipping meals for computer game playing was 9.5 times higher in those who played computer games weekly or more while eating, and the risk of meal skipping in order to read books was 22.9 times higher in those who read books during meals less than weekly. The more meals the respondents ate with the entire family, the less likely they were to skip meals to watch television. The use of media during meals predicts meal skipping for using that same medium. Family meals appear to be inversely related to meal skipping for television viewing.

Test and Evaluation of an Image-Matching Navigation System for a UAS Operating in a GPS-Denied Environment

DTIC Science & Technology

2017-09-01

NAVAL POSTGRADUATE SCHOOL MONTEREY, CALIFORNIA THESIS TEST AND EVALUATION OF AN IMAGE-MATCHING NAVIGATION SYSTEM FOR A UAS OPERATING IN A GPS-DENIED...INTENTIONALLY LEFT BLANK ii Approved for public release. Distribution is unlimited. TEST AND EVALUATION OF AN IMAGE-MATCHING NAVIGATION SYSTEM FOR A UAS... Evaluation Setup and Procedures 39 4.1 Test Equipment and Data Collection Procedures . . . . . . . . . . . . 39 4.2 Actual Flight Data Collection

Assessment of the feasibility of exon 45–55 multiexon skipping for duchenne muscular dystrophy

PubMed Central

van Vliet, Laura; de Winter, Christa L; van Deutekom, Judith CT; van Ommen, Gert-Jan B; Aartsma-Rus, Annemieke

2008-01-01

Background The specific skipping of an exon, induced by antisense oligonucleotides (AON) during splicing, has shown to be a promising therapeutic approach for Duchenne muscular dystrophy (DMD) patients. As different mutations require skipping of different exons, this approach is mutation dependent. The skipping of an entire stretch of exons (e.g. exons 45 to 55) has recently been suggested as an approach applicable to larger groups of patients. However, this multiexon skipping approach is technically challenging. The levels of intended multiexon skips are typically low and highly variable, and may be dependent on the order of intron removal. We hypothesized that the splicing order might favor the induction of multiexon 45–55 skipping. Methods We here tested the feasibility of inducing multiexon 45–55 in control and patient muscle cell cultures using various AON cocktails. Results In all experiments, the exon 45–55 skip frequencies were minimal and comparable to those observed in untreated cells. Conclusion We conclude that current state of the art does not sufficiently support clinical development of multiexon skipping for DMD. PMID:19046429

Self-Navigating THE TERRAIN

ERIC Educational Resources Information Center

Anyaso, Hilary Hurd

2008-01-01

There's some good news in the academy regarding Black women: They occupy a number of high-profile executive posts in higher education. But whether Black women scholars want to follow in their footsteps or continue in a teaching or research capacity, the bad news is that many feel they are left to navigate the personal and professional politics of…

33 CFR 66.10-15 - Aids to navigation.

Code of Federal Regulations, 2012 CFR

2012-07-01

... solid colored buoy. A buoy which marks the left side of the channel viewed looking upstream or toward... channel, solid colored buoys shall be established in pairs, one on each side of the navigable channel... that the user should pass between the buoys. (c) On an irregularly defined channel, solid colored buoys...

33 CFR 66.10-15 - Aids to navigation.

Code of Federal Regulations, 2013 CFR

2013-07-01

... solid colored buoy. A buoy which marks the left side of the channel viewed looking upstream or toward... channel, solid colored buoys shall be established in pairs, one on each side of the navigable channel... that the user should pass between the buoys. (c) On an irregularly defined channel, solid colored buoys...

33 CFR 66.10-15 - Aids to navigation.

Code of Federal Regulations, 2014 CFR

2014-07-01

... solid colored buoy. A buoy which marks the left side of the channel viewed looking upstream or toward... channel, solid colored buoys shall be established in pairs, one on each side of the navigable channel... that the user should pass between the buoys. (c) On an irregularly defined channel, solid colored buoys...

Washington Headquarters Services

Science.gov Websites

Status OPM Status: Open Open Main Navigation Home Our Services Our Customers Our People Our Leaders Our Organization Contact Us CAC Site Navigation Customers Employees Our Services Our Customers Our People Our facilities in the Washington, DC area. Read more about Our Customers Our People A picture with the left edge

Thinking Style, Browsing Primes and Hypermedia Navigation

ERIC Educational Resources Information Center

Fiorina, Lorenzo; Antonietti, Alessandro; Colombo, Barbara; Bartolomeo, Annella

2007-01-01

There is a common assumption that hypermedia navigation is influenced by a learner's style of thinking, so people who are inclined to apply sequential and analytical strategies (left-thinkers) are thought to browse hypermedia in a linear way, whereas those who prefer holistic and intuitive strategies (right-thinkers) tend towards non-linear paths.…

KSC-07pd0192

NASA Image and Video Library

2007-01-30

KENNEDY SPACE CENTER, FLA. -- Representatives from NASA, Lockheed Martin, Space Florida and the state of Florida are seated on stage at a ceremony to commemorate the transition of the historic Operations and Checkout (O&C) Building high bay for use by the Constellation Program. From left are Cleon Lacefield, Lockheed Martin program manager; Thad Altman, representative of the State of Florida; Bill Parsons, Kennedy Space Center director; Steve Koller, executive director of Space Florida; and Skip Hatfield, Orion Project manager. Representatives from NASA, Lockheed Martin, Space Florida and the state of Florida are seated on stage at a ceremony to commemorate the transition of the historic Operations and Checkout (O&C) Building high bay for use by the Constellation Program. From left are Cleon Lacefield, Lockheed Martin program manager; Thad Altman, representative of the State of Florida; Bill Parsons, Kennedy Space Center director; Steve Koller, executive director of Space Florida; and Skip Hatfield, Orion Project manager. Originally built to process space vehicles in the Apollo era, the O&C Building will serve as the final assembly facility for the Orion crew exploration vehicle. Orion, America's human spaceflight vehicle of the future, will be capable of transporting four crewmembers for lunar missions and later will support crew transfers for Mars missions. Each Orion spacecraft also may be used to support up to six crewmembers to the International Space Station after the space shuttle is retired in 2010. Design, development and construction of Orion's components will be performed by Lockheed Martin for NASA at facilities throughout the country. Photo credit: NASA/Kim Shiflett

Maternal and best friends' influences on meal-skipping behaviours.

PubMed

Pearson, Natalie; Williams, Lauren; Crawford, David; Ball, Kylie

2012-09-01

Skipping meals is particularly common during adolescence and can have a detrimental effect on multiple aspects of adolescent health. Understanding the correlates of meal-skipping behaviours is important for the design of nutrition interventions. The present study examined maternal and best friends' influences on adolescent meal-skipping behaviours. Frequency of skipping breakfast, lunch and dinner was assessed using a Web-based survey completed by 3001 adolescent boys and girls from years 7 and 9 of secondary schools in Victoria, Australia. Perceived best friend and maternal meal skipping, modelling of healthy eating (eating healthy food, limiting junk food, eating fruit and vegetables) and weight watching were assessed. Best friend and maternal factors were differentially associated with meal-skipping behaviours. For example, boys and girls who perceived that their best friend often skipped meals were more likely to skip lunch (OR = 2·01, 95 % CI 1·33, 3·04 and OR = 1·93, 95 % CI 1·41, 2·65; P < 0·001). Boys and girls who perceived that their mother often skipped meals were more likely to skip breakfast (OR = 1·48, 95 % CI 1·01, 2·15; P < 0·05 and OR = 1·93, 95 % CI 1·42, 2·59; P < 0·001) and lunch (OR = 2·05, 95 % CI 1·35, 3·12 and OR = 2·02, 95 % CI 1·43, 2·86; P < 0·001). Educating adolescents on how to assess and interpret unhealthy eating behaviours that they observe from significant others may be one nutrition promotion strategy to reduce meal-skipping behaviour. The involvement of mothers may be particularly important in such efforts. Encouraging a peer subculture that promotes regular consumption of meals and educates adolescents on the detrimental impact of meal-skipping behaviour on health may also offer a promising nutrition promotion strategy.

Stability in skipping gaits

NASA Astrophysics Data System (ADS)

Andrada, Emanuel; Müller, Roy; Blickhan, Reinhard

2016-11-01

As an alternative to walking and running, humans are able to skip. However, adult humans avoid it. This fact seems to be related to the higher energetic costs associated with skipping. Still, children, some birds, lemurs and lizards use skipping gaits during daily locomotion. We combined experimental data on humans with numerical simulations to test whether stability and robustness motivate this choice. Parameters for modelling were obtained from 10 male subjects. They locomoted using unilateral skipping along a 12 m runway. We used a bipedal spring loaded inverted pendulum to model and to describe the dynamics of skipping. The subjects displayed higher peak ground reaction forces and leg stiffness in the first landing leg (trailing leg) compared to the second landing leg (leading leg). In numerical simulations, we found that skipping is stable across an amazing speed range from skipping on the spot to fast running speeds. Higher leg stiffness in the trailing leg permits longer strides at same system energy. However, this strategy is at the same time less robust to sudden drop perturbations than skipping with a stiffer leading leg. A slightly higher stiffness in the leading leg is most robust, but might be costlier.

Processing the in the parafovea: are articles skipped automatically?

PubMed

Angele, Bernhard; Rayner, Keith

2013-03-01

One of the words that readers of English skip most often is the definite article the. Most accounts of reading assume that in order for a reader to skip a word, it must have received some lexical processing. The definite article is skipped so regularly, however, that the oculomotor system might have learned to skip the letter string t-h-e automatically. We tested whether skipping of articles in English is sensitive to context information or whether it is truly automatic in the sense that any occurrence of the letter string the will trigger a skip. This was done using the gaze-contingent boundary paradigm (Rayner, 1975) to provide readers with false parafoveal previews of the article the. All experimental sentences contained a short target verb, the preview of which could be correct (i.e., identical to the actual subsequent word in the sentence; e.g., ace), a nonword (tda), or an infelicitous article preview (the). Our results indicated that readers tended to skip the infelicitous the previews frequently, suggesting that, in many cases, they seemed to be unable to detect the syntactic anomaly in the preview and based their skipping decision solely on the orthographic properties of the article. However, there was some evidence that readers sometimes detected the anomaly, as they also showed increased skipping of the pretarget word in the the preview condition. (c) 2013 APA, all rights reserved.

Navigation ability dependent neural activation in the human brain: an fMRI study.

PubMed

Ohnishi, Takashi; Matsuda, Hiroshi; Hirakata, Makiko; Ugawa, Yoshikazu

2006-08-01

Visual-spatial navigation in familiar and unfamiliar environments is an essential requirement of daily life. Animal studies indicated the importance of the hippocampus for navigation. Neuroimaging studies demonstrated gender difference or strategies dependent difference of neural substrates for navigation. Using functional magnetic resonance imaging, we measured brain activity related to navigation in four groups of normal volunteers: good navigators (males and females) and poor navigators (males and females). In a whole group analysis, task related activity was noted in the hippocampus, parahippocampal gyrus, posterior cingulate cortex, precuneus, parietal association areas, and the visual association areas. In group comparisons, good navigators showed a stronger activation in the medial temporal area and precuneus than poor navigators. There was neither sex effect nor interaction effect between sex and navigation ability. The activity in the left medial temporal areas was positively correlated with task performance, whereas activity in the right parietal area was negatively correlated with task performance. Furthermore, the activity in the bilateral medial temporal areas was positively correlated with scores reflecting preferred navigation strategies, whereas activity in the bilateral superior parietal lobules was negatively correlated with them. Our data suggest that different brain activities related to navigation should reflect navigation skill and strategies.

A protocol of rope skipping exercise for primary school children: A pilot test

NASA Astrophysics Data System (ADS)

Radzi, A. N. M.; Rambely, A. S.; Chellapan, K.

2014-06-01

This paper aims to investigate the methods and sample used in rope skipping as an exercise approach. A systematic literature review was approached in identifying skipping performance in the related researches. The methods were compared to determine the best methodological approach for the targeted skipping based research measure. A pilot test was performed among seven students below 12 years old. As the outcome of the review, a skipping protocol design has been proposed for 10 years old primary school students. The proposed protocol design is to be submitted to PPUKM Ethical Committee for approval prior to its implementation in investigation memory enhancement in relation to designed skipping activities.

The effect of high- and low-frequency previews and sentential fit on word skipping during reading

PubMed Central

Angele, Bernhard; Laishley, Abby; Rayner, Keith; Liversedge, Simon P.

2014-01-01

In a previous gaze-contingent boundary experiment, Angele and Rayner (2012) found that readers are likely to skip a word that appears to be the definite article the even when syntactic constraints do not allow for articles to occur in that position. In the present study, we investigated whether the word frequency of the preview of a three-letter target word influences a reader’s decision to fixate or skip that word. We found that the word frequency rather than the felicitousness (syntactic fit) of the preview affected how often the upcoming word was skipped. These results indicate that visual information about the upcoming word trumps information from the sentence context when it comes to making a skipping decision. Skipping parafoveal instances of the therefore may simply be an extreme case of skipping high-frequency words. PMID:24707791

The Relation between Breakfast Skipping and School Performance in Adolescents

ERIC Educational Resources Information Center

Boschloo, Annemarie; Ouwehand, Carolijn; Dekker, Sanne; Lee, Nikki; de Groot, Renate; Krabbendam, Lydia; Jolles, Jelle

2012-01-01

Breakfast skipping is common in adolescents, but research on the effects of breakfast skipping on school performance is scarce. This current cross-sectional survey study of 605 adolescents aged 11-18 years investigated whether adolescents who habitually skip breakfast have lower end-of-term grades than adolescents who eat breakfast daily.…

Is snack consumption associated with meal skipping in children and adolescents? The CASPIAN-IV study.

PubMed

Kelishadi, Roya; Mozafarian, Nafiseh; Qorbani, Mostafa; Motlagh, Mohammad Esmaeil; Safiri, Saeid; Ardalan, Gelayol; Keikhah, Mojtaba; Rezaei, Fatemeh; Heshmat, Ramin

2017-06-01

The present inquiry set to assess the relationship between snack consumption and meal skipping in Iranian children and adolescents. Overall, 14,880 students, aged 6-18 years, were selected via multistage cluster sampling method from rural and urban areas of 30 provinces of Iran. A validated questionnaire of food behaviors including questions on snacks consumption and taking/skipping meals was completed. Consuming and skipping meals and their related factors were reported in both crude and adjusted models. Overall, 13,486 students with a mean age of 12.47 ± 3.36 years completed the study (90.6% participation rate). Among them, 32.08, 8.89, and 10.90% skipped breakfast, lunch, and dinner, respectively. Compared to their counterpart groups, the frequency of meal skipping was higher in girls, urban inhabitants, and students in higher school grades (P < 0.05). Snack consumption was associated with an increased odds ratio of meal skipping in many types of snack groups. Meal skipping and snack consumption were frequent among Iranian children and adolescents. Evidence based interventions are proposed to improve the students' eating habits.

A Well-Traveled 'Eagle Crater' (left-eye)

NASA Technical Reports Server (NTRS)

2004-01-01

This is the left-eye version of the Mars Exploration Rover Opportunity's view on its 56th sol on Mars, before it left its landing-site crater. To the right, the rover tracks are visible at the original spot where the rover attempted unsuccessfully to exit the crater. After a one-sol delay, Opportunity took another route to the plains of Meridiani Planum. This image was taken by the rover's navigation camera.

MET Exon 14 Skipping Mutations in Lung Adenocarcinoma: Clinicopathologic Implications and Prognostic Values.

PubMed

Lee, Geun Dong; Lee, Seung Eun; Oh, Doo-Yi; Yu, Dan-Bi; Jeong, Hae Min; Kim, Jooseok; Hong, Sungyoul; Jung, Hun Soon; Oh, Ensel; Song, Ji-Young; Lee, Mi-Sook; Kim, Mingi; Jung, Kyungsoo; Kim, Jhingook; Shin, Young Kee; Choi, Yoon-La; Kim, Hyeong Ryul

2017-08-01

Response to mesenchymal-epithelial transition (MET) inhibitors in NSCLC with mesenchymal-epithelial transition gene (MET) exon 14 skipping (METex14) has fueled molecular screening efforts and the search for optimal therapies. However, further work is needed to refine the clinicopathologic and prognostic implications of METex14 skipping. Among 795 East Asian patients who underwent a surgical procedure for NSCLC, we screened 45 patients with quintuple-negative (EGFR-negative/KRAS-negative/anaplastic lymphoma kinase gene [ALK]-negative/ROS1-negative/ret proto-oncogene [RET]-negative) lung adenocarcinomas by using reverse-transcriptase polymerase chain reaction and found 17 patients (37.8%) with METex14 skipping. We also investigated the effect of small interfering RNA (siRNA) targeting skipping junction in cells with METex14 skipping. The median age of the 17 patients was 73 years. The acinar subtype was predominant (52.9%), followed by the solid subtype (35.3%). MET immunohistochemistry demonstrated 100% sensitivity and 70.4% specificity. Multivariate analyses showed that patients with METex14 skipping had a higher recurrence rate than those with ALK fusion (versus METex14 skipping) (hazard ratio = 0.283, 95% confidence interval: 0.119-0.670) in stage I to IIIA disease; however, the differences in overall survival were not significant after adjustment for pathologic stage (p = 0.669). Meanwhile, siRNA decreased MET-driven signaling pathways in Hs746T cells, and combined treatment with siRNA and crizotinib inhibited cell proliferation in crizotinib-resistant H596 cells. The prevalence of METex14 skipping was quite high in East Asian patients without other driver mutations in lung adenocarcinomas. METex14 skipping was associated with old age, the acinar or solid histologic subtype, and high MET immunohistochemical expression. The prognosis of patients with METex14 skipping was similar to that of patients with major driver mutations. siRNA targeting the junction of METex14 skipping could inhibit MET-driven signaling pathways in cells with METex14 skipping. Copyright © 2017 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

Children's Perceptions of Parental Attitude Affecting Breakfast Skipping in Primary Sixth-Grade Students

ERIC Educational Resources Information Center

Cheng, Tereza Sy; Tse, Lap Ah; Yu, Ignatius Tak-Sun; Griffiths, Sian

2008-01-01

Background: Breakfast skipping is an international public health concern. This study investigated the prevalence of breakfast skipping among primary sixth-grade students in Hong Kong and the impact of students' perceptions of parental attitudes on breakfast skipping. Methods: A total of 426 students aged 10-14 years in 4 local schools participated…

Metabolic and Cardiorespiratory Responses of Young Women to Skipping and Jogging.

ERIC Educational Resources Information Center

Allen, T. Earl; And Others

1987-01-01

Nine 18- to 29-year-old females were studied while jogging and skipping at treadmill speeds of 4.0, 4.8, and 5.4 miles per hour. Comparison of metabolic demand, musculoskeletal stress, and perceived exertion indicated skipping imposed significantly greater metabolic demands and caused higher heart rates than jogging. Skipping was also rated more…

Merry-Go-Round

NASA Technical Reports Server (NTRS)

2004-01-01

Dubbed 'Carousel,' the rock in this image was the target of the Mars Exploration Rover Opportunity science team's outcrop 'scuff test.' The image on the left, taken by the rover's navigation camera on sol 48 of the mission (March 12, 2004), shows the rock pre-scuff. On sol 51 (March 15, 2004), Opportunity slowly rotated its left front wheel on the rock, abrading it in the same way that geology students use a scratch test to determine the hardness of minerals. The image on the right, taken by the rover's navigation camera on sol 51, shows the rock post-scuff. In this image, it is apparent that Opportunity scratched the surface of 'Carousel' and deposited dirt that it was carrying in its wheel rims.

241. BUILDINGS 455, 456, 509, 510 AND 457 (CELESTIAL NAVIGATION ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

241. BUILDINGS 455, 456, 509, 510 AND 457 (CELESTIAL NAVIGATION COMPLEX), 1942-43. BUREAU OF YARDS AND DOCKS STANDARD PLANS. VIEW NORTH ACROSS WASP ST. SHOWING THE 4 TRAINING SILOS FROM LEFT TO RIGHT: BUILDINGS 455, 456, 509, AND 510; AND, BESIDE THEM, BUILDING 457. - Quonset Point Naval Air Station, Roger Williams Way, North Kingstown, Washington County, RI

Unusual coelom formation in the direct-type developing sand dollar Peronella japonica.

PubMed

Tsuchimoto, Jun; Yamada, Toshihiro; Yamaguchi, Masaaki

2011-11-01

Peronella japonica is a sand dollar with a zygote that develops into an abbreviated pluteus but then metamorphoses on day three. The adult rudiment formation is unique; it uses a median position of the hydrocoel and a stomodeum-like invagination of vestibule that covers the dorsal side of the hydrocoel. However, the developmental processes underlying coelom formation remain unclear. In this study, we examined this process by reconstructing three-dimensional images from serial sections of larvae. We show that the left coelom developed by both schizocoely and enterocoely from the archenteron tip, whereas the hydrocoel and right coelom formed by enterocoely from the archenteron. This coelom formation arranged the coelomic compartments directly along the adult oral-aboral axis by skipping the initial bilateral phases. Furthermore, our data indicate P. japonica retains ancestral asymmetry along the left-right axis in the location of the adult rudiment. Copyright © 2011 Wiley Periodicals, Inc.

Reading Skill and Word Skipping: Implications for Visual and Linguistic Accounts of Word Skipping

ERIC Educational Resources Information Center

Eskenazi, Michael A.; Folk, Jocelyn R.

2015-01-01

We investigated whether high-skill readers skip more words than low-skill readers as a result of parafoveal processing differences based on reading skill. We manipulated foveal load and word length, two variables that strongly influence word skipping, and measured reading skill using the Nelson-Denny Reading Test. We found that reading skill did…

Evidence for skipped spawning in a potamodromous cyprinid, humpback chub (Gila cypha), with implications for demographic parameter estimates

USGS Publications Warehouse

Pearson, Kristen Nicole; Kendall, William L.; Winkelman, Dana L.; Persons, William R.

2015-01-01

Our findings reveal evidence for skipped spawning in a potamodromous cyprinid, humpback chub (HBC; Gila cypha  ). Using closed robust design mark-recapture models, we found, on average, spawning HBC transition to the skipped spawning state () with a probability of 0.45 (95% CRI (i.e. credible interval): 0.10, 0.80) and skipped spawners remain in the skipped spawning state () with a probability of 0.60 (95% CRI: 0.26, 0.83), yielding an average spawning cycle of every 2.12 years, conditional on survival. As a result, migratory skipped spawners are unavailable for detection during annual sampling events. If availability is unaccounted for, survival and detection probability estimates will be biased. Therefore, we estimated annual adult survival probability (S), while accounting for skipped spawning, and found S remained reasonably stable throughout the study period, with an average of 0.75 ((95% CRI: 0.66, 0.82), process varianceσ2 = 0.005), while skipped spawning probability was highly dynamic (σ2 = 0.306). By improving understanding of HBC spawning strategies, conservation decisions can be based on less biased estimates of survival and a more informed population model structure.

Risk of mental health problems in adolescents skipping meals: The Korean National Health and Nutrition Examination Survey 2010 to 2012.

PubMed

Lee, Gyungjoo; Han, Kyungdo; Kim, Hyunju

Adolescents frequently skip meals, doing so even more than once per day. This is associated with more mental health problems. This study identified mental health problems' associations with skipping meals and the frequency thereof among adolescents. This cross-sectional population-based study used a data set of 1,413 adolescents from the 2010 to 2012 Korean National Health and Nutrition Examination Survey. Hierarchical multivariable logistic regression was conducted to determine the risk of mental health problems, including stress, depressive mood, and suicidal ideation in relation to skipping meals and the frequency thereof per day. Breakfast skipping significantly increased the risks of stress and depressive mood. Stress, depressive mood, and suicidal ideation were significantly prevalent as the daily frequency of skipping meals increased. Specific strategies should be developed at government or school level to decrease the frequency of skipping meals per day, associated with serious mental health problems in adolescents. Copyright © 2017 Elsevier Inc. All rights reserved.

Navigating the Difficult Waters of the No Child Left Behind Act of 2001: What It Means for Education of the Deaf

ERIC Educational Resources Information Center

Steffan, Richard C., Jr.

2004-01-01

The author outlines the major elements of the No Child Left Behind Act of 2001 and describes the law's impact on deaf education. The law's stated purpose is to close the achievement gap with accountability, flexibility, and choice, so that no child is left behind. The specific goal of the law is to ensure that all students are 100% proficient in…

11. photographer unknown 3 September 1984 AERIAL VIEW OF BONNEVILLE ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

11. photographer unknown 3 September 1984 AERIAL VIEW OF BONNEVILLE PROJECT TAKEN AT 6000-FOOT ELEVATION. POWERHOUSE #1 AND NAVIGATION LOCK ARE IN UPPER/CENTER PART OF PHOTO, AND THE DAM/SPILLWAY IS IN LEFT/CENTER; THE SECOND POWERHOUSE IS PARTIALLY VISIBLE IN LOWER LEFT CORNER. COLUMBIA RIVER FLOWS FROM LEFT-TO-RIGHT. - Bonneville Project, Columbia River, 1 mile Northeast of Exit 40, off Interstate 84, Bonneville, Multnomah County, OR

Navigation interface for recommending home medical products.

PubMed

Luo, Gang

2012-04-01

Based on users' health issues, an intelligent personal health record (iPHR) system can automatically recommend home medical products (HMPs) and display them in a sequential order. However, the sequential output interface does not categorize search results and is not easy for users to quickly navigate to their desired HMPs. To address this problem, we developed a navigation interface for retrieved HMPs. Our idea is to use medical knowledge and nursing knowledge to construct a navigation hierarchy based on product categories. This hierarchy is added to the left side of each search result Web page to help users move through retrieved HMPs. We demonstrate the effectiveness of our techniques using USMLE medical exam cases.

What Lies Ahead (left-eye)

NASA Technical Reports Server (NTRS)

2004-01-01

This is the left-eye version of the 3-D cylindrical-perspective mosaic showing the view south of the martian crater dubbed 'Bonneville.' The image was taken by the navigation camera on the Mars Exploration Rover Spirit. The rover will travel toward the Columbia Hills, seen here at the upper left. The rock dubbed 'Mazatzal' and the hole the rover drilled in to it can be seen at the lower left. The rover's position is referred to as 'Site 22, Position 32.' This image was geometrically corrected to make the horizon appear flat.

Skipping breakfast and 5‐year changes in body mass index and waist circumference in Japanese men and women

PubMed Central

Yoshita, K.; Nakamura, K.; Miura, K.; Takamura, T.; Nagasawa, S.Y.; Morikawa, Y.; Kido, T.; Naruse, Y.; Nogawa, K.; Suwazono, Y.; Sasaki, S.; Ishizaki, M.; Nakagawa, H.

2017-01-01

Summary Objective This study investigated the relationship between frequency of skipping breakfast and annual changes in body mass index (BMI) and waist circumference (WC). Methods The participants were 4,430 factory employees. BMI and WC were measured repeatedly at annual medical examinations over a 5‐year period. The association between frequency of skipping breakfast at the baseline examination and annual changes in anthropometric indices was evaluated using the generalized estimating equation method. Results The mean (standard deviation) BMI was 23.3 (3.0) kg m−2 for men and 21.9 (3.6) kg m−2 for women; and the mean WC was 82.6 (8.7) cm for men and 77.8 (9.8) cm for women. During the follow‐up period, mean BMI increased by 0.2 kg m−2 for men and women, and mean WC increased by 1.1 cm for men and 1.0 cm for women. The annual change in the BMI of men who skipped breakfast four to six times per week was 0.061 kg m−2 higher, and that of those who skipped breakfast seven times per week was 0.046 kg m−2 higher, compared with those who did not skip breakfast. Annual changes in the WC of male participants who skipped breakfast seven times per week was 0.248 cm higher than that of those who did not skip breakfast. Skipping breakfast was not associated with changes in BMI or WC in women. Conclusions Skipping breakfast was closely associated with annual changes in BMI and WC among men, and eating breakfast more than four times per week may prevent the excessive body weight gain associated with skipping breakfast. PMID:28702211

Water Surface Impact and Ricochet of Deformable Elastomeric Spheres

NASA Astrophysics Data System (ADS)

Hurd, Randy C.

Soft and deformable silicone rubber spheres ricochet from a water surface when rigid spheres and disks (or skipping stones) cannot. This dissertation investigates why these objects are able to skip so successfully. High speed cameras allow us to see that these unique spheres deform significantly as they impact the water surface, flattening into pancake-like shapes with greater area. Though the water entry behavior of deformable spheres deviates from that of rigid spheres, our research shows that if this deformation is accounted for, their behavior can be predicted from previously established methods. Soft spheres skip more easily because they deform significantly when impacting the water surface. We present a diagram which enables the prediction of a ricochet from sphere impact conditions such as speed and angle. Experiments and mathematical representations of the sphere skipping both show that these deformable spheres skip more readily because deformation momentarily increases sphere area and produces an attack angle with the water which is favorable to skipping. Predictions from our mathematical representation of sphere skipping agree strongly with observations from experiments. Even when a sphere was allowed to skip multiple times in the laboratory, the mathematical predictions show good agreement with measured impact conditions through subsequent skipping events. While studying multiple impact events in an outdoor setting, we discovered a previously unidentified means of skipping, which is unique to deformable spheres. This new skipping occurs when a relatively soft sphere first hits the water at a high speed and low impact angle and the sphere begins to rotate very quickly. This quick rotation causes the sphere to stretch into a shape similar to an American football and maintain this shape while it spins. The sphere is observed to move nearly parallel with the water surface with the tips of this "football" dipping into the water as it rotates and the sides passing just over the surface. This sequence of rapid impact events give the impression that the sphere is walking across the water surface.

Breakfast skipping is associated with cyberbullying and school bullying victimization. A school-based cross-sectional study.

PubMed

Sampasa-Kanyinga, Hugues; Roumeliotis, Paul; Farrow, Claire V; Shi, Yuanfeng F

2014-08-01

Breakfast skipping is a health concern that has well-known negative consequences physically and psychologically. It is therefore important to understand why children skip breakfast. The purpose of this study was to establish whether the experience of bullying and cyberbullying impacts upon breakfast skipping and to further evaluate whether the inability for youths to cope with bullying victimization affects their mental health (depression), and in turn predicts breakfast skipping. Data were obtained from the Eastern Ontario 2011 Youth Risk Behaviour Survey, a cross-sectional regional school-based survey of middle and high school students (11-20 years old) across the five counties of Eastern Ontario, Canada (N = 3035). Self-reported data about children's experiences of bullying victimization, breakfast eating habits, socio-economical status, depression, and other risk behaviours were analysed. Approximately half of the participants (50.4%) reported not eating breakfast on a regular basis: 26.3% and 24.1% reported often (usually eat breakfast three times or more per week) and frequent (usually eat breakfast twice a week or less) breakfast skipping behaviour, respectively. Victims of both cyberbullying and school bullying presented greater likelihood of often (adjusted relative risk ratio (RR) = 1.55; 95% confidence interval (CI) = 1.17-2.06) and frequent (RR = 1.97; 95% CI = 1.28-3.03) breakfast skipping. Mediation analysis further showed that depression fully mediated the relationship between school bullying victimization and frequent breakfast skipping. Moreover, depression partially mediated the associations between both cyberbullying and school bullying with frequent breakfast skipping. These findings highlight the potential interrelationships between cyberbullying, school bullying and depression in predicting unhealthy breakfast skipping behaviour in children. Copyright © 2014 Elsevier Ltd. All rights reserved.

MET exon 14 skipping defines a unique molecular class of non-small cell lung cancer.

PubMed

Zheng, Difan; Wang, Rui; Ye, Ting; Yu, Su; Hu, Haichuan; Shen, Xuxia; Li, Yuan; Ji, Hongbin; Sun, Yihua; Chen, Haiquan

2016-07-05

Recurrent MET exon 14 splicing has been revealed in lung cancers and is a promising therapeutic target. Because we have limited knowledge about the natural history of MET mutant tumors, the current study was aiming to determine the clinical and pathological characteristics in non-small cell lung cancers (NSCLC). Twenty-three patients (1.3%) were positive for MET exon 14 skipping. Patients with MET exon 14 skipping displayed unique characteristics: female, non-smokers, earlier pathology stage and older age. MET exon 14 skipping indicated an early event as other drivers in lung cancer, while MET copy number gain was more likely a late event in lung cancer. Overall survival (OS) of patients harboring MET exon 14 skipping was longer than patients with KRAS mutation. Almost four-fifths of the lung tumors with MET exon 14 skipping had EGFR and/or HER2 gene copy number gains. EGFR inhibitor showed moderate antitumor activity in treatment of a patient harboring MET exon 14 skipping. From October 2007 to June 2013, we screened 1770 patients with NSCLC and correlated MET status with clinical pathologic characteristics and mutations in EGFR, KRAS, BRAF, HER2, and ALK. Quantitative Real-Time PCR was used to detect MET gene copy number gain. Immunohistochemistry (IHC) was also performed to screen MET exon 14 skipping. Clinicopathological characteristics and survival information were analyzed. MET exon 14 skipping was detected in 1.3% (23/1770) of the Chinese patients with NSCLC. MET exon 14 skipping defined a new molecular subset of NSCLC with identifiable clinical characteristics. The therapeutic EGFR inhibitors might be an alternative treatment for patients with MET mutant NSCLC.

Rice cyclophilin OsCYP18-2 is translocated to the nucleus by an interaction with SKIP and enhances drought tolerance in rice and Arabidopsis.

PubMed

Lee, Sang Sook; Park, Hyun Ji; Yoon, Dae Hwa; Kim, Beom-Gi; Ahn, Jun Cheul; Luan, Sheng; Cho, Hye Sun

2015-10-01

Cyclophilin 18-2 (CYP18-2) genes, homologues of human peptidyl-prolyl isomerase-like 1 (PPiL1), are conserved across multicellular organisms and Schizosaccharomyces pombe. Although PPiL1 is known to interact with ski-interacting protein (SKIP), a transcriptional co-regulator and spliceosomal component, there have been no functional analyses of PPiL1 homologues in plants. Rice cyclophilin 18-2 (OsCYP18-2) bound directly to amino acids 56-95 of OsSKIP and its binding was independent of cyclosporin A, a cyclophilin-binding drug. Moreover, OsCYP18-2 exhibited PPIase activity regardless of its interaction with OsSKIP. Therefore, the binding site for OsCYP18-2's interaction with SKIP was distinct from the PPIase active site. OsCYP18-2's interaction with SKIP full-length protein enabled OsCYP18-2's translocation from the cytoplasm into the nucleus and AtSKIP interacted in planta with both AtCYP18-2 and OsCYP18-2. Drought and salt stress induced similar expression of OsCYP18-2 and OsSKIP. Overexpression of OsCYP18-2 in transgenic rice and Arabidopsis thaliana plants enhanced drought tolerance and altered expression and pre-mRNA splicing patterns of stress-related genes in Arabidopsis under drought conditions. Furthermore, OsCYP18-2 caused transcriptional activation with/without OsSKIP in the GAL4 system of yeast; thus the OsSKIP-OsCYP18-2 interaction has an important role in the transcriptional and post-transcriptional regulation of stress-related genes and increases tolerance to drought stress. © 2015 John Wiley & Sons Ltd.

Associations between perceived friends' support of healthy eating and meal skipping in adolescence.

PubMed

Rosenrauch, Sharon; Ball, Kylie; Lamb, Karen E

2017-12-01

Meal skipping is a relatively common behaviour during adolescence. As peer influence increases during adolescence, friendship groups may play a role in determining eating patterns such as meal skipping. The current study examined cross-sectional and longitudinal associations between perceived friends' support of healthy eating and breakfast and lunch skipping among adolescents. Survey of intrapersonal, social and environmental factors that may influence eating patterns at baseline (2004/05) and follow-up (2006/07). Thirty-seven secondary schools in Victoria, Australia. Sample of 1785 students aged 12-15 years at baseline. Adolescents who reported that their friends sometimes or often ate healthy foods with them were less likely (adjusted OR; 95 % CI) to skip breakfast (sometimes: 0·71; 0·57, 0·90; often: 0·54; 0·38, 0·76) or lunch (sometimes: 0·61; 0·41, 0·89; often: 0·59; 0·37, 0·94) at baseline than those who reported their friends never or rarely displayed this behaviour. Although this variable was associated with lunch skipping at follow-up, there was no evidence of an association with breakfast skipping at follow-up. There was no evidence of an association between perceived encouragement of healthy eating, and an inconsistent relationship between perceived discouragement of junk food consumption, and meal skipping. Friends eating healthy foods together may serve to reduce meal skipping during early adolescence, possibly due to the influence of directly observable behaviour and shared beliefs held by those in the same friendship group. Verbal encouragement or discouragement from friends may be less impactful an influence on meal skipping (than directly observable behaviours) in adolescents.

The combined unhealthy behaviors of breakfast skipping and smoking are associated with the prevalence of diabetes mellitus.

PubMed

Nishiyama, Midori; Muto, Takashi; Minakawa, Toshihiro; Shibata, Toshie

2009-08-01

Skipping breakfast has been considered a representative unhealthy behavior, but there is little information about the combined effects of breakfast skipping and other unhealthy health habits, especially smoking. First this cross-sectional study investigated unhealthy behaviors among breakfast skippers, and then examined the impact of the combined association of skipping breakfast and smoking on health. A total of 1,200 adults living in one Japanese community were sent questionnaires to elicit data on age, gender, breakfast-eating frequency, and other lifestyle habits. A total 603 of people returned their questionnaires (response rate: 50.3%), and 493 (230 men and 263 women) questionnaires were considered appropriate for analysis. Smoking rate in men (mean age, 53.7 years) and women (mean age, 50.4 years) was 41.3%, and 9.5%, respectively. Skipping breakfast was more prevalent in people under age 50 years (p < 0.001), and was related to other unhealthy behaviors. Binary logistic regression identified current smoking as the most significant factor related to breakfast skipping (3.10, 95%CI 1.50-6.39). Other factors included, age younger than 50 years (3.04, 95%CI 1.31-7.06) and poor sleeping quality (2.06, 95%CI 1.00-4.25). After examining the combined impact of skipping breakfast and smoking, the highest odds ratio for a diagnosis of diabetes mellitus was found among those who smoked and skipped breakfast (4.68, 95% CI: 1.46-15.05). Moreover, skipping breakfast among non-smokers showed a high association with perceived stress (2.83, 95% CI: 1.05-7.61). In conclusion, the combined unhealthy behaviors of skipping breakfast and smoking are associated with the prevalence of diabetes mellitus.

NASA CEV Reference Entry GN&C System and Analysis

NASA Technical Reports Server (NTRS)

Munday, S.; Madsen, C.; Broome, J.; Gay, R.; Tigges, M.; Strahan, A.

2007-01-01

As part of its overall objectives, the Orion spacecraft will be required to perform entry and Earth landing functions for Low Earth Orbit (LEO) and Lunar missions. Both of these entry scenarios will begin with separation of the Service Module (SM), making them unique from other Orion mission phases in that only the Command Module (CM) portion of the Crew Exploration Vehicle (CEV) will be involved, requiring a CM specific Guidance, Navigation and Control (GN&C) system. Also common to these mission scenarios will be the need for GN&C to safely return crew (or cargo) to earth within the dynamic thermal and structural constraints of entry and within acceptable accelerations on the crew, utilizing the limited aerodynamic performance of the CM capsule. The lunar return mission could additionally require an initial atmospheric entry designed to support a precision skip and second entry, all to maximize downrange performance and ensure landing in the United States. This paper describes the Entry GN&C reference design, developed by the NASA-led team, that supports these entry scenarios and that was used to validate the Orion System requirements. Description of the reference design will include an overview of the GN&C functions, avionics, and effectors and will relate these to the specific design drivers of the entry scenarios, as well as the desire for commonality in vehicle systems to support the different missions. The discussion will also include the requirement for an Emergency Entry capability beyond that of the nominal performance of the multi-string GNC system, intended to return the crew to the earth in a survivable but unguided manner. Finally, various analyses will be discussed, including those completed to support validation efforts of the current CEV requirements, along with those on-going and planned with the intention to further refine the requirements and to support design development work in conjunction with the prime contractor. Some of these ongoing analyses will include work to size effectors (jets) and fuel budgets, to refine skip entry concepts, to characterize navigation performance and uncertainties, to provide for SM disposal offshore and to identify requirements to support target site selection.

33 CFR 165.820 - Security Zone; Ohio River Mile, 34.6 to 35.1, Shippingport, Pennsylvania.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 33 Navigation and Navigable Waters 2 2011-07-01 2011-07-01 false Security Zone; Ohio River Mile... Guard District § 165.820 Security Zone; Ohio River Mile, 34.6 to 35.1, Shippingport, Pennsylvania. (a... shoreline of the left descending bank beginning from mile marker 34.6 and ending at mile marker 35.1. (b...

33 CFR 165.820 - Security Zone; Ohio River Mile, 34.6 to 35.1, Shippingport, Pennsylvania.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 33 Navigation and Navigable Waters 2 2014-07-01 2014-07-01 false Security Zone; Ohio River Mile... Guard District § 165.820 Security Zone; Ohio River Mile, 34.6 to 35.1, Shippingport, Pennsylvania. (a... shoreline of the left descending bank beginning from mile marker 34.6 and ending at mile marker 35.1. (b...

33 CFR 165.820 - Security Zone; Ohio River Mile, 34.6 to 35.1, Shippingport, Pennsylvania.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 33 Navigation and Navigable Waters 2 2012-07-01 2012-07-01 false Security Zone; Ohio River Mile... Guard District § 165.820 Security Zone; Ohio River Mile, 34.6 to 35.1, Shippingport, Pennsylvania. (a... shoreline of the left descending bank beginning from mile marker 34.6 and ending at mile marker 35.1. (b...

33 CFR 165.820 - Security Zone; Ohio River Mile, 34.6 to 35.1, Shippingport, Pennsylvania.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 33 Navigation and Navigable Waters 2 2013-07-01 2013-07-01 false Security Zone; Ohio River Mile... Guard District § 165.820 Security Zone; Ohio River Mile, 34.6 to 35.1, Shippingport, Pennsylvania. (a... shoreline of the left descending bank beginning from mile marker 34.6 and ending at mile marker 35.1. (b...

Sand Waves That Impede Navigation of Coastal Inlet Navigation Channels

DTIC Science & Technology

2006-08-01

Merrymeeting Bay. The bay collects coarse-grained sediment from unconsolidated ice-contact and periglacial deposits (Fenster and FitzGerald 1996). During...bed, which is a layer of denser or larger sized sediment left after finer material has been winnowed by a strong current, can inhibit bed form...Order Descriptors (important) • Superposition: simple or compound. • Sediment Characteristics (size, sorting). Third Order Descriptors (useful

Word skipping: effects of word length, predictability, spelling and reading skill.

PubMed

Slattery, Timothy J; Yates, Mark

2017-08-31

Readers eyes often skip over words as they read. Skipping rates are largely determined by word length; short words are skipped more than long words. However, the predictability of a word in context also impacts skipping rates. Rayner, Slattery, Drieghe and Liversedge (2011) reported an effect of predictability on word skipping for even long words (10-13 characters) that extend beyond the word identification span. Recent research suggests that better readers and spellers have an enhanced perceptual span (Veldre & Andrews, 2014). We explored whether reading and spelling skill interact with word length and predictability to impact word skipping rates in a large sample (N=92) of average and poor adult readers. Participants read the items from Rayner et al. (2011) while their eye movements were recorded. Spelling skill (zSpell) was assessed using the dictation and recognition tasks developed by Sally Andrews and colleagues. Reading skill (zRead) was assessed from reading speed (words per minute) and accuracy of three 120 word passages each with 10 comprehension questions. We fit linear mixed models to the target gaze duration data and generalized linear mixed models to the target word skipping data. Target word gaze durations were significantly predicted by zRead while, the skipping likelihoods were significantly predicted by zSpell. Additionally, for gaze durations, zRead significantly interacted with word predictability as better readers relied less on context to support word processing. These effects are discussed in relation to the lexical quality hypothesis and eye movement models of reading.

Efficient exon skipping of SGCG mutations mediated by phosphorodiamidate morpholino oligomers.

PubMed

Wyatt, Eugene J; Demonbreun, Alexis R; Kim, Ellis Y; Puckelwartz, Megan J; Vo, Andy H; Dellefave-Castillo, Lisa M; Gao, Quan Q; Vainzof, Mariz; Pavanello, Rita C M; Zatz, Mayana; McNally, Elizabeth M

2018-05-03

Exon skipping uses chemically modified antisense oligonucleotides to modulate RNA splicing. Therapeutically, exon skipping can bypass mutations and restore reading frame disruption by generating internally truncated, functional proteins to rescue the loss of native gene expression. Limb-girdle muscular dystrophy type 2C is caused by autosomal recessive mutations in the SGCG gene, which encodes the dystrophin-associated protein γ-sarcoglycan. The most common SGCG mutations disrupt the transcript reading frame abrogating γ-sarcoglycan protein expression. In order to treat most SGCG gene mutations, it is necessary to skip 4 exons in order to restore the SGCG transcript reading frame, creating an internally truncated protein referred to as Mini-Gamma. Using direct reprogramming of human cells with MyoD, myogenic cells were tested with 2 antisense oligonucleotide chemistries, 2'-O-methyl phosphorothioate oligonucleotides and vivo-phosphorodiamidate morpholino oligomers, to induce exon skipping. Treatment with vivo-phosphorodiamidate morpholino oligomers demonstrated efficient skipping of the targeted exons and corrected the mutant reading frame, resulting in the expression of a functional Mini-Gamma protein. Antisense-induced exon skipping of SGCG occurred in normal cells and those with multiple distinct SGCG mutations, including the most common 521ΔT mutation. These findings demonstrate a multiexon-skipping strategy applicable to the majority of limb-girdle muscular dystrophy 2C patients.

Post-stroke unilateral spatial neglect: virtual reality-based navigation and detection tasks reveal lateralized and non-lateralized deficits in tasks of varying perceptual and cognitive demands.

PubMed

Ogourtsova, Tatiana; Archambault, Philippe S; Lamontagne, Anouk

2018-04-23

Unilateral spatial neglect (USN), a highly prevalent and disabling post-stroke impairment, has been shown to affect the recovery of locomotor and navigation skills needed for community mobility. We recently found that USN alters goal-directed locomotion in conditions of different cognitive/perceptual demands. However, sensorimotor post-stroke dysfunction (e.g. decreased walking speed) could have influenced the results. Analogous to a previously used goal-directed locomotor paradigm, a seated, joystick-driven navigation experiment, minimizing locomotor demands, was employed in individuals with and without post-stroke USN (USN+ and USN-, respectively) and healthy controls (HC). Participants (n = 15 per group) performed a seated, joystick-driven navigation and detection time task to targets 7 m away at 0°, ±15°/30° in actual (visually-guided), remembered (memory-guided) and shifting (visually-guided with representational updating component) conditions while immersed in a 3D virtual reality environment. Greater end-point mediolateral errors to left-sided targets (remembered and shifting conditions) and overall lengthier onsets in reorientation strategy (shifting condition) were found for USN+ vs. USN- and vs. HC (p < 0.05). USN+ individuals mostly overshot left targets (- 15°/- 30°). Greater delays in detection time for target locations across the visual spectrum (left, middle and right) were found in USN+ vs. USN- and HC groups (p < 0.05). USN-related attentional-perceptual deficits alter navigation abilities in memory-guided and shifting conditions, independently of post-stroke locomotor deficits. Lateralized and non-lateralized deficits in object detection are found. The employed paradigm could be considered in the design and development of sensitive and functional assessment methods for neglect; thereby addressing the drawbacks of currently used traditional paper-and-pencil tools.

Preservation of the Acetabular Cup During Revision Total Hip Arthroplasty Using a Novel Mini-navigation Tool: A Case Report.

PubMed

Vincent, John; Alshaygy, Ibrahim; Muir, Jeffrey M; Kuzyk, Paul

2018-01-01

While intraoperative navigation systems have been shown to improve outcomes in primary total hip arthroplasty (THA), their use in the context of revision has been largely overlooked. This case report presents the first documented use of an imageless navigation tool in the context of revision THA, and an unexpected benefit to the surgical procedure as a result. An 84-year-old female patient presented following five episodes of dislocation of the left hip and with pain in the left buttock, groin, and posterior aspect of her hip. Relevant surgical history included primary hip arthroplasty in 1999 and the first revision in 2014. Preoperative analysis revealed a constrained liner that had become disengaged and migrated inferiorly, lodging at the distal aspect of the femoral neck. Acetabular protrusion was also noted. The pre-operative plan included the replacement of the fragmented liner and likely of the acetabular cup due to hardware failure. Intraoperative assessment, however, revealed that the cup was in good condition and would be difficult to remove due to substantial bony ingrowth. With the assistance of imageless navigation, the orientation of the acetabular cup was determined and a new constrained liner was cemented into the preexisting acetabular component at an altered orientation, correcting anteversion by 7°. In revision hip arthroplasty cases, image-based navigation is limited by the presence of existing implants and corresponding metal artefact. This case demonstrates the successful use of an imageless navigation tool for revision surgery. Use of navigation led to the unexpected intraoperative discovery that the acetabular cup was in an acceptable state, and allowed the surgical team to correct the position of the cup using a constrained liner, thus preserving the cup. This significantly benefitted patient outcome, due to the risks associated with the removal of a firmly fixated acetabular cup. While more extensive research is required, this case demonstrates that imageless navigation may be an indispensable tool for revision surgery.

Skip residues modulate the structural properties of the myosin rod and guide thick filament assembly

DOE PAGES

Taylor, Keenan C.; Buvoli, Massimo; Korkmaz, Elif Nihal; ...

2015-07-06

The rod of sarcomeric myosins directs thick filament assembly and is characterized by the insertion of four skip residues that introduce discontinuities in the coiled-coil heptad repeats. We report in this paper that the regions surrounding the first three skip residues share high structural similarity despite their low sequence homology. Near each of these skip residues, the coiled-coil transitions to a nonclose-packed structure inducing local relaxation of the superhelical pitch. Moreover, molecular dynamics suggest that these distorted regions can assume different conformationally stable states. In contrast, the last skip residue region constitutes a true molecular hinge, providing C-terminal rod flexibility.more » Assembly of myosin with mutated skip residues in cardiomyocytes shows that the functional importance of each skip residue is associated with rod position and reveals the unique role of the molecular hinge in promoting myosin antiparallel packing. By defining the biophysical properties of the rod, the structures and molecular dynamic calculations presented here provide insight into thick filament formation, and highlight the structural differences occurring between the coiled-coils of myosin and the stereotypical tropomyosin. Finally, in addition to extending our knowledge into the conformational and biological properties of coiled-coil discontinuities, the molecular characterization of the four myosin skip residues also provides a guide to modeling the effects of rod mutations causing cardiac and skeletal myopathies.« less

Reward-based spatial learning in unmedicated adults with obsessive-compulsive disorder.

PubMed

Marsh, Rachel; Tau, Gregory Z; Wang, Zhishun; Huo, Yuankai; Liu, Ge; Hao, Xuejun; Packard, Mark G; Peterson, Bradley S; Simpson, H Blair

2015-04-01

The authors assessed the functioning of mesolimbic and striatal areas involved in reward-based spatial learning in unmedicated adults with obsessive-compulsive disorder (OCD). Functional MRI blood-oxygen-level-dependent response was compared in 33 unmedicated adults with OCD and 33 healthy, age-matched comparison subjects during a reward-based learning task that required learning to use extramaze cues to navigate a virtual eight-arm radial maze to find hidden rewards. The groups were compared in their patterns of brain activation associated with reward-based spatial learning versus a control condition in which rewards were unexpected because they were allotted pseudorandomly to experimentally prevent learning. Both groups learned to navigate the maze to find hidden rewards, but group differences in neural activity during navigation and reward processing were detected in mesolimbic and striatal areas. During navigation, the OCD group, unlike the healthy comparison group, exhibited activation in the left posterior hippocampus. Unlike healthy subjects, participants in the OCD group did not show activation in the left ventral putamen and amygdala when anticipating rewards or in the left hippocampus, amygdala, and ventral putamen when receiving unexpected rewards (control condition). Signal in these regions decreased relative to baseline during unexpected reward receipt among those in the OCD group, and the degree of activation was inversely associated with doubt/checking symptoms. Participants in the OCD group displayed abnormal recruitment of mesolimbic and ventral striatal circuitry during reward-based spatial learning. Whereas healthy comparison subjects exhibited activation in this circuitry in response to the violation of reward expectations, unmedicated OCD participants did not and instead over-relied on the posterior hippocampus during learning. Thus, dopaminergic innervation of reward circuitry may be altered, and future study of anterior/posterior hippocampal dysfunction in OCD is warranted.

Mathematical modeling for optimizing skip-stop rail transit operation strategy using genetic algorithm.

DOT National Transportation Integrated Search

2012-03-01

"With skip-stop rail transit operation, transit agencies can reduce their operating costs and fleet size, : and passengers can experience reduced in-transit travel times without extra track and technological : improvement. However, since skip-stop op...

At Home in the Crater

NASA Technical Reports Server (NTRS)

2004-01-01

The wheel tracks seen above and to the left of the lander trace the path the Mars Exploration Rover Opportunity has traveled since landing in a small crater at Meridiani Planum, Mars. After this picture was taken, the rover excavated a trench near the soil seen at the lower left corner of the image. This image mosaic was taken by the rover's navigation camera.

33 CFR 207.160 - All waterways tributary to the Atlantic Ocean south of Chesapeake Bay and all waterways tributary...

Code of Federal Regulations, 2011 CFR

2011-07-01

... the United States or under its authorization. (6) When rafts are left for any reason with no one in... be left clear for navigation along the tributary. Such storage spaces must be protected by booms and... north of New River Inlet, North Carolina; to the Superintendent of Lighthouses at Charleston, South...

Dust Devil in Spirit's View Ahead on Sol 1854 (Stereo)

NASA Technical Reports Server (NTRS)

2009-01-01

[figure removed for brevity, see original site] Left-eye view of a color stereo pair for PIA11960 [figure removed for brevity, see original site] Right-eye view of a color stereo pair for PIA11960

NASA's Mars Exploration Rover Spirit used its navigation camera to take the images that have been combined into this stereo, 180-degree view of the rover's surroundings during the 1,854th Martian day, or sol, of Spirit's surface mission (March 21, 2009).

This view combines images from the left-eye and right-eye sides of the navigation camera. It appears three-dimensional when viewed through red-blue glasses with the red lens on the left.

The rover had driven 13.79 meters (45 feet) westward earlier on Sol 1854.

West is at the center, where a dust devil is visible in the distance. North on the right, where Husband Hill dominates the horizon; Spirit was on top of Husband Hill in September and October 2005. South is on the left, where lighter-toned rock lines the edge of the low plateau called 'Home Plate.'

This view is presented as a cylindrical-perspective projection with geometric seam correction.

Characterization of porcine SKIP gene in skeletal muscle development: polymorphisms, association analysis, expression and regulation of cell growth in C2C12 cells.

PubMed

Xiong, Qi; Chai, Jin; Deng, Changyan; Jiang, Siwen; Liu, Yang; Huang, Tao; Suo, Xiaojun; Zhang, Nian; Li, Xiaofeng; Yang, Qianping; Chen, Mingxin; Zheng, Rong

2012-12-01

Skeletal muscle and kidney-enriched inositol phosphatase (SKIP) was identified as a 5'-inositol phosphatase that hydrolyzes phosphatidylinositol (3,4,5)-triphosphate (PI(3,4,5)P3) to PI(3,4)P2 and negatively regulates insulin-induced phosphatidylinositol 3-kinase signaling in skeletal muscle. In this study, two new single nucleotide polymorphisms (SNPs) in porcine SKIP introns 1 and 6 were detected. The C1092T locus in intron 1 showed significant associations with some meat traits, whereas the A17G locus in intron 6 showed significant associations with some carcass traits. Expression analysis showed that porcine SKIP is upregulated at d 65 of gestation and Meishan fetuses have higher and prolonged expression of SKIP compared to Large White at d 100 of gestation. Ectopic expression of porcine SKIP decreased insulin-induced cell proliferation and promoted serum starvation-induced cell cycle arrest in G0/G1 phase in C2C12. Our results suggest that SKIP plays a negative regulatory role in skeletal muscle development partly by preventing cell proliferation. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.

Gait biomechanics of skipping are substantially different than those of running.

PubMed

McDonnell, Jessica; Willson, John D; Zwetsloot, Kevin A; Houmard, Joseph; DeVita, Paul

2017-11-07

The inherit injury risk associated with high-impact exercises calls for alternative ways to achieve the benefits of aerobic exercise while minimizing excessive stresses to body tissues. Skipping presents such an alternative, incorporating double support, flight, and single support phases. We used ground reaction forces (GRFs), lower extremity joint torques and powers to compare skipping and running in 20 healthy adults. The two consecutive skipping steps on each limb differed significantly from each other, and from running. Running had the longest step length, the highest peak vertical GRF, peak knee extensor torque, and peak knee negative and positive power and negative and positive work. Skipping had the greater cadence, peak horizontal GRF, peak hip and ankle extensor torques, peak ankle negative power and work, and peak ankle positive power. The second vs first skipping step had the shorter step length, higher cadence, peak horizontal GRF, peak ankle extensor torque, and peak ankle negative power, negative work, and positive power and positive work. The first skipping step utilized predominately net negative joint work (eccentric muscle action) while the second utilized predominately net positive joint work (concentric muscle action). The skipping data further highlight the persistence of net negative work performed at the knee and net positive work performed at the ankle across locomotion gaits. Evidence of step segregation was seen in distribution of the braking and propelling impulses and net work produced across the hip, knee, and ankle joints. Skipping was substantially different than running and was temporally and spatially asymmetrical with successive foot falls partitioned into a dominant function, either braking or propelling whereas running had a single, repeated step in which both braking and propelling actions were performed equally. Copyright © 2017 Elsevier Ltd. All rights reserved.

The relationship between breakfast skipping, chronotype, and glycemic control in type 2 diabetes.

PubMed

Reutrakul, Sirimon; Hood, Megan M; Crowley, Stephanie J; Morgan, Mary K; Teodori, Marsha; Knutson, Kristen L

2014-02-01

Breakfast skipping is associated with obesity and an increased risk of type 2 diabetes. Later chronotypes, individuals who have a preference for later bed and wake times, often skip breakfast. The aim of the study was to explore the relationships among breakfast skipping, chronotype, and glycemic control in type 2 diabetes patients. We collected sleep timing and 24-h dietary recall from 194 non-shift-working type 2 diabetes patients who were being followed in outpatient clinics. Mid-sleep time on free days (MSF) was used as an indicator of chronotype. Hemoglobin A1C (HbA1C) values were obtained from medical records. Hierarchical linear regression analyses controlling for demographic, sleep, and dietary variables were computed to determine whether breakfast skipping was associated with HbA1C. Additional regression analyses were performed to test if this association was mediated by chronotype. There were 22 participants (11.3%) who self-reported missing breakfast. Breakfast skippers had significantly higher HbA1C levels, higher body mass indices (BMI), and later MSF than breakfast eaters. Breakfast skipping was significantly associated with higher HbA1C values (B = 0.108, p = 0.01), even after adjusting for age, sex, race, BMI, number of diabetes complications, insulin use, depressive symptoms, perceived sleep debt, and percentage of daily caloric intake at dinner. The relationship between breakfast skipping and HbA1C was partially mediated by chronotype. In summary, breakfast skipping is associated with a later chronotype. Later chronotype and breakfast skipping both contribute to poorer glycemic control, as indicated by higher HbA1C levels. Future studies are needed to confirm these findings and determine whether behavioral interventions targeting breakfast eating or sleep timing may improve glycemic control in patients with type 2 diabetes.

Investigating virtual reality navigation in amnestic mild cognitive impairment using fMRI.

PubMed

Migo, E M; O'Daly, O; Mitterschiffthaler, M; Antonova, E; Dawson, G R; Dourish, C T; Craig, K J; Simmons, A; Wilcock, G K; McCulloch, E; Jackson, S H D; Kopelman, M D; Williams, S C R; Morris, R G

2016-01-01

Spatial navigation requires a well-established network of brain regions, including the hippocampus, caudate nucleus, and retrosplenial cortex. Amnestic Mild Cognitive Impairment (aMCI) is a condition with predominantly memory impairment, conferring a high predictive risk factor for dementia. aMCI is associated with hippocampal atrophy and subtle deficits in spatial navigation. We present the first use of a functional Magnetic Resonance Imaging (fMRI) navigation task in aMCI, using a virtual reality analog of the Radial Arm Maze. Compared with controls, aMCI patients showed reduced activity in the hippocampus bilaterally, retrosplenial cortex, and left dorsolateral prefrontal cortex. Reduced activation in key areas for successful navigation, as well as additional regions, was found alongside relatively normal task performance. Results also revealed increased activity in the right dorsolateral prefrontal cortex in aMCI patients, which may reflect compensation for reduced activations elsewhere. These data support suggestions that fMRI spatial navigation tasks may be useful for staging of progression in MCI.

A Navigation System for the Visually Impaired: A Fusion of Vision and Depth Sensor

PubMed Central

Kanwal, Nadia; Bostanci, Erkan; Currie, Keith; Clark, Adrian F.

2015-01-01

For a number of years, scientists have been trying to develop aids that can make visually impaired people more independent and aware of their surroundings. Computer-based automatic navigation tools are one example of this, motivated by the increasing miniaturization of electronics and the improvement in processing power and sensing capabilities. This paper presents a complete navigation system based on low cost and physically unobtrusive sensors such as a camera and an infrared sensor. The system is based around corners and depth values from Kinect's infrared sensor. Obstacles are found in images from a camera using corner detection, while input from the depth sensor provides the corresponding distance. The combination is both efficient and robust. The system not only identifies hurdles but also suggests a safe path (if available) to the left or right side and tells the user to stop, move left, or move right. The system has been tested in real time by both blindfolded and blind people at different indoor and outdoor locations, demonstrating that it operates adequately. PMID:27057135

78 FR 42819 - Proposed Collection; Comment Request for Form 709

Federal Register 2010, 2011, 2012, 2013, 2014

2013-07-17

... 709, United States Gift (and Generation-Skipping Transfer) Tax Return. DATES: Written comments should....gov . SUPPLEMENTARY INFORMATION: Title: United States Gift (and Generation-Skipping Transfer) Tax... transfers subject to the gift and generation-skipping transfer taxes and to compute these taxes. The IRS...

75 FR 38179 - Proposed Collection; Comment Request for Form 709

Federal Register 2010, 2011, 2012, 2013, 2014

2010-07-01

... 709, United States Gift (and Generation-Skipping Transfer) Tax Return. DATES: Written comments should....gov . SUPPLEMENTARY INFORMATION: Title: United States Gift (and Generation-Skipping Transfer) Tax... transfers subject to the gift and generation-skipping transfer taxes and to compute these taxes. The IRS...

78 FR 46688 - Proposed Collection; Comment Request for Form 706

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-01

... 706, United States Estate (and Generation-Skipping Transfer) Tax Return. DATES: Written comments... INFORMATION: Title: United States Estate (and Generation-Skipping Transfer) Tax Return. OMB Number: 1545-0015... imposed by Internal Revenue Code section 2001 and the Federal generation-skipping transfer (GST) tax...

Eye movements and word skipping during reading: Effects of word length and predictability

PubMed Central

Rayner, Keith; Slattery, Timothy J.; Drieghe, Denis; Liversedge, Simon P.

2012-01-01

The extent to which target words were predictable from prior context was varied: half of the target words were predictable and the other half were unpredictable. In addition, the length of the target word varied: the target words were short (4–6 letters), medium (7–9 letters), or long (10–12 letters). Length and predictability both yielded strong effects on the probability of skipping the target words and on the amount of time readers fixated the target words (when they were not skipped). However, there was no interaction in any of the measures examined for either skipping or fixation time. The results demonstrate that word predictability (due to contextual constraint) and word length have strong and independent influences on word skipping and fixation durations. Furthermore, since the long words extended beyond the word identification span, the data indicate that skipping can occur on the basis of partial information in relation to word identity. PMID:21463086

Design of limited-stop service based on the degree of unbalance of passenger demand

PubMed Central

2018-01-01

This paper presents a limited-stop service for a bus fleet to meet the unbalanced demand of passengers on a bus route and to improve the transit service of the bus route. This strategy includes two parts: a degree assessment of unbalanced passenger demand and an optimization of the limited-stop service. The degree assessment of unbalanced passenger demand, which is based on the different passenger demand between stations and the unbalance of passengers within the station, is used to judge whether implementing the limited-stop service is necessary for a bus route. The optimization of limited-stop service considers the influence of stop skipping action and bus capacity on the left-over passengers to determine the proper skipping stations for the bus fleet serving the entire route by minimizing both the waiting time and in-vehicle time of passengers and the running time of vehicles. A solution algorithm based on genetic algorithm is also presented to evaluate the degree of unbalanced passenger demand and optimize the limited-stop scheme. Then, the proper strategy is tested on a bus route in Changchun city of China. The threshold of degree assessment of unbalanced passenger demand can be calibrated and adapted to different passenger demands. PMID:29505585

Design of limited-stop service based on the degree of unbalance of passenger demand.

PubMed

Zhang, Hu; Zhao, Shuzhi; Liu, Huasheng; Liang, Shidong

2018-01-01

This paper presents a limited-stop service for a bus fleet to meet the unbalanced demand of passengers on a bus route and to improve the transit service of the bus route. This strategy includes two parts: a degree assessment of unbalanced passenger demand and an optimization of the limited-stop service. The degree assessment of unbalanced passenger demand, which is based on the different passenger demand between stations and the unbalance of passengers within the station, is used to judge whether implementing the limited-stop service is necessary for a bus route. The optimization of limited-stop service considers the influence of stop skipping action and bus capacity on the left-over passengers to determine the proper skipping stations for the bus fleet serving the entire route by minimizing both the waiting time and in-vehicle time of passengers and the running time of vehicles. A solution algorithm based on genetic algorithm is also presented to evaluate the degree of unbalanced passenger demand and optimize the limited-stop scheme. Then, the proper strategy is tested on a bus route in Changchun city of China. The threshold of degree assessment of unbalanced passenger demand can be calibrated and adapted to different passenger demands.

Functional cross‐hemispheric shift between object‐place paired associate memory and spatial memory in the human hippocampus

PubMed Central

Lee, Choong‐Hee; Ryu, Jungwon; Lee, Sang‐Hun; Kim, Hakjin

2016-01-01

ABSTRACT The hippocampus plays critical roles in both object‐based event memory and spatial navigation, but it is largely unknown whether the left and right hippocampi play functionally equivalent roles in these cognitive domains. To examine the hemispheric symmetry of human hippocampal functions, we used an fMRI scanner to measure BOLD activity while subjects performed tasks requiring both object‐based event memory and spatial navigation in a virtual environment. Specifically, the subjects were required to form object‐place paired associate memory after visiting four buildings containing discrete objects in a virtual plus maze. The four buildings were visually identical, and the subjects used distal visual cues (i.e., scenes) to differentiate the buildings. During testing, the subjects were required to identify one of the buildings when cued with a previously associated object, and when shifted to a random place, the subject was expected to navigate to the previously chosen building. We observed that the BOLD activity foci changed from the left hippocampus to the right hippocampus as task demand changed from identifying a previously seen object (object‐cueing period) to searching for its paired‐associate place (object‐cued place recognition period). Furthermore, the efficient retrieval of object‐place paired associate memory (object‐cued place recognition period) was correlated with the BOLD response of the left hippocampus, whereas the efficient retrieval of relatively pure spatial memory (spatial memory period) was correlated with the right hippocampal BOLD response. These findings suggest that the left and right hippocampi in humans might process qualitatively different information for remembering episodic events in space. © 2016 The Authors Hippocampus Published by Wiley Periodicals, Inc. PMID:27009679

JCE Online 99

NASA Astrophysics Data System (ADS)

Holmes, Jon L.

1999-04-01

As I write this, JCE Online is in the middle of being redesigned to make it a more usable resource. By the time you read this, the typical online page for articles of this Journal will look like Figure 1. The page has five main features:

• the page heading with the global menu bar
• the left-hand navigation bar
• the page menu bar near the top of the page and repeated near the bottom
• the main content region in the middle of the page
• the right-hand column of local navigation links

26 CFR 26.2612-1 - Definitions.

Code of Federal Regulations, 2013 CFR

2013-04-01

... GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2612-1 Definitions. (a... person. Only one direct skip occurs when a single transfer of property skips two or more generations. See... termination is a taxable termination with respect to the distributed property. (3) Simultaneous terminations...

26 CFR 26.2612-1 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-04-01

... GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2612-1 Definitions. (a... person. Only one direct skip occurs when a single transfer of property skips two or more generations. See... termination is a taxable termination with respect to the distributed property. (3) Simultaneous terminations...

The Timing of Grade Skipping

ERIC Educational Resources Information Center

Kuo, Yi-Lung; Lohman, David F.

2011-01-01

The purposes of this study were to investigate the following: (a) the impact of sex, ethnicity, socioeconomic status, and family income on the likelihood of whole-grade skipping between kindergarten and Grade 7 and (b) the effects of grade skipping during elementary or middle school on students' academic achievement in high school. The authors…

1999 Survey of Active Duty Personnel: Administration, Datasets, and Codebook. Appendix G: Frequency and Percentage Distributions for Variables in the Survey Analysis Files.

DTIC Science & Technology

2000-12-01

A SKIP FLAG INDICATING THE RESULT OF CHECKING THE RESPONSE ON THE PARENT (SCREENING) ITEM AGAINST THE RESPONSE(S) ON THE ITEMS WITHIN THE SKIP...RESPONSE ON THE PARENT (SCREENING) ITEM AGAINST THE RESPONSE(S) ON THE ITEMS WITHIN THE SKIP PATTERN. SEE TABLE D-5, NOTE 2, IN APPENDIX D. G-52...RESULT OF CHECKING THE RESPONSE ON THE PARENT (SCREENING) ITEM AGAINST THE RESPONSE(S) ON THE ITEMS WITHIN THE SKIP PATTERN. SEE TABLE D-5

Reengineering a transmembrane protein to treat muscular dystrophy using exon skipping.

PubMed

Gao, Quan Q; Wyatt, Eugene; Goldstein, Jeff A; LoPresti, Peter; Castillo, Lisa M; Gazda, Alec; Petrossian, Natalie; Earley, Judy U; Hadhazy, Michele; Barefield, David Y; Demonbreun, Alexis R; Bönnemann, Carsten; Wolf, Matthew; McNally, Elizabeth M

2015-11-02

Exon skipping uses antisense oligonucleotides as a treatment for genetic diseases. The antisense oligonucleotides used for exon skipping are designed to bypass premature stop codons in the target RNA and restore reading frame disruption. Exon skipping is currently being tested in humans with dystrophin gene mutations who have Duchenne muscular dystrophy. For Duchenne muscular dystrophy, the rationale for exon skipping derived from observations in patients with naturally occurring dystrophin gene mutations that generated internally deleted but partially functional dystrophin proteins. We have now expanded the potential for exon skipping by testing whether an internal, in-frame truncation of a transmembrane protein γ-sarcoglycan is functional. We generated an internally truncated γ-sarcoglycan protein that we have termed Mini-Gamma by deleting a large portion of the extracellular domain. Mini-Gamma provided functional and pathological benefits to correct the loss of γ-sarcoglycan in a Drosophila model, in heterologous cell expression studies, and in transgenic mice lacking γ-sarcoglycan. We generated a cellular model of human muscle disease and showed that multiple exon skipping could be induced in RNA that encodes a mutant human γ-sarcoglycan. Since Mini-Gamma represents removal of 4 of the 7 coding exons in γ-sarcoglycan, this approach provides a viable strategy to treat the majority of patients with γ-sarcoglycan gene mutations.

Reengineering a transmembrane protein to treat muscular dystrophy using exon skipping

PubMed Central

Gao, Quan Q.; Wyatt, Eugene; Goldstein, Jeff A.; LoPresti, Peter; Castillo, Lisa M.; Gazda, Alec; Petrossian, Natalie; Earley, Judy U.; Hadhazy, Michele; Barefield, David Y.; Demonbreun, Alexis R.; Bönnemann, Carsten; Wolf, Matthew; McNally, Elizabeth M.

2015-01-01

Exon skipping uses antisense oligonucleotides as a treatment for genetic diseases. The antisense oligonucleotides used for exon skipping are designed to bypass premature stop codons in the target RNA and restore reading frame disruption. Exon skipping is currently being tested in humans with dystrophin gene mutations who have Duchenne muscular dystrophy. For Duchenne muscular dystrophy, the rationale for exon skipping derived from observations in patients with naturally occurring dystrophin gene mutations that generated internally deleted but partially functional dystrophin proteins. We have now expanded the potential for exon skipping by testing whether an internal, in-frame truncation of a transmembrane protein γ-sarcoglycan is functional. We generated an internally truncated γ-sarcoglycan protein that we have termed Mini-Gamma by deleting a large portion of the extracellular domain. Mini-Gamma provided functional and pathological benefits to correct the loss of γ-sarcoglycan in a Drosophila model, in heterologous cell expression studies, and in transgenic mice lacking γ-sarcoglycan. We generated a cellular model of human muscle disease and showed that multiple exon skipping could be induced in RNA that encodes a mutant human γ-sarcoglycan. Since Mini-Gamma represents removal of 4 of the 7 coding exons in γ-sarcoglycan, this approach provides a viable strategy to treat the majority of patients with γ-sarcoglycan gene mutations. PMID:26457733

View Ahead After Spirit's Sol 1861 Drive (Stereo)

NASA Technical Reports Server (NTRS)

2009-01-01

[figure removed for brevity, see original site] Left-eye view of a color stereo pair for PIA11977 [figure removed for brevity, see original site] Right-eye view of a color stereo pair for PIA11977

NASA's Mars Exploration Rover Spirit used its navigation camera to take the images combined into this stereo, 210-degree view of the rover's surroundings during the 1,861st to 1,863rd Martian days, or sols, of Spirit's surface mission (March 28 to 30, 2009).

This view combines images from the left-eye and right-eye sides of the navigation camera. It appears three-dimensional when viewed through red-blue glasses with the red lens on the left.

The center of the scene is toward the south-southwest. East is on the left. West-northwest is on the right.

The rover had driven 22.7 meters (74 feet) southwestward on Sol 1861 before beginning to take the frames in this view. The drive brought Spirit past the northwestern corner of Home Plate.

In this view, the western edge of Home Plate is on the portion of the horizon farthest to the left. A mound in middle distance near the center of the view is called 'Tsiolkovsky' and is about 40 meters (about 130 feet) from the rover's position.

This view is presented as a cylindrical-perspective projection with geometric seam correction.

ARC-2013-ACD13-0044-002

NASA Image and Video Library

2013-03-12

Women Fly it forward event at Hiller Aviation. Aisha Bowe (right) with Ames Navigation, Guidance & Control Systems Branch reaches out to Julia Smith (left) and Taylor Grafstrom (center) about women in aviation.

Novel robotic catheter manipulation system integrated with remote magnetic navigation for fully remote ablation of atrial tachyarrhythmias: a two-centre evaluation.

PubMed

Nölker, Georg; Gutleben, Klaus-Jürgen; Muntean, Bogdan; Vogt, Jürgen; Horstkotte, Dieter; Dabiri Abkenari, Lara; Akca, Ferdi; Szili-Torok, Tamas

2012-12-01

Studies have shown that remote magnetic navigation is safe and effective for ablation of atrial arrhythmias, although optimal outcomes often require frequent manual manipulation of a circular mapping catheter. The Vdrive robotic system ('Vdrive') was designed for remote navigation of circular mapping catheters to enable a fully remote procedure. This study details the first human clinical experience with remote circular catheter manipulation in the left atrium. This was a prospective, multi-centre, non-randomized consecutive case series that included patients presenting for catheter ablation of left atrial arrhythmias. Remote systems were used exclusively to manipulate both the circular mapping catheter and the ablation catheter. Patients were followed through hospital discharge. Ninety-four patients were included in the study, including 23 with paroxysmal atrial fibrillation (AF), 48 with persistent AF, and 15 suffering from atrial tachycardias. The population was predominately male (77%) with a mean age of 60.5 ± 11.7 years. The Vdrive was used for remote navigation between veins, creation of chamber maps, and gap identification with segmental isolation. The intended acute clinical endpoints were achieved in 100% of patients. Mean case time was 225.9 ± 70.5 min. Three patients (3.2%) crossed over to manual circular mapping catheter navigation. There were no adverse events related to the use of the remote manipulation system. The results of this study demonstrate that remote manipulation of a circular mapping catheter in the ablation of atrial arrhythmias is feasible and safe. Prospective randomized studies are needed to prove efficiency improvements over manual techniques.

SKIPing With Head Start Teachers: Influence of T-SKIP on Object-Control Skills.

PubMed

Brian, Ali; Goodway, Jacqueline D; Logan, Jessica A; Sutherland, Sue

2017-12-01

Children from disadvantaged settings are at risk for delays in their object-control (OC) skills. Fundamental motor skill interventions, such as the Successful Kinesthetic Instruction for Preschoolers (SKIP) Program, are highly successful when led by motor development experts. However, few preschools employ such experts. This study examined the extent to which Head Start teachers delivering an 8-week teacher-led SKIP (T-SKIP) intervention elicited learning of OC skills for Head Start children. Head Start teachers (n = 5) delivered T-SKIP for 8 weeks (450 min). Control teachers (n = 5) implemented the typical standard of practice, or well-equipped free play. All children (N = 122) were pretested and posttested on the OC Skill subscale of the Test of Gross Motor Development-2. Descriptive analyses at pretest identified 81% of the children were developmentally delayed in OC skills (below the 30th percentile). A 2-level hierarchical linear model demonstrated the effectiveness of T-SKIP with significant differences (β = 4.70), t(8) = 7.02, p < .001, η2 = .56, between T-SKIP children (n = 63) and control children (n = 59) at posttest. Head Start teachers who delivered T-SKIP could bring about positive changes in children's OC skills, thereby remediating the initial developmental delays presented. Control children remained delayed in their OC skills in spite of daily well-equipped free play, giving rise to concerns about their future motor competence and physical activity levels.

Assessment of Navigation Using a Hybrid Cognitive/Metric World Model

DTIC Science & Technology

2015-01-01

The robot failed to avoid the stairs of the church. Table A-26 Assessment of vignette 1, path 6b, by researcher TBS Navigate left of the...NOTES 14. ABSTRACT One goal of the US Army Research Laboratory’s Robotic Collaborative Technology Alliance is to develop a cognitive architecture...that would allow a robot to operate on both the semantic and metric levels. As such, both symbolic and metric information would be interpreted within

26 CFR 26.2632-1 - Allocation of GST exemption.

Code of Federal Regulations, 2011 CFR

2011-04-01

... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2632... United States Gift (and Generation-Skipping Transfer) Tax Return (Form 709) the transfer and the extent... generation-skipping potential, the initial allocation under paragraph (b)(4)(ii)(A)(1)(i) of this section is...

26 CFR 26.2632-1 - Allocation of GST exemption.

Code of Federal Regulations, 2014 CFR

2014-04-01

... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2632... United States Gift (and Generation-Skipping Transfer) Tax Return (Form 709) the transfer and the extent... generation-skipping potential, the initial allocation under paragraph (b)(4)(ii)(A)(1)(i) of this section is...

26 CFR 26.2632-1 - Allocation of GST exemption.

Code of Federal Regulations, 2013 CFR

2013-04-01

... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2632... United States Gift (and Generation-Skipping Transfer) Tax Return (Form 709) the transfer and the extent... generation-skipping potential, the initial allocation under paragraph (b)(4)(ii)(A)(1)(i) of this section is...

26 CFR 26.2632-1 - Allocation of GST exemption.

Code of Federal Regulations, 2012 CFR

2012-04-01

... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2632... United States Gift (and Generation-Skipping Transfer) Tax Return (Form 709) the transfer and the extent... generation-skipping potential, the initial allocation under paragraph (b)(4)(ii)(A)(1)(i) of this section is...

26 CFR 26.2653-1 - Taxation of multiple skips.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 26 Internal Revenue 14 2010-04-01 2010-04-01 false Taxation of multiple skips. 26.2653-1 Section 26.2653-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE...-1 Taxation of multiple skips. (a) General rule. If property is held in trust immediately after a GST...

26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 26 Internal Revenue 14 2011-04-01 2010-04-01 true Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 26 Internal Revenue 14 2010-04-01 2010-04-01 false Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 26 Internal Revenue 14 2013-04-01 2013-04-01 false Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 26 Internal Revenue 14 2014-04-01 2013-04-01 true Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 26 Internal Revenue 14 2012-04-01 2012-04-01 false Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

26 CFR 26.2653-1 - Taxation of multiple skips.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 26 Internal Revenue 14 2011-04-01 2010-04-01 true Taxation of multiple skips. 26.2653-1 Section 26.2653-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND... Taxation of multiple skips. (a) General rule. If property is held in trust immediately after a GST, solely...

One Way to Design a Valence-Skip Compound.

PubMed

Hase, I; Yanagisawa, T; Kawashima, K

2017-12-01

Valence-skip compound is a good candidate with high T c and low anisotropy because it has a large attractive interaction at the site of valence-skip atom. However, it is not easy to synthesize such compound because of (i) the instability of the skipping valence state, (ii) the competing charge order, and (iii) that formal valence may not be true in some compounds. In the present study, we show several examples of the valence-skip compounds and discuss how we can design them by first principles calculations. Furthermore, we calculated the electronic structure of a promising candidate of valence skipping compound RbTlCl 3 from first principles. We confirmed that the charge-density wave (CDW) is formed in this compound, and the Tl atoms in two crystallographic different sites take the valence Tl 1+ and Tl 3+ . Structure optimization study reveals that this CDW is stable at the ambient pressure, while this CDW gap can be collapsed when we apply pressure with several gigapascals. In this metallic phase, we can expect a large charge fluctuation and a large electron-phonon interaction.

Is breakfast skipping associated with physical activity among U.S. adolescents? A cross-sectional study of adolescents aged 12-19 years, National Health and Nutrition Examination Survey (NHANES).

PubMed

Lyerly, Jordan E; Huber, Larissa R; Warren-Findlow, Jan; Racine, Elizabeth F; Dmochowski, Jacek

2014-04-01

To examine the association between breakfast skipping and physical activity among US adolescents aged 12-19 years. A cross-sectional study of nationally representative 2007-2008 National Health and Nutrition Examination Survey (NHANES) data. Breakfast skipping was assessed by two 24 h dietary recalls. Physical activity was self-reported by participants and classified based on meeting national recommendations for physical activity for the appropriate age group. Multiple logistic regression analysis was used to model the association between breakfast skipping and physical activity while controlling for confounders. A total of 936 adolescents aged 12-19 years in the USA. After adjusting for family income, there was no association between breakfast skipping and meeting physical activity guidelines for age among adolescents aged 12-19 years (OR = 0.95, 95% CI 0.56, 1.32). Findings from the study differ from previous research findings on breakfast skipping and physical activity. Therefore, further research that uses large, nationally representative US samples and national recommended guidelines for physical activity is needed.

Accurate predictor-corrector skip entry guidance for low lift-to-drag ratio spacecraft

NASA Astrophysics Data System (ADS)

Enmi, Y.; Qian, W.; He, K.; Di, D.

2018-06-01

This paper develops numerical predictor-corrector skip en try guidance for vehicles with low lift-to-drag L/D ratio during the skip entry phase of a Moon return mission. The guidance method is composed of two parts: trajectory planning before entry and closed-loop gu idance during skip entry. The result of trajectory planning before entry is able to present an initial value for predictor-corrector algorithm in closed-loop guidance for fast convergence. The magnitude of bank angle, which is parameterized as a linear function of the range-to-go, is modulated to satisfy the downrange requirements. The sign of the bank ang le is determined by the bank-reversal logic. The predictor-corrector algorithm repeatedly applied onboard in each guidance cycle to realize closed-loop guidance in the skip entry phase. The effectivity of the proposed guidance is validated by simulations in nominal conditions, including skip entry, loft entry, and direct entry, as well as simulations in dispersion conditions considering the combination disturbance of the entry interface, the aerodynamic coefficients, the air density, and the mass of the vehicle.

Breakfast Skipping, Extreme Commutes, and the Sex Composition at Birth.

PubMed

Mazumder, Bhashkar; Seeskin, Zachary

2015-01-01

A growing body of literature has shown that environmental exposures in the period around conception can affect the sex ratio at birth through selective attrition that favors the survival of female conceptuses. Glucose availability is considered a key indicator of the fetal environment, and its absence as a result of meal skipping may inhibit male survival. We hypothesize that breakfast skipping during pregnancy may lead to a reduction in the fraction of male births. Using time use data from the United States we show that women with commute times of 90 minutes or longer are 20 percentage points more likely to skip breakfast. Using U.S. census data we show that women with commute times of 90 minutes or longer are 1.2 percentage points less likely to have a male child under the age of 2. Under some assumptions, this implies that routinely skipping breakfast around the time of conception leads to a 6 percentage point reduction in the probability of a male child. Skipping breakfast during pregnancy may therefore constitute a poor environment for fetal health more generally.

TDRS-M NASA Social

NASA Image and Video Library

2017-08-17

Skip Owen of NASA Launch Services, left and Scott Messer, United Launch Alliance program manager for NASA missions speak to members of social media in the Kennedy Space Center’s Press Site auditorium. The briefing focused on preparations to launch NASA's Tracking and Data Relay Satellite, TDRS-M. The latest spacecraft destined for the agency's constellation of communications satellites, TDRS-M will allow nearly continuous contact with orbiting spacecraft ranging from the International Space Station and Hubble Space Telescope to the array of scientific observatories. Liftoff atop a United Launch Alliance Atlas V rocket is scheduled to take place from Space Launch Complex 41 at Cape Canaveral Air Force Station at 8:03 a.m. EDT Aug. 18.

Systemic Delivery of Morpholinos to Skip Multiple Exons in a Dog Model of Duchenne Muscular Dystrophy.

PubMed

Maruyama, Rika; Echigoya, Yusuke; Caluseriu, Oana; Aoki, Yoshitsugu; Takeda, Shin'ichi; Yokota, Toshifumi

2017-01-01

Exon-skipping therapy is an emerging approach that uses synthetic DNA-like molecules called antisense oligonucleotides (AONs) to splice out frame-disrupting parts of mRNA, restore the reading frame, and produce truncated yet functional proteins. Multiple exon skipping utilizing a cocktail of AONs can theoretically treat 80-90% of patients with Duchenne muscular dystrophy (DMD). The success of multiple exon skipping by the systemic delivery of a cocktail of AONs called phosphorodiamidate morpholino oligomers (PMOs) in a DMD dog model has made a significant impact on the development of therapeutics for DMD, leading to clinical trials of PMO-based drugs. Here, we describe the systemic delivery of a cocktail of PMOs to skip multiple exons in dystrophic dogs and the evaluation of the efficacies and toxicity in vivo.

The Team Approach to Pain Relief

MedlinePlus

... Navigation Bar Home Current Issue Past Issues The Team Approach to Pain Relief Past Issues / Fall 2007 ... Roberts is seen here with some of the team members, (left to right) Dr. Berger, Jacques Bolle, ...

Spirit Beside 'Home Plate,' Sol 1809 (Stereo)

NASA Technical Reports Server (NTRS)

2009-01-01

[figure removed for brevity, see original site] Left-eye view of a color stereo pair for PIA11803 [figure removed for brevity, see original site] Right-eye view of a color stereo pair for PIA11803

NASA Mars Exploration Rover Spirit used its navigation camera to take the images assembled into this stereo, 120-degree view southward after a short drive during the 1,809th Martian day, or sol, of Spirit's mission on the surface of Mars (February 3, 2009).

By combining images from the left-eye and right-eye sides of the navigation camera, the view appears three-dimensional when viewed through red-blue glasses with the red lens on the left.

Spirit had driven about 2.6 meters (8.5 feet) that sol, continuing a clockwise route around a low plateau called 'Home Plate.' In this image, the rocks visible above the rovers' solar panels are on the slope at the northern edge of Home Plate.

This view is presented as a cylindrical-perspective projection with geometric seam correction.

Opportunity's Surroundings on Sol 1818 (Stereo)

NASA Technical Reports Server (NTRS)

2009-01-01

[figure removed for brevity, see original site] Left-eye view of a color stereo pair for PIA11846 [figure removed for brevity, see original site] Right-eye view of a color stereo pair for PIA11846

NASA's Mars Exploration Rover Opportunity used its navigation camera to take the images combined into this full-circle view of the rover's surroundings during the 1,818th Martian day, or sol, of Opportunity's surface mission (March 5, 2009). South is at the center; north at both ends.

This view combines images from the left-eye and right-eye sides of the navigation camera. It appears three-dimensional when viewed through red-blue glasses with the red lens on the left.

The rover had driven 80.3 meters (263 feet) southward earlier on that sol. Tracks from the drive recede northward in this view.

The terrain in this portion of Mars' Meridiani Planum region includes dark-toned sand ripples and lighter-toned bedrock.

This view is presented as a cylindrical-perspective projection with geometric seam correction.

Opportunity's Surroundings on Sol 1798 (Stereo)

NASA Technical Reports Server (NTRS)

2009-01-01

[figure removed for brevity, see original site] Left-eye view of a color stereo pair for PIA11850 [figure removed for brevity, see original site] Right-eye view of a color stereo pair for PIA11850

NASA's Mars Exploration Rover Opportunity used its navigation camera to take the images combined into this stereo 180-degree view of the rover's surroundings during the 1,798th Martian day, or sol, of Opportunity's surface mission (Feb. 13, 2009). North is on top.

This view combines images from the left-eye and right-eye sides of the navigation camera. It appears three-dimensional when viewed through red-blue glasses with the red lens on the left.

The rover had driven 111 meters (364 feet) southward on the preceding sol. Tracks from that drive recede northward in this view. For scale, the distance between the parallel wheel tracks is about 1 meter (about 40 inches).

The terrain in this portion of Mars' Meridiani Planum region includes dark-toned sand ripples and lighter-toned bedrock.

This view is presented as a cylindrical-perspective projection with geometric seam correction.

The influence of the metastasis pattern of mediastinal lymph nodes on the postoperative radiotherapy’s efficacy for the IIIA-pN2 non-small-cell lung cancer: a retrospective analysis of 220 patients

PubMed Central

Zhang, Baozhong; Zhao, Lujun; Yuan, Zhiyong; Pang, Qingsong; Wang, Ping

2016-01-01

Objective The use of postoperative radiotherapy (PORT) remains controversial for Stage IIIA-N2 non-small-cell lung cancer (NSCLC) patients, a possible reason is that IIIA-pN2 NSCLC diseases are a heterogeneous group with different clinicopathologic features. The aim of this research was to prove whether the mediastinal lymph nodes’ (LNs) skipping status could indicate the necessity of the PORT for the pN2 NSCLC patients. Methods The skip metastasis was defined as pN0N2 (no N1 LN involved), and nonskip metastasis was pN1N2 (one or more N1 LNs involved). Patients were divided into two groups: LNs nonskip and LNs skip, and postoperative chemoradiotherapy (POCRT) and postoperative chemotherapy. Then, the LN nonskip and LN skip groups were further divided into subgroups: POCRT and point of care testing (POCT) for subgroup analysis. Results There were 220 cases included in the analysis, and 43 of them received PORT. On univariate analysis, the median 3-year progression-free survival (PFS) was, respectively, 16 months (27.7%) for the LN skip group and 11 months (15.3%) for the LN nonskip group (P=0.001). The median 3-year overall survival (OS) was, respectively, 35 months (47.0%) for the LN skip group and 27 months (38.7%) for the LN nonskip group (P=0.025). The median 3-year local recurrence-free survival (LRFS) was, respectively, 25 months (41.0%) for the LN skip group and19 months (29.9%) for the LN nonskip group (P=0.014). The median 3-year distant metastasis-free survival (DMFS) was, respectively, 22 months (32.5%) for the LN skip group and 15 months (20.4%) for the LN nonskip group (P=0.013). The median 3-year PFS was, respectively, 17 months (25.6%) for the POCRT group and 12 months (18.6%) for the POCT group (P=0.037). Although the POCRT group showed better OS, LRFS, and DMFS than the POCT group, the results showed no statistical significance. In subgroup analysis, there was no statistical significance in the Kaplan–Meier analysis between subgroups, but it showed that POCRT resulted in better PFS, OS, and DMFS in both LN skip and LN nonskip subgroups; this advantage was more obvious in the LN skip subgroup. Conclusion The LN skip status is closely related to the survival of the IIIA-N2 NSCLC disease, and the LN skip patients may get more benefit in PFS and LRFS than the LN nonskip patients from PORT. PMID:27785064

Quantitative Antisense Screening and Optimization for Exon 51 Skipping in Duchenne Muscular Dystrophy.

PubMed

Echigoya, Yusuke; Lim, Kenji Rowel Q; Trieu, Nhu; Bao, Bo; Miskew Nichols, Bailey; Vila, Maria Candida; Novak, James S; Hara, Yuko; Lee, Joshua; Touznik, Aleksander; Mamchaoui, Kamel; Aoki, Yoshitsugu; Takeda, Shin'ichi; Nagaraju, Kanneboyina; Mouly, Vincent; Maruyama, Rika; Duddy, William; Yokota, Toshifumi

2017-11-01

Duchenne muscular dystrophy (DMD), the most common lethal genetic disorder, is caused by mutations in the dystrophin (DMD) gene. Exon skipping is a therapeutic approach that uses antisense oligonucleotides (AOs) to modulate splicing and restore the reading frame, leading to truncated, yet functional protein expression. In 2016, the US Food and Drug Administration (FDA) conditionally approved the first phosphorodiamidate morpholino oligomer (morpholino)-based AO drug, eteplirsen, developed for DMD exon 51 skipping. Eteplirsen remains controversial with insufficient evidence of its therapeutic effect in patients. We recently developed an in silico tool to design antisense morpholino sequences for exon skipping. Here, we designed morpholino AOs targeting DMD exon 51 using the in silico tool and quantitatively evaluated the effects in immortalized DMD muscle cells in vitro. To our surprise, most of the newly designed morpholinos induced exon 51 skipping more efficiently compared with the eteplirsen sequence. The efficacy of exon 51 skipping and rescue of dystrophin protein expression were increased by up to more than 12-fold and 7-fold, respectively, compared with the eteplirsen sequence. Significant in vivo efficacy of the most effective morpholino, determined in vitro, was confirmed in mice carrying the human DMD gene. These findings underscore the importance of AO sequence optimization for exon skipping. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

26 CFR 26.2663-2 - Application of chapter 13 to transfers by nonresidents not citizens of the United States.

Code of Federal Regulations, 2012 CFR

2012-04-01

... SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX... generation-skipping trust. Of the property transferred to the trust, property having a value of $200 is... exemption to the trust on a timely filed United States Gift (and Generation-Skipping Transfer) Tax Return...

26 CFR 26.2663-2 - Application of chapter 13 to transfers by nonresidents not citizens of the United States.

Code of Federal Regulations, 2013 CFR

2013-04-01

... SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX... generation-skipping trust. Of the property transferred to the trust, property having a value of $200 is... exemption to the trust on a timely filed United States Gift (and Generation-Skipping Transfer) Tax Return...

26 CFR 26.2663-2 - Application of chapter 13 to transfers by nonresidents not citizens of the United States.

Code of Federal Regulations, 2014 CFR

2014-04-01

... SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX... generation-skipping trust. Of the property transferred to the trust, property having a value of $200 is... exemption to the trust on a timely filed United States Gift (and Generation-Skipping Transfer) Tax Return...

26 CFR 26.2663-2 - Application of chapter 13 to transfers by nonresidents not citizens of the United States.

Code of Federal Regulations, 2011 CFR

2011-04-01

... SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX... generation-skipping trust. Of the property transferred to the trust, property having a value of $200 is... exemption to the trust on a timely filed United States Gift (and Generation-Skipping Transfer) Tax Return...

26 CFR 26.2611-1 - Generation-skipping transfer defined.

Code of Federal Regulations, 2010 CFR

2010-04-01

... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2611... either a direct skip, a taxable distribution, or a taxable termination. See § 26.2612-1 for the definition of these terms. The determination as to whether an event is a GST is made by reference to the most...

7 CFR 42.123 - Flow diagram for skip lot sampling and inspection.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 7 Agriculture 2 2014-01-01 2014-01-01 false Flow diagram for skip lot sampling and inspection. 42.123 Section 42.123 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING... Procedures § 42.123 Flow diagram for skip lot sampling and inspection. EC02SE91.000 Notes: 1. Only normal...

7 CFR 42.123 - Flow diagram for skip lot sampling and inspection.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 7 Agriculture 2 2011-01-01 2011-01-01 false Flow diagram for skip lot sampling and inspection. 42.123 Section 42.123 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING... Procedures § 42.123 Flow diagram for skip lot sampling and inspection. EC02SE91.000 Notes: 1. Only normal...

7 CFR 42.123 - Flow diagram for skip lot sampling and inspection.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 7 Agriculture 2 2013-01-01 2013-01-01 false Flow diagram for skip lot sampling and inspection. 42.123 Section 42.123 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING... Procedures § 42.123 Flow diagram for skip lot sampling and inspection. EC02SE91.000 Notes: 1. Only normal...

7 CFR 42.123 - Flow diagram for skip lot sampling and inspection.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 7 Agriculture 2 2012-01-01 2012-01-01 false Flow diagram for skip lot sampling and inspection. 42.123 Section 42.123 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING... Procedures § 42.123 Flow diagram for skip lot sampling and inspection. EC02SE91.000 Notes: 1. Only normal...

Sweets, snacking habits, and skipping meals in children and adolescents on intensive insulin treatment.

PubMed

Øverby, N C; Margeirsdottir, H D; Brunborg, C; Dahl-Jørgensen, K; Andersen, L F

2008-08-01

To examine the association between skipping meals and snacking events and dietary and clinical characteristics in children and adolescents using modern insulin treatment. Dietary intake was recorded for 4 d in food diaries in 655 young diabetic patients. Number of meals and snacking events was recorded in a separated questionnaire, while clinical data were obtained from case record forms. Skipping meals refer to consuming a main meal (e.g., breakfast) five times a week or less. Modern insulin treatment may favor a more flexible lifestyle. This study shows that there are fewer young diabetic patients who skip meals than non-diabetic controls (p < 0.001) even when using modern intensified insulin treatment. However, skipping meals among young diabetic patients was associated with negative characteristics such as having suboptimal hemoglobin A1c (HbA1c) (OR 4.7, p = 0.02), higher low-density lipoprotein (LDL) cholesterol levels (OR 4.0, p < 0.001), watching more TV (OR 3.6, p < 0.001), being overweight (OR 2.8, p = 0.03), as well as having a higher intake of added sugar (OR 2.1, p = 0.01) and lower intake of fiber (OR 0.2, p = 0.04) compared with those not skipping meals. Having more than two snacking events during the day was associated with higher HbA1c, higher intake of added sugar and sweets, and spending more hours in front of the TV or personal computer. In general, fewer children and adolescents with type 1 diabetes skip meals compared with healthy peers. Those who skip meals and have more snacking events have poorer glycemic control and less healthy dietary and leisure habits.

Elastic spheres can walk on water.

PubMed

Belden, Jesse; Hurd, Randy C; Jandron, Michael A; Bower, Allan F; Truscott, Tadd T

2016-02-04

Incited by public fascination and engineering application, water-skipping of rigid stones and spheres has received considerable study. While these objects can be coaxed to ricochet, elastic spheres demonstrate superior water-skipping ability, but little is known about the effect of large material compliance on water impact physics. Here we show that upon water impact, very compliant spheres naturally assume a disk-like geometry and dynamic orientation that are favourable for water-skipping. Experiments and numerical modelling reveal that the initial spherical shape evolves as elastic waves propagate through the material. We find that the skipping dynamics are governed by the wave propagation speed and by the ratio of material shear modulus to hydrodynamic pressure. With these insights, we explain why softer spheres skip more easily than stiffer ones. Our results advance understanding of fluid-elastic body interaction during water impact, which could benefit inflatable craft modelling and, more playfully, design of elastic aquatic toys.

Elastic spheres can walk on water

PubMed Central

Belden, Jesse; Hurd, Randy C.; Jandron, Michael A.; Bower, Allan F.; Truscott, Tadd T.

2016-01-01

Incited by public fascination and engineering application, water-skipping of rigid stones and spheres has received considerable study. While these objects can be coaxed to ricochet, elastic spheres demonstrate superior water-skipping ability, but little is known about the effect of large material compliance on water impact physics. Here we show that upon water impact, very compliant spheres naturally assume a disk-like geometry and dynamic orientation that are favourable for water-skipping. Experiments and numerical modelling reveal that the initial spherical shape evolves as elastic waves propagate through the material. We find that the skipping dynamics are governed by the wave propagation speed and by the ratio of material shear modulus to hydrodynamic pressure. With these insights, we explain why softer spheres skip more easily than stiffer ones. Our results advance understanding of fluid-elastic body interaction during water impact, which could benefit inflatable craft modelling and, more playfully, design of elastic aquatic toys. PMID:26842860

Magnetic navigation and catheter ablation of right atrial ectopic tachycardia in the presence of a hemi-azygos continuation: a magnetic navigation case using 3D electroanatomical mapping.

PubMed

Ernst, Sabine; Chun, Julian K R; Koektuerk, Buelent; Kuck, Karl-Heinz

2009-01-01

We report on a 63-year-old female patient in whom an electrophysiologic study discovered a hemi-azygos continuation. Using the magnetic navigation system, remote-controlled ablation was performed in conjunction with the 3D electroanatomical mapping system. Failing the attempt to advance a diagnostic catheter from the femoral vein, a diagnostic catheter was advanced via the left subclavian vein into the coronary sinus. The soft magnetic catheter was positioned in the right atrium via the hemi-azygos vein, and 3D mapping demonstrated an ectopic atrial tachycardia. Successful ablation was performed entirely remote controlled. Fluoroscopy time was only 7.1 minutes, of which 45 seconds were required during remote navigation. Remote-controlled catheter ablation using magnetic navigation in conjunction with the electroanatomical mapping system proved to be a valuable tool to perform successful ablation in the presence of a hemi-azygos continuation.

Integrating Communication and Navigation: Next Generation Broadcast Service (NGBS)

NASA Technical Reports Server (NTRS)

Donaldson, Jennifer

2017-01-01

NASA Goddard has been investing in technology demonstrations of a beacon service, now called Next Generation Broadcast Services (NGBS). NGBS is a global, space-based, communications and navigation service for users of Global Navigation Satellite Systems (GNSS) and the Tracking and Data Relay Satellite System (TDRSS). NGBS will provide an S-band beacon messaging source and radio navigation available to users at orbital altitudes 1400 km and below, increasing the autonomy and resiliency of onboard communication and navigation. NGBS will deliver both one-way radiometric (Doppler and pseudorange) and fast forward data transport services to users. Portions of the overall forward data volume will be allocated for fixed message types while the remaining data volume will be left for user forward command data. The NGBS signal will reside within the 2106.43 MHz spectrum currently allocated for the Space Networks multiple access forward (MAF) service and a live service demonstration is currently being planned via the 2nd and 3rd generation TDRS satellites.

40 CFR 61.243-2 - Alternative standards for valves in VHAP service-skip period leak detection and repair.

Code of Federal Regulations, 2010 CFR

2010-07-01

... VHAP service-skip period leak detection and repair. 61.243-2 Section 61.243-2 Protection of Environment... AIR POLLUTANTS National Emission Standard for Equipment Leaks (Fugitive Emission Sources) § 61.243-2 Alternative standards for valves in VHAP service—skip period leak detection and repair. (a)(1) An owner or...

40 CFR 264.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2010 CFR

2010-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 264.1062 Section... Emission Standards for Equipment Leaks § 264.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or operator subject to...

40 CFR 264.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2011 CFR

2011-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 264.1062 Section... Emission Standards for Equipment Leaks § 264.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or operator subject to...

40 CFR 265.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2014 CFR

2014-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 265.1062 Section... FACILITIES Air Emission Standards for Equipment Leaks § 265.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or...

40 CFR 264.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2012 CFR

2012-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 264.1062 Section... Emission Standards for Equipment Leaks § 264.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or operator subject to...

40 CFR 265.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2011 CFR

2011-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 265.1062 Section... FACILITIES Air Emission Standards for Equipment Leaks § 265.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or...

40 CFR 265.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2010 CFR

2010-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 265.1062 Section... FACILITIES Air Emission Standards for Equipment Leaks § 265.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or...

40 CFR 264.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2013 CFR

2013-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 264.1062 Section... Emission Standards for Equipment Leaks § 264.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or operator subject to...

40 CFR 265.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2013 CFR

2013-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 265.1062 Section... FACILITIES Air Emission Standards for Equipment Leaks § 265.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or...

40 CFR 265.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2012 CFR

2012-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 265.1062 Section... FACILITIES Air Emission Standards for Equipment Leaks § 265.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or...

40 CFR 264.1062 - Alternative standards for valves in gas/vapor service or in light liquid service: skip period...

Code of Federal Regulations, 2014 CFR

2014-07-01

... gas/vapor service or in light liquid service: skip period leak detection and repair. 264.1062 Section... Emission Standards for Equipment Leaks § 264.1062 Alternative standards for valves in gas/vapor service or in light liquid service: skip period leak detection and repair. (a) An owner or operator subject to...

Water walking - an evolution of water surface skipping

NASA Astrophysics Data System (ADS)

Hurd, Randy; Belden, Jesse; Jandron, Michael; Bower, Allan; Holekamp, Sean; Truscott, Tadd

2017-11-01

Previous work has shown that elastomeric spheres skip more easily than disk-shaped stones. This is due to increased lift stemming from sphere deformation, which provides an increased cross-sectional area and favorable attack angle upon impact. We extend lift models developed for individual impacts to long-range multiple impact events and compare the estimates to experimental results, which show good agreement. Additionally, a surprising new mode of skipping is observed that resembles water-walking, wherein a quickly rotating sphere produces small successive impacts allowing it to move parallel to the water surface. The dynamics of this new multiple skip behavior are rationalized analytically and tested experimentally.

Antisense-mediated exon skipping: A versatile tool with therapeutic and research applications

PubMed Central

Aartsma-Rus, Annemieke; van Ommen, Gert-Jan B.

2007-01-01

Antisense-mediated modulation of splicing is one of the few fields where antisense oligonucleotides (AONs) have been able to live up to their expectations. In this approach, AONs are implemented to restore cryptic splicing, to change levels of alternatively spliced genes, or, in case of Duchenne muscular dystrophy (DMD), to skip an exon in order to restore a disrupted reading frame. The latter allows the generation of internally deleted, but largely functional, dystrophin proteins and would convert a severe DMD into a milder Becker muscular dystrophy phenotype. In fact, exon skipping is currently one of the most promising therapeutic tools for DMD, and a successful first-in-man trial has recently been completed. In this review the applicability of exon skipping for DMD and other diseases is described. For DMD AONs have been designed for numerous exons, which has given us insight into their mode of action, splicing in general, and splicing of the DMD gene in particular. In addition, retrospective analysis resulted in guidelines for AON design for DMD and most likely other genes as well. This knowledge allows us to optimize therapeutic exon skipping, but also opens up a range of other applications for the exon skipping approach. PMID:17684229

New scene change control scheme based on pseudoskipped picture

NASA Astrophysics Data System (ADS)

Lee, Youngsun; Lee, Jinwhan; Chang, Hyunsik; Nam, Jae Y.

1997-01-01

A new scene change control scheme which improves the video coding performance for sequences that have many scene changed pictures is proposed in this paper. The scene changed pictures except intra-coded picture usually need more bits than normal pictures in order to maintain constant picture quality. The major idea of this paper is how to obtain extra bits which are needed to encode scene changed pictures. We encode a B picture which is located before a scene changed picture like a skipped picture. We call such a B picture as a pseudo-skipped picture. By generating the pseudo-skipped picture like a skipped picture. We call such a B picture as a pseudo-skipped picture. By generating the pseudo-skipped picture, we can save some bits and they are added to the originally allocated target bits to encode the scene changed picture. The simulation results show that the proposed algorithm improves encoding performance about 0.5 to approximately 2.0 dB of PSNR compared to MPEG-2 TM5 rate controls scheme. In addition, the suggested algorithm is compatible with MPEG-2 video syntax and the picture repetition is not recognizable.

Performance Analysis of Stop-Skipping Scheduling Plans in Rail Transit under Time-Dependent Demand

PubMed Central

Cao, Zhichao; Yuan, Zhenzhou; Zhang, Silin

2016-01-01

Stop-skipping is a key method for alleviating congestion in rail transit, where schedules are sometimes difficult to implement. Several mechanisms have been proposed and analyzed in the literature, but very few performance comparisons are available. This study formulated train choice behavior estimation into the model considering passengers’ perception. If a passenger’s train path can be identified, this information would be useful for improving the stop-skipping schedule service. Multi-performance is a key characteristic of our proposed five stop-skipping schedules, but quantified analysis can be used to illustrate the different effects of well-known deterministic and stochastic forms. Problems in the novel category of forms were justified in the context of a single line rather than transit network. We analyzed four deterministic forms based on the well-known A/B stop-skipping operating strategy. A stochastic form was innovatively modeled as a binary integer programming problem. We present a performance analysis of our proposed model to demonstrate that stop-skipping can feasibly be used to improve the service of passengers and enhance the elasticity of train operations under demand variations along with an explicit parametric discussion. PMID:27420087

Performance Analysis of Stop-Skipping Scheduling Plans in Rail Transit under Time-Dependent Demand.

PubMed

Cao, Zhichao; Yuan, Zhenzhou; Zhang, Silin

2016-07-13

Stop-skipping is a key method for alleviating congestion in rail transit, where schedules are sometimes difficult to implement. Several mechanisms have been proposed and analyzed in the literature, but very few performance comparisons are available. This study formulated train choice behavior estimation into the model considering passengers' perception. If a passenger's train path can be identified, this information would be useful for improving the stop-skipping schedule service. Multi-performance is a key characteristic of our proposed five stop-skipping schedules, but quantified analysis can be used to illustrate the different effects of well-known deterministic and stochastic forms. Problems in the novel category of forms were justified in the context of a single line rather than transit network. We analyzed four deterministic forms based on the well-known A/B stop-skipping operating strategy. A stochastic form was innovatively modeled as a binary integer programming problem. We present a performance analysis of our proposed model to demonstrate that stop-skipping can feasibly be used to improve the service of passengers and enhance the elasticity of train operations under demand variations along with an explicit parametric discussion.

Abnormal hippocampal functioning and impaired spatial navigation in depressed individuals: evidence from whole-head magnetoencephalography.

PubMed

Cornwell, Brian R; Salvadore, Giacomo; Colon-Rosario, Veronica; Latov, David R; Holroyd, Tom; Carver, Frederick W; Coppola, Richard; Manji, Husseini K; Zarate, Carlos A; Grillon, Christian

2010-07-01

Dysfunction of the hippocampus has long been suspected to be a key component of the pathophysiology of major depressive disorder. Despite evidence of hippocampal structural abnormalities in depressed patients, abnormal hippocampal functioning has not been demonstrated. The authors aimed to link spatial navigation deficits previously documented in depressed patients to abnormal hippocampal functioning using a virtual reality navigation task. Whole-head magnetoencephalography (MEG) recordings were collected while participants (19 patients diagnosed with major depressive disorder and 19 healthy subjects matched by gender and age) navigated a virtual Morris water maze to find a hidden platform; navigation to a visible platform served as a control condition. Behavioral measures were obtained to assess navigation performance. Theta oscillatory activity (4-8 Hz) was mapped across the brain on a voxel-wise basis using a spatial-filtering MEG source analysis technique. Depressed patients performed worse than healthy subjects in navigating to the hidden platform. Robust group differences in theta activity were observed in right medial temporal cortices during navigation, with patients exhibiting less engagement of the anterior hippocampus and parahippocampal cortices relative to comparison subjects. Left posterior hippocampal theta activity was positively correlated with individual performance within each group. Consistent with previous findings, depressed patients showed impaired spatial navigation. Dysfunction of right anterior hippocampus and parahippocampal cortices may underlie this deficit and stem from structural abnormalities commonly found in depressed patients.

Breakfast skipping as a risk correlate of overweight and obesity in school-going ethnic Fijian adolescent girls

PubMed Central

Thompson-McCormick, Jonas J; Thomas, Jennifer J; Bainivualiku, Asenaca; Khan, A Nisha; Becker, Anne E

2013-01-01

The prevalence of overweight and obesity has increased globally, and population data suggest that it is also increasing among ethnic Fijian youth. Among numerous behavioural changes contributing to overweight in youth residing in nations undergoing rapid economic and social change, meal skipping has not been examined as a potential risk factor. The study objectives were to assess the prevalence of overweight, obesity, and breakfast skipping and examine their cross-sectional association in a community sample of school-going ethnic Fijian adolescent girls (n=523). We measured height and weight, and assessed dietary patterns, eating pathology, dimensions of acculturation, and other socio-demographic and cultural data by self-report. We observed a high prevalence of both overweight (41%, including 15% who were obese) and breakfast skipping (68%). In addition, in multivariable analyses unadjusted for eating pathology, we found that more frequent breakfast skipping was associated with greater odds of overweight (odds ratio (OR)=1.15, confidence interval (CI)=1.06, 1.26, p<0.01) and obesity (OR=1.18, CI=1.05, 1.33, p<0.01). Regression models adjusting for eating pathology attenuated this relation so that it was non-significant, but demonstrated that greater eating pathology was associated with greater odds of both overweight and obesity. Future research is necessary to clarify the relation among breakfast skipping, eating pathology, and overweight in ethnic Fijian girls, and to identify whether breakfast skipping may be a modifiable risk factor for overweight in this population. PMID:20805082

Relationship between Breakfast Skipping and Obesity among Elderly: Cross-Sectional Analysis of the HEIJO-KYO Study.

PubMed

Otaki, N; Obayashi, K; Saeki, K; Kitagawa, M; Tone, N; Kurumatani, N

2017-01-01

Breakfast skipping is reported to be associated with obesity in children and younger populations; however, few studies report the association among elderly. The purpose of this study was to investigate the relationships between breakfast skipping and obesity prevalence among elderly. Cross-sectional study. Community-dwelling elderly in Nara, Japan. 1052 elderly participants (mean age: 71.6 years). Obesity and breakfast skipping were defined as body mass index of ≥25 kg/m2 and skipping breakfast one or more times per week, respectively. Two hundred and seventy-two participants (25.9%) were classified as obese and forty-one (3.9%) were as breakfast skippers. Obesity prevalence was significantly higher in breakfast skippers than in breakfast eaters (43.9% vs. 25.1%, P = 0.007). In multivariable logistic regression analysis adjusted for potential confounders (age, sex and alcohol consumption), breakfast skippers showed significantly higher odds ratio (OR) for obesity than breakfast eaters (OR, 2.23; 95% confidence interval, 1.17-4.27; P = 0.015), which continued to be significant after further adjustment for socioeconomic status. In addition, breakfast skippers showed significantly lower daily potassium (P <0.001) and dietary fibre intakes (P = 0.001) and lower subjective physical activity (P = 0.035) than breakfast eaters. Breakfast skipping was significantly associated with obesity among elderly. Poor diet quality and physical inactivity may be potential intermediators underlying the association between breakfast skipping and obesity.

Probabilistic choice between symmetric disparities in motion stereo matching for a lateral navigation system

NASA Astrophysics Data System (ADS)

Ershov, Egor; Karnaukhov, Victor; Mozerov, Mikhail

2016-02-01

Two consecutive frames of a lateral navigation camera video sequence can be considered as an appropriate approximation to epipolar stereo. To overcome edge-aware inaccuracy caused by occlusion, we propose a model that matches the current frame to the next and to the previous ones. The positive disparity of matching to the previous frame has its symmetric negative disparity to the next frame. The proposed algorithm performs probabilistic choice for each matched pixel between the positive disparity and its symmetric disparity cost. A disparity map obtained by optimization over the cost volume composed of the proposed probabilistic choice is more accurate than the traditional left-to-right and right-to-left disparity maps cross-check. Also, our algorithm needs two times less computational operations per pixel than the cross-check technique. The effectiveness of our approach is demonstrated on synthetic data and real video sequences, with ground-truth value.

The relationship of breakfast skipping and type of breakfast consumption with nutrient intake and weight status in children and adolescents: the National Health and Nutrition Examination Survey 1999-2006

USDA-ARS?s Scientific Manuscript database

National data comparing nutrient intakes and anthropometric measures in children and adolescents in the United States who skip breakfast or consume different types of breakfasts are limited. The objective was to examine the relationship between breakfast skipping and type of breakfast consumed with ...

Skip trajectory flight of a ramjet-powered hypersonic vehicle

NASA Astrophysics Data System (ADS)

Fomin, V. M.; Aulchenko, S. M.; Zvegintsev, V. I.

2010-07-01

Possible skip trajectories of a flying vehicle with a periodically actuated ramjet are numerically simulated. An optimal choice of ramjet actuation areas and duration is demonstrated to ensure the maximum flight range with a given amount of the fuel. The main advantage of skip trajectories is found to be a significant (by an order of magnitude) decrease in thermal loads on the flying vehicle.

Modulating Calcium Signals to Boost AON Exon Skipping for DMD

DTIC Science & Technology

2016-10-01

RNA Seq analysis to identify mechanisms of activity and specificity in order to guide discovery of second-generation skipping drugs or combinations...with greater activity. 15. SUBJECT TERMS Exon skipping, Dantrolene, Calcium, Duchenne, Dytrophy, Dystrophin, anti-sense-oligonucleatide, DMD, RNA ...for a subset of very rare mutations. Finally, we hypothesize that by combining chemical genomics with RNA Seq analysis we can begin to identify

An examination of the role of feeding regimens in regulating metabolism during the broiler breeder grower period. 1. Hepatic lipid metabolism.

PubMed

de Beer, M; Rosebrough, R W; Russell, B A; Poch, S M; Richards, M P; Coon, C N

2007-08-01

A trial was conducted to determine the effects of feeding regimens on hepatic lipid metabolism in 16-wk-old broiler breeder pullets. A flock of 350 Cobb 500 breeder pullets was divided into 2 at 4 wk of age and fed either every day (ED) or skip-a-day (SKIP) from 4 to 16 wk of age. Total feed intake did not differ between the 2 groups. At 112 d, 52 randomly selected ED-fed pullets, and 76 SKIP-fed pullets were individually caged and fed a 74-g (ED) or 148-g (SKIP) meal. Four pullets from each group were killed at intervals after feeding and livers were collected, weighed, and snap-frozen for determination of lipogenic gene expression. Total RNA was isolated from livers using Trizol reagent and then quantitatively measured by noting the optical density 260:280 ratio and qualitatively measured by gel electrophoresis. The expression of certain regulatory genes in metabolism [acetyl coenzyme A carboxylase; fatty acid synthase; malic enzyme (MAE); isocitrate dehydrogenase (ICDH); and aspartate aminotransferase (AAT)] were determined by real-time reverse-transcription PCR. Remaining liver portions were analyzed for enzyme activity of MAE, ICDH, and AAT as well as glycogen and lipid contents. Liver weight was higher in SKIP than in ED birds. Feeding caused dramatic increases in liver weight, glycogen, and lipids of SKIP birds. Expression of acetyl coenzyme A carboxylase, FAS, and MAE genes were increased in SKIP birds 12 and 24 h after feeding, with the increases in MAE expression from 0 to 24 h after feeding being of the greatest magnitude. In contrast, SKIP decreased ICDH and AAT gene expression, which parallels findings noted in fasting-refeeding experiments conducted with much younger birds. Skip-a-day feeding resulted in far greater changes in gene expression compared with ED, which was indicative of the inconsistent supply of nutrients in such regimens. Enzyme activity of MAE, ICDH, and AAT was reflective of noted changes in gene expression. In summary, the feeding regimen greatly affected hepatic gene expression in breeder pullets.

Media use as a reason for meal skipping and fast eating in secondary school children.

PubMed

Van den Bulck, J; Eggermont, S

2006-04-01

This study examined self-reported meal skipping and eating faster than usual with the goal of watching television or playing computer games. Respondents reported their media use and indicated how often they skipped a meal to watch a favourite television programme or to play a computer game, and how often they ate faster than usual in order to watch television or play a computer game. Respondents were 2546 adolescents of 13 (first year of secondary school) and 16 years (fourth year of secondary school) of age. About one respondent in 10 skipped at least one meal every week for either television viewing or computer game playing. Weekly meal skipping for television viewing occurs more regularly in boys and first-year students, but particularly in teenagers who view 5 h or more daily (15% of the sample). The category of teenagers who play computer games four times a week or more (25.3% of the sample) is at increased risk of meal skipping; those who play more than four times a week are 10 times more likely weekly to skip a meal. A quarter of the adolescents eat faster at least once a week to be able to watch television or play a computer game. Regardless of gender and school year, teenagers' risk of eating faster progressively increases with their use of the media. Those who watch 4 h or more daily are about seven times more likely to skip a meal for television and those who play computer games at least four times a week are nine times more likely weekly to skip a meal. Unhealthy eating habits can be a side effect of heavy or excessive media use. Teenagers' use of television or game computers during nonworking or out-of-school hours partly displaces the amount of time that needs to be spent at meals. Practitioners and educators may try to encourage or restore a pattern of healthful meal consumption habits by reducing the amount of media use, and by supporting parental rule-making regarding children's eating habits and media use.

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

PubMed

Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

2018-05-24

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

Rescue of cardiomyopathy through U7snRNA-mediated exon skipping in Mybpc3-targeted knock-in mice.

PubMed

Gedicke-Hornung, Christina; Behrens-Gawlik, Verena; Reischmann, Silke; Geertz, Birgit; Stimpel, Doreen; Weinberger, Florian; Schlossarek, Saskia; Précigout, Guillaume; Braren, Ingke; Eschenhagen, Thomas; Mearini, Giulia; Lorain, Stéphanie; Voit, Thomas; Dreyfus, Patrick A; Garcia, Luis; Carrier, Lucie

2013-07-01

Exon skipping mediated by antisense oligoribonucleotides (AON) is a promising therapeutic approach for genetic disorders, but has not yet been evaluated for cardiac diseases. We investigated the feasibility and efficacy of viral-mediated AON transfer in a Mybpc3-targeted knock-in (KI) mouse model of hypertrophic cardiomyopathy (HCM). KI mice carry a homozygous G>A transition in exon 6, which results in three different aberrant mRNAs. We identified an alternative variant (Var-4) deleted of exons 5-6 in wild-type and KI mice. To enhance its expression and suppress aberrant mRNAs we designed AON-5 and AON-6 that mask splicing enhancer motifs in exons 5 and 6. AONs were inserted into modified U7 small nuclear RNA and packaged in adeno-associated virus (AAV-U7-AON-5+6). Transduction of cardiac myocytes or systemic administration of AAV-U7-AON-5+6 increased Var-4 mRNA/protein levels and reduced aberrant mRNAs. Injection of newborn KI mice abolished cardiac dysfunction and prevented left ventricular hypertrophy. Although the therapeutic effect was transient and therefore requires optimization to be maintained over an extended period, this proof-of-concept study paves the way towards a causal therapy of HCM. © 2013 The Authors. Published by John Wiley and Sons, Ltd on behalf of EMBO.

Optimized P2A for reporter gene insertion into Nipah virus results in efficient ribosomal skipping and wild-type lethality.

PubMed

Park, Arnold; Yun, Tatyana; Hill, Terence E; Ikegami, Tetsuro; Juelich, Terry L; Smith, Jennifer K; Zhang, Lihong; Freiberg, Alexander N; Lee, Benhur

2016-04-01

Incorporation of reporter genes within virus genomes is an indispensable tool for interrogation of virus biology and pathogenesis. In previous work, we incorporated a fluorophore into a viral ORF by attaching it to the viral gene via a P2A ribosomal skipping sequence. This recombinant Nipah virus, however, was attenuated in vitro relative to WT virus. In this work, we determined that inefficient ribosomal skipping was a major contributing factor to this attenuation. Inserting a GSG linker before the P2A sequence resulted in essentially complete skipping, significantly improved growth in vitro, and WT lethality in vivo. To the best of our knowledge, this represents the first time a recombinant virus of Mononegavirales with integration of a reporter into a viral ORF has been compared with the WT virus in vivo. Incorporating the GSG linker for improved skipping efficiency whenever functionally important is a critical consideration for recombinant virus design.

Scooped Material on Rover Observation Tray

NASA Image and Video Library

2012-10-25

Sample material from the fourth scoop of Martian soil collected by NASA Mars rover Curiosity is on the rover observation tray in this image taken during the mission 78th Martian sol, Oct. 24, 2012 by Curiosity left Navigation Camera.

Skirting an Obstacle, Opportunity Sol 1867

NASA Image and Video Library

2009-07-15

This view from the navigation camera on NASA Mars Exploration Rover Opportunity shows tracks left by backing out of a wind-formed ripple after the rover wheels had started to dig too deeply into the dust and sand of the ripple.

A Large Scale Code Resolution Service Network in the Internet of Things

PubMed Central

Yu, Haining; Zhang, Hongli; Fang, Binxing; Yu, Xiangzhan

2012-01-01

In the Internet of Things a code resolution service provides a discovery mechanism for a requester to obtain the information resources associated with a particular product code immediately. In large scale application scenarios a code resolution service faces some serious issues involving heterogeneity, big data and data ownership. A code resolution service network is required to address these issues. Firstly, a list of requirements for the network architecture and code resolution services is proposed. Secondly, in order to eliminate code resolution conflicts and code resolution overloads, a code structure is presented to create a uniform namespace for code resolution records. Thirdly, we propose a loosely coupled distributed network consisting of heterogeneous, independent; collaborating code resolution services and a SkipNet based code resolution service named SkipNet-OCRS, which not only inherits DHT's advantages, but also supports administrative control and autonomy. For the external behaviors of SkipNet-OCRS, a novel external behavior mode named QRRA mode is proposed to enhance security and reduce requester complexity. For the internal behaviors of SkipNet-OCRS, an improved query algorithm is proposed to increase query efficiency. It is analyzed that integrating SkipNet-OCRS into our resolution service network can meet our proposed requirements. Finally, simulation experiments verify the excellent performance of SkipNet-OCRS. PMID:23202207

Identification of Small Molecule and Genetic Modulators of AON-Induced Dystrophin Exon Skipping by High-Throughput Screening

PubMed Central

O'Leary, Debra A.; Sharif, Orzala; Anderson, Paul; Tu, Buu; Welch, Genevieve; Zhou, Yingyao; Caldwell, Jeremy S.; Engels, Ingo H.; Brinker, Achim

2009-01-01

One therapeutic approach to Duchenne Muscular Dystrophy (DMD) recently entering clinical trials aims to convert DMD phenotypes to that of a milder disease variant, Becker Muscular Dystrophy (BMD), by employing antisense oligonucleotides (AONs) targeting splice sites, to induce exon skipping and restore partial dystrophin function. In order to search for small molecule and genetic modulators of AON-dependent and independent exon skipping, we screened ∼10,000 known small molecule drugs, >17,000 cDNA clones, and >2,000 kinase- targeted siRNAs against a 5.6 kb luciferase minigene construct, encompassing exon 71 to exon 73 of human dystrophin. As a result, we identified several enhancers of exon skipping, acting on both the reporter construct as well as endogenous dystrophin in mdx cells. Multiple mechanisms of action were identified, including histone deacetylase inhibition, tubulin modulation and pre-mRNA processing. Among others, the nucleolar protein NOL8 and staufen RNA binding protein homolog 2 (Stau2) were found to induce endogenous exon skipping in mdx cells in an AON-dependent fashion. An unexpected but recurrent theme observed in our screening efforts was the apparent link between the inhibition of cell cycle progression and the induction of exon skipping. PMID:20020055

Identification of small molecule and genetic modulators of AON-induced dystrophin exon skipping by high-throughput screening.

PubMed

O'Leary, Debra A; Sharif, Orzala; Anderson, Paul; Tu, Buu; Welch, Genevieve; Zhou, Yingyao; Caldwell, Jeremy S; Engels, Ingo H; Brinker, Achim

2009-12-17

One therapeutic approach to Duchenne Muscular Dystrophy (DMD) recently entering clinical trials aims to convert DMD phenotypes to that of a milder disease variant, Becker Muscular Dystrophy (BMD), by employing antisense oligonucleotides (AONs) targeting splice sites, to induce exon skipping and restore partial dystrophin function. In order to search for small molecule and genetic modulators of AON-dependent and independent exon skipping, we screened approximately 10,000 known small molecule drugs, >17,000 cDNA clones, and >2,000 kinase- targeted siRNAs against a 5.6 kb luciferase minigene construct, encompassing exon 71 to exon 73 of human dystrophin. As a result, we identified several enhancers of exon skipping, acting on both the reporter construct as well as endogenous dystrophin in mdx cells. Multiple mechanisms of action were identified, including histone deacetylase inhibition, tubulin modulation and pre-mRNA processing. Among others, the nucleolar protein NOL8 and staufen RNA binding protein homolog 2 (Stau2) were found to induce endogenous exon skipping in mdx cells in an AON-dependent fashion. An unexpected but recurrent theme observed in our screening efforts was the apparent link between the inhibition of cell cycle progression and the induction of exon skipping.

A large scale code resolution service network in the Internet of Things.

PubMed

Yu, Haining; Zhang, Hongli; Fang, Binxing; Yu, Xiangzhan

2012-11-07

In the Internet of Things a code resolution service provides a discovery mechanism for a requester to obtain the information resources associated with a particular product code immediately. In large scale application scenarios a code resolution service faces some serious issues involving heterogeneity, big data and data ownership. A code resolution service network is required to address these issues. Firstly, a list of requirements for the network architecture and code resolution services is proposed. Secondly, in order to eliminate code resolution conflicts and code resolution overloads, a code structure is presented to create a uniform namespace for code resolution records. Thirdly, we propose a loosely coupled distributed network consisting of heterogeneous, independent; collaborating code resolution services and a SkipNet based code resolution service named SkipNet-OCRS, which not only inherits DHT’s advantages, but also supports administrative control and autonomy. For the external behaviors of SkipNet-OCRS, a novel external behavior mode named QRRA mode is proposed to enhance security and reduce requester complexity. For the internal behaviors of SkipNet-OCRS, an improved query algorithm is proposed to increase query efficiency. It is analyzed that integrating SkipNet-OCRS into our resolution service network can meet our proposed requirements. Finally, simulation experiments verify the excellent performance of SkipNet-OCRS.

Skipped words and fixated words are processed differently during reading.

PubMed

Eskenazi, Michael A; Folk, Jocelyn R

2015-04-01

The purpose of this study was to investigate whether words are processed differently when they are fixated during silent reading than when they are skipped. According to a serial processing model of eye movement control (e.g., EZ Reader) skipped words are fully processed (Reichle, Rayner, Pollatsek, Behavioral and Brain Sciences, 26(04):445-476, 2003), whereas in a parallel processing model (e.g., SWIFT) skipped words do not need to be fully processed (Engbert, Nuthmann, Richter, Kliegl, Psychological Review, 112(4):777-813, 2005). Participants read 34 sentences with target words embedded in them while their eye movements were recorded. All target words were three-letter, low-frequency, and unpredictable nouns. After the reading session, participants completed a repetition priming lexical decision task with the target words from the reading session included as the repetition prime targets, with presentation of those same words during the reading task acting as the prime. When participants skipped a word during the reading session, their reaction times on the lexical decision task were significantly longer (M = 656.42 ms) than when they fixated the word (M = 614.43 ms). This result provides evidence that skipped words are sometimes not processed to the same degree as fixated words during reading.

Factors associated with skipping breakfast among Inner Mongolia medical students in China.

PubMed

Sun, Juan; Yi, He; Liu, Zhiyue; Wu, Yan; Bian, Jiang; Wu, Yanyan; Eshita, Yuki; Li, Gaimei; Zhang, Qing; Yang, Ying

2013-01-17

Few studies on the breakfast consumption habits of medical students in China have been carried out. The aim of the present study was to determine the prevalence of skipping breakfast and factors associated with skipping breakfast among medical students in Inner Mongolia of China, and to assist in the design of interventions to improve breakfast consumption habits of medical college students in this region. From December 2010 to January 2011 a cross-sectional survey was conducted among medical students in the Inner Mongolia Medical College using a self-administered questionnaire. The prevalence of skipping breakfast in relation to lifestyle habits was described and factors associated with breakfast consumption were identified using multiple logistic regression analysis. The overall prevalence of skipping breakfast was 41.7% and 23.5% for males and females, respectively. The Faculty of Medicine Information Management had the highest breakfast skipping prevalence. Logistic regression models found that the main factors associated with breakfast consumption habits among medical students were gender, class years of education, monthly expenses, faculty, appetite, sleeping quality, and the learning process; monthly expenses, sleeping quality, and the learning process showed a dose-dependent relationship. Breakfast consumption was associated with many factors, most importantly monthly expenses, sleeping quality and the learning process. The prevalence of skipping breakfast is significantly higher compared recently reported figures for medical students in western countries and other areas of China. Improvement of breakfast education should be considered for students in which higher monthly expenses, poor sleeping quality, or a laborious learning process have been identified.

Evaluating the Ergonomics of Flexible Ureteroscopy.

PubMed

Ludwig, Wesley W; Lee, Gyusung; Ziemba, Justin B; Ko, Joan S; Matlaga, Brian R

2017-10-01

To date, the ergonomics of flexible ureteroscopy (URS) have not been well described. We performed a study to assess the biomechanical stresses on urologists performing URS and to investigate the effect of ureteroscope type on these parameters. Electromyography (EMG) was used to quantify the activation level of muscle groups involved in URS. Surface EMG electrodes (Delsys, Boston, MA) were placed on the right and left thenar, flexor carpi ulnaris (FCU), extensor carpi ulnaris (ECU), biceps, triceps, and deltoid. Three endoscopes were studied: single-use digital (Boston Scientific LithoVue), reusable digital (Karl Storz Flex-X c ), and reusable fiber-optic (Karl Storz Flex-X 2 ). Each ureteroscope was used to perform a set sequence of navigation and procedural tasks in a training model. EMG data were processed and normalized to compare the maximum voluntary contractions between muscle groups. Cumulative muscular workload (CMW) and average muscular work per second (AWS) were used for comparative analysis. For navigational tasks, CMW and AWS were greatest for the ECU, followed in descending order by right and left thenar, FCU, biceps, deltoid, and triceps. For procedural tasks, CMW and AWS were greatest for the right thenar, followed in descending order by the left thenar, ECU, FCU, triceps, biceps, and deltoid. During navigational tasks, both LithoVue and Flex-X c had lower CMWs for every muscle group than Flex-X 2 (p < 0.05). LithoVue and Flex-X c had similar AWS and both were lower than Flex-X 2 for the right thenar, ECU, biceps, and deltoid activation (p < 0.05). During procedural tasks, both LithoVue and Flex-X c had lower CMWs and AWS for right and left thenar, ECU, and biceps than Flex-X 2 (p < 0.05). This study provides the first description of EMG-measured ergonomics of URS. Both the single-use and reusable digital ureteroscopes have similar profiles, and both have significantly better ergonomic metrics than the reusable fiber-optic ureteroscope.

Opportunity's Surroundings After Sol 1820 Drive (Stereo)

NASA Technical Reports Server (NTRS)

2009-01-01

[figure removed for brevity, see original site] Left-eye view of a color stereo pair for PIA11841 [figure removed for brevity, see original site] Right-eye view of a color stereo pair for PIA11841

NASA's Mars Exploration Rover Opportunity used its navigation camera to take the images combined into this full-circle view of the rover's surroundings during the 1,820th to 1,822nd Martian days, or sols, of Opportunity's surface mission (March 7 to 9, 2009).

This view combines images from the left-eye and right-eye sides of the navigation camera. It appears three-dimensional when viewed through red-blue glasses with the red lens on the left.

The rover had driven 20.6 meters toward the northwest on Sol 1820 before beginning to take the frames in this view. Tracks from that drive recede southwestward. For scale, the distance between the parallel wheel tracks is about 1 meter (about 40 inches).

The terrain in this portion of Mars' Meridiani Planum region includes dark-toned sand ripples and small exposures of lighter-toned bedrock.

This view is presented as a cylindrical-perspective projection with geometric seam correction.

Neuroendovascular magnetic navigation: clinical experience in ten patients.

PubMed

Dabus, Guilherme; Gerstle, Ronald J; Cross, Dewitte T; Derdeyn, Colin P; Moran, Christopher J

2007-04-01

The magnetic navigation system consists of an externally generated magnetic field that is used to control and steer a magnetically tipped microguidewire. The goal of this study was to demonstrate that the use of the magnetic navigation system and its magnetic microguidewire is feasible and safe in all types of neuroendovascular procedures. A magnetic navigation system is an interventional workstation that combines a biplanar fluoroscopy system with a computer-controlled magnetic field generator to provide both visualization and control of a magnetically activated endovascular microguidewire. Ten consecutive patients underwent a variety of neuroendovascular procedures using the magnetic guidance system and magnetic microguidewire. All patients presented with a neurovascular disease that was suitable for endovascular treatment. Multiple different devices and embolic agents were used. Of the ten patients, three were male and seven female. Their mean age was 53.9 years. The predominant neurovascular condition was the presence of intracranial aneurysm (nine patients). One patient had a left mandibular arteriovenous malformation. All treatments were successfully performed on the magnetic navigation system suite. The magnetic navigation system and the magnetic microguidewire allowed safe and accurate endovascular navigation allowing placement of the microcatheters in the desired location. There were no neurological complications or death in our series. The use of the magnetic navigation system and the magnetic microguidewire in the endovascular treatment of patients with neurovascular diseases is feasible and safe.

Argos: Design and Development of Object-Oriented, Event-Driven Multimedia Data Base Technology in Support of the Paperless Ship

DTIC Science & Technology

1988-12-01

on openStack global mode -- mode may be any of the following types: -- navigate - traverse through the graphical hierarchy -- order - for...ordering an item via graphics put "NAVIGATE" into MODE hide message box hide menubar set userlevel to 5 end openStack on closestack -- this handler will... openStack hide menuBAR hide message box end openStack * BKGND #1, BUTTON #1: Next * * * * ** ** * on mouseUp visual effect wipe left go to next card of

UFO in the Left Atrium: How to Capture Metal Debris Floating in the Left Atrium.

PubMed

Fassini, Gaetano; Moltrasio, Massimo; Conti, Sergio; Biagioli, Viviana; Tondo, Claudio

2016-06-01

Electrophysiology procedures involving left atrium navigation are becoming more frequent, mostly due to the increase of atrial fibrillation ablation. Mapping catheters of different shapes and size as well as dedicated sheaths are mandatory tools for the accomplishment of procedural end point. Therefore, technical issues are expected, usually unrelated to significant risk. However, any accidental intra-atrial device loss of integrity implies a risk of cerebrovascular embolization. The lack of clear evidence on how to manage these events and the need for a quick solution complicate the scenario. We report an empirical solution in the case of debris floating in the left atrium. Copyright © 2016 Canadian Cardiovascular Society. Published by Elsevier Inc. All rights reserved.

Influence of Landmarks on Wayfinding and Brain Connectivity in Immersive Virtual Reality Environment

PubMed Central

Sharma, Greeshma; Kaushal, Yash; Chandra, Sushil; Singh, Vijander; Mittal, Alok P.; Dutt, Varun

2017-01-01

Spatial navigation is influenced by landmarks, which are prominent visual features in the environment. Although previous research has focused on finding advantages of landmarks on wayfinding via experimentation; however, less attention has been given to identifying the key attributes of landmarks that facilitate wayfinding, including the study of neural correlates (involving electroencephalogram, EEG analyses). In this paper, we combine behavioral measures, virtual environment, and EEG signal-processing to provide a holistic investigation about the influence of landmarks on performance during navigation in a maze-like environment. In an experiment, participants were randomly divided into two conditions, Landmark-enriched (LM+; N = 17) and Landmark-devoid (LM-; N = 18), and asked to navigate from an initial location to a goal location in a maze. In the LM+ condition, there were landmarks placed at certain locations, which participants could use for wayfinding in the maze. However, in the LM- condition, such landmarks were not present. Beyond behavioral analyses of data, analyses were carried out of the EEG data collected using a 64-channel device. Results revealed that participants took less time and committed fewer errors in navigating the maze in the LM+ condition compared to the LM- condition. EEG analyses of the data revealed that the left-hemispheric activation was more prominent in the LM+ condition compared to the LM- condition. The event-related desynchronization/synchronization (ERD/ERS) of the theta frequency band, revealed activation in the left posterior inferior and superior regions in the LM+ condition compared to the LM- condition, suggesting an occurrence of an object-location binding in the LM+ condition along with spatial transformation between representations. Moreover, directed transfer function method, which measures information flow between two regions, showed a higher number of active channels in the LM- condition compared to the LM+ condition, exhibiting additional wiring cost associated with the cognitive demands when no landmark was available. These findings reveal pivotal role of the left-hemispheric region (especially, parietal cortex), which indicates the integration of available sensory cues and current memory requirements to encode contextual information of landmarks. Overall, this research helps to understand the role of brain regions and processes that are utilized when people use landmarks in navigating maze-like environments. PMID:28775698

First 3-D Panorama of Spirit Landing Site

NASA Image and Video Library

2004-01-05

This sprawling look at the martian landscape surrounding the Mars Exploration Rover Spirit is the first 3-D stereo image from the rover navigation camera. Sleepy Hollow can be seen to center left of the image. 3D glasses are necessary.

Using a respiratory navigator significantly reduces variability when quantifying left ventricular torsion with cardiovascular magnetic resonance.

PubMed

Hamlet, Sean M; Haggerty, Christopher M; Suever, Jonathan D; Wehner, Gregory J; Andres, Kristin N; Powell, David K; Charnigo, Richard J; Fornwalt, Brandon K

2017-03-01

Left ventricular (LV) torsion is an important indicator of cardiac function that is limited by high inter-test variability (50% of the mean value). We hypothesized that this high inter-test variability is partly due to inconsistent breath-hold positions during serial image acquisitions, which could be significantly improved by using a respiratory navigator for cardiovascular magnetic resonance (CMR) based quantification of LV torsion. We assessed respiratory-related variability in measured LV torsion with two distinct experimental protocols. First, 17 volunteers were recruited for CMR with cine displacement encoding with stimulated echoes (DENSE) in which a respiratory navigator was used to measure and then enforce variability in end-expiratory position between all LV basal and apical acquisitions. From these data, we quantified the inter-test variability of torsion in the absence and presence of enforced end-expiratory position variability, which established an upper bound for the expected torsion variability. For the second experiment (in 20 new, healthy volunteers), 10 pairs of cine DENSE basal and apical images were each acquired from consecutive breath-holds and consecutive navigator-gated scans (with a single acceptance position). Inter-test variability of torsion was compared between the breath-hold and navigator-gated scans to quantify the variability due to natural breath-hold variation. To demonstrate the importance of these variability reductions, we quantified the reduction in sample size required to detect a clinically meaningful change in LV torsion with the use of a respiratory navigator. The mean torsion was 3.4 ± 0.2°/cm. From the first experiment, enforced variability in end-expiratory position translated to considerable variability in measured torsion (0.56 ± 0.34°/cm), whereas inter-test variability with consistent end-expiratory position was 57% lower (0.24 ± 0.16°/cm, p < 0.001). From the second experiment, natural respiratory variability from consecutive breath-holds translated to a variability in torsion of 0.24 ± 0.10°/cm, which was significantly higher than the variability from navigator-gated scans (0.18 ± 0.06°/cm, p = 0.02). By using a respiratory navigator with DENSE, theoretical sample sizes were reduced from 66 to 16 and 26 to 15 as calculated from the two experiments. A substantial portion (22-57%) of the inter-test variability of LV torsion can be reduced by using a respiratory navigator to ensure a consistent breath-hold position between image acquisitions.

The lower body muscle activation of intermediate to experienced kayakers when navigating white water.

PubMed

Murtagh, Misha; Brooks, Darrell; Sinclair, Jonathan; Atkins, Stephen

2016-11-01

In white-water kayaking, the legs play a vital part in turning, stabilising and bracing actions. To date, there has been no reported information on neuromuscular activation of the legs in an authentic white-water environment. The aim of the current study was to identify lower body muscle activation, using 'in-boat' electromyography (EMG), whilst navigating a white-water run. Ten experienced male kayakers (age 31.5 ± 12.5 yr, intermediate to advanced experience) completed three successful runs of an international standard white-water course (grade 3 rapids), targeting right and left sides of the course, in a zigzag formation. Surface EMG (sEMG) outputs were generated, bilaterally, for the rectus femoris (RF), vastus lateralis, biceps femoris and gastrocnemius, expressed as a percentage of a dynamic maximal voluntary contraction (dMVC). Only RF showed significantly higher activation than any muscle on the left side of the body, and only on the left side of the course (P = .004; ETA(2) = 0.56). Other results showed no significant difference between muscle activation in the right and left legs during each run, nor when assessed at either the right or left side of the course (P > .05). These findings indicate that contralateral symmetry in lower limb muscle activation is evident during white-water kayaking. This symmetry may provide a stable base to allow more asymmetrical upper body and trunk movements to be fully optimised. Lower body symmetry development should be considered useful in targeted training programmes for white-water kayakers.

Navigation Patterns and Scent Marking: Underappreciated Contributors to Hippocampal and Entorhinal Spatial Representations?

PubMed

Lebedev, Mikhail A; Pimashkin, Alexey; Ossadtchi, Alexei

2018-01-01

According to the currently prevailing theory, hippocampal formation constructs and maintains cognitive spatial maps. Most of the experimental evidence for this theory comes from the studies on navigation in laboratory rats and mice, typically male animals. While these animals exhibit a rich repertoire of behaviors associated with navigation, including locomotion, head movements, whisking, sniffing, raring and scent marking, the contribution of these behavioral patterns to the hippocampal spatially-selective activity has not been sufficiently studied. Instead, many publications have considered animal position in space as the major variable that affects the firing of hippocampal place cells and entorhinal grid cells. Here we argue that future work should focus on a more detailed examination of different behaviors exhibited during navigation to better understand the mechanism of spatial tuning in hippocampal neurons. As an inquiry in this direction, we have analyzed data from two datasets, shared online, containing recordings from rats navigating in square and round arenas. Our analyses revealed patchy navigation patterns, evident from the spatial maps of animal position, velocity and acceleration. Moreover, grid cells available in the datasets exhibited similar periodicity as the navigation parameters. These findings indicate that activity of grid cells could affect navigation parameters and/or vice versa. Additionally, we speculate that scent marks left by navigating animals could contribute to neuronal responses while rats and mice sniff their environment; the act of sniffing could modulate neuronal discharges even in virtual visual environments. Accordingly, we propose that future experiments should contain additional controls for navigation patterns, whisking, sniffing and maps composed of scent marks.

Live-cell imaging visualizes frequent mitotic skipping during senescence-like growth arrest in mammary carcinoma cells exposed to ionizing radiation.

PubMed

Suzuki, Masatoshi; Yamauchi, Motohiro; Oka, Yasuyoshi; Suzuki, Keiji; Yamashita, Shunichi

2012-06-01

Senescence-like growth arrest in human solid carcinomas is now recognized as the major outcome of radiotherapy. This study was designed to analyze cell cycle during the process of senescence-like growth arrest in mammary carcinoma cells exposed to X-rays. Fluorescent ubiquitination-based cell cycle indicators were introduced into the human mammary carcinoma cell line MCF-7. Cell cycle was sequentially monitored by live-cell imaging for up to 5 days after exposure to 10 Gy of X-rays. Live-cell imaging revealed that cell cycle transition from G2 to G1 phase without mitosis, so-called mitotic skipping, was observed in 17.1% and 69.8% of G1- and G2-irradiated cells, respectively. Entry to G1 phase was confirmed by the nuclear accumulation of mKO(2)-hCdt1 as well as cyclin E, which was inversely correlated to the accumulation of G2-specific markers such as mAG-hGeminin and CENP-F. More than 90% of cells skipping mitosis were persistently arrested in G1 phase and showed positive staining for the senescent biochemical marker, which is senescence-associated ß-galactosidase, indicating induction of senescence-like growth arrest accompanied by mitotic skipping. While G2 irradiation with higher doses of X-rays induced mitotic skipping in approximately 80% of cells, transduction of short hairpin RNA (shRNA) for p53 significantly suppressed mitotic skipping, suggesting that ionizing radiation-induced mitotic skipping is associated with p53 function. The present study found the pathway of senescence-like growth arrest in G1 phase without mitotic entry following G2-irradiation. Copyright © 2012 Elsevier Inc. All rights reserved.

Precursor processes of human self-initiated action.

PubMed

Khalighinejad, Nima; Schurger, Aaron; Desantis, Andrea; Zmigrod, Leor; Haggard, Patrick

2018-01-15

A gradual buildup of electrical potential over motor areas precedes self-initiated movements. Recently, such "readiness potentials" (RPs) were attributed to stochastic fluctuations in neural activity. We developed a new experimental paradigm that operationalized self-initiated actions as endogenous 'skip' responses while waiting for target stimuli in a perceptual decision task. We compared these to a block of trials where participants could not choose when to skip, but were instead instructed to skip. Frequency and timing of motor action were therefore balanced across blocks, so that conditions differed only in how the timing of skip decisions was generated. We reasoned that across-trial variability of EEG could carry as much information about the source of skip decisions as the mean RP. EEG variability decreased more markedly prior to self-initiated compared to externally-triggered skip actions. This convergence suggests a consistent preparatory process prior to self-initiated action. A leaky stochastic accumulator model could reproduce this convergence given the additional assumption of a systematic decrease in input noise prior to self-initiated actions. Our results may provide a novel neurophysiological perspective on the topical debate regarding whether self-initiated actions arise from a deterministic neurocognitive process, or from neural stochasticity. We suggest that the key precursor of self-initiated action may manifest as a reduction in neural noise. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Effect of innovative building design on physical activity.

PubMed

Nicoll, Gayle; Zimring, Craig

2009-01-01

Stair climbing can be a low-cost and relatively accessible way to add everyday physical activity, but many building stairwells are inaccessible or unpleasant and elevators are far more convenient. This study explores the use of and attitude toward stairs in an innovative office building where the main elevators for able-bodied users stop only at every third floor ("skip-stop" elevators). These users are expected to walk up or down nearby stairs that have been made open and appealing ("skip-stop" stairs). The study takes advantage of a natural experiment. Some workers' offices were clustered around the skip-stop elevator and the stairs, whereas others had access to a traditional elevator core, that is, an elevator that stopped at each floor with nearby fire exit stairs. Stair use on the open skip-stop stairs and enclosed fire stairs was measured using infrared monitors and card-reader activity logs. An online survey of employees (N=299, a 17.4% response rate) gathered information on stair use and attitudes and behaviors toward physical activity; interviews with key personnel identified major implementation issues. The skip-stop stair was used 33 times more than the enclosed stair of the traditional elevator core, with 72% of survey participants reporting daily stair use. Although implementation issues related to organizational objectives, costs, security, barrier-free accessibility, and building codes exist, the skip-stop feature offers a successful strategy for increasing stair use in workplaces.

Immortalized Muscle Cell Model to Test the Exon Skipping Efficacy for Duchenne Muscular Dystrophy

PubMed Central

Nguyen, Quynh

2017-01-01

Duchenne muscular dystrophy (DMD) is a lethal genetic disorder that most commonly results from mutations disrupting the reading frame of the dystrophin (DMD) gene. Among the therapeutic approaches employed, exon skipping using antisense oligonucleotides (AOs) is one of the most promising strategies. This strategy aims to restore the reading frame, thus producing a truncated, yet functioning dystrophin protein. In 2016, the Food and Drug Administration (FDA) conditionally approved the first AO-based drug, eteplirsen (Exondys 51), developed for DMD exon 51 skipping. An accurate and reproducible method to quantify exon skipping efficacy is essential for evaluating the therapeutic potential of different AOs sequences. However, previous in vitro screening studies have been hampered by the limited proliferative capacity and insufficient amounts of dystrophin expressed by primary muscle cell lines that have been the main system used to evaluate AOs sequences. In this paper, we illustrate the challenges associated with primary muscle cell lines and describe a novel approach that utilizes immortalized cell lines to quantitatively evaluate the exon skipping efficacy in in vitro studies. PMID:29035327

Beyond Dizziness: Virtual Navigation, Spatial Anxiety and Hippocampal Volume in Bilateral Vestibulopathy

PubMed Central

Kremmyda, Olympia; Hüfner, Katharina; Flanagin, Virginia L.; Hamilton, Derek A.; Linn, Jennifer; Strupp, Michael; Jahn, Klaus; Brandt, Thomas

2016-01-01

Bilateral vestibulopathy (BVP) is defined as the impairment or loss of function of either the labyrinths or the eighth nerves. Patients with total BVP due to bilateral vestibular nerve section exhibit difficulties in spatial memory and navigation and show a loss of hippocampal volume. In clinical practice, most patients do not have a complete loss of function but rather an asymmetrical residual functioning of the vestibular system. The purpose of the current study was to investigate navigational ability and hippocampal atrophy in BVP patients with residual vestibular function. Fifteen patients with BVP and a group of age- and gender- matched healthy controls were examined. Self-reported questionnaires on spatial anxiety and wayfinding were used to assess the applied strategy of wayfinding and quality of life. Spatial memory and navigation were tested directly using a virtual Morris Water Maze Task. The hippocampal volume of these two groups was evaluated by voxel-based morphometry. In the patients, the questionnaire showed a higher spatial anxiety and the Morris Water Maze Task a delayed spatial learning performance. MRI revealed a significant decrease in the gray matter mid-hippocampal volume (Left: p = 0.006, Z = 4.58, Right: p < 0.001, Z = 3.63) and posterior parahippocampal volume (Right: p = 0.005, Z = 4.65, Left: p < 0.001, Z = 3.87) compared to those of healthy controls. In addition, a decrease in hippocampal formation volume correlated with a more dominant route-finding strategy. Our current findings demonstrate that even partial bilateral vestibular loss leads to anatomical and functional changes in the hippocampal formation and objective and subjective behavioral deficits. PMID:27065838

Virtual water maze learning in human increases functional connectivity between posterior hippocampus and dorsal caudate.

PubMed

Woolley, Daniel G; Mantini, Dante; Coxon, James P; D'Hooge, Rudi; Swinnen, Stephan P; Wenderoth, Nicole

2015-04-01

Recent work has demonstrated that functional connectivity between remote brain regions can be modulated by task learning or the performance of an already well-learned task. Here, we investigated the extent to which initial learning and stable performance of a spatial navigation task modulates functional connectivity between subregions of hippocampus and striatum. Subjects actively navigated through a virtual water maze environment and used visual cues to learn the position of a fixed spatial location. Resting-state functional magnetic resonance imaging scans were collected before and after virtual water maze navigation in two scan sessions conducted 1 week apart, with a behavior-only training session in between. There was a large significant reduction in the time taken to intercept the target location during scan session 1 and a small significant reduction during the behavior-only training session. No further reduction was observed during scan session 2. This indicates that scan session 1 represented initial learning and scan session 2 represented stable performance. We observed an increase in functional connectivity between left posterior hippocampus and left dorsal caudate that was specific to scan session 1. Importantly, the magnitude of the increase in functional connectivity was correlated with offline gains in task performance. Our findings suggest cooperative interaction occurs between posterior hippocampus and dorsal caudate during awake rest following the initial phase of spatial navigation learning. Furthermore, we speculate that the increase in functional connectivity observed during awake rest after initial learning might reflect consolidation-related processing. © 2014 Wiley Periodicals, Inc.

Fire Safety

MedlinePlus

... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... able to reliably rescue themselves. Know What to Do in a Fire Test any closed doors with ...

Precession and circularization of elliptical space-tether motion

NASA Technical Reports Server (NTRS)

Chapel, Jim D.; Grosserode, Patrick

1993-01-01

In this paper, we present a simplified analytic model for predicting motion of long space tethers. The perturbation model developed here addresses skip rope motion, where each end of the tether is held in place and the middle of the tether swings with a motion similar to that of a child's skip rope. If the motion of the tether midpoint is elliptical rather than circular, precession of the ellipse complicates the procedures required to damp this motion. The simplified analytic model developed in this paper parametrically predicts the precession of elliptical skip rope motion. Furthermore, the model shows that elliptic skip rope motion will circularize when damping is present in the longitudinal direction. Compared with high-fidelity simulation results, this simplified model provides excellent predictions of these phenomena.

Improving Family Communications

MedlinePlus

... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... do the same. More Tips To Improve Communication Do Give clear, age-appropriate directions such as, "When ...

Sleep Apnea Detection

MedlinePlus

... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... the night Sleepiness during the day Difficulty paying attention Behavior problems If you notice any of these ...

Histone hyperacetylation and exon skipping: a calcium-mediated dynamic regulation in cardiomyocytes

PubMed Central

Sharma, Alok; Nguyen, Hieu; Cai, Lu; Lou, Hua

2015-01-01

In contrast to cell type-specific pre-mRNA alternative splicing, mechanisms controlling activity-dependent alternative splicing is under-studied and not well understood. In a recent study, we conducted a comprehensive analysis of calcium-mediated mechanism that regulates alternative exon skipping in mouse cardiomyocytes. Our results reveal a strong link between histone hyperacetylation and skipping of cassette exons, and provide support to the kinetic coupling model of the epigenetic regulation of alternative splicing at the chromatin level. PMID:26325491

What Is a Neonatologist?

MedlinePlus

... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... care during your pregnancy. What Kind of Training Do Neonatologists Have? Neonatologists are medical doctors who have ...

TDRS-M NASA Social

NASA Image and Video Library

2017-08-17

Social media gather in Kennedy Space Center’s Press Site auditorium for a briefing focused on preparations to launch NASA's Tracking and Data Relay Satellite, TDRS-M. The latest spacecraft destined for the agency's constellation of communications satellites, TDRS-M will allow nearly continuous contact with orbiting spacecraft ranging from the International Space Station and Hubble Space Telescope to the array of scientific observatories. Liftoff atop a United Launch Alliance Atlas V rocket is scheduled to take place from Space Launch Complex 41 at Cape Canaveral Air Force Station at 8:03 a.m. EDT Aug. 18. NASA Social Media Team includes: Emily Furfaro and Amber Jacobson. Guest speakers include: Badri Younes, Deputy Associate Administrator for Space Communications and Navigation at NASA Headquarters in Washington; Dave Littmann, Project Manager for TDRS-M at NASA’s Goddard Space Flight Center; Neil Mallik, NASA Deputy Network Director for Human Spaceflight; Nicole Mann, NASA Astronaut; Steve Bowen, NASA Astronaut; Skip Owen, NASA Launch Services; Scott Messer, United Launch Alliance Program Manager for NASA Missions.

What Is a Pediatric Endocrinologist?

MedlinePlus

... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... and the teen years. What Kind of Training Do Pediatric Endocrinologists Have? Pediatric endocrinologists are medical doctors ...

What Is a Pediatric Urologist?

MedlinePlus

... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... to treat your child. What Kind of Training Do Pediatric Urologists Have? Pediatric urologists are medical doctors ...

Emotional Development: 1 Year Olds

MedlinePlus

... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... her regain her composure is to give her attention and reassurance when she needs it. Snapping at ...

Mental space travel: damage to posterior parietal cortex prevents egocentric navigation and reexperiencing of remote spatial memories.

PubMed

Ciaramelli, Elisa; Rosenbaum, R Shayna; Solcz, Stephanie; Levine, Brian; Moscovitch, Morris

2010-05-01

The ability to navigate in a familiar environment depends on both an intact mental representation of allocentric spatial information and the integrity of systems supporting complementary egocentric representations. Although the hippocampus has been implicated in learning new allocentric spatial information, converging evidence suggests that the posterior parietal cortex (PPC) might support egocentric representations. To date, however, few studies have examined long-standing egocentric representations of environments learned long ago. Here we tested 7 patients with focal lesions in PPC and 12 normal controls in remote spatial memory tasks, including 2 tasks reportedly reliant on allocentric representations (distance and proximity judgments) and 2 tasks reportedly reliant on egocentric representations (landmark sequencing and route navigation; see Rosenbaum, Ziegler, Winocur, Grady, & Moscovitch, 2004). Patients were unimpaired in distance and proximity judgments. In contrast, they all failed in route navigation, and left-lesioned patients also showed marginally impaired performance in landmark sequencing. Patients' subjective experience associated with navigation was impoverished and disembodied compared with that of the controls. These results suggest that PPC is crucial for accessing remote spatial memories within an egocentric reference frame that enables both navigation and reexperiencing. Additionally, PPC was found to be necessary to implement specific aspects of allocentric navigation with high demands on spontaneous retrieval. PsycINFO Database Record (c) 2010 APA, all rights reserved.

Investigation of impact of post-metallization annealing on reliability of 65 nm NOR floating-gate flash memories

NASA Astrophysics Data System (ADS)

Chiu, Shengfen; Xu, Yue; Ji, Xiaoli; Yan, Feng

2016-12-01

This paper investigates the impact of post-metallization annealing (PMA) in pure nitrogen ambient on the reliability of 65 nm NOR-type floating-gate flash memory devices. The experimental results show that, with PMA process, the cycling performance of flash cells, especially for the erasing speed is obviously degraded compared to that without PMA. It is found that the bulk oxide traps and tunnel oxide/Si interface traps are significantly increased with PMA treatment. The water/moisture residues left in the interlayer dielectric layers diffuse to tunnel oxide during PMA process is considered to be responsible for these traps generation, which further enhances the degradation of erase performance. Skipping PMA treatment is proposed to suppress the water diffusion effect on erase performance degradation of flash cells.

MRI roadmap-guided transendocardial delivery of exon-skipping recombinant adeno-associated virus restores dystrophin expression in a canine model of Duchenne muscular dystrophy.

PubMed

Barbash, I M; Cecchini, S; Faranesh, A Z; Virag, T; Li, L; Yang, Y; Hoyt, R F; Kornegay, J N; Bogan, J R; Garcia, L; Lederman, R J; Kotin, R M

2013-03-01

Duchenne muscular dystrophy (DMD) cardiomyopathy patients currently have no therapeutic options. We evaluated catheter-based transendocardial delivery of a recombinant adeno-associated virus (rAAV) expressing a small nuclear U7 RNA (U7smOPT) complementary to specific cis-acting splicing signals. Eliminating specific exons restores the open reading frame resulting in translation of truncated dystrophin protein. To test this approach in a clinically relevant DMD model, golden retriever muscular dystrophy (GRMD) dogs received serotype 6 rAAV-U7smOPT via the intracoronary or transendocardial route. Transendocardial injections were administered with an injection-tipped catheter and fluoroscopic guidance using X-ray fused with magnetic resonance imaging (XFM) roadmaps. Three months after treatment, tissues were analyzed for DNA, RNA, dystrophin protein, and histology. Whereas intracoronary delivery did not result in effective transduction, transendocardial injections, XFM guidance, enabled 30±10 non-overlapping injections per animal. Vector DNA was detectable in all samples tested and ranged from <1 to >3000 vector genome copies per cell. RNA analysis, western blot analysis, and immunohistology demonstrated extensive expression of skipped RNA and dystrophin protein in the treated myocardium. Left ventricular function remained unchanged over a 3-month follow-up. These results demonstrated that effective transendocardial delivery of rAAV-U7smOPT was achieved using XFM. This approach restores an open reading frame for dystrophin in affected dogs and has potential clinical utility.

What Is a Pediatric Infectious Diseases Specialist?

MedlinePlus

... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... through the teen years. What Kind of Training Do Pediatric Infectious Diseases Specialists Have? Pediatric infectious diseases ...

How to Keep Your Sleeping Baby Safe

MedlinePlus

... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... any of the recommendations listed. What You Can Do: Recommendations for Infant Sleep Safety Until their first ...

What Is a Pediatric Critical Care Specialist?

MedlinePlus

... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... offered in the PICU. What Kind of Training Do Pediatric Critical Care Specialists Have? Pediatric critical care ...

SKIP Is a Component of the Spliceosome Linking Alternative Splicing and the Circadian Clock in Arabidopsis[W

PubMed Central

Wang, Xiaoxue; Wu, Fangming; Xie, Qiguang; Wang, Huamei; Wang, Ying; Yue, Yanling; Gahura, Ondrej; Ma, Shuangshuang; Liu, Lei; Cao, Ying; Jiao, Yuling; Puta, Frantisek; McClung, C. Robertson; Xu, Xiaodong; Ma, Ligeng

2012-01-01

Circadian clocks generate endogenous rhythms in most organisms from cyanobacteria to humans and facilitate entrainment to environmental diurnal cycles, thus conferring a fitness advantage. Both transcriptional and posttranslational mechanisms are prominent in the basic network architecture of circadian systems. Posttranscriptional regulation, including mRNA processing, is emerging as a critical step for clock function. However, little is known about the molecular mechanisms linking RNA metabolism to the circadian clock network. Here, we report that a conserved SNW/Ski-interacting protein (SKIP) domain protein, SKIP, a splicing factor and component of the spliceosome, is involved in posttranscriptional regulation of circadian clock genes in Arabidopsis thaliana. Mutation in SKIP lengthens the circadian period in a temperature-sensitive manner and affects light input and the sensitivity of the clock to light resetting. SKIP physically interacts with the spliceosomal splicing factor Ser/Arg-rich protein45 and associates with the pre-mRNA of clock genes, such as PSEUDORESPONSE REGULATOR7 (PRR7) and PRR9, and is necessary for the regulation of their alternative splicing and mRNA maturation. Genome-wide investigations reveal that SKIP functions in regulating alternative splicing of many genes, presumably through modulating recognition or cleavage of 5′ and 3′ splice donor and acceptor sites. Our study addresses a fundamental question on how the mRNA splicing machinery contributes to circadian clock function at a posttranscriptional level. PMID:22942380

Skipping meals and alcohol consumption. The regulation of energy intake and expenditure among weight loss participants.

PubMed

Carels, Robert A; Young, Kathleen M; Coit, Carissa; Clayton, Anna Marie; Spencer, Alexis; Wagner, Marissa

2008-11-01

Research suggests that specific eating patterns (e.g., eating breakfast) may be related to favorable weight status. This investigation examined the relationship between eating patterns (i.e., skipping meals; consuming alcohol) and weight loss treatment outcomes (weight loss, energy intake, energy expenditure, and duration of exercise). Fifty-four overweight or obese adults (BMI> or =27 kg/m(2)) participated in a self-help or therapist-assisted weight loss program. Daily energy intake from breakfast, lunch, dinner, and alcoholic beverages, total daily energy intake, total daily energy expenditure, physical activity, and weekly weight loss were assessed. On days that breakfast or dinner was skipped, or alcoholic beverages were not consumed, less total daily energy was consumed compared to days that breakfast, dinner, or alcoholic beverages were consumed. On days that breakfast or alcohol was consumed, daily energy expenditure (breakfast only) and duration of exercise were higher compared to days that breakfast or alcohol was not consumed. Individuals who skipped dinner or lunch more often had lower energy expenditure and exercise duration than individuals who skipped dinner or lunch less often. Individuals who consumed alcohol more often had high daily energy expenditure than individuals who consumed alcohol less often. Skipping meals or consuming alcoholic beverages was not associated with weekly weight loss. In this investigation, weight loss program participants may have compensated for excess energy intake from alcoholic beverages and meals with greater daily energy expenditure and longer exercise duration.

Olfaction and topography, but not magnetic cues, control navigation in a pelagic seabird: displacements with shearwaters in the Mediterranean Sea

PubMed Central

Pollonara, Enrica; Luschi, Paolo; Guilford, Tim; Wikelski, Martin; Bonadonna, Francesco; Gagliardo, Anna

2015-01-01

Pelagic seabirds wander the open oceans then return accurately to their habitual nest-sites. We investigated the effects of sensory manipulation on oceanic navigation in Scopoli’s shearwaters (Calonectris diomedea) breeding at Pianosa island (Italy), by displacing them 400 km from their colony and tracking them. A recent experiment on Atlantic shearwaters (Cory’s shearwater, Calonectris borealis) breeding in the Azores indicated a crucial role of olfaction over the open ocean, but left open the question of whether birds might navigate by topographical landmark cues when available. Our experiment was conducted in the Mediterranean sea, where the availability of topographical cues may provide an alternative navigational mechanism for homing. Magnetically disturbed shearwaters and control birds oriented homeward even when the coast was not visible and rapidly homed. Anosmic shearwaters oriented in a direction significantly different from the home direction when in open sea. After having approached a coastline their flight path changed from convoluted to homeward oriented, so that most of them eventually reached home. Beside confirming that magnetic cues appear unimportant for oceanic navigation by seabirds, our results support the crucial role of olfactory cues for birds’ navigation and reveal that anosmic shearwaters are able to home eventually by following coastal features. PMID:26548946

Placement of iliosacral screws using 3D image-guided (O-Arm) technology and Stealth Navigation: comparison with traditional fluoroscopy.

PubMed

Theologis, A A; Burch, S; Pekmezci, M

2016-05-01

We compared the accuracy, operating time and radiation exposure of the introduction of iliosacral screws using O-arm/Stealth Navigation and standard fluoroscopy. Iliosacral screws were introduced percutaneously into the first sacral body (S1) of ten human cadavers, four men and six women. The mean age was 77 years (58 to 85). Screws were introduced using a standard technique into the left side of S1 using C-Arm fluoroscopy and then into the right side using O-Arm/Stealth Navigation. The radiation was measured on the surgeon by dosimeters placed under a lead thyroid shield and apron, on a finger, a hat and on the cadavers. There were no neuroforaminal breaches in either group. The set-up time for the O-Arm was significantly longer than for the C-Arm, while total time for placement of the screws was significantly shorter for the O-Arm than for the C-Arm (p = 0.001). The mean absorbed radiation dose during fluoroscopy was 1063 mRad (432.5 mRad to 4150 mRad). No radiation was detected on the surgeon during fluoroscopy, or when he left the room during the use of the O-Arm. The mean radiation detected on the cadavers was significantly higher in the O-Arm group (2710 mRem standard deviation (sd) 1922) than during fluoroscopy (11.9 mRem sd 14.8) (p < 0.01). O-Arm/Stealth Navigation allows for faster percutaneous placement of iliosacral screws in a radiation-free environment for surgeons, albeit with the same accuracy and significantly more radiation exposure to cadavers, when compared with standard fluoroscopy. Placement of iliosacral screws with O-Arm/Stealth Navigation can be performed safely and effectively. Cite this article: Bone Joint J 2016;98-B:696-702. ©2016 The British Editorial Society of Bone & Joint Surgery.

Antisense Oligonucleotide-mediated Exon Skipping as a Systemic Therapeutic Approach for Recessive Dystrophic Epidermolysis Bullosa.

PubMed

Bremer, Jeroen; Bornert, Olivier; Nyström, Alexander; Gostynski, Antoni; Jonkman, Marcel F; Aartsma-Rus, Annemieke; van den Akker, Peter C; Pasmooij, Anna Mg

2016-10-18

The "generalized severe" form of recessive dystrophic epidermolysis bullosa (RDEB-gen sev) is caused by bi-allelic null mutations in COL7A1, encoding type VII collagen. The absence of type VII collagen leads to blistering of the skin and mucous membranes upon the slightest trauma. Because most patients carry exonic point mutations or small insertions/deletions, most exons of COL7A1 are in-frame, and low levels of type VII collagen already drastically improve the disease phenotype, this gene seems a perfect candidate for antisense oligonucleotide (AON)-mediated exon skipping. In this study, we examined the feasibility of AON-mediated exon skipping in vitro in primary cultured keratinocytes and fibroblasts, and systemically in vivo using a human skin-graft mouse model. We show that treatment with AONs designed against exon 105 leads to in-frame exon 105 skipping at the RNA level and restores type VII collagen protein production in vitro. Moreover, we demonstrate that systemic delivery in vivo induces de novo expression of type VII collagen in skin grafts generated from patient cells. Our data demonstrate strong proof-of-concept for AON-mediated exon skipping as a systemic therapeutic strategy for RDEB.

Skimming and Skipping Stones

ERIC Educational Resources Information Center

Humble, Steve

2007-01-01

This article presents an example of skimming and skipping stone motion in mathematical terms available to students studying A-level mathematics. The theory developed in the article postulates a possible mathematical model that is verified by experimental results.

What is the Best Way to Treat Diarrhea?

MedlinePlus

... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... starts making normal amounts of urine again. Reminder–Do's and Don'ts Do Watch for signs of ...

Safety for Your Child: Birth to 6 Months

MedlinePlus

... mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn ... seat, will behave better, so you can pay attention to your driving. Make your newborn’s first ride ...

Catalyst-free synthesis of skipped dienes from phosphorus ylides, allylic carbonates, and aldehydes via a one-pot SN2' allylation-Wittig strategy.

PubMed

Xu, Silong; Zhu, Shaoying; Shang, Jian; Zhang, Junjie; Tang, Yuhai; Dou, Jianwei

2014-04-18

A catalyst-free allylic alkylation of stabilized phosphorus ylides with allylic carbonates via a regioselective SN2' process is presented. Subsequent one-pot Wittig reaction with both aliphatic and aromatic aldehydes as well as ketenes provides structurally diverse skipped dienes (1,4-dienes) in generally high yields and moderate to excellent stereoselectivity with flexible substituent patterns. This one-pot SN2' allylation-Wittig strategy constitutes a convenient and efficient synthetic method for highly functionalized skipped dienes from readily available starting materials.

In Silico Screening Based on Predictive Algorithms as a Design Tool for Exon Skipping Oligonucleotides in Duchenne Muscular Dystrophy

PubMed Central

Echigoya, Yusuke; Mouly, Vincent; Garcia, Luis; Yokota, Toshifumi; Duddy, William

2015-01-01

The use of antisense ‘splice-switching’ oligonucleotides to induce exon skipping represents a potential therapeutic approach to various human genetic diseases. It has achieved greatest maturity in exon skipping of the dystrophin transcript in Duchenne muscular dystrophy (DMD), for which several clinical trials are completed or ongoing, and a large body of data exists describing tested oligonucleotides and their efficacy. The rational design of an exon skipping oligonucleotide involves the choice of an antisense sequence, usually between 15 and 32 nucleotides, targeting the exon that is to be skipped. Although parameters describing the target site can be computationally estimated and several have been identified to correlate with efficacy, methods to predict efficacy are limited. Here, an in silico pre-screening approach is proposed, based on predictive statistical modelling. Previous DMD data were compiled together and, for each oligonucleotide, some 60 descriptors were considered. Statistical modelling approaches were applied to derive algorithms that predict exon skipping for a given target site. We confirmed (1) the binding energetics of the oligonucleotide to the RNA, and (2) the distance in bases of the target site from the splice acceptor site, as the two most predictive parameters, and we included these and several other parameters (while discounting many) into an in silico screening process, based on their capacity to predict high or low efficacy in either phosphorodiamidate morpholino oligomers (89% correctly predicted) and/or 2’O Methyl RNA oligonucleotides (76% correctly predicted). Predictions correlated strongly with in vitro testing for sixteen de novo PMO sequences targeting various positions on DMD exons 44 (R2 0.89) and 53 (R2 0.89), one of which represents a potential novel candidate for clinical trials. We provide these algorithms together with a computational tool that facilitates screening to predict exon skipping efficacy at each position of a target exon. PMID:25816009

About the Subdivision of Indoor Spaces in Indoorgml

NASA Astrophysics Data System (ADS)

Diakité, A. A.; Zlatanova, S.; Li, K.-J.

2017-10-01

Boosted by the dynamic urbanization of cities, indoor environments are getting more and more complex in order to be able to host people properly. While most of our time is spent inside buildings, the need of GIS tools to assist our daily activities that can become tedious, such as indoor navigation or facility management, became more and more urgent. In that perspective, the IndoorGML standard is aiming to address the gaps left by other standards regarding the spatial modelling for indoor navigation. It includes several concepts such as the organization of the spaces into cells along with their network representation and the possibility to represent multiple connected layers. However, being at its first stage, several concepts of the standard could be improved. One of these is the cell subspacing that is not enough discussed in the current version of the standard. In this paper, we explore all the aspects involved in the subdivision process, from the identification of the navigable and non-navigable space cells to the generation of a navigation graph. We propose several criteria on which the indoor sub-spacing can rely to be automatically performed and and illustrate them on a 3D indoor model.

Electromagnetic tracking of flexible robotic catheters enables "assisted navigation" and brings automation to endovascular navigation in an in vitro study.

PubMed

Schwein, Adeline; Kramer, Benjamin; Chinnadurai, Ponraj; Virmani, Neha; Walker, Sean; O'Malley, Marcia; Lumsden, Alan B; Bismuth, Jean

2018-04-01

Combining three-dimensional (3D) catheter control with electromagnetic (EM) tracking-based navigation significantly reduced fluoroscopy time and improved robotic catheter movement quality in a previous in vitro pilot study. The aim of this study was to expound on previous results and to expand the value of EM tracking with a novel feature, assistednavigation, allowing automatic catheter orientation and semiautomatic vessel cannulation. Eighteen users navigated a robotic catheter in an aortic aneurysm phantom using an EM guidewire and a modified 9F robotic catheter with EM sensors at the tip of both leader and sheath. All users cannulated two targets, the left renal artery and posterior gate, using four visualization modes: (1) Standard fluoroscopy (control). (2) 2D biplane fluoroscopy showing real-time virtual catheter localization and orientation from EM tracking. (3) 2D biplane fluoroscopy with novel EM assisted navigation allowing the user to define the target vessel. The robotic catheter orients itself automatically toward the target; the user then only needs to advance the guidewire following this predefined optimized path to catheterize the vessel. Then, while advancing the catheter over the wire, the assisted navigation automatically modifies catheter bending and rotation in order to ensure smooth progression, avoiding loss of wire access. (4) Virtual 3D representation of the phantom showing real-time virtual catheter localization and orientation. Standard fluoroscopy was always available; cannulation and fluoroscopy times were noted for every mode and target cannulation. Quality of catheter movement was assessed by measuring the number of submovements of the catheter using the 3D coordinates of the EM sensors. A t-test was used to compare the standard fluoroscopy mode against EM tracking modes. EM tracking significantly reduced the mean fluoroscopy time (P < .001) and the number of submovements (P < .02) for both cannulation tasks. For the posterior gate, mean cannulation time was also significantly reduced when using EM tracking (P < .001). The use of novel EM assisted navigation feature (mode 3) showed further reduced cannulation time for the posterior gate (P = .002) and improved quality of catheter movement for the left renal artery cannulation (P = .021). These results confirmed the findings of a prior study that highlighted the value of combining 3D robotic catheter control and 3D navigation to improve safety and efficiency of endovascular procedures. The novel EM assisted navigation feature augments the robotic master/slave concept with automated catheter orientation toward the target and shows promising results in reducing procedure time and improving catheter motion quality. Copyright © 2017 Society for Vascular Surgery. Published by Elsevier Inc. All rights reserved.

Toward brain-computer interface based wheelchair control utilizing tactually-evoked event-related potentials

PubMed Central

2014-01-01

Background People with severe disabilities, e.g. due to neurodegenerative disease, depend on technology that allows for accurate wheelchair control. For those who cannot operate a wheelchair with a joystick, brain-computer interfaces (BCI) may offer a valuable option. Technology depending on visual or auditory input may not be feasible as these modalities are dedicated to processing of environmental stimuli (e.g. recognition of obstacles, ambient noise). Herein we thus validated the feasibility of a BCI based on tactually-evoked event-related potentials (ERP) for wheelchair control. Furthermore, we investigated use of a dynamic stopping method to improve speed of the tactile BCI system. Methods Positions of four tactile stimulators represented navigation directions (left thigh: move left; right thigh: move right; abdomen: move forward; lower neck: move backward) and N = 15 participants delivered navigation commands by focusing their attention on the desired tactile stimulus in an oddball-paradigm. Results Participants navigated a virtual wheelchair through a building and eleven participants successfully completed the task of reaching 4 checkpoints in the building. The virtual wheelchair was equipped with simulated shared-control sensors (collision avoidance), yet these sensors were rarely needed. Conclusion We conclude that most participants achieved tactile ERP-BCI control sufficient to reliably operate a wheelchair and dynamic stopping was of high value for tactile ERP classification. Finally, this paper discusses feasibility of tactile ERPs for BCI based wheelchair control. PMID:24428900

Choledochoscopic Examination of a 3-Dimensional Printing Model Using Augmented Reality Techniques: A Preliminary Proof of Concept Study.

PubMed

Tang, Rui; Ma, Longfei; Li, Ang; Yu, Lihan; Rong, Zhixia; Zhang, Xinjing; Xiang, Canhong; Liao, Hongen; Dong, Jiahong

2018-06-01

We applied augmented reality (AR) techniques to flexible choledochoscopy examinations. Enhanced computed tomography data of a patient with intrahepatic and extrahepatic biliary duct dilatation were collected to generate a hollow, 3-dimensional (3D) model of the biliary tree by 3D printing. The 3D printed model was placed in an opaque box. An electromagnetic (EM) sensor was internally installed in the choledochoscope instrument channel for tracking its movements through the passages of the 3D printed model, and an AR navigation platform was built using image overlay display. The porta hepatis was used as the reference marker with rigid image registration. The trajectories of the choledochoscope and the EM sensor were observed and recorded using the operator interface of the choledochoscope. Training choledochoscopy was performed on the 3D printed model. The choledochoscope was guided into the left and right hepatic ducts, the right anterior hepatic duct, the bile ducts of segment 8, the hepatic duct in subsegment 8, the right posterior hepatic duct, and the left and the right bile ducts of the caudate lobe. Although stability in tracking was less than ideal, the virtual choledochoscope images and EM sensor tracking were effective for navigation. AR techniques can be used to assist navigation in choledochoscopy examinations in bile duct models. Further research is needed to determine its benefits in clinical settings.

In vivo effects on intron retention and exon skipping by the U2AF large subunit and SF1/BBP in the nematode Caenorhabditis elegans

PubMed Central

Ma, Long; Tan, Zhiping; Teng, Yanling; Hoersch, Sebastian; Horvitz, H. Robert

2011-01-01

The in vivo analysis of the roles of splicing factors in regulating alternative splicing in animals remains a challenge. Using a microarray-based screen, we identified a Caenorhabditis elegans gene, tos-1, that exhibited three of the four major types of alternative splicing: intron retention, exon skipping, and, in the presence of U2AF large subunit mutations, the use of alternative 3′ splice sites. Mutations in the splicing factors U2AF large subunit and SF1/BBP altered the splicing of tos-1. 3′ splice sites of the retained intron or before the skipped exon regulate the splicing pattern of tos-1. Our study provides in vivo evidence that intron retention and exon skipping can be regulated largely by the identities of 3′ splice sites. PMID:22033331

Power inverter implementing phase skipping control

DOEpatents

Somani, Utsav; Amirahmadi, Ahmadreza; Jourdan, Charles; Batarseh, Issa

2016-10-18

A power inverter includes a DC/AC inverter having first, second and third phase circuitry coupled to receive power from a power source. A controller is coupled to a driver for each of the first, second and third phase circuitry (control input drivers). The controller includes an associated memory storing a phase skipping control algorithm, wherein the controller is coupled to receive updating information including a power level generated by the power source. The drivers are coupled to control inputs of the first, second and third phase circuitry, where the drivers are configured for receiving phase skipping control signals from the controller and outputting mode selection signals configured to dynamically select an operating mode for the DC/AC inverter from a Normal Control operation and a Phase Skipping Control operation which have different power injection patterns through the first, second and third phase circuitry depending upon the power level.

Along Endurance Crater's Inner Wall (Left Eye)

NASA Technical Reports Server (NTRS)

2004-01-01

This view from the base of 'Burns Cliff' in the inner wall of 'Endurance Crater' combines several frames taken by Opportunity's navigation camera during the NASA rover's 280th martian day (Nov. 6, 2004). It is the left-eye member of a stereo pair, presented in a cylindrical-perspective projection with geometric seam correction. The cliff dominates the left and right portions of the image, while the central portion looks down into the crater. The 'U' shape of this mosaic results from the rover's tilt of about 30 degrees on the sloped ground below the cliff. Rover wheel tracks in the left half of the image show some of the slippage the rover experienced in making its way to this point. The site from which this image was taken has been designated as Opportunity's Site 37.

The Lived Transitions of Senior Student Affairs Leaders

ERIC Educational Resources Information Center

Kuk, Linda; King, Margaret; Forrest, Cynthia

2012-01-01

This study of student affairs leaders who have left senior roles used an interpretive qualitative approach to explore these lived transitional experiences. The context of the departure, its immediate impact, the ensuing emotions, the change navigation process, and the envisioned future appear to shape the departing leaders' perceptions of the…

75 FR 4284 - Triticonazole; Pesticide Tolerances

Federal Register 2010, 2011, 2012, 2013, 2014

2010-01-27

... harmonized test guidelines referenced in this document electronically, please go to http://www.epa.gov/oppts and select ``Test Methods & Guidelines'' on the left-side navigation menu. C. Can I File an Objection..., P.O. Box 13528, Research Triangle Park, NC 27709-3528. The petition requested that 40 CFR 180.583 be...

33 CFR 165.810 - Mississippi River, LA-regulated navigation area.

Code of Federal Regulations, 2010 CFR

2010-07-01

.... (c) Movement of vessels in vicinity of Algiers Point, New Orleans Harbor: (1) Control lights. When... green lights designated and located as follows: Governor Nicholls Light located on the left descending bank on the wharf shed at the upstream end of Esplanade Avenue Wharf, New Orleans, approximately 94.3...

Teacher Agency and Education Policy

ERIC Educational Resources Information Center

Coffman, Ann Nutter

2015-01-01

New teachers are often left to their own devices to navigate the policy world without necessarily having the strategies and tools to advocate for themselves or more experienced teachers to help guide them. More senior teachers may report a feeling of helplessness as curriculum and policy changes occur around them without necessarily considering…

A Comparison of Two Skip Entry Guidance Algorithms

NASA Technical Reports Server (NTRS)

Rea, Jeremy R.; Putnam, Zachary R.

2007-01-01

The Orion capsule vehicle will have a Lift-to-Drag ratio (L/D) of 0.3-0.35. For an Apollo-like direct entry into the Earth's atmosphere from a lunar return trajectory, this L/D will give the vehicle a maximum range of about 2500 nm and a maximum crossrange of 216 nm. In order to y longer ranges, the vehicle lift must be used to loft the trajectory such that the aerodynamic forces are decreased. A Skip-Trajectory results if the vehicle leaves the sensible atmosphere and a second entry occurs downrange of the atmospheric exit point. The Orion capsule is required to have landing site access (either on land or in water) inside the Continental United States (CONUS) for lunar returns anytime during the lunar month. This requirement means the vehicle must be capable of flying ranges of at least 5500 nm. For the L/D of the vehicle, this is only possible with the use of a guided Skip-Trajectory. A skip entry guidance algorithm is necessary to achieve this requirement. Two skip entry guidance algorithms have been developed: the Numerical Skip Entry Guidance (NSEG) algorithm was developed at NASA/JSC and PredGuid was developed at Draper Laboratory. A comparison of these two algorithms will be presented in this paper. Each algorithm has been implemented in a high-fidelity, 6 degree-of-freedom simulation called the Advanced NASA Technology Architecture for Exploration Studies (ANTARES). NASA and Draper engineers have completed several monte carlo analyses in order to compare the performance of each algorithm in various stress states. Each algorithm has been tested for entry-to-target ranges to include direct entries and skip entries of varying length. Dispersions have been included on the initial entry interface state, vehicle mass properties, vehicle aerodynamics, atmosphere, and Reaction Control System (RCS). Performance criteria include miss distance to the target, RCS fuel usage, maximum g-loads and heat rates for the first and second entry, total heat load, and control system saturation. The comparison of the performance criteria has led to a down select and guidance merger that will take the best ideas from each algorithm to create one skip entry guidance algorithm for the Orion vehicle.

Neuronavigation Based on Track Density Image Extracted from Deterministic High-Definition Fiber Tractography.

PubMed

Wei, Peng-Hu; Cong, Fei; Chen, Ge; Li, Ming-Chu; Yu, Xin-Guang; Bao, Yu-Hai

2017-02-01

Diffusion tensor imaging-based navigation is unable to resolve crossing fibers or to determine with accuracy the fanning, origin, and termination of fibers. It is important to improve the accuracy of localizing white matter fibers for improved surgical approaches. We propose a solution to this problem using navigation based on track density imaging extracted from high-definition fiber tractography (HDFT). A 28-year-old asymptomatic female patient with a left-lateral ventricle meningioma was enrolled in the present study. Language and visual tests, magnetic resonance imaging findings, both preoperative and postoperative HDFT, and the intraoperative navigation and surgery process are presented. Track density images were extracted from tracts derived using full q-space (514 directions) diffusion spectrum imaging (DSI) and integrated into a neuronavigation system. Navigation accuracy was verified via intraoperative records and postoperative DSI tractography, as well as a functional examination. DSI successfully represented the shape and range of the Meyer loop and arcuate fasciculus. Extracted track density images from the DSI were successfully integrated into the navigation system. The relationship between the operation channel and surrounding tracts was consistent with the postoperative findings, and the patient was functionally intact after the surgery. DSI-based TDI navigation allows for the visualization of anatomic features such as fanning and angling and helps to identify the range of a given tract. Moreover, our results show that our HDFT navigation method is a promising technique that preserves neural function. Copyright © 2016 Elsevier Inc. All rights reserved.

The time-course of lexical activation in Japanese morphographic word recognition: evidence for a character-driven processing model.

PubMed

Miwa, Koji; Libben, Gary; Dijkstra, Ton; Baayen, Harald

2014-01-01

This lexical decision study with eye tracking of Japanese two-kanji-character words investigated the order in which a whole two-character word and its morphographic constituents are activated in the course of lexical access, the relative contributions of the left and the right characters in lexical decision, the depth to which semantic radicals are processed, and how nonlinguistic factors affect lexical processes. Mixed-effects regression analyses of response times and subgaze durations (i.e., first-pass fixation time spent on each of the two characters) revealed joint contributions of morphographic units at all levels of the linguistic structure with the magnitude and the direction of the lexical effects modulated by readers' locus of attention in a left-to-right preferred processing path. During the early time frame, character effects were larger in magnitude and more robust than radical and whole-word effects, regardless of the font size and the type of nonwords. Extending previous radical-based and character-based models, we propose a task/decision-sensitive character-driven processing model with a level-skipping assumption: Connections from the feature level bypass the lower radical level and link up directly to the higher character level.

Do Vaccines Cause Autism? Is it OK to Skip Certain Vaccines? Get the facts

MedlinePlus

... Lifestyle Infant and toddler health Do vaccines cause autism? Is it OK to skip certain vaccines? Get ... their potentially serious complications. Vaccines do not cause autism. Despite much controversy on the topic, researchers haven' ...

Atmospheric guidance law for planar skip trajectories

NASA Technical Reports Server (NTRS)

Mease, K. D.; Mccreary, F. A.

1985-01-01

The applicability of an approximate, closed-form, analytical solution to the equations of motion, as a basis for a deterministic guidance law for controlling the in-plane motion during a skip trajectory, is investigated. The derivation of the solution by the method of matched asymptotic expansions is discussed. Specific issues that arise in the application of the solution to skip trajectories are addressed. Based on the solution, an explicit formula for the approximate energy loss due to an atmospheric pass is derived. A guidance strategy is proposed that illustrates the use of the approximate solution. A numerical example shows encouraging performance.

Hemispheric language dominance measured by repetitive navigated transcranial magnetic stimulation and postoperative course of language function in brain tumor patients.

PubMed

Ille, Sebastian; Kulchytska, Nataliia; Sollmann, Nico; Wittig, Regina; Beurskens, Eva; Butenschoen, Vicki M; Ringel, Florian; Vajkoczy, Peter; Meyer, Bernhard; Picht, Thomas; Krieg, Sandro M

2016-10-01

The resection of left-sided perisylvian brain lesions harbors the risk of postoperative aphasia. Because it is known that language function can shift between hemispheres in brain tumor patients, the preoperative knowledge of the patient's language dominance could be helpful. We therefore investigated the hemispheric language dominance by repetitive navigated transcranial magnetic stimulation (rTMS) and surgery-related deficits of language function. We pooled the bicentric language mapping data of 80 patients undergoing the resection of left-sided perisylvian brain lesions in our two university neurosurgical departments. We calculated error rates (ERs; ER = errors per stimulations) for both hemispheres and defined the hemispheric dominance ratio (HDR) as the quotient of the left- and right-sided ER (HDR >1= left dominant; HDR <1= right dominant). The course of the patient's language function was evaluated and correlated with the preoperative HDR. Only three of 80 patients (4%) presented with permanent surgery-related aphasia and 24 patients (30%) with transient surgery-related aphasia. The mean HDR (± standard deviation) of patients with new aphasia after five days was significantly higher (1.68±1.07) than the HDR of patients with no new language deficit (1.37±1.08) (p=0.0482). With a predefined cut-off value of 0.5 for HDR, we achieved a sensitivity for predicting new aphasia of 100%. A higher preoperative HDR significantly correlates with an increased risk for transient aphasia. Moreover, the intensive preoperative workup in this study led to a considerably low rate of permanent aphasia. Copyright © 2016 Elsevier Ltd. All rights reserved.

New Record Five-Wheel Drive, Spirit's Sol 1856 (Stereo)

NASA Technical Reports Server (NTRS)

2009-01-01

[figure removed for brevity, see original site] Left-eye view of a color stereo pair for PIA11962 [figure removed for brevity, see original site] Right-eye view of a color stereo pair for PIA11962

NASA's Mars Exploration Rover Spirit used its navigation camera to take the images that have been combined into this stereo, 180-degree view of the rover's surroundings during the 1,856th Martian day, or sol, of Spirit's surface mission (March 23, 2009). The center of the view is toward the west-southwest.

This view combines images from the left-eye and right-eye sides of the navigation camera. It appears three-dimensional when viewed through red-blue glasses with the red lens on the left.

The rover had driven 25.82 meters (84.7 feet) west-northwestward earlier on Sol 1856. This is the longest drive on Mars so far by a rover using only five wheels. Spirit lost the use of its right-front wheel in March 2006. Before Sol 1856, the farthest Spirit had covered in a single sol's five-wheel drive was 24.83 meters (81.5 feet), on Sol 1363 (Nov. 3, 2007).

The Sol 1856 drive made progress on a route planned for taking Spirit around the western side of the low plateau called 'Home Plate.' A portion of the northwestern edge of Home Plate is prominent in the left quarter of this image, toward the south.

This view is presented as a cylindrical-perspective projection with geometric seam correction.

A Long Way From Home

NASA Technical Reports Server (NTRS)

2004-01-01

This pair of pieced-together images was taken by the Mars Exploration Rover Spirit's left navigation camera looking aft on March 6, 2004. It reveals the long and rocky path of nearly 240 meters (787 feet) that Spirit had traveled since safely arriving at Gusev Crater on Jan. 3, 2004.

The lander can still be seen in the distance, but will never be 'home' again for the journeying rover. This image is also a tribute to the effectiveness of the autonomous navigation system that the rovers use during parts of their martian drives. Instead of driving directly through the 'hollow' seen in the middle right of the image, the autonomous navigation system guided Spirit around the high ridge bordering the hollow.

In the two days after these images were taken, Spirit has traveled roughly 60 meters (197 feet) farther toward its destination at the crater nicknamed 'Bonneville'.

7 CFR 42.123 - Flow diagram for skip lot sampling and inspection.

Code of Federal Regulations, 2010 CFR

2010-01-01

....123 Section 42.123 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE COMMODITY STANDARDS AND STANDARD CONTAINER REGULATIONS STANDARDS FOR CONDITION OF FOOD CONTAINERS Skip Lot Sampling and Inspection...

75 FR 32989 - Proposed Collection; Comment Request for Form 706

Federal Register 2010, 2011, 2012, 2013, 2014

2010-06-10

... [email protected] . SUPPLEMENTARY INFORMATION: Title: United States Estate (and Generation-Skipping... proposed and/or continuing information collections, as required by the Paperwork Reduction Act of 1995... 706, United States Estate (and Generation-Skipping Transfer) Tax Return. DATES: Written comments...

Language function distribution in left-handers: A navigated transcranial magnetic stimulation study.

PubMed

Tussis, Lorena; Sollmann, Nico; Boeckh-Behrens, Tobias; Meyer, Bernhard; Krieg, Sandro M

2016-02-01

Recent studies suggest that in left-handers, the right hemisphere (RH) is more involved in language function when compared to right-handed subjects. Since data on lesion-based approaches is lacking, we aimed to investigate language distribution of left-handers by repetitive navigated transcranial magnetic stimulation (rTMS). Thus, rTMS was applied to the left hemisphere (LH) and RH in 15 healthy left-handers during an object-naming task, and resulting naming errors were categorized. Then, we calculated error rates (ERs=number of errors per number of stimulations) for both hemispheres separately and defined a laterality score as the quotient of the LH ER - RH ER through the LH ER + RH ER (abbreviated as (L-R)/(L+R)). In this context, (L-R)/(L+R)>0 indicates that the LH is dominant, whereas (L-R)/(L+R)<0 shows that the RH is dominant. No significant difference in ERs was found between hemispheres (all errors: mean LH 18.0±11.7%, mean RH 18.1±12.2%, p=0.94; all errors without hesitation: mean LH 12.4±9.8%, mean RH 12.9±10.0%, p=0.65; no responses: mean LH 9.3±9.2%, mean RH 11.5±10.3%, p=0.84). However, a significant difference between the results of (L-R)/(L+R) of left-handers and right-handers (source data of another study) for all errors (mean 0.01±0.14 vs. 0.19±0.20, p=0.0019) and all errors without hesitation (mean -0.02±0.20 vs. 0.19±0.28, p=0.0051) was revealed, whereas the comparison for no responses did not show a significant difference (mean: -0.004±0.27 vs. 0.09±0.44, p=0.64). Accordingly, left-handers present a comparatively equal language distribution across both hemispheres with language dominance being nearly equally distributed between hemispheres in contrast to right-handers. Copyright © 2016 Elsevier Ltd. All rights reserved.

Longitudinal effect of eteplirsen versus historical control on ambulation in Duchenne muscular dystrophy

PubMed Central

Goemans, Nathalie; Lowes, Linda P.; Alfano, Lindsay N.; Berry, Katherine; Shao, James; Kaye, Edward M.; Mercuri, Eugenio; Hamid, Hoda Abdel; Byrne, Barry J.; Connolly, Anne M.; Dracker, Robert A.; Matthew Frank, L.; Heydemann, Peter T.; O'Brien, Kevin C.; Sparks, Susan E.; Specht, Linda A.; Rodino‐Klapac, Louise; Sahenk, Zarife; Al‐Zaidy, Samiah; Cripe, Linda H.; Lewis, Sarah; M, Pane; E, Mazzone; S, Messina; GL, Vita; Bertini, D Amico A; Casimiro, Berardinelli A; Y, Torrente; F, Magri; GP, Comi; G, Baranello; T, Mongini; A, Pini; R, Battini; E, Pegoraro; C, Bruno; L, Politano; S, Previtali

2016-01-01

Objective To continue evaluation of the long‐term efficacy and safety of eteplirsen, a phosphorodiamidate morpholino oligomer designed to skip DMD exon 51 in patients with Duchenne muscular dystrophy (DMD). Three‐year progression of eteplirsen‐treated patients was compared to matched historical controls (HC). Methods Ambulatory DMD patients who were ≥7 years old and amenable to exon 51 skipping were randomized to eteplirsen (30/50mg/kg) or placebo for 24 weeks. Thereafter, all received eteplirsen on an open‐label basis. The primary functional assessment in this study was the 6‐Minute Walk Test (6MWT). Respiratory muscle function was assessed by pulmonary function testing (PFT). Longitudinal natural history data were used for comparative analysis of 6MWT performance at baseline and months 12, 24, and 36. Patients were matched to the eteplirsen group based on age, corticosteroid use, and genotype. Results At 36 months, eteplirsen‐treated patients (n = 12) demonstrated a statistically significant advantage of 151m (p < 0.01) on 6MWT and experienced a lower incidence of loss of ambulation in comparison to matched HC (n = 13) amenable to exon 51 skipping. PFT results remained relatively stable in eteplirsen‐treated patients. Eteplirsen was well tolerated. Analysis of HC confirmed the previously observed change in disease trajectory at age 7 years, and more severe progression was observed in patients with mutations amenable to exon skipping than in those not amenable. The subset of patients amenable to exon 51 skipping showed a more severe disease course than those amenable to any exon skipping. Interpretation Over 3 years of follow‐up, eteplirsen‐treated patients showed a slower rate of decline in ambulation assessed by 6MWT compared to untreated matched HC. Ann Neurol 2016;79:257–271 PMID:26573217

Sexual divergence in microtubule function: the novel intranasal microtubule targeting SKIP normalizes axonal transport and enhances memory.

PubMed

Amram, N; Hacohen-Kleiman, G; Sragovich, S; Malishkevich, A; Katz, J; Touloumi, O; Lagoudaki, R; Grigoriadis, N C; Giladi, E; Yeheskel, A; Pasmanik-Chor, M; Jouroukhin, Y; Gozes, I

2016-10-01

Activity-dependent neuroprotective protein (ADNP), essential for brain formation, is a frequent autism spectrum disorder (ASD)-mutated gene. ADNP associates with microtubule end-binding proteins (EBs) through its SxIP motif, to regulate dendritic spine formation and brain plasticity. Here, we reveal SKIP, a novel four-amino-acid peptide representing an EB-binding site, as a replacement therapy in an outbred Adnp-deficient mouse model. We discovered, for the first time, axonal transport deficits in Adnp(+/-) mice (measured by manganese-enhanced magnetic resonance imaging), with significant male-female differences. RNA sequencing evaluations showed major age, sex and genotype differences. Function enrichment and focus on major gene expression changes further implicated channel/transporter function and the cytoskeleton. In particular, a significant maturation change (1 month-five months) was observed in beta1 tubulin (Tubb1) mRNA, only in Adnp(+/+) males, and sex-dependent increase in calcium channel mRNA (Cacna1e) in Adnp(+/+) males compared with females. At the protein level, the Adnp(+/-) mice exhibited impaired hippocampal expression of the calcium channel (voltage-dependent calcium channel, Cacnb1) as well as other key ASD-linked genes including the serotonin transporter (Slc6a4), and the autophagy regulator, BECN1 (Beclin1), in a sex-dependent manner. Intranasal SKIP treatment normalized social memory in 8- to 9-month-old Adnp(+/-)-treated mice to placebo-control levels, while protecting axonal transport and ameliorating changes in ASD-like gene expression. The control, all d-amino analog D-SKIP, did not mimic SKIP activity. SKIP presents a novel prototype for potential ASD drug development, a prevalent unmet medical need.

Do older adults use the Method of Loci? Results from the ACTIVE Study

PubMed Central

Gross, Alden L.; Brandt, Jason; Bandeen-Roche, Karen; Carlson, Michelle C.; Stuart, Elizabeth A.; Marsiske, Michael; Rebok, George W.

2013-01-01

Background The method of loci (MoL) is a complex visuospatial mnemonic strategy. Previous research suggests older adults could potentially benefit from using the MoL, but that it is too attentionally demanding for them to use in practice. We evaluated the hypotheses that training can increase the use of MoL, and that MoL use is associated with better memory. Methods We analyzed skip patterns on response forms for the Auditory Verbal Learning Test (AVLT) in the Advanced Cognitive Training for Independent and Vital Elderly (ACTIVE, n=1,401) trial using 5 years of longitudinal follow-up. Results At baseline, 2% of participants skipped spaces. Fewer than 2% of control participants skipped spaces at any visit across 5 years, but 25% of memory-trained participants, taught the MoL, did so. Participants who skipped spaces used more serial clustering, a hallmark of the MoL (p<0.001). Trained participants who skipped spaces showed greater memory improvement after training than memory-trained participants who did not skip spaces (Cohen's d=0.84, P=0.007), and did not differ in the subsequent rate of long-term memory decline through up to 5 years of follow-up. Conclusion Despite being attentionally demanding, this study suggests that after training, the MoL is used by up to 25% of older adults, and that its use is associated with immediate memory improvement that was sustained through the course of follow-up. Findings are consistent with the notion that older adults balance complexity with novelty in strategy selection, and that changes in strategies used following memory training result in observable qualitative and quantitative differences in memory performance. PMID:24625044

DOE Office of Scientific and Technical Information (OSTI.GOV)

Suzuki, Masatoshi, E-mail: msuzuki@nagasaki-u.ac.jp; Yamauchi, Motohiro; Oka, Yasuyoshi

Purpose: Senescence-like growth arrest in human solid carcinomas is now recognized as the major outcome of radiotherapy. This study was designed to analyze cell cycle during the process of senescence-like growth arrest in mammary carcinoma cells exposed to X-rays. Methods and Materials: Fluorescent ubiquitination-based cell cycle indicators were introduced into the human mammary carcinoma cell line MCF-7. Cell cycle was sequentially monitored by live-cell imaging for up to 5 days after exposure to 10 Gy of X-rays. Results: Live-cell imaging revealed that cell cycle transition from G2 to G1 phase without mitosis, so-called mitotic skipping, was observed in 17.1% andmore » 69.8% of G1- and G2-irradiated cells, respectively. Entry to G1 phase was confirmed by the nuclear accumulation of mKO{sub 2}-hCdt1 as well as cyclin E, which was inversely correlated to the accumulation of G2-specific markers such as mAG-hGeminin and CENP-F. More than 90% of cells skipping mitosis were persistently arrested in G1 phase and showed positive staining for the senescent biochemical marker, which is senescence-associated ss-galactosidase, indicating induction of senescence-like growth arrest accompanied by mitotic skipping. While G2 irradiation with higher doses of X-rays induced mitotic skipping in approximately 80% of cells, transduction of short hairpin RNA (shRNA) for p53 significantly suppressed mitotic skipping, suggesting that ionizing radiation-induced mitotic skipping is associated with p53 function. Conclusions: The present study found the pathway of senescence-like growth arrest in G1 phase without mitotic entry following G2-irradiation.« less

NDBC Tropical Atmosphere Ocean (TAO)

Science.gov Websites

to go to the NWS homepage Left navigation bar Home News Organization Search NDBC web site search TAO Tour FAQ NDBC Home Contact Us USA.gov is the U.S. government's official web portal to all federal , state and local government web resources and services. Recent Data Observations Search TAO DART Tropical

National Centers for Environmental Prediction

Science.gov Websites

Weather Service NWS logo - Click to go to the NWS homepage EMC Logo Navigation Bar Left Cap Home News TRAINING AND DOCUMENTATION MATERIALS: * WCOSS Transition Request Form (10/11/12) * WCOSS User Account Request Form has been added under 'Training and Documentation Materials' and will be used by all

77 FR 59082 - Drawbridge Operation Regulation; Atlantic Intracoastal Waterway (AIWW), Elizabeth River, Southern...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-09-26

... Chesapeake, VA. This deviation is necessary to facilitate replacing lift joints on the Norfolk Southern 7... accommodate lift joint replacement. Under the current operating schedule the bridge shall be left in the open.... To facilitate lift joint replacement, the drawbridge will be maintained in the closed-to-navigation...

Navigating the Power Dynamics between Institutions and Their Communities

ERIC Educational Resources Information Center

White, Byron P.

2009-01-01

The author's career experiences--as an impartial observer of community building, as an advocate working from within urban communities, and as a catalyst working from the outside--have given him a unique perspective into the dynamics of institutional/community engagement. "Basically, they have left me with three overriding convictions. First,…

Construction of topological structure of 3D coronary vessels for analysis of catheter navigation in interventional cardiology simulation

NASA Astrophysics Data System (ADS)

Wang, Yaoping; Chui, Cheekong K.; Cai, Yiyu; Mak, KoonHou

1998-06-01

This study presents an approach to build a 3D vascular system of coronary for the development of a virtual cardiology simulator. The 3D model of the coronary arterial tree is reconstructed from the geometric information segmented from the Visible Human data set for physical analysis of catheterization. The process of segmentation is guided by a 3D topologic hierarchy structure of coronary vessels which is obtained from a mechanical model by using Coordinate Measuring Machine (CMM) probing. This mechanical professional model includes all major coronary arterials ranging from right coronary artery to atrioventricular branch and from left main trunk to left anterior descending branch. All those branches are considered as the main operating sites for cardiology catheterization. Along with the primary arterial vasculature and accompanying secondary and tertiary networks obtained from a previous work, a more complete vascular structure can then be built for the simulation of catheterization. A novel method has been developed for real time Finite Element Analysis of catheter navigation based on this featured vasculature of vessels.

Flight demonstrations of curved, descending approaches and automatic landings using time referenced scanning beam guidance

NASA Technical Reports Server (NTRS)

White, W. F. (Compiler)

1978-01-01

The Terminal Configured Vehicle (TCV) program operates a Boeing 737 modified to include a second cockpit and a large amount of experimental navigation, guidance and control equipment for research on advanced avionics systems. Demonstration flights to include curved approaches and automatic landings were tracked by a phototheodolite system. For 50 approaches during the demonstration flights, the following results were obtained: the navigation system, using TRSB guidance, delivered the aircraft onto the 3 nautical mile final approach leg with an average overshoot of 25 feet past centerline, subjet to a 2-sigma dispersion of 90 feet. Lateral tracking data showed a mean error of 4.6 feet left of centerline at the category 1 decision height (200 feet) and 2.7 feet left of centerline at the category 2 decision height (100 feet). These values were subject to a sigma dispersion of about 10 feet. Finally, the glidepath tracking errors were 2.5 feet and 3.0 feet high at the category 1 and 2 decision heights, respectively, with a 2 sigma value of 6 feet.

Time for a Change; Spirit's View on Sol 1843 (Stereo)

NASA Technical Reports Server (NTRS)

2009-01-01

[figure removed for brevity, see original site] Left-eye view of a color stereo pair for PIA11973 [figure removed for brevity, see original site] Right-eye view of a color stereo pair for PIA11973

NASA's Mars Exploration Rover Spirit used its navigation camera to take the images that have been combined into this stereo, full-circle view of the rover's surroundings during the 1,843rd Martian day, or sol, of Spirit's surface mission (March 10, 2009). South is in the middle. North is at both ends.

This view combines images from the left-eye and right-eye sides of the navigation camera. It appears three-dimensional when viewed through red-blue glasses with the red lens on the left.

The rover had driven 36 centimeters downhill earlier on Sol 1854, but had not been able to get free of ruts in soft material that had become an obstacle to getting around the northeastern corner of the low plateau called 'Home Plate.'

The Sol 1854 drive, following two others in the preceding four sols that also achieved little progress in the soft ground, prompted the rover team to switch to a plan of getting around Home Plate counterclockwise, instead of clockwise. The drive direction in subsequent sols was westward past the northern edge of Home Plate.

This view is presented as a cylindrical-perspective projection with geometric seam correction.

Operant conditioning of rat navigation using electrical stimulation for directional cues and rewards.

PubMed

Lee, Maan-Gee; Jun, Gayoung; Choi, Hyo-Soon; Jang, Hwan Soo; Bae, Yong Chul; Suk, Kyoungho; Jang, Il-Sung; Choi, Byung-Ju

2010-07-01

Operant conditioning is often used to train a desired behavior in an animal. The contingency between a specific behavior and a reward is required for successful training. Here, we compared the effectiveness of two different mazes for training turning behaviors in response to directional cues in Sprague-Dawley rats. Forty-three rats were implanted with electrodes into the medial forebrain bundle and the left and right somatosensory cortices for reward and cues. Among them, thirteen rats discriminated between the left and right somatosensory stimulations to obtain rewards. They were trained to learn ipsilateral turning response to the stimulation of the left or right somatosensory cortex in either the T-maze (Group T) or the E| maze (Group W). Performance was measured by the navigation speed in the mazes. Performances of rats in Group T were enhanced faster than those in Group W. A significant correlation between performances during training and performance in final testing was observed in Group T starting with the fifth training session while such a correlation was not observed in Group W until the tenth training session. The training mazes did not however affect the performances in the final test. These results suggest that a simple maze is better than a complicated maze for training animals to learn directions and direct cortical stimulation can be used as a cue for direction training. Copyright (c) 2010 Elsevier B.V. All rights reserved.

The effects of larval habitat quality on Aedes albopictus skip oviposition

USDA-ARS?s Scientific Manuscript database

Aedes albopictus, an invasive mosquito species that transmits disease-causing pathogens, oviposits in containers in resource-limited habitats. To mitigate larval competition, Ae. albopictus females may choose to distribute eggs from a single gonotrophic cycle among multiple containers through skip o...

Development of Exon Skipping Therapies for Duchenne Muscular Dystrophy: A Critical Review and a Perspective on the Outstanding Issues

PubMed Central

Aartsma-Rus, Annemieke; Straub, Volker; Hemmings, Robert; Haas, Manuel; Schlosser-Weber, Gabriele; Stoyanova-Beninska, Violeta; Mercuri, Eugenio; Muntoni, Francesco; Sepodes, Bruno; Vroom, Elizabeth

2017-01-01

Duchenne muscular dystrophy (DMD) is a rare, severe, progressive muscle-wasting disease leading to disability and premature death. Patients lack the muscle membrane-stabilizing protein dystrophin. Antisense oligonucleotide (AON)-mediated exon skipping is a therapeutic approach that aims to induce production of partially functional dystrophins. Recently, an AON targeting exon 51 became the first of its class to be approved by the United States regulators [Food and Drug Administration (FDA)] for the treatment of DMD. A unique aspect of the exon-skipping approach for DMD is that, depending on the size and location of the mutation, different exons need to be skipped. This challenge raises a number of questions regarding the development and regulatory approval of those individual compounds. In this study, we present a perspective on those questions, following a European stakeholder meeting involving academics, regulators, and representatives from industry and patient organizations, and in the light of the most recent scientific and regulatory experience. PMID:28796573

Genetic variation affecting exon skipping contributes to brain structural atrophy in Alzheimer's disease.

PubMed

Lee, Younghee; Han, Seonggyun; Kim, Dongwook; Kim, Dokyoon; Horgousluoglu, Emrin; Risacher, Shannon L; Saykin, Andrew J; Nho, Kwangsik

2018-01-01

Genetic variation in cis-regulatory elements related to splicing machinery and splicing regulatory elements (SREs) results in exon skipping and undesired protein products. We developed a splicing decision model to identify actionable loci among common SNPs for gene regulation. The splicing decision model identified SNPs affecting exon skipping by analyzing sequence-driven alternative splicing (AS) models and by scanning the genome for the regions with putative SRE motifs. We used non-Hispanic Caucasians with neuroimaging, and fluid biomarkers for Alzheimer's disease (AD) and identified 17,088 common exonic SNPs affecting exon skipping. GWAS identified one SNP (rs1140317) in HLA-DQB1 as significantly associated with entorhinal cortical thickness, AD neuroimaging biomarker, after controlling for multiple testing. Further analysis revealed that rs1140317 was significantly associated with brain amyloid-f deposition (PET and CSF). HLA-DQB1 is an essential immune gene and may regulate AS, thereby contributing to AD pathology. SRE may hold potential as novel therapeutic targets for AD.

Visual Navigation during Colony Emigration by the Ant Temnothorax rugatulus

PubMed Central

Bowens, Sean R.; Glatt, Daniel P.; Pratt, Stephen C.

2013-01-01

Many ants rely on both visual cues and self-generated chemical signals for navigation, but their relative importance varies across species and context. We evaluated the roles of both modalities during colony emigration by Temnothorax rugatulus. Colonies were induced to move from an old nest in the center of an arena to a new nest at the arena edge. In the midst of the emigration the arena floor was rotated 60°around the old nest entrance, thus displacing any substrate-bound odor cues while leaving visual cues unchanged. This manipulation had no effect on orientation, suggesting little influence of substrate cues on navigation. When this rotation was accompanied by the blocking of most visual cues, the ants became highly disoriented, suggesting that they did not fall back on substrate cues even when deprived of visual information. Finally, when the substrate was left in place but the visual surround was rotated, the ants' subsequent headings were strongly rotated in the same direction, showing a clear role for visual navigation. Combined with earlier studies, these results suggest that chemical signals deposited by Temnothorax ants serve more for marking of familiar territory than for orientation. The ants instead navigate visually, showing the importance of this modality even for species with small eyes and coarse visual acuity. PMID:23671713

7 CFR 42.121 - Sampling and inspection procedures.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 7 Agriculture 2 2011-01-01 2011-01-01 false Sampling and inspection procedures. 42.121 Section 42... REGULATIONS STANDARDS FOR CONDITION OF FOOD CONTAINERS Skip Lot Sampling and Inspection Procedures § 42.121 Sampling and inspection procedures. (a) Following skip lot procedure authorization, inspect every lot...

7 CFR 42.121 - Sampling and inspection procedures.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 2 2010-01-01 2010-01-01 false Sampling and inspection procedures. 42.121 Section 42... REGULATIONS STANDARDS FOR CONDITION OF FOOD CONTAINERS Skip Lot Sampling and Inspection Procedures § 42.121 Sampling and inspection procedures. (a) Following skip lot procedure authorization, inspect every lot...

Immunization: Department of Health

Science.gov Websites

State of Rhode Island: Department of Health State of Rhode Island: Department of Health Rhode Island Department of Health State of Rhode Island Department of Health Skip to content | Skip to Health & Wellness Food, Water & Environment Birth, Death & Marriage Records Laboratory

Tuberculosis: Department of Health

Science.gov Websites

State of Rhode Island: Department of Health State of Rhode Island: Department of Health Rhode Island Department of Health State of Rhode Island Department of Health Skip to content | Skip to Health & Wellness Food, Water & Environment Birth, Death & Marriage Records Laboratory

78 FR 10001 - Proposed Collection; Comment Request for Form 706-GS(D)

Federal Register 2010, 2011, 2012, 2013, 2014

2013-02-12

... Form 706-GS(D), Generation-Skipping Transfer Tax Return for Distributions. DATES: Written comments should be received on or before April 15, 2013 to be assured of consideration. ADDRESSES: Direct all... [email protected] . SUPPLEMENTARY INFORMATION: Title: Generation-Skipping Transfer Tax Return for...

Skipping Syntactically Illegal "the" Previews: The Role of Predictability

ERIC Educational Resources Information Center

Abbott, Matthew J.; Angele, Bernhard; Ahn, Y. Danbi; Rayner, Keith

2015-01-01

Readers tend to skip words, particularly when they are short, frequent, or predictable. Angele and Rayner (2013) recently reported that readers are often unable to detect syntactic anomalies in parafoveal vision. In the present study, we manipulated target word predictability to assess whether contextual constraint modulates…

Therapeutic NOTCH3 cysteine correction in CADASIL using exon skipping: in vitro proof of concept.

PubMed

Rutten, Julie W; Dauwerse, Hans G; Peters, Dorien J M; Goldfarb, Andrew; Venselaar, Hanka; Haffner, Christof; van Ommen, Gert-Jan B; Aartsma-Rus, Annemieke M; Lesnik Oberstein, Saskia A J

2016-04-01

Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy, or CADASIL, is a hereditary cerebral small vessel disease caused by characteristic cysteine altering missense mutations in the NOTCH3 gene. NOTCH3 mutations in CADASIL result in an uneven number of cysteine residues in one of the 34 epidermal growth factor like-repeat (EGFr) domains of the NOTCH3 protein. The consequence of an unpaired cysteine residue in an EGFr domain is an increased multimerization tendency of mutant NOTCH3, leading to toxic accumulation of the protein in the (cerebro)vasculature, and ultimately reduced cerebral blood flow, recurrent stroke and vascular dementia. There is no therapy to delay or alleviate symptoms in CADASIL. We hypothesized that exclusion of the mutant EGFr domain from NOTCH3 would abolish the detrimental effect of the unpaired cysteine and thus prevent toxic NOTCH3 accumulation and the negative cascade of events leading to CADASIL. To accomplish this NOTCH3 cysteine correction by EGFr domain exclusion, we used pre-mRNA antisense-mediated skipping of specific NOTCH3 exons. Selection of these exons was achieved using in silico studies and based on the criterion that skipping of a particular exon or exon pair would modulate the protein in such a way that the mutant EGFr domain is eliminated, without otherwise corrupting NOTCH3 structure and function. Remarkably, we found that this strategy closely mimics evolutionary events, where the elimination and fusion of NOTCH EGFr domains led to the generation of four functional NOTCH homologues. We modelled a selection of exon skip strategies using cDNA constructs and show that the skip proteins retain normal protein processing, can bind ligand and be activated by ligand. We then determined the technical feasibility of targeted NOTCH3 exon skipping, by designing antisense oligonucleotides targeting exons 2-3, 4-5 and 6, which together harbour the majority of distinct CADASIL-causing mutations. Transfection of these antisense oligonucleotides into CADASIL patient-derived cerebral vascular smooth muscle cells resulted in successful exon skipping, without abrogating NOTCH3 signalling. Combined, these data provide proof of concept for this novel application of exon skipping, and are a first step towards the development of a rational therapeutic approach applicable to up to 94% of CADASIL-causing mutations. © The Author (2016). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Effect of skipping breakfast on subsequent energy intake.

PubMed

Levitsky, David A; Pacanowski, Carly R

2013-07-02

The objective was to examine the effect of consuming breakfast on subsequent energy intake. Participants who habitually ate breakfast and those who skipped breakfast were recruited for two studies. Using a randomized crossover design, the first study examined the effect of having participants consume either (a) no breakfast, (b) a high carbohydrate breakfast (335 kcals), or (c) a high fiber breakfast (360 kcals) on three occasions and measured ad libitum intake at lunch. The second study again used a randomized crossover design but with a larger, normal carbohydrate breakfast consumed ad libtum. Intake averaged 624 kcals and subsequent food intake was measured throughout the day. Participants ate only foods served from the Cornell Human Metabolic Research Unit where all foods were weighed before and after consumption. In the first study, neither eating breakfast nor the kind of breakfast consumed had an effect on the amount consumed at lunch despite a reduction in hunger ratings. In the second study, intake at lunch as well as hunger ratings were significantly increased after skipping breakfast (by 144 kcal), leaving a net caloric deficit of 408 kcal by the end of the day. These data are consistent with published literature demonstrating that skipping a meal does not result in accurate energy compensation at subsequent meals and suggests that skipping breakfast may be an effective means to reduce daily energy intake in some adults. Copyright © 2013 Elsevier Inc. All rights reserved.

Concurrent 3-D sonifications enable the head-up monitoring of two interrelated aircraft navigation instruments.

PubMed

Towers, John; Burgess-Limerick, Robin; Riek, Stephan

2014-12-01

The aim of this study was to enable the head-up monitoring of two interrelated aircraft navigation instruments by developing a 3-D auditory display that encodes this navigation information within two spatially discrete sonifications. Head-up monitoring of aircraft navigation information utilizing 3-D audio displays, particularly involving concurrently presented sonifications, requires additional research. A flight simulator's head-down waypoint bearing and course deviation instrument readouts were conveyed to participants via a 3-D auditory display. Both readouts were separately represented by a colocated pair of continuous sounds, one fixed and the other varying in pitch, which together encoded the instrument value's deviation from the norm. Each sound pair's position in the listening space indicated the left/right parameter of its instrument's readout. Participants' accuracy in navigating a predetermined flight plan was evaluated while performing a head-up task involving the detection of visual flares in the out-of-cockpit scene. The auditory display significantly improved aircraft heading and course deviation accuracy, head-up time, and flare detections. Head tracking did not improve performance by providing participants with the ability to orient potentially conflicting sounds, suggesting that the use of integrated localizing cues was successful. Conclusion: A supplementary 3-D auditory display enabled effective head-up monitoring of interrelated navigation information normally attended to through a head-down display. Pilots operating aircraft, such as helicopters and unmanned aerial vehicles, may benefit from a supplementary auditory display because they navigate in two dimensions while performing head-up, out-of-aircraft, visual tasks.

Influence of non-contextual auditory stimuli on navigation in a virtual reality context involving executive functions among patients after stroke.

PubMed

Cogné, Mélanie; Violleau, Marie-Hélène; Klinger, Evelyne; Joseph, Pierre-Alain

2018-01-31

Topographical disorientation is frequent among patients after a stroke and can be well explored with virtual environments (VEs). VEs also allow for the addition of stimuli. A previous study did not find any effect of non-contextual auditory stimuli on navigational performance in the virtual action planning-supermarket (VAP-S) simulating a medium-sized 3D supermarket. However, the perceptual or cognitive load of the sounds used was not high. We investigated how non-contextual auditory stimuli with high load affect navigational performance in the VAP-S for patients who have had a stroke and any correlation between this performance and dysexecutive disorders. Four kinds of stimuli were considered: sounds from living beings, sounds from supermarket objects, beeping sounds and names of other products that were not available in the VAP-S. The condition without auditory stimuli was the control. The Groupe de réflexion pour l'évaluation des fonctions exécutives (GREFEX) battery was used to evaluate executive functions of patients. The study included 40 patients who have had a stroke (n=22 right-hemisphere and n=18 left-hemisphere stroke). Patients' navigational performance was decreased under the 4 conditions with non-contextual auditory stimuli (P<0.05), especially for those with dysexecutive disorders. For the 5 conditions, the lower the performance, the more GREFEX tests were failed. Patients felt significantly disadvantaged by the non-contextual sounds sounds from living beings, sounds from supermarket objects and names of other products as compared with beeping sounds (P<0.01). Patients' verbal recall of the collected objects was significantly lower under the condition with names of other products (P<0.001). Left and right brain-damaged patients did not differ in navigational performance in the VAP-S under the 5 auditory conditions. These non-contextual auditory stimuli could be used in neurorehabilitation paradigms to train patients with dysexecutive disorders to inhibit disruptive stimuli. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

26 CFR 26.2653-1 - Taxation of multiple skips.

Code of Federal Regulations, 2013 CFR

2013-04-01

... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2653... thereafter deemed to occupy the generation immediately above the highest generation of any person holding an... immediately after the GST, the transferor is treated as occupying the generation above the highest generation...

26 CFR 26.2653-1 - Taxation of multiple skips.

Code of Federal Regulations, 2012 CFR

2012-04-01

... AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2653... thereafter deemed to occupy the generation immediately above the highest generation of any person holding an... immediately after the GST, the transferor is treated as occupying the generation above the highest generation...

26 CFR 26.2653-1 - Taxation of multiple skips.

Code of Federal Regulations, 2014 CFR

2014-04-01

... GIFT TAXES GENERATION-SKIPPING TRANSFER TAX REGULATIONS UNDER THE TAX REFORM ACT OF 1986 § 26.2653-1... deemed to occupy the generation immediately above the highest generation of any person holding an... immediately after the GST, the transferor is treated as occupying the generation above the highest generation...

Quiz Today: Should I Skip Class?

ERIC Educational Resources Information Center

Zizler, Peter

2013-01-01

How does selective assessment, wherein one counts only the best "k" out of "n" quizzes set, impact grade inflation? Based on our analysis, a specific quantitative answer can be given to a student who plans to skip a quiz, depending, of course, on the student's quiz writing consistency or inconsistency.

26 CFR 26.2642-5 - Finality of inclusion ratio.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 26 Internal Revenue 14 2014-04-01 2013-04-01 true Finality of inclusion ratio. 26.2642-5 Section...-5 Finality of inclusion ratio. (a) Direct skips. The inclusion ratio applicable to a direct skip...) Other GSTs. With respect to taxable distributions and taxable terminations, the inclusion ratio for a...

26 CFR 26.2642-5 - Finality of inclusion ratio.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 26 Internal Revenue 14 2012-04-01 2012-04-01 false Finality of inclusion ratio. 26.2642-5 Section...-5 Finality of inclusion ratio. (a) Direct skips. The inclusion ratio applicable to a direct skip...) Other GSTs. With respect to taxable distributions and taxable terminations, the inclusion ratio for a...

26 CFR 26.2642-5 - Finality of inclusion ratio.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 26 Internal Revenue 14 2013-04-01 2013-04-01 false Finality of inclusion ratio. 26.2642-5 Section...-5 Finality of inclusion ratio. (a) Direct skips. The inclusion ratio applicable to a direct skip...) Other GSTs. With respect to taxable distributions and taxable terminations, the inclusion ratio for a...

26 CFR 25.2518-1 - Qualified disclaimers of property; in general.

Code of Federal Regulations, 2010 CFR

2010-04-01

...-2, for purposes of the Federal estate, gift, and generation-skipping transfer tax provisions, the... estate, gift, and generation-skipping transfer tax provisions, the disclaimer is disregarded and the... State Y on June 17, 1978. G and H are beneficiaries under the will. The will provides that any...

29 CFR 1926.702 - Requirements for equipment and tools.

Code of Federal Regulations, 2010 CFR

2010-07-01

..., DEPARTMENT OF LABOR (CONTINUED) SAFETY AND HEALTH REGULATIONS FOR CONSTRUCTION Concrete and Masonry... the ejection system is not to be operated. (b) Concrete mixers. Concrete mixers with one cubic yard... the skip of materials; and (2) Guardrails installed on each side of the skip. (c) Power concrete...

75 FR 36480 - Proposed Collection; Comment Request for Regulation Project

Federal Register 2010, 2011, 2012, 2013, 2014

2010-06-25

... required by the Paperwork Reduction Act of 1995, Public Law 104-13 (44 U.S.C. 3506(c)(2)(A)). Currently..., Qualified Severance of a Trust for Generation-Skipping Transfer (GST) Tax Purposes. DATES: Written [email protected] . SUPPLEMENTARY INFORMATION: Title: Qualified Severance of a Trust for Generation-Skipping...

75 FR 38869 - Proposed Collection; Comment Request for Regulation Project

Federal Register 2010, 2011, 2012, 2013, 2014

2010-07-06

...-73-88 (TD 8644), Generation-Skipping Transfer Tax (Sec. Sec. 26.2601-1, 26.2632- 1, 26.2642-1, 26... or before September 7, 2010 to be assured of consideration. ADDRESSES: Direct all written comments to... [email protected] . SUPPLEMENTARY INFORMATION: Title: Generation-Skipping Transfer Tax. OMB...

26 CFR 26.2642-5 - Finality of inclusion ratio.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 26 Internal Revenue 14 2010-04-01 2010-04-01 false Finality of inclusion ratio. 26.2642-5 Section...-5 Finality of inclusion ratio. (a) Direct skips. The inclusion ratio applicable to a direct skip...) Other GSTs. With respect to taxable distributions and taxable terminations, the inclusion ratio for a...

26 CFR 26.2642-5 - Finality of inclusion ratio.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 26 Internal Revenue 14 2011-04-01 2010-04-01 true Finality of inclusion ratio. 26.2642-5 Section...-5 Finality of inclusion ratio. (a) Direct skips. The inclusion ratio applicable to a direct skip...) Other GSTs. With respect to taxable distributions and taxable terminations, the inclusion ratio for a...

75 FR 38874 - Proposed Collection; Comment Request for Form 706-NA

Federal Register 2010, 2011, 2012, 2013, 2014

2010-07-06

... INFORMATION: Title: United States Estate (and Generation-Skipping Transfer) Tax Return, Estate of nonresident... Form 706-NA, United States Estate (and Generation-Skipping Transfer) Tax Return, Estate of nonresident not a citizen of the United States. DATES: Written comments should be received on or before September...

Nonvisual spatial navigation fMRI lateralizes mesial temporal lobe epilepsy in a patient with congenital blindness.

PubMed

Toller, Gianina; Adhimoolam, Babu; Grunwald, Thomas; Huppertz, Hans-Jürgen; König, Kristina; Jokeit, Hennric

2015-01-01

Nonvisual spatial navigation functional magnetic resonance imaging (fMRI) may help clinicians determine memory lateralization in blind individuals with refractory mesial temporal lobe epilepsy (MTLE). We report on an exceptional case of a congenitally blind woman with late-onset left MTLE undergoing presurgical memory fMRI. To activate mesial temporal structures despite the lack of visual memory, the patient was requested to recall familiar routes using nonvisual multisensory and verbal cues. Our findings demonstrate the diagnostic value of a nonvisual fMRI task to lateralize MTLE despite congenital blindness and may therefore contribute to the risk assessment for postsurgical amnesia in rare cases with refractory MTLE and accompanying congenital blindness.

Comet Wild 2 Up Close and Personal

NASA Technical Reports Server (NTRS)

2004-01-01

On January 2, 2004 NASA's Stardust spacecraft made a close flyby of comet Wild 2 (pronounced 'Vilt-2'). Among the equipment the spacecraft carried on board was a navigation camera. This is the 34th of the 72 images taken by Stardust's navigation camera during close encounter. The exposure time was 10 milliseconds. The two frames are actually of 1 single exposure. The frame on the left depicts the comet as the human eye would see it. The frame on the right depicts the same image but 'stretched' so that the faint jets emanating from Wild 2 can be plainly seen. Comet Wild 2 is about five kilometers (3.1 miles) in diameter.

Opportunity's Outcrop Outing

NASA Technical Reports Server (NTRS)

2006-01-01

This composite of three images from the navigation camera shows the view from NASA's Mars Exploration Rover Opportunity toward the southeast, in the direction of 'Victoria Crater,' on the rover's 817th Martian day, or sol (May 12, 2006). To reach Victoria Crater, still about 1,100 meters (two-thirds of a mile) from this location, the rover must navigate among the large ripples visible on the left and ahead in the distance.

On this sol, Opportunity was preparing to deploy its arm instrument suite to analyze a rock on the outcrop pavement. At upper right is a small depression that was the target of further imaging on sols 825 and 826 (May 20 and 21, 2006).

Navigating between a Rock and a Hard Place: Lessons from an Urban School Teacher

ERIC Educational Resources Information Center

Eslinger, James C.

2014-01-01

The educational accountability movement in the United States under No Child Left Behind has negatively affected urban teachers because of high-stakes testing, narrowed curriculum, and scripted pedagogy. Such conditions have led to teacher stress, burnout, and attrition. Missing from the scholarly literature are the ways in which teachers work to…

33 CFR 209.140 - Operations of the Corps of Engineers under the Federal Power Act.

Code of Federal Regulations, 2011 CFR

2011-07-01

... attention of the Commission. No public hearing will be held unless specifically authorized by the Commission... projects in this class is left to the discretion of the Division Engineer but annual reports will be... conditions in the interest of navigation has come to the attention of the Division Engineer. (f) Delegation...

National Centers for Environmental Prediction

Science.gov Websites

Weather Service NWS logo - Click to go to the NWS homepage EMC Logo Navigation Bar Left Cap Home News TRAINING AND DOCUMENTATION MATERIALS: * Workflow Manager (7/24/12) * Zeus Advanced Group B Training Agenda (4/17/12) * Zeus Quickstart Training * NESCC HPC Group A End User Training (2/16/12) * Adaptive

Re-Thinking Re-Entry: New Approaches to Supporting Students after Study Abroad

ERIC Educational Resources Information Center

Brubaker, Cate

2017-01-01

While participation in study abroad continues to increase, and both pre-departure and in-country support and interventions have become more robust, the re-entry experience after a program ends still typically takes a back seat to other priorities. Consequently, most students are left to navigate the re-entry transition on their own. This article…

Breakfast Blitz: An Innovative Nutrition Education Program

ERIC Educational Resources Information Center

Towery, Pamela C.; Nix, Elizabeth S.; Norman, Bilinda

2014-01-01

Childhood overweight and obesity are major problems in the United States, with important consequences for our nation's health and economy. Breakfast is considered the most important meal of the day, yet children, adolescents, and adults skip breakfast on a routine basis. This habit of breakfast skipping is related to weight gain, higher body…

The Influence of Mathematical Ability and Morning Nutrition on Mental Arithmetic in Preadolescents: An ERP study.

USDA-ARS?s Scientific Manuscript database

The effects of eating or skipping breakfast on ERP correlates of mental arithmetic were studied in preadolescents differing in experience (age) and mathematical skills. Participants, randomly assigned to treatment [eat (B) or skip (SB) breakfast (each, n = 41)], were sub-grouped by age [8.8 yrs (B: ...

Examining Predictors of Breakfast Skipping and Breakfast Program Use among Secondary School Students in the Compass Study

ERIC Educational Resources Information Center

Godin, Katelyn M.; Patte, Karen A.; Leatherdale, Scott T.

2018-01-01

Background: Many Canadian schools offer breakfast programs; however, students' engagement in these programs is low, while breakfast skipping is highly prevalent among youth. This study examined whether the availability of breakfast programs supports adolescents' regular breakfast eating, and identified characteristics of breakfast skippers who are…

SKIPing with Head Start Teachers: Influence of T-SKIP on Object-Control Skills

ERIC Educational Resources Information Center

Brian, Ali; Goodway, Jacqueline D.; Logan, Jessica A.; Sutherland, Sue

2017-01-01

Purpose: Children from disadvantaged settings are at risk for delays in their object-control (OC) skills. Fundamental motor skill interventions, such as the Successful Kinesthetic Instruction for Preschoolers (SKIP) Program, are highly successful when led by motor development experts. However, few preschools employ such experts. This study…

Skip-row Planting Patterns Stabilize Corn Grain Yields in the Central Great Plains

USDA-ARS?s Scientific Manuscript database

The highly variable climate of the Central Great Plains makes dryland corn (Zea mays) production a risky enterprise. Twenty-three field trials were conducted across the Central Great Plains from 2004 through 2006 to quantify the effect of various skip-row planting patterns and plant populations on g...

Helping Struggling Students: The Impact of Three Instructional Interventions on College Students' Exam Scores and Exam-Skipping Behavior

ERIC Educational Resources Information Center

Thomas, Nichole Gibbs; Thomas, Antonio Lamar

2018-01-01

Whether instructional-communication feedback sent to struggling students and succeeding students following course exams would significantly increase their exam scores and significantly decrease their exam-skipping behavior relative to students in the control group was investigated. An experimenter-blind study utilizing feedback and the…

Skipping on uneven ground: trailing leg adjustments simplify control and enhance robustness.

PubMed

Müller, Roy; Andrada, Emanuel

2018-01-01

It is known that humans intentionally choose skipping in special situations, e.g. when descending stairs or when moving in environments with lower gravity than on Earth. Although those situations involve uneven locomotion, the dynamics of human skipping on uneven ground have not yet been addressed. To find the reasons that may motivate this gait, we combined experimental data on humans with numerical simulations on a bipedal spring-loaded inverted pendulum model (BSLIP). To drive the model, the following parameters were estimated from nine subjects skipping across a single drop in ground level: leg lengths at touchdown, leg stiffness of both legs, aperture angle between legs, trailing leg angle at touchdown (leg landing first after flight phase), and trailing leg retraction speed. We found that leg adjustments in humans occur mostly in the trailing leg (low to moderate leg retraction during swing phase, reduced trailing leg stiffness, and flatter trailing leg angle at lowered touchdown). When transferring these leg adjustments to the BSLIP model, the capacity of the model to cope with sudden-drop perturbations increased.

Effects of social determinants on food choice and skipping meals among Turkish adolescents.

PubMed

Soyer, Meral Turk; Ergin, Isil; Gursoy, Safak Taner

2008-01-01

To present data that contributes to understanding factors that influence food choice and skipping meals in adolescents. A cross sectional study is carried in selected high schools in Bornova. Study sample compromises of 527 students chosen randomly by class from a population of 2410 first year in high school students. Self-administered questionnaires containing sociodemographic determinants, self reported weight and height, food choices and meal patterns were used. A psychosocial factor that affects almost all of the students is the "taste and sensory perception of food". The second noticable factor is the "health and nutritious value of food". The time conserved and the convenience in the preparation of food is one of the lifestyle factors that affect more than half of the students. The cost of the food was also found to have an effect. Among the third group of factors categorized as "media", the leading factor is advertisement, effective in one third of the students. Among boys and girls, there was no statistical difference in the type of meal skipped. Living in Izmir for more than 10 years compared to less than ten years, being in a nuclear family to extended family, and belonging to the "owner" social class to "wage laborer" class also do not statistically differ with regard to skipping meals. However, the mother's and father's education level and having a working mother are associated with skipping meals. These results provide important evidence to support opportunities to positively influence the adoption of healthful eating.

Identification of a novel exonic mutation at -13 from 5' splice site causing exon skipping in a girl with mitochondrial acetoacetyl-coenzyme A thiolase deficiency.

PubMed Central

Fukao, T; Yamaguchi, S; Wakazono, A; Orii, T; Hoganson, G; Hashimoto, T

1994-01-01

We identified a novel exonic mutation which causes exon skipping in the mitochondrial acetoacetyl-CoA thiolase (T2) gene from a girl with T2 deficiency (GK07). GK07 is a compound heterozygote; the maternal allele has a novel G to T transversion at position 1136 causing Gly379 to Val substitution (G379V) of the T2 precursor. In case of in vivo expression analysis, cells transfected with this mutant cDNA showed no evidence of restored T2 activity. The paternal allele was associated with exon 8 skipping at the cDNA level. At the gene level, a C to T transition causing Gln272 to termination codon (Q272STOP) was identified within exon 8, 13 bp from the 5' splice site of intron 8 in the paternal allele. The mRNA with Q272STOP could not be detected in GK07 fibroblasts, presumably because pre-mRNA with Q272STOP was unstable because of the premature termination. In vivo splicing experiments revealed that the exonic mutation caused partial skipping of exon 8. This substitution was thought to alter the secondary structure of T2 pre-mRNA around exon 8 and thus impede normal splicing. The role of exon sequences in the splicing mechanism is indicated by the exon skipping which occurred with an exonic mutation. Images PMID:7907600

HnRNP C, YB-1 and hnRNP L coordinately enhance skipping of human MUSK exon 10 to generate a Wnt-insensitive MuSK isoform

PubMed Central

Nasrin, Farhana; Rahman, Mohammad Alinoor; Masuda, Akio; Ohe, Kenji; Takeda, Jun-ichi; Ohno, Kinji

2014-01-01

Muscle specific receptor tyrosine kinase (MuSK) is an essential postsynaptic transmembrane molecule that mediates clustering of acetylcholine receptors (AChR). MUSK exon 10 is alternatively skipped in human, but not in mouse. Skipping of this exon disrupts a cysteine-rich region (Fz-CRD), which is essential for Wnt-mediated AChR clustering. To investigate the underlying mechanisms of alternative splicing, we exploited block-scanning mutagenesis with human minigene and identified a 20-nucleotide block that contained exonic splicing silencers. Using RNA-affinity purification, mass spectrometry, and Western blotting, we identified that hnRNP C, YB-1 and hnRNP L are bound to MUSK exon 10. siRNA-mediated knockdown and cDNA overexpression confirmed the additive, as well as the independent, splicing suppressing effects of hnRNP C, YB-1 and hnRNP L. Antibody-mediated in vitro protein depletion and scanning mutagenesis additionally revealed that binding of hnRNP C to RNA subsequently promotes binding of YB-1 and hnRNP L to the immediate downstream sites and enhances exon skipping. Simultaneous tethering of two splicing trans-factors to the target confirmed the cooperative effect of YB-1 and hnRNP L on hnRNP C-mediated exon skipping. Search for a similar motif in the human genome revealed nine alternative exons that were individually or coordinately regulated by hnRNP C and YB-1. PMID:25354590

Health, behavioral, cognitive, and social correlates of breakfast skipping among women living in socioeconomically disadvantaged neighborhoods.

PubMed

Smith, Kylie J; McNaughton, Sarah A; Cleland, Verity J; Crawford, David; Ball, Kylie

2013-11-01

Breakfast skipping is a potentially modifiable behavior that has negative effects on health and is socioeconomically patterned. This study aimed to examine the intrapersonal (health, behavioral, and cognitive) and social factors associated with breakfast skipping. Nonpregnant women (n = 4123) aged 18-45 y from socioeconomically disadvantaged neighborhoods throughout Victoria, Australia, completed a postal questionnaire. Sociodemographic characteristics, diet, physical activity, sedentary behaviors, and cognitive and social factors were assessed by self-report. Breakfast skipping was defined in 2 ways: 1) "rarely/never" eating breakfast (n = 498) and 2) eating breakfast ≤2 d/wk (includes those who rarely/never ate breakfast; n = 865). Poisson regression was used to calculate prevalence ratios and linear trends, adjusting for covariates. The P values for linear trends are reported below. Compared with breakfast consumers, women who reported rarely/never eating breakfast tended to have poorer self-rated health (P-trend < 0.001), be current smokers (P-trend < 0.001), pay less attention to health (P-trend < 0.001), not prioritize their own healthy eating when busy looking after their family (P-trend < 0.001), have less nutrition knowledge (P-trend < 0.001), and a lower proportion were trying to control their weight (P-trend < 0.020). When breakfast skipping was defined as eating breakfast ≤2 d/wk, additional associations were found for having lower leisure-time physical activity (P-trend = 0.012) and less self-efficacy for eating a healthy diet (P-trend < 0.043). In conclusion, a range of intrapersonal and social factors were significantly associated with breakfast skipping among women living in socioeconomically disadvantaged areas. Acknowledging the cross-sectional design and need for causal confirmation, programs that aim to promote breakfast consumption in this population group should consider targeting family-related barriers to healthy eating and nutrition knowledge.

Cwf16p Associating with the Nineteen Complex Ensures Ordered Exon Joining in Constitutive Pre-mRNA Splicing in Fission Yeast

PubMed Central

Sasaki-Haraguchi, Noriko; Ikuyama, Takeshi; Yoshii, Shogo; Takeuchi-Andoh, Tomoko; Frendewey, David; Tani, Tokio

2015-01-01

Exons are ligated in an ordered manner without the skipping of exons in the constitutive splicing of pre-mRNAs with multiple introns. To identify factors ensuring ordered exon joining in constitutive pre-mRNA splicing, we previously screened for exon skipping mutants in Schizosaccharomyces pombe using a reporter plasmid, and characterized three exon skipping mutants named ods1 (ordered splicing 1), ods2, and ods3, the responsible genes of which encode Prp2/U2AF59, U2AF23, and SF1, respectively. They form an SF1-U2AF59-U2AF23 complex involved in recognition of the branch and 3′ splice sites in pre-mRNA. In the present study, we identified a fourth ods mutant, ods4, which was isolated in an exon-skipping screen. The ods4 + gene encodes Cwf16p, which interacts with the NineTeen Complex (NTC), a complex thought to be involved in the first catalytic step of the splicing reaction. We isolated two multi-copy suppressors for the ods4-1 mutation, Srp2p, an SR protein essential for pre-mRNA splicing, and Tif213p, a translation initiation factor, in S. pombe. The overexpression of Srp2p suppressed the exon-skipping phenotype of all ods mutants, whereas Tif213p suppressed only ods4-1, which has a mutation in the translational start codon of the cwf16 gene. We also showed that the decrease in the transcriptional elongation rate induced by drug treatment suppressed exon skipping in ods4-1. We propose that Cwf16p/NTC participates in the early recognition of the branch and 3′ splice sites and cooperates with the SF1-U2AF59-U2AF23 complex to maintain ordered exon joining. PMID:26302002

Chronic Stress Is Associated with Indicators of Diet Quality in Habitual Breakfast Skippers.

PubMed

Widaman, Adrianne M; Witbracht, Megan G; Forester, Shavawn M; Laugero, Kevin D; Keim, Nancy L

2016-11-01

Previous studies suggest skipping breakfast is associated with lower diet quality, but possible reasons underlying this relationship are not clear. Our aim was to determine the relationship between chronic stress and variations in diet quality in the context of breakfast eating or breakfast skipping. Based on morning eating habits, 40 breakfast eaters and 35 breakfast skippers participated in a cross-sectional study. Diet assessment was based on unannounced 24-hour recalls. Women, ages 18 to 45 years, with a body mass index (calculated as kg/m 2 ) <40 were recruited in the greater Sacramento, CA, area between 2009 and 2013. Only women who consistently ate or skipped breakfast were enrolled. Compliance with the 2010 Dietary Guidelines for Americans was measured using the Healthy Eating Index 2010 (HEI-2010). Stress and executive function were evaluated with validated questionnaires and a computer-based task, respectively. Diet characteristics of breakfast eating and breakfast skipping were evaluated as nutrient densities (amounts per 1,000 kcal) and compared using a one-way analysis of covariance, with body mass index as covariate. Diet and stress variable associations were assessed using Pearson correlations. Despite no observed differences in daily energy intake between breakfast skipping and breakfast eating, overall diet quality (P=0.001), whole grains (P=0.002), fruit (P=0.002), empty calories (P=0.050), fiber (P=0.001), calcium (P=0.001), potassium (P=0.033), and folate (P=0.013) intakes were higher in breakfast eating. In the evening, breakfast skipping consumed more added sugars (P=0.012) and saturated fat (P=0.006). In breakfast skipping, reported stress was associated with empty calories (r=-0.39; P=0.027) and evening intake of added sugars (r=0.501; P=0.005). These relationships were not observed in breakfast eating. Breakfast skippers were less likely to meet the Dietary Guidelines for Americans and consumed more empty calories at night. Chronic stress was related to evening eating choices and overall empty calories in the diet of breakfast skippers, whereas breakfast eaters' dietary intake did not appear to be affected by chronic stress. Copyright © 2016 Academy of Nutrition and Dietetics. Published by Elsevier Inc. All rights reserved.

Correlating subcortical interhemispheric connectivity and cortical hemispheric dominance in brain tumor patients: A repetitive navigated transcranial magnetic stimulation study.

PubMed

Sollmann, Nico; Ille, Sebastian; Tussis, Lorena; Maurer, Stefanie; Hauck, Theresa; Negwer, Chiara; Bauer, Jan S; Ringel, Florian; Meyer, Bernhard; Krieg, Sandro M

2016-02-01

The present study aims to investigate the relationship between transcallosal interhemispheric connectivity (IC) and hemispheric language lateralization by using a novel approach including repetitive navigated transcranial magnetic stimulation (rTMS), hemispheric dominance ratio (HDR) calculation, and rTMS-based diffusion tensor imaging fiber tracking (DTI FT). 31 patients with left-sided perisylvian brain lesions underwent diffusion tensor imaging (DTI) and rTMS language mapping. Cortical language-positive rTMS spots were used to calculate HDRs (HDR: quotient of the left-sided divided by right-sided naming error rates for corresponding left- and right-sided cortical regions) and to create regions of interest (ROIs) for DTI FT. Then, fibers connecting the rTMS-based ROIs of both hemispheres were tracked, and the correlation of IC to HDRs was calculated via Spearman's rank correlation coefficient (rs). Fibers connecting rTMS-based ROIs of both hemispheres were detected in 12 patients (38.7%). Within the patients in which IC was detected, the mean number of subcortical IC fibers ± standard deviation (SD) was 138.0 ± 346.5 (median: 7.5; range: 1-1,217 fibers). Regarding rs for the correlation of HDRs and fiber numbers of patients that showed IC, only moderate correlation was revealed. Our approach might be beneficial and technically feasible for further investigation of the relationship between IC and language lateralization. However, only moderate correlation was revealed in the present study. Copyright © 2015 Elsevier B.V. All rights reserved.

An interactive videogame designed to improve respiratory navigator efficiency in children undergoing cardiovascular magnetic resonance.

PubMed

Hamlet, Sean M; Haggerty, Christopher M; Suever, Jonathan D; Wehner, Gregory J; Grabau, Jonathan D; Andres, Kristin N; Vandsburger, Moriel H; Powell, David K; Sorrell, Vincent L; Fornwalt, Brandon K

2016-09-06

Advanced cardiovascular magnetic resonance (CMR) acquisitions often require long scan durations that necessitate respiratory navigator gating. The tradeoff of navigator gating is reduced scan efficiency, particularly when the patient's breathing patterns are inconsistent, as is commonly seen in children. We hypothesized that engaging pediatric participants with a navigator-controlled videogame to help control breathing patterns would improve navigator efficiency and maintain image quality. We developed custom software that processed the Siemens respiratory navigator image in real-time during CMR and represented diaphragm position using a cartoon avatar, which was projected to the participant in the scanner as visual feedback. The game incentivized children to breathe such that the avatar was positioned within the navigator acceptance window (±3 mm) throughout image acquisition. Using a 3T Siemens Tim Trio, 50 children (Age: 14 ± 3 years, 48 % female) with no significant past medical history underwent a respiratory navigator-gated 2D spiral cine displacement encoding with stimulated echoes (DENSE) CMR acquisition first with no feedback (NF) and then with the feedback game (FG). Thirty of the 50 children were randomized to undergo extensive off-scanner training with the FG using a MRI simulator, or no off-scanner training. Navigator efficiency, signal-to-noise ratio (SNR), and global left-ventricular strains were determined for each participant and compared. Using the FG improved average navigator efficiency from 33 ± 15 to 58 ± 13 % (p < 0.001) and improved SNR by 5 % (p = 0.01) compared to acquisitions with NF. There was no difference in navigator efficiency (p = 0.90) or SNR (p = 0.77) between untrained and trained participants for FG acquisitions. Circumferential and radial strains derived from FG acquisitions were slightly reduced compared to NF acquisitions (-16 ± 2 % vs -17 ± 2 %, p < 0.001; 40 ± 10 % vs 44 ± 11 %, p = 0.005, respectively). There were no differences in longitudinal strain (p = 0.38). Use of a respiratory navigator feedback game during navigator-gated CMR improved navigator efficiency in children from 33 to 58 %. This improved efficiency was associated with a 5 % increase in SNR for spiral cine DENSE. Extensive off-scanner training was not required to achieve the improvement in navigator efficiency.

Brain mechanisms underlying the impact of attachment-related stress on social cognition

PubMed Central

Nolte, Tobias; Bolling, Danielle Z.; Hudac, Caitlin M.; Fonagy, Peter; Mayes, Linda; Pelphrey, Kevin A.

2013-01-01

Mentalizing, in particular the successful attribution of complex mental states to others, is crucial for navigating social interactions. This ability is highly influenced by external factors within one's daily life, such as stress. We investigated the impact of stress on the brain basis of mentalization in adults. Using a novel modification of the Reading the Mind in the Eyes Test (RMET-R) we compared the differential effects of two personalized stress induction procedures: a general stress induction (GSI) and an attachment-related stress induction (ASI). Participants performed the RMET-R at baseline and after each of the two inductions. Baseline results replicated and extended previous findings regarding the neural correlates of the RMET-R. Additionally, we identified brain regions associated with making complex age judgments from the same stimuli. Results after stress exposure showed that the ASI condition resulted in reduced mentalization-related activation in the left posterior superior temporal sulcus (STS), left inferior frontal gyrus and left temporoparietal junction (TPJ). Moreover, the left middle frontal gyrus and left anterior insula showed greater functional connectivity to the left posterior STS after the ASI. Our findings indicate that attachment-related stress has a unique effect on the neural correlates of mentalization. PMID:24348364

Pedometer Accuracy in Elementary School Children while Walking, Skipping, Galloping, and Sliding

ERIC Educational Resources Information Center

Smith, John Damien; Schroeder, Cynthia Ann

2010-01-01

The purpose of this study was to examine the accuracy of the SW-701 (Yamax Corporation, Tokyo, Japan) and NL-800 (New-Lifestyles, Inc., Lee's Summit, Missouri, USA) pedometer in fifth-grade students while walking, skipping, galloping, sliding, and hopping. Counts registered by both pedometer models were significantly lower than actual counts while…

The Relationships of Balance and Bilateral Coordination to Skipping in Kindergarten Children.

ERIC Educational Resources Information Center

Hockersmith, Mary R.; Folsom-Meek, Sherry L.

The purpose of this study was to examine the relationship of balance and bilateral coordination to the fundamental locomotor pattern of skipping in 5- and 6-year old children. Subjects were kindergarten students (N=30) who were attending an elementary school in the suburban Kansas City area. The investigators used items from the…

Effect of skip row planting configuration on grain sorghum water use

USDA-ARS?s Scientific Manuscript database

Grain sorghum (Sorghum bicolor L. [Moench]) is grown as a dryland crop in the semi-arid Central Great Plains. Growing the crop in a skip row configuration has been proposed as a means of delaying water use during the vegetative stage such that more water will be available to be used during the more ...

75 FR 5866 - Proposed Collection; Comment Request for Form 4768

Federal Register 2010, 2011, 2012, 2013, 2014

2010-02-04

...: Application for Extension of Time To File a Return and/or Pay U.S. Estate (and Generation-Skipping Transfer... 4768, Application for Extension of Time To File a Return and/or Pay U.S. Estate (and Generation-Skipping Transfer) Taxes. DATES: Written comments should be received on or before April 5, 2010 to be...

Development and evaluation of an attractive self-marking ovitrap to measure dispersal and determine skip oviposition in Aedes albopictus(Diptera:Culicidae) field populations

USDA-ARS?s Scientific Manuscript database

Aedes albopictus (Skuse) is a container-breeding mosquito of public health importance. Its oviposition behavior has been assessed in outdoor conditions, but only with laboratory-reared specimens. We used an attractive self-marking oviposition device to assess Ae. albopictus skip oviposition behavi...

Modeling Skipped and Not-Reached Items Using IRTrees

ERIC Educational Resources Information Center

Debeer, Dries; Janssen, Rianne; De Boeck, Paul

2017-01-01

When dealing with missing responses, two types of omissions can be discerned: items can be skipped or not reached by the test taker. When the occurrence of these omissions is related to the proficiency process the missingness is nonignorable. The purpose of this article is to present a tree-based IRT framework for modeling responses and omissions…

Non-invasive mapping of bilateral motor speech areas using navigated transcranial magnetic stimulation and functional magnetic resonance imaging.

PubMed

Könönen, Mervi; Tamsi, Niko; Säisänen, Laura; Kemppainen, Samuli; Määttä, Sara; Julkunen, Petro; Jutila, Leena; Äikiä, Marja; Kälviäinen, Reetta; Niskanen, Eini; Vanninen, Ritva; Karjalainen, Pasi; Mervaala, Esa

2015-06-15

Navigated transcranial magnetic stimulation (nTMS) is a modern precise method to activate and study cortical functions noninvasively. We hypothesized that a combination of nTMS and functional magnetic resonance imaging (fMRI) could clarify the localization of functional areas involved with motor control and production of speech. Navigated repetitive TMS (rTMS) with short bursts was used to map speech areas on both hemispheres by inducing speech disruption during number recitation tasks in healthy volunteers. Two experienced video reviewers, blinded to the stimulated area, graded each trial offline according to possible speech disruption. The locations of speech disrupting nTMS trials were overlaid with fMRI activations of word generation task. Speech disruptions were produced on both hemispheres by nTMS, though there were more disruptive stimulation sites on the left hemisphere. Grade of the disruptions varied from subjective sensation to mild objectively recognizable disruption up to total speech arrest. The distribution of locations in which speech disruptions could be elicited varied among individuals. On the left hemisphere the locations of disturbing rTMS bursts with reviewers' verification followed the areas of fMRI activation. Similar pattern was not observed on the right hemisphere. The reviewer-verified speech disruptions induced by nTMS provided clinically relevant information, and fMRI might explain further the function of the cortical area. nTMS and fMRI complement each other, and their combination should be advocated when assessing individual localization of speech network. Copyright © 2015 Elsevier B.V. All rights reserved.

Terminal Homing for Autonomous Underwater Vehicle Docking

DTIC Science & Technology

2016-06-01

underwater domain, accurate navigation. Above the water, light and electromagnetic signals travel well through air and space, mediums that allow for a...DISTRIBUTION CODE 13. ABSTRACT The use of docking stations for autonomous underwater vehicles (AUV) provides the ability to keep a vehicle on...Mechanical and Aerospace Engineering iv THIS PAGE INTENTIONALLY LEFT BLANK v ABSTRACT The use of docking stations for autonomous underwater

NOAA Photo Library - Navigating the Collection

Science.gov Websites

will have to change the setting to 800x600 to view the full image without having to scroll from left to view or download the highest resolution image available, click on the message "High Resolution viewing individual images associated with albums. If wishing to view the image ID number of a thumbnail

Accuracy of computed tomographic features in differentiating intestinal tuberculosis from Crohn's disease: a systematic review with meta-analysis.

PubMed

Kedia, Saurabh; Sharma, Raju; Sreenivas, Vishnubhatla; Madhusudhan, Kumble Seetharama; Sharma, Vishal; Bopanna, Sawan; Pratap Mouli, Venigalla; Dhingra, Rajan; Yadav, Dawesh Prakash; Makharia, Govind; Ahuja, Vineet

2017-04-01

Abdominal computed tomography (CT) can noninvasively image the entire gastrointestinal tract and assess extraintestinal features that are important in differentiating Crohn's disease (CD) and intestinal tuberculosis (ITB). The present meta-analysis pooled the results of all studies on the role of CT abdomen in differentiating between CD and ITB. We searched PubMed and Embase for all publications in English that analyzed the features differentiating between CD and ITB on abdominal CT. The features included comb sign, necrotic lymph nodes, asymmetric bowel wall thickening, skip lesions, fibrofatty proliferation, mural stratification, ileocaecal area, long segment, and left colonic involvements. Sensitivity, specificity, positive and negative likelihood ratios, and diagnostic odds ratio (DOR) were calculated for all the features. Symmetric receiver operating characteristic curve was plotted for features present in >3 studies. Heterogeneity and publication bias was assessed and sensitivity analysis was performed by excluding studies that compared features on conventional abdominal CT instead of CT enterography (CTE). We included 6 studies (4 CTE, 1 conventional abdominal CT, and 1 CTE+conventional abdominal CT) involving 417 and 195 patients with CD and ITB, respectively. Necrotic lymph nodes had the highest diagnostic accuracy (sensitivity, 23%; specificity, 100%; DOR, 30.2) for ITB diagnosis, and comb sign (sensitivity, 82%; specificity, 81%; DOR, 21.5) followed by skip lesions (sensitivity, 86%; specificity, 74%; DOR, 16.5) had the highest diagnostic accuracy for CD diagnosis. On sensitivity analysis, the diagnostic accuracy of other features excluding asymmetric bowel wall thickening remained similar. Necrotic lymph nodes and comb sign on abdominal CT had the best diagnostic accuracy in differentiating CD and ITB.

Comet Wild 2 Up Close and Personal

NASA Image and Video Library

2004-01-02

On January 2, 2004 NASA's Stardust spacecraft made a close flyby of comet Wild 2 (pronounced "Vilt-2"). Among the equipment the spacecraft carried on board was a navigation camera. This is the 34th of the 72 images taken by Stardust's navigation camera during close encounter. The exposure time was 10 milliseconds. The two frames are actually of 1 single exposure. The frame on the left depicts the comet as the human eye would see it. The frame on the right depicts the same image but "stretched" so that the faint jets emanating from Wild 2 can be plainly seen. Comet Wild 2 is about five kilometers (3.1 miles) in diameter. http://photojournal.jpl.nasa.gov/catalog/PIA05571

Liver diffusion-weighted MR imaging: reproducibility comparison of ADC measurements obtained with multiple breath-hold, free-breathing, respiratory-triggered, and navigator-triggered techniques.

PubMed

Chen, Xin; Qin, Lei; Pan, Dan; Huang, Yanqi; Yan, Lifen; Wang, Guangyi; Liu, Yubao; Liang, Changhong; Liu, Zaiyi

2014-04-01

To prospectively compare the reproducibility of normal liver apparent diffusion coefficient (ADC) measurements by using different respiratory motion compensation techniques with multiple breath-hold (MBH), free-breathing (FB), respiratory-triggered (RT), and navigator-triggered (NT) diffusion-weighted (DW) imaging and to compare the ADCs at different liver anatomic locations. The study protocol was approved by the institutional review board, and written informed consent was obtained from each participant. Thirty-nine volunteers underwent liver DW imaging twice. Imaging was performed with a 1.5-T MR imager with MBH, FB, RT, and NT techniques (b = 0, 100, and 500 sec/mm(2)). Three representative sections--superior, central, and inferior--were selected on left and right liver lobes, respectively. On each selected section, three regions of interest were drawn, and ADCs were measured. Analysis of variance was used to assess ADCs among the four techniques and various anatomic locations. Reproducibility of ADCs was assessed with the Bland-Altman method. ADCs obtained with MBH (range: right lobe, [1.641-1.662] × 10(-3)mm(2)/sec; left lobe, [2.034-2.054] ×10(-3)mm(2)/sec) were higher than those obtained with FB (right, [1.349-1.391] ×10(-3)mm(2)/sec; left, [1.630-1.700] ×10(-3)mm(2)/sec), RT (right, [1.439-1.455] ×10(-3)mm(2)/sec; left, [1.720-1.755] ×10(-3)mm(2)/sec), or NT (right, [1.387-1.400] ×10(-3)mm(2)/sec; left, [1.661-1.736] ×10(-3)mm(2)/sec) techniques (P < .001); however, no significant difference was observed between ADCs obtained with FB, RT, and NT techniques (P = .130 to P >.99). ADCs showed a trend to decrease moving from left to right. Reproducibility in the left liver lobe was inferior to that in the right, and the central middle segment in the right lobe had the most reproducible ADC. Statistical differences in ADCs were observed in the left-right direction in the right lobe (P < .001), but they were not observed in the superior-inferior direction (P = .144-.450). However, in the left liver lobe, statistical differences existed in both directions (P = .001 to P = .016 in the left-right direction, P < .001 in the superior-inferior direction). Both anatomic location and DW imaging technique influence liver ADC measurements and their reproducibility. FB DW imaging is recommended for liver DW imaging because of its good reproducibility and shorter acquisition time compared with that of MBH, RT, and NT techniques. RSNA, 2014

Magnetic guide-wire navigation in pulmonary and systemic arterial catheterization: initial experience in pigs.

PubMed

Grosse-Wortmann, Lars; Grabitz, Ralf; Seghaye, Marie-Christine

2007-04-01

Cardiovascular catheterization can be challenging whenever a stenosis or an abnormal vascular course interferes with probing the target vessel. This study addresses the feasibility of navigating a guide wire with a magnetic tip by an external magnetic field through pulmonary and systemic arteries in an experimental porcine model. We investigated six piglets using magnetic guide-wire navigation. Two pulmonary arteriograms were taken from different angles in order to reconstruct the three-dimensional vessel anatomy. A computer interface then calculated three-dimensional coordinates for the vessel in space. Using these coordinates, two external magnets were positioned to create magnetic vectors along the expected vessel course. Magnetically enabled guide wires were then navigated into the vessels using the magnetic field to orient the guide-wire tips. Aortic and renal branches were addressed in a similar fashion. Difficulty in reaching the target vessel was reflected by the number of attempts that were necessary. After 10 failed attempts, the maneuver was recorded to have failed. Thirty-five of 37 (94.6%) arteries with branches at acute angles were reached successfully using magnetic navigation. In two pigs, the left upper lobe artery could not be probed. Peripheral arteries of small diameter were easier to reach than large central arteries, requiring less attempts. Magnetic guide-wire navigation is feasible in the arteries of the lungs, the head and neck, and the kidneys. It is particularly useful in entering small arterial branches at acute angles and may facilitate interventional therapy in a variety of vascular diseases in children and adults.

Feeling 'too fat' rather than being 'too fat' increases unhealthy eating habits among adolescents - even in boys.

PubMed

van Vliet, Jolanda S; Gustafsson, Per A; Nelson, Nina

2016-01-01

Adolescence is a period of gender-specific physical changes, during which eating habits develop. To better understand what factors determine unhealthy eating habits such as dieting to lose weight, skipping meals, and consumption of unhealthy foods, we studied how physical measurements and body perception relate to eating habits in boys and girls, before and during adolescence. For this cross-sectional study, we obtained data from both written questionnaires and physical measurements of height, weight, and waist circumference (WC). Dieting to lose weight and skipping breakfast were more common among adolescents than among younger boys and girls (p<0.05). The strongest risk factor for dieting in both boys and girls was perception of overweight, which persisted after adjusting for age and for being overweight (p<0.01). Another independent risk factor for dieting behaviour was overweight, as defined by body mass index (BMI) among boys (p<0.01) and WC among girls (p<0.05). In both boys and girls, skipping breakfast was associated with both a more negative body perception and higher BMI (p<0.05). Skipping breakfast was also associated with age- and gender-specific unhealthy eating habits such as skipping other meals, lower consumption of fruits and vegetables, and higher consumption of sweets and sugary drinks (p<0.05). Body perception among adolescents is an important factor relating to unhealthy eating habits, not only in girls, but even in boys. Focus on body perception and eating breakfast daily is crucial for the development of healthy food consumption behaviours during adolescence and tracking into adulthood.

Word Skipping During Sentence Reading: Effects of Lexicality on Parafoveal Processing

PubMed Central

Choi, Wonil; Gordon, Peter C.

2013-01-01

Two experiments examined how lexical status affects the targeting of saccades during reading by using the boundary technique to vary independently the content of a letter string when seen in parafoveal preview and when directly fixated. Experiment 1 measured the skipping rate for a target word embedded in a sentence under three parafoveal preview conditions: full preview (e.g. brain-brain), pseudohomophone preview (e.g. brane-brain), and orthographic nonword control preview (e.g. brant-brain); in the first condition the preview string was always an English word while in the second and third conditions it was always a nonword. Experiment 2 investigated three conditions where the preview string was always a word: full preview (e.g. beach-beach), homophone preview (e.g. beech-beach), and orthographic control preview (e.g. bench-beach). None of the letter string manipulations used to create the preview conditions in the experiments disrupted sub-lexical orthographic or phonological patterns. In Experiment 1 higher skipping rates were observed for the full (lexical) preview condition, which consisted of a word, compared to the nonword preview conditions (pseudohomophone and orthographic-control). In contrast Experiment 2 showed no difference in skipping rates across the three types of lexical preview conditions (full, homophone and orthographic control), though preview type did influence reading times. This pattern indicates that skipping depends not only on the presence of disrupted sub-lexical patterns of orthography or phonology but is also critically dependent on processes that are sensitive to the lexical status of letter strings in the parafovea. PMID:24170376

Oxidative Stress Triggers Body-Wide Skipping of Multiple Exons of the Spinal Muscular Atrophy Gene

PubMed Central

Seo, Joonbae; Singh, Natalia N.; Ottesen, Eric W.; Sivanesan, Senthilkumar; Shishimorova, Maria; Singh, Ravindra N.

2016-01-01

Humans carry two nearly identical copies of Survival Motor Neuron gene: SMN1 and SMN2. Loss of SMN1 leads to spinal muscular atrophy (SMA), the most frequent genetic cause of infant mortality. While SMN2 cannot compensate for the loss of SMN1 due to predominant skipping of exon 7, correction of SMN2 exon 7 splicing holds the promise of a cure for SMA. Previously, we used cell-based models coupled with a multi-exon-skipping detection assay (MESDA) to demonstrate the vulnerability of SMN2 exons to aberrant splicing under the conditions of oxidative stress (OS). Here we employ a transgenic mouse model and MESDA to examine the OS-induced splicing regulation of SMN2 exons. We induced OS using paraquat that is known to trigger production of reactive oxygen species and cause mitochondrial dysfunction. We show an overwhelming co-skipping of SMN2 exon 5 and exon 7 under OS in all tissues except testis. We also show that OS increases skipping of SMN2 exon 3 in all tissues except testis. We uncover several new SMN2 splice isoforms expressed at elevated levels under the conditions of OS. We analyze cis-elements and transacting factors to demonstrate the diversity of mechanisms for splicing misregulation under OS. Our results of proteome analysis reveal downregulation of hnRNP H as one of the potential consequences of OS in brain. Our findings suggest SMN2 as a sensor of OS with implications to SMA and other diseases impacted by low levels of SMN protein. PMID:27111068

Clinical characterisation of Becker muscular dystrophy patients predicts favourable outcome in exon-skipping therapy.

PubMed

van den Bergen, J C; Schade van Westrum, S M; Dekker, L; van der Kooi, A J; de Visser, M; Wokke, B H A; Straathof, C S; Hulsker, M A; Aartsma-Rus, A; Verschuuren, J J; Ginjaar, H B

2014-01-01

Duchenne and Becker muscular dystrophy (DMD/BMD) are both caused by mutations in the DMD gene. Out-of-frame mutations in DMD lead to absence of the dystrophin protein, while in-frame BMD mutations cause production of internally deleted dystrophin. Clinically, patients with DMD loose ambulance around the age of 12, need ventilatory support at their late teens and die in their third or fourth decade due to pulmonary or cardiac failure. BMD has a more variable disease course. The disease course of patients with BMD with specific mutations could be very informative to predict the outcome of the exon-skipping therapy, aiming to restore the reading-frame in patients with DMD. Patients with BMD with a mutation equalling a DMD mutation after successful exon skipping were selected from the Dutch Dystrophinopathy Database. Information about disease course was gathered through a standardised questionnaire. Cardiac data were collected from medical correspondence and a previous study on cardiac function in BMD. Forty-eight patients were included, representing 11 different mutations. Median age of patients was 43 years (range 6-67). Nine patients were wheelchair users (26-56 years). Dilated cardiomyopathy was present in 7/36 patients. Only one patient used ventilatory support. Three patients had died at the age of 45, 50 and 76 years, respectively. This study provides mutation specific data on the course of disease in patients with BMD. It shows that the disease course of patients with BMD, with a mutation equalling a 'skipped' DMD mutation is relatively mild. This finding strongly supports the potential benefit of exon skipping in patients with DMD.

New architecture for dynamic frame-skipping transcoder.

PubMed

Fung, Kai-Tat; Chan, Yui-Lam; Siu, Wan-Chi

2002-01-01

Transcoding is a key technique for reducing the bit rate of a previously compressed video signal. A high transcoding ratio may result in an unacceptable picture quality when the full frame rate of the incoming video bitstream is used. Frame skipping is often used as an efficient scheme to allocate more bits to the representative frames, so that an acceptable quality for each frame can be maintained. However, the skipped frame must be decompressed completely, which might act as a reference frame to nonskipped frames for reconstruction. The newly quantized discrete cosine transform (DCT) coefficients of the prediction errors need to be re-computed for the nonskipped frame with reference to the previous nonskipped frame; this can create undesirable complexity as well as introduce re-encoding errors. In this paper, we propose new algorithms and a novel architecture for frame-rate reduction to improve picture quality and to reduce complexity. The proposed architecture is mainly performed on the DCT domain to achieve a transcoder with low complexity. With the direct addition of DCT coefficients and an error compensation feedback loop, re-encoding errors are reduced significantly. Furthermore, we propose a frame-rate control scheme which can dynamically adjust the number of skipped frames according to the incoming motion vectors and re-encoding errors due to transcoding such that the decoded sequence can have a smooth motion as well as better transcoded pictures. Experimental results show that, as compared to the conventional transcoder, the new architecture for frame-skipping transcoder is more robust, produces fewer requantization errors, and has reduced computational complexity.

Nonparametric Multiple Imputation for Questionnaires with Individual Skip Patterns and Constraints: The Case of Income Imputation in The National Educational Panel Study

ERIC Educational Resources Information Center

Aßmann, Christian; Würbach, Ariane; Goßmann, Solange; Geissler, Ferdinand; Bela, Anika

2017-01-01

Large-scale surveys typically exhibit data structures characterized by rich mutual dependencies between surveyed variables and individual-specific skip patterns. Despite high efforts in fieldwork and questionnaire design, missing values inevitably occur. One approach for handling missing values is to provide multiply imputed data sets, thus…

School Breakfast-Club Program Changes and Youth Eating Breakfast during the School Week in the COMPASS Study

ERIC Educational Resources Information Center

Leatherdale, Scott T.; Stefanczyk, Jennifer M.; Kirkpatrick, Sharon I.

2016-01-01

Background: Despite the importance of breakfast consumption, breakfast skipping is common among Canadian youth. This study examines how changes to school-based breakfast programs are associated with breakfast-skipping behavior. Methods: Using school-level longitudinal data from Year 1 (Y[subscript 1]: 2012-2013) and Year 2 (Y[subscript 2]:…

Do breakfast skipping and breakfast type affect energy intake, nutrient intake, nutrient adequacy, and diet quality in young adults? NHANES 1999-2002

USDA-ARS?s Scientific Manuscript database

The objective of this study was to assess the impact of breakfast skipping and type of breakfast consumed on energy/nutrient intake, nutrient adequacy, and diet quality using a cross-sectional design. The setting was The National Health and Nutrition Examination Survey (NHANES), 1999-2002. The sub...

The relationship of breakfast skipping and type of breakfast consumed with overweight/obesity, abdominal obesity, other cardiometabolic risk factors and the metabolic syndrome in young adults. NHANES 1999-2006

USDA-ARS?s Scientific Manuscript database

The goal of this study was to examine the association between breakfast skipping and type of breakfast consumed with overweight /obesity, abdominal obesity, other cardiometabolic risk factors and the metabolic syndrome. Three breakfast groups were identified (breakfast skippers, ready-to-eat-cereal ...

Variation in Student Skipping: A Study of Six High Schools. Final Report.

ERIC Educational Resources Information Center

Duckworth, Kenneth; deJung, John

Data were obtained from six high schools in the Northwest during 1984 and 1985 to determine the variation in students' reports of the frequency with which they skip school and cut classes. The study was guided by the advice of school administrators and a theoretical model of the influences or levels of participation in work organizations. Evidence…

The Indirect Effect of Alcohol Use on GPA in First-Semester College Students: The Mediating Role of Academic Effort

ERIC Educational Resources Information Center

Conway, James M.; DiPlacido, Joanne

2015-01-01

This study focused on first-semester college students, investigating (a) indirect effects of aggregate alcohol use on grade point average (GPA) through academic effort (skipping class and time on schoolwork) and (b) daily effects of alcohol use on reduced effort. Eighty students reported daily alcohol use and academic effort (skipping class and…

Cal OES Internet Home Cal OES Home

Science.gov Websites

Sign In You may be trying to access this site from a secured browser on the server. Please enable scripts and reload this page. Turn on more accessible mode Turn off more accessible mode Skip Ribbon Commands Skip to main content Turn off Animations Turn on Animations image of CA.gov logo image of Cal OES

Translational and regulatory challenges for exon skipping therapies.

PubMed

Aartsma-Rus, Annemieke; Ferlini, Alessandra; Goemans, Nathalie; Pasmooij, Anna M G; Wells, Dominic J; Bushby, Katerine; Vroom, Elizabeth; Balabanov, Pavel

2014-10-01

Several translational challenges are currently impeding the therapeutic development of antisense-mediated exon skipping approaches for rare diseases. Some of these are inherent to developing therapies for rare diseases, such as small patient numbers and limited information on natural history and interpretation of appropriate clinical outcome measures. Others are inherent to the antisense oligonucleotide (AON)-mediated exon skipping approach, which employs small modified DNA or RNA molecules to manipulate the splicing process. This is a new approach and only limited information is available on long-term safety and toxicity for most AON chemistries. Furthermore, AONs often act in a mutation-specific manner, in which case multiple AONs have to be developed for a single disease. A workshop focusing on preclinical development, trial design, outcome measures, and different forms of marketing authorization was organized by the regulatory models and biochemical outcome measures working groups of Cooperation of Science and Technology Action: "Networking towards clinical application of antisense-mediated exon skipping for rare diseases." The workshop included participants from patient organizations, academia, and members of staff from the European Medicine Agency and Medicine Evaluation Board (the Netherlands). This statement article contains the key outcomes of this meeting.

Kinematic analysis of rope skipper's stability

NASA Astrophysics Data System (ADS)

Ab Ghani, Nor Atikah; Rambely, Azmin Sham

2014-06-01

There are various kinds of jumping that can be done while performing rope skipping activity. This activity was always associated with injury. But, if the rope skipper can perform the activity in a right way, it is believed that the injury might be reduced. The main purpose of this paper is to observe the stability of rope skipper from a biomechanics perspective, which are the centre of mass, angle at the ankle, knee and hip joints and also the trajectory for the ipsilateral leg between the two types of skip which is one leg and two legs. Six healthy, physically active subject, two males and four females (age: 8.00±1.25 years, weight: 17.90±6.85 kg and height: 1.22±0.08 m) participated in this study. Kinematic data of repeated five cycles of rope skipping activity was captured by using Vicon Nexus system. Based on the data collected, skipping with two legs shows more stable behavior during preparation, flight and landing phases. It is concluded that landing on the balls of the feet, lowering the trajectory positions of the feet from the ground as well as flexion of each joint which would reduce the injury while landing.

Video Browsing on Handheld Devices

NASA Astrophysics Data System (ADS)

Hürst, Wolfgang

Recent improvements in processing power, storage space, and video codec development enable users now to playback video on their handheld devices in a reasonable quality. However, given the form factor restrictions of such a mobile device, screen size still remains a natural limit and - as the term "handheld" implies - always will be a critical resource. This is not only true for video but any data that is processed on such devices. For this reason, developers have come up with new and innovative ways to deal with large documents in such limited scenarios. For example, if you look at the iPhone, innovative techniques such as flicking have been introduced to skim large lists of text (e.g. hundreds of entries in your music collection). Automatically adapting the zoom level to, for example, the width of table cells when double tapping on the screen enables reasonable browsing of web pages that have originally been designed for large, desktop PC sized screens. A multi touch interface allows you to easily zoom in and out of large text documents and images using two fingers. In the next section, we will illustrate that advanced techniques to browse large video files have been developed in the past years, as well. However, if you look at state-of-the-art video players on mobile devices, normally just simple, VCR like controls are supported (at least at the time of this writing) that only allow users to just start, stop, and pause video playback. If supported at all, browsing and navigation functionality is often restricted to simple skipping of chapters via two single buttons for backward and forward navigation and a small and thus not very sensitive timeline slider.

Current status of sentinel lymph node navigation surgery in breast and gastrointestinal tract.

PubMed

Tangoku, Akira; Seike, Junichi; Nakano, Kiichiro; Nagao, Taeko; Honda, Junko; Yoshida, Takahiro; Yamai, Hiromichi; Matsuoka, Hisashi; Uyama, Kou; Goto, Masakazu; Miyoshi, Takanori; Morimoto, Tadaoki

2007-02-01

Sentinel lymph node biopsy (SLNB) has been developed as a new diagnostic and therapeutic modality in melanoma and breast cancer surgery. The purpose of the SLNB include preventing the operative morbidity and improving the pathologic stage by focusing on fewer lymph nodes using immunocytochemic and molecular technology has almost achieved in breast cancer surgery. The prognostic meaning of immunocytochemically detected micrometastases is also evaluating in the SLN and bone marrow aspirates of women with early-stage breast cancer. SLNB using available techniques have suggested that the lymphatic drainage of the gastrointestinal tract is much more complicated than other sites, skip metastasis being rather frequent because of an aberrant lymphatic drainage outside of the basin exist. At the moment, the available data does not justify reduced extent of lymphadenectomy, but provides strong evidence for an improvement in tumor staging on the basis of SLNB. Two large scale prospective multi-center trials concerning feasibility of gamma-probe and dye detection for gastric cancer are ongoing in Japan. Recent studies have shown favorable results for identification of SLN in esophageal cancer. CT lymphography with endoscopic mucosal injection of iopamidol was applicable for SLN navigation of superficial esophageal cancer. The aim of surgical treatment is complete resection of the tumor-infiltrated organ including the regional lymph nodes. Accurate detection of SLN can achieve a selection of a more sophisticated tailor made approach. The patient can make a individualized choice from a broader spectrum of therapeutic options including endoscopic, laparoscopic or laparoscopy-assisted surgery, modified radical surgery, and typical radical surgery with lymph node dissection. Ultrastaging by detecting micrometastasis at the molecular level and the choice of an adequate treatment improve the postoperative quality of life and survival. However these issues require further investigation.

Deep learning meets ontologies: experiments to anchor the cardiovascular disease ontology in the biomedical literature.

PubMed

Arguello Casteleiro, Mercedes; Demetriou, George; Read, Warren; Fernandez Prieto, Maria Jesus; Maroto, Nava; Maseda Fernandez, Diego; Nenadic, Goran; Klein, Julie; Keane, John; Stevens, Robert

2018-04-12

Automatic identification of term variants or acceptable alternative free-text terms for gene and protein names from the millions of biomedical publications is a challenging task. Ontologies, such as the Cardiovascular Disease Ontology (CVDO), capture domain knowledge in a computational form and can provide context for gene/protein names as written in the literature. This study investigates: 1) if word embeddings from Deep Learning algorithms can provide a list of term variants for a given gene/protein of interest; and 2) if biological knowledge from the CVDO can improve such a list without modifying the word embeddings created. We have manually annotated 105 gene/protein names from 25 PubMed titles/abstracts and mapped them to 79 unique UniProtKB entries corresponding to gene and protein classes from the CVDO. Using more than 14 M PubMed articles (titles and available abstracts), word embeddings were generated with CBOW and Skip-gram. We setup two experiments for a synonym detection task, each with four raters, and 3672 pairs of terms (target term and candidate term) from the word embeddings created. For Experiment I, the target terms for 64 UniProtKB entries were those that appear in the titles/abstracts; Experiment II involves 63 UniProtKB entries and the target terms are a combination of terms from PubMed titles/abstracts with terms (i.e. increased context) from the CVDO protein class expressions and labels. In Experiment I, Skip-gram finds term variants (full and/or partial) for 89% of the 64 UniProtKB entries, while CBOW finds term variants for 67%. In Experiment II (with the aid of the CVDO), Skip-gram finds term variants for 95% of the 63 UniProtKB entries, while CBOW finds term variants for 78%. Combining the results of both experiments, Skip-gram finds term variants for 97% of the 79 UniProtKB entries, while CBOW finds term variants for 81%. This study shows performance improvements for both CBOW and Skip-gram on a gene/protein synonym detection task by adding knowledge formalised in the CVDO and without modifying the word embeddings created. Hence, the CVDO supplies context that is effective in inducing term variability for both CBOW and Skip-gram while reducing ambiguity. Skip-gram outperforms CBOW and finds more pertinent term variants for gene/protein names annotated from the scientific literature.

Diver Relative UUV Navigation for Joint Human-Robot Operations

DTIC Science & Technology

2013-09-01

loop response: (10) where Kej is the gain that scales the position error to force . Substituting the measured values for ζ and ων as well as the...Underwater Vehicle; Tethered ; Hovering; Autonomous Underwater Vehicle; Joint human-robot operations; dynamic, uncertain environments 15. NUMBER OF PAGES...4   Figure 3.   The SeaBotix vLBV300 tethered AUV platform (left), and the planar vectored thruster

A Dichotomy Examined: Beginning Teach For America Educators Navigate Culturally Relevant Teaching and a Scripted Literacy Program in Their Urban Classrooms

ERIC Educational Resources Information Center

Kavanagh, Kara Maura

2010-01-01

In contrast to the increasing diversity of students, the implementation and consequences of federal and state policies such as No Child Left Behind (NCLB) and the Comprehensive School Reform Act, have created a push for standardization in pedagogy and curriculum that serve culturally and linguistically diverse students. Effects of NCLB policies…

Effect of Bearing Defects

DTIC Science & Technology

1974-12-01

defect types were tested at various levels: Comet- Tail, Dig-Nick, Dirt Brinell, Grind-Skip Lines, Impingement, Orange Peel , Pit, Scratch and "Liney...Shallow irregular indentation of surface. <.0015 max. dim. -(<.0008)*’ Otange Peel Pebbly appearance of raceway surface. Small ** Comet Tail Pit...scratch; dig-nick; impingement; grind-skip lines; and orange peel . The data obtained indicated that these defects in most cases, affected bearing

40 CFR 60.483-2a - Alternative standards for valves-skip period leak detection and repair.

Code of Federal Regulations, 2012 CFR

2012-07-01

.../vapor and light liquid service. (4) If the percent of valves leaking is greater than 2.0, the owner or... Industry for Which Construction, Reconstruction, or Modification Commenced After November 7, 2006 § 60.483... percent of valves leaking equal to or less than 2.0, an owner or operator may begin to skip 1 of the...

40 CFR 60.483-2a - Alternative standards for valves-skip period leak detection and repair.

Code of Federal Regulations, 2014 CFR

2014-07-01

.../vapor and light liquid service. (4) If the percent of valves leaking is greater than 2.0, the owner or... Industry for Which Construction, Reconstruction, or Modification Commenced After November 7, 2006 § 60.483... percent of valves leaking equal to or less than 2.0, an owner or operator may begin to skip 1 of the...

40 CFR 60.483-2a - Alternative standards for valves-skip period leak detection and repair.

Code of Federal Regulations, 2011 CFR

2011-07-01

.../vapor and light liquid service. (4) If the percent of valves leaking is greater than 2.0, the owner or... Industry for Which Construction, Reconstruction, or Modification Commenced After November 7, 2006 § 60.483... percent of valves leaking equal to or less than 2.0, an owner or operator may begin to skip 1 of the...

40 CFR 60.483-2a - Alternative standards for valves-skip period leak detection and repair.

Code of Federal Regulations, 2013 CFR

2013-07-01

.../vapor and light liquid service. (4) If the percent of valves leaking is greater than 2.0, the owner or... Industry for Which Construction, Reconstruction, or Modification Commenced After November 7, 2006 § 60.483... percent of valves leaking equal to or less than 2.0, an owner or operator may begin to skip 1 of the...

40 CFR 60.483-2a - Alternative standards for valves-skip period leak detection and repair.

Code of Federal Regulations, 2010 CFR

2010-07-01

.../vapor and light liquid service. (4) If the percent of valves leaking is greater than 2.0, the owner or... Industry for Which Construction, Reconstruction, or Modification Commenced After November 7, 2006 § 60.483... percent of valves leaking equal to or less than 2.0, an owner or operator may begin to skip 1 of the...

The Effect of High- and Low-Frequency Previews and Sentential Fit on Word Skipping during Reading

ERIC Educational Resources Information Center

Angele, Bernhard; Laishley, Abby E.; Rayner, Keith; Liversedge, Simon P.

2014-01-01

In a previous gaze-contingent boundary experiment, Angele and Rayner (2013) found that readers are likely to skip a word that appears to be the definite article "the" even when syntactic constraints do not allow for articles to occur in that position. In the present study, we investigated whether the word frequency of the preview of a…

Dystrophin quantification and clinical correlations in Becker muscular dystrophy: implications for clinical trials.

PubMed

Anthony, Karen; Cirak, Sebahattin; Torelli, Silvia; Tasca, Giorgio; Feng, Lucy; Arechavala-Gomeza, Virginia; Armaroli, Annarita; Guglieri, Michela; Straathof, Chiara S; Verschuuren, Jan J; Aartsma-Rus, Annemieke; Helderman-van den Enden, Paula; Bushby, Katherine; Straub, Volker; Sewry, Caroline; Ferlini, Alessandra; Ricci, Enzo; Morgan, Jennifer E; Muntoni, Francesco

2011-12-01

Duchenne muscular dystrophy is caused by mutations in the DMD gene that disrupt the open reading frame and prevent the full translation of its protein product, dystrophin. Restoration of the open reading frame and dystrophin production can be achieved by exon skipping using antisense oligonucleotides targeted to splicing elements. This approach aims to transform the Duchenne muscular dystrophy phenotype to that of the milder disorder, Becker muscular dystrophy, typically caused by in-frame dystrophin deletions that allow the production of an internally deleted but partially functional dystrophin. There is ongoing debate regarding the functional properties of the different internally deleted dystrophins produced by exon skipping for different mutations; more insight would be valuable to improve and better predict the outcome of exon skipping clinical trials. To this end, we have characterized the clinical phenotype of 17 patients with Becker muscular dystrophy harbouring in-frame deletions relevant to on-going or planned exon skipping clinical trials for Duchenne muscular dystrophy and correlated it to the levels of dystrophin, and dystrophin-associated protein expression. The cohort of 17 patients, selected exclusively on the basis of their genotype, included 4 asymptomatic, 12 mild and 1 severe patient. All patients had dystrophin levels of >40% of control and significantly higher dystrophin (P = 0.013), β-dystroglycan (P = 0.025) and neuronal nitric oxide synthase (P = 0.034) expression was observed in asymptomatic individuals versus symptomatic patients with Becker muscular dystrophy. Furthermore, grouping the patients by deletion, patients with Becker muscular dystrophy with deletions with an end-point of exon 51 (the skipping of which could rescue the largest group of Duchenne muscular dystrophy deletions) showed significantly higher dystrophin levels (P = 0.034) than those with deletions ending with exon 53. This is the first quantitative study on both dystrophin and dystrophin-associated protein expression in patients with Becker muscular dystrophy with deletions relevant for on-going exon skipping trials in Duchenne muscular dystrophy. Taken together, our results indicate that all varieties of internally deleted dystrophin assessed in this study have the functional capability to provide a substantial clinical benefit to patients with Duchenne muscular dystrophy.

Dystrophin quantification and clinical correlations in Becker muscular dystrophy: implications for clinical trials

PubMed Central

Anthony, Karen; Cirak, Sebahattin; Torelli, Silvia; Tasca, Giorgio; Feng, Lucy; Arechavala-Gomeza, Virginia; Armaroli, Annarita; Guglieri, Michela; Straathof, Chiara S.; Verschuuren, Jan J.; Aartsma-Rus, Annemieke; Helderman-van den Enden, Paula; Bushby, Katherine; Straub, Volker; Sewry, Caroline; Ferlini, Alessandra; Ricci, Enzo; Morgan, Jennifer E.

2011-01-01

Duchenne muscular dystrophy is caused by mutations in the DMD gene that disrupt the open reading frame and prevent the full translation of its protein product, dystrophin. Restoration of the open reading frame and dystrophin production can be achieved by exon skipping using antisense oligonucleotides targeted to splicing elements. This approach aims to transform the Duchenne muscular dystrophy phenotype to that of the milder disorder, Becker muscular dystrophy, typically caused by in-frame dystrophin deletions that allow the production of an internally deleted but partially functional dystrophin. There is ongoing debate regarding the functional properties of the different internally deleted dystrophins produced by exon skipping for different mutations; more insight would be valuable to improve and better predict the outcome of exon skipping clinical trials. To this end, we have characterized the clinical phenotype of 17 patients with Becker muscular dystrophy harbouring in-frame deletions relevant to on-going or planned exon skipping clinical trials for Duchenne muscular dystrophy and correlated it to the levels of dystrophin, and dystrophin-associated protein expression. The cohort of 17 patients, selected exclusively on the basis of their genotype, included 4 asymptomatic, 12 mild and 1 severe patient. All patients had dystrophin levels of >40% of control and significantly higher dystrophin (P = 0.013), β-dystroglycan (P = 0.025) and neuronal nitric oxide synthase (P = 0.034) expression was observed in asymptomatic individuals versus symptomatic patients with Becker muscular dystrophy. Furthermore, grouping the patients by deletion, patients with Becker muscular dystrophy with deletions with an end-point of exon 51 (the skipping of which could rescue the largest group of Duchenne muscular dystrophy deletions) showed significantly higher dystrophin levels (P = 0.034) than those with deletions ending with exon 53. This is the first quantitative study on both dystrophin and dystrophin-associated protein expression in patients with Becker muscular dystrophy with deletions relevant for on-going exon skipping trials in Duchenne muscular dystrophy. Taken together, our results indicate that all varieties of internally deleted dystrophin assessed in this study have the functional capability to provide a substantial clinical benefit to patients with Duchenne muscular dystrophy. PMID:22102647

Transnasal endoscopic resection of a nasopharyngeal pleomorphic adenoma: a rare case report.

PubMed

Martínez-Capoccioni, Gabriel; Martín-Martín, Carlos; Espinosa-Restrepo, Federico

2012-08-01

Pleomorphic adenoma (PA) is the most common benign tumor of the major and minor salivary glands, but rarely found in the nasopharynx. A PA originating from the left lateral wall of the nasopharynx was found in a 52-year-old female who presented with nasal obstruction, left-side otalgia, aural fullness, tinnitus and subjective hearing loss. It was successfully removed by transnasal endoscopic surgery (TES) and navigator system assessed our location, due to the proximity of critical anatomic structures such as the left internal carotid. We believe that the TES for primary and recurrent nasopharyngeal benign tumors is feasible and safe in properly selected patients, due to superior functional and cosmetic results and a low complication rate. Tumor characteristics and location should be taken into account when selecting cases for the right procedure for this lesions; transnasal endoscopic surgery is safe and preferable, carrying less potential morbidity compared to open procedures.

Blindness enhances auditory obstacle circumvention: Assessing echolocation, sensory substitution, and visual-based navigation

PubMed Central

Scarfe, Amy C.; Moore, Brian C. J.; Pardhan, Shahina

2017-01-01

Performance for an obstacle circumvention task was assessed under conditions of visual, auditory only (using echolocation) and tactile (using a sensory substitution device, SSD) guidance. A Vicon motion capture system was used to measure human movement kinematics objectively. Ten normally sighted participants, 8 blind non-echolocators, and 1 blind expert echolocator navigated around a 0.6 x 2 m obstacle that was varied in position across trials, at the midline of the participant or 25 cm to the right or left. Although visual guidance was the most effective, participants successfully circumvented the obstacle in the majority of trials under auditory or SSD guidance. Using audition, blind non-echolocators navigated more effectively than blindfolded sighted individuals with fewer collisions, lower movement times, fewer velocity corrections and greater obstacle detection ranges. The blind expert echolocator displayed performance similar to or better than that for the other groups using audition, but was comparable to that for the other groups using the SSD. The generally better performance of blind than of sighted participants is consistent with the perceptual enhancement hypothesis that individuals with severe visual deficits develop improved auditory abilities to compensate for visual loss, here shown by faster, more fluid, and more accurate navigation around obstacles using sound. PMID:28407000

Blindness enhances auditory obstacle circumvention: Assessing echolocation, sensory substitution, and visual-based navigation.

PubMed

Kolarik, Andrew J; Scarfe, Amy C; Moore, Brian C J; Pardhan, Shahina

2017-01-01

Performance for an obstacle circumvention task was assessed under conditions of visual, auditory only (using echolocation) and tactile (using a sensory substitution device, SSD) guidance. A Vicon motion capture system was used to measure human movement kinematics objectively. Ten normally sighted participants, 8 blind non-echolocators, and 1 blind expert echolocator navigated around a 0.6 x 2 m obstacle that was varied in position across trials, at the midline of the participant or 25 cm to the right or left. Although visual guidance was the most effective, participants successfully circumvented the obstacle in the majority of trials under auditory or SSD guidance. Using audition, blind non-echolocators navigated more effectively than blindfolded sighted individuals with fewer collisions, lower movement times, fewer velocity corrections and greater obstacle detection ranges. The blind expert echolocator displayed performance similar to or better than that for the other groups using audition, but was comparable to that for the other groups using the SSD. The generally better performance of blind than of sighted participants is consistent with the perceptual enhancement hypothesis that individuals with severe visual deficits develop improved auditory abilities to compensate for visual loss, here shown by faster, more fluid, and more accurate navigation around obstacles using sound.

Non-invasive mapping of calculation function by repetitive navigated transcranial magnetic stimulation.

PubMed

Maurer, Stefanie; Tanigawa, Noriko; Sollmann, Nico; Hauck, Theresa; Ille, Sebastian; Boeckh-Behrens, Tobias; Meyer, Bernhard; Krieg, Sandro M

2016-11-01

Concerning calculation function, studies have already reported on localizing computational function in patients and volunteers by functional magnetic resonance imaging and transcranial magnetic stimulation. However, the development of accurate repetitive navigated TMS (rTMS) with a considerably higher spatial resolution opens a new field in cognitive neuroscience. This study was therefore designed to evaluate the feasibility of rTMS for locating cortical calculation function in healthy volunteers, and to establish this technique for future scientific applications as well as preoperative mapping in brain tumor patients. Twenty healthy subjects underwent rTMS calculation mapping using 5 Hz/10 pulses. Fifty-two previously determined cortical spots of the whole hemispheres were stimulated on both sides. The subjects were instructed to perform the calculation task composed of 80 simple arithmetic operations while rTMS pulses were applied. The highest error rate (80 %) for all errors of all subjects was observed in the right ventral precentral gyrus. Concerning division task, a 45 % error rate was achieved in the left middle frontal gyrus. The subtraction task showed its highest error rate (40 %) in the right angular gyrus (anG). In the addition task a 35 % error rate was observed in the left anterior superior temporal gyrus. Lastly, the multiplication task induced a maximum error rate of 30 % in the left anG. rTMS seems feasible as a way to locate cortical calculation function. Besides language function, the cortical localizations are well in accordance with the current literature for other modalities or lesion studies.

Spirit's View Beside 'Home Plate' on Sol 1823 (Stereo)

NASA Technical Reports Server (NTRS)

2009-01-01

[figure removed for brevity, see original site] Left-eye view of a color stereo pair for PIA11971 [figure removed for brevity, see original site] Right-eye view of a color stereo pair for PIA11971

NASA's Mars Exploration Rover Spirit used its navigation camera to take the images that have been combined into this stereo, 180-degree view of the rover's surroundings during the 1,823rd Martian day, or sol, of Spirit's surface mission (Feb. 17, 2009).

This view combines images from the left-eye and right-eye sides of the navigation camera. It appears three-dimensional when viewed through red-blue glasses with the red lens on the left.

The center of the view is toward the south-southwest.

The rover had driven 7 meters (23 feet) eastward earlier on Sol 1823, part of maneuvering to get Spirit into a favorable position for climbing onto the low plateau called 'Home Plate.' However, after two driving attempts with negligible progress during the following three sols, the rover team changed its strategy for getting to destinations south of Home Plate. The team decided to drive Spirit at least partway around Home Plate, instead of ascending the northern edge and taking a shorter route across the top of the plateau.

Layered rocks forming part of the northern edge of Home Plate can be seen near the center of the image. Rover wheel tracks are visible at the lower edge.

This view is presented as a cylindrical-perspective projection with geometric seam correction.

Coordination of Word Recognition and Oculomotor Control During Reading: The Role of Implicit Lexical Decisions

PubMed Central

Choi, Wonil; Gordon, Peter C.

2013-01-01

The coordination of word-recognition and oculomotor processes during reading was evaluated in two eye-tracking experiments that examined how word skipping, where a word is not fixated during first-pass reading, is affected by the lexical status of a letter string in the parafovea and ease of recognizing that string. Ease of lexical recognition was manipulated through target-word frequency (Experiment 1) and through repetition priming between prime-target pairs embedded in a sentence (Experiment 2). Using the gaze-contingent boundary technique the target word appeared in the parafovea either with full preview or with transposed-letter (TL) preview. The TL preview strings were nonwords in Experiment 1 (e.g., bilnk created from the target blink), but were words in Experiment 2 (e.g., sacred created from the target scared). Experiment 1 showed greater skipping for high-frequency than low-frequency target words in the full preview condition but not in the TL preview (nonword) condition. Experiment 2 showed greater skipping for target words that repeated an earlier prime word than for those that did not, with this repetition priming occurring both with preview of the full target and with preview of the target’s TL neighbor word. However, time to progress from the word after the target was greater following skips of the TL preview word, whose meaning was anomalous in the sentence context, than following skips of the full preview word whose meaning fit sensibly into the sentence context. Together, the results support the idea that coordination between word-recognition and oculomotor processes occurs at the level of implicit lexical decisions. PMID:23106372